Science.gov

Sample records for induced clustered dna

  1. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)

    2000-01-01

    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  2. Clustered DNA damages induced in human hematopoietic cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Bennett, Paula V.; Cintron-Torres, Nela; Hada, Megumi; Trunk, John; Monteleone, Denise; Sutherland, John C.; Laval, Jacques; Stanislaus, Marisha; Gewirtz, Alan

    2002-01-01

    Ionizing radiation induces clusters of DNA damages--oxidized bases, abasic sites and strand breaks--on opposing strands within a few helical turns. Such damages have been postulated to be difficult to repair, as are double strand breaks (one type of cluster). We have shown that low doses of low and high linear energy transfer (LET) radiation induce such damage clusters in human cells. In human cells, DSB are about 30% of the total of complex damages, and the levels of DSBs and oxidized pyrimidine clusters are similar. The dose responses for cluster induction in cells can be described by a linear relationship, implying that even low doses of ionizing radiation can produce clustered damages. Studies are in progress to determine whether clusters can be produced by mechanisms other than ionizing radiation, as well as the levels of various cluster types formed by low and high LET radiation.

  3. DNA-PKcs deficiency leads to persistence of oxidatively-induced clustered DNA lesions in human tumor cells

    PubMed Central

    Peddi, Prakash; Loftin, Charles W.; Dickey, Jennifer S.; Hair, Jessica M.; Burns, Kara J.; Aziz, Khaled; Francisco, Dave C.; Panayiotidis, Mihalis I.; Sedelnikova, Olga A.; Bonner, William M.; Winters, Thomas A.; Georgakilas, Alexandros G.

    2010-01-01

    DNA-dependent protein kinase (DNA-PK) is a key non-homologous end joining (NHEJ) nuclear serine/threonine protein kinase involved in various DNA metabolic and damage signaling pathways contributing to the maintenance of genomic stability and prevention of cancer. In order to examine the role of DNA-PK in processing of non-DSB clustered DNA damage, we have used three different models of DNA-PK deficiency i.e. chemical inactivation of its kinase activity by novel inhibitors IC86621 and NU7026, knock-down and complete absence of the protein in human breast cancer (MCF-7) and glioblastoma cell lines (MO59-J/K). Compromised DNA-PK repair pathway has lead to accumulation of clustered DNA lesions induced by γ-rays. Tumor cells lacking protein expression or with inhibited kinase activity showed a marked decrease in their ability to process oxidatively-induced non-DSB clustered DNA lesions measured using a modified version of pulsed field gel electrophoresis or single cell gel electrophoresis (Comet assay). In all cases, DNA-PK inactivation lead to a higher level of lesion persistence even after 24–72 hrs of repair. We suggest a model in which DNA-PK deficiency affects the processing of these clusters by first compromising base excision repair and second by the presence of catalytically inactive DNA-PK inhibiting the efficient processing of these lesions due to the failure of DNA-PK to disassociate from the DNA ends. The information rendered will be important not only for understating cancer etiology in the presence of a NHEJ deficiency but also lead to a better understanding of cancer treatments based on the induction of oxidative stress and inhibition of cluster repair. PMID:20193758

  4. Clustered DNA damages induced by high and low LET radiation, including heavy ions

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Schenk, H.; Sidorkina, O.; Laval, J.; Trunk, J.; Monteleone, D.; Sutherland, J.; Lowenstein, D. I. (Principal Investigator)

    2001-01-01

    Clustered DNA damages--here defined as two or more lesions (strand breaks, oxidized purines, oxidized pyrimidines or abasic sites) within a few helical turns--have been postulated as difficult to repair accurately, and thus highly significant biological lesions. Further, attempted repair of clusters may produce double strand breaks (DSBs). However, until recently, there was no way to measure ionizing radiation-induced clustered damages, except DSB. We recently described an approach for measuring classes of clustered damages (oxidized purine clusters, oxidized pyrimidine clusters, abasic clusters, along with DSB). We showed that ionizing radiation (gamma rays and Fe ions, 1 GeV/amu) does induce such clusters in genomic DNA in solution and in human cells. These studies also showed that each damage cluster results from one radiation hit (and its track), thus indicating that they can be induced by very low doses of radiation, i.e. two independent hits are not required for cluster induction. Further, among all complex damages, double strand breaks comprise--at most-- 20%, with the other clustered damages being at least 80%.

  5. Isolated and clustered DNA lesions induced by high-energy iron and carbon ions

    NASA Astrophysics Data System (ADS)

    Ide, H.; Tanaka, R.; Nakaarai, Y.; Terato, H.; Furusawa, Y.

    During space flight astronauts are exposed to various types of radiation from sun and galactic cosmic rays, the latter of which contain high-energy charged particles such as Fe and C ions. The radiation risk to astronauts toward such high-energy charged particles has been assessed by ground-based experiments. When irradiated by ionizing radiation, DNA molecules suffer from oxidation of bases and strand breaks. The distribution of these lesions along the DNA strand may differ significantly between densely ionizing high-energy Fe and C ions and sparsely ionizing radiation like 60Co gamma-rays. Among various types of DNA damage, bistranded clustered lesions comprised of multiple oxidized bases or strand breaks on opposite strands within a few helical turns are of particular interest since they are assumed to be resistant to repair or induce faulty repair, hence resulting in cell killing and mutations. In the present study, we have analyzed isolated and clustered DNA lesions generated by high-energy Fe and C ions to elucidate the nature of DNA lesions. Plasmid DNA (pDEL19) was irradiated in 10 mM Tris buffer (pH 7.5) by Fe (500 MeV/amu) and C (290 MeV/amu) ions and 60Co gamma-rays. Single-strand breaks (SSB) and double-strand breaks (DSB) were quantified by analysis of conformational changes using agarose gel electrophoresis. For quantification of isolated and bistranded clustered base lesions, irradiated plasmid was exhaustively digested prior to agarose gel analysis by Endo III and Fpg that preferentially incise DNA at oxidative pyrimidine and purine lesions, respectively. The yield (site/Gy/nucleotide) of isolated damages (SSB and bases lesions) tended to decrease with increasing LET [gamma (0.2 keV/μ m) < C (13 keV/μ m) < Fe (200 keV/μ m)]. The yield of DSB was decreased similarly, but that of clustered base lesions was virtually constant. As a result, the spectra of clustered damage changed in an LET-dependent manner: the fraction of clustered base lesions in

  6. Nonspecific bridging-induced attraction drives clustering of DNA-binding proteins and genome organization

    PubMed Central

    Brackley, Chris A.; Taylor, Stephen; Papantonis, Argyris; Cook, Peter R.; Marenduzzo, Davide

    2013-01-01

    Molecular dynamics simulations are used to model proteins that diffuse to DNA, bind, and dissociate; in the absence of any explicit interaction between proteins, or between templates, binding spontaneously induces local DNA compaction and protein aggregation. Small bivalent proteins form into rows [as on binding of the bacterial histone-like nucleoid-structuring protein (H-NS)], large proteins into quasi-spherical aggregates (as on nanoparticle binding), and cylinders with eight binding sites (representing octameric nucleosomal cores) into irregularly folded clusters (like those seen in nucleosomal strings). Binding of RNA polymerase II and a transcription factor (NFκB) to the appropriate sites on four human chromosomes generates protein clusters analogous to transcription factories, multiscale loops, and intrachromosomal contacts that mimic those found in vivo. We suggest that this emergent behavior of clustering is driven by an entropic bridging-induced attraction that minimizes bending and looping penalties in the template. PMID:24003126

  7. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  8. UVA-induced DNA double-strand breaks result from the repair of clustered oxidative DNA damages

    PubMed Central

    Greinert, R.; Volkmer, B.; Henning, S.; Breitbart, E. W.; Greulich, K. O.; Cardoso, M. C.; Rapp, Alexander

    2012-01-01

    UVA (320–400 nm) represents the main spectral component of solar UV radiation, induces pre-mutagenic DNA lesions and is classified as Class I carcinogen. Recently, discussion arose whether UVA induces DNA double-strand breaks (dsbs). Only few reports link the induction of dsbs to UVA exposure and the underlying mechanisms are poorly understood. Using the Comet-assay and γH2AX as markers for dsb formation, we demonstrate the dose-dependent dsb induction by UVA in G1-synchronized human keratinocytes (HaCaT) and primary human skin fibroblasts. The number of γH2AX foci increases when a UVA dose is applied in fractions (split dose), with a 2-h recovery period between fractions. The presence of the anti-oxidant Naringin reduces dsb formation significantly. Using an FPG-modified Comet-assay as well as warm and cold repair incubation, we show that dsbs arise partially during repair of bi-stranded, oxidative, clustered DNA lesions. We also demonstrate that on stretched chromatin fibres, 8-oxo-G and abasic sites occur in clusters. This suggests a replication-independent formation of UVA-induced dsbs through clustered single-strand breaks via locally generated reactive oxygen species. Since UVA is the main component of solar UV exposure and is used for artificial UV exposure, our results shine new light on the aetiology of skin cancer. PMID:22941639

  9. Oxidative stress at low levels can induce clustered DNA lesions leading to NHEJ mediated mutations.

    PubMed

    Sharma, Vyom; Collins, Leonard B; Chen, Ting-Huei; Herr, Natalie; Takeda, Shunichi; Sun, Wei; Swenberg, James A; Nakamura, Jun

    2016-05-01

    DNA damage and mutations induced by oxidative stress are associated with various different human pathologies including cancer. The facts that most human tumors are characterized by large genome rearrangements and glutathione depletion in mice results in deletions in DNA suggest that reactive oxygen species (ROS) may cause gene and chromosome mutations through DNA double strand breaks (DSBs). However, the generation of DSBs at low levels of ROS is still controversial. In the present study, we show that H2O2 at biologically-relevant levels causes a marked increase in oxidative clustered DNA lesions (OCDLs) with a significant elevation of replication-independent DSBs. Although it is frequently reported that OCDLs are fingerprint of high-energy IR, our results indicate for the first time that H2O2, even at low levels, can also cause OCDLs leading to DSBs specifically in G1 cells. Furthermore, a reverse genetic approach revealed a significant contribution of the non-homologous end joining (NHEJ) pathway in H2O2-induced DNA repair & mutagenesis. This genomic instability induced by low levels of ROS may be involved in spontaneous mutagenesis and the etiology of a wide variety of human diseases like chronic inflammation-related disorders, carcinogenesis, neuro-degeneration and aging. PMID:27015367

  10. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    NASA Technical Reports Server (NTRS)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  11. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling.

    PubMed

    Holley, W R; Chatterjee, A

    1996-02-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  12. Mitochondrial nucleoid clusters protect newly synthesized mtDNA during Doxorubicin- and Ethidium Bromide-induced mitochondrial stress.

    PubMed

    Alán, Lukáš; Špaček, Tomáš; Pajuelo Reguera, David; Jabůrek, Martin; Ježek, Petr

    2016-07-01

    Mitochondrial DNA (mtDNA) is compacted in ribonucleoprotein complexes called nucleoids, which can divide or move within the mitochondrial network. Mitochondrial nucleoids are able to aggregate into clusters upon reaction with intercalators such as the mtDNA depletion agent Ethidium Bromide (EB) or anticancer drug Doxorobicin (DXR). However, the exact mechanism of nucleoid clusters formation remains unknown. Resolving these processes may help to elucidate the mechanisms of DXR-induced cardiotoxicity. Therefore, we addressed the role of two key nucleoid proteins; mitochondrial transcription factor A (TFAM) and mitochondrial single-stranded binding protein (mtSSB); in the formation of mitochondrial nucleoid clusters during the action of intercalators. We found that both intercalators cause numerous aberrations due to perturbing their native status. By blocking mtDNA replication, both agents also prevented mtDNA association with TFAM, consequently causing nucleoid aggregation into large nucleoid clusters enriched with TFAM, co-existing with the normal nucleoid population. In the later stages of intercalation (>48h), TFAM levels were reduced to 25%. In contrast, mtSSB was released from mtDNA and freely distributed within the mitochondrial network. Nucleoid clusters mostly contained nucleoids with newly replicated mtDNA, however the nucleoid population which was not in replication mode remained outside the clusters. Moreover, the nucleoid clusters were enriched with p53, an anti-oncogenic gatekeeper. We suggest that mitochondrial nucleoid clustering is a mechanism for protecting nucleoids with newly replicated DNA against intercalators mediating genotoxic stress. These results provide new insight into the common mitochondrial response to mtDNA stress and can be implied also on DXR-induced mitochondrial cytotoxicity. PMID:27102948

  13. Quantitative Analysis of Clustered DNA Damages Induced by Silicon Beams of Different Kinetic Energy

    SciTech Connect

    Keszenman D. J.; Keszenman, D.J.; Bennett, P.V.; Sutherland, B.M.; Wilson, P.F.

    2013-05-14

    Humans may b exposed to highly energetic charged particle radiation as a result of medical treatments, occupational activitie or accidental events. In recent years, our increasing presence and burgeoning interest in space exploration beyond low Earth orbit has led to a large increase in the research of the biological effects ofcharged particle radiation typical of that encountered in the space radiation environment. The study of the effects of these types of radiation qualities in terms ofDNA damage induction and repair is fundamental to understand mechanisms both underlying their greater biological effectiveness as we)) as the short and long term risks of health effects such as carcinogenesis, degen rative diseases and premature aging. Charged particle radiation induces a variety of DNA alterations, notably bistranded clustered damages, defined as two or more closely-opposed strand break , oxidized bases or abasic sites within a few helical turns. The induction of such highly complex DNA damage enhances the probability of incorrect or incomplete repair and thus constitutes greater potential for genomic instability, cell death and transformation.

  14. Melatonin Protects Human Cells from Clustered DNA Damages, Killing and Acquisition of Soft Agar Growth Induced by X-rays or 970 MeV/n Fe ions

    SciTech Connect

    Das, B.; Sutherland, B.; Bennett, P. V.; Cutter, N. C.; Sutherland, J. C.

    2011-06-01

    We tested the ability of melatonin (N-acetyl-5 methoxytryptamine), a highly effective radical scavenger and human hormone, to protect DNA in solution and in human cells against induction of complex DNA clusters and biological damage induced by low or high linear energy transfer radiation (100 kVp X-rays, 970 MeV/nucleon Fe ions). Plasmid DNA in solution was treated with increasing concentrations of melatonin (0.0-3.5 mM) and were irradiated with X-rays. Human cells (28SC monocytes) were also irradiated with X-rays and Fe ions with and without 2 mM melatonin. Agarose plugs containing genomic DNA were subjected to Contour Clamped Homogeneous Electrophoretic Field (CHEF) followed by imaging and clustered DNA damages were measured by using Number Average length analysis. Transformation experiments on human primary fibroblast cells using soft agar colony assay were carried out which were irradiated with Fe ions with or without 2 mM melatonin. In plasmid DNA in solution, melatonin reduced the induction of single- and double-strand breaks. Pretreatment of human 28SC cells for 24 h before irradiation with 2 mM melatonin reduced the level of X-ray induced double-strand breaks by {approx}50%, of abasic clustered damages about 40%, and of Fe ion-induced double-strand breaks (41% reduction) and abasic clusters (34% reduction). It decreased transformation to soft agar growth of human primary cells by a factor of 10, but reduced killing by Fe ions only by 20-40%. Melatonin's effective reduction of radiation-induced critical DNA damages, cell killing, and striking decrease of transformation suggest that it is an excellent candidate as a countermeasure against radiation exposure, including radiation exposure to astronaut crews in space travel.

  15. Method for assaying clustered DNA damages

    DOEpatents

    Sutherland, Betsy M.

    2004-09-07

    Disclosed is a method for detecting and quantifying clustered damages in DNA. In this method, a first aliquot of the DNA to be tested for clustered damages with one or more lesion-specific cleaving reagents under conditions appropriate for cleavage of the DNA to produce single-strand nicks in the DNA at sites of damage lesions. The number average molecular length (Ln) of double stranded DNA is then quantitatively determined for the treated DNA. The number average molecular length (Ln) of double stranded DNA is also quantitatively determined for a second, untreated aliquot of the DNA. The frequency of clustered damages (.PHI..sub.c) in the DNA is then calculated.

  16. DNA templates silver clusters with magic sizes and colors for multi-cluster fluorescent assemblies

    NASA Astrophysics Data System (ADS)

    Copp, Stacy

    2015-03-01

    The natural inclusion of information in DNA, a vital part of life's rich complexity, can also be exploited to create diverse structures with multiple scales of complexity. Now emerging in novel photonic applications, DNA-stabilized silver clusters (AgN-DNA) are compelling examples of multi-scale DNA-directed assembly: individual fluorescent clusters, each templated by specific DNA base motifs, can then be arranged together in DNA-mediated multi-cluster assemblies with nanoscale precision. We discuss how DNA imbues AgN-DNA with unique features. Our optical data on pure AgN-DNA show that DNA base-cationic silver ligands impose rod-like shapes for neutral silver clusters, whose length primarily determines fluorescence color. This shape anisotropy leads to the aspherical AgN-DNA magic number cluster sizes and ``magic color'' groupings. We exploit DNA's sequence properties to extract multi-base motifs that select certain magic cluster sizes, using machine learning algorithms applied to large data sets. With these base motifs, we design DNA scaffolds to arrange multiple atomically precise AgN together in nanoscale proximity. We demonstrate that clusters are stable when held at separations below 10 nm, both in bicolor, dual cluster DNA clamp assemblies and in one-dimensional assemblies of atomically precise clusters arrayed on DNA nanotubes. Supported by NSF-CHE-1213895 and NSF-DMR-1309410. SMC acknowledges NSF-DGE-1144085, a NSF GRFP.

  17. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    2001-01-01

    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  18. Development of a radiation track structure clustering algorithm for the prediction of DNA DSB yields and radiation induced cell death in Eukaryotic cells

    NASA Astrophysics Data System (ADS)

    Douglass, Michael; Bezak, Eva; Penfold, Scott

    2015-04-01

    The preliminary framework of a combined radiobiological model is developed and calibrated in the current work. The model simulates the production of individual cells forming a tumour, the spatial distribution of individual ionization events (using Geant4-DNA) and the stochastic biochemical repair of DNA double strand breaks (DSBs) leading to the prediction of survival or death of individual cells. In the current work, we expand upon a previously developed tumour generation and irradiation model to include a stochastic ionization damage clustering and DNA lesion repair model. The Geant4 code enabled the positions of each ionization event in the cells to be simulated and recorded for analysis. An algorithm was developed to cluster the ionization events in each cell into simple and complex double strand breaks. The two lesion kinetic (TLK) model was then adapted to predict DSB repair kinetics and the resultant cell survival curve. The parameters in the cell survival model were then calibrated using experimental cell survival data of V79 cells after low energy proton irradiation. A monolayer of V79 cells was simulated using the tumour generation code developed previously. The cells were then irradiated by protons with mean energies of 0.76 MeV and 1.9 MeV using a customized version of Geant4. By replicating the experimental parameters of a low energy proton irradiation experiment and calibrating the model with two sets of data, the model is now capable of predicting V79 cell survival after low energy (<2 MeV) proton irradiation for a custom set of input parameters. The novelty of this model is the realistic cellular geometry which can be irradiated using Geant4-DNA and the method in which the double strand breaks are predicted from clustering the spatial distribution of ionisation events. Unlike the original TLK model which calculates a tumour average cell survival probability, the cell survival probability is calculated for each cell in the geometric tumour model

  19. Accelerating DNA analysis applications on GPU clusters

    SciTech Connect

    Tumeo, Antonino; Villa, Oreste

    2010-06-13

    DNA analysis is an emerging application of high performance bioinformatic. Modern sequencing machinery are able to provide, in few hours, large input streams of data which needs to be matched against exponentially growing databases known fragments. The ability to recognize these patterns effectively and fastly may allow extending the scale and the reach of the investigations performed by biology scientists. Aho-Corasick is an exact, multiple pattern matching algorithm often at the base of this application. High performance systems are a promising platform to accelerate this algorithm, which is computationally intensive but also inherently parallel. Nowadays, high performance systems also include heterogeneous processing elements, such as Graphic Processing Units (GPUs), to further accelerate parallel algorithms. Unfortunately, the Aho-Corasick algorithm exhibits large performance variabilities, depending on the size of the input streams, on the number of patterns to search and on the number of matches, and poses significant challenges on current high performance software and hardware implementations. An adequate mapping of the algorithm on the target architecture, coping with the limit of the underlining hardware, is required to reach the desired high throughputs. Load balancing also plays a crucial role when considering the limited bandwidth among the nodes of these systems. In this paper we present an efficient implementation of the Aho-Corasick algorithm for high performance clusters accelerated with GPUs. We discuss how we partitioned and adapted the algorithm to fit the Tesla C1060 GPU and then present a MPI based implementation for a heterogeneous high performance cluster. We compare this implementation to MPI and MPI with pthreads based implementations for a homogeneous cluster of x86 processors, discussing the stability vs. the performance and the scaling of the solutions, taking into consideration aspects such as the bandwidth among the different nodes.

  20. DNA damage in cells exhibiting radiation-induced genomic instability

    DOE PAGESBeta

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  1. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.

  2. A polymerization-based method to construct a plasmid containing clustered DNA damage and a mismatch.

    PubMed

    Takahashi, Momoko; Akamatsu, Ken; Shikazono, Naoya

    2016-10-01

    Exposure of biological materials to ionizing radiation often induces clustered DNA damage. The mutagenicity of clustered DNA damage can be analyzed with plasmids carrying a clustered DNA damage site, in which the strand bias of a replicating plasmid (i.e., the degree to which each of the two strands of the plasmid are used as the template for replication of the plasmid) can help to clarify how clustered DNA damage enhances the mutagenic potential of comprising lesions. Placement of a mismatch near a clustered DNA damage site can help to determine the strand bias, but present plasmid-based methods do not allow insertion of a mismatch at a given site in the plasmid. Here, we describe a polymerization-based method for constructing a plasmid containing clustered DNA lesions and a mismatch. The presence of a DNA lesion and a mismatch in the plasmid was verified by enzymatic treatment and by determining the relative abundance of the progeny plasmids derived from each of the two strands of the plasmid. PMID:27449134

  3. DNA damage induced by the direct effect of radiation

    NASA Astrophysics Data System (ADS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.

    2008-10-01

    We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.

  4. A wavelet-based feature vector model for DNA clustering.

    PubMed

    Bao, J P; Yuan, R Y

    2015-01-01

    DNA data are important in the bioinformatic domain. To extract useful information from the enormous collection of DNA sequences, DNA clustering is often adopted to efficiently deal with DNA data. The alignment-free method is a very popular way of creating feature vectors from DNA sequences, which are then used to compare DNA similarities. This paper proposes a wavelet-based feature vector (WFV) model, which is also an alignment-free method. From the perspective of signal processing, a DNA sequence is a sequence of digital signals. However, most traditional alignment-free models only extract features in the time domain. The WFV model uses discrete wavelet transform to adaptively yield feature vectors with a fixed dimension based on the features in both the time and frequency domains. The level of wavelet transform is adjusted according to the length of the DNA sequence rather than a fixed manually set value. The WFV model prefers a 32-dimension feature vector, which greatly promotes system performance. We compared the WFV model with the other five alignment-free models, i.e., k-tuple, DMK, TSM, AMI, and CV, on several large-scale DNA datasets on the DNA clustering application by means of the K-means algorithm. The experimental results showed that the WFV model outperformed the other models in terms of both the clustering results and the running time. PMID:26782569

  5. Repair of clustered DNA damage caused by high LET radiation in human fibroblasts

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Lobrich, M.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1998-01-01

    It has recently been demonstrated experimentally that DNA damage induced by high LET radiation in mammalian cells is non-randomly distributed along the DNA molecule in the form of clusters of various sizes. The sizes of such clusters range from a few base-pairs to at least 200 kilobase-pairs. The high biological efficiency of high LET radiation for induction of relevant biological endpoints is probably a consequence of this clustering, although the exact mechanisms by which the clustering affects the biological outcome is not known. We discuss here results for induction and repair of base damage, single-strand breaks and double-strand breaks for low and high LET radiations. These results are discussed in the context of clustering. Of particular interest is to determine how clustering at different scales affects overall rejoining and fidelity of rejoining of DNA double-strand breaks. However, existing methods for measuring repair of DNA strand breaks are unable to resolve breaks that are close together in a cluster. This causes problems in interpretation of current results from high LET radiation and will require new methods to be developed.

  6. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  7. Formation of clustered DNA damage after high-LET irradiation: a review.

    PubMed

    Hada, Megumi; Georgakilas, Alexandros G

    2008-05-01

    Radiation can cause as well as cure cancer. The risk of developing radiation-induced cancer has traditionally been estimated from cancer incidence among survivors of the atomic bombs in Hiroshima and Nagasaki.(1)) These data provide the best estimate of human cancer risk over the dose range for low linear energy transfer (LET) radiations, such as X- or gamma-rays. The situation of estimating the real biological effects becomes even more difficult in the case of high LET particles encountered in space or as the result of domestic exposure to alpha-particles from radon gas emitters or other radioactive emitters like uranium-238. Complex DNA damage, i.e., the signature of high-LET radiations comprises of closely spaced DNA lesions forming a cluster of DNA damage. The two basic groups of complex DNA damage are double strand breaks (DSBs) and non-DSB oxidative clustered DNA lesions (OCDL). Theoretical analysis and experimental evidence suggest an increased complexity and severity of complex DNA damage with increasing LET (linear energy transfer) and a high mutagenic or carcinogenic potential. Data available on the formation of clustered DNA damage (DSBs and OCDL) by high-LET radiations are often controversial suggesting a variable response to dose and type of radiation. The chemical nature and cellular repair mechanisms of complex DNA damage have been much less characterized than those of isolated DNA lesions like an oxidized base or a single strand break especially in the case of high-LET radiation. This review will focus on the induction of clustered DNA damage by high-LET radiations presenting the earlier and recent relative data. PMID:18413977

  8. Formation of Clustered DNA Damage after High-LET Irradiation: A Review

    NASA Technical Reports Server (NTRS)

    Hada, Megumi; Georgakilas, Alexandros G.

    2008-01-01

    Radiation can cause as well as cure cancer. The risk of developing radiation-induced cancer has traditionally been estimated from cancer incidence among survivors of the atomic bombs in Hiroshima and Nagasaki. These data provide the best estimate of human cancer risk over the dose range for low linear energy transfer (LET) radiations, such as X- or gamma-rays. The situation of estimating the real biological effects becomes even more difficult in the case of high LET particles encountered in space or as the result of domestic exposure to particles from radon gas emitters or other radioactive emitters like uranium-238. Complex DNA damage, i.e., the signature of high-LET radiations comprises by closely spaced DNA lesions forming a cluster of DNA damage. The two basic groups of complex DNA damage are double strand breaks (DSBs) and non-DSB oxidative clustered DNA lesions (OCDL). Theoretical analysis and experimental evidence suggest there is increased complexity and severity of complex DNA damage with increasing LET (linear energy transfer) and a high mutagenic or carcinogenic potential. Data available on the formation of clustered DNA damage (DSBs and OCDL) by high-LET radiations are often controversial suggesting a variable response to dose and type of radiation. The chemical nature and cellular repair mechanisms of complex DNA damage have been much less characterized than those of isolated DNA lesions like an oxidized base or a single strand break especially in the case of high-LET radiation. This review will focus on the induction of clustered DNA damage by high-LET radiations presenting the earlier and recent relative data.

  9. Cluster Plasmonics: Dielectric and Shape Effects on DNA-Stabilized Silver Clusters.

    PubMed

    Copp, Stacy M; Schultz, Danielle; Swasey, Steven M; Faris, Alexis; Gwinn, Elisabeth G

    2016-06-01

    This work investigates the effects of dielectric environment and cluster shape on electronic excitations of fluorescent DNA-stabilized silver clusters, AgN-DNA. We first establish that the longitudinal plasmon wavelengths predicted by classical Mie-Gans (MG) theory agree with previous quantum calculations for excitation wavelengths of linear silver atom chains, even for clusters of just a few atoms. Application of MG theory to AgN-DNA with 400-850 nm cluster excitation wavelengths indicates that these clusters are characterized by a collective excitation process and suggests effective cluster thicknesses of ∼2 silver atoms and aspect ratios of 1.5 to 5. To investigate sensitivity to the surrounding medium, we measure the wavelength shifts produced by addition of glycerol. These are smaller than reported for much larger gold nanoparticles but easily detectable due to narrower line widths, suggesting that AgN-DNA may have potential for fluorescence-reported changes in dielectric environment at length scales of ∼1 nm. PMID:27187492

  10. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome

    PubMed Central

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo. PMID:26559182

  11. Multistep assembly of DNA condensation clusters by SMC

    PubMed Central

    Kim, HyeongJun; Loparo, Joseph J.

    2016-01-01

    SMC (structural maintenance of chromosomes) family members play essential roles in chromosome condensation, sister chromatid cohesion and DNA repair. It remains unclear how SMCs structure chromosomes and how their mechanochemical cycle regulates their interactions with DNA. Here we used single-molecule fluorescence microscopy to visualize how Bacillus subtilis SMC (BsSMC) interacts with flow-stretched DNAs. We report that BsSMC can slide on DNA, switching between static binding and diffusion. At higher concentrations, BsSMCs form clusters that condense DNA in a weakly ATP-dependent manner. ATP increases the apparent cooperativity of DNA condensation, demonstrating that BsSMC can interact cooperatively through their ATPase head domains. Consistent with these results, ATPase mutants compact DNA more slowly than wild-type BsSMC in the presence of ATP. Our results suggest that transiently static BsSMC molecules can nucleate the formation of clusters that act to locally condense the chromosome while forming long-range DNA bridges. PMID:26725510

  12. Multistep assembly of DNA condensation clusters by SMC.

    PubMed

    Kim, HyeongJun; Loparo, Joseph J

    2016-01-01

    SMC (structural maintenance of chromosomes) family members play essential roles in chromosome condensation, sister chromatid cohesion and DNA repair. It remains unclear how SMCs structure chromosomes and how their mechanochemical cycle regulates their interactions with DNA. Here we used single-molecule fluorescence microscopy to visualize how Bacillus subtilis SMC (BsSMC) interacts with flow-stretched DNAs. We report that BsSMC can slide on DNA, switching between static binding and diffusion. At higher concentrations, BsSMCs form clusters that condense DNA in a weakly ATP-dependent manner. ATP increases the apparent cooperativity of DNA condensation, demonstrating that BsSMC can interact cooperatively through their ATPase head domains. Consistent with these results, ATPase mutants compact DNA more slowly than wild-type BsSMC in the presence of ATP. Our results suggest that transiently static BsSMC molecules can nucleate the formation of clusters that act to locally condense the chromosome while forming long-range DNA bridges. PMID:26725510

  13. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting

    PubMed Central

    Vlijm, Rifka; v.d. Torre, Jaco; Dekker, Cees

    2015-01-01

    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, have determined that AT-rich sequences have a lower binding energy than GC-rich sequences. In cells, however, the double-stranded backbone of DNA is destabilized by negative supercoiling, and not by temperature. To investigate what the effect of GC content is on DNA melting induced by negative supercoiling, we studied DNA molecules with a GC content ranging from 38% to 77%, using single-molecule magnetic tweezer measurements in which the length of a single DNA molecule is measured as a function of applied stretching force and supercoiling density. At low force (<0.5pN), supercoiling results into twisting of the dsDNA backbone and loop formation (plectonemes), without inducing any DNA melting. This process was not influenced by the DNA sequence. When negative supercoiling is introduced at increasing force, local melting of DNA is introduced. We measured for the different DNA molecules a characteristic force Fchar, at which negative supercoiling induces local melting of the dsDNA. Surprisingly, GC-rich sequences melt at lower forces than AT-rich sequences: Fchar = 0.56pN for 77% GC but 0.73pN for 38% GC. An explanation for this counterintuitive effect is provided by the realization that supercoiling densities of a few percent only induce melting of a few percent of the base pairs. As a consequence, denaturation bubbles occur in local AT-rich regions and the sequence-dependent effect arises from an increased DNA bending/torsional energy associated with the plectonemes. This new insight indicates that an increased GC-content adjacent to AT-rich DNA regions will enhance local opening of the double-stranded DNA helix. PMID:26513573

  14. Spectrometer for cluster ion beam induced luminescence

    SciTech Connect

    Ryuto, H. Sakata, A.; Takeuchi, M.; Takaoka, G. H.; Musumeci, F.

    2015-02-15

    A spectrometer to detect the ultra-weak luminescence originated by the collision of cluster ions on the surfaces of solid materials was constructed. This spectrometer consists of 11 photomultipliers with band-pass interference filters that can detect the luminescence within the wavelength ranging from 300 to 700 nm and of a photomultiplier without filter. The calibration of the detection system was performed using the photons emitted from a strontium aluminate fluorescent tape and from a high temperature tungsten filament. Preliminary measurements show the ability of this spectrometer to detect the cluster ion beam induced luminescence.

  15. Tidally Induced Bars of Galaxies in Clusters

    NASA Astrophysics Data System (ADS)

    Łokas, Ewa L.; Ebrová, Ivana; del Pino, Andrés; Sybilska, Agnieszka; Athanassoula, E.; Semczuk, Marcin; Gajda, Grzegorz; Fouquet, Sylvain

    2016-08-01

    Using N-body simulations, we study the formation and evolution of tidally induced bars in disky galaxies in clusters. Our progenitor is a massive, late-type galaxy similar to the Milky Way, composed of an exponential disk and a Navarro-Frenk-White dark matter halo. We place the galaxy on four different orbits in a Virgo-like cluster and evolve it for 10 Gyr. As a reference case, we also evolve the same model in isolation. Tidally induced bars form on all orbits soon after the first pericenter passage and survive until the end of the evolution. They appear earlier, are stronger and longer, and have lower pattern speeds for tighter orbits. Only for the tightest orbit are the properties of the bar controlled by the orientation of the tidal torque from the cluster at pericenter. The mechanism behind the formation of the bars is the angular momentum transfer from the galaxy stellar component to its halo. All of the bars undergo extended periods of buckling instability that occur earlier and lead to more pronounced boxy/peanut shapes when the tidal forces are stronger. Using all simulation outputs of galaxies at different evolutionary stages, we construct a toy model of the galaxy population in the cluster and measure the average bar strength and bar fraction as a function of clustercentric radius. Both are found to be mildly decreasing functions of radius. We conclude that tidal forces can trigger bar formation in cluster cores, but not in the outskirts, and thus can cause larger concentrations of barred galaxies toward the cluster center.

  16. Stellar clustering as induced by a supernova

    NASA Technical Reports Server (NTRS)

    Baierlein, R.; Schwing, E.; Herbst, W.

    1981-01-01

    A possible mechanism for the fragmentation of the expanding shock wave from a supernova to form stellar clusters is considered. A model of supernova shell expansion is constructed in which the ratio of magnetic field intensity to gas density remains constant during the one-dimensional compression of the interstellar medium by the shock, and the gas and field adjust to a quasi-equilibrium within the shell following shock passage. It is shown that the quasi-equilibrium, which may be considered as an isothermal atmosphere, is unstable to a hydromagnetic instability representing a form of the Parker instability, which results in a clumping of gas at intervals on the order of parsecs. The length and time scales of the instability are consistent with the clustering of newly formed stars observed in Canis Major R1, where there is evidence for supernova-induced star formation.

  17. Dynamic Expression of DNA Complexation with Self-assembled Biomolecular Clusters.

    PubMed

    Bartolami, Eline; Bessin, Yannick; Gervais, Virginie; Dumy, Pascal; Ulrich, Sébastien

    2015-08-24

    We report herein the implementation of a dynamic covalent chemistry approach to the generation of multivalent clusters for DNA recognition. We show that biomolecular clusters can be expressed in situ by a programmed self-assembly process using chemoselective ligations. The cationic clusters are shown, by fluorescence displacement assay, gel electrophoresis and isothermal titration calorimetry, to effectively complex DNA through multivalent interactions. The reversibility of the ligation was exploited to demonstrate that template effects occur, whereby DNA imposes component selection in order to favor the most active DNA-binding clusters. Furthermore, we show that a chemical effector can be used to trigger DNA release through component exchange reactions. PMID:26177835

  18. Persistent damage induces mitochondrial DNA degradation

    PubMed Central

    Shokolenko, Inna N.; Wilson, Glenn L.; Alexeyev, Mikhail F.

    2013-01-01

    Considerable progress has been made recently toward understanding the processes of mitochondrial DNA (mtDNA) damage and repair. However, a paucity of information still exists regarding the physiological effects of persistent mtDNA damage. This is due, in part, to experimental difficulties associated with targeting mtDNA for damage, while sparing nuclear DNA. Here, we characterize two systems designed for targeted mtDNA damage based on the inducible (Tet-ON) mitochondrial expression of the bacterial enzyme, exonuclease III, and the human enzyme, uracil-N-glyosylase containing the Y147A mutation. In both systems, damage was accompanied by degradation of mtDNA, which was detectable by six hours after induction of mutant uracil-N-glycosylase and by twelve hours after induction of exoIII. Unexpectedly, increases in the steady-state levels of single-strand lesions, which led to degradation, were small in absolute terms indicating that both abasic sites and single-strand gaps may be poorly tolerated in mtDNA. mtDNA degradation was accompanied by the loss of expression of mtDNA-encoded COX2. After withdrawal of the inducer, recovery from mtDNA depletion occurred faster in the system expressing exonuclease III, but in both systems reduced mtDNA levels persisted longer than 144h after doxycycline withdrawal. mtDNA degradation was followed by reduction and loss of respiration, decreased membrane potential, reduced cell viability, reduced intrinsic reactive oxygen species production, slowed proliferation, and changes in mitochondrial morphology (fragmentation of the mitochondrial network, rounding and “foaming” of the mitochondria). The mutagenic effects of abasic sites in mtDNA were low, which indicates that damaged mtDNA molecules may be degraded if not rapidly repaired. This study establishes, for the first time, that mtDNA degradation can be a direct and immediate consequence of persistent mtDNA damage and that increased ROS production is not an invariant consequence

  19. Proton-induced direct and indirect damage of plasmid DNA.

    PubMed

    Vyšín, Luděk; Pachnerová Brabcová, Kateřina; Štěpán, Václav; Moretto-Capelle, Patrick; Bugler, Beatrix; Legube, Gaelle; Cafarelli, Pierre; Casta, Romain; Champeaux, Jean Philippe; Sence, Martine; Vlk, Martin; Wagner, Richard; Štursa, Jan; Zach, Václav; Incerti, Sebastien; Juha, Libor; Davídková, Marie

    2015-08-01

    Clustered DNA damage induced by 10, 20 and 30 MeV protons in pBR322 plasmid DNA was investigated. Besides determination of strand breaks, additional lesions were detected using base excision repair enzymes. The plasmid was irradiated in dry form, where indirect radiation effects were almost fully suppressed, and in water solution containing only minimal residual radical scavenger. Simultaneous irradiation of the plasmid DNA in the dry form and in the solution demonstrated the contribution of the indirect effect as prevalent. The damage composition slightly differed when comparing the results for liquid and dry samples. The obtained data were also subjected to analysis concerning different methodological approaches, particularly the influence of irradiation geometry, models used for calculation of strand break yields and interpretation of the strand breaks detected with the enzymes. It was shown that these parameters strongly affect the results. PMID:26007308

  20. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9

    PubMed Central

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang

    2015-01-01

    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  1. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.

    PubMed

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang

    2015-08-01

    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  2. Allostery through protein-induced DNA bubbles

    NASA Astrophysics Data System (ADS)

    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; Rasmussen, Kim Ø.; Voulgarakis, Nikolaos K.

    2015-03-01

    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resulting melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.

  3. Allostery through protein-induced DNA bubbles

    DOE PAGESBeta

    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; Rasmussen, Kim Ø.; Voulgarakis, Nikolaos K.

    2015-03-12

    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resultingmore » melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.« less

  4. Allostery through protein-induced DNA bubbles

    SciTech Connect

    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; Rasmussen, Kim Ø.; Voulgarakis, Nikolaos K.

    2015-03-12

    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resulting melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.

  5. Triplex-Induced DNA Damage Response

    PubMed Central

    Rogers, Faye A.; Tiwari, Meetu Kaushik

    2013-01-01

    Cellular DNA damage response is critical to preserving genomic integrity following exposure to genotoxic stress. A complex series of networks and signaling pathways become activated after DNA damage and trigger the appropriate cellular response, including cell cycle arrest, DNA repair, and apoptosis. The response elicited is dependent upon the type and extent of damage sustained, with the ultimate goal of preventing propagation of the damaged DNA. A major focus of our studies is to determine the cellular pathways involved in processing damage induced by altered helical structures, specifically triplexes. Our lab has demonstrated that the TFIIH factor XPD occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. We have shown that XPD co-localizes with γH2AX, and its presence is required for the phosphorylation of H2AX tyrosine142, which stimulates the signaling pathway to recruit pro-apoptotic factors to the damage site. Herein, we examine the cellular pathways activated in response to triplex formation and discuss our finding that suggests that XPD-dependent apoptosis plays a role in preserving genomic integrity in the presence of excessive structurally induced DNA damage. PMID:24348211

  6. Light-Induced Dielectrophoretic Manipulation of DNA

    PubMed Central

    Hoeb, Marco; Rädler, Joachim O.; Klein, Stefan; Stutzmann, Martin; Brandt, Martin S.

    2007-01-01

    Light-induced dielectrophoretic movement of polystyrene beads and λ-DNA is studied using thin films of amorphous hydrogenated silicon as local photoaddressable electrodes with a diameter of 4 μm. Positive (high-field seeking) dielectrophoretic movement is observed for both types of objects. The absence of strong negative (low-field seeking) dielectrophoresis of DNA at high frequencies is in agreement with the similarity of the dielectric constants of DNA and water, the real part of the dielectric function. The corresponding imaginary part of the dielectric function governed by the conductivity of DNA can be determined from a comparison of the frequency dependence of the dielectrophoretic drift velocity with the Clausius-Mossotti relation. PMID:17483160

  7. Viroid-induced DNA methylation in plants.

    PubMed

    Dalakouras, Athanasios; Dadami, Elena; Wassenegger, Michael

    2013-12-01

    In eukaryotes, DNA methylation refers to the addition of a methyl group to the fifth atom in the six-atom ring of cytosine residues. At least in plants, DNA regions that become de novo methylated can be defined by homologous RNA molecules in a process termed RNA-directed DNA methylation (RdDM). RdDM was first discovered in viroid-infected plants. Viroids are pathogenic circular, non-coding, single-stranded RNA molecules. Members of the Pospiviroidae family replicate in the nucleus through double-stranded RNA intermediates, attracting the host RNA silencing machinery. The recruitment of this machinery results in the production of viroid-derived small RNAs (vd-sRNAs) that mediate RNA degradation and DNA methylation of cognate sequences. Here, we provide an overview of the cumulative data on the field of viroid-induced RdDM and discuss three possible scenarios concerning the mechanistic details of its establishment. PMID:25436756

  8. Transcription Driven Somatic DNA Methylation within the Imprinted Gnas Cluster

    PubMed Central

    Mehta, Stuti; Williamson, Christine M.; Ball, Simon; Tibbit, Charlotte; Beechey, Colin; Fray, Martin; Peters, Jo

    2015-01-01

    Differential marking of genes in female and male gametes by DNA methylation is essential to genomic imprinting. In female gametes transcription traversing differentially methylated regions (DMRs) is a common requirement for de novo methylation at DMRs. At the imprinted Gnas cluster oocyte specific transcription of a protein-coding transcript, Nesp, is needed for methylation of two DMRs intragenic to Nesp, namely the Nespas-Gnasxl DMR and the Exon1A DMR, thereby enabling expression of the Gnas transcript and repression of the Gnasxl transcript. On the paternal allele, Nesp is repressed, the germline DMRs are unmethylated, Gnas is repressed and Gnasxl is expressed. Using mutant mouse models, we show that on the paternal allele, ectopic transcription of Nesp traversing the intragenic Exon1A DMR (which regulates Gnas expression) results in de novo methylation of the Exon1A DMR and de-repression of Gnas just as on the maternal allele. However, unlike the maternal allele, methylation on the mutant paternal allele occurs post-fertilisation, i.e. in somatic cells. This, to our knowledge is the first example of transcript/transcription driven DNA methylation of an intragenic CpG island, in somatic tissues, suggesting that transcription driven de novo methylation is not restricted to the germline in the mouse. Additionally, Gnasxl is repressed on a paternal chromosome on which Nesp is ectopically expressed. Thus, a paternally inherited Gnas cluster showing ectopic expression of Nesp is “maternalised” in terms of Gnasxl and Gnas expression. We show that these mice have a phenotype similar to mutants with two expressed doses of Gnas and none of Gnasxl. PMID:25659103

  9. An evolutionary and visual framework for clustering of DNA microarray data.

    PubMed

    Castellanos-Garzón, José A; Díaz, Fernando

    2013-01-01

    This paper presents a case study to show the competence of our evolutionary and visual framework for cluster analysis of DNA microarray data. The proposed framework joins a genetic algorithm for hierarchical clustering with a set of visual components of cluster tasks given by a tool. The cluster visualization tool allows us to display different views of clustering results as a means of cluster visual validation. The results of the genetic algorithm for clustering have shown that it can find better solutions than the other methods for the selected data set. Thus, this shows the reliability of the proposed framework. PMID:24231146

  10. Heat Stress-Induced DNA Damage

    PubMed Central

    Kantidze, O.L.; Velichko, A.K.; Luzhin, A.V.; Razin, S.V.

    2016-01-01

    Although the heat-stress response has been extensively studied for decades, very little is known about its effects on nucleic acids and nucleic acid-associated processes. This is due to the fact that the research has focused on the study of heat shock proteins and factors (HSPs and HSFs), their involvement in the regulation of transcription, protein homeostasis, etc. Recently, there has been some progress in the study of heat stress effects on DNA integrity. In this review, we summarize and discuss well-known and potential mechanisms of formation of various heat stress-induced DNA damage. PMID:27437141

  11. Differences between hydrodynamic and macromolecule induced clusters in microcapillary flow

    NASA Astrophysics Data System (ADS)

    Wagner, Christian; Claveria, Viviana; Aouane, Othmane; Coupier, Gwennou; Misbah, Chaouqi; Abkarian, Manouk

    2015-03-01

    Recent studies have been shown that despite the large shear rates, the presence of either fibrinogen or the synthetic polymer dextran leads to an enhanced formation of robust clusters of RBC in microcapillaries under flow conditions. The contribution of hydrodynamical interactions and interactions induced by the presence of macromolecules in the cluster formation has not been established. In order to elucidate this mechanism, we compare experimentally in microchannels under flow condition, the pure hydrodynamical cluster formation of RBCs and the cluster formation of RBCs in the presence of macromolecules inducing aggregation. The results reveal strong differences in the cluster morphology. Emphasizing on the case of clusters formed by two cells, the surface to surface interdistances between the cells in the different solutions shows a bimodal distribution. Numerical simulations based on the boundary integral method showed a good agreement with the experimental findings.

  12. Phoresis-induced clustering of particles in turbulence

    NASA Astrophysics Data System (ADS)

    Schmidt, Lukas; Fouxon, Itzhak; Krug, Dominik; van Reeuwijk, Maarten; Holzner, Markus

    2015-11-01

    We demonstrate phoresis-induced clustering of non-inertial particles in turbulent flows. Phoretic mechanisms such as thermophoresis, chemotaxis or diffusiophroesis are known to create a particle drift with respect to the fluid. Theory, based on the framework of weakly compressible flow, predicts that particles in turbulence streaked by salinity gradients experience a diffusiophoretic drift and will thus form particle cluster. An inclined gravity current setup is used to analyse clustering due to the diffusiophoretic effect in turbulent flow experimentally. Simultaneous 3D particle tracking velocimetry and laser induced fluorescent measurements provide the full Lagrangian velocity field and the local salt concentration in the observed 3D domain. Two independent methods show consistent evidence of the theoretically predicted particle clustering in turbulence. This clustering mechanism can provide the key to the understanding of spontaneous clustering phenomena such as the formation of marine snow in the ocean.

  13. Cluster analysis for the probability of DSB site induced by electron tracks

    NASA Astrophysics Data System (ADS)

    Yoshii, Y.; Sasaki, K.; Matsuya, Y.; Date, H.

    2015-05-01

    To clarify the influence of bio-cells exposed to ionizing radiations, the densely populated pattern of the ionization in the cell nucleus is of importance because it governs the extent of DNA damage which may lead to cell lethality. In this study, we have conducted a cluster analysis of ionization and excitation events to estimate the number of double-strand breaks (DSBs) induced by electron tracks. A Monte Carlo simulation for electrons in liquid water was performed to determine the spatial location of the ionization and excitation events. The events were divided into clusters by using the density-based spatial clustering of applications with noise (DBSCAN) algorithm. The algorithm enables us to sort out the events into the groups (clusters) in which a minimum number of neighboring events are contained within a given radius. For evaluating the number of DSBs in the extracted clusters, we have introduced an aggregation index (AI). The computational results show that a sub-keV electron produces DSBs in a dense formation more effectively than higher energy electrons. The root-mean square radius (RMSR) of the cluster size is below 5 nm, which is smaller than the chromatin fiber thickness. It was found that this size of clustering events has a high possibility to cause lesions in DNA within the chromatin fiber site.

  14. Role of isolated and clustered DNA damage and the post-irradiating repair process in the effects of heavy ion beam irradiation.

    PubMed

    Tokuyama, Yuka; Furusawa, Yoshiya; Ide, Hiroshi; Yasui, Akira; Terato, Hiroaki

    2015-05-01

    Clustered DNA damage is a specific type of DNA damage induced by ionizing radiation. Any type of ionizing radiation traverses the target DNA molecule as a beam, inducing damage along its track. Our previous study showed that clustered DNA damage yields decreased with increased linear energy transfer (LET), leading us to investigate the importance of clustered DNA damage in the biological effects of heavy ion beam radiation. In this study, we analyzed the yield of clustered base damage (comprising multiple base lesions) in cultured cells irradiated with various heavy ion beams, and investigated isolated base damage and the repair process in post-irradiation cultured cells. Chinese hamster ovary (CHO) cells were irradiated by carbon, silicon, argon and iron ion beams with LETs of 13, 55, 90 and 200 keV µm(-1), respectively. Agarose gel electrophoresis of the cells with enzymatic treatments indicated that clustered base damage yields decreased as the LET increased. The aldehyde reactive probe procedure showed that isolated base damage yields in the irradiated cells followed the same pattern. To analyze the cellular base damage process, clustered DNA damage repair was investigated using DNA repair mutant cells. DNA double-strand breaks accumulated in CHO mutant cells lacking Xrcc1 after irradiation, and the cell viability decreased. On the other hand, mouse embryonic fibroblast (Mef) cells lacking both Nth1 and Ogg1 became more resistant than the wild type Mef. Thus, clustered base damage seems to be involved in the expression of heavy ion beam biological effects via the repair process. PMID:25717060

  15. Clustering and methylation of repeated DNA: persistence in avian development and evolution.

    PubMed Central

    Sobieski, D A; Eden, F C

    1981-01-01

    In the chicken genome, clusters of repeated DNA sequences occur which have alternate arrangements of the component sequence elements. Many of these clustered, repeated sequences are extensively methylated. We have established that both their arrangement and their methylation are invariant regardless of the source of chicken DNA. Comparisons included DNA from sperm, from a series of embryonic stages, from tissues of single adult individuals, and from thirty individual chickens of two strains. These same sequences are found in the DNA of some avian species related to chickens, and there they show the same clustered, methylated form. In related species, some of the arrangements found in chicken DNA are different or missing. Images PMID:7312632

  16. Maintenance of the DNA-Damage Checkpoint Requires DNA-Damage-Induced Mediator Protein Oligomerization

    PubMed Central

    Usui, Takehiko; Foster, Steven S.; Petrini, John H.J.

    2010-01-01

    SUMMARY Oligomeric assembly of Brca1 C-terminal (BRCT) domain-containing mediator proteins occurs at sites of DNA damage. However, the functional significance and regulation of such assemblies are not well understood. In this study, we defined the molecular mechanism of DNA-damage-induced oligomerization of the S. cerevisiae BRCT protein Rad9. Our data suggest that Rad9’s tandem BRCT domain mediates Rad9 oligomerization via its interaction with its own Mec1/Tel1-phosphorylated SQ/TQ cluster domain (SCD). Rad53 activation is unaffected by mutations that impair Rad9 oligomerization, but checkpoint maintenance is lost, indicating that oligomerization is required to sustain checkpoint signaling. Once activated, Rad53 phosphorylates the Rad9 BRCT domain, which attenuates the BRCT-SCD interaction. Failure to phosphorylate the Rad9 BRCT results in cytologically visible Rad9 foci. This suggests a feedback loop wherein Rad53 activity and Rad9 oligomerization are regulated to tune the DNA-damage response. PMID:19187758

  17. DNA linking number change induced by sequence-specific DNA-binding proteins

    PubMed Central

    Chen, Bo; Xiao, Yazhong; Liu, Chang; Li, Chenzhong; Leng, Fenfei

    2010-01-01

    Sequence-specific DNA-binding proteins play a key role in many fundamental biological processes, such as transcription, DNA replication and recombination. Very often, these DNA-binding proteins introduce structural changes to the target DNA-binding sites including DNA bending, twisting or untwisting and wrapping, which in many cases induce a linking number change (ΔLk) to the DNA-binding site. Due to the lack of a feasible approach, ΔLk induced by sequence-specific DNA-binding proteins has not been fully explored. In this paper we successfully constructed a series of DNA plasmids that carry many tandem copies of a DNA-binding site for one sequence-specific DNA-binding protein, such as λ O, LacI, GalR, CRP and AraC. In this case, the protein-induced ΔLk was greatly amplified and can be measured experimentally. Indeed, not only were we able to simultaneously determine the protein-induced ΔLk and the DNA-binding constant for λ O and GalR, but also we demonstrated that the protein-induced ΔLk is an intrinsic property for these sequence-specific DNA-binding proteins. Our results also showed that protein-mediated DNA looping by AraC and LacI can induce a ΔLk to the plasmid DNA templates. Furthermore, we demonstrated that the protein-induced ΔLk does not correlate with the protein-induced DNA bending by the DNA-binding proteins. PMID:20185570

  18. Mapping the phase diagram of DNA force-induced melting in the presence of DNA intercalators

    NASA Astrophysics Data System (ADS)

    Vladescu, Ioana; McCauley, Micah; Nunez, Megan; Rouzina, Ioulia; Williams, Mark

    2006-03-01

    The interactions between single DNA molecules and different non-covalent binding agents - the classical intercalator ethidium and compounds from the family of ruthenium complexes - are investigated using an optical tweezers instrument and their effects on the structure and mechanical stability of DNA molecules are quantitatively analyzed using a model of force-induced melting. When a single DNA molecule is stretched beyond its normal contour length, a melting phase transition is observed. Drug binding increases the dsDNA contour length, decreases the DNA elongation upon melting, and increases the DNA melting force. At concentrations of intercalator above critical, no force induced melting of dsDNA is possible. The DNA stretching curves map out a phase diagram for DNA melting in the presence of intercalator, and define its critical point in the force-extension-drug concentration space. Our results allow for the complete thermodynamic characterization of the interaction of these intercalators with DNA.

  19. DNA-PK is Involved in Repairing a Transient Surge of DNA BreaksInduced by Deceleration of DNA Replication.

    SciTech Connect

    Shimura, Tsutomu; Martin, Melvenia M.; Torres, Michael J.; Gu,Cory; Pluth, Janice M.; DiBernardi, Maria A.; McDonald, Jeffrey S.; Aladjem, Mirit I.

    2006-09-25

    ells that suffer substantial inhibition of DNA replication halt their cell cycle via a checkpoint response mediated by the PI3 kinases ATM and ATR. It is unclear how cells cope with milder replication insults, which are under the threshold for ATM and ATR activation. A third PI3 kinase, DNA-dependent protein kinase (DNA-PK), is also activated following replication inhibition, but the role DNA-PK might play in response to perturbed replication is unclear, since this kinase does not activate the signaling cascades involved in the S-phase checkpoint. Here we report that mild, transient drug-induced perturbation of DNA replication rapidly induced DNA breaks that promptly disappeared in cells that contained a functional DNA-PK whereas such breaks persisted in cells that were deficient in DNA-PK activity. After the initial transient burst of DNA breaks, cells with a functional DNA-PK did not halt replication and continued to synthesize DNA at a slow pace in the presence of replication inhibitors. In contrast, DNA-PK deficient cells subject to low levels of replication inhibition halted cell cycle progression via an ATR-mediated S-phase checkpoint. The ATM kinase was dispensable for the induction of the initial DNA breaks. These observations suggest that DNA-PK is involved in setting a high threshold for the ATR-Chkl-mediated S-phase checkpoint by promptly repairing DNA breaks that appear immediately following inhibition of DNA replication.

  20. Application of Subspace Clustering in DNA Sequence Analysis.

    PubMed

    Wallace, Tim; Sekmen, Ali; Wang, Xiaofei

    2015-10-01

    Identification and clustering of orthologous genes plays an important role in developing evolutionary models such as validating convergent and divergent phylogeny and predicting functional proteins in newly sequenced species of unverified nucleotide protein mappings. Here, we introduce an application of subspace clustering as applied to orthologous gene sequences and discuss the initial results. The working hypothesis is based upon the concept that genetic changes between nucleotide sequences coding for proteins among selected species and groups may lie within a union of subspaces for clusters of the orthologous groups. Estimates for the subspace dimensions were computed for a small population sample. A series of experiments was performed to cluster randomly selected sequences. The experimental design allows for both false positives and false negatives, and estimates for the statistical significance are provided. The clustering results are consistent with the main hypothesis. A simple random mutation binary tree model is used to simulate speciation events that show the interdependence of the subspace rank versus time and mutation rates. The simple mutation model is found to be largely consistent with the observed subspace clustering singular value results. Our study indicates that the subspace clustering method may be applied in orthology analysis. PMID:26162018

  1. Clustering binary fingerprint vectors with missing values for DNA array data analysis.

    PubMed

    Figueroa, Andres; Borneman, James; Jiang, Tao

    2004-01-01

    Oligonucleotide fingerprinting is a powerful DNA array-based method to characterize cDNA and ribosomal RNA gene (rDNA) libraries and has many applications including gene expression profiling and DNA clone classification. We are especially interested in the latter application. A key step in the method is the cluster analysis of fingerprint data obtained from DNA array hybridization experiments. Most of the existing approaches to clustering use (normalized) real intensity values and thus do not treat positive and negative hybridization signals equally (positive signals are much more emphasized). In this paper, we consider a discrete approach. Fingerprint data are first normalized and binarized using control DNA clones. Because there may exist unresolved (or missing) values in this binarization process, we formulate the clustering of (binary) oligonucleotide fingerprints as a combinatorial optimization problem that attempts to identify clusters and resolve the missing values in the fingerprints simultaneously. We study the computational complexity of this clustering problem and a natural parameterized version and present an efficient greedy algorithm based on MINIMUM CLIQUE PARTITION on graphs. The algorithm takes advantage of some unique properties of the graphs considered here, which allow us to efficiently find the maximum cliques as well as some special maximal cliques. Our preliminary experimental results on simulated and real data demonstrate that the algorithm runs faster and performs better than some popular hierarchical and graph-based clustering methods. The results on real data from DNA clone classification also suggest that this discrete approach is more accurate than clustering methods based on real intensity values in terms of separating clones that have different characteristics with respect to the given oligonucleotide probes. PMID:15700408

  2. Clustering binary fingerprint vectors with missing values for DNA array data analysis.

    PubMed

    Figueroa, Andres; Borneman, James; Jiang, Tao

    2003-01-01

    Oligonucleotide fingerprinting is a powerful DNA array based method to characterize cDNA and ribosomal RNA gene (rDNA) libraries and has many applications including gene expression profiling and DNA clone classification. We are especially interested in the latter application. A key step in the method is the cluster analysis of fingerprint data obtained from DNA array hybridization experiments. Most of the existing approaches to clustering use (normalized) real intensity values and thus do not treat positive and negative hybridization signals equally (positive signals are much more emphasized). In this paper, we consider a discrete approach. Fingerprint data are first normalized and binarized using control DNA clones. Because there may exist unresolved (or missing) values in this binarization process, we formulate the clustering of (binary) oligonucleotide fingerprints as a combinatorial optimization problem that attempts to identify clusters and resolve the missing values in the fingerprints simultaneously. We study the computational complexity of this clustering problem and a natural parameterized version, and present an efficient greedy algorithm based on MINIMUM CLIQUE PARTITION on graphs. The algorithm takes advantage of some unique properties of the graphs considered here, which allow us to efficiently find the maximum cliques as well as some special maximal cliques. Our experimental results on simulated and real data demonstrate that the algorithm runs faster and performs better than some popular hierarchical and graph-based clustering methods. The results on real data from DNA clone classification also suggest that this discrete approach is more accurate than clustering methods based on real intensity values, in terms of separating clones that have different characteristics with respect to the given oligonucleotide probes. PMID:16452777

  3. Structural changes of linear DNA molecules induced by cisplatin

    SciTech Connect

    Liu, Zhiguo; Liu, Ruisi; Zhou, Zhen; Zu, Yuangang; Xu, Fengjie

    2015-02-20

    Interaction between long DNA molecules and activated cisplatin is believed to be crucial to anticancer activity. However, the exact structural changes of long DNA molecules induced by cisplatin are still not very clear. In this study, structural changes of long linear double-stranded DNA (dsDNA) and short single-stranded DNA (ssDNA) induced by activated cisplatin have been investigated by atomic force microscopy (AFM). The results indicated that long DNA molecules gradually formed network structures, beads-on-string structures and their large aggregates. Electrostatic and coordination interactions were considered as the main driving forces producing these novel structures. An interesting finding in this study is the beads-on-string structures. Moreover, it is worth noting that the beads-on-string structures were linked into the networks, which can be ascribed to the strong DNA–DNA interactions. This study expands our knowledge of the interactions between DNA molecules and cisplatin. - Highlights: • We investigate structural changes of dsDNA and ssDNA induced by cisplatin. • AFM results indicated long dsDNA formed network, beads-on-string and aggregates. • ssDNA can form very similar structures as those of long linear dsDNA. • A possible formation process of theses novel structure is proposed.

  4. Radiation-induced degradation of DNA bases

    NASA Astrophysics Data System (ADS)

    Douki, T.; Delatour, T.; Martini, R.; Cadet, J.

    1999-01-01

    Radio-induced degradation of DNA involves radical processes. A series of lesions among the major bases degradation products has been measured in isolated DNA exposed to gamma radiation in aerated aqueous solution. Degradation can be accounted for by the formation of hydroxyl radicals upon radiolysis of water (indirect effect). The four bases are degraded in high yield. Direct effect has been mimicked by photo-induced electron abstraction from the bases producing their radical cation. Quantification of the modified bases showed that guanine is the preferential target. This can be explained by its lower oxidation potential and charge transfer phenomena. La décomposition radio-induite de l'ADN fait intervenir des processus radicalaires. Une série de lésions choisies parmi les produits majeurs de dégradation des bases a été mesurée dans de l'ADN isolé exposé au rayonnement en solution aqueuse aérée. Les modifications sont alors dues aux radicaux hydroxyles produits par la radiolyse de l'eau (effet indirect) et les quatre bases sont efficacement dégradées. L'arrachement d'électrons aux bases par photosensibilisation pour produire leur radical cation, a été utilisé comme modèle de l'effet direct. La quantification des bases modifiées montre que la guanine est préférentiellement dégradée. Cette observation peut s'expliquer par le plus faible potentiel d'oxydation de cette base ainsi que par les phénomènes de transfert de charge vers les guanines.

  5. Prompt repair of hydrogen peroxide-induced DNA lesions prevents catastrophic chromosomal fragmentation.

    PubMed

    Mahaseth, Tulip; Kuzminov, Andrei

    2016-05-01

    Iron-dependent oxidative DNA damage in vivo by hydrogen peroxide (H2O2, HP) induces copious single-strand(ss)-breaks and base modifications. HP also causes infrequent double-strand DNA breaks, whose relationship to the cell killing is unclear. Since hydrogen peroxide only fragments chromosomes in growing cells, these double-strand breaks were thought to represent replication forks collapsed at direct or excision ss-breaks and to be fully reparable. We have recently reported that hydrogen peroxide kills Escherichia coli by inducing catastrophic chromosome fragmentation, while cyanide (CN) potentiates both the killing and fragmentation. Remarkably, the extreme density of CN+HP-induced chromosomal double-strand breaks makes involvement of replication forks unlikely. Here we show that this massive fragmentation is further amplified by inactivation of ss-break repair or base-excision repair, suggesting that unrepaired primary DNA lesions are directly converted into double-strand breaks. Indeed, blocking DNA replication lowers CN+HP-induced fragmentation only ∼2-fold, without affecting the survival. Once cyanide is removed, recombinational repair in E. coli can mend several double-strand breaks, but cannot mend ∼100 breaks spread over the entire chromosome. Therefore, double-strand breaks induced by oxidative damage happen at the sites of unrepaired primary one-strand DNA lesions, are independent of replication and are highly lethal, supporting the model of clustered ss-breaks at the sites of stable DNA-iron complexes. PMID:27078578

  6. Delayed chromosomal instability induced by DNA damage.

    PubMed Central

    Marder, B A; Morgan, W F

    1993-01-01

    DNA damage induced by ionizing radiation can result in gene mutation, gene amplification, chromosome rearrangements, cellular transformation, and cell death. Although many of these changes may be induced directly by the radiation, there is accumulating evidence for delayed genomic instability following X-ray exposure. We have investigated this phenomenon by studying delayed chromosomal instability in a hamster-human hybrid cell line by means of fluorescence in situ hybridization. We examined populations of metaphase cells several generations after expanding single-cell colonies that had survived 5 or 10 Gy of X rays. Delayed chromosomal instability, manifested as multiple rearrangements of human chromosome 4 in a background of hamster chromosomes, was observed in 29% of colonies surviving 5 Gy and in 62% of colonies surviving 10 Gy. A correlation of delayed chromosomal instability with delayed reproductive cell death, manifested as reduced plating efficiency in surviving clones, suggests a role for chromosome rearrangements in cytotoxicity. There were small differences in chromosome destabilization and plating efficiencies between cells irradiated with 5 or 10 Gy of X rays after a previous exposure to 10 Gy and cells irradiated only once. Cell clones showing delayed chromosomal instability had normal frequencies of sister chromatid exchange formation, indicating that at this cytogenetic endpoint the chromosomal instability was not apparent. The types of chromosomal rearrangements observed suggest that chromosome fusion, followed by bridge breakage and refusion, contributes to the observed delayed chromosomal instability. Images PMID:8413263

  7. Glutathione Depletion and Carbon Ion Radiation Potentiate Clustered DNA Lesions, Cell Death and Prevent Chromosomal Changes in Cancer Cells Progeny

    PubMed Central

    Hanot, Maïté; Boivin, Anthony; Malésys, Céline; Beuve, Michaël; Colliaux, Anthony; Foray, Nicolas; Douki, Thierry; Ardail, Dominique; Rodriguez-Lafrasse, Claire

    2012-01-01

    Poor local control and tumor escape are of major concern in head-and-neck cancers treated by conventional radiotherapy or hadrontherapy. Reduced glutathione (GSH) is suspected of playing an important role in mechanisms leading to radioresistance, and its depletion should enable oxidative stress insult, thereby modifying the nature of DNA lesions and the subsequent chromosomal changes that potentially lead to tumor escape. This study aimed to highlight the impact of a GSH-depletion strategy (dimethylfumarate, and l-buthionine sulfoximine association) combined with carbon ion or X-ray irradiation on types of DNA lesions (sparse or clustered) and the subsequent transmission of chromosomal changes to the progeny in a radioresistant cell line (SQ20B) expressing a high endogenous GSH content. Results are compared with those of a radiosensitive cell line (SCC61) displaying a low endogenous GSH level. DNA damage measurements (γH2AX/comet assay) demonstrated that a transient GSH depletion in resistant SQ20B cells potentiated the effects of irradiation by initially increasing sparse DNA breaks and oxidative lesions after X-ray irradiation, while carbon ion irradiation enhanced the complexity of clustered oxidative damage. Moreover, residual DNA double-strand breaks were measured whatever the radiation qualities. The nature of the initial DNA lesions and amount of residual DNA damage were similar to those observed in sensitive SCC61 cells after both types of irradiation. Misrepaired or unrepaired lesions may lead to chromosomal changes, estimated in cell progeny by the cytome assay. Both types of irradiation induced aberrations in nondepleted resistant SQ20B and sensitive SCC61 cells. The GSH-depletion strategy prevented the transmission of aberrations (complex rearrangements and chromosome break or loss) in radioresistant SQ20B only when associated with carbon ion irradiation. A GSH-depleting strategy combined with hadrontherapy may thus have considerable advantage in the

  8. Analysis of alcohol-induced DNA damage in Escherichia coli by visualizing single genomic DNA molecules.

    PubMed

    Kang, Yujin; Lee, Jinyong; Kim, Jisoo; Oh, Yeeun; Kim, Dogeun; Lee, Jungyun; Lim, Sangyong; Jo, Kyubong

    2016-07-21

    Consumption of alcohol injures DNA, and such damage is considered to be a primary cause for the development of cancer and many other diseases essentially due to reactive oxygen species generated from alcohol. To sensitively detect alcohol-induced DNA lesions in a biological system, we introduced a novel analytical platform for visualization of single genomic DNA molecules using E. coli. By fluorescently labelling the DNA lesions, our approach demonstrated, with the highest sensitivity, that we could count the number of DNA lesions induced by alcohol metabolism in a single bacterial cell. Moreover, our results showed a linear relationship between ethanol concentration and the number of DNA lesions: 0.88 lesions per 1% ethanol. Using this approach, we quantitatively analysed the DNA damage induced by exposure to alcoholic beverages such as beer (5% ethanol), rice wine (13%), soju (20%), and whisky (40%). PMID:27186604

  9. OGG1 is essential in oxidative stress induced DNA demethylation.

    PubMed

    Zhou, Xiaolong; Zhuang, Ziheng; Wang, Wentao; He, Lingfeng; Wu, Huan; Cao, Yan; Pan, Feiyan; Zhao, Jing; Hu, Zhigang; Sekhar, Chandra; Guo, Zhigang

    2016-09-01

    DNA demethylation is an essential cellular activity to regulate gene expression; however, the mechanism that triggers DNA demethylation remains unknown. Furthermore, DNA demethylation was recently demonstrated to be induced by oxidative stress without a clear molecular mechanism. In this manuscript, we demonstrated that 8-oxoguanine DNA glycosylase-1 (OGG1) is the essential protein involved in oxidative stress-induced DNA demethylation. Oxidative stress induced the formation of 8-oxoguanine (8-oxoG). We found that OGG1, the 8-oxoG binding protein, promotes DNA demethylation by interacting and recruiting TET1 to the 8-oxoG lesion. Downregulation of OGG1 makes cells resistant to oxidative stress-induced DNA demethylation, while over-expression of OGG1 renders cells susceptible to DNA demethylation by oxidative stress. These data not only illustrate the importance of base excision repair (BER) in DNA demethylation but also reveal how the DNA demethylation signal is transferred to downstream DNA demethylation enzymes. PMID:27251462

  10. A measure of DNA sequence similarity by Fourier Transform with applications on hierarchical clustering.

    PubMed

    Yin, Changchuan; Chen, Ying; Yau, Stephen S-T

    2014-10-21

    Multiple sequence alignment (MSA) is a prominent method for classification of DNA sequences, yet it is hampered with inherent limitations in computational complexity. Alignment-free methods have been developed over past decade for more efficient comparison and classification of DNA sequences than MSA. However, most alignment-free methods may lose structural and functional information of DNA sequences because they are based on feature extractions. Therefore, they may not fully reflect the actual differences among DNA sequences. Alignment-free methods with information conservation are needed for more accurate comparison and classification of DNA sequences. We propose a new alignment-free similarity measure of DNA sequences using the Discrete Fourier Transform (DFT). In this method, we map DNA sequences into four binary indicator sequences and apply DFT to the indicator sequences to transform them into frequency domain. The Euclidean distance of full DFT power spectra of the DNA sequences is used as similarity distance metric. To compare the DFT power spectra of DNA sequences with different lengths, we propose an even scaling method to extend shorter DFT power spectra to equal the longest length of the sequences compared. After the DFT power spectra are evenly scaled, the DNA sequences are compared in the same DFT frequency space dimensionality. We assess the accuracy of the similarity metric in hierarchical clustering using simulated DNA and virus sequences. The results demonstrate that the DFT based method is an effective and accurate measure of DNA sequence similarity. PMID:24911780

  11. Influence of the geometrical detail in the description of DNA and the scoring method of ionization clustering on nanodosimetric parameters of track structure: a Monte Carlo study using Geant4-DNA

    NASA Astrophysics Data System (ADS)

    Bueno, M.; Schulte, R.; Meylan, S.; Villagrasa, C.

    2015-11-01

    The aim of this study was to evaluate the influence of the geometrical detail of the DNA on nanodosimetric parameters of track structure induced by protons and alpha particles of different energies (LET values ranging from 1 to 162.5~\\text{keV}~μ {{\\text{m}}-1} ) as calculated by Geant4-DNA Monte Carlo simulations. The first geometry considered consisted of a well-structured placement of a realistic description of the DNA double helix wrapped around cylindrical histones (GeomHist) forming a 18 kbp-long chromatin fiber. In the second geometry considered, the DNA was modeled as a total of 1800 ten bp-long homogeneous cylinders (2.3 nm diameter and 3.4 nm height) placed in random positions and orientations (GeomCyl). As for GeomHist, GeomCyl contained a DNA material equivalent to 18 kbp. Geant4-DNA track structure simulations were performed and ionizations were counted in the scoring volumes. For GeomCyl, clusters were defined as the number of ionizations (ν) scored in each 10 bp-long cylinder. For GeomHist, clusters of ionizations scored in the sugar-phosphate groups of the double-helix were revealed by the DBSCAN clustering algorithm according to a proximity criteria among ionizations separated by less than 10 bp. The topology of the ionization clusters formed using GeomHist and GeomCyl geometries were compared in terms of biologically relevant nanodosimetric quantities. The discontinuous modeling of the DNA for GeomCyl led to smaller cluster sizes than for GeomHist. The continuous modeling of the DNA molecule for GeomHist allowed the merging of ionization points by the DBSCAN algorithm giving rise to larger clusters, which were not detectable within the GeomCyl geometry. Mean cluster size (m1) was found to be of the order of 10% higher for GeomHist compared to GeomCyl for LET <15~\\text{keV}~μ {{\\text{m}}-1} . For higher LETs, the difference increased with LET similarly for protons and alpha particles. Both geometries showed the same relationship

  12. Influence of the geometrical detail in the description of DNA and the scoring method of ionization clustering on nanodosimetric parameters of track structure: a Monte Carlo study using Geant4-DNA.

    PubMed

    Bueno, M; Schulte, R; Meylan, S; Villagrasa, C

    2015-11-01

    The aim of this study was to evaluate the influence of the geometrical detail of the DNA on nanodosimetric parameters of track structure induced by protons and alpha particles of different energies (LET values ranging from 1 to 162.5 keV µm-1) as calculated by Geant4-DNA Monte Carlo simulations.The first geometry considered consisted of a well-structured placement of a realistic description of the DNA double helix wrapped around cylindrical histones (GeomHist) forming a 18 kbp-long chromatin fiber. In the second geometry considered, the DNA was modeled as a total of 1800 ten bp-long homogeneous cylinders (2.3 nm diameter and 3.4 nm height) placed in random positions and orientations (GeomCyl). As for GeomHist, GeomCyl contained a DNA material equivalent to 18 kbp. Geant4-DNA track structure simulations were performed and ionizations were counted in the scoring volumes. For GeomCyl, clusters were defined as the number of ionizations (ν) scored in each 10 bp-long cylinder. For GeomHist, clusters of ionizations scored in the sugar-phosphate groups of the double-helix were revealed by the DBSCAN clustering algorithm according to a proximity criteria among ionizations separated by less than 10 bp. The topology of the ionization clusters formed using GeomHist and GeomCyl geometries were compared in terms of biologically relevant nanodosimetric quantities.The discontinuous modeling of the DNA for GeomCyl led to smaller cluster sizes than for GeomHist. The continuous modeling of the DNA molecule for GeomHist allowed the merging of ionization points by the DBSCAN algorithm giving rise to larger clusters, which were not detectable within the GeomCyl geometry. Mean cluster size (m1) was found to be of the order of 10% higher for GeomHist compared to GeomCyl for LET < 15 keV µm-1. For higher LETs, the difference increased with LET similarly for protons and alpha particles. Both geometries showed the same relationship between m1 and the cumulative relative frequency of

  13. Clustering of DNA words and biological function: a proof of principle.

    PubMed

    Hackenberg, Michael; Rueda, Antonio; Carpena, Pedro; Bernaola-Galván, Pedro; Barturen, Guillermo; Oliver, José L

    2012-03-21

    Relevant words in literary texts (key words) are known to be clustered, while common words are randomly distributed. Given the clustered distribution of many functional genome elements, we hypothesize that the biological text per excellence, the DNA sequence, might behave in the same way: k-length words (k-mers) with a clear function may be spatially clustered along the one-dimensional chromosome sequence, while less-important, non-functional words may be randomly distributed. To explore this linguistic analogy, we calculate a clustering coefficient for each k-mer (k=2-9bp) in human and mouse chromosome sequences, then checking if clustered words are enriched in the functional part of the genome. First, we found a positive general trend relating clustering level and word enrichment within exons and Transcription Factor Binding Sites (TFBSs), while a much weaker relation exists for repeats, and no relation at all exists for introns. Second, we found that 38.45% of the 200 top-clustered 8-mers, but only 7.70% of the non-clustered words, are represented in known motif databases. Third, enrichment/depletion experiments show that highly clustered words are significantly enriched in exons and TFBSs, while they are depleted in introns and repetitive DNA. Considering exons and TFBSs together, 1417 (or 72.26%) in human and 1385 (or 72.97%) in mouse of the top-clustered 8-mers showed a statistically significant association to either exons or TFBSs, thus strongly supporting the link between word clustering and biological function. Lastly, we identified a subset of clustered, diagnostic words that are enriched in exons but depleted in introns, and therefore might help to discriminate between these two gene regions. The clustering of DNA words thus appears as a novel principle to detect functionality in genome sequences. As evolutionary conservation is not a prerequisite, the proof of principle described here may open new ways to detect species-specific functional DNA sequences

  14. DNA induced chirality and helical twist in achiral liquid crystals

    NASA Astrophysics Data System (ADS)

    Garvey, Alfred; Basu, Rajratan; Kinnamon, Daniel

    A small quantity of DNA sample (Deoxyribonucleic acid -cellulose double-stranded from calf thymus DNA in lyophilized powder form) was doped in an achiral liquid crystal (LC), and the mixture was found to exhibit a weak degree of chirality. The induced chirality in the LC was probed by means of the electroclinic effect in the LC's smectic-A phase, which showed significant pretransitional behavior on approaching the smectic- A-smectic- C transition temperature from above. The same DNA was doped in an achiral nematic LC and the mixture was found to exhibit an average mechanical twist over macroscopic dimensions. The double-stranded DNA-induced chiral pitch length P was determined by measuring the radius of curvature of reverse twist disclination lines in 90o nematic twist cells. In the LC +DNA mixture, the LC's benzene rings interact with the nucleobases of the DNA through π - π stacking, which induces a molecular conformational deracemization in the LC.

  15. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  16. Induced DNA repair pathway in mammalian cells

    SciTech Connect

    Overberg, R.

    1985-01-01

    The survival of cultured rat kangaroo cells (PtK-2) and human xeroderma pigmentosum cells incubated with 5 ..mu..M cycloheximide subsequent to ultraviolet irradiation is lower than that of cells incubated without cycloheximide. The drop in survival is considerably larger than that produced by incubation of unirradiated cells with cycloheximide. The phenomenon was also observed when PtK-2 cells were incubated with emetine, another protein synthesis inhibitor, or with 5,6-dichloro-1-..beta..-D-ribofuranosylbenzimidazole, a RNA synthesis inhibitor. PtK cells which received a preliminary UV treatment followed by an incubation period without cycloheximide and then a second irradiation and 24 hour incubation with cycloheximide, survived the effects of the second irradiation better than cells which were incubated in the presence of cycloheximide after the first and second UV irradiation. The application of cycloheximide for 24 hours after UV irradiation of PtK cells resulted in one-half as many 6-thioguanine resistant cells as compared to the number of 6-thioguanine resistant cells found when cycloheximide was not used. These experiments indicate that a UV-inducible cycloheximide-sensitive DNA repair pathway is present in PtK and xeroderma pigmentosum cells, which is error-prone in PtK cells.

  17. DNA topoisomerase IIα controls replication origin cluster licensing and firing time in Xenopus egg extracts

    PubMed Central

    Gaggioli, Vincent; Le Viet, Barbara; Germe, Thomas; Hyrien, Olivier

    2013-01-01

    Sperm chromatin incubated in Xenopus egg extracts undergoes origin licensing and nuclear assembly before DNA replication. We found that depletion of DNA topoisomerase IIα (topo IIα), the sole topo II isozyme of eggs and its inhibition by ICRF-193, which clamps topo IIα around DNA have opposite effects on these processes. ICRF-193 slowed down replication origin cluster activation and fork progression in a checkpoint-independent manner, without altering replicon size. In contrast, topo IIα depletion accelerated origin cluster activation, and topo IIα add-back negated overinitiation. Therefore, topo IIα is not required for DNA replication, but topo IIα clamps slow replication, probably by forming roadblocks. ICRF-193 had no effect on DNA synthesis when added after nuclear assembly, confirming that topo IIα activity is dispensable for replication and revealing that topo IIα clamps formed on replicating DNA do not block replication, presumably because topo IIα acts behind and not in front of forks. Topo IIα depletion increased, and topo IIα addition reduced, chromatin loading of MCM2-7 replicative helicase, whereas ICRF-193 did not affect MCM2-7 loading. Therefore, topo IIα restrains MCM2-7 loading in an ICRF-193-resistant manner during origin licensing, suggesting a model for establishing the sequential firing of origin clusters. PMID:23757188

  18. Crystal structure of Mycobacterium tuberculosis O6-methylguanine-DNA methyltransferase protein clusters assembled on to damaged DNA.

    PubMed

    Miggiano, Riccardo; Perugino, Giuseppe; Ciaramella, Maria; Serpe, Mario; Rejman, Dominik; Páv, Ondřej; Pohl, Radek; Garavaglia, Silvia; Lahiri, Samarpita; Rizzi, Menico; Rossi, Franca

    2016-01-15

    Mycobacterium tuberculosis O(6)-methylguanine-DNA methyltransferase (MtOGT) contributes to protect the bacterial GC-rich genome against the pro-mutagenic potential of O(6)-methylated guanine in DNA. Several strains of M. tuberculosis found worldwide encode a point-mutated O(6)-methylguanine-DNA methyltransferase (OGT) variant (MtOGT-R37L), which displays an arginine-to-leucine substitution at position 37 of the poorly functionally characterized N-terminal domain of the protein. Although the impact of this mutation on the MtOGT activity has not yet been proved in vivo, we previously demonstrated that a recombinant MtOGT-R37L variant performs a suboptimal alkylated-DNA repair in vitro, suggesting a direct role for the Arg(37)-bearing region in catalysis. The crystal structure of MtOGT complexed with modified DNA solved in the present study reveals details of the protein-protein and protein-DNA interactions occurring during alkylated-DNA binding, and the protein capability also to host unmodified bases inside the active site, in a fully extrahelical conformation. Our data provide the first experimental picture at the atomic level of a possible mode of assembling three adjacent MtOGT monomers on the same monoalkylated dsDNA molecule, and disclose the conformational flexibility of discrete regions of MtOGT, including the Arg(37)-bearing random coil. This peculiar structural plasticity of MtOGT could be instrumental to proper protein clustering at damaged DNA sites, as well as to protein-DNA complexes disassembling on repair. PMID:26512127

  19. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest.

    PubMed

    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P; Chow, Vincent T K

    2016-01-01

    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  20. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest

    PubMed Central

    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P.; Chow, Vincent T.K.

    2016-01-01

    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  1. Weakly Charged Cationic Nanoparticles Induce DNA Bending and Strand Separation

    SciTech Connect

    Railsback, Justin; Singh, Abhishek; Pearce, Ryan; McKnight, Timothy E; Collazo, Ramon; Sitar, Zlatko; Yingling, Yaroslava; Melechko, Anatoli Vasilievich

    2012-01-01

    The understanding of interactions between double stranded (ds) DNA and charged nanoparticles will have a broad bearing on many important applications from drug delivery [ 1 4 ] to DNAtemplated metallization. [ 5 , 6 ] Cationic nanoparticles (NPs) can bind to DNA, a negatively charged molecule, through a combination of electrostatic attraction, groove binding, and intercalation. Such binding events induce changes in the conformation of a DNA strand. In nature, DNA wraps around a cylindrical protein assembly (diameter and height of 6 nm) [ 7 ] with an 220 positive charge, [ 8 ] creating the complex known as chromatin. Wrapping and bending of DNA has also been achieved in the laboratory through the binding of highly charged species such as molecular assemblies, [ 9 , 10 ] cationic dendrimers, [ 11 , 12 ] and nanoparticles. [ 13 15 ] The charge of a nanoparticle plays a crucial role in its ability to induce DNA structural changes. If a nanoparticle has a highly positive surface charge density, the DNA is likely to wrap and bend upon binding to the nanoparticle [ 13 ] (as in the case of chromatin). On the other hand, if a nanoparticle is weakly charged it will not induce dsDNA compaction. [ 9 , 10 , 15 ] Consequently, there is a transition zone from extended to compact DNA conformations which depends on the chemical nature of the nanoparticle and occurs for polycations with charges between 5 and 10. [ 9 ] While the interactions between highly charged NPs and DNA have been extensively studied, the processes that occur within the transition zone are less explored.

  2. Myeloperoxidase-induced genomic DNA-centered radicals.

    PubMed

    Gomez-Mejiba, Sandra E; Zhai, Zili; Gimenez, Maria S; Ashby, Michael T; Chilakapati, Jaya; Kitchin, Kirk; Mason, Ronald P; Ramirez, Dario C

    2010-06-25

    Myeloperoxidase (MPO) released by activated neutrophils can initiate and promote carcinogenesis. MPO produces hypochlorous acid (HOCl) that oxidizes the genomic DNA in inflammatory cells as well as in surrounding epithelial cells. DNA-centered radicals are early intermediates formed during DNA oxidation. Once formed, DNA-centered radicals decay by mechanisms that are not completely understood, producing a number of oxidation products that are studied as markers of DNA oxidation. In this study we employed the 5,5-dimethyl-1-pyrroline N-oxide-based immuno-spin trapping technique to investigate the MPO-triggered formation of DNA-centered radicals in inflammatory and epithelial cells and to test whether resveratrol blocks HOCl-induced DNA-centered radical formation in these cells. We found that HOCl added exogenously or generated intracellularly by MPO that has been taken up by the cell or by MPO newly synthesized produces DNA-centered radicals inside cells. We also found that resveratrol passed across cell membranes and scavenged HOCl before it reacted with the genomic DNA, thus blocking DNA-centered radical formation. Taken together our results indicate that the formation of DNA-centered radicals by intracellular MPO may be a useful point of therapeutic intervention in inflammation-induced carcinogenesis. PMID:20406811

  3. Myeloperoxidase-induced Genomic DNA-centered Radicals*

    PubMed Central

    Gomez-Mejiba, Sandra E.; Zhai, Zili; Gimenez, Maria S.; Ashby, Michael T.; Chilakapati, Jaya; Kitchin, Kirk; Mason, Ronald P.; Ramirez, Dario C.

    2010-01-01

    Myeloperoxidase (MPO) released by activated neutrophils can initiate and promote carcinogenesis. MPO produces hypochlorous acid (HOCl) that oxidizes the genomic DNA in inflammatory cells as well as in surrounding epithelial cells. DNA-centered radicals are early intermediates formed during DNA oxidation. Once formed, DNA-centered radicals decay by mechanisms that are not completely understood, producing a number of oxidation products that are studied as markers of DNA oxidation. In this study we employed the 5,5-dimethyl-1-pyrroline N-oxide-based immuno-spin trapping technique to investigate the MPO-triggered formation of DNA-centered radicals in inflammatory and epithelial cells and to test whether resveratrol blocks HOCl-induced DNA-centered radical formation in these cells. We found that HOCl added exogenously or generated intracellularly by MPO that has been taken up by the cell or by MPO newly synthesized produces DNA-centered radicals inside cells. We also found that resveratrol passed across cell membranes and scavenged HOCl before it reacted with the genomic DNA, thus blocking DNA-centered radical formation. Taken together our results indicate that the formation of DNA-centered radicals by intracellular MPO may be a useful point of therapeutic intervention in inflammation-induced carcinogenesis. PMID:20406811

  4. Emerging critical roles of Fe-S clusters in DNA replication and repair

    PubMed Central

    Fuss, Jill O.; Tsai, Chi-Lin; Ishida, Justin P.; Tainer, John A.

    2015-01-01

    Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life – the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. PMID:25655665

  5. Globular clusters: DNA of early-type galaxies?

    NASA Astrophysics Data System (ADS)

    Forte, Juan C.; Vega, E. Irene; Faifer, Favio R.; Smith Castelli, Analía V.; Escudero, Carlos; González, Nélida M.; Sesto, Leandro

    2014-06-01

    This paper explores if the mean properties of early-type galaxies (ETGs) can be reconstructed from `genetic' information stored in their globular clusters (GCs; i.e. in their chemical abundances, spatial distributions and ages). This approach implies that the formation of each globular occurs in very massive stellar environments, as suggested by some models that aim at explaining the presence of multipopulations in these systems. The assumption that the relative number of GCs to diffuse stellar mass depends exponentially on chemical abundance, [Z/H], and the presence of two dominant GC subpopulations (blue and red), allows the mapping of low-metallicity haloes and of higher metallicity (and more heterogeneous) bulges. In particular, the masses of the low-metallicity haloes seem to scale up with dark matter mass through a constant. We also find a dependence of the GC formation efficiency with the mean projected stellar mass density of the galaxies within their effective radii. The analysis is based on a selected subsample of galaxies observed within the ACS Virgo Cluster Survey of the Hubble Space Telescope. These systems were grouped, according to their absolute magnitudes, in order to define composite fiducial galaxies and look for a quantitative connection with their (also composite) GCs systems. The results strengthen the idea that GCs are good quantitative tracers of both baryonic and dark matter in ETGs.

  6. Increased Sensitivity of DNA Damage Response-Deficient Cells to Stimulated Microgravity-Induced DNA Lesions

    PubMed Central

    Li, Nan; An, Lili; Hang, Haiying

    2015-01-01

    Microgravity is a major stress factor that astronauts have to face in space. In the past, the effects of microgravity on genomic DNA damage were studied, and it seems that the effect on genomic DNA depends on cell types and the length of exposure time to microgravity or simulated microgravity (SMG). In this study we used mouse embryonic stem (MES) and mouse embryonic fibroblast (MEF) cells to assess the effects of SMG on DNA lesions. To acquire the insight into potential mechanisms by which cells resist and/or adapt to SMG, we also included Rad9-deleted MES and Mdc1-deleted MEF cells in addition to wild type cells in this study. We observed significant SMG-induced DNA double strand breaks (DSBs) in Rad9-/- MES and Mdc1-/- MEF cells but not in their corresponding wild type cells. A similar pattern of DNA single strand break or modifications was also observed in Rad9-/- MES. As the exposure to SMG was prolonged, Rad9-/- MES cells adapted to the SMG disturbance by reducing the induced DNA lesions. The induced DNA lesions in Rad9-/- MES were due to SMG-induced reactive oxygen species (ROS). Interestingly, Mdc1-/- MEF cells were only partially adapted to the SMG disturbance. That is, the induced DNA lesions were reduced over time, but did not return to the control level while ROS returned to a control level. In addition, ROS was only partially responsible for the induced DNA lesions in Mdc1-/- MEF cells. Taken together, these data suggest that SMG is a weak genomic DNA stress and can aggravate genomic instability in cells with DNA damage response (DDR) defects. PMID:25915950

  7. UV laser-induced DNA photochemistry

    SciTech Connect

    Minton, K.W.

    1991-01-01

    Previous studies examining the effects of UV laser irradiation of nucleosides and nucleotides have determined that qualitative and quantitative differences exist between irradiation at low and high intensities. Multi-photon events involving the singlet and triplet excited states of DNA bases occur following irradiation at high intensity, leading to degradation of bases due to intra-molecular bond cleavage; such events are not seen following irradiation at low intensity. This work extends these studies. Salmon sperm and plasmid DNA were irradiated at low (3.15 [times] 10[sup 7] W/m[sup 2]), intermediate (2.5 [times] 10[sup 9] and 1.16 [times] 10[sup 10] W/m[sup 2]), and high (1.25 [times] 10[sup 11] W/m[sup 2]) intensities, using a KrF excimer laser emitting at 248 nm. DNA damage was then assayed, with the following findings; (1) pyrimidine cyclobutane dimer and bipyrimidine T(6-4)C photoadduct formation was reduced at high intensity relative to low intensity; (2) free thymine and thymine fragments were released from DNA at high intensity, but not at low intensity; (3) DNA strand break formation increased with increasing intensity; (4) double-stranded breaks occurred in DNA at high intensity. A mathematical model describing the effect of high intensity UV radiation on plasmid DNa conformation was developed and fit to experimental data on strand breaks. Using the model, dose constants for single- and double-stranded breaks were determined and found to increase with intensity. These results are consistent with the absorption of a second photon by long-lived triplet excited states of DNA following irradiation at high intensity, but not low intensity. Absorption of two photons leads to the depopulation of triplet excited states in DNA through ionization and fragmentation of bases, causing decreased levels of pyrimidine dimer formation and increased amounts of strand breakage in DNA components, and help extend our understanding of DNA-UV light interactions.

  8. Ethanol Induced Shortening of DNA in Nanochannels

    NASA Astrophysics Data System (ADS)

    Gemmen, Greg; Reisner, Walter; Tegenfeldt, Jonas; Linke, Heiner

    2010-03-01

    The confinement of DNA in nanochannels has greatly facilitated the study of DNA polymer physics and holds promise as a powerful tool for genomic sequencing. Ethanol precipitation of DNA is a common tool in molecular biology, typically in >70% [EtOH]. Even at lower ethanol concentrations, however, DNA transforms from B-form to A-form, a shorter yet slightly less twisted conformation. Accordingly, we isolated individual YOYO-1 labeled λ-DNA molecules in 100nmx100nm channels in 0, 20, 40 and 60% [EtOH]. We observed a dramatic shortening in the mean measured lengths with increasing [EtOH] and a broadening of the distribution of measured lengths at the intermediate concentrations. These observed lengths are less than those expected from fully A-form λ-DNA, suggesting that poor solvency effects are involved. Also, substantial spatial variations in intensity in a small number of molecules at the higher [EtOH] suggest the presence of higher order DNA conformations, in accord with the observation that the effective persistence length of DNA has been greatly reduced.

  9. Characterization of a novel DNA glycosylase from S. sahachiroi involved in the reduction and repair of azinomycin B induced DNA damage

    PubMed Central

    Wang, Shan; Liu, Kai; Xiao, Le; Yang, LiYuan; Li, Hong; Zhang, FeiXue; Lei, Lei; Li, ShengQing; Feng, Xu; Li, AiYing; He, Jing

    2016-01-01

    Azinomycin B is a hybrid polyketide/nonribosomal peptide natural product and possesses antitumor activity by interacting covalently with duplex DNA and inducing interstrand crosslinks. In the biosynthetic study of azinomycin B, a gene (orf1) adjacent to the azinomycin B gene cluster was found to be essential for the survival of the producer, Streptomyces sahachiroi ATCC33158. Sequence analyses revealed that Orf1 belongs to the HTH_42 superfamily of conserved bacterial proteins which are widely distributed in pathogenic and antibiotic-producing bacteria with unknown functions. The protein exhibits a protective effect against azinomycin B when heterologously expressed in azinomycin-sensitive strains. EMSA assays showed its sequence nonspecific binding to DNA and structure-specific binding to azinomycin B-adducted sites, and ChIP assays revealed extensive association of Orf1 with chromatin in vivo. Interestingly, Orf1 not only protects target sites by protein–DNA interaction but is also capable of repairing azinomycin B-mediated DNA cross-linking. It possesses the DNA glycosylase-like activity and specifically repairs DNA damage induced by azinomycin B through removal of both adducted nitrogenous bases in the cross-link. This bifunctional protein massively binds to genomic DNA to reduce drug attack risk as a novel DNA binding protein and triggers the base excision repair system as a novel DNA glycosylase. PMID:26400161

  10. Clustered DNA Lesions Containing 5-Formyluracil and AP Site: Repair via the BER System

    PubMed Central

    Belousova, Ekaterina A.; Vasil'eva, Inna A.; Moor, Nina A.; Zatsepin, Timofey S.; Oretskaya, Tatiana S.; Lavrik, Olga I.

    2013-01-01

    Lesions in the DNA arise under ionizing irradiation conditions or various chemical oxidants as a single damage or as part of a multiply damaged site within 1–2 helical turns (clustered lesion). Here, we explored the repair opportunity of the apurinic/apyrimidinic site (AP site) composed of the clustered lesion with 5-formyluracil (5-foU) by the base excision repair (BER) proteins. We found, that if the AP site is shifted relative to the 5-foU of the opposite strand, it could be repaired primarily via the short-patch BER pathway. In this case, the cleavage efficiency of the AP site-containing DNA strand catalyzed by human apurinic/apyrimidinic endonuclease 1 (hAPE1) decreased under AP site excursion to the 3'-side relative to the lesion in the other DNA strand. DNA synthesis catalyzed by DNA polymerase lambda was more accurate in comparison to the one catalyzed by DNA polymerase beta. If the AP site was located exactly opposite 5-foU it was expected to switch the repair to the long-patch BER pathway. In this situation, human processivity factor hPCNA stimulates the process. PMID:23936307

  11. Herpes simplex virus induces the replication of foreign DNA

    SciTech Connect

    Danovich, R.M.; Frenkel, N.

    1988-08-01

    Plasmids containing the simian virus 40 (SV40) DNA replication origin and the large T gene are replicated in Vero monkey cells but not in rabbit skin cells. Efficient replication of the plasmids was observed in rabbit cells infected with herpes simplex virus type 1 (HSV-1) and HSV-2. The HSV-induced replication required the large T antigen and the SV40 replication origin. However, it produced concatemeric molecules resembling replicative intermediates of HSV DNA and was sensitive to phosphonoacetate at concentrations known to inhibit the HSV DNA polymerase. Therefore, it involved the HSV DNA polymerase itself or a viral gene product(s) which was expressed following the replication of HSV DNA. Analyses of test plasmids lacking SV40 or HSV DNA sequences showed that, under some conditions. HSV also induced low-level replication of test plasmids containing no known eucaryotic replication origins. Together, these results show that HSV induces a DNA replicative activity which amplifies foreign DNA. The relevance of these findings to the putative transforming potential of HSV is discussed.

  12. Herpes simplex virus induces the replication of foreign DNA.

    PubMed Central

    Danovich, R M; Frenkel, N

    1988-01-01

    Plasmids containing the simian virus 40 (SV40) DNA replication origin and the large T gene are replicated efficiently in Vero monkey cells but not in rabbit skin cells. Efficient replication of the plasmids was observed in rabbit skin cells infected with herpes simplex virus type 1 (HSV-1) and HSV-2. The HSV-induced replication required the large T antigen and the SV40 replication origin. However, it produced concatemeric molecules resembling replicative intermediates of HSV DNA and was sensitive to phosphonoacetate at concentrations known to inhibit the HSV DNA polymerase. Therefore, it involved the HSV DNA polymerase itself or a viral gene product(s) which was expressed following the replication of HSV DNA. Analyses of test plasmids lacking SV40 or HSV DNA sequences showed that, under some conditions, HSV also induced low-level replication of test plasmids containing no known eucaryotic replication origins. Together, these results show that HSV induces a DNA replicative activity which amplifies foreign DNA. The relevance of these findings to the putative transforming potential of HSV is discussed. Images PMID:2850486

  13. Nuclear Magnetic Resonance Solution Structure of DNA Featuring Clustered 2'-Deoxyribonolactone and 8-Oxoguanine Lesions.

    PubMed

    Zálešák, Jan; Constant, Jean-François; Jourdan, Muriel

    2016-07-19

    Ionizing radiation, free radicals, and reactive oxygen species produce hundreds of different DNA lesions. Clustered lesions are typical for ionizing radiation. They compromise the efficiency of the base excision repair (BER) pathway, and as a consequence, they are much more toxic and mutagenic than isolated lesions. Despite their biological relevance, e.g., in cancer radiotherapy and accidental exposure, they are not very well studied from a structural point of view, and while insights provided by structural studies contribute to the understanding of the repair process, only three nuclear magnetic resonance (NMR) studies of DNA containing clusters of lesions were reported. Herein, we report the first NMR solution structure of two DNAs containing a bistranded cluster with the 2'-deoxyribonolactone and 8-oxoguanine lesions. Both DNA duplexes feature a 2'-deoxyribonolactone site in the middle of the sequence of one strand and differ by the relative position of the 8-oxoguanine, staggered 3' or 5' side on the complementary strand at a three-nucleotide distance. Depending on its relative position, the repair of the 8-oxoguanine lesion by the base excision repair protein Fpg is either almost complete or inhibited. We found that the structures of the two DNAs containing a bistranded cluster of two lesions are similar and do not deviate very much from the standard B-form. As no obvious structural deformations were observed between the two duplexes, we concluded that the differences in Fpg activity are not due to differences in their global conformation. PMID:27322640

  14. Prescribed nanoparticle cluster architectures and low-dimensional arrays built using octahedral DNA origami frames.

    PubMed

    Tian, Ye; Wang, Tong; Liu, Wenyan; Xin, Huolin L; Li, Huilin; Ke, Yonggang; Shih, William M; Gang, Oleg

    2015-07-01

    Three-dimensional mesoscale clusters that are formed from nanoparticles spatially arranged in pre-determined positions can be thought of as mesoscale analogues of molecules. These nanoparticle architectures could offer tailored properties due to collective effects, but developing a general platform for fabricating such clusters is a significant challenge. Here, we report a strategy for assembling three-dimensional nanoparticle clusters that uses a molecular frame designed with encoded vertices for particle placement. The frame is a DNA origami octahedron and can be used to fabricate clusters with various symmetries and particle compositions. Cryo-electron microscopy is used to uncover the structure of the DNA frame and to reveal that the nanoparticles are spatially coordinated in the prescribed manner. We show that the DNA frame and one set of nanoparticles can be used to create nanoclusters with different chiroptical activities. We also show that the octahedra can serve as programmable interparticle linkers, allowing one- and two-dimensional arrays to be assembled with designed particle arrangements. PMID:26005999

  15. Prescribed nanoparticle cluster architectures and low-dimensional arrays built using octahedral DNA origami frames

    DOE PAGESBeta

    Tian, Ye; Wang, Tong; Liu, Wenyan; Xin, Huolin L.; Li, Huilin; Ke, Yonggang; Shih, William M.; Gang, Oleg

    2015-05-25

    Three-dimensional mesoscale clusters that are formed from nanoparticles spatially arranged in pre-determined positions can be thought of as mesoscale analogues of molecules. These nanoparticle architectures could offer tailored properties due to collective effects, but developing a general platform for fabricating such clusters is a significant challenge. Here, we report a strategy for assembling 3D nanoparticle clusters that uses a molecular frame designed with encoded vertices for particle placement. The frame is a DNA origami octahedron and can be used to fabricate clusters with various symmetries and particle compositions. Cryo-electron microscopy is used to uncover the structure of the DNA framemore » and to reveal that the nanoparticles are spatially coordinated in the prescribed manner. We show that the DNA frame and one set of nanoparticles can be used to create nanoclusters with different chiroptical activities. We also show that the octahedra can serve as programmable interparticle linkers, allowing one- and two-dimensional arrays to be assembled that have designed particle arrangements.« less

  16. Prescribed nanoparticle cluster architectures and low-dimensional arrays built using octahedral DNA origami frames

    SciTech Connect

    Tian, Ye; Wang, Tong; Liu, Wenyan; Xin, Huolin L.; Li, Huilin; Ke, Yonggang; Shih, William M.; Gang, Oleg

    2015-05-25

    Three-dimensional mesoscale clusters that are formed from nanoparticles spatially arranged in pre-determined positions can be thought of as mesoscale analogues of molecules. These nanoparticle architectures could offer tailored properties due to collective effects, but developing a general platform for fabricating such clusters is a significant challenge. Here, we report a strategy for assembling 3D nanoparticle clusters that uses a molecular frame designed with encoded vertices for particle placement. The frame is a DNA origami octahedron and can be used to fabricate clusters with various symmetries and particle compositions. Cryo-electron microscopy is used to uncover the structure of the DNA frame and to reveal that the nanoparticles are spatially coordinated in the prescribed manner. We show that the DNA frame and one set of nanoparticles can be used to create nanoclusters with different chiroptical activities. We also show that the octahedra can serve as programmable interparticle linkers, allowing one- and two-dimensional arrays to be assembled that have designed particle arrangements.

  17. Comparative studies of UV-induced DNA cleavage by structural isomers of an iodinated DNA ligand

    SciTech Connect

    Martin, R.F.; Green, A.; Denison, L.; Pardee, M.; Kelly, D.P.; Roberts, M.; Rose, M.; Reum, M.

    1994-06-15

    The purpose was to evaluate the importance of the position of the halogen atom in iodinated DNA-binding bibenzimidazoles, with respect to sensitization of UV-A-induced DNA breakage. Three analogues of iodoHoechst 33258, denoted ortho-, meta- and paraiodoHoechst, according to the site of iodine substitution, were synthesized. Plasmid DNA (pBR322) was used to assay UV-A-induced DNA single-strand breaks (ssbs). The location of the sites of strand breakage was determined by DNA sequencing gel analysis, using a [sup 32]P-endlabelled oligoDNA with a single binding site for the ligands. A clear trend in decreasing activity of sensitization of UV-induced DNA ssbs was established: Ortho- > meta-, para- > iodoHoechst 33258. The sequencing gel studies showed that orthoiodoHoechst was distinct from the other three compounds, with respect to the sites of DNA strand breakage and the chemistry of the cleavage reaction. The position of iodine substitution in iodinated bibenzimidazoles determines the location of the carbon-centered radical on the ligand in the minor groove of DNA. DNA strand cleavage is mediated by abstraction of a nearby deoxyribosyl H-atom. Hence, the position of the radical species determines: which deoxyribosyl group is attacked (i.e., site of cleavage relative to the ligand binding site); which H-atom is abstracted, more specifically which of the five deoxyribosyl carbons is involved (i.e., the chemistry of the cleavage reaction), and the stereochemistry of the transition state for the H-atom abstraction (and hence the efficiency or extent of strand breakage). The ortho-compound represents the best example to date of iodinated DNA ligands designed as potential radiation sensitizers, as an extension of the well-established sensitization by halogenated DNA precursors. 30 refs., 3 figs.

  18. Stepwise Assembly and Characterization of DNA Linked Two-Color Quantum Dot Clusters.

    PubMed

    Coopersmith, Kaitlin; Han, Hyunjoo; Maye, Mathew M

    2015-07-14

    The DNA-mediated self-assembly of multicolor quantum dot (QD) clusters via a stepwise approach is described. The CdSe/ZnS QDs were synthesized and functionalized with an amphiphilic copolymer, followed by ssDNA conjugation. At each functionalization step, the QDs were purified via gradient ultracentrifugation, which was found to remove excess polymer and QD aggregates, allowing for improved conjugation yields and assembly reactivity. The QDs were then assembled and disassembled in a stepwise manner at a ssDNA functionalized magnetic colloid, which provided a convenient way to remove unreacted QDs and ssDNA impurities. After assembly/disassembly, the clusters' optical characteristics were studied by fluorescence spectroscopy and the assembly morphology and stoichiometry was imaged via electron microscopy. The results indicate that a significant amount of QD-to-QD energy transfer occurred in the clusters, which was studied as a function of increasing acceptor-to-donor ratios, resulting in increased QD acceptor emission intensities compared to controls. PMID:26086169

  19. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage.

    PubMed

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-03-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  20. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage

    PubMed Central

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-01-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  1. A Green Solvent Induced DNA Package

    NASA Astrophysics Data System (ADS)

    Satpathi, Sagar; Sengupta, Abhigyan; Hridya, V. M.; Gavvala, Krishna; Koninti, Raj Kumar; Roy, Bibhisan; Hazra, Partha

    2015-03-01

    Mechanistic details of DNA compaction is essential blue print for gene regulation in living organisms. Many in vitro studies have been implemented using several compaction agents. However, these compacting agents may have some kinds of cytotoxic effects to the cells. To minimize this aspect, several research works had been performed, but people have never focused green solvent, i.e. room temperature ionic liquid as DNA compaction agent. To the best of our knowledge, this is the first ever report where we have shown that guanidinium tris(pentafluoroethyl)trifluorophosphate (Gua-IL) acts as a DNA compacting agent. The compaction ability of Gua-IL has been verified by different spectroscopic techniques, like steady state emission, circular dichroism, dynamic light scattering and UV melting. Notably, we have extensively probed this compaction by Gua-IL through field emission scanning electron microscopy (FE-SEM) and fluorescence microscopy images. We also have discussed the plausible compaction mechanism process of DNA by Gua-IL. Our results suggest that Gua-IL forms a micellar kind of self aggregation above a certain concentration (>=1 mM), which instigates this compaction process. This study divulges the specific details of DNA compaction mechanism by a new class of compaction agent, which is highly biodegradable and eco friendly in nature.

  2. DNA Photonics — Probing Light-Induced Dynamics in DNA on the Femtosecond Timescale

    NASA Astrophysics Data System (ADS)

    Wang, Qiang; Fiebig, Torsten

    In Chap. 10, Wang and Fiebig discuss about a new field, DNA photonics that is important to understand the role of DNA as a functional building block in molecular nanoscale devices, and is also expected to shed light on the complex interactions between structural and electronic properties of DNA. The latter is important for biomedical applications such as DNA-targeted drug design. In this chapter, the authors present experimental data from several different classes of functionalized DNA systems and illustrate the relationship between the structural dynamics and charge injection/migration using state-of-the art femtosecond broadband spectroscopy. They also highlight the importance of the initial electronic excitation for modelling electron transfer rates and point out that ultrafast electronic energy migration, dissipation, and (de)localization must be included into the theoretical description of light-induced dynamics in DNA.

  3. Pea (Pisum sativum) cells arrested in G2 have nascent DNA with breaks between replicons and replication clusters

    SciTech Connect

    Van't Hof, J.

    1980-01-01

    DNA fiber autoradiography and alkaline sucrose sedimentation of DNA of cultured pea-root cells (Pisum sativum) arrested in G2 by carbohydrate starvation demonstrated that nascent DNA molecules of replicon (16 to 27 x 10/sup 6/D) and apparent cluster (approx. 330 x 10/sup 6/D) size were not joined. That the arrested cells were in G2 was confirmed by single-cell autoradiography and cytophotometry. In pea there are about 18 replicons per average cluster, 4.2 x 10/sup 3/ clusters, and 7.7 x 10/sup 4/ replicons per genome.

  4. Oxidative DNA adducts and DNA-protein cross-links are the major DNA lesions induced by arsenite.

    PubMed

    Bau, Da-Tian; Wang, Tsu-Shing; Chung, Chiao-Hui; Wang, Alexander S S; Wang, Alexander S S; Jan, Kun-Yan

    2002-10-01

    Arsenic is recognized to be a nonmutagenic carcinogen because it induces DNA damage only at very high concentrations. However, many more DNA strand breaks could be detected by digesting the DNA of arsenite-treated cells with endonuclease III, formamidopyrimidine-DNA glycosylase, and proteinase K. By doing so, arsenite could be shown to induce DNA damage in human cells within a pathologically meaningful concentration range. Oxidized guanine products were detected in all arsenite-treated human cells examined. DNA-protein cross-links were also detected in arsenite-treated NB4 and HL60 cells. In human umbilical vein endothelial cells, the induction of oxidized guanine products by arsenite was sensitive to inhibitors of nitric oxide (NO) synthase but not to oxidant modulators, whereas the opposite result was obtained in vascular smooth muscle cells. On the other hand, the arsenite-induced oxidized guanine products and DNA-protein cross-links in NB4 and HL60 cells were sensitive to modulators of calcium, NO synthase, oxidant, and myeloperoxidase. Therefore, although oxidized guanine products were detected in all the human cells treated with arsenite, the pathways could be different in different cell types. Because the sensitivity and the mechanism of arsenic intoxication are cell specific, it is important that target tissues and target cells are used for investigations. It is also important that pathologically or pharmacologically meaningful concentrations of arsenic are used. This is because in most cases we are dealing with the chronic effect rather than acute toxicity. PMID:12426126

  5. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  6. Harnessing DNA-induced immune responses for improving cancer vaccines

    PubMed Central

    Herrada, Andrés A.; Rojas-Colonelli, Nicole; González-Figueroa, Paula; Roco, Jonathan; Oyarce, César; Ligtenberg, Maarten A.; Lladser, Alvaro

    2012-01-01

    DNA vaccines have emerged as an attractive strategy to promote protective cellular and humoral immunity against the encoded antigen. DNA vaccines are easy to generate, inexpensive to produce and purify at large-scale, highly stable and safe. In addition, plasmids used for DNA vaccines act as powerful “danger signals” by stimulating several DNA-sensing innate immune receptors that promote the induction of protective adaptive immunity. The induction of tumor-specific immune responses represents a major challenge for DNA vaccines because most of tumor-associated antigens are normal non-mutated self-antigens. As a consequence, induction of potentially self-reactive T cell responses against such poorly immunogenic antigens is controlled by mechanisms of central and peripheral tolerance as well as tumor-induced immunosuppression. Although several DNA vaccines against cancer have reached clinical testing, disappointing results have been observed. Therefore, the development of new adjuvants that strongly stimulate the induction of antitumor T cell immunity and counteract immune-suppressive regulation is an attractive approach to enhance the potency of DNA vaccines and overcome tumor-associated tolerance. Understanding the DNA-sensing signaling pathways of innate immunity that mediate the induction of T cell responses elicited by DNA vaccines represents a unique opportunity to develop novel adjuvants that enhance vaccine potency. The advance of DNA adjuvants needs to be complemented with the development of potent delivery systems, in order to step toward successful clinical application. Here, we briefly discuss recent evidence showing how to harness DNA-induced immune response to improve the potency of cancer vaccines and counteract tumor-associated tolerance. PMID:23111166

  7. U1 snDNA clusters in grasshoppers: chromosomal dynamics and genomic organization

    PubMed Central

    Anjos, A; Ruiz-Ruano, F J; Camacho, J P M; Loreto, V; Cabrero, J; de Souza, M J; Cabral-de-Mello, D C

    2015-01-01

    The spliceosome, constituted by a protein set associated with small nuclear RNA (snRNA), is responsible for mRNA maturation through intron removal. Among snRNA genes, U1 is generally a conserved repetitive sequence. To unveil the chromosomal/genomic dynamics of this multigene family in grasshoppers, we mapped U1 genes by fluorescence in situ hybridization in 70 species belonging to the families Proscopiidae, Pyrgomorphidae, Ommexechidae, Romaleidae and Acrididae. Evident clusters were observed in all species, indicating that, at least, some U1 repeats are tandemly arrayed. High conservation was observed in the first four families, with most species carrying a single U1 cluster, frequently located in the third or fourth longest autosome. By contrast, extensive variation was observed among Acrididae, from a single chromosome pair carrying U1 to all chromosome pairs carrying it, with occasional occurrence of two or more clusters in the same chromosome. DNA sequence analysis in Eyprepocnemis plorans (species carrying U1 clusters on seven different chromosome pairs) and Locusta migratoria (carrying U1 in a single chromosome pair) supported the coexistence of functional and pseudogenic lineages. One of these pseudogenic lineages was truncated in the same nucleotide position in both species, suggesting that it was present in a common ancestor to both species. At least in E. plorans, this U1 snDNA pseudogenic lineage was associated with 5S rDNA and short interspersed elements (SINE)-like mobile elements. Given that we conclude in grasshoppers that the U1 snDNA had evolved under the birth-and-death model and that its intragenomic spread might be related with mobile elements. PMID:25248465

  8. U1 snDNA clusters in grasshoppers: chromosomal dynamics and genomic organization.

    PubMed

    Anjos, A; Ruiz-Ruano, F J; Camacho, J P M; Loreto, V; Cabrero, J; de Souza, M J; Cabral-de-Mello, D C

    2015-02-01

    The spliceosome, constituted by a protein set associated with small nuclear RNA (snRNA), is responsible for mRNA maturation through intron removal. Among snRNA genes, U1 is generally a conserved repetitive sequence. To unveil the chromosomal/genomic dynamics of this multigene family in grasshoppers, we mapped U1 genes by fluorescence in situ hybridization in 70 species belonging to the families Proscopiidae, Pyrgomorphidae, Ommexechidae, Romaleidae and Acrididae. Evident clusters were observed in all species, indicating that, at least, some U1 repeats are tandemly arrayed. High conservation was observed in the first four families, with most species carrying a single U1 cluster, frequently located in the third or fourth longest autosome. By contrast, extensive variation was observed among Acrididae, from a single chromosome pair carrying U1 to all chromosome pairs carrying it, with occasional occurrence of two or more clusters in the same chromosome. DNA sequence analysis in Eyprepocnemis plorans (species carrying U1 clusters on seven different chromosome pairs) and Locusta migratoria (carrying U1 in a single chromosome pair) supported the coexistence of functional and pseudogenic lineages. One of these pseudogenic lineages was truncated in the same nucleotide position in both species, suggesting that it was present in a common ancestor to both species. At least in E. plorans, this U1 snDNA pseudogenic lineage was associated with 5S rDNA and short interspersed elements (SINE)-like mobile elements. Given that we conclude in grasshoppers that the U1 snDNA had evolved under the birth-and-death model and that its intragenomic spread might be related with mobile elements. PMID:25248465

  9. Amphiphilic oligoethyleneimine-β-cyclodextrin "click" clusters for enhanced DNA delivery.

    PubMed

    Martínez, Álvaro; Bienvenu, Céline; Jiménez Blanco, José L; Vierling, Pierre; Mellet, Carmen Ortiz; García Fernández, José M; Di Giorgio, Christophe

    2013-08-16

    Monodisperse amphiphilic oligoethyleneimine (OEI)-β-cyclodextrin (βCD) clusters have been prepared, and their potential as gene delivery systems has been evaluated in comparison with a nonamphiphilic congener. The general prototype incorporates tetraethyleneimine segments linked to the primary rim of βCD through either triazolyl or thioureidocysteaminyl connectors. Transfection efficiency data for the corresponding CD:pDNA nanocomplexes (CDplexes) in BNL-CL2 murine hepatocytes evidenced the strong beneficial effect of facial amphiphilicity. PMID:23859761

  10. Bubbles, Clusters and Denaturation in Genomic Dna: Modeling, Parametrization, Efficient Computation

    NASA Astrophysics Data System (ADS)

    Theodorakopoulos, Nikos

    2011-08-01

    The paper uses mesoscopic, non-linear lattice dynamics based (Peyrard-Bishop-Dauxois, PBD) modeling to describe thermal properties of DNA below and near the denaturation temperature. Computationally efficient notation is introduced for the relevant statistical mechanics. Computed melting profiles of long and short heterogeneous sequences are presented, using a recently introduced reparametrization of the PBD model, and critically discussed. The statistics of extended open bubbles and bound clusters is formulated and results are presented for selected examples.

  11. Efficient selection of biomineralizing DNA aptamers using deep sequencing and population clustering.

    PubMed

    Bawazer, Lukmaan A; Newman, Aaron M; Gu, Qian; Ibish, Abdullah; Arcila, Mary; Cooper, James B; Meldrum, Fiona C; Morse, Daniel E

    2014-01-28

    DNA-based information systems drive the combinatorial optimization processes of natural evolution, including the evolution of biominerals. Advances in high-throughput DNA sequencing expand the power of DNA as a potential information platform for combinatorial engineering, but many applications remain to be developed due in part to the challenge of handling large amounts of sequence data. Here we employ high-throughput sequencing and a recently developed clustering method (AutoSOME) to identify single-stranded DNA sequence families that bind specifically to ZnO semiconductor mineral surfaces. These sequences were enriched from a diverse DNA library after a single round of screening, whereas previous screening approaches typically require 5-15 rounds of enrichment for effective sequence identification. The consensus sequence of the largest cluster was poly d(T)30. This consensus sequence exhibited clear aptamer behavior and was shown to promote the synthesis of crystalline ZnO from aqueous solution at near-neutral pH. This activity is significant, as the crystalline form of this wide-bandgap semiconductor is not typically amenable to solution synthesis in this pH range. High-resolution TEM revealed that this DNA synthesis route yields ZnO nanoparticles with an amorphous-crystalline core-shell structure, suggesting that the mechanism of mineralization involves nanoscale coacervation around the DNA template. We thus demonstrate that our new method, termed Single round Enrichment of Ligands by deep Sequencing (SEL-Seq), can facilitate biomimetic synthesis of technological nanomaterials by accelerating combinatorial selection of biomolecular-mineral interactions. Moreover, by enabling direct characterization of sequence family demographics, we anticipate that SEL-Seq will enhance aptamer discovery in applications employing additional rounds of screening. PMID:24341560

  12. TreeParser-Aided Klee Diagrams Display Taxonomic Clusters in DNA Barcode and Nuclear Gene Datasets

    PubMed Central

    Stoeckle, Mark Y.; Coffran, Cameron

    2013-01-01

    Indicator vector analysis of a nucleotide sequence alignment generates a compact heat map, called a Klee diagram, with potential insight into clustering patterns in evolution. However, so far this approach has examined only mitochondrial cytochrome c oxidase I (COI) DNA barcode sequences. To further explore, we developed TreeParser, a freely-available web-based program that sorts a sequence alignment according to a phylogenetic tree generated from the dataset. We applied TreeParser to nuclear gene and COI barcode alignments from birds and butterflies. Distinct blocks in the resulting Klee diagrams corresponded to species and higher-level taxonomic divisions in both groups, and this enabled graphic comparison of phylogenetic information in nuclear and mitochondrial genes. Our results demonstrate TreeParser-aided Klee diagrams objectively display taxonomic clusters in nucleotide sequence alignments. This approach may help establish taxonomy in poorly studied groups and investigate higher-level clustering which appears widespread but not well understood. PMID:24022383

  13. Deriving non-homogeneous DNA Markov chain models by cluster analysis algorithm minimizing multiple alignment entropy.

    PubMed

    Borodovsky, M; Peresetsky, A

    1994-09-01

    Non-homogeneous Markov chain models can represent biologically important regions of DNA sequences. The statistical pattern that is described by these models is usually weak and was found primarily because of strong biological indications. The general method for extracting similar patterns is presented in the current paper. The algorithm incorporates cluster analysis, multiple alignment and entropy minimization. The method was first tested using the set of DNA sequences produced by Markov chain generators. It was shown that artificial gene sequences, which initially have been randomly set up along the multiple alignment panels, are aligned according to the hidden triplet phase. Then the method was applied to real protein-coding sequences and the resulting alignment clearly indicated the triplet phase and produced the parameters of the optimal 3-periodic non-homogeneous Markov chain model. These Markov models were already employed in the GeneMark gene prediction algorithm, which is used in genome sequencing projects. The algorithm can also handle the case in which the sequences to be aligned reveal different statistical patterns, such as Escherichia coli protein-coding sequences belonging to Class II and Class III. The algorithm accepts a random mix of sequences from different classes, and is able to separate them into two groups (clusters), align each cluster separately, and define a non-homogeneous Markov chain model for each sequence cluster. PMID:7952897

  14. Depletion induced clustering of red blood cells in microchannels

    NASA Astrophysics Data System (ADS)

    Wagner, Christian; Brust, Mathias; Podgorski, Thomas; Coupier, Gwennou

    2012-11-01

    The flow properties of blood are determined by the physical properties of its main constituents, the red blood cells (RBC's). At low shear rates RBC's form aggregates, so called rouleaux. Higher shear rates can break them up and the viscosity of blood shows a shear thinning behavior. The physical origin of the rouleaux formation is not yet fully resolved and there are two competing models available. One predicts that the adhesion is induced by bridging of the plasma (macromolecular) proteins in-between two RBC's. The other is based on the depletion effect and thus predicts the absence of macromolecules in-between the cells of a rouleaux. Recent single cell force measurements by use of an AFM support strongly the depletion model. By varying the concentration of Dextran at different molecular weights we can control the adhesions strength. Measurements at low hematocrit in a microfluidic channel show that the number of size of clusters is determined by the depletion induced adhesion strength.

  15. Photochromic switching of the DNA helicity induced by azobenzene derivatives

    PubMed Central

    Deiana, Marco; Pokladek, Ziemowit; Olesiak-Banska, Joanna; Młynarz, Piotr; Samoc, Marek; Matczyszyn, Katarzyna

    2016-01-01

    The photochromic properties of azobenzene, involving conformational changes occurring upon interaction with light, provide an excellent tool to establish new ways of selective regulation applied to biosystems. We report here on the binding of two water-soluble 4-(phenylazo)benzoic acid derivatives (Azo-2N and Azo-3N) with double stranded DNA and demonstrate that the photoisomerization of Azo-3N leads to changes in DNA structure. In particular, we show that stabilization and destabilization of the B-DNA secondary structure can be photochemically induced in situ by light. This photo-triggered process is fully reversible and could be an alternative pathway to control a broad range of biological processes. Moreover, we found that the bicationic Azo-3N exhibited a higher DNA-binding constant than the monocationic Azo-2N pointing out that the number of positive charges along the photosensitive polyamines chain plays a pivotal role in stabilizing the photochrome-DNA complex. PMID:27339811

  16. Photochromic switching of the DNA helicity induced by azobenzene derivatives.

    PubMed

    Deiana, Marco; Pokladek, Ziemowit; Olesiak-Banska, Joanna; Młynarz, Piotr; Samoc, Marek; Matczyszyn, Katarzyna

    2016-01-01

    The photochromic properties of azobenzene, involving conformational changes occurring upon interaction with light, provide an excellent tool to establish new ways of selective regulation applied to biosystems. We report here on the binding of two water-soluble 4-(phenylazo)benzoic acid derivatives (Azo-2N and Azo-3N) with double stranded DNA and demonstrate that the photoisomerization of Azo-3N leads to changes in DNA structure. In particular, we show that stabilization and destabilization of the B-DNA secondary structure can be photochemically induced in situ by light. This photo-triggered process is fully reversible and could be an alternative pathway to control a broad range of biological processes. Moreover, we found that the bicationic Azo-3N exhibited a higher DNA-binding constant than the monocationic Azo-2N pointing out that the number of positive charges along the photosensitive polyamines chain plays a pivotal role in stabilizing the photochrome-DNA complex. PMID:27339811

  17. Genomic DNA transposition induced by human PGBD5

    PubMed Central

    Henssen, Anton G; Henaff, Elizabeth; Jiang, Eileen; Eisenberg, Amy R; Carson, Julianne R; Villasante, Camila M; Ray, Mondira; Still, Eric; Burns, Melissa; Gandara, Jorge; Feschotte, Cedric; Mason, Christopher E; Kentsis, Alex

    2015-01-01

    Transposons are mobile genetic elements that are found in nearly all organisms, including humans. Mobilization of DNA transposons by transposase enzymes can cause genomic rearrangements, but our knowledge of human genes derived from transposases is limited. In this study, we find that the protein encoded by human PGBD5, the most evolutionarily conserved transposable element-derived gene in vertebrates, can induce stereotypical cut-and-paste DNA transposition in human cells. Genomic integration activity of PGBD5 requires distinct aspartic acid residues in its transposase domain, and specific DNA sequences containing inverted terminal repeats with similarity to piggyBac transposons. DNA transposition catalyzed by PGBD5 in human cells occurs genome-wide, with precise transposon excision and preference for insertion at TTAA sites. The apparent conservation of DNA transposition activity by PGBD5 suggests that genomic remodeling contributes to its biological function. DOI: http://dx.doi.org/10.7554/eLife.10565.001 PMID:26406119

  18. Photochromic switching of the DNA helicity induced by azobenzene derivatives

    NASA Astrophysics Data System (ADS)

    Deiana, Marco; Pokladek, Ziemowit; Olesiak-Banska, Joanna; Młynarz, Piotr; Samoc, Marek; Matczyszyn, Katarzyna

    2016-06-01

    The photochromic properties of azobenzene, involving conformational changes occurring upon interaction with light, provide an excellent tool to establish new ways of selective regulation applied to biosystems. We report here on the binding of two water-soluble 4-(phenylazo)benzoic acid derivatives (Azo-2N and Azo-3N) with double stranded DNA and demonstrate that the photoisomerization of Azo-3N leads to changes in DNA structure. In particular, we show that stabilization and destabilization of the B-DNA secondary structure can be photochemically induced in situ by light. This photo-triggered process is fully reversible and could be an alternative pathway to control a broad range of biological processes. Moreover, we found that the bicationic Azo-3N exhibited a higher DNA-binding constant than the monocationic Azo-2N pointing out that the number of positive charges along the photosensitive polyamines chain plays a pivotal role in stabilizing the photochrome-DNA complex.

  19. Torin2 Suppresses Ionizing Radiation-Induced DNA Damage Repair.

    PubMed

    Udayakumar, Durga; Pandita, Raj K; Horikoshi, Nobuo; Liu, Yan; Liu, Qingsong; Wong, Kwok-Kin; Hunt, Clayton R; Gray, Nathanael S; Minna, John D; Pandita, Tej K; Westover, Kenneth D

    2016-05-01

    Several classes of inhibitors of the mammalian target of rapamycin (mTOR) have been developed based on its central role in sensing growth factor and nutrient levels to regulate cellular metabolism. However, its ATP-binding site closely resembles other phosphatidylinositol 3-kinase-related kinase (PIKK) family members, resulting in reactivity with these targets that may also be therapeutically useful. The ATP-competitive mTOR inhibitor, Torin2, shows biochemical activity against the DNA repair-associated proteins ATM, ATR and DNA-PK, which raises the possibility that Torin2 and related compounds might radiosensitize cancerous tumors. In this study Torin2 was also found to enhance ionizing radiation-induced cell killing in conditions where ATM was dispensable, confirming the requirement for multiple PIKK targets. Moreover, Torin2 did not influence the initial appearance of γ-H2AX foci after irradiation but significantly delayed the disappearance of radiation-induced γ-H2AX foci, indicating a DNA repair defect. Torin2 increased the number of radiation-induced S-phase specific chromosome aberrations and reduced the frequency of radiation-induced CtIP and Rad51 foci formation, suggesting that Torin2 works by blocking homologous recombination (HR)-mediated DNA repair resulting in an S-phase specific DNA repair defect. Accordingly, Torin2 reduced HR-mediated repair of I-Sce1-induced DNA damage and contributed to replication fork stalling. We conclude that radiosensitization of tumor cells by Torin2 is associated with disrupting ATR- and ATM-dependent DNA damage responses. Our findings support the concept of developing combination cancer therapies that incorporate ionizing radiation therapy and Torin2 or compounds with similar properties. PMID:27135971

  20. Temperature mediated variation of DNA secondary structure in (A.T) clusters; evidence by use of the oligopeptide netropsin as a structural probe.

    PubMed Central

    Reinert, K E; Geller, D; Stutter, E

    1981-01-01

    The titration viscometric investigation of the multi-mode interaction of netropsin (Nt) with (A.T) clusters of NaDNA12 and NH4DNA10 has been extended to different temperatures. The position of two boundaries on the r-scale (r= [Nt]bound/[DNA-P]) with increasing temperature steadily (rI/II) or more abruptly (rO/I) shifts to lower values. For the most (A.T) rich Nt-binding sites of modes (O), (I) and (II) this observation suggests the existence of an equilibrium between different DNA secondary structures with a different translation per base pair. The mode specific changes delta L1Nt of DNA contour length as induced by one Nt molecule proved to be almost independent of temperature. Concomitant stiffening effects increase with decreasing temperature, contrary to initial expectation. Conformational variability of (A.T) clusters may represent an essential feature in specific or selective DNA-protein interaction. PMID:6265870

  1. Modulation of irinotecan-induced genomic DNA damage by theanine.

    PubMed

    Attia, Sabry

    2012-05-01

    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity. PMID:22414655

  2. Mutational clusters generated by non-processive polymerases: A case study using DNA polymerase betain vitro.

    PubMed

    García-Villada, Libertad; Drake, John W

    2010-08-01

    Available DNA mutational spectra reveal that the number of mutants with multiple mutations ("multiples") is usually greater than expected from a random distribution of mutations among mutants. These overloads imply the occurrence of non-random clusters of mutations, probably generated during episodes of low-fidelity DNA synthesis. Excess multiples have been reported not only for viruses, bacteria, and eukaryotic cells but also for the DNA polymerases of phages T4 and RB69 in vitro. In the simplest case of a purified polymerase, non-random clusters may be generated by a subfraction of phenotypic variants able to introduce more errors per cycle of DNA synthesis than the normal enzyme. According to this hypothesis, excess multiples are not expected with non-processive polymerases even if they harbor rare mutator variants. DNA polymerase beta (Pol beta) is a mammalian DNA-repair polymerase with very low processivity. Although several Pol beta mutational spectra have been described, there is conflicting evidence on whether or not excess multiples occur, with spectra based on the HSV-tk system tending to show excess multiples. Excess multiples generated by Pol beta or any of its mutants might imply that the excesses of multiples observed in numerous other systems, especially those with processive polymerases, could be artifactual. Here, the distributions of mutations generated by native and recombinant rat Pol beta and by the Pol beta(Y265C) mutator were analyzed in the M13mp2 lacZalpha system. Our results present no evidence for a significant excess of multiples over the expected numbers with any of the Pol beta enzymes tested in this system. The reported excess of Pol beta-generated multiples in the HSV-tk system may reflect a reduced efficiency of detection of base substitutions that cause weak phenotypes, which in turn may artifactually increase the frequency of multiples. PMID:20627824

  3. Cisplatin induces loop structures and condensation of single DNA molecules

    PubMed Central

    Hou, Xi-Miao; Zhang, Xing-Hua; Wei, Kong-Ji; Ji, Chao; Dou, Shuo-Xing; Wang, Wei-Chi; Li, Ming; Wang, Peng-Ye

    2009-01-01

    Structural properties of single λ DNA treated with anti-cancer drug cisplatin were studied with magnetic tweezers and AFM. Under the effect of low-concentration cisplatin, the DNA became more flexible, with the persistence length decreased significantly from ∼52 to 15 nm. At a high drug concentration, a DNA condensation phenomenon was observed. Based on experimental results from both single-molecule and AFM studies, we propose a model to explain this kind of DNA condensation by cisplatin: first, di-adducts induce local distortions of DNA. Next, micro-loops of ∼20 nm appear through distant crosslinks. Then, large aggregates are formed through further crosslinks. Finally, DNA is condensed into a compact globule. Experiments with Pt(dach)Cl2 indicate that oxaliplatin may modify the DNA structures in the same way as cisplatin. The observed loop structure formation of DNA may be an important feature of the effect of platinum anti-cancer drugs that are analogous to cisplatin in structure. PMID:19129234

  4. Mitochondrial DNA Released by Trauma Induces Neutrophil Extracellular Traps

    PubMed Central

    Itagaki, Kiyoshi; Kaczmarek, Elzbieta; Lee, Yen Ting; Tang, I. Tien; Isal, Burak; Adibnia, Yashar; Sandler, Nicola; Grimm, Melissa J.; Segal, Brahm H.; Otterbein, Leo E.; Hauser, Carl J.

    2015-01-01

    Neutrophil extracellular traps (NETs) are critical for anti-bacterial activity of the innate immune system. We have previously shown that mitochondrial damage-associated molecular patterns (mtDAMPs), including mitochondrial DNA (mtDNA), are released into the circulation after injury. We therefore questioned whether mtDNA is involved in trauma-induced NET formation. Treatment of human polymorphoneutrophils (PMN) with mtDNA induced robust NET formation, though in contrast to phorbol myristate acetate (PMA) stimulation, no NADPH-oxidase involvement was required. Moreover, formation of mtDNA-induced NETs was completely blocked by TLR9 antagonist, ODN-TTAGGG. Knowing that infective outcomes of trauma in elderly people are more severe than in young people, we measured plasma mtDNA and NET formation in elderly and young trauma patients and control subjects. MtDNA levels were significantly higher in the plasma of elderly trauma patients than young patients, despite lower injury severity scores in the elderly group. NETs were not visible in circulating PMN isolated from either young or old control subjects. NETs were however, detected in PMN isolated from young trauma patients and to a lesser extent from elderly patients. Stimulation by PMA induced widespread NET formation in PMN from both young volunteers and young trauma patients. NET response to PMA was much less pronounced in both elderly volunteers’ PMN and in trauma patients’ PMN. We conclude that mtDNA is a potent inducer of NETs that activates PMN via TLR9 without NADPH-oxidase involvement. We suggest that decreased NET formation in the elderly regardless of higher mtDNA levels in their plasma may result from decreased levels of TLR9 and/or other molecules, such as neutrophil elastase and myeloperoxidase that are involved in NET generation. Further study of the links between circulating mtDNA and NET formation may elucidate the mechanisms of trauma-related organ failure as well as the greater susceptibility to

  5. DNA interference: DNA-induced gene silencing in the appendicularian Oikopleura dioica

    PubMed Central

    Omotezako, Tatsuya; Onuma, Takeshi A.; Nishida, Hiroki

    2015-01-01

    RNA interference is widely employed as a gene-silencing system in eukaryotes for host defence against invading nucleic acids. In response to invading double-stranded RNA (dsRNA), mRNA is degraded in sequence-specific manner. So far, however, DNA interference (DNAi) has been reported only in plants, ciliates and archaea, and has not been explored in Metazoa. Here, we demonstrate that linear double-stranded DNA promotes both sequence-specific transcription blocking and mRNA degradation in developing embryos of the appendicularian Oikopleura dioica. Introduced polymerase chain reaction (PCR) products or linearized plasmids encoding Brachyury induced tail malformation and mRNA degradation. This malformation was also promoted by DNA fragments of the putative 5′-flanking region and intron without the coding region. PCR products encoding Zic-like1 and acetylcholine esterase also induced loss of sensory organ and muscle acetylcholinesterase activity, respectively. Co-injection of mRNA encoding EGFP and mCherry, and PCR products encoding these fluorescent proteins, induced sequence-specific decrease in the green or red fluorescence, respectively. These results suggest that O. dioica possesses a defence system against exogenous DNA and RNA, and that DNA fragment-induced gene silencing would be mediated through transcription blocking as well as mRNA degradation. This is the first report of DNAi in Metazoa. PMID:25904672

  6. DNA interference: DNA-induced gene silencing in the appendicularian Oikopleura dioica.

    PubMed

    Omotezako, Tatsuya; Onuma, Takeshi A; Nishida, Hiroki

    2015-05-22

    RNA interference is widely employed as a gene-silencing system in eukaryotes for host defence against invading nucleic acids. In response to invading double-stranded RNA (dsRNA), mRNA is degraded in sequence-specific manner. So far, however, DNA interference (DNAi) has been reported only in plants, ciliates and archaea, and has not been explored in Metazoa. Here, we demonstrate that linear double-stranded DNA promotes both sequence-specific transcription blocking and mRNA degradation in developing embryos of the appendicularian Oikopleura dioica. Introduced polymerase chain reaction (PCR) products or linearized plasmids encoding Brachyury induced tail malformation and mRNA degradation. This malformation was also promoted by DNA fragments of the putative 5'-flanking region and intron without the coding region. PCR products encoding Zic-like1 and acetylcholine esterase also induced loss of sensory organ and muscle acetylcholinesterase activity, respectively. Co-injection of mRNA encoding EGFP and mCherry, and PCR products encoding these fluorescent proteins, induced sequence-specific decrease in the green or red fluorescence, respectively. These results suggest that O. dioica possesses a defence system against exogenous DNA and RNA, and that DNA fragment-induced gene silencing would be mediated through transcription blocking as well as mRNA degradation. This is the first report of DNAi in Metazoa. PMID:25904672

  7. Low Dose Iron Treatments Induce a DNA Damage Response in Human Endothelial Cells within Minutes

    PubMed Central

    Mollet, Inês G.; Giess, Adam; Paschalaki, Koralia; Periyasamy, Manikandan; Lidington, Elaine C.; Mason, Justin C.; Jones, Michael D.; Game, Laurence; Ali, Simak; Shovlin, Claire L.

    2016-01-01

    Background Spontaneous reports from patients able to report vascular sequelae in real time, and recognition that serum non transferrin bound iron may reach or exceed 10μmol/L in the blood stream after iron tablets or infusions, led us to hypothesize that conventional iron treatments may provoke acute vascular injury. This prompted us to examine whether a phenotype could be observed in normal human endothelial cells treated with low dose iron. Methodology Confluent primary human endothelial cells (EC) were treated with filter-sterilized iron (II) citrate or fresh media for RNA sequencing and validation studies. RNA transcript profiles were evaluated using directional RNA sequencing with no pre-specification of target sequences. Alignments were counted for exons and junctions of the gene strand only, blinded to treatment types. Principal Findings Rapid changes in RNA transcript profiles were observed in endothelial cells treated with 10μmol/L iron (II) citrate, compared to media-treated cells. Clustering for Gene Ontology (GO) performed on all differentially expressed genes revealed significant differences in biological process terms between iron and media-treated EC, whereas 10 sets of an equivalent number of randomly selected genes from the respective EC gene datasets showed no significant differences in any GO terms. After 1 hour, differentially expressed genes clustered to vesicle mediated transport, protein catabolism, and cell cycle (Benjamini p = 0.0016, 0.0024 and 0.0032 respectively), and by 6 hours, to cellular response to DNA damage stimulus most significantly through DNA repair genes FANCG, BLM, and H2AFX. Comet assays demonstrated that 10μM iron treatment elicited DNA damage within 1 hour. This was accompanied by a brisk DNA damage response pulse, as ascertained by the development of DNA damage response (DDR) foci, and p53 stabilization. Significance These data suggest that low dose iron treatments are sufficient to modify the vascular endothelium

  8. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope

    2014-01-01

    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  9. Dissecting protein-induced DNA looping dynamics in real time

    PubMed Central

    Laurens, Niels; Bellamy, Stuart R. W.; Harms, August F.; Kovacheva, Yana S.; Halford, Stephen E.; Wuite, Gijs J. L.

    2009-01-01

    Many proteins that interact with DNA perform or enhance their specific functions by binding simultaneously to multiple target sites, thereby inducing a loop in the DNA. The dynamics and energies involved in this loop formation influence the reaction mechanism. Tethered particle motion has proven a powerful technique to study in real time protein-induced DNA looping dynamics while minimally perturbing the DNA–protein interactions. In addition, it permits many single-molecule experiments to be performed in parallel. Using as a model system the tetrameric Type II restriction enzyme SfiI, that binds two copies of its recognition site, we show here that we can determine the DNA–protein association and dissociation steps as well as the actual process of protein-induced loop capture and release on a single DNA molecule. The result of these experiments is a quantitative reaction scheme for DNA looping by SfiI that is rigorously compared to detailed biochemical studies of SfiI looping dynamics. We also present novel methods for data analysis and compare and discuss these with existing methods. The general applicability of the introduced techniques will further enhance tethered particle motion as a tool to follow DNA–protein dynamics in real time. PMID:19586932

  10. Quantifying clustered DNA damage induction and repair by gel electrophoresis, electronic imaging and number average length analysis

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Georgakilas, Alexandros G.; Bennett, Paula V.; Laval, Jacques; Sutherland, John C.; Gewirtz, A. M. (Principal Investigator)

    2003-01-01

    Assessing DNA damage induction, repair and consequences of such damages requires measurement of specific DNA lesions by methods that are independent of biological responses to such lesions. Lesions affecting one DNA strand (altered bases, abasic sites, single strand breaks (SSB)) as well as damages affecting both strands (clustered damages, double strand breaks) can be quantified by direct measurement of DNA using gel electrophoresis, gel imaging and number average length analysis. Damage frequencies as low as a few sites per gigabase pair (10(9)bp) can be quantified by this approach in about 50ng of non-radioactive DNA, and single molecule methods may allow such measurements in DNA from single cells. This review presents the theoretical basis, biochemical requirements and practical aspects of this approach, and shows examples of their applications in identification and quantitation of complex clustered damages.

  11. Laser induced neutron production by explosion of the deuterium clusters

    NASA Astrophysics Data System (ADS)

    Holkundkar, Amol R.; Mishra, Gaurav; Gupta, N. K.

    2014-01-01

    The high energy deuterium ions serve as compact source of neutrons when fused with either deuterium or tritium atoms. In view of this, the explosion of the deuterium clusters under the influence of the laser pulse with intensity ranging from 1015 to 1019 W/cm2 is being studied along with the effect of the cluster radius and inter-cluster distance. The objective of this article is to study the efficiency of the deuterium cluster as a compact source of neutrons under various laser and cluster parameters. It is being observed that the cluster density (number of clusters per unit volume) is quite important to gain high neutron yield.

  12. DNA damage profiles induced by sunlight at different latitudes.

    PubMed

    Schuch, André Passaglia; Yagura, Teiti; Makita, Kazuo; Yamamoto, Hiromasa; Schuch, Nelson Jorge; Agnez-Lima, Lucymara Fassarella; MacMahon, Ricardo Monreal; Menck, Carlos Frederico Martins

    2012-04-01

    Despite growing knowledge on the biological effects of ultraviolet (UV) radiation on human health and ecosystems, it is still difficult to predict the negative impacts of the increasing incidence of solar UV radiation in a scenario of global warming and climate changes. Hence, the development and application of DNA-based biological sensors to monitor the solar UV radiation under different environmental conditions is of increasing importance. With a mind to rendering a molecular view-point of the genotoxic impact of sunlight, field experiments were undertaken with a DNA-dosimeter system in parallel with physical photometry of solar UVB/UVA radiation, at various latitudes in South America. On applying biochemical and immunological approaches based on specific DNA-repair enzymes and antibodies, for evaluating sunlight-induced DNA damage profiles, it became clear that the genotoxic potential of sunlight does indeed vary according to latitude. Notwithstanding, while induction of oxidized DNA bases is directly dependent on an increase in latitude, the generation of 6-4PPs is inversely so, whereby the latter can be regarded as a biomolecular marker of UVB incidence. This molecular DNA lesion-pattern largely reflects the relative incidence of UVA and UVB energy at any specific latitude. Hereby is demonstrated the applicability of this DNA-based biosensor for additional, continuous field experiments, as a means of registering variations in the genotoxic impact of solar UV radiation. PMID:22674547

  13. Nonlocal correlations induced by Hund's coupling: A cluster DMFT study

    NASA Astrophysics Data System (ADS)

    Nomura, Yusuke; Sakai, Shiro; Arita, Ryotaro

    2015-06-01

    We study spatial correlation effects in multiorbital systems, especially in a paramagnetic metallic state subject to Hund's coupling. We apply a cluster extension of the dynamical mean-field theory (DMFT) to the three-orbital Hubbard model away from half filling, where previous single-site DMFT studies revealed that local correlation effects caused by Hund's coupling bring about unusual strongly correlated metallic behaviors. We find that Hund's coupling significantly affects the nonlocal correlations too; it strongly modulates the electron distribution in the momentum space so as to make a momentum region almost half filled and hence strongly correlated. It leads to an anomalous electronic state distinct both from the Fermi liquid and the Mott insulator. We identify the mechanism of the anomalous state with the intersite ferromagnetic correlations induced by Hund's coupling.

  14. DNA melting and genotoxicity induced by silver nanoparticles and graphene.

    PubMed

    Ivask, Angela; Voelcker, Nicolas H; Seabrook, Shane A; Hor, Maryam; Kirby, Jason K; Fenech, Michael; Davis, Thomas P; Ke, Pu Chun

    2015-05-18

    We have revealed a connection between DNA-nanoparticle (NP) binding and in vitro DNA damage induced by citrate- and branched polyethylenimine-coated silver nanoparticles (c-AgNPs and b-AgNPs) as well as graphene oxide (GO) nanosheets. All three types of nanostructures triggered an early onset of DNA melting, where the extent of the melting point shift depends upon both the type and concentration of the NPs. Specifically, at a DNA/NP weight ratio of 1.1/1, the melting temperature of lambda DNA dropped from 94 °C down to 76 °C, 60 °C, and room temperature for GO, c-AgNPs and b-AgNPs, respectively. Consistently, dynamic light scattering revealed that the largest changes in DNA hydrodynamic size were also associated with the binding of b-AgNPs. Upon introduction to cells, b-AgNPs also exhibited the highest cytotoxicity, at the half-maximal inhibitory (IC50) concentrations of 3.2, 2.9, and 5.2 mg/L for B and T-lymphocyte cell lines and primary lymphocytes, compared to the values of 13.4, 12.2, and 12.5 mg/L for c-AgNPs and 331, 251, and 120 mg/L for GO nanosheets, respectively. At cytotoxic concentrations, all NPs elicited elevated genotoxicities via the increased number of micronuclei in the lymphocyte cells. However, b-AgNPs also induced micronuclei at subtoxic concentrations starting from 0.1 mg/L, likely due to their stronger cellular adhesion and internalization, as well as their subsequent interference with normal DNA synthesis or chromosome segregation during the cell cycle. This study facilitates our understanding of the effects of NP chemical composition, surface charge, and morphology on DNA stability and genotoxicity, with implications ranging from nanotoxicology to nanobiotechnology and nanomedicine. PMID:25781053

  15. Auxin mediates patterning of cluster root development induced by phosphorus deficiency in Lupinus albus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White lupin (Lupinus albus L.) develops cluster roots under phosphorus (P) deficiency. This species is widely used as a model system to study the morphology and physiology of cluster roots. However, the mechanism of P deficiency-induced cluster root formation is not fully understood. To evaluate the...

  16. Cluster synchronization induced by one-node clusters in networks with asymmetric negative couplings

    SciTech Connect

    Zhang, Jianbao; Ma, Zhongjun; Zhang, Gang

    2013-12-15

    This paper deals with the problem of cluster synchronization in networks with asymmetric negative couplings. By decomposing the coupling matrix into three matrices, and employing Lyapunov function method, sufficient conditions are derived for cluster synchronization. The conditions show that the couplings of multi-node clusters from one-node clusters have beneficial effects on cluster synchronization. Based on the effects of the one-node clusters, an effective and universal control scheme is put forward for the first time. The obtained results may help us better understand the relation between cluster synchronization and cluster structures of the networks. The validity of the control scheme is confirmed through two numerical simulations, in a network with no cluster structure and in a scale-free network.

  17. Bayesian clustering of DNA sequences using Markov chains and a stochastic partition model.

    PubMed

    Jääskinen, Väinö; Parkkinen, Ville; Cheng, Lu; Corander, Jukka

    2014-02-01

    In many biological applications it is necessary to cluster DNA sequences into groups that represent underlying organismal units, such as named species or genera. In metagenomics this grouping needs typically to be achieved on the basis of relatively short sequences which contain different types of errors, making the use of a statistical modeling approach desirable. Here we introduce a novel method for this purpose by developing a stochastic partition model that clusters Markov chains of a given order. The model is based on a Dirichlet process prior and we use conjugate priors for the Markov chain parameters which enables an analytical expression for comparing the marginal likelihoods of any two partitions. To find a good candidate for the posterior mode in the partition space, we use a hybrid computational approach which combines the EM-algorithm with a greedy search. This is demonstrated to be faster and yield highly accurate results compared to earlier suggested clustering methods for the metagenomics application. Our model is fairly generic and could also be used for clustering of other types of sequence data for which Markov chains provide a reasonable way to compress information, as illustrated by experiments on shotgun sequence type data from an Escherichia coli strain. PMID:24246289

  18. Evolutionary Dynamics of rDNA Clusters in Chromosomes of Five Clam Species Belonging to the Family Veneridae (Mollusca, Bivalvia)

    PubMed Central

    Pérez-García, Concepción; Hurtado, Ninoska S.; Morán, Paloma; Pasantes, Juan J.

    2014-01-01

    The chromosomal changes accompanying bivalve evolution are an area about which few reports have been published. To improve our understanding on chromosome evolution in Veneridae, ribosomal RNA gene clusters were mapped by fluorescent in situ hybridization (FISH) to chromosomes of five species of venerid clams (Venerupis corrugata, Ruditapes philippinarum, Ruditapes decussatus, Dosinia exoleta, and Venus verrucosa). The results were anchored to the most comprehensive molecular phylogenetic tree currently available for Veneridae. While a single major rDNA cluster was found in each of the five species, the number of 5S rDNA clusters showed high interspecies variation. Major rDNA was either subterminal to the short arms or intercalary to the long arms of metacentric or submetacentric chromosomes, whereas minor rDNA signals showed higher variability. Major and minor rDNAs map to different chromosome pairs in all species, but in R. decussatus one of the minor rDNA gene clusters and the major rDNA cluster were located in the same position on a single chromosome pair. This interspersion of both sequences was confirmed by fiber FISH. Telomeric signals appeared at both ends of every chromosome in all species. FISH mapping data are discussed in relation to the molecular phylogenetic trees currently available for Veneridae. PMID:24967400

  19. Calculation of complex DNA damage induced by ions

    NASA Astrophysics Data System (ADS)

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.

    2011-11-01

    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  20. Calculation of complex DNA damage induced by ions

    SciTech Connect

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.

    2011-11-15

    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  1. Inhibition of DNA Methyltransferases Blocks Mutant Huntingtin-Induced Neurotoxicity

    PubMed Central

    Pan, Yanchun; Daito, Takuji; Sasaki, Yo; Chung, Yong Hee; Xing, Xiaoyun; Pondugula, Santhi; Swamidass, S. Joshua; Wang, Ting; Kim, Albert H.; Yano, Hiroko

    2016-01-01

    Although epigenetic abnormalities have been described in Huntington’s disease (HD), the causal epigenetic mechanisms driving neurodegeneration in HD cortex and striatum remain undefined. Using an epigenetic pathway-targeted drug screen, we report that inhibitors of DNA methyltransferases (DNMTs), decitabine and FdCyd, block mutant huntingtin (Htt)-induced toxicity in primary cortical and striatal neurons. In addition, knockdown of DNMT3A or DNMT1 protected neurons against mutant Htt-induced toxicity, together demonstrating a requirement for DNMTs in mutant Htt-triggered neuronal death and suggesting a neurodegenerative mechanism based on DNA methylation-mediated transcriptional repression. Inhibition of DNMTs in HD model primary cortical or striatal neurons restored the expression of several key genes, including Bdnf, an important neurotrophic factor implicated in HD. Accordingly, the Bdnf promoter exhibited aberrant cytosine methylation in mutant Htt-expressing cortical neurons. In vivo, pharmacological inhibition of DNMTs in HD mouse brains restored the mRNA levels of key striatal genes known to be downregulated in HD. Thus, disturbances in DNA methylation play a critical role in mutant Htt-induced neuronal dysfunction and death, raising the possibility that epigenetic strategies targeting abnormal DNA methylation may have therapeutic utility in HD. PMID:27516062

  2. A Combinational Clustering Based Method for cDNA Microarray Image Segmentation

    PubMed Central

    Shao, Guifang; Li, Tiejun; Zuo, Wangda; Wu, Shunxiang; Liu, Tundong

    2015-01-01

    Microarray technology plays an important role in drawing useful biological conclusions by analyzing thousands of gene expressions simultaneously. Especially, image analysis is a key step in microarray analysis and its accuracy strongly depends on segmentation. The pioneering works of clustering based segmentation have shown that k-means clustering algorithm and moving k-means clustering algorithm are two commonly used methods in microarray image processing. However, they usually face unsatisfactory results because the real microarray image contains noise, artifacts and spots that vary in size, shape and contrast. To improve the segmentation accuracy, in this article we present a combination clustering based segmentation approach that may be more reliable and able to segment spots automatically. First, this new method starts with a very simple but effective contrast enhancement operation to improve the image quality. Then, an automatic gridding based on the maximum between-class variance is applied to separate the spots into independent areas. Next, among each spot region, the moving k-means clustering is first conducted to separate the spot from background and then the k-means clustering algorithms are combined for those spots failing to obtain the entire boundary. Finally, a refinement step is used to replace the false segmentation and the inseparable ones of missing spots. In addition, quantitative comparisons between the improved method and the other four segmentation algorithms--edge detection, thresholding, k-means clustering and moving k-means clustering--are carried out on cDNA microarray images from six different data sets. Experiments on six different data sets, 1) Stanford Microarray Database (SMD), 2) Gene Expression Omnibus (GEO), 3) Baylor College of Medicine (BCM), 4) Swiss Institute of Bioinformatics (SIB), 5) Joe DeRisi’s individual tiff files (DeRisi), and 6) University of California, San Francisco (UCSF), indicate that the improved approach is

  3. A Combinational Clustering Based Method for cDNA Microarray Image Segmentation.

    PubMed

    Shao, Guifang; Li, Tiejun; Zuo, Wangda; Wu, Shunxiang; Liu, Tundong

    2015-01-01

    Microarray technology plays an important role in drawing useful biological conclusions by analyzing thousands of gene expressions simultaneously. Especially, image analysis is a key step in microarray analysis and its accuracy strongly depends on segmentation. The pioneering works of clustering based segmentation have shown that k-means clustering algorithm and moving k-means clustering algorithm are two commonly used methods in microarray image processing. However, they usually face unsatisfactory results because the real microarray image contains noise, artifacts and spots that vary in size, shape and contrast. To improve the segmentation accuracy, in this article we present a combination clustering based segmentation approach that may be more reliable and able to segment spots automatically. First, this new method starts with a very simple but effective contrast enhancement operation to improve the image quality. Then, an automatic gridding based on the maximum between-class variance is applied to separate the spots into independent areas. Next, among each spot region, the moving k-means clustering is first conducted to separate the spot from background and then the k-means clustering algorithms are combined for those spots failing to obtain the entire boundary. Finally, a refinement step is used to replace the false segmentation and the inseparable ones of missing spots. In addition, quantitative comparisons between the improved method and the other four segmentation algorithms--edge detection, thresholding, k-means clustering and moving k-means clustering--are carried out on cDNA microarray images from six different data sets. Experiments on six different data sets, 1) Stanford Microarray Database (SMD), 2) Gene Expression Omnibus (GEO), 3) Baylor College of Medicine (BCM), 4) Swiss Institute of Bioinformatics (SIB), 5) Joe DeRisi's individual tiff files (DeRisi), and 6) University of California, San Francisco (UCSF), indicate that the improved approach is

  4. Inducible Escherichia coli fermentation for increased plasmid DNA production.

    PubMed

    Carnes, Aaron E; Hodgson, Clague P; Williams, James A

    2006-11-01

    Bacterial plasmids are the vectors of choice for DNA vaccines and short-term gene therapeutics. Growing plasmid DNA by microbial (Escherichia coli) fermentation is usually combined with alkaline lysis/chromatography methods of purification. To date, typical plasmid fermentation media and processes result in yields of 100-250 mg of plasmid DNA/l of culture medium, using standard high-copy pUC origin-containing plasmids. In order to address this initial and yield-limiting upstream step, we identified novel fermentation control parameters for fed-batch fermentation. The resulting fermentation strategies significantly increased specific plasmid yield with respect to cell mass while enhancing plasmid integrity and maintaining supercoiled DNA content. Fed-batch fermentation yield exceeding 1000 mg of plasmid DNA/l was obtained after reduction of plasmid-mediated metabolic burden during growth, and yields up to 1500 mg of plasmid DNA/l have been achieved with optimized plasmid backbones. Interestingly, by inducing high plasmid levels after sufficient biomass accumulation at low temperature and restricted growth, cells were able to tolerate significantly higher plasmid quantities than cells grown by conventional processes. This 5-10-fold increase in plasmid yield dramatically decreases plasmid manufacturing costs and improves the effectiveness of downstream purification by reducing the fraction of impurities. PMID:16819941

  5. Radiation-induced DNA content variability in mouse sperm

    SciTech Connect

    Pinkel, D.; Gledhill, B.L.; van Dilla, M.A.; Lake, S.; Wyrobek, A.J.

    1983-09-01

    Mouse sperm collected from the cauda epididymidis 35 days after acute testicular x-ray exposure and fluorescently stained for DNA show dose-dependent increases in the coefficient of variation (CV) of flow cytometrically obtained fluorescence distributions. By comparing dose-response curves obtained with three protocols which overcome the optical and cytochemical difficulties of sperm measurement in different ways we conclude the response is due to x-ray-induced DNA content variability. Computer modeling of the shapes of the fluorescence distributions show that at 600 rad 30 to 40% of the sperm have abnormal DNA content. Some have errors as large as two whole chromosomes, but it is not clear whether they are due to whole chromosome nondisjunction or a finer fragmentation of the genome. Exposures to benzo(a)pyrene and mitomycin C cause no detectable DNA content variability. We conclude mouse sperm DNA content measurements are not sensitive to small amounts of aneuploidy and as such will only be useful in detecting agents that produce substantial DNA content variability. Another animal with a smaller number of chromosomes might be more favorable. These sperm measurement techniques may find additional application in other areas of reproductive biology, such as the determination of the relative numbers of X and Y chromosome-bearing sperm in semen that may be artifically enriched in one population.

  6. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  7. Computer-Based Methods for the Mouse Full-Length cDNA Encyclopedia: Real-Time Sequence Clustering for Construction of a Nonredundant cDNA Library

    PubMed Central

    Konno, Hideaki; Fukunishi, Yoshifumi; Shibata, Kazuhiro; Itoh, Masayoshi; Carninci, Piero; Sugahara, Yuichi; Hayashizaki, Yoshihide

    2001-01-01

    We developed computer-based methods for constructing a nonredundant mouse full-length cDNA library. Our cDNA library construction process comprises assessment of library quality, sequencing the 3′ ends of inserts and clustering, and completing a re-array to generate a nonredundant library from a redundant one. After the cDNA libraries are generated, we sequence the 5′ ends of the inserts to check the quality of the library; then we determine the sequencing priority of each library. Selected libraries undergo large-scale sequencing of the 3′ ends of the inserts and clustering of the tag sequences. After clustering, the nonredundant library is constructed from the original libraries, which have redundant clones. All libraries, plates, clones, sequences, and clusters are uniquely identified, and all information is saved in the database according to this identifier. At press time, our system has been in place for the past two years; we have clustered 939,725 3′ end sequences into 127,385 groups from 227 cDNA libraries/sublibraries (see http://genome.gse.riken.go.jp/). [The sequence data described in this paper have been submitted to the DDBJ data library under accession nos. AV00011–AV175734, AV204013–AV382295, and BB561685–BB609425.] PMID:11157791

  8. Influenza infection induces host DNA damage and dynamic DNA damage responses during tissue regeneration

    PubMed Central

    Li, Na; Parrish, Marcus; Chan, Tze Khee; Yin, Lu; Rai, Prashant; Yoshiyuki, Yamada; Abolhassani, Nona; Tan, Kong Bing; Kiraly, Orsolya; Chow, Vincent TK; Engelward, Bevin P.

    2016-01-01

    Influenza viruses account for significant morbidity worldwide. Inflammatory responses, including excessive generation of reactive oxygen and nitrogen species (RONS), mediate lung injury in severe Influenza infections. However, the molecular basis of inflammation-induced lung damage is not fully understood. Here, we studied influenza H1N1 infected cells in vitro, as well as H1N1 infected mice, and we monitored molecular and cellular responses over the course of two weeks in vivo. We show that influenza induces DNA damage both when cells are directly exposed to virus in vitro (measured using the comet assay) and also when cells are exposed to virus in vivo (estimated via γH2AX foci). We show that DNA damage, as well as responses to DNA damage, persist in vivo until long after virus has been cleared, at times when there are inflammation associated RONS (measured by xanthine oxidase activity and oxidative products). The frequency of lung epithelial and immune cells with increased γH2AX foci is elevated in vivo, especially for dividing cells (Ki-67 positive) exposed to oxidative stress during tissue regeneration. Additionally, we observed a significant increase in apoptotic cells as well as increased levels of DSB repair proteins Ku70, Ku86 and Rad51 during the regenerative phase. In conclusion, results show that influenza induces DNA both in vitro and in vivo, and that DNA damage responses are activated, raising the possibility that DNA repair capacity may be a determining factor for tissue recovery and disease outcome. PMID:25809161

  9. DNA damage response in peripheral nervous system: coping with cancer therapy-induced DNA lesions.

    PubMed

    Englander, Ella W

    2013-08-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons. PMID:23684797

  10. DNA Damage Response in Peripheral Nervous System: Coping with Cancer Therapy-Induced DNA Lesions

    PubMed Central

    Englander, Ella W

    2013-01-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons. PMID:23684797

  11. Low-energy plasma immersion ion implantation to induce DNA transfer into bacterial E. coli

    NASA Astrophysics Data System (ADS)

    Sangwijit, K.; Yu, L. D.; Sarapirom, S.; Pitakrattananukool, S.; Anuntalabhochai, S.

    2015-12-01

    Plasma immersion ion implantation (PIII) at low energy was for the first time applied as a novel biotechnology to induce DNA transfer into bacterial cells. Argon or nitrogen PIII at low bias voltages of 2.5, 5 and 10 kV and fluences ranging from 1 × 1012 to 1 × 1017 ions/cm2 treated cells of Escherichia coli (E. coli). Subsequently, DNA transfer was operated by mixing the PIII-treated cells with DNA. Successes in PIII-induced DNA transfer were demonstrated by marker gene expressions. The induction of DNA transfer was ion-energy, fluence and DNA-size dependent. The DNA transferred in the cells was confirmed functioning. Mechanisms of the PIII-induced DNA transfer were investigated and discussed in terms of the E. coli cell envelope anatomy. Compared with conventional ion-beam-induced DNA transfer, PIII-induced DNA transfer was simpler with lower cost but higher efficiency.

  12. The N-Terminal Domain of Human DNA Helicase Rtel1 Contains a Redox Active Iron-Sulfur Cluster

    PubMed Central

    Landry, Aaron P.

    2014-01-01

    Human telomere length regulator Rtel1 is a superfamily II DNA helicase and is essential for maintaining proper length of telomeres in chromosomes. Here we report that the N-terminal domain of human Rtel1 (RtelN) expressed in Escherichia coli cells produces a protein that contains a redox active iron-sulfur cluster with the redox midpoint potential of −248 ± 10 mV (pH 8.0). The iron-sulfur cluster in RtelN is sensitive to hydrogen peroxide and nitric oxide, indicating that reactive oxygen/nitrogen species may modulate the DNA helicase activity of Rtel1 via modification of its iron-sulfur cluster. Purified RtelN retains a weak binding affinity for the single-stranded (ss) and double-stranded (ds) DNA in vitro. However, modification of the iron-sulfur cluster by hydrogen peroxide or nitric oxide does not significantly affect the DNA binding activity of RtelN, suggesting that the iron-sulfur cluster is not directly involved in the DNA interaction in the N-terminal domain of Rtel1. PMID:25147792

  13. Proteomic analysis of mismatch repair-mediated alkylating agent-induced DNA damage response

    PubMed Central

    2013-01-01

    Background Mediating DNA damage-induced apoptosis is an important genome-maintenance function of the mismatch repair (MMR) system. Defects in MMR not only cause carcinogenesis, but also render cancer cells highly resistant to chemotherapeutics, including alkylating agents. To understand the mechanisms of MMR-mediated apoptosis and MMR-deficiency-caused drug resistance, we analyze a model alkylating agent (N-methyl-N’-nitro-N-nitrosoguanidine, MNNG)-induced changes in protein phosphorylation and abundance in two cell lines, the MMR-proficient TK6 and its derivative MMR-deficient MT1. Results Under an experimental condition that MNNG-induced apoptosis was only observed in MutSα-proficient (TK6), but not in MutSα-deficient (MT1) cells, quantitative analysis of the proteomic data revealed differential expression and phosphorylation of numerous individual proteins and clusters of protein kinase substrates, as well differential activation of response pathways/networks in MNNG-treated TK6 and MT1 cells. Many alterations in TK6 cells are in favor of turning on the apoptotic machinery, while many of those in MT1 cells are to promote cell proliferation and anti-apoptosis. Conclusions Our work provides novel molecular insights into the mechanism of MMR-mediated DNA damage-induced apoptosis. PMID:24330662

  14. Current-induced enhancement of DNA bubble creation

    NASA Astrophysics Data System (ADS)

    Gu, Lei; Fu, Hua-Hua

    2016-05-01

    Current-induced heating of short double-stranded DNA chains is studied within a two-probe transport setup by using the Langevin approach. The electrons are modeled by a tight-binding Hamiltonian. The DNA atomic motion is described by the Peyrard–Bishop–Dauxois atomic potential, coupled with electrons through the Holstein interaction. The solvent environment is accounted for as a classical heat bath. Voltage biases of 0.1∼ 0.5 {{V}} can effectively break the base pairs and lead to the melting transition, which can be detected from the resulting significant reduction of the conductance. When the bias increases, the opening of base pairs near the leads with higher chemical potential is suppressed and bubble (localized separation of the double strand) formation becomes asymmetric. Our results suggest that the voltage bias can excite the base pairs, hence increases the chemical activity of DNA.

  15. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].

    PubMed

    2013-01-01

    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells. PMID:25507621

  16. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].

    PubMed

    Smetanina, N M; Pustovalova, M V; Osipov, A N

    2013-01-01

    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells. PMID:25427371

  17. Laser induced neutron production by explosion of the deuterium clusters

    SciTech Connect

    Holkundkar, Amol R.; Mishra, Gaurav Gupta, N. K.

    2014-01-15

    The high energy deuterium ions serve as compact source of neutrons when fused with either deuterium or tritium atoms. In view of this, the explosion of the deuterium clusters under the influence of the laser pulse with intensity ranging from 10{sup 15} to 10{sup 19} W/cm{sup 2} is being studied along with the effect of the cluster radius and inter-cluster distance. The objective of this article is to study the efficiency of the deuterium cluster as a compact source of neutrons under various laser and cluster parameters. It is being observed that the cluster density (number of clusters per unit volume) is quite important to gain high neutron yield.

  18. Molecular regulation of UV-induced DNA repair.

    PubMed

    Shah, Palak; He, Yu-Ying

    2015-01-01

    Ultraviolet (UV) radiation from sunlight is a major etiologic factor for skin cancer, the most prevalent cancer in the United States, as well as premature skin aging. In particular, UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair, also known as UV-induced DNA repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing people to carcinogenesis as well as to premature aging. Genetic loss of nucleotide excision repair leads to severe disorders, namely, xeroderma pigmentosum (XP), trichothiodystrophy (TTD) and Cockayne syndrome (CS), which are associated with predisposition to skin carcinogenesis at a young age as well as developmental and neurological conditions. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here, we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors. PMID:25534312

  19. Molecular Regulation of UV-Induced DNA Repair

    PubMed Central

    Shah, Palak; He, Yu-Ying

    2014-01-01

    Ultraviolet (UV) radiation from sunlight is a major etiologic factor for skin cancer, the most prevalent cancer in the U.S., as well as premature skin aging. In particular, UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair, also known as UV-induced DNA repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing people to carcinogenesis as well as to premature aging. Genetic loss of nucleotide excision repair leads to severe disorders, namely, xeroderma pigmentosum (XP), trichothiodystrophy (TTD) and Cockayne syndrome (CS), which are associated with predisposition to skin carcinogenesis at a young age as well as developmental and neurological conditions. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors. PMID:25534312

  20. Transcription induces gyration of the DNA template in Escherichia coli.

    PubMed Central

    Figueroa, N; Bossi, L

    1988-01-01

    We show that transcription modulation of a plasmid sequence in exponentially growing Escherichia coli cells leads to a rapid change in the linking number of plasmid DNA. Activation of transcription is accompanied by an increase in the plasmid's level of negative supercoiling. The added superhelical turns, whose number is proportional to the strength of the promoter and to the length of the transcript, are promptly removed when transcription is turned off. The transcription-induced increase of template supercoiling can still be detected in the presence of an inhibitor of ATP-dependent DNA gyrase [DNA topoisomerase (ATP-hydrolyzing), EC 5.99.1.3]. Altogether, our results indicate that, in addition to being under a general control, DNA superhelicity can be modulated locally in response to the topological perturbations associated with DNA tracking processes. We discuss a model in which supercoiling changes are produced by differential swiveling activities on the opposite sides of a transcriptional flow during transcriptional modulation. Images PMID:2849103

  1. DNA glycosylase enzymes induced during chemical adaptation of M. luteus.

    PubMed Central

    Riazuddin, S; Athar, A; Ahmed, Z; Lali, S M; Sohail, A

    1987-01-01

    Five peaks of DNA glycosylase activity showing a preference for MNNG alkylated DNA have been identified from extracts of adapted M. luteus. They are numerically designated as GI to GV in order of their decreasing molecular weights. The first two of these peaks have been highly purified. GI, is a constitutive heat labile protein, 35% stimulated by the presence of 50 mM NaCl, acts exclusively on 3 MeA residues in alkylated DNA, 60-70% inhibited by the presence of 2 mM free 3MeA and has been designated as 3MeA DNA glycosylase enzyme. GII, which is an inducible protein, is heat stable, 28% inhibited by the presence of 50 mM NaCl, removes 3MeA, 3MeG, 7MeA & 7MeG with different efficiency, and has been designated as 3,7 methylpurine DNA glycosylase enzyme. The rate of release of 3 methylpurines is 30 times that of 7MeG. There is no activity of either enzyme on O2-MeC, O2-MeT, O4-MeT or O6-MeG. The apparent molecular weights of GI and GII proteins are 28 Kd and 22 Kd respectively. PMID:3628000

  2. Radiation-induced DNA content variability in mouse sperm

    SciTech Connect

    Pinkel, D.; Gledhill, B.L.; Van Dilla, M.A.; Lake, S.; Wyrobek, A.J.

    1983-09-01

    Mouse sperm collected from the cauda epididymidis 35 days after acute testicular X-ray exposure and fluorescently stained for DNA show dose-dependent increases in the coefficient of variation (CV) of flow cytometrically obtained fluorescence distributions. By comparing dose-response curves obtained with three protocols which overcome the optical and cytochemical difficulties of sperm measurement in different ways we conclude the response is due to X-ray-induced DNA content variability. In the range between 0 and 600 rad the dose dependence of the square of CV of the DNA content variability, delta CV2D, is described by delta CV2D . Bx + Cx2, with 0 less than or equal to B less than or equal to 0.23 X 10(-2) and C . (0.44 +/- 0.06) X 10(-4). The dose x is measured in rad and delta CVD is expressed in percent. Computer modeling of the shapes of the fluorescence distributions show that at 600 rad 30 to 40% of the sperm have abnormal DNA content. Some have errors as large as two whole chromosomes, but it is not clear whether they are due to whole chromosome nondisjunction or a finer fragmentation of the genome. Exposures to benzo(a)pyrene and mitomycin C cause no detectable DNA content variability. We conclude mouse sperm DNA content measurements are not sensitive to small amounts of aneuploidy and as such will only be useful in detecting agents that produce substantial DNA content variability. Another animal with a smaller number of chromosomes might be more favorable. These sperm measurement techniques may find additional application in other areas of reproductive biology, such as the determination of the relative numbers of X and Y chromosome-bearing sperm in semen that may be artificially enriched in one population.

  3. Heavy ion induced DNA transfer in biological cells

    NASA Astrophysics Data System (ADS)

    Vilaithong, T.; Yu, L. D.; Apavatjrut, P.; Phanchaisri, B.; Sangyuenyongpipat, S.; Anuntalabhochai, S.; Brown, I. G.

    2004-10-01

    Low-energy ion beam bombardment of biological materials for genetic modification purposes has experienced rapid growth in the last decade, particularly for the direct DNA transfer into living organisms including both plants and bacteria. Attempts have been made to understand the mechanisms involved in ion-bombardment-induced direct gene transfer into biological cells. Here we summarize the present status of the application of low-energy ions for genetic modification of living sample materials.

  4. Contribution of indirect effects to clustered damage in DNA irradiated with protons.

    PubMed

    Pachnerová Brabcová, K; Štěpán, V; Karamitros, M; Karabín, M; Dostálek, P; Incerti, S; Davídková, M; Sihver, L

    2015-09-01

    Protons are the dominant particles both in galactic cosmic rays and in solar particle events and, furthermore, proton irradiation becomes increasingly used in tumour treatment. It is believed that complex DNA damage is the determining factor for the consequent cellular response to radiation. DNA plasmid pBR322 was irradiated at U120-M cyclotron with 30 MeV protons and treated with two Escherichia coli base excision repair enzymes. The yields of SSBs and DSBs were analysed using agarose gel electrophoresis. DNA has been irradiated in the presence of hydroxyl radical scavenger (coumarin-3-carboxylic acid) in order to distinguish between direct and indirect damage of the biological target. Pure scavenger solution was used as a probe for measurement of induced OH· radical yields. Experimental OH· radical yield kinetics was compared with predictions computed by two theoretical models-RADAMOL and Geant4-DNA. Both approaches use Geant4-DNA for description of physical stages of radiation action, and then each of them applies a distinct model for description of the pre-chemical and chemical stage. PMID:25897140

  5. Fungicide prochloraz induces oxidative stress and DNA damage in vitro.

    PubMed

    Lundqvist, J; Hellman, B; Oskarsson, A

    2016-05-01

    Prochloraz is widely used in horticulture and agriculture, e.g. as a post-harvest anti-mold treatment. Prochloraz is a known endocrine disruptor causing developmental toxicity with multiple mechanisms of action. However, data are scarce concerning other toxic effects. Since oxidative stress response, with formation of reactive oxygen species (ROS), is a common mechanism for different toxic endpoints, e.g. genotoxicity, carcinogenicity and teratogenicity, the aim of this study was to investigate if prochloraz can induce oxidative stress and/or DNA damage in human cells. A cell culture based in vitro model was used to study oxidative stress response by prochloraz, as measured by the activity of the nuclear factor erythroid 2-related factor 2 (Nrf2), a key molecule in oxidative defense mechanisms. It was observed that prochloraz induced oxidative stress in cultured human adrenocortical H295R and hepatoma HepG2 cells at non-toxic concentrations. Further, we used Comet assay to investigate the DNA damaging potential of prochloraz, and found that non-toxic concentrations of prochloraz induced DNA damage in HepG2 cells. These are novel findings, contradicting previous studies in the field of prochloraz and genotoxicity. This study reports a new mechanism by which prochloraz may exert toxicity. Our findings suggest that prochloraz might have genotoxic properties. PMID:26945613

  6. Surface-enhanced Raman scattering spectroscopy of topotecan-DNA complexes: Binding to DNA induces topotecan dimerization

    NASA Astrophysics Data System (ADS)

    Mochalov, K. E.; Strel'Tsov, S. A.; Ermishov, M. A.; Grokhovskii, S. L.; Zhuze, A. L.; Ustinova, O. A.; Sukhanova, A. V.; Nabiev, I. R.; Oleinikov, V. A.

    2002-09-01

    The interaction of topotecan (TPT), antitumor inhibitor of human DNA topoisomerase I, with calf thymus DNA was studied by surface-enhanced Raman scattering (SERS) spectroscopy. The SERS spectra of TPT are found to depend on its concentration in solution, which is associated with the dimerization of TPT. The spectral signatures of dimerization are identified. It is shown that binding to DNA induces the formation of TPT dimers. The formation of DNA-TPT-TPT-DNA complexes is considered as one of the possible mechanisms of human DNA topoisomerase I inhibition.

  7. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.

    PubMed

    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji

    2016-03-01

    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV. PMID:26573366

  8. Exploring DNA assembler, a synthetic biology tool for characterizing and engineering natural product gene clusters

    PubMed Central

    Shao, Zengyi; Zhao, Huimin

    2015-01-01

    The majority of existing antibacterial and anticancer drugs are natural products or their derivatives. However, the characterization and engineering of these compounds are often hampered by limited ability to manipulate the corresponding biosynthetic pathways. Recently, we developed a genomics-driven, synthetic biology-based method, DNA assembler, for discovery, characterization, and engineering of natural product biosynthetic pathways (Shao et al., 2011). By taking advantage of the highly efficient yeast in vivo homologous recombination mechanism, this method synthesizes the entire expression vector containing the target biosynthetic pathway and the genetic elements needed for DNA maintenance and replication in individual hosts in a single-step manner. In this chapter, we describe the general guidelines for construct design. By using two distinct biosynthetic pathways, we demonstrate that DNA assembler can perform multiple tasks, including heterologous expression, introduction of single or multiple point mutations, scar-less gene deletion, generation of product derivatives and creation of artificial gene clusters. As such, this method offers unprecedented flexibility and versatility in pathway manipulations. PMID:23084940

  9. Ion beam induced nanosized Ag metal clusters in glass

    NASA Astrophysics Data System (ADS)

    Mahnke, H.-E.; Schattat, B.; Schubert-Bischoff, P.; Novakovic, N.

    2006-04-01

    Silver metal clusters have been formed in soda lime glass by high-energy heavy-ion irradiation at ISL. The metal cluster formation was detected with X-ray absorption spectroscopy (EXAFS) in fluorescence mode, and the shape of the clusters was imaged with transmission electron microscopy. While annealing in reducing atmosphere alone, leads to the formation of metal clusters in Ag-containing glasses, where the Ag was introduced by ion-exchange, such clusters are not very uniform in size and are randomly distributed over the Ag-containing glass volume. Irradiation with 600-MeV Au ions followed by annealing, however, results in clusters more uniform in size and arranged in chains parallel to the direction of the ion beam.

  10. Cluster-Induced Fluctuations in the Microwave Background Radiation

    NASA Technical Reports Server (NTRS)

    Birkinshaw, Mark

    1997-01-01

    The research proposed was to detect, map and interpret the Sunyaev-Zel dovich (SZ) effects in two samples of distant clusters of galaxies with the OVRO 40-m telescope: an optically selected sample of 26 clusters at the North Ecliptic Pole, and an X-ray selected sample of clusters based on the Einstein Medium Sensitivity Survey, to make small maps of the strongest cluster SZ effects using the OVRO 40-m telescope, to combine the SZ and X-ray data for well-detected clusters to determine the value of the Hubble constant and set limits to the value of the deceleration parameter, and to study the properties of cluster atmospheres using the SZ effect.

  11. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  12. Photo-induced brightening and broadening effects of gold quantum clusters

    NASA Astrophysics Data System (ADS)

    Huang, Hsiu-Ying; Lin, Chia-Hui; Lin, Cheng-An J.

    2016-04-01

    We describe the use of UV light under different radiation time induces a variety of fluorescence wavelength of gold quantum clusters. First, we synthesize blue-emitted gold quantum clusters by dissolving the gold trichloride in pure toluene. To simplify the expression, we assume that the several featured PL peak (425, 450, 470 nm) is the signal for blue-emitted gold quantum clusters. Undergo UV irradiation can brighten and broaden the PL spectra of gold quantum clusters, which are observed by the evolutional spectra versus exposure time. After UV light exposure, the major population of gold quantum clusters @425nm decreased and turned to gold quantum clusters@450nm, followed by the growing population of gold quantum clusters@470nm clusters. Until 2 hour exposure, the spectra become broad with major peak shifted to 525 nm. The tunable spectra from blue to green attributes to the induced growth of gold quantum clusters by UV irradiation. The UV energy indeed tunes and broadens the emission covering the whole visible-spectra range. Finally, we also utilize via proper selection of organic surfactant (such as: trioctyl phosphine, TOP) can coordinate the quantum yield enhancement of blue-emitted gold quantum clusters under UV irradiation. The experiment method is easily for gold quantum clusters synthesis. Thus we expect this materials can be developed for fluorescence labeling application in the future.

  13. A novel method for discovering local spatial clusters of genomic regions with functional relationships from DNA contact maps

    PubMed Central

    Hu, Xihao; Shi, Christina Huan; Yip, Kevin Y.

    2016-01-01

    Motivation: The three-dimensional structure of genomes makes it possible for genomic regions not adjacent in the primary sequence to be spatially proximal. These DNA contacts have been found to be related to various molecular activities. Previous methods for analyzing DNA contact maps obtained from Hi-C experiments have largely focused on studying individual interactions, forming spatial clusters composed of contiguous blocks of genomic locations, or classifying these clusters into general categories based on some global properties of the contact maps. Results: Here, we describe a novel computational method that can flexibly identify small clusters of spatially proximal genomic regions based on their local contact patterns. Using simulated data that highly resemble Hi-C data obtained from real genome structures, we demonstrate that our method identifies spatial clusters that are more compact than methods previously used for clustering genomic regions based on DNA contact maps. The clusters identified by our method enable us to confirm functionally related genomic regions previously reported to be spatially proximal in different species. We further show that each genomic region can be assigned a numeric affinity value that indicates its degree of participation in each local cluster, and these affinity values correlate quantitatively with DNase I hypersensitivity, gene expression, super enhancer activities and replication timing in a cell type specific manner. We also show that these cluster affinity values can precisely define boundaries of reported topologically associating domains, and further define local sub-domains within each domain. Availability and implementation: The source code of BNMF and tutorials on how to use the software to extract local clusters from contact maps are available at http://yiplab.cse.cuhk.edu.hk/bnmf/. Contact: kevinyip@cse.cuhk.edu.hk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27307607

  14. Hydrodynamic and macromolecules induced clusters of red blood cells in microcapillary flow

    NASA Astrophysics Data System (ADS)

    Claveira, Viviana; Aouane, Othmane; Coupier, Gwennou; Misbah, Chaouqi; Abkarian, Manouk; Wagner, Christian

    2015-11-01

    Recent studies have been shown that despite the large shear rates, the presence of either fibrinogen or the synthetic polymer dextran leads to an enhanced formation of robust clusters of RBC in microcapillaries under flow conditions. The contribution of hydrodynamic interactions and interactions induced by the presence of macromolecules in the cluster formation has not been established. In order to elucidate this mechanism, we compare experimentally in microchannels under flow condition, the pure hydrodynamic cluster formation of RBCs and the cluster formation of RBCs in the presence of macromolecules inducing aggregation. The results reveal strong differences in the cluster morphology. Emphasizing on the case of clusters formed by two cells, the surface to surface interdistances between the cells in the different solutions shows a bimodal distribution. Numerical simulations based on the boundary integral method showed a good agreement with the experimental findings.

  15. Insights into eukaryotic DNA priming from the structure and functional interactions of the 4Fe-4S cluster domain of human DNA primase

    SciTech Connect

    Vaithiyalingam, Sivaraja; Warren, Eric M.; Eichman, Brandt F.; Chazin, Walter J.

    2010-10-19

    DNA replication requires priming of DNA templates by enzymes known as primases. Although DNA primase structures are available from archaea and bacteria, the mechanism of DNA priming in higher eukaryotes remains poorly understood in large part due to the absence of the structure of the unique, highly conserved C-terminal regulatory domain of the large subunit (p58C). Here, we present the structure of this domain determined to 1.7-{angstrom} resolution by X-ray crystallography. The p58C structure reveals a novel arrangement of an evolutionarily conserved 4Fe-4S cluster buried deeply within the protein core and is not similar to any known protein structure. Analysis of the binding of DNA to p58C by fluorescence anisotropy measurements revealed a strong preference for ss/dsDNA junction substrates. This approach was combined with site-directed mutagenesis to confirm that the binding of DNA occurs to a distinctively basic surface on p58C. A specific interaction of p58C with the C-terminal domain of the intermediate subunit of replication protein A (RPA32C) was identified and characterized by isothermal titration calorimetry and NMR. Restraints from NMR experiments were used to drive computational docking of the two domains and generate a model of the p58C-RPA32C complex. Together, our results explain functional defects in human DNA primase mutants and provide insights into primosome loading on RPA-coated ssDNA and regulation of primase activity.

  16. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    PubMed

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. PMID:24861204

  17. Microplitis demolitor Bracovirus Proviral Loci and Clustered Replication Genes Exhibit Distinct DNA Amplification Patterns during Replication

    PubMed Central

    Simmonds, Tyler J.; Thomas, Sarah A.; Strand, Michael R.

    2015-01-01

    ABSTRACT Polydnaviruses are large, double-stranded DNA viruses that are beneficial symbionts of parasitoid wasps. Polydnaviruses in the genus Bracovirus (BVs) persist in wasps as proviruses, and their genomes consist of two functional components referred to as proviral segments and nudivirus-like genes. Prior studies established that the DNA domains where proviral segments reside are amplified during replication and that segments within amplified loci are circularized before packaging into nucleocapsids. One DNA domain where nudivirus-like genes are located is also amplified but never packaged into virions. We recently sequenced the genome of the braconid Microplitis demolitor, which carries M. demolitor bracovirus (MdBV). Here, we took advantage of this resource to characterize the DNAs that are amplified during MdBV replication using a combination of Illumina and Pacific Biosciences sequencing approaches. The results showed that specific nucleotide sites identify the boundaries of amplification for proviral loci. Surprisingly, however, amplification of loci 3, 4, 6, and 8 produced head-to-tail concatemeric intermediates; loci 1, 2, and 5 produced head-to-head/tail-to-tail concatemers; and locus 7 yielded no identified concatemers. Sequence differences at amplification junctions correlated with the types of amplification intermediates the loci produced, while concatemer processing gave rise to the circularized DNAs that are packaged into nucleocapsids. The MdBV nudivirus-like gene cluster was also amplified, albeit more weakly than most proviral loci and with nondiscrete boundaries. Overall, the MdBV genome exhibited three patterns of DNA amplification during replication. Our data also suggest that PacBio sequencing could be useful in studying the replication intermediates produced by other DNA viruses. IMPORTANCE Polydnaviruses are of fundamental interest because they provide a novel example of viruses evolving into beneficial symbionts. All polydnaviruses are

  18. Sildenafil can induce the onset of a cluster headache bout

    PubMed Central

    Lin, Guan-Yu; Lee, Jiunn-Tay; Peng, Giia-Sheun; Yang, Fu-Chi

    2014-01-01

    About 25% of patients who are prescribed sildenafil, the phosphodiesterase type 5 (PDE-5) inhibitor, for erectile dysfunction (ED) experience headaches. These migraine effects are well-described, including cluster headaches. We report the case of a man who experienced a cluster headache attack following each of 2 sildenafil doses. His symptoms were resolved by adding naproxen to his treatment regimen and changing his ED treatment from 50 mg of sildenafil to 5 mg of vardenafil. To our knowledge, no study has reported cluster headaches triggered by the less commonly used PDE-5 inhibitors, namely vardenafil and tadalafil. Urologists should be cautious in prescribing sildenafil to patients with ED and with a history of cluster headaches. In these patients, they should consider prescribing low-dose vardenafil or tadalafil instead. Failure to recognize sildenafil risks could result in unnecessary headache bouts in patients with a history of cluster headaches. PMID:24940471

  19. Acoustically Induced Microparticle Orbiting and Clustering on a Solid Surface

    NASA Astrophysics Data System (ADS)

    Abdel-Fattah, A.; Tarimala, S.; Roberts, P. M.

    2008-12-01

    Behavior of colloidal particles in the bulk solution or at interfaces under the effect of high-frequency acoustics is critical to many seemingly different applications ranging from enhanced oil recovery to improved mixing in microfluidic channels and from accelerated contaminant extractions to surface cleaning, drug delivery and microelectronics. It can be detrimental or beneficial, depending on the application. In medical research, flow cytometry and microfluidics, for example, acoustically induced clustering of tracer particles and/or their sticking to the walls of channels, vessels, or tubes often becomes a problem. On the other hand, it can be tailored to enhance processes such as mixing in microfluidic devices, particle separation and sizing, and power generation microdevices. To better understand the underlying mechanisms, microscopic visualization experiments were performed in which polystyrene fluorescent (468/508 nm wavelength) microspheres with a mean diameter of 2.26-µm and density of 1.05 g/cm3, were suspended in either de-ionized water or a 0.1M NaCl solution. The freshly-prepared colloidal suspension was injected into a parallel-plate glass flow cell, which was subjected to high-frequency acoustics (200-500 kHz) through a piezoelectric transducer attached to one of the cell's outer walls. When the suspending medium is de-ionized water, acoustic stimulation of the cell at 313 kHz induced three distinct particle behaviors: 1) entrainment and bulk transport via wavelength-scale Rayleigh streaming, 2) transport via direct radiation forces to concentrate at nodal or anti-nodal planes, and 3) entrapment via boundary layer vorticular microstreaming resulting in mobile particles orbiting deposited particles. This latter phenomenon is intriguing. It occurs at specific frequencies and the shape of the orbits is determined by the applied frequency, whereas the rotation speed is proportional to the applied amplitude. At the higher ionic strength, on the other

  20. Transcription-induced DNA toxicity at trinucleotide repeats

    PubMed Central

    Wilson, John H

    2011-01-01

    Trinucleotide repeats (TNRs) are a blessing and a curse. In coding regions, where they are enriched, short repeats offer the potential for continuous, rapid length variation with linked incremental changes in the activity of the encoded protein, a valuable source of variation for evolution. But at the upper end of these benign and beneficial lengths, trinucleotide repeats become very unstable, with a dangerous bias toward continual expansion, which can lead to neurological diseases in humans. The mechanisms of expansion are varied and the links to disease are complex. Where they have been delineated, however, they have often revealed unexpected, fundamental aspects of the underlying cell biology. Nowhere is this more apparent than in recent studies, which indicate that expanded CAG repeats can form toxic sites in the genome, which can, upon interaction with normal components of DNA metabolism, trigger cell death. Here we discuss the phenomenon of TNR-induced DNA toxicity, with special emphasis on the role of transcription. Transcription-induced DNA toxicity may have profound biological consequences, with particular relevance to repeat-associated neurodegenerative diseases. PMID:21293182

  1. Thermal stability of DNA adducts induced by cyanomorpholinoadriamycin in vitro.

    PubMed Central

    Cullinane, C; Phillips, D R

    1993-01-01

    The Adriamycin derivative, cyanomorpholinoadriamycin (CMA) was reacted with DNA in vitro to form apparent interstrand crosslinks. The extent of interstrand crosslink formation was monitored by a gel electrophoresis assay and maximal crosslinking of DNA was observed within 1 hr with 5 microM of drug. The interstrand crosslinks were heat labile, with a midpoint melting temperature of 70 degrees C (10 min exposure to heat) in 45% formamide. When CMA-induced adducts were detected as blockages of lambda-exonuclease, 12 blockage sites were observed with 8 being prior to 5'-GG sequences, one prior to 5'-CC, one prior to 5'-GC and 2 at unresolved combinations of these sequences. These exonuclease-detected blockages reveal the same sites of CMA-induced crosslinking as detected by in vitro transcription footprinting and primer-extension blockages on single strand DNA, where the blockages at 5'-GG and 5'-CC were identified as sites of intrastrand crosslinking and the 5'-GC blockage as a probable site of interstrand crosslinking. The thermal stability of both types of crosslink (10 min exposure to heat) ranged from 63-70 degrees C at individual sites. High levels of adduct were detected with poly (dG-dC) but not with poly (dI-dC). These results suggest adduct formation involving an aminal linkage between the 3 position of the morpholino moiety and N2 of guanine. Images PMID:8493102

  2. PCA and clustering reveal alternate mtDNA phylogeny of N and M clades.

    PubMed

    Alexe, G; Satya, R Vijaya; Seiler, M; Platt, D; Bhanot, T; Hui, S; Tanaka, M; Levine, A J; Bhanot, G

    2008-11-01

    Phylogenetic trees based on mtDNA polymorphisms are often used to infer the history of recent human migrations. However, there is no consensus on which method to use. Most methods make strong assumptions which may bias the choice of polymorphisms and result in computational complexity which limits the analysis to a few samples/polymorphisms. For example, parsimony minimizes the number of mutations, which biases the results to minimizing homoplasy events. Such biases may miss the global structure of the polymorphisms altogether, with the risk of identifying a "common" polymorphism as ancient without an internal check on whether it either is homoplasic or is identified as ancient because of sampling bias (from oversampling the population with the polymorphism). A signature of this problem is that different methods applied to the same data or the same method applied to different datasets results in different tree topologies. When the results of such analyses are combined, the consensus trees have a low internal branch consensus. We determine human mtDNA phylogeny from 1737 complete sequences using a new, direct method based on principal component analysis (PCA) and unsupervised consensus ensemble clustering. PCA identifies polymorphisms representing robust variations in the data and consensus ensemble clustering creates stable haplogroup clusters. The tree is obtained from the bifurcating network obtained when the data are split into k = 2,3,4,...,kmax clusters, with equal sampling from each haplogroup. Our method assumes only that the data can be clustered into groups based on mutations, is fast, is stable to sample perturbation, uses all significant polymorphisms in the data, works for arbitrary sample sizes, and avoids sample choice and haplogroup size bias. The internal branches of our tree have a 90% consensus accuracy. In conclusion, our tree recreates the standard phylogeny of the N, M, L0/L1, L2, and L3 clades, confirming the African origin of modern humans

  3. Quantitation of DNA Adducts Induced by 1,3-Butadiene

    NASA Astrophysics Data System (ADS)

    Sangaraju, Dewakar; Villalta, Peter W.; Wickramaratne, Susith; Swenberg, James; Tretyakova, Natalia

    2014-07-01

    Human exposure to 1,3-butadiene (BD) present in automobile exhaust, cigarette smoke, and forest fires is of great concern because of its potent carcinogenicity. The adverse health effects of BD are mediated by its epoxide metabolites such as 3,4-epoxy-1-butene (EB), which covalently modify genomic DNA to form promutagenic nucleobase adducts. Because of their direct role in cancer, BD-DNA adducts can be used as mechanism-based biomarkers of BD exposure. In the present work, a mass spectrometry-based methodology was developed for accurate, sensitive, and precise quantification of EB-induced N-7-(1-hydroxy-3-buten-2-yl) guanine (EB-GII) DNA adducts in vivo. In our approach, EB-GII adducts are selectively released from DNA backbone by neutral thermal hydrolysis, followed by ultrafiltration, offline HPLC purification, and isotope dilution nanoLC/ESI+-HRMS3 analysis on an Orbitrap Velos mass spectrometer. Following method validation, EB-GII lesions were quantified in human fibrosarcoma (HT1080) cells treated with micromolar concentrations of EB and in liver tissues of rats exposed to sub-ppm concentrations of BD (0.5-1.5 ppm). EB-GII concentrations increased linearly from 1.15 ± 0.23 to 10.11 ± 0.45 adducts per 106 nucleotides in HT1080 cells treated with 0.5-10 μM DEB. EB-GII concentrations in DNA of laboratory rats exposed to 0.5, 1.0, and 1.5 ppm BD were 0.17 ± 0.05, 0.33 ± 0.08, and 0.50 ± 0.04 adducts per 106 nucleotides, respectively. We also used the new method to determine the in vivo half-life of EB-GII adducts in rat liver DNA (2.20 ± 0.12 d) and to detect EB-GII in human blood DNA. To our knowledge, this is the first application of nanoLC/ESI+-HRMS3 Orbitrap methodology to quantitative analysis of DNA adducts in vivo.

  4. Dynamical DNA accessibility induced by chromatin remodeling and protein binding

    NASA Astrophysics Data System (ADS)

    Montel, F.; Faivre-Moskalenko, C.; Castelnovo, M.

    2014-11-01

    Chromatin remodeling factors are enzymes being able to alter locally chromatin structure at the nucleosomal level and they actively participate in the regulation of gene expression. Using simple rules for individual nucleosome motion induced by a remodeling factor, we designed simulations of the remodeling of oligomeric chromatin, in order to address quantitatively collective effects in DNA accessibility upon nucleosome mobilization. Our results suggest that accessibility profiles are inhomogeneous thanks to borders effects like protein binding. Remarkably, we show that the accessibility lifetime of DNA sequence is roughly doubled in the vicinity of borders as compared to its value in bulk regions far from the borders. These results are quantitatively interpreted as resulting from the confined diffusion of a large nucleosome depleted region.

  5. DNA Oligonucleotide Fragment Ion Rearrangements Upon Collision-Induced Dissociation

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Neumann, Elizabeth K.; Solouki, Touradj

    2015-08-01

    Collision-induced dissociation (CID) of m/z-isolated w type fragment ions and an intact 5' phosphorylated DNA oligonucleotide generated rearranged product ions. Of the 21 studied w ions of various nucleotide sequences, fragment ion sizes, and charge states, 18 (~86%) generated rearranged product ions upon CID in a Synapt G2-S HDMS (Waters Corporation, Manchester, England, UK) ion mobility-mass spectrometer. Mass spectrometry (MS), ion mobility spectrometry (IMS), and theoretical modeling data suggest that purine bases can attack the free 5' phosphate group in w type ions and 5' phosphorylated DNA to generate sequence permuted [phosphopurine]- fragment ions. We propose and discuss a potential mechanism for generation of rearranged [phosphopurine]- and complementary y-B type product ions.

  6. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENNTIAL FLUORESENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

  7. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

  8. Understanding the Molecular Mechanism(s) of Formaldehyde-induced DNA-protein Crosslink Repair

    EPA Science Inventory

    Although formaldehyde has been shown to induce many kinds of DNA damage both in in vitro and in vivo assay systems, initial DNA-protein crosslink (DPC) formation might play a major role in FA-induced mutagenesis and carcinogenesis. Several DNA repair pathways, such as base excisi...

  9. He cluster dynamics in W in the presence of cluster induced formation of He traps

    NASA Astrophysics Data System (ADS)

    Krasheninnikov, S. I.; Smirnov, R. D.

    2016-02-01

    The theoretical model describing spatiotemporal dynamics of He clusters in tungsten, which takes into account He trap generation associated with the growth of He clusters, is presented. Application of this model to the formation of the layer of nano-bubbles underneath of the surface of thick He irradiated sample, before surface morphology starts to change, gives very good agreement with currently available experimental data. The role of thermophoresis in a long-term evolution of nano-bubble containing structures is discussed.

  10. Reconstruction of CMB temperature anisotropies with primordial CMB induced polarization in galaxy clusters

    NASA Astrophysics Data System (ADS)

    Liu, Guo-Chin; Ichiki, Kiyotomo; Tashiro, Hiroyuki; Sugiyama, Naoshi

    2016-07-01

    Scattering of cosmic microwave background (CMB) radiation in galaxy clusters induces polarization signals determined by the quadrupole anisotropy in the photon distribution at the location of clusters. This `remote quadrupole' derived from the measurements of the induced polarization in galaxy clusters provides an opportunity to reconstruct local CMB temperature anisotropies. In this Letter, we develop an algorithm of the reconstruction through the estimation of the underlying primordial gravitational potential, which is the origin of the CMB temperature and polarization fluctuations and CMB induced polarization in galaxy clusters. We found a nice reconstruction for the quadrupole and octopole components of the CMB temperature anisotropies with the assistance of the CMB induced polarization signals. The reconstruction can be an important consistency test on the puzzles of CMB anomalies, especially for the low-quadrupole and axis-of-evil problems reported in Wilkinson Microwave Anisotropy Probe and Planck data.

  11. DNA-stabilized Ag-Au bimetallic clusters: the effects of alloying and embedding on optical properties.

    PubMed

    Palagin, Dennis; Doye, Jonathan P K

    2016-08-10

    Global geometry optimization and time-dependent density functional theory calculations have been used to study the structural evolution and optical properties of AgnAun (n = 2-6) nanoalloys both as individual clusters and as clusters stabilized with the fragments of DNA of different size. We show that alloying can be used to control and tune the level of interaction between the metal atoms of the cluster and the organic fragments of the DNA ligands. For instance, gold and silver atoms are shown to exhibit synergistic effects in the process of charge transfer from the nucleobase to the cluster, with the silver atoms directly connected to the nitrogen atoms of cytosine increasing their positive partial charge, while their more electronegative neighbouring gold atoms host the excess negative charge. This allows the geometrical structures and optical absorption spectra of small bimetallic clusters to retain many of their main features upon aggregation with relatively large DNA fragments, such as a cytosine-based 9-nucleotide hairpin loop, which suggests a potential synthetic route to such hybrid metal-organic compounds, and opens up the possibility of bringing the unique tunable properties of bimetallic nanoalloys to biological applications. PMID:27459508

  12. Repair and recombination induced by triple helix DNA.

    PubMed

    Chin, Joanna Y; Schleifman, Erica B; Glazer, Peter M

    2007-01-01

    Triple-helix DNA structures can form endogenously at mirror repeat polypurine/polypyrimidine sequences or by introduction of triplex-forming oligonucleotides (TFOs). Recent evidence suggests that triple helices are sources of genetic instability, and are subject to increased rates of mutagenesis and recruitment of repair factors. Indeed, observations using TFOs suggest that triple helices provoke a variety of biological processes which can be harnessed to modulate gene expression and induce heritable changes in targeted genes. This review surveys the biological applications of TFOs, with particular attention to their recombinogenic and mutagenic potential, and summarizes available evidence for the mechanism of triplex and triplex-associated repair. PMID:17485375

  13. Hybrid magnetic nanoparticle/nanogold clusters and their distance-dependent metal-enhanced fluorescence effect via DNA hybridization

    NASA Astrophysics Data System (ADS)

    GuThese Authors Contributed Equally To This Study., Xuefan; Wu, Youshen; Zhang, Lingze; Liu, Yongchun; Li, Yan; Yan, Yongli; Wu, Daocheng

    2014-07-01

    To improve the metal-enhanced fluorescence (MEF) effect of nanogolds (AuNPs) and accurately detect specific DNA sequences via DNA hybridization, novel hybrid magnetic nanoparticles/nanogold clusters (HMNCs) were designed based on finite-difference time-domain simulation results and prepared by using Fe3O4 and nanogolds. The nanogolds outside the HMNC were then conjugated with thiol-terminated DNA molecules, thus DNA modified-HMNCs (DNA-HMNCs) were obtained. The size distributions of these nanostructures were measured by a Malvern size analyzer, and their morphology was observed via transmission electron microscopy (TEM). The ultraviolet (UV)-visible (vis) absorption spectra of the samples were recorded with a UV-2600 spectrophotometer. Fluorescence spectra and the MEF effect were recorded using a spectrophotofluorometer, and lifetimes were determined using a time-correlated single photon counting apparatus. The prepared HMNCs were stable in aqueous solutions and had an average diameter of 87 +/- 3.2 nm, with six to eight AuNPs around a single Fe3O4 nanoparticle. Fluorescein isothiocyanate (FITC) tagged DNA-HMNC conjugates exhibited a significant MEF effect and could accurately detect specific DNA sequences after DNA hybridization. This result indicates their various potential applications in sensors and biomedical fields.To improve the metal-enhanced fluorescence (MEF) effect of nanogolds (AuNPs) and accurately detect specific DNA sequences via DNA hybridization, novel hybrid magnetic nanoparticles/nanogold clusters (HMNCs) were designed based on finite-difference time-domain simulation results and prepared by using Fe3O4 and nanogolds. The nanogolds outside the HMNC were then conjugated with thiol-terminated DNA molecules, thus DNA modified-HMNCs (DNA-HMNCs) were obtained. The size distributions of these nanostructures were measured by a Malvern size analyzer, and their morphology was observed via transmission electron microscopy (TEM). The ultraviolet (UV

  14. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.

    PubMed

    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena

    2012-06-01

    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. PMID:22556029

  15. Ribosomal DNA clusters and telomeric (TTAGG)n repeats in blue butterflies (Lepidoptera, Lycaenidae) with low and high chromosome numbers

    PubMed Central

    Vershinina, Alisa O.; Anokhin, Boris A.; Lukhtanov, Vladimir A.

    2015-01-01

    Abstract Ribosomal DNA clusters and telomeric repeats are important parts of eukaryotic genome. However, little is known about their organization and localization in karyotypes of organisms with holocentric chromosomes. Here we present first cytogenetic study of these molecular structures in seven blue butterflies of the genus Polyommatus Latreille, 1804 with low and high chromosome numbers (from n=10 to n=ca.108) using fluorescence in situ hybridization (FISH) with 18S rDNA and (TTAGG)n telomeric probes. FISH with the 18S rDNA probe showed the presence of two different variants of the location of major rDNA clusters in Polyommatus species: with one or two rDNA-carrying chromosomes in haploid karyotype. We discuss evolutionary trends and possible mechanisms of changes in the number of ribosomal clusters. We also demonstrate that Polyommatus species have the classical insect (TTAGG)n telomere organization. This chromosome end protection mechanism probably originated de novo in small chromosomes that evolved via fragmentations. PMID:26140159

  16. Sputtered metal and silicon cluster ions: collision-induced fragmentation and neutralization

    NASA Astrophysics Data System (ADS)

    Begemann, W.; Hector, R.; Liu, Y. Y.; Tiggesbäumker, J.; Meiwes-Broer, K. H.; Lutz, H. O.

    1989-03-01

    Mass separated metal and silicon cluster ion beams M{/n +, -} are produced by sputtering and undergo fragmenting and/or neutralizing collisions at different kinetic energies (100 1800 eV) in Ar and SF6. Fragment patterns induced by rare gas collisions open a way to determine ionization potentials and electron affinities of clusters. These values are compared to known experimental and theoretical data. For negatively charged clusters the absorption in gas targets is mainly due to neutralization, the cross sections varying with cluster material, number of atoms and collision partner from 10 Å2 to about 50 Å2.

  17. Genomic DNA breakpoints in AML1/RUNX1 and ETO cluster with topoisomerase II DNA cleavage and DNase I hypersensitive sites in t(8;21) leukemia

    PubMed Central

    Zhang, Yanming; Strissel, Pamela; Strick, Reiner; Chen, Jianjun; Nucifora, Giuseppina; Le Beau, Michelle M.; Larson, Richard A.; Rowley, Janet D.

    2002-01-01

    The translocation t(8;21)(q22;q22) is one of the most frequent chromosome translocations in acute myeloid leukemia (AML). AML1/RUNX1 at 21q22 is involved in t(8;21), t(3;21), and t(16;21) in de novo and therapy-related AML and myelodysplastic syndrome as well as in t(12;21) in childhood B cell acute lymphoblastic leukemia. Although DNA breakpoints in AML1 and ETO (at 8q22) cluster in a few introns, the mechanisms of DNA recombination resulting in t(8;21) are unknown. The correlation of specific chromatin structural elements, i.e., topoisomerase II (topo II) DNA cleavage sites, DNase I hypersensitive sites, and scaffold-associated regions, which have been implicated in chromosome recombination with genomic DNA breakpoints in AML1 and ETO in t(8;21) is unknown. The breakpoints in AML1 and ETO were clustered in the Kasumi 1 cell line and in 31 leukemia patients with t(8;21); all except one had de novo AML. Sequencing of the breakpoint junctions revealed no common DNA motif; however, deletions, duplications, microhomologies, and nontemplate DNA were found. Ten in vivo topo II DNA cleavage sites were mapped in AML1, including three in intron 5 and seven in intron 7a, and two were in intron 1b of ETO. All strong topo II sites colocalized with DNase I hypersensitive sites and thus represent open chromatin regions. These sites correlated with genomic DNA breakpoints in both AML1 and ETO, thus implicating them in the de novo 8;21 translocation. PMID:11867721

  18. DNA methylation dynamics in human induced pluripotent stem cells.

    PubMed

    Nishino, Koichiro; Umezawa, Akihiro

    2016-07-01

    Indeed human induced pluripotent stem cells (hiPSCs) are considered to be powerful tools in regenerative medicine. To enable the use of hiPSCs in the field of regenerative medicine, it is necessary to understand the mechanisms of reprogramming during the transformation of somatic cells into hiPSCs. Genome-wide epigenetic modification constitutes a critical event in the generation of iPSCs. In other words, to analyze epigenetic changes in iPSCs means to elucidate reprogramming processes. We have established a large number of hiPSCs derived from various human tissues and have obtained their DNA methylation profiles. Comparison analyses indicated that the epigenetic patterns of various hiPSCs, irrespective of their source tissue, were very similar to one another and were similar to those of human embryonic stem cells (hESCs). However, the profiles of hiPSCs and hESCs exhibited epigenetic differences, which were caused by random aberrant hypermethylation at early passages. Interestingly, continuous passaging of the hiPSCs diminished the differences between DNA methylation profiles of hiPSCs and hESCs. The number of aberrant DNA methylation regions may thus represent a useful epigenetic index for evaluating hiPSCs in the context of therapeutic applications. PMID:27083573

  19. Novel kinetic trapping in charged colloidal clusters due to self-induced surface charge organization

    PubMed Central

    Klix, Christian L.; Murata, Ken-ichiro; Tanaka, Hajime; Williams, Stephen R.; Malins, Alex; Royall, C. Patrick

    2013-01-01

    Colloidal clusters are an unusual state of matter where tunable interactions enable a sufficient reduction in their degrees of freedom that their energy landscapes can become tractable — they form a playground for statistical mechanics and promise unprecedented control of structure on the submicron lengthscale. We study colloidal clusters in a system where a short-ranged polymer-induced attraction drives clustering, while a weak, long-ranged electrostatic repulsion prevents extensive aggregation. We compare experimental yields of cluster structures with theory which assumes simple addition of competing isotropic interactions between the colloids. Here we show that for clusters of size 4 ≤ m ≤ 7, the yield of minimum energy clusters is much less than expected. We attribute this to an anisotropic self-organized surface charge distribution which leads to unexpected kinetic trapping. We introduce a model for the coupling between counterions and binding sites on the colloid surface with which we interpret our findings. PMID:23797807

  20. A kinetic analysis of strand breaks on large DNA induced by cigarette smoke extract

    NASA Astrophysics Data System (ADS)

    Kurita, Hirofumi; Takata, Tatsuya; Yasuda, Hachiro; Takashima, Kazunori; Mizuno, Akira

    2010-06-01

    We report a kinetic analysis of strand breakages on large DNA molecules induced by cigarette smoke extract (CSE), an extract of soluble cigarette smoke components. Previously, this DNA damage was analyzed by agarose gel electrophoresis, whereas we used fluorescence to kinetically analyze damage to individual DNA molecules. CSE caused a marked change in length of DNA molecules. The rate of CSE-induced double-strand breakage on large random-coiled DNA molecules was determined using a simple theoretical model, allowing the facile estimation of the rate of double-strand breaks on large DNA molecules.

  1. Delay-induced cluster patterns in coupled Cayley tree networks

    NASA Astrophysics Data System (ADS)

    Singh, A.; Jalan, S.

    2013-07-01

    We study effects of delay in diffusively coupled logistic maps on the Cayley tree networks. We find that smaller coupling values exhibit sensitiveness to value of delay, and lead to different cluster patterns of self-organized and driven types. Whereas larger coupling strengths exhibit robustness against change in delay values, and lead to stable driven clusters comprising nodes from last generation of the Cayley tree. Furthermore, introduction of delay exhibits suppression as well as enhancement of synchronization depending upon coupling strength values. To the end we discuss the importance of results to understand conflicts and cooperations observed in family business.

  2. Langevin Dynamics Simulation of DNA Condensation Induced by Nanoparticles in Confinement

    NASA Astrophysics Data System (ADS)

    Liao, Guo-Jun; Chen, Yeng-Long

    2013-03-01

    We study nanoparticle-induced DNA condensation in a confined suspension of dilute DNA molecules and ideal nanoparticles (NPs) with Langevin dynamics simulation. DNA condensation has been observed in a solution of dilute DNA molecules (persistence length P ~ 50 nm) and high concentration of electrostatically neutral NPs (diameter d ~ 5 to 35 nm) in recent experimental measurements. It is believed that NPs entropically induce an attraction between DNA segments. For NPs much smaller than P, a DNA molecule can be considered as a chain of connected rods, and the NP-induced depletion attraction between DNA segments can be regarded as rod-rod attraction. Thus, the strength of the depletion attraction is proportional to the number of persistence length in a DNA chain, N = L / P , the depletion volume NP2 d , and the NP density ρ, where L is the DNA contour length. In slit confinement, DNA conformation changes are much different from in an unconfined environment. The height of the slit relative to the NPs size (H / d) strongly influences the DNA conformation. For H / d ~ 1 , DNA size decreases monotonically as ρ increases, while non-monotonic dependence happens for H / d ~ 5 , due to the competition between DNA-DNA, DNA-NP, and NP-wall interactions.

  3. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation

    PubMed Central

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang

    2016-01-01

    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92–1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  4. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation.

    PubMed

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang

    2016-01-01

    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92-1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  5. Study on Cluster Analysis Used with Laser-Induced Breakdown Spectroscopy

    NASA Astrophysics Data System (ADS)

    He, Li'ao; Wang, Qianqian; Zhao, Yu; Liu, Li; Peng, Zhong

    2016-06-01

    Supervised learning methods (eg. PLS-DA, SVM, etc.) have been widely used with laser-induced breakdown spectroscopy (LIBS) to classify materials; however, it may induce a low correct classification rate if a test sample type is not included in the training dataset. Unsupervised cluster analysis methods (hierarchical clustering analysis, K-means clustering analysis, and iterative self-organizing data analysis technique) are investigated in plastics classification based on the line intensities of LIBS emission in this paper. The results of hierarchical clustering analysis using four different similarity measuring methods (single linkage, complete linkage, unweighted pair-group average, and weighted pair-group average) are compared. In K-means clustering analysis, four kinds of choosing initial centers methods are applied in our case and their results are compared. The classification results of hierarchical clustering analysis, K-means clustering analysis, and ISODATA are analyzed. The experiment results demonstrated cluster analysis methods can be applied to plastics discrimination with LIBS. supported by Beijing Natural Science Foundation of China (No. 4132063)

  6. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes

    PubMed Central

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W.; Agarwal, Rajesh

    2014-01-01

    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury. PMID:24732344

  7. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.

    PubMed

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh

    2014-01-01

    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury. PMID:24732344

  8. A Zn(II)2Cys6 DNA binding protein regulates the sirodesmin PL biosynthetic gene cluster in Leptosphaeria maculans

    PubMed Central

    Fox, Ellen M.; Gardiner, Donald M.; Keller, Nancy P.; Howlett, Barbara J.

    2008-01-01

    A gene, sirZ, encoding a Zn(II)2Cys6 DNA binding protein is present in a cluster of genes responsible for the biosynthesis of the epipolythiodioxopiperazine (ETP) toxin, sirodesmin PL in the ascomycete plant pathogen, Leptosphaeria maculans. RNA-mediated silencing of sirZ gives rise to transformants that produce only residual amounts of sirodesmin PL and display a decrease in the transcription of several sirodesmin PL biosynthetic genes. This indicates that SirZ is a major regulator of this gene cluster. Proteins similar to SirZ are encoded in the gliotoxin biosynthetic gene cluster of Aspergillus fumigatus (gliZ) and in an ETP-like cluster in Penicillium lilacinoechinulatum (PlgliZ). Despite its high level of sequence similarity to gliZ, PlgliZ is unable to complement the gliotoxin-deficiency of a mutant of gliZ in A. fumigatus. Putative binding sites for these regulatory proteins in the promoters of genes in these clusters were predicted using bioinformatic analysis. These sites are similar to those commonly bound by other proteins with Zn(II)2Cys6 DNA binding domains. PMID:18023597

  9. ThioFinder: A Web-Based Tool for the Identification of Thiopeptide Gene Clusters in DNA Sequences

    PubMed Central

    He, Xinyi; Duan, Lian; Wu, Guojun; Bi, Dexi; Deng, Zixin; Liu, Wen; Ou, Hong-Yu

    2012-01-01

    Thiopeptides are a growing class of sulfur-rich, highly modified heterocyclic peptides that are mainly active against Gram-positive bacteria including various drug-resistant pathogens. Recent studies also reveal that many thiopeptides inhibit the proliferation of human cancer cells, further expanding their application potentials for clinical use. Thiopeptide biosynthesis shares a common paradigm, featuring a ribosomally synthesized precursor peptide and conserved posttranslational modifications, to afford a characteristic core system, but differs in tailoring to furnish individual members. Identification of new thiopeptide gene clusters, by taking advantage of increasing information of DNA sequences from bacteria, may facilitate new thiopeptide discovery and enrichment of the unique biosynthetic elements to produce novel drug leads by applying the principle of combinatorial biosynthesis. In this study, we have developed a web-based tool ThioFinder to rapidly identify thiopeptide biosynthetic gene cluster from DNA sequence using a profile Hidden Markov Model approach. Fifty-four new putative thiopeptide biosynthetic gene clusters were found in the sequenced bacterial genomes of previously unknown producing microorganisms. ThioFinder is fully supported by an open-access database ThioBase, which contains the sufficient information of the 99 known thiopeptides regarding the chemical structure, biological activity, producing organism, and biosynthetic gene (cluster) along with the associated genome if available. The ThioFinder website offers researchers a unique resource and great flexibility for sequence analysis of thiopeptide biosynthetic gene clusters. ThioFinder is freely available at http://db-mml.sjtu.edu.cn/ThioFinder/. PMID:23029291

  10. Clustering of Caucasian Leber hereditary optic neuropathy patients containing the 11778 or 14484 mutations on an mtDNA lineage

    SciTech Connect

    Brown, M.D.; Sun, F.; Wallace, D.C.

    1997-02-01

    Leber hereditary optic neuropathy (LHON) is a type of blindness caused by mtDNA mutations. Three LHON mtDNA mutations at nucleotide positions 3460, 11778, and 14484 are specific for LHON and account for 90% of worldwide cases and are thus designated as {open_quotes}primary{close_quotes} LHON mutations. Fifteen other {open_quotes}secondary{close_quotes} LHON mtDNA mutations have been identified, but their pathogenicity is unclear. mtDNA haplotype and phylogenetic analysis of the primary LHON mutations in North American Caucasian patients and controls has shown that, unlike the 3460 and 11778 mutations, which are distributed throughout the European-derived (Caucasian) mtDNA phylogeny, patients containing the 14484 mutation tended to be associated with European mtDNA haplotype J. To investigate this apparent clustering, we performed {chi}{sup 2}-based statistical analyses to compare the distribution of LHON patients on the Caucasian phylogenetic tree. Our results indicate that, unlike the 3460 and 11778 mutations, the 14484 mutation was not distributed on the phylogeny in proportion to the frequencies of the major Caucasian mtDNA haplogroups found in North America. The 14484 mutation was next shown to occur on the haplogroup J background more frequently that expected, consistent with the observation that {approximately}75% of worldwide 14484-positive LHON patients occur in association with haplogroup J. The 11778 mutation also exhibited a moderate clustering on haplogroup J. These observations were supported by statistical analysis using all available mutation frequencies reported in the literature. This paper thus illustrates the potential importance of genetic background in certain mtDNA-based diseases, speculates on a pathogenic role for a subset of LHON secondary mutations and their interaction with primary mutations, and provides support for a polygenic model for LHON expression in some cases. 18 refs., 3 tabs.

  11. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    NASA Astrophysics Data System (ADS)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  12. DNA fragment sizing and sorting by laser-induced fluorescence

    DOEpatents

    Hammond, Mark L.; Jett, James H.; Keller, Richard A.; Marrone, Babetta L.; Martin, John C.

    1996-01-01

    A method is provided for sizing DNA fragments using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA piece or the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is linearly related to the fragment length. The distribution of DNA fragment sizes forms a characterization of the DNA piece for use in forensic and research applications.

  13. Pili-Induced Clustering of N. gonorrhoeae Bacteria.

    PubMed

    Taktikos, Johannes; Lin, Yen Ting; Stark, Holger; Biais, Nicolas; Zaburdaev, Vasily

    2015-01-01

    Type IV pili (Tfp) are prokaryotic retractable appendages known to mediate surface attachment, motility, and subsequent clustering of cells. Tfp are the main means of motility for Neisseria gonorrhoeae, the causative agent of gonorrhea. Tfp are also involved in formation of the microcolonies, which play a crucial role in the progression of the disease. While motility of individual cells is relatively well understood, little is known about the dynamics of N. gonorrhoeae aggregation. We investigate how individual N. gonorrhoeae cells, initially uniformly dispersed on flat plastic or glass surfaces, agglomerate into spherical microcolonies within hours. We quantify the clustering process by measuring the area fraction covered by the cells, number of cell aggregates, and their average size as a function of time. We observe that the microcolonies are also able to move but their mobility rapidly vanishes as the size of the colony increases. After a certain critical size they become immobile. We propose a simple theoretical model which assumes a pili-pili interaction of cells as the main clustering mechanism. Numerical simulations of the model quantitatively reproduce the experimental data on clustering and thus suggest that the agglomeration process can be entirely explained by the Tfp-mediated interactions. In agreement with this hypothesis mutants lacking pili are not able to form colonies. Moreover, cells with deficient quorum sensing mechanism show similar aggregation as the wild-type bacteria. Therefore, our results demonstrate that pili provide an essential mechanism for colony formation, while additional chemical cues, for example quorum sensing, might be of secondary importance. PMID:26355966

  14. Pili-Induced Clustering of N. gonorrhoeae Bacteria

    PubMed Central

    Taktikos, Johannes; Lin, Yen Ting; Stark, Holger; Biais, Nicolas; Zaburdaev, Vasily

    2015-01-01

    Type IV pili (Tfp) are prokaryotic retractable appendages known to mediate surface attachment, motility, and subsequent clustering of cells. Tfp are the main means of motility for Neisseria gonorrhoeae, the causative agent of gonorrhea. Tfp are also involved in formation of the microcolonies, which play a crucial role in the progression of the disease. While motility of individual cells is relatively well understood, little is known about the dynamics of N. gonorrhoeae aggregation. We investigate how individual N. gonorrhoeae cells, initially uniformly dispersed on flat plastic or glass surfaces, agglomerate into spherical microcolonies within hours. We quantify the clustering process by measuring the area fraction covered by the cells, number of cell aggregates, and their average size as a function of time. We observe that the microcolonies are also able to move but their mobility rapidly vanishes as the size of the colony increases. After a certain critical size they become immobile. We propose a simple theoretical model which assumes a pili-pili interaction of cells as the main clustering mechanism. Numerical simulations of the model quantitatively reproduce the experimental data on clustering and thus suggest that the agglomeration process can be entirely explained by the Tfp-mediated interactions. In agreement with this hypothesis mutants lacking pili are not able to form colonies. Moreover, cells with deficient quorum sensing mechanism show similar aggregation as the wild-type bacteria. Therefore, our results demonstrate that pili provide an essential mechanism for colony formation, while additional chemical cues, for example quorum sensing, might be of secondary importance. PMID:26355966

  15. Polymer- and salt-induced toroids of hexagonal DNA.

    PubMed Central

    Ubbink, J; Odijk, T

    1995-01-01

    A model is proposed for polymer- and salt-induced toroidal condensates of DNA, based on a recent theory of the undulation enhancement of the electrostatic interaction in the bulk hexagonal phase of semiflexible polyions. In a continuum approximation, the thermodynamic potential of a monomolecular toroid may be split up in bulk, surface, and curvature contributions. With the help of an approximate analytical minimization procedure, the optimal torus dimensions are calculated as a function of the concentrations of inert polymer and added salt. The stability of the torus is analyzed in terms of its surface tension and a bulk melting criterion. The theory should be applicable to psi-toroids that are not too thick. PMID:7711268

  16. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  17. DNA damage sensor MRE11 recognizes cytosolic double-stranded DNA and induces type I interferon by regulating STING trafficking

    PubMed Central

    Kondo, Takeshi; Kobayashi, Junya; Saitoh, Tatsuya; Maruyama, Kenta; Ishii, Ken J.; Barber, Glen N.; Komatsu, Kenshi; Akira, Shizuo; Kawai, Taro

    2013-01-01

    Double-stranded DNA (dsDNA) derived from pathogen- or host-damaged cells triggers innate immune responses when exposed to cytoplasm. However, the machinery underlying the primary recognition of intracellular dsDNA is obscure. Here we show that the DNA damage sensor, meiotic recombination 11 homolog A (MRE11), serves as a cytosolic sensor for dsDNA. Cells with a mutation of MRE11 gene derived from a patient with ataxia-telangiectasia–like disorder, and cells in which Mre11 was knocked down, had defects in dsDNA-induced type I IFN production. MRE11 physically interacted with dsDNA in the cytoplasm and was required for activation of stimulator of IFN genes (STING) and IRF3. RAD50, a binding protein to MRE11, was also required for dsDNA responses, whereas NBS1, another binding protein to MRE11, was dispensable. Collectively, our results suggest that the MRE11–RAD50 complex plays important roles in recognition of dsDNA and initiation of STING-dependent signaling, in addition to its role in DNA-damage responses. PMID:23388631

  18. Construction of DNA logic gates utilizing a H+/Ag+ induced i-motif structure.

    PubMed

    Shi, Yunhua; Sun, Hongxia; Xiang, Junfeng; Chen, Hongbo; Yang, Qianfan; Guan, Aijiao; Li, Qian; Yu, Lijia; Tang, Yalin

    2014-12-18

    A simple technology to construct diverse DNA logic gates (OR and INHIBIT) has been designed utilizing a H(+) and/or Ag(+) induced i-motif structure. The logic gates are easily controlled and also show a real time response towards inputs. The research provides a new insight for designing DNA logic gates using an i-motif DNA structure. PMID:25349963

  19. Inducing Transient Charge State of a Single Water Cluster on Cu(111) Surface.

    PubMed

    Guo, Yang; Ding, Zijing; Sun, Lihuan; Li, Jianmei; Meng, Sheng; Lu, Xinghua

    2016-04-26

    The hydrated electron on solid surface is a crucial species to interfacial chemistry. We present a joint low-temperature scanning tunneling microscopy and density functional theory investigation to explore the existence of a transient hydrated electron state induced by injecting tunneling electrons into a single water nonamer cluster on Cu(111) surface. The directional diffusion of water cluster under the Coulomb repulsive potential has been observed as evidence for the emergence of the transient hydrated electron. A critical structure transformation in water cluster for the emergence of hydrated electron has been identified. A charging mechanism has been proposed based on density functional theory calculation and scanning tunneling microscope results. PMID:27007702

  20. Analysis of radiation-induced small Cu particle cluster formation in aqueous CuCl2

    USGS Publications Warehouse

    Jayanetti, Sumedha; Mayanovic, Robert A.; Anderson, Alan J.; Bassett, William A.; Chou, I.-Ming

    2001-01-01

    Radition-induced small Cu particle cluster formation in aqueous CuCl2 was analyzed. It was noticed that nearest neighbor distance increased with the increase in the time of irradiation. This showed that the clusters approached the lattice dimension of bulk copper. As the average cluster size approached its bulk dimensions, an increase in the nearest neighbor coordination number was found with the decrease in the surface to volume ratio. Radiolysis of water by incident x-ray beam led to the reduction of copper ions in the solution to themetallic state.

  1. Mitochondrial DNA plasticity is an essential inducer of tumorigenesis

    PubMed Central

    Lee, W T Y; Cain, J E; Cuddihy, A; Johnson, J; Dickinson, A; Yeung, K-Y; Kumar, B; Johns, T G; Watkins, D N; Spencer, A; St John, J C

    2016-01-01

    Although mitochondrial DNA has been implicated in diseases such as cancer, its role remains to be defined. Using three models of tumorigenesis, namely glioblastoma multiforme, multiple myeloma and osteosarcoma, we show that mitochondrial DNA plays defining roles at early and late tumour progression. Specifically, tumour cells partially or completely depleted of mitochondrial DNA either restored their mitochondrial DNA content or actively recruited mitochondrial DNA, which affected the rate of tumorigenesis. Nevertheless, non-depleted tumour cells modulated mitochondrial DNA copy number at early and late progression in a mitochondrial DNA genotype-specific manner. In glioblastoma multiforme and osteosarcoma, this was coupled with loss and gain of mitochondrial DNA variants. Changes in mitochondrial DNA genotype affected tumour morphology and gene expression patterns at early and late progression. Importantly, this identified a subset of genes that are essential to early progression. Consequently, mitochondrial DNA and commonly expressed early tumour-specific genes provide novel targets against tumorigenesis. PMID:27551510

  2. Mitochondrial DNA plasticity is an essential inducer of tumorigenesis.

    PubMed

    Lee, W T Y; Cain, J E; Cuddihy, A; Johnson, J; Dickinson, A; Yeung, K-Y; Kumar, B; Johns, T G; Watkins, D N; Spencer, A; St John, J C

    2016-01-01

    Although mitochondrial DNA has been implicated in diseases such as cancer, its role remains to be defined. Using three models of tumorigenesis, namely glioblastoma multiforme, multiple myeloma and osteosarcoma, we show that mitochondrial DNA plays defining roles at early and late tumour progression. Specifically, tumour cells partially or completely depleted of mitochondrial DNA either restored their mitochondrial DNA content or actively recruited mitochondrial DNA, which affected the rate of tumorigenesis. Nevertheless, non-depleted tumour cells modulated mitochondrial DNA copy number at early and late progression in a mitochondrial DNA genotype-specific manner. In glioblastoma multiforme and osteosarcoma, this was coupled with loss and gain of mitochondrial DNA variants. Changes in mitochondrial DNA genotype affected tumour morphology and gene expression patterns at early and late progression. Importantly, this identified a subset of genes that are essential to early progression. Consequently, mitochondrial DNA and commonly expressed early tumour-specific genes provide novel targets against tumorigenesis. PMID:27551510

  3. DNA Self-Assembling Nanostructures Induced by Trivalent Ions and Polycations

    NASA Astrophysics Data System (ADS)

    Kasyanenko, Nina; Afanasieva, Daria

    The purpose of this work is to compare DNA condensation induced by small multivalent ions and polycations. DNA complexes with trivalent ions Fe3+, La3+, [Co(NH3)6]3+, spermidine and cationic polymers in a solution were investigated. The influence of cations on the volume, persistent length, and secondary structure of DNA was studied. A comparison of DNA packaging induced by trivalent ions and polycations was made. DNA complexes with trivalent metal ions and polycations were characterized by means of low gradient viscometry, dynamic light scattering, circular dichroism, UV spectrometry, flow birefringence, and atomic force microscopy.

  4. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    SciTech Connect

    Yoshimura, Akari; Kobayashi, Yume; Tada, Shusuke; Seki, Masayuki; Enomoto, Takemi

    2014-09-12

    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  5. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.

    PubMed

    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong

    2016-09-01

    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  6. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.

    1984-01-01

    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  7. Formation of globular clusters induced by external ultraviolet radiation

    NASA Astrophysics Data System (ADS)

    Hasegawa, Kenji; Umemura, Masayuki; Kitayama, Tetsu

    2009-08-01

    We present a novel scenario for globular cluster (GC) formation, where the ultraviolet (UV) background radiation effectively works so as to produce compact star clusters. Recent observations on the age distributions of GCs indicate that many GCs formed even after the cosmic reionization epoch. This implies that a significant fraction of GCs formed in UV background radiation fields. Also, the star formation in an early-generation of subgalactic objects may be affected by strong UV radiation from pre-formed massive stars, e.g. Population III stars. Here, we explore the formation of GCs in UV radiation fields. For this purpose, we calculate baryon and dark matter (DM) dynamics in spherical symmetry, incorporating the self-shielding effects by solving the radiative transfer of UV radiation. In addition, we prescribe the star formation in cooled gas components and pursue the dynamics of formed stars. As a result, we find that the evolution of subgalactic objects in UV background radiation is separated into three types: (i) prompt star formation, where less massive clouds (~105-8Msolar) are promptly self-shielded and undergo star formation, (ii) delayed star formation, where photoionized massive clouds (>~108Msolar) collapse despite high thermal pressure and are eventually self-shielded to form stars in a delayed fashion, and (iii) supersonic infall, where photoionized less massive clouds (~105-8Msolar) contract with supersonic infall velocity and are self-shielded when a compact core forms. In particular, the type (iii) is a novel type found in the present simulations, and eventually produces a very compact star cluster. The resultant mass-to-light ratios, half-mass radii and velocity dispersions for the three types are compared to the observations of GCs, dwarf spheroidals (dSphs) and ultracompact dwarfs (UCDs). It turns out that the properties of star clusters resulting from supersonic infall match well with those of observed GCs, whereas the other two types are

  8. Irradiation-induced defect clustering and amorphization in silicon carbide

    SciTech Connect

    Weber, William J.; Gao, Fei

    2010-12-01

    Previous computer simulations of multiple 10 keV Si cascades in 3C-SiC demonstrated that many damage-state properties exhibit relatively smooth, but noticeably different, dose dependencies. Recent analysis of these archived damage-state properties reveals more complex relationships between system energy, swelling, energy per defect, relative disorder, elastic modulus and elastic constant, C11. These relationships provide evidence for the onset of defect clustering and amorphization processes, both of which appear to be driven by local energy and elastic instabilities from the accumulation of defects. The results provide guidance on experimental approaches to reveal the onset of these processes.

  9. Radiation-induced mobility of small defect clusters in covalent materials

    NASA Astrophysics Data System (ADS)

    Jiang, Hao; He, Li; Morgan, Dane; Voyles, Paul M.; Szlufarska, Izabela

    2016-07-01

    Although defect clusters are detrimental to the electronic and mechanical properties of semiconductor materials, annihilation of such clusters is limited by their lack of thermal mobility due to high migration barriers. Here, we find that small clusters in bulk SiC (a covalent material of importance for both electronic and nuclear applications) can become mobile at room temperature under the influence of electron radiation. So far, direct observation of radiation-induced diffusion of defect clusters in bulk materials has not yet been demonstrated. This finding was made possible by low-angle annular dark-field scanning transmission electron microscopy combined with a nonrigid registration technique to remove sample instability, which enables atomic resolution imaging of small migrating defect clusters. We show that the underlying mechanism of this athermal diffusion is a ballistic collision between incoming electrons and cluster atoms. Our findings suggest that defect clusters may be mobile under certain irradiation conditions, changing the current understanding of the cluster annealing process in irradiated covalent materials.

  10. Human cytomegalovirus induces JC virus DNA replication in human fibroblasts.

    PubMed Central

    Heilbronn, R; Albrecht, I; Stephan, S; Bürkle, A; zur Hausen, H

    1993-01-01

    JC virus, a human papovavirus, is the causative agent of the demyelinating brain disease progressive multifocal leucoencephalopathy (PML). PML is a rare but fatal disease which develops as a complication of severe immunosuppression. Latent JC virus is harbored by many asymptomatic carriers and is transiently reactivated from the latent state upon immunosuppression. JC virus has a very restricted host range, with human glial cells being the only tissue in which it can replicate at reasonable efficiency. Evidence that latent human cytomegalovirus is harbored in the kidney similar to latent JC virus led to the speculation that during episodes of impaired immunocompetence, cytomegalovirus might serve as helper virus for JC virus replication in otherwise nonpermissive cells. We show here that cytomegalovirus infection indeed leads to considerable JC virus DNA replication in cultured human fibroblasts that are nonpermissive for the replication of JC virus alone. Cytomegalovirus-mediated JC virus replication is dependent on the JC virus origin of replication and T antigen. Ganciclovir-induced inhibition of cytomegalovirus replication is associated with a concomitant inhibition of JC virus replication. These results suggest that reactivation of cytomegalovirus during episodes of immunosuppression might lead to activation of latent JC virus, which would enhance the probability of subsequent PML development. Ganciclovir-induced repression of both cytomegalovirus and JC virus replication may form the rational basis for the development of an approach toward treatment or prevention of PML. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8248262

  11. Recycling of Acetylcholine Receptors at Ectopic Postsynaptic Clusters Induced by Exogenous Agrin in Living Rats

    PubMed Central

    Brenner, Hans Rudolf; Akaaboune, Mohammed

    2014-01-01

    During the development of the neuromuscular junction, motor axons induce the clustering of acetylcholine receptors (AChRs) and increase their metabolic stability in the muscle membrane. Here, we asked whether the synaptic organizer agrin might regulate the metabolic stability and density of AChRs by promoting the recycling of internalized AChRs, which would otherwise be destined for degradation, into synaptic sites. We show that at nerve-free AChR clusters induced by agrin in extrasynaptic membrane, internalized AChRs are driven back into the ectopic synaptic clusters where they intermingle with pre-existing and new receptors. The extent of AChR recycling depended on the strength of the agrin stimulus, but not on the development of junctional folds, another hallmark of mature postsynaptic membranes. In chronically denervated muscles, in which both AChR stability and recycling are significantly decreased by muscle inactivity, agrin maintained the amount of recycled AChRs at agrin-induced clusters at a level similar to that at denervated original endplates. In contrast, AChRs did not recycle at agrin-induced clusters in C2C12 or primary myotubes. Thus, in muscles in vivo, but not in cultured myotubes, neural agrin promotes the recycling of AChRs and thereby increases their metabolic stability. PMID:25093969

  12. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  13. Oxidative DNA damage induced by a metabolite of 2-naphthylamine, a smoking-related bladder carcinogen.

    PubMed

    Ohnishi, Shiho; Murata, Mariko; Kawanishi, Shosuke

    2002-07-01

    2-Naphthylamine (2-NA), a bladder carcinogen, is contained in cigarette smoke. DNA adduct formation is thought to be a major cause of DNA damage by carcinogenic aromatic amines. We have investigated whether a metabolite of 2-NA, 2-nitroso-1-naphthol (NO-naphthol) causes oxidative DNA damage, using (32)P-labeled DNA fragments. We compared the mechanism of DNA damage induced by NO-naphthol with that by N-hydroxy-4-aminobiphenyl (4-ABP(NHOH)), a metabolite of 4-aminobiphenyl, another smoking-related bladder carcinogen. NO-naphthol caused Cu(II)-mediated DNA damage at T > C > G residues, with non-enzymatic reduction by NADH. Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited the DNA damage, suggesting the involvement of H(2)O(2) and Cu(I). Some free. OH scavengers also attenuated NO-naphthol-induced DNA damage, while free. OH scavengers had no effect on the DNA damage induced by 4-ABP(NHOH). This difference suggests that the reactive species formed by NO-naphthol has more free. OH-character than that by 4-ABP(NHOH). A high-pressure liquid chromatograph equipped with an electrochemical detector showed that NO-naphthol induced 8-oxo-7,8-dihydro-2'-deoxyguanosine formation in the presence of NADH and Cu(II). The oxidative DNA damage by these amino-aromatic compounds may participate in smoking-related bladder cancer, in addition to DNA adduct formation. PMID:12149138

  14. Mechanism of Cluster DNA Damage Repair in Response to High-Atomic Number and Energy Particles Radiation

    PubMed Central

    Asaithamby, Aroumougame; Chen, David J.

    2012-01-01

    Low-linear energy transfer (LET) radiation (i.e., γ- and X-rays) induces DNA double-strand breaks (DSBs) that are rapidly repaired (rejoined). In contrast, DNA damage induced by the dense ionizing track of high-atomic number and energy (HZE) particles are slowly repaired or are irreparable. These unrepaired and/or misrepaired DNA lesions may contribute to the observed higher relative biological effectiveness for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in HZE particle irradiated cells compared to those treated with low-LET radiation. The types of DNA lesions induced by HZE particles have been characterized in vitro and usually consist of two or more closely spaced strand breaks, abasic sites, or oxidized bases on opposing strands. It is unclear why these lesions are difficult to repair. In this review, we highlight the potential of a new technology allowing direct visualization of different types of DNA lesions in human cells and document the emerging significance of live-cell imaging for elucidation of the spatio-temporal characterization of complex DNA damage. We focus on the recent insights into the molecular pathways that participate in the repair of HZE particle-induced DSBs. We also discuss recent advances in our understanding of how different end-processing nucleases aid in repair of DSBs with complicated ends generated by HZE particles. Understanding the mechanism underlying the repair of DNA damage induced by HZE particles will have important implications for estimating the risks to human health associated with HZE particle exposure. PMID:21126526

  15. MET18 Connects the Cytosolic Iron-Sulfur Cluster Assembly Pathway to Active DNA Demethylation in Arabidopsis

    PubMed Central

    Tang, Kai; Zhang, Huiming; Mangrauthia, Satendra K.; Lei, Mingguang; Hsu, Chuan-Chih; Hou, Yueh-Ju; Wang, Chunguo; Li, Yan; Tao, W. Andy; Zhu, Jian-Kang

    2015-01-01

    DNA demethylation mediated by the DNA glycosylase ROS1 helps determine genomic DNA methylation patterns and protects active genes from being silenced. However, little is known about the mechanism of regulation of ROS1 enzymatic activity. Using a forward genetic screen, we identified an anti-silencing (ASI) factor, ASI3, the dysfunction of which causes transgene promoter hyper-methylation and silencing. Map-based cloning identified ASI3 as MET18, a component of the cytosolic iron-sulfur cluster assembly (CIA) pathway. Mutation in MET18 leads to hyper-methylation at thousands of genomic loci, the majority of which overlap with hypermethylated loci identified in ros1 and ros1dml2dml3 mutants. Affinity purification followed by mass spectrometry indicated that ROS1 physically associates with MET18 and other CIA components. Yeast two-hybrid and split luciferase assays showed that ROS1 can directly interact with MET18 and another CIA component, AE7. Site-directed mutagenesis of ROS1 indicated that the conserved iron-sulfur motif is indispensable for ROS1 enzymatic activity. Our results suggest that ROS1-mediated active DNA demethylation requires MET18-dependent transfer of the iron-sulfur cluster, highlighting an important role of the CIA pathway in epigenetic regulation. PMID:26492035

  16. MET18 Connects the Cytosolic Iron-Sulfur Cluster Assembly Pathway to Active DNA Demethylation in Arabidopsis.

    PubMed

    Duan, Cheng-Guo; Wang, Xingang; Tang, Kai; Zhang, Huiming; Mangrauthia, Satendra K; Lei, Mingguang; Hsu, Chuan-Chih; Hou, Yueh-Ju; Wang, Chunguo; Li, Yan; Tao, W Andy; Zhu, Jian-Kang

    2015-10-01

    DNA demethylation mediated by the DNA glycosylase ROS1 helps determine genomic DNA methylation patterns and protects active genes from being silenced. However, little is known about the mechanism of regulation of ROS1 enzymatic activity. Using a forward genetic screen, we identified an anti-silencing (ASI) factor, ASI3, the dysfunction of which causes transgene promoter hyper-methylation and silencing. Map-based cloning identified ASI3 as MET18, a component of the cytosolic iron-sulfur cluster assembly (CIA) pathway. Mutation in MET18 leads to hyper-methylation at thousands of genomic loci, the majority of which overlap with hypermethylated loci identified in ros1 and ros1dml2dml3 mutants. Affinity purification followed by mass spectrometry indicated that ROS1 physically associates with MET18 and other CIA components. Yeast two-hybrid and split luciferase assays showed that ROS1 can directly interact with MET18 and another CIA component, AE7. Site-directed mutagenesis of ROS1 indicated that the conserved iron-sulfur motif is indispensable for ROS1 enzymatic activity. Our results suggest that ROS1-mediated active DNA demethylation requires MET18-dependent transfer of the iron-sulfur cluster, highlighting an important role of the CIA pathway in epigenetic regulation. PMID:26492035

  17. DNA Bending is Induced in an Enhancer by the DNA-Binding Domain of the Bovine Papillomavirus E2 Protein

    NASA Astrophysics Data System (ADS)

    Moskaluk, Christopher; Bastia, Deepak

    1988-03-01

    The E2 gene of bovine papillomavirus type 1 has been shown to encode a DNA-binding protein and to trans-activate the viral enhancer. We have localized the DNA-binding domain of the E2 protein to the carboxyl-terminal 126 amino acids of the E2 open reading frame. The DNA-binding domain has been expressed in Escherichia coli and partially purified. Gel retardation and DNase I ``footprinting'' on the bovine papillomavirus type 1 enhancer identify the sequence motif ACCN6GGT (in which N = any nucleotide) as the E2 binding site. Using electrophoretic methods we have shown that the DNA-binding domain changes conformation of the enhancer by inducing significant DNA bending.

  18. The activation-induced cytidine deaminase (AID) efficiently targets DNA in nucleosomes but only during transcription

    PubMed Central

    Shen, Hong Ming; Poirier, Michael G.; Allen, Michael J.; North, Justin; Lal, Ratnesh; Widom, Jonathan

    2009-01-01

    The activation-induced cytidine deaminase (AID) initiates somatic hypermutation, class-switch recombination, and gene conversion of immunoglobulin genes. In vitro, AID has been shown to target single-stranded DNA, relaxed double-stranded DNA, when transcribed, or supercoiled DNA. To simulate the in vivo situation more closely, we have introduced two copies of a nucleosome positioning sequence, MP2, into a supercoiled AID target plasmid to determine where around the positioned nucleosomes (in the vicinity of an ampicillin resistance gene) cytidine deaminations occur in the absence or presence of transcription. We found that without transcription nucleosomes prevented cytidine deamination by AID. However, with transcription AID readily accessed DNA in nucleosomes on both DNA strands. The experiments also showed that AID targeting any DNA molecule was the limiting step, and they support the conclusion that once targeted to DNA, AID acts processively in naked DNA and DNA organized within transcribed nucleosomes. PMID:19380635

  19. Quantifying DNA and proteins using laser-induced thermophoresis

    NASA Astrophysics Data System (ADS)

    Yu, Li-Hsien; Wang, Chih-Hsuan; Chen, Yih-Fan

    2014-03-01

    The study utilized thermophoresis, the directed motion of molecules in a temperature gradient to quantify DNA and proteins for point-of-care applications. Because the direction and speed of thermophoretic motion is dependent on the size, charge, and conformation of the molecules, the binding between molecules can induce changes in their thermophoretic motion. To quantify biomolecules using thermophoresis, we mixed fluorescently-labeled capture probes with samples and then used an infrared laser to create a temperature gradient in the solution. By adding a small fraction of polymers to the buffer solution, we accumulated the fluorescent probes in a temperature gradient using the thermophoretic effects. The thermophoretic motion of the fluorescent probes significantly changed as the target molecules bind to the specially designed capture probes. Consequently, the level of the thermophoretic accumulation, which was determined by the spatial distribution of fluorescent probes, could be used to quantify molecules. This method functioned well even when the buffer contained 10% serum, which suggested that the detection was resistant to the interferences from the molecules in serum. The thermophoresis-based detection method developed in this study only requires a laser and an epi-fluorescence microscope during the detection. Unlike many other commonly seen biosensing methods, quantifying molecules using thermophoresis does not need any fluid channels or pumps for washing away unbound molecules during the detection process. In addition, the detection does not rely on any micro- or nanofabricated chips. In short, this thermophoresis-based biosensing method can be a simple, robust, and sensitive method for quantifying proteins and DNA.

  20. Irradiation-induced defect clustering and amorphization in silicon carbide

    SciTech Connect

    Weber, William J; Gao, Fei

    2010-01-01

    Previous computer simulations of multiple 10 keV Si cascades in 3C-SiC demonstrated that many damage-state properties exhibit relatively smooth, but noticeably different, dose dependencies. A more recent analysis of these damage-state properties, which includes additional data at low and intermediate doses, reveals more complex relationships between system energy, swelling, energy per defect, relative disorder, elastic modulus and elastic constant, C11. These relationships provide evidence for the onset of both defect clustering and solid-state amorphization, which appear to be driven by local energy and elastic instabilities from the accumulation of defects. The results provide guidance on experimental approaches to reveal the onset of these processes.

  1. Boron Clusters as a Platform for New Materials: Synthesis of Functionalized o-Carborane (C2 B10 H12 ) Derivatives Incorporating DNA Fragments.

    PubMed

    Janczak, Slawomir; Olejniczak, Agnieszka; Balabańska, Sandra; Chmielewski, Marcin K; Lupu, Marius; Viñas, Clara; Lesnikowski, Zbigniew J

    2015-10-19

    A synthetic strategy for functionalization of the three vertices of o-carborane and the attachment of the obtained triped to the solid support was developed. Further functionalization of the triped with short DNA sequences by automated DNA synthesis was achieved. The proposed methodology is a first example of boron cluster chemistry on a solid support opening new perspectives in boron cluster functionalization. PMID:26346614

  2. PREDICTING MERGER-INDUCED GAS MOTIONS IN ΛCDM GALAXY CLUSTERS

    SciTech Connect

    Nagai, Daisuke; Lau, Erwin T.; Avestruz, Camille; Rudd, Douglas H.; Nelson, Kaylea

    2013-11-10

    In the hierarchical structure formation model, clusters of galaxies form through a sequence of mergers and continuous mass accretion, which generate significant random gas motions especially in their outskirts where material is actively accreting. Non-thermal pressure provided by the internal gas motions affects the thermodynamic structure of the X-ray emitting intracluster plasma and introduces biases in the physical interpretation of X-ray and Sunyaev-Zeldovich effect observations. However, we know very little about the nature of gas motions in galaxy clusters. The ASTRO-H X-ray mission, scheduled to launch in 2015, will have a calorimeter capable of measuring gas motions in galaxy clusters at the level of ∼< 100 km s{sup –1}. In this work, we predict the level of merger-induced gas motions expected in the ΛCDM model using hydrodynamical simulations of galaxy cluster formation. We show that the gas velocity dispersion is larger in more massive clusters, but exhibits a large scatter. We show that systems with large gas motions are morphologically disturbed, while early forming, relaxed groups show a smaller level of gas motions. By analyzing mock ASTRO-H observations of simulated clusters, we show that such observations can accurately measure the gas velocity dispersion out to the outskirts of nearby relaxed galaxy clusters. ASTRO-H analysis of merging clusters, on the other hand, requires multi-component spectral fitting and enables unique studies of substructures in galaxy clusters by measuring both the peculiar velocities and the velocity dispersion of gas within individual sub-clusters.

  3. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    PubMed Central

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Background. Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis. PMID:26273425

  4. DNA fragment sizing and sorting by laser-induced fluorescence

    SciTech Connect

    Jett, J.H.; Hammond, M.L.; Keller, R.A.; Marrone, B.L.; Martin, J.C.

    1992-12-31

    A method is provided for obtaining DNA fingerprints using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a selected sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is directly proportional to the fragment length. Additional dyes can be bound to the DNA piece and DNA fragments to provide information additional to length information. Oligonucleotide specific dyes and/or hybridization probes can be bound to the DNA fragments to provide information on oligonucleotide distribution or probe hybridization to DNA fragments of different sizes.

  5. Noise-induced dispersion and breakup of clusters in cell cycle dynamics

    PubMed Central

    Gong, Xue; Moses, Gregory; Neiman, Alexander B.; Young, Todd

    2014-01-01

    We study the effects of random perturbations on collective dynamics of a large ensemble of interacting cells in a model of the cell division cycle. We consider a parameter region for which the unperturbed model possesses asymptotically stable two-cluster periodic solutions. Two biologically motivated forms of random perturbations are considered: bounded variations in growth rate and asymmetric division. We compare the effects of these two dispersive mechanisms with additive Gaussian white noise perturbations. We observe three distinct phases of the response to noise in the model. First, for weak noise there is a linear relationship between the applied noise strength and the dispersion of the clusters. Second, for moderate noise strengths the clusters begin to mix, i.e. individual cells move between clusters, yet the population distribution clearly continues to maintain a two-cluster structure. Third, for strong noise the clusters are destroyed and the population is characterized by a uniform distribution. The second and third phases are separated by an order - disorder phase transition that has the characteristics of a Hopf bifurcation. Furthermore, we show that for the cell cycle model studied, the effects of bounded random perturbations are virtually indistinguishable from those induced by additive Gaussian noise, after appropriate scaling of the variance of noise strength. We then use the model to predict the strength of coupling among the cells from experimental data. In particular, we show that coupling must be rather strong to account for the observed clustering of cells given experimentally estimated noise variance. PMID:24694583

  6. Moiré induced organization of size-selected Pt clusters soft landed on epitaxial graphene

    PubMed Central

    Linas, Sébastien; Jean, Fabien; Zhou, Tao; Albin, Clément; Renaud, Gilles; Bardotti, Laurent; Tournus, Florent

    2015-01-01

    Two-dimensional hexagonal arrays of Pt nanoparticles (1.5 nm diameter) have been obtained by deposition of preformed and size selected Pt nanoparticles on graphene. This original self-organization is induced, at room temperature, by the 2D periodic undulation (the moiré pattern) of graphene epitaxially grown on the Ir(111) surface. By means of complementary techniques (scanning tunneling microscopy, grazing incidence X ray scattering), the Pt clusters shapes and organization are characterized and the structural evolution during annealing is investigated. The soft-landed clusters remain quasi-spherical and a large proportion appears to be pinned on specific moiré sites. The quantitative determination of the proportion of organized clusters reveals that the obtained hexagonal array of the almost spherical nanoparticles is stable up to 650 K, which is an indication of a strong cluster-surface interaction. PMID:26278787

  7. Increase of the mean inner Coulomb potential in Au clusters induced by surface tension and its implication for electron scattering

    SciTech Connect

    Popescu, Radian; Mueller, Erich; Wanner, Matthias; Gerthsen, Dagmar; Schowalter, Marco; Rosenauer, Andreas; Boettcher, Artur; Loeffler, Daniel; Weis, Patrick

    2007-12-15

    Electron holography in a transmission electron microscope was applied to measure the phase shift {delta}{phi} induced by Au clusters as a function of the cluster size. Large {delta}{phi} observed for small Au clusters cannot be described by the well-known equation {delta}{phi}=C{sub E}V{sub 0}t (C{sub E}, interaction constant; V{sub 0}, mean inner Coulomb potential (MIP) of bulk gold; and t, cluster thickness). The rapid increase of the Au MIP with decreasing cluster size derived from {delta}{phi} can be explained by the compressive strain of surface atoms in the cluster.

  8. The organophosphate insecticide chlorpyrifos confers its genotoxic effects by inducing DNA damage and cell apoptosis.

    PubMed

    Li, Diqiu; Huang, Qingchun; Lu, Miaoqing; Zhang, Lei; Yang, Zhichuan; Zong, Mimi; Tao, Liming

    2015-09-01

    The organophosphate insecticide chlorpyrifos (CPF) is known to induce neurological effects, malformation and micronucleus formation, persistent developmental disorders, and maternal toxicity in rats and mice. The binding of chlorpyrifos with DNA to produce DNA adducts leads to an increasing social concern about the genotoxic risk of CPF in human, but CPF-induced cytotoxicity through DNA damage and cell apoptosis is not well understood. Here, we quantified the cytotoxicity and potential genotoxicity of CPF using the alkaline comet assay, γH2AX foci formation, and the DNA laddering assay in order to detect DNA damage and apoptosis in human HeLa and HEK293 cells in vitro. Drosophila S2 cells were used as a positive control. The alkaline comet assay showed that sublethal concentrations of CPF induced significant concentration-dependent increases in single-strand DNA breaks in the treated cells compared with the control. The percentage of γH2AX-positive HeLa cells revealed that CPF also causes DNA double-strand breaks in a time-dependent manner. Moreover, DNA fragmentation analysis demonstrated that exposure to CPF induced a significant concentration- and time-dependent increase in cell apoptosis. We conclude that CPF is a strongly genotoxic agent that induces DNA damage and cell apoptosis. PMID:26002045

  9. Electric field induced by collective vortex creep in superconductors with fractal clusters of normal phase

    NASA Astrophysics Data System (ADS)

    Kuzmin, Yu. I.; Pleshakov, I. V.

    2016-02-01

    The influence of the collective creep of magnetic flux on the electric field induced in a superconducting composite with fractal cluster structure is considered. Current-voltage ( I- V) characteristics of these superconductors are determined with allowance for the influence of the fractal dimensionality of boundaries of the normal phase clusters and the height of pinning barriers on the nonlinearity of I- V characteristics at small transport currents. A relationship is established between the collective pinning and vortex glass state that is formed in superconductors with a fractal cluster structure. It is shown that the intensity of an electric field induced in the case of collective creep is smaller than that for Anderson-Kim creep.

  10. Vorinostat Induces Reactive Oxygen Species and DNA Damage in Acute Myeloid Leukemia Cells

    PubMed Central

    Pettersson, Filippa; Retrouvey, Hélène; Skoulikas, Sophia; Miller, Wilson H.

    2011-01-01

    Histone deacetylase inhibitors (HDACi) are promising anti-cancer agents, however, their mechanisms of action remain unclear. In acute myeloid leukemia (AML) cells, HDACi have been reported to arrest growth and induce apoptosis. In this study, we elucidate details of the DNA damage induced by the HDACi vorinostat in AML cells. At clinically relevant concentrations, vorinostat induces double-strand breaks and oxidative DNA damage in AML cell lines. Additionally, AML patient blasts treated with vorinostat display increased DNA damage, followed by an increase in caspase-3/7 activity and a reduction in cell viability. Vorinostat-induced DNA damage is followed by a G2-M arrest and eventually apoptosis. We found that pre-treatment with the antioxidant N-acetyl cysteine (NAC) reduces vorinostat-induced DNA double strand breaks, G2-M arrest and apoptosis. These data implicate DNA damage as an important mechanism in vorinostat-induced growth arrest and apoptosis in both AML cell lines and patient-derived blasts. This supports the continued study and development of vorinostat in AMLs that may be sensitive to DNA-damaging agents and as a combination therapy with ionizing radiation and/or other DNA damaging agents. PMID:21695163

  11. DNA binding of Jun and Fos bZip domains: homodimers and heterodimers induce a DNA conformational change in solution.

    PubMed Central

    John, M; Leppik, R; Busch, S J; Granger-Schnarr, M; Schnarr, M

    1996-01-01

    We constructed plasmids encoding the sequences for the bZip modules of c-Jun and c-Fos which could then be expressed as soluble proteins in Escherichia coli. The purified bZip modules were tested for their binding capacities of synthetic oligonucleotides containing either TRE or CRE recognition sites in electrophoretic mobility shift assays and circular dichroism (CD). Electrophoretic mobility shift assays showed that bZip Jun homodimers and bZip Jun/Fos heterodimers bind a collagenase-like TRE (CTGACTCAT) with dissociation constants of respectively 1.4 x 10(-7) M and 5 x 10(-8) M. As reported earlier [Patel et al. (1990) Nature 347, 572-575], DNA binding induces a marked change of the protein structure. However, we found that the DNA also undergoes a conformational change. This is most clearly seen with small oligonucleotides of 13 or 14 bp harboring respectively a TRE (TGACTCA) or a CRE (TGACGTCA) sequence. In this case, the positive DNA CD signal at 280 nm increases almost two-fold with a concomitant blue-shift of 3-4 nm. Within experimental error the same spectral changes are observed for TRE and CRE containing DNA fragments. The spectral changes observed with a non-specific DNA fragment are weaker and the signal of free DNA is recovered upon addition of much smaller salt concentrations than required for a specific DNA fragment. Surprisingly the spectral changes induced by Jun/Jun homodimers are not identical to those induced by Jun/Fos heterodimers. However, in both cases the increase of the positive CD band and the concomitant blue shift would be compatible with a B to A-transition of part of the binding site or a DNA conformation intermediate between the canonical A and B structures. PMID:8948639

  12. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  13. Stress-induced DNA damage biomarkers: applications and limitations.

    PubMed

    Nikitaki, Zacharenia; Hellweg, Christine E; Georgakilas, Alexandros G; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  14. Mitochondrial DNA damage induced autophagy, cell death, and disease

    PubMed Central

    Van Houten, Bennett; Hunter, Senyene E.; Meyer, Joel N.

    2016-01-01

    Mammalian mitochondria contain multiple small genomes. While these organelles have efficient base excision removal of oxidative DNA lesions and alkylation damage, many DNA repair systems that work on nuclear DNA damage are not active in mitochondria. What is the fate of DNA damage in the mitochondria that cannot be repaired or that overwhelms the repair system? Some forms of mitochondrial DNA damage can apparently trigger mitochondrial DNA destruction, either via direct degradation or through specific forms of autophagy, such as mitophagy. However, accumulation of certain types of mitochondrial damage, in the absence of DNA ligase III (Lig3) or exonuclease G (EXOG), enzymes required for repair, can directly trigger cell death. This review examines the cellular effects of persistent damage to mitochondrial genomes and discusses the very different cell fates that occur in response to different kinds of damage. PMID:26709760

  15. Topographic confinement of epithelial clusters induces epithelial-to-mesenchymal transition in compliant matrices

    NASA Astrophysics Data System (ADS)

    Nasrollahi, Samila; Pathak, Amit

    2016-01-01

    Epithelial cells disengage from their clusters and become motile by undergoing epithelial-to-mesenchymal transition (EMT), an essential process for both embryonic development and tumor metastasis. Growing evidence suggests that high extracellular matrix (ECM) stiffness induces EMT. In reality, epithelial clusters reside in a heterogeneous microenvironment whose mechanical properties vary not only in terms of stiffness, but also topography, dimensionality, and confinement. Yet, very little is known about how various geometrical parameters of the ECM might influence EMT. Here, we adapt a hydrogel-microchannels based matrix platform to culture mammary epithelial cell clusters in ECMs of tunable stiffness and confinement. We report a previously unidentified role of ECM confinement in EMT induction. Surprisingly, confinement induces EMT even in the cell clusters surrounded by a soft matrix, which otherwise protects against EMT in unconfined environments. Further, we demonstrate that stiffness-induced and confinement-induced EMT work through cell-matrix adhesions and cytoskeletal polarization, respectively. These findings highlight that both the structure and the stiffness of the ECM can independently regulate EMT, which brings a fresh perspective to the existing paradigm of matrix stiffness-dependent dissemination and invasion of tumor cells.

  16. Topographic confinement of epithelial clusters induces epithelial-to-mesenchymal transition in compliant matrices

    PubMed Central

    Nasrollahi, Samila; Pathak, Amit

    2016-01-01

    Epithelial cells disengage from their clusters and become motile by undergoing epithelial-to-mesenchymal transition (EMT), an essential process for both embryonic development and tumor metastasis. Growing evidence suggests that high extracellular matrix (ECM) stiffness induces EMT. In reality, epithelial clusters reside in a heterogeneous microenvironment whose mechanical properties vary not only in terms of stiffness, but also topography, dimensionality, and confinement. Yet, very little is known about how various geometrical parameters of the ECM might influence EMT. Here, we adapt a hydrogel-microchannels based matrix platform to culture mammary epithelial cell clusters in ECMs of tunable stiffness and confinement. We report a previously unidentified role of ECM confinement in EMT induction. Surprisingly, confinement induces EMT even in the cell clusters surrounded by a soft matrix, which otherwise protects against EMT in unconfined environments. Further, we demonstrate that stiffness-induced and confinement-induced EMT work through cell-matrix adhesions and cytoskeletal polarization, respectively. These findings highlight that both the structure and the stiffness of the ECM can independently regulate EMT, which brings a fresh perspective to the existing paradigm of matrix stiffness-dependent dissemination and invasion of tumor cells. PMID:26728047

  17. A model of photon cell killing based on the spatio-temporal clustering of DNA damage in higher order chromatin structures.

    PubMed

    Herr, Lisa; Friedrich, Thomas; Durante, Marco; Scholz, Michael

    2014-01-01

    We present a new approach to model dose rate effects on cell killing after photon radiation based on the spatio-temporal clustering of DNA double strand breaks (DSBs) within higher order chromatin structures of approximately 1-2 Mbp size, so called giant loops. The main concept of this approach consists of a distinction of two classes of lesions, isolated and clustered DSBs, characterized by the number of double strand breaks induced in a giant loop. We assume a low lethality and fast component of repair for isolated DSBs and a high lethality and slow component of repair for clustered DSBs. With appropriate rates, the temporal transition between the different lesion classes is expressed in terms of five differential equations. These allow formulating the dynamics involved in the competition of damage induction and repair for arbitrary dose rates and fractionation schemes. Final cell survival probabilities are computable with a cell line specific set of three parameters: The lethality for isolated DSBs, the lethality for clustered DSBs and the half-life time of isolated DSBs. By comparison with larger sets of published experimental data it is demonstrated that the model describes the cell line dependent response to treatments using either continuous irradiation at a constant dose rate or to split dose irradiation well. Furthermore, an analytic investigation of the formulation concerning single fraction treatments with constant dose rates in the limiting cases of extremely high or low dose rates is presented. The approach is consistent with the Linear-Quadratic model extended by the Lea-Catcheside factor up to the second moment in dose. Finally, it is shown that the model correctly predicts empirical findings about the dose rate dependence of incidence probabilities for deterministic radiation effects like pneumonitis and the bone marrow syndrome. These findings further support the general concepts on which the approach is based. PMID:24392100

  18. Regulation of chromosomal replication initiation by oriC-proximal DnaA-box clusters in Bacillus subtilis

    PubMed Central

    Okumura, Hajime; Yoshimura, Mika; Ueki, Mikako; Oshima, Taku; Ogasawara, Naotake; Ishikawa, Shu

    2012-01-01

    Bacterial chromosome replication is initiated by binding of DnaA to a DnaA-box cluster (DBC) within the replication origin (oriC). In Bacillus subtilis, six additional DBCs are found outside of oriC and some are known to be involved in transcriptional regulation of neighboring genes. A deletion mutant lacking the six DBCs (Δ6) initiated replication early. Further, inactivation of spo0J in Δ6 cells yielded a pleiotropic phenotype, accompanied by severe growth inhibition. However, a spontaneous suppressor in soj or a deletion of soj, which stimulates DnaA activity in the absence of Spo0J, counteracted these effects. Such abnormal phenotypic features were not observed in a mutant background in which replication initiation was driven by a plasmid-derived replication origin. Moreover, introduction of a single DBC at various ectopic positions within the Δ6 chromosome partly suppressed the early-initiation phenotype, but this was dependent on insertion location. We propose that DBCs negatively regulate replication initiation by interacting with DnaA molecules and play a major role, together with Spo0J/Soj, in regulating the activity of DnaA. PMID:21911367

  19. BRCA2 diffuses as oligomeric clusters with RAD51 and changes mobility after DNA damage in live cells

    PubMed Central

    Reuter, Marcel; Zelensky, Alex; Smal, Ihor; Meijering, Erik; van Cappellen, Wiggert A.; de Gruiter, H. Martijn; van Belle, Gijsbert J.; van Royen, Martin E.; Houtsmuller, Adriaan B.; Essers, Jeroen; Kanaar, Roland

    2014-01-01

    Genome maintenance by homologous recombination depends on coordinating many proteins in time and space to assemble at DNA break sites. To understand this process, we followed the mobility of BRCA2, a critical recombination mediator, in live cells at the single-molecule level using both single-particle tracking and fluorescence correlation spectroscopy. BRCA2-GFP and -YFP were compared to distinguish diffusion from fluorophore behavior. Diffusive behavior of fluorescent RAD51 and RAD54 was determined for comparison. All fluorescent proteins were expressed from endogenous loci. We found that nuclear BRCA2 existed in oligomeric clusters, and exhibited heterogeneous mobility. DNA damage increased BRCA2 transient binding, presumably including binding to damaged sites. Despite its very different size, RAD51 displayed mobility similar to BRCA2, which indicates physical interaction between these proteins both before and after induction of DNA damage. We propose that BRCA2-mediated sequestration of nuclear RAD51 serves to prevent inappropriate DNA interactions and that all RAD51 is delivered to DNA damage sites in association with BRCA2. PMID:25488918

  20. DNA SEQUENCING, ANALYSIS, AND IDENTIFICATION OF SEROGROUP-SPECIFIC GENES IN THE ESCHERICHIA COLI O28AC AND O118 O ANTIGEN GENE CLUSTERS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The DNA sequence of the O antigen gene clusters of Escherichia coli serogroups O28ac and O118 was determined, and 7 and 13 ORFs were identified, respectively, encoding genes required for O antigen sugar biosynthesis, transfer, and processing. Analysis of the DNA sequence revealed that the wzx (O ...

  1. DNA Compaction Induced by a Cationic Polymer or Surfactant Impact Gene Expression and DNA Degradation

    PubMed Central

    Ainalem, Marie-Louise; Bartles, Andrew; Muck, Joscha; Dias, Rita S.; Carnerup, Anna M.; Zink, Daniele; Nylander, Tommy

    2014-01-01

    There is an increasing interest in achieving gene regulation in biotechnological and biomedical applications by using synthetic DNA-binding agents. Most studies have so far focused on synthetic sequence-specific DNA-binding agents. Such approaches are relatively complicated and cost intensive and their level of sophistication is not always required, in particular for biotechnological application. Our study is inspired by in vivo data that suggest that DNA compaction might contribute to gene regulation. This study exploits the potential of using synthetic DNA compacting agents that are not sequence-specific to achieve gene regulation for in vitro systems. The semi-synthetic in vitro system we use include common cationic DNA-compacting agents, poly(amido amine) (PAMAM) dendrimers and the surfactant hexadecyltrimethylammonium bromide (CTAB), which we apply to linearized plasmid DNA encoding for the luciferase reporter gene. We show that complexing the DNA with either of the cationic agents leads to gene expression inhibition in a manner that depends on the extent of compaction. This is demonstrated by using a coupled in vitro transcription-translation system. We show that compaction can also protect DNA against degradation in a dose-dependent manner. Furthermore, our study shows that these effects are reversible and DNA can be released from the complexes. Release of DNA leads to restoration of gene expression and makes the DNA susceptible to degradation by Dnase. A highly charged polyelectrolyte, heparin, is needed to release DNA from dendrimers, while DNA complexed with CTAB dissociates with the non-ionic surfactant C12E5. Our results demonstrate the relation between DNA compaction by non-specific DNA-binding agents and gene expression and gene regulation can be achieved in vitro systems in a reliable dose-dependent and reversible manner. PMID:24671109

  2. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc

    2015-06-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  3. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage-induced cell senescence.

    PubMed

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A; Kumar, Sheetal; Kalab, Petr

    2016-04-15

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase-regulated nuclear-cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage-induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β-dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP-regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  4. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage–induced cell senescence

    PubMed Central

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A.; Kumar, Sheetal; Kalab, Petr

    2016-01-01

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase–regulated nuclear–cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage–induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β–dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP–regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  5. The role of nitric oxide on DNA damage induced by benzene metabolites

    PubMed Central

    MELIKIAN, ASSIEH A.; CHEN, KUN-MING; LI, HEYI; SODUM, RAMA; FIALA, EMERICH; EL-BAYOUMY, KARAM

    2013-01-01

    Benzene, a tobacco constituent, is a leukemogen in humans and a carcinogen in rodents. Several benzene metabolites generate superoxide anion (O2•−) and induce nitric oxide synthase in the bone marrow of mice. We hypothesized that the reaction of nitric oxide (•NO) with O2•− leads to the formation of peroxynitrite as an intermediate during benzene metabolism. This hypothesis was supported by demonstrating that the exposure of mice to benzene produced nitrated metabolites and enhanced the levels of protein-bound 3-nitrotyrosine in the bone marrow of mice in vivo. In the current study, we investigated the influence of nitric oxide, generated from sodium 1-(N,N-diethylamino)diazen-1-ium-1,2-diolate, on DNA strand breaks induced by each single or binary benzene metabolite at different doses and compared the levels of the DNA damage induced by each benzene metabolite in the presence of nitric oxide with the levels of DNA strand breaks induced by peroxynitrite at similar doses in vitro. We found that among benzene metabolites only 1,2,4-trihydroxybenzene (BT) can induce significant DNA damage in the absence of nitric oxide. While 1,4-dihydroxybenzene (HQ), 1,4-benzo-quinone (BQ) and 1,2-dihydroxybenzene (CAT) require •NO to induce DNA strand breaks, hydroquinone was the most potent DNA-damaging benzene metabolite in the presence of •NO. The order of DNA breaks by benzene metabolites in the presence of •NO is: Peroxynitrite = HQ > BT > BQ > CAT. The •NO and O2•− scavengers inhibited DNA damage induced by [HQ+•NO]. Benzene, trans,trans-muconaldehyde, and phenol, do not induce DNA strand breaks either in the absence or presence of •NO. However, adding phenol to [HQ+•NO] leads to greater DNA damage than [HQ+•NO] alone. Collectively, these results suggest that nitric oxide is an important factor in DNA damage induced by certain benzene metabolites, probably via the formation of the peroxynitrite intermediate. Phenol, the major benzene metabolite

  6. DNA repair and the evolution of transformation in Bacillus subtilis. II. Role of inducible repair

    SciTech Connect

    Wojciechowski, M.F.; Hoelzer, M.A.; Michod, R.E.

    1989-03-01

    In Bacillus subtilis, DNA repair and recombination are intimately associated with competence, the physiological state in which the bacterium can bind, take up and recombine exogenous DNA. Previously, we have shown that the homologous DNA transformation rate (ratio of transformants to total cells) increases with increasing UV dosage if cells are transformed after exposure to UV radiation (UV-DNA), whereas the transformation rate decreases if cells are transformed before exposure to UV (DNA-UV). In this report, by using different DNA repair-deficient mutants, we show that the greater increase in transformation rate in UV-DNA experiments than in DNA-UV experiments does not depend upon excision repair or inducible SOS-like repair, although certain quantitative aspects of the response do depend upon these repair systems. We also show that there is no increase in the transformation rate in a UV-DNA experiment when repair and recombination proficient cells are transformed with nonhomologous plasmid DNA, although the results in a DNA-UV experiment are essentially unchanged by using plasmid DNA. We have used din operon fusions as a sensitive means of assaying for the expression of genes under the control of the SOS-like regulon in both competent and noncompetent cell subpopulations as a consequence of competence development and our subsequent experimental treatments. Results indicate that the SOS-like system is induced in both competent and noncompetent subpopulations in our treatments and so should not be a major factor in the differential response in transformation rate observed in UV-DNA and DNA-UV treatments. These results provide further support to the hypothesis that the evolutionary function of competence is to bring DNA into the cell for use as template in the repair of DNA damage.

  7. Low concentration of arsenite exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity

    SciTech Connect

    Qin Xujun; Hudson, Laurie G.; Liu Wenlan; Timmins, Graham S.; Liu Kejian

    2008-10-01

    Epidemiological studies have associated arsenic exposure with many types of human cancers. Arsenic has also been shown to act as a co-carcinogen even at low concentrations. However, the precise mechanism of its co-carcinogenic action is unknown. Recent studies indicate that arsenic can interfere with DNA-repair processes. Poly(ADP-ribose) polymerase (PARP)-1 is a zinc-finger DNA-repair protein, which can promptly sense DNA strand breaks and initiate DNA-repair pathways. In the present study, we tested the hypothesis that low concentrations of arsenic could inhibit PAPR-1 activity and so exacerbate levels of ultraviolet radiation (UVR)-induced DNA strand breaks. HaCat cells were treated with arsenite and/or UVR, and then DNA strand breaks were assessed by comet assay. Low concentrations of arsenite ({<=} 2 {mu}M) alone did not induce significant DNA strand breaks, but greatly enhanced the DNA strand breaks induced by UVR. Further studies showed that 2 {mu}M arsenite effectively inhibited PARP-1 activity. Zinc supplementation of arsenite-treated cells restored PARP-1 activity and significantly diminished the exacerbating effect of arsenite on UVR-induced DNA strand breaks. Importantly, neither arsenite treatment, nor zinc supplementation changed UVR-triggered reactive oxygen species (ROS) formation, suggesting that their effects upon UVR-induced DNA strand breaks are not through a direct free radical mechanism. Combination treatments of arsenite with PARP-1 inhibitor 3-aminobenzamide or PARP-1 siRNA demonstrate that PARP-1 is the target of arsenite. Together, these findings show that arsenite at low concentration exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity, which may represent an important mechanism underlying the co-carcinogenicity of arsenic.

  8. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  9. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells.

    PubMed

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells' molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  10. Persistent and heritable structural damage induced in heterochromatic DNA from rat liver by N-nitrosodimethylamine

    SciTech Connect

    Ward, E.J.; Stewart, B.W.

    1987-03-24

    Analysis, by benzoylated DEAE-cellulose chromatography, has been made of structural change in eu- and heterochromatic DNA from rat liver following administration of the carcinogen N-nitrosodimethylamine. Either hepatic DNA was prelabeled with (/sup 3/H)thymidine administered 2-3 weeks before injection of the carcinogen or the labeled precursor was given during regenerative hyperplasia in rats treated earlier with N-nitrosodimethylamine. Following phenol extraction of either whole liver homogenate or nuclease-fractionated eu- and heterochromatin, carcinogen-modified DNA was examined by stepwise or caffeine gradient elution from benzoylated DEAE-cellulose. In whole DNA, nitrosamine-induced single-stranded character was maximal 4-24 h after treatment, declining rapidly thereafter; gradient elution of these DNA preparations also provided short-term evidence of structural change. Caffeine gradient chromatography suggested short-term nitrosamine-induced structural change in euchromatic DNA, while increased binding of heterochromatic DNA was evident for up to 3 months after carcinogen treatment. Preparations of newly synthesized heterochromatic DNA from animals subjected to hepatectomy up to 2 months after carcinogen treatment provided evidence of heritable structural damage. Carcinogen-induced binding of heterochromatic DNA to benzoylated DEAE-cellulose was indicative of specific structural lesions whose affinity equalled that of single-stranded DNA up to 1.0 kilobase in length. The data suggest that structural lesions in heterochromatin, which may be a consequence of incomplete repair, are preferentially degraded by endogenous nuclease(s).

  11. Azobenzene Photoisomerization-Induced Destabilization of B-DNA

    PubMed Central

    Biswas, Mithun; Burghardt, Irene

    2014-01-01

    Molecular photoswitches provide a promising way for selective regulation of nanoscaled biological systems. It has been shown that conformational changes of azobenzene, one of the widely used photoswitches, can be used to reversibly control DNA duplex formation. Here, we investigate the conformational response of DNA upon azobenzene binding and isomerization, using a threoninol linker that has been experimentally investigated recently. To this end, nonequilibrium molecular dynamics simulations are carried out using a switching potential describing the photoinduced isomerization. Attachment of azobenzene leads to a distortion of the DNA helical conformation that is similar for the trans and cis forms. However, the trans form is stabilized by favorable stacking interactions whereas the cis form is found to remain flipped out of the basepair-stacked position. Multiple azobenzene attachment augments the distortion in DNA helical conformation. The distorted DNA retains nativelike pairing of bases at ambient temperatures, but shows weaker basepairing compared to native DNA at an elevated temperature. PMID:25140428

  12. The determination of the DNA sequence specificity of bleomycin-induced abasic sites.

    PubMed

    Chen, Jon K; Murray, Vincent

    2016-06-01

    The DNA sequence specificity of the cancer chemotherapeutic agent, bleomycin, was determined with high precision in purified plasmid DNA using an improved technique. This improved technique involved the labelling of the 5'- and 3'-ends of DNA with different fluorescent tags, followed by simultaneous cleavage by bleomycin and capillary electrophoresis with laser-induced fluorescence. This permitted the determination of bleomycin cleavage specificity with high accuracy since end-label bias was greatly reduced. Bleomycin produces single- and double-strand breaks, abasic sites and other base damage in DNA. This high-precision method was utilised to elucidate, for the first time, the DNA sequence specificity of bleomycin-induced DNA damage at abasic sites. This was accomplished using endonuclease IV that cleaves DNA at abasic sites after bleomycin damage. It was found that bleomycin-induced abasic sites formed at 5'-GC and 5'-GT sites while bleomycin-induced phosphodiester strand breaks formed mainly at 5'-GT dinucleotides. Since bleomycin-induced abasic sites are produced in the absence of molecular oxygen, this difference in DNA sequence specificity could be important in hypoxic tumour cells. PMID:26940956

  13. Basic Mechanics of DNA Methylation and the Unique Landscape of the DNA Methylome in Metal-Induced Carcinogenesis

    PubMed Central

    Brocato, Jason; Costa, Max

    2013-01-01

    DNA methylation plays an intricate role in the regulation of gene expression and events that compromise the integrity of the methylome may potentially contribute to disease development. DNA methylation is a reversible and regulatory modification that elicits a cascade of events leading to chromatin condensation and gene silencing. In general, normal cells are characterized by gene-specific hypomethylation and global hypermethylation, while cancer cells portray a reverse profile to this norm. The unique methylome displayed in cancer cells is induced after exposure to carcinogenic metals such as nickel, arsenic, cadmium, and chromium (VI). These metals alter the DNA methylation profile by provoking both hyper- and hypomethylation events. The metal-stimulated deviations to the methylome are possible mechanisms for metal-induced carcinogenesis and may provide potential biomarkers for cancer detection. Development of therapies based on the cancer methylome requires further research including human studies that supply results with larger impact and higher human relevance. PMID:23844698

  14. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    SciTech Connect

    Zafar, Faria; Seidler, Sara B.; Kronenberg, Amy; Schild, David; Wiese, Claudia

    2010-06-29

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  15. PML induces compaction, TRF2 depletion and DNA damage signaling at telomeres and promotes their alternative lengthening.

    PubMed

    Osterwald, Sarah; Deeg, Katharina I; Chung, Inn; Parisotto, Daniel; Wörz, Stefan; Rohr, Karl; Erfle, Holger; Rippe, Karsten

    2015-05-15

    The alternative lengthening of telomeres (ALT) mechanism allows cancer cells to escape senescence and apoptosis in the absence of active telomerase. A characteristic feature of this pathway is the assembly of ALT-associated promyelocytic leukemia (PML) nuclear bodies (APBs) at telomeres. Here, we dissected the role of APBs in a human ALT cell line by performing an RNA interference screen using an automated 3D fluorescence microscopy platform and advanced 3D image analysis. We identified 29 proteins that affected APB formation, which included proteins involved in telomere and chromatin organization, protein sumoylation and DNA repair. By integrating and extending these findings, we found that APB formation induced clustering of telomere repeats, telomere compaction and concomitant depletion of the shelterin protein TRF2 (also known as TERF2). These APB-dependent changes correlated with the induction of a DNA damage response at telomeres in APBs as evident by a strong enrichment of the phosphorylated form of the ataxia telangiectasia mutated (ATM) kinase. Accordingly, we propose that APBs promote telomere maintenance by inducing a DNA damage response in ALT-positive tumor cells through changing the telomeric chromatin state to trigger ATM phosphorylation. PMID:25908860

  16. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  17. Cluster analysis and relative relocation of mining-induced seismicity using HAMNET data

    NASA Astrophysics Data System (ADS)

    Wehling-Benatelli, S.; Becker, D.; Bischoff, M.; Friederich, W.; Meier, T.

    2012-04-01

    Longwall mining activity in the Ruhr-coal mining district leads to mining-induced seismicity. For detailed studies seismicity of the single longwall panel S 109 beneath Hamm-Herringen in the eastern Ruhr area was monitored between June 2006 and July 2007. More than 7000 seismic events with magnitudes -1.7 ≤ ML ≤ 2.0 are localized in this period. 70% of the events occur in the vicinity of the moving longwall face. Moreover, the seismicity pattern shows spatial clustering of events in distances up to 500 m from the panel which is related to remnant pillars of old workings and tectonic features. Two sources with common location and rock failure mechanism are expected to show identical waveforms. Hence, similar waveforms suggest similarity of source properties. Waveform similarity can be quantified by cross-correlation. Similarity matrices have been established and build the basis of a cluster analysis presented here. We compare two approaches for cluster definition: a single-linkage approach and excerpting clusters by visual inspection of the sorted similarity matrices. Clusters are found as areas of high inter-event similarity in the depicted matrix. In contrast, the single-linkage approach assigns an event to the cluster if the similarity threshold v sl = 0.9 is exceeded to at least one other member. This method is more restrictive and, in general, leads to clusters with less members than visual inspection. Both methods exhibit clusters which show the same properties. The largest clusters are built by low-magnitude events (around ML ≈-0.6) directly at the longwall face at the mining level. Other clusters include events with magnitudes as large as ML,max = 1.8. Their locations tend to lie above or below the mining level in load-bearing sandstone layers. Mining accompanying events show face-parallel near vertical fault planes whereas more distant clusters have typical solutions of remnant pillar failure with a medium dip angle. Relative relocation of the events

  18. Effect of data normalization on fuzzy clustering of DNA microarray data

    PubMed Central

    Kim, Seo Young; Lee, Jae Won; Bae, Jong Sung

    2006-01-01

    Background Microarray technology has made it possible to simultaneously measure the expression levels of large numbers of genes in a short time. Gene expression data is information rich; however, extensive data mining is required to identify the patterns that characterize the underlying mechanisms of action. Clustering is an important tool for finding groups of genes with similar expression patterns in microarray data analysis. However, hard clustering methods, which assign each gene exactly to one cluster, are poorly suited to the analysis of microarray datasets because in such datasets the clusters of genes frequently overlap. Results In this study we applied the fuzzy partitional clustering method known as Fuzzy C-Means (FCM) to overcome the limitations of hard clustering. To identify the effect of data normalization, we used three normalization methods, the two common scale and location transformations and Lowess normalization methods, to normalize three microarray datasets and three simulated datasets. First we determined the optimal parameters for FCM clustering. We found that the optimal fuzzification parameter in the FCM analysis of a microarray dataset depended on the normalization method applied to the dataset during preprocessing. We additionally evaluated the effect of normalization of noisy datasets on the results obtained when hard clustering or FCM clustering was applied to those datasets. The effects of normalization were evaluated using both simulated datasets and microarray datasets. A comparative analysis showed that the clustering results depended on the normalization method used and the noisiness of the data. In particular, the selection of the fuzzification parameter value for the FCM method was sensitive to the normalization method used for datasets with large variations across samples. Conclusion Lowess normalization is more robust for clustering of genes from general microarray data than the two common scale and location adjustment methods

  19. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.

    PubMed

    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A

    2013-09-01

    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity. PMID:23793613

  20. Dielectric-spectroscopy approach to ferrofluid nanoparticle clustering induced by an external electric field

    NASA Astrophysics Data System (ADS)

    Rajnak, Michal; Kurimsky, Juraj; Dolnik, Bystrik; Kopcansky, Peter; Tomasovicova, Natalia; Taculescu-Moaca, Elena Alina; Timko, Milan

    2014-09-01

    An experimental study of magnetic colloidal particles cluster formation induced by an external electric field in a ferrofluid based on transformer oil is presented. Using frequency domain isothermal dielectric spectroscopy, we study the influence of a test cell electrode separation distance on a low-frequency relaxation process. We consider the relaxation process to be associated with an electric double layer polarization taking place on the particle surface. It has been found that the relaxation maximum considerably shifts towards lower frequencies when conducting the measurements in the test cells with greater electrode separation distances. As the electric field intensity was always kept at a constant value, we propose that the particle cluster formation induced by the external ac electric field accounts for that phenomenon. The increase in the relaxation time is in accordance with the Schwarz theory of electric double layer polarization. In addition, we analyze the influence of a static electric field generated by dc bias voltage on a similar shift in the relaxation maximum position. The variation of the dc electric field for the hysteresis measurements purpose provides understanding of the development of the particle clusters and their decay. Following our results, we emphasize the utility of dielectric spectroscopy as a simple, complementary method for detection and study of clusters of colloidal particles induced by external electric field.

  1. Dielectric-spectroscopy approach to ferrofluid nanoparticle clustering induced by an external electric field.

    PubMed

    Rajnak, Michal; Kurimsky, Juraj; Dolnik, Bystrik; Kopcansky, Peter; Tomasovicova, Natalia; Taculescu-Moaca, Elena Alina; Timko, Milan

    2014-09-01

    An experimental study of magnetic colloidal particles cluster formation induced by an external electric field in a ferrofluid based on transformer oil is presented. Using frequency domain isothermal dielectric spectroscopy, we study the influence of a test cell electrode separation distance on a low-frequency relaxation process. We consider the relaxation process to be associated with an electric double layer polarization taking place on the particle surface. It has been found that the relaxation maximum considerably shifts towards lower frequencies when conducting the measurements in the test cells with greater electrode separation distances. As the electric field intensity was always kept at a constant value, we propose that the particle cluster formation induced by the external ac electric field accounts for that phenomenon. The increase in the relaxation time is in accordance with the Schwarz theory of electric double layer polarization. In addition, we analyze the influence of a static electric field generated by dc bias voltage on a similar shift in the relaxation maximum position. The variation of the dc electric field for the hysteresis measurements purpose provides understanding of the development of the particle clusters and their decay. Following our results, we emphasize the utility of dielectric spectroscopy as a simple, complementary method for detection and study of clusters of colloidal particles induced by external electric field. PMID:25314449

  2. Light-induced processes on atoms and clusters confined in nanoporous silica and organic films

    NASA Astrophysics Data System (ADS)

    Moi, L.; Burchianti, A.; Bogi, A.; Marinelli, C.; Maibohm, C.; Mariotti, E.

    2007-03-01

    The study of light induced processes on atoms and nanoparticles confined in organic films or in dielectric structures is motivated both by fundamental interest and applications in optics and photonics. Depending on the light intensity and frequency and the kind of confinement, different processes can be activated. Among them photodesorption processes have a key role. Non thermal light induced atomic desorption has been observed from siloxane and paraffin films previously exposed to alkali vapors. This effect has been extensively investigated and used both to develop photo-atom sources and to load magneto-optical traps. Recently we observed huge photodesorption of alkali atoms embedded in nanoporous silica. In this case the atomic photodesorption causes, by properly tuning the light frequency, either formation or evaporation of clusters inside the silica matrix. Green-blue light desorbs isolated adatoms from the glass surface eventually producing clusters, whereas red-near infrared (NIR) light causes cluster evaporation due to direct excitation of surface plasmon oscillations. Green-blue light induces cluster formation taking advantage of the dense atomic vapor, which diffuses through the glass nano-cavities. Both processes are reversible and even visible to the naked eye. By alternatively illuminating the porous glass sample with blue-green and red-NIR light we demonstrate that the glass remembers the illumination sequences behaving as an effective rereadable and rewritable optical medium.

  3. Redox signaling via lipid raft clustering in homocysteine-induced injury of podocytes

    PubMed Central

    Zhang, Chun; Hu, Jun-Jun; Xia, Min; Boini, Krishna M.; Brimson, Christopher; Li, Pin-Lan

    2010-01-01

    Our recent studies have indicated that hyperhomocysteinemia (hHcys) may induce podocyte damage, resulting in glomerulosclerosis. However, the molecular mechanisms mediating hHcys-induced podocyte injury are still poorly understood. In the present study, we first demonstrated that an intact NADPH oxidase system is present in podocytes as shown by detection of its membrane subunit (gp91phox) and cytosolic subunit (p47phox). Then, confocal microscopy showed that gp91phox and p47phox could be aggregated in lipid raft (LR) clusters in podocytes treated with homocysteine (Hcys), which were illustrated by their co-localization with cholera toxin B, a common LR marker. Different mechanistic LR disruptors, either methyl-β-cyclodextrin (MCD) or filipin abolished such Hcys-induced formation of LR-gp91phox or LR-p47phox transmembrane signaling complexes. By flotation of detergent-resistant membrane fractions we found that gp91phox and p47phox were enriched in LR fractions upon Hcys stimulation, and such enrichment of NADPH oxidase subunits and increase in its enzyme activity were blocked by MCD or filipin. Functionally, disruption of LR clustering significantly attenuated Hcys-induced podocyte injury, as shown by their inhibitory effects on Hcys-decreased expression of slit diaphragm molecules such as nephrin and podocin. Similarly, Hcys-increased expression of desmin was also reduced by disruption of LR clustering. In addition, inhibition of such LR-associated redox signaling prevented cytoskeleton disarrangement and apoptosis induced by Hcys. It is concluded that NADPH oxidase subunits aggregation and consequent activation of this enzyme through LR clustering is an important molecular mechanism triggering oxidative injury of podocytes induced by Hcys. PMID:20036696

  4. Study on DNA Damage Induced by Neon Beam Irradiation in Saccharomyces Cerevisiae

    NASA Astrophysics Data System (ADS)

    Lu, Dong; Li, Wenjian; Wu, Xin; Wang, Jufang; Ma, Shuang; Liu, Qingfang; He, Jinyu; Jing, Xigang; Ding, Nan; Dai, Zhongying; Zhou, Jianping

    2010-12-01

    Yeast strain Saccharomyces cerevisiae was irradiated with different doses of 85 MeV/u 20Ne10+ to investigate DNA damage induced by heavy ion beam in eukaryotic microorganism. The survival rate, DNA double strand breaks (DSBs) and DNA polymorphic were tested after irradiation. The results showed that there were substantial differences in DNA between the control and irradiated samples. At the dose of 40 Gy, the yeast cell survival rate approached 50%, DNA double-strand breaks were barely detectable, and significant DNA polymorphism was observed. The alcohol dehydrogenase II gene was amplified and sequenced. It was observed that base changes in the mutant were mainly transversions of T→G and T→C. It can be concluded that heavy ion beam irradiation can lead to change in single gene and may be an effective way to induce mutation.

  5. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.

    PubMed

    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2014-07-01

    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma. PMID:24798949

  6. DNA damage-induced type I interferon promotes senescence and inhibits stem cell function

    PubMed Central

    Carbone, Christopher J.; Zhao, Bin; Katlinski, Kanstantsin V.; Zheng, Hui; Guha, Manti; Li, Ning; Chen, Qijun; Yang, Ting; Lengner, Christopher J.; Greenberg, Roger A.; Johnson, F. Brad; Fuchs, Serge Y.

    2015-01-01

    Expression of type I interferons (IFN) can be induced by DNA damaging agents but the mechanisms and significance of this regulation are not completely understood. We found that the transcription factor IRF3, activated in an ATM-IKKα/β dependent manner, stimulates cell-autonomous IFNβ expression in response to double-stranded DNA breaks. Cells and tissues with accumulating DNA damage produce endogenous IFNβ and stimulate IFN signaling in vitro and in vivo. In turn, IFN acts to amplify DNA damage responses, activate the p53 pathway, promote senescence and inhibit stem cells function in response to telomere shortening. Inactivation of the IFN pathway abrogates the development of diverse progeric phenotypes and extends the life span of Terc knockout mice. These data identify DNA damage response-induced IFN signaling as a critical mechanism that links accumulating DNA damage with senescence and premature aging. PMID:25921537

  7. The cytosolic Fe-S cluster assembly component MET18 is required for the full enzymatic activity of ROS1 in active DNA demethylation

    PubMed Central

    Wang, Xiaokang; Li, Qi; Yuan, Wei; Cao, Zhendong; Qi, Bei; Kumar, Suresh; Li, Yan; Qian, Weiqiang

    2016-01-01

    DNA methylation patterns in plants are dynamically regulated by DNA methylation and active DNA demethylation in response to both environmental changes and development of plant. Beginning with the removal of methylated cytosine by ROS1/DME family of 5-methylcytosine DNA glycosylases, active DNA demethylation in plants occurs through base excision repair. So far, many components involved in active DNA demethylation remain undiscovered. Through a forward genetic screening of Arabidopsis mutants showing DNA hypermethylation at the EPF2 promoter region, we identified the conserved iron-sulfur cluster assembly protein MET18. MET18 dysfunction caused DNA hypermethylation at more than 1000 loci as well as the silencing of reporter genes and some endogenous genes. MET18 can directly interact with ROS1 in vitro and in vivo. ROS1 activity was reduced in the met18 mutant plants and point mutation in the conserved Fe-S cluster binding motif of ROS1 disrupted its biological function. Interestingly, a large number of DNA hypomethylated loci, especially in the CHH context, were identified from the met18 mutants and most of the hypo-DMRs were from TE regions. Our results suggest that MET18 can regulate both active DNA demethylation and DNA methylation pathways in Arabidopsis. PMID:27193999

  8. The cytosolic Fe-S cluster assembly component MET18 is required for the full enzymatic activity of ROS1 in active DNA demethylation.

    PubMed

    Wang, Xiaokang; Li, Qi; Yuan, Wei; Cao, Zhendong; Qi, Bei; Kumar, Suresh; Li, Yan; Qian, Weiqiang

    2016-01-01

    DNA methylation patterns in plants are dynamically regulated by DNA methylation and active DNA demethylation in response to both environmental changes and development of plant. Beginning with the removal of methylated cytosine by ROS1/DME family of 5-methylcytosine DNA glycosylases, active DNA demethylation in plants occurs through base excision repair. So far, many components involved in active DNA demethylation remain undiscovered. Through a forward genetic screening of Arabidopsis mutants showing DNA hypermethylation at the EPF2 promoter region, we identified the conserved iron-sulfur cluster assembly protein MET18. MET18 dysfunction caused DNA hypermethylation at more than 1000 loci as well as the silencing of reporter genes and some endogenous genes. MET18 can directly interact with ROS1 in vitro and in vivo. ROS1 activity was reduced in the met18 mutant plants and point mutation in the conserved Fe-S cluster binding motif of ROS1 disrupted its biological function. Interestingly, a large number of DNA hypomethylated loci, especially in the CHH context, were identified from the met18 mutants and most of the hypo-DMRs were from TE regions. Our results suggest that MET18 can regulate both active DNA demethylation and DNA methylation pathways in Arabidopsis. PMID:27193999

  9. Measurement of 60Co-gamma ray-induced DNA damage by capillary electrophoresis.

    PubMed

    Nackerdien, Z; Atha, D

    1996-08-01

    Capillary electrophoresis was employed in this study to monitor 60Co-gamma ray-induced damage to a 1 kb DNA ladder which consists of restriction fragments ranging from 75 to 12,000 bp. DNA samples (0.5 mg/ml) were exposed to 0-60 Gy of gamma-radiation in the presence and absence of 110 mumol/l ethidium bromide (EB). The analysis showed peak broadening without significant changes in the size distribution of irradiated fragments. Radiation-induced conformational changes may account for this peak broadening. EB addition caused small increases in the retention times of DNA fragments without affecting the overall DNA damage. This indicates that the presence of intercalated EB during radiation will not stabilize the DNA against 60Co-gamma ray-induced damage. PMID:8876442

  10. Hybrid Coupled Cluster and Molecular Dynamics Approach: Application to the Excitation Spectrum of Cytosine in the Native DNA Environment

    SciTech Connect

    Valiev, Marat; Kowalski, Karol

    2006-12-07

    Evolution of the excited state energies of cytosine base in the native DNA environment was investigated using hybrid coupled cluster and classical molecular dynamics approach. The time averaged excitation energies obtained with the variant of the completely renormalized equation-of-motion with singles, doubles, and non-iterative triples approach that includes a bulk of the correlation effects for excited states, are compared with the analogous calculations in the gas phase. Significant blue shifts for the two lowest singlet excitation energies can be observed as a result of interaction of the quantum system with surrounding environment.

  11. Distorted DNA structures induced by HMGB2 possess a high affinity for HMGB2.

    PubMed

    Nakamura, Yasuyuki; Shimizu, Mitsuhiro; Yoshida, Michiteru

    2002-01-01

    HMGB2 (HMG2) protein binds with DNA duplex in a sequence-nonspecific manner, then bends and unwinds the DNA. In DNA cyclization analyses for the bending activity of HMGB2, two unidentified bands, denoted alpha and beta, were observed in addition to monomer circular DNA (1C) on the gel. Re-electrophoresis and proteinase K digestion revealed that alpha and beta are complexes of circularized probe DNA (seeming 1C) with HMGB2 (K(d) approximately 10(-10) M). The DNA components of alpha and beta (alpha- and beta-DNA) showed higher affinities to HMGB2 than did the linear probe DNA (K(d) approximately 10(-7) M). The DNAs have distorted structures containing partial single-stranded regions. Nicked circular molecules presumably due to severe DNA distortion by HMGB2 were observed in alpha- and beta-DNA, in addition to closed circular double-stranded molecules. The alpha and beta bands were not formed in the presence of sole DNA binding regions which are necessary for DNA bending, indicating that the acidic C-tail in the HMGB2 molecule is necessary for inducing the peculiar distorted structures of higher affinity to HMGB2. HMGB2 binds with linker DNA and/or the entry and exit of nucleosomes fixed at both ends likewise mini-circles similar to alpha-DNA and beta-DNA. Thus, the distorted structures present in alpha-DNA and beta-DNA should be important in considering the functional mechanisms in which HMGB2 participates. PMID:11754747

  12. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.

    1985-05-27

    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  13. Replication-induced supercoiling: a neglected DNA transaction regulator?

    PubMed

    Yu, Haojie; Dröge, Peter

    2014-05-01

    Dynamic (-) DNA supercoiling generated in the wake of translocating protein complexes is known to occur during transcription. Recent studies indicate that (-) superhelical tension also builds up specifically in the leading duplex during replication. Here, we argue that this unrecognized supercoiling is causally involved in the regulation of key DNA transactions and deserves further consideration. PMID:24637041

  14. Weakly charged cationic nanoparticles induce DNA bending and strand separation.

    PubMed

    Railsback, Justin G; Singh, Abhishek; Pearce, Ryan C; McKnight, Timothy E; Collazo, Ramón; Sitar, Zlatko; Yingling, Yaroslava G; Melechko, Anatoli V

    2012-08-16

    Weakly charged cationic nanoparticles cause structural changes including local denaturing and compaction to DNA under mild conditions. The charged ligands bind to the phosphate backbone of DNA and the uncharged ligands penetrate the helix and disrupt base pairing. Mobility shifts in electrophoresis, molecular dynamics, and UV-vis spectrophotometry give clues to the details of the interactions. PMID:22711427

  15. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster.

    PubMed

    Lin, Chun-Chieh; Potter, Christopher J

    2016-08-01

    Gene conversions occur when genomic double-strand DNA breaks (DSBs) trigger unidirectional transfer of genetic material from a homologous template sequence. Exogenous or mutated sequence can be introduced through this homology-directed repair (HDR). We leveraged gene conversion to develop a method for genomic editing of existing transgenic insertions in Drosophila melanogaster The clustered regularly-interspaced palindromic repeats (CRISPR)/Cas9 system is used in the H: omology A: ssisted C: RISPR K: nock-in (HACK) method to induce DSBs in a GAL4 transgene, which is repaired by a single-genomic transgenic construct containing GAL4 homologous sequences flanking a T2A-QF2 cassette. With two crosses, this technique converts existing GAL4 lines, including enhancer traps, into functional QF2 expressing lines. We used HACK to convert the most commonly-used GAL4 lines (labeling tissues such as neurons, fat, glia, muscle, and hemocytes) to QF2 lines. We also identified regions of the genome that exhibited differential efficiencies of HDR. The HACK technique is robust and readily adaptable for targeting and replacement of other genomic sequences, and could be a useful approach to repurpose existing transgenes as new genetic reagents become available. PMID:27334272

  16. The Energetic Contribution of Induced Electrostatic Asymmetry to DNA Bending by a Site-Specific Protein

    PubMed Central

    Hancock, Stephen P.; Hiller, David A.; Perona, John J.; Jen-Jacobson, Linda

    2012-01-01

    DNA bending can be promoted by reducing the net negative electrostatic potential around phosphates on one face of the DNA, such that electrostatic repulsion among phosphates on the opposite face drives bending toward the less negative surface. To provide the first assessment of the energetic contribution to DNA bending when electrostatic asymmetry is induced by a site-specific DNA binding protein, we manipulated the electrostatics in the EcoRV endonuclease-DNA complex by mutation of cationic sidechains that contact DNA phosphates and/or by replacing a selected phosphate in each strand with uncharged methylphosphonate. Reducing the net negative charge at two symmetrically located phosphates on the concave DNA face contributes −2.3 to −0.9 kcal/mol (depending on position) to complex formation. In contrast, reducing negative charge on the opposing convex face produces a penalty of +1.3 kcal/mol. Förster resonance energy transfer experiments show that the extent of axial DNA bending (about 50°) is little affected in the modified complexes, implying that modification affects the energetic cost but not the extent of DNA bending. Kinetic studies show that favorable effects of induced electrostatic asymmetry on equilibrium binding derive primarily from a reduced rate of complex dissociation, suggesting stabilization of the specific complex between protein and markedly bent DNA. A smaller increase in the association rate may suggest that the DNA in the initial encounter complex is mildly bent. The data imply that protein-induced electrostatic asymmetry makes a significant contribution to DNA bending, but is not itself sufficient to drive full bending in the specific EcoRV-DNA complex. PMID:21167173

  17. In vivo binding of trimethylpsoralen detects DNA structural alterations associated with transcribing regions in the human beta-globin cluster.

    PubMed

    Jiménez-Ruiz, A; Zhang, Q; Shen, C K

    1995-12-01

    In order to increase our knowledge about the mechanisms that regulate expression of human beta-like globin genes, we have used a novel technique to analyze the chromatin structure in living cells. This approach allowed us to detect specific DNA regions in vivo where nucleosome folding or unconstrained DNA supercoiling in erythroid cells differs from that in non-erythroid cells. In this method, we use 4,5',8-trimethylpsoralen (TMP) as a probe capable of detecting altered chromatin conformations. Our results show that TMP binds to DNA with a higher affinity over the regions in the locus that are actively expressed, including both the promoter and the transcribed region. This higher affinity detected when comparing erythroid cells with non-erythroid cells does not extend to other regions inside the beta-globin cluster. Our data suggest that the observed effect is likely due to nucleosome displacement. Alternatively, it could result from localized DNA supercoiling, but not from widespread torsional stress across the entire beta-like globin locus as hypothesized previously. PMID:7499429

  18. Linearity and additivity in cluster-induced sputtering: A molecular-dynamics study of van der Waals bonded systems

    SciTech Connect

    Anders, Christian; Urbassek, Herbert M.; Johnson, Robert E.

    2004-10-15

    Using molecular-dynamics simulation, we study sputtering of a condensed-gas solid induced by the impact of atomic clusters with sizes 1{<=}n{<=}10{sup 4}. Above a nonlinear onset regime, we find a linear increase of the sputter yield Y with the total energy E of the bombarding cluster. The fitting coefficients in the linear regime depend only on the cluster size n such that for fixed bombardment energy, sputtering decreases with increasing cluster size n. We find that to a good approximation the sputter yield in this regime obeys an additivity rule in cluster size n such that doubling the cluster size at the same cluster velocity amounts to doubling the sputter yield. The sputter-limiting energy {epsilon}{sub s} is introduced which separates erosion ({epsilon}>{epsilon}{sub s}) from growth ({epsilon}<{epsilon}{sub s}) under cluster impact.

  19. Clustering and training set selection methods for improving the accuracy of quantitative laser induced breakdown spectroscopy

    NASA Astrophysics Data System (ADS)

    Anderson, Ryan B.; Bell, James F., III; Wiens, Roger C.; Morris, Richard V.; Clegg, Samuel M.

    2012-04-01

    We investigated five clustering and training set selection methods to improve the accuracy of quantitative chemical analysis of geologic samples by laser induced breakdown spectroscopy (LIBS) using partial least squares (PLS) regression. The LIBS spectra were previously acquired for 195 rock slabs and 31 pressed powder geostandards under 7 Torr CO2 at a stand-off distance of 7 m at 17 mJ per pulse to simulate the operational conditions of the ChemCam LIBS instrument on the Mars Science Laboratory Curiosity rover. The clustering and training set selection methods, which do not require prior knowledge of the chemical composition of the test-set samples, are based on grouping similar spectra and selecting appropriate training spectra for the partial least squares (PLS2) model. These methods were: (1) hierarchical clustering of the full set of training spectra and selection of a subset for use in training; (2) k-means clustering of all spectra and generation of PLS2 models based on the training samples within each cluster; (3) iterative use of PLS2 to predict sample composition and k-means clustering of the predicted compositions to subdivide the groups of spectra; (4) soft independent modeling of class analogy (SIMCA) classification of spectra, and generation of PLS2 models based on the training samples within each class; (5) use of Bayesian information criteria (BIC) to determine an optimal number of clusters and generation of PLS2 models based on the training samples within each cluster. The iterative method and the k-means method using 5 clusters showed the best performance, improving the absolute quadrature root mean squared error (RMSE) by ~ 3 wt.%. The statistical significance of these improvements was ~ 85%. Our results show that although clustering methods can modestly improve results, a large and diverse training set is the most reliable way to improve the accuracy of quantitative LIBS. In particular, additional sulfate standards and specifically fabricated

  20. Understanding the molecular mechanism of formaldehyde-induced DNA-protein crosslink repair

    EPA Science Inventory

    Formaldehyde induces DNA-protein crosslinks (DPCs) in several experimental in vitro and in vivo test systems, as well as in exposed human workers. DPCs are repaired by several DNA repair pathways in different species, but the molecular understanding of DPC repair in human tissues...

  1. DEVELOPMENT OF RAPID TECHNIQUES FOR DETECTION OF CHEMICALLY-INDUCED DNA DAMAGE

    EPA Science Inventory

    Rapid and cost-effective indicator assays are being developed which may be used as a rapid screen to assess the potential for exposure to hazardous compounds that can be related to a biological target (e.g., DNA). Chemically-induced DNA damage will be measured using surrogate DN...

  2. Chromatin Structure Following UV-Induced DNA Damage—Repair or Death?

    PubMed Central

    Farrell, Andrew W.; Halliday, Gary M.; Lyons, James Guy

    2011-01-01

    In eukaryotes, DNA is compacted into a complex structure known as chromatin. The unravelling of DNA is a crucial step in DNA repair, replication, transcription and recombination as this allows access to DNA for these processes. Failure to package DNA into the nucleosome, the individual unit of chromatin, can lead to genomic instability, driving a cell into apoptosis, senescence, or cellular proliferation. Ultraviolet (UV) radiation damage causes destabilisation of chromatin integrity. UV irradiation induces DNA damage such as photolesions and subjects the chromatin to substantial rearrangements, causing the arrest of transcription forks and cell cycle arrest. Highly conserved processes known as nucleotide and base excision repair (NER and BER) then begin to repair these lesions. However, if DNA repair fails, the cell may be forced into apoptosis. The modification of various histones as well as nucleosome remodelling via ATP-dependent chromatin remodelling complexes are required not only to repair these UV-induced DNA lesions, but also for apoptosis signalling. Histone modifications and nucleosome remodelling in response to UV also lead to the recruitment of various repair and pro-apoptotic proteins. Thus, the way in which a cell responds to UV irradiation via these modifications is important in determining its fate. Failure of these DNA damage response steps can lead to cellular proliferation and oncogenic development, causing skin cancer, hence these chromatin changes are critical for a proper response to UV-induced injury. PMID:22174650

  3. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed

    2014-01-01

    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  4. Capillary electrophoresis as a technique to analyze sequence-induced anomalously migrating DNA fragments.

    PubMed Central

    Wenz, H M

    1994-01-01

    Sequence-induced anomalous migration of double-stranded (ds) DNA in native gel electrophoresis is a well known phenomenon. The retardation of migration is more obvious in polyacrylamide compared with agarose gels, and is greatly affected by the concentration of the gel and the temperature. This anomalous migration results in a difference between calculated and actual sizes of the affected DNA fragments. A low viscosity polymer solution (DNA Fragment Analysis Reagent) under investigation for use in dsDNA analysis by capillary electrophoresis is shown to be useful for the visualization of anomalies in migration of dsDNA fragments. Comparable with traditional slab gel systems, the retardation effect, indicative of bent or curved DNA, is strongly dependent on polymer concentration and separation temperature. These dependencies have implications on the accurate sizing of dsDNA fragments with unknown sequences and secondary structures. PMID:7937124

  5. Expression of an exogenous eukaryotic DNA methyltransferase gene induces transformation of NIH 3T3 cells.

    PubMed Central

    Wu, J; Issa, J P; Herman, J; Bassett, D E; Nelkin, B D; Baylin, S B

    1993-01-01

    Abnormal regional increases in DNA methylation, which have potential for causing gene inactivation and chromosomal instability, are consistently found in immortalized and tumorigenic cells. Increased DNA methyltransferase activity, which is also a characteristic of such cells, is a candidate to mediate these abnormal DNA methylation patterns. We now show that, in NIH 3T3 mouse fibroblasts, constitutive overexpression of an exogenous mouse DNA methyltransferase gene results in a marked increase in overall DNA methylation which is accompanied by tumorigenic transformation. These transformation changes can also be elicited by dexamethasone-inducible expression of an exogenous DNA methyltransferase gene. Our findings provide strong evidence that the increase in DNA methyltransferase activity associated with tumor progression could be a key step in carcinogenesis and provide a model system that can be used to further study this possibility. Images Fig. 1 Fig. 2 PMID:8415627

  6. Hairpin DNA probes based on target-induced in situ generation of luminescent silver nanoclusters.

    PubMed

    Xiao, Yan; Wu, Zhengjun; Wong, Kwok-Yin; Liu, Zhihong

    2014-05-14

    Novel hairpin DNA probes are designed and constructed based on target-induced in situ generation of luminescent silver nanoclusters. This design allows specific and versatile detection of diverse targets with easy operation and low cost. PMID:24686790

  7. Radiation induced apoptosis and initial DNA damage are inversely related in locally advanced breast cancer patients

    PubMed Central

    2010-01-01

    Background DNA-damage assays, quantifying the initial number of DNA double-strand breaks induced by radiation, have been proposed as a predictive test for radiation-induced toxicity. Determination of radiation-induced apoptosis in peripheral blood lymphocytes by flow cytometry analysis has also been proposed as an approach for predicting normal tissue responses following radiotherapy. The aim of the present study was to explore the association between initial DNA damage, estimated by the number of double-strand breaks induced by a given radiation dose, and the radio-induced apoptosis rates observed. Methods Peripheral blood lymphocytes were taken from 26 consecutive patients with locally advanced breast carcinoma. Radiosensitivity of lymphocytes was quantified as the initial number of DNA double-strand breaks induced per Gy and per DNA unit (200 Mbp). Radio-induced apoptosis at 1, 2 and 8 Gy was measured by flow cytometry using annexin V/propidium iodide. Results Radiation-induced apoptosis increased in order to radiation dose and data fitted to a semi logarithmic mathematical model. A positive correlation was found among radio-induced apoptosis values at different radiation doses: 1, 2 and 8 Gy (p < 0.0001 in all cases). Mean DSB/Gy/DNA unit obtained was 1.70 ± 0.83 (range 0.63-4.08; median, 1.46). A statistically significant inverse correlation was found between initial damage to DNA and radio-induced apoptosis at 1 Gy (p = 0.034). A trend toward 2 Gy (p = 0.057) and 8 Gy (p = 0.067) was observed after 24 hours of incubation. Conclusions An inverse association was observed for the first time between these variables, both considered as predictive factors to radiation toxicity. PMID:20868468

  8. Repair of radiation-induced heat-labile sites is independent of DNA-PKcs, XRCC1 or PARP

    SciTech Connect

    Stenerlöw, Bo; Karlsson, Karin H.; Radulescu, Irina; Rydberg, Bjorn; Stenerlow, Bo

    2008-04-29

    Ionizing radiation induces a variety of different DNA lesions: in addition to the most critical DNA damage, the DSB, numerous base alterations, SSBs and other modifications of the DNA double-helix are formed. When several non-DSB lesions are clustered within a short distance along DNA, or close to a DSB, they may interfere with the repair of DSBs and affect the measurement of DSB induction and repair. We have previously shown that a substantial fraction of DSBs measured by pulsed-field gel electrophoresis (PFGE) are in fact due to heat-labile sites (HLS) within clustered lesions, thus reflecting an artifact of preparation of genomic DNA at elevated temperature. To further characterize the influence of HLS on DSB induction and repair, four human cell lines (GM5758, GM7166, M059K, U-1810) with apparently normal DSB rejoining were tested for bi-phasic rejoining after gamma irradiation. When heat-released DSBs were excluded from the measurements the fraction of fast rejoining decreased to less than 50% of the total. However, neither the half-times of the fast (t{sub 1/2} = 7-8 min) or slow (t{sub 1/2} = 2.5 h) DSB rejoining were changed significantly. At t=0 the heat-released DSBs accounted for almost 40% of the DSBs, corresponding to 10 extra DSB/cell/Gy in the initial DSB yield. These heat-released DSBs were repaired within 60-90 min in all tested cells, including M059K cells treated with wortmannin or DNA-PKcs defect M059J cells. Furthermore, cells lacking XRCC1 or Poly(ADP-ribose) polymerase-1 (PARP-1) rejoined both total DSBs and heat-released DSBs similar to normal cells. In summary, the presence of heat-labile sites have a substantial impact on DSB induction yields and DSB rejoining rates measured by pulsed-field gel electrophoresis, and HLS repair is independent of DNA-PKcs, XRCC1 and PARP.

  9. DNA Processing Proteins Involved in the UV-Induced Stress Response of Sulfolobales

    PubMed Central

    van Wolferen, Marleen; Ma, Xiaoqing

    2015-01-01

    ABSTRACT The ups operon of Sulfolobus species is highly induced upon UV stress. Previous studies showed that the pili encoded by this operon are involved in cellular aggregation, which is essential for subsequent DNA exchange between cells, resulting in homologous recombination. The presence of this pilus system increases the fitness of Sulfolobus cells under UV light-induced stress conditions, as the transfer of DNA takes place in order to repair UV-induced DNA lesions via homologous recombination. Four conserved genes (saci_1497 to saci_1500) which encode proteins with putative DNA processing functions are present downstream of the ups operon. In this study, we show that after UV treatment the cellular aggregation of strains with saci_1497, saci_1498, and saci_1500 deletions is similar to that of wild-type strains; their survival rates, however, were reduced and similar to or lower than those of the pilus deletion strains, which could not aggregate anymore. DNA recombination assays indicated that saci_1498, encoding a ParB-like protein, plays an important role in DNA transfer. Moreover, biochemical analysis showed that the endonuclease III encoded by saci_1497 nicks UV-damaged DNA. In addition, RecQ-like helicase Saci_1500 is able to unwind homologous recombination intermediates, such as Holliday junctions. Interestingly, a saci_1500 deletion mutant was more sensitive to UV light but not to the replication-stalling agents hydroxyurea and methyl methanesulfonate, suggesting that Saci_1500 functions specifically in the UV damage pathway. Together these results suggest a role of Saci_1497 to Saci_1500 in the repair or transfer of DNA that takes place after UV-induced damage to the genomic DNA of Sulfolobus acidocaldarius. IMPORTANCE Sulfolobales species increase their fitness after UV stress by a UV-inducible pilus system that enables high rates of DNA exchange between cells. Downstream of the pilus operon, three genes that seem to play a role in the repair or

  10. Oxidative DNA damage induced by di-(2-ethylhexyl) phthalate in HEK-293 cell line.

    PubMed

    Wang, Xuan; Jiang, Lijie; Ge, Lan; Chen, Min; Yang, Guang; Ji, Fang; Zhong, Laifu; Guan, Yingjie; Liu, Xiaofang

    2015-05-01

    Di-(2-ethylhexyl) phthalate (DEHP) is commonly employed as a plasticizer. We have found that exposure of human embryonic kidney cell line 293 (HEK-293) to DEHP resulted in a crucial dose-dependent increase of DNA strand breaks in a comet assay. To elucidate the role of glutathione (GSH) in the DNA damage, the cells were pretreated with buthionine-(S,R)-sulfoximine (BSO) and pretreated with N-acetylcysteine (NAC), a GSH precursor. Here we show that depletion of GSH in HEK-293 cells with BSO dramatically increased the susceptibility of HEK-293 cells to DEHP-induced DNA damage. Furthermore, when the intracellular GSH content was elevated by NAC, the DNA damage induced by DEHP was almost completely abolished. In addition, DEHP had effect on lysosomal or mitochondrial damage at high dose level. These results indicate that DEHP exerts genotoxic effects in HEK-293 cells, probably through DNA damage induced by oxidative stress; GSH is responsible for cellular defense against DEHP-induced DNA damage; lysosome and mitochondria may be the vital targets in DEHP-induced DNA damage. PMID:25899473

  11. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  12. Mycobacterium tuberculosis WhiB1 is an essential DNA-binding protein with a nitric oxide-sensitive iron-sulfur cluster.

    PubMed

    Smith, Laura J; Stapleton, Melanie R; Fullstone, Gavin J M; Crack, Jason C; Thomson, Andrew J; Le Brun, Nick E; Hunt, Debbie M; Harvey, Evelyn; Adinolfi, Salvatore; Buxton, Roger S; Green, Jeffrey

    2010-12-15

    Mycobacterium tuberculosis is a major pathogen that has the ability to establish, and emerge from, a persistent state. Wbl family proteins are associated with developmental processes in actinomycetes, and M. tuberculosis has seven such proteins. In the present study it is shown that the M. tuberculosis H37Rv whiB1 gene is essential. The WhiB1 protein possesses a [4Fe-4S]2+ cluster that is stable in air but reacts rapidly with eight equivalents of nitric oxide to yield two dinuclear dinitrosyl-iron thiol complexes. The [4Fe-4S] form of WhiB1 did not bind whiB1 promoter DNA, but the reduced and oxidized apo-WhiB1, and nitric oxide-treated holo-WhiB1 did bind to DNA. Mycobacterium smegmatis RNA polymerase induced transcription of whiB1 in vitro; however, in the presence of apo-WhiB1, transcription was severely inhibited, irrespective of the presence or absence of the CRP (cAMP receptor protein) Rv3676, which is known to activate whiB1 expression. Footprinting suggested that autorepression of whiB1 is achieved by apo-WhiB1 binding at a region that overlaps the core promoter elements. A model incorporating regulation of whiB1 expression in response to nitric oxide and cAMP is discussed with implications for sensing two important signals in establishing M. tuberculosis infections. PMID:20929442

  13. Protection of DNA From Ionizing Radiation-Induced Lesions by Asiaticoside.

    PubMed

    Joy, Jisha; Alarifi, Saud; Alsuhaibani, Entissar; Nair, Cherupally K Krishnan

    2015-01-01

    This study aims to investigate whether asiaticoside, a triterpene glycoside, can afford protection to DNA from alterations induced by gamma radiation under in vitro, ex vivo, and in vivo conditions. In vitro studies were done on plasmid pBR322 DNA, ex vivo studies were done on cellular DNA of human peripheral blood leukocytes, and in vivo investigations were conducted on cellular DNA of spleen and bone marrow cells of mice exposed to whole-body gamma radiation. The supercoiled form of the plasmid pBR322 DNA upon exposure to the radiation was converted into relaxed open circular form due to induction of strand breaks. Presence of asiaticoside along with the DNA during irradiation prevented the relaxation of the supercoiled form to the open circular form. When human peripheral blood leukocytes were exposed to gamma radiation, the cellular DNA suffered strand breaks as evidenced by the increased comet parameters in an alkaline comet assay. Asiaticoside, when present along with blood during irradiation ex vivo, prevented the strand breaks and the comet parameters were closer to that of the controls. Whole-body exposure of mice to gamma radiation resulted in a significant increase in comet parameters of DNA of bone marrow and spleen cells of mice as a result of radiation-induced strand breaks in DNA. Administration of asiaticoside prior to whole-body radiation exposure of the mice prevented this increase in radiation-induced increase in comet parameters, which could be the result of protection to DNA under in vivo conditions of radiation exposure. Thus, it can be concluded from the results that asiaticoside can offer protection to DNA from radiation-induced alterations under in vitro, ex vivo, and in vivo conditions. PMID:26756427

  14. Increased Mitochondrial DNA Induces Acquired Docetaxel Resistance in Head and Neck Cancer Cells

    PubMed Central

    Mizumachi, T; Suzuki, S; Naito, A; Carcel-Trullols, J; Evans, TT; Spring, PM; Oridate, N; Furuta, Y; Fukuda, S; Higuchi, M

    2008-01-01

    Docetaxel is one of the most effective chemotherapeutic agents against cancer; nevertheless, some patients develop resistance. Unfortunately, their causes and mechanisms remain unknown. We created docetaxel-resistant DRHEp2 from human laryngeal cancer HEp2 and investigated the roles of mitochondrial DNA (mtDNA) and ROS on docetaxel resistance. DRHEp2 had greatly increased mtDNA content. Reduction of mtDNA content in DRHEp2 by ethidium bromide treatment reduced the resistance. These results indicate the possible roles of mtDNA-coded enzymes in mitochondrial respiratory chain (MRC) in resistant mechanisms. Oligomycin A, an Fo-ATPase inhibitor, eliminated docetaxel resistance in DRHEp2. In contrast, inhibitors of other MRC did not. RNA interference targeted to Fo-ATPase d-subunit restored docetaxel-induced cytotoxicity to DRHEp2. These results indicate the roles of Fo-ATPase for resistant mechanisms. Docetaxel induced ROS generation in HEp2 but not in DRHEp2 and antioxidant pyrrolidine dithiocarbamate eliminated docetaxel-induced cytotoxicity, suggesting roles of ROS in docetaxel-induced cell death. Furthermore, inhibition of Fo-ATPase by Oligomycin A induced docetaxel–mediated ROS generation in DRHEp2. Taken together, DRHEp2 acquired docetaxel resistance through increasing Fo-ATPase, which led to diminish docetaxel-induced ROS generation and subsequently inhibited cell death. In conclusion, mtDNA plays an important role in developing docetaxel resistance through the reduction of ROS generation by regulating Fo-ATPase. PMID:17637738

  15. The ovarian DNA damage repair response is induced prior to phosphoramide mustard-induced follicle depletion, and ataxia telangiectasia mutated inhibition prevents PM-induced follicle depletion.

    PubMed

    Ganesan, Shanthi; Keating, Aileen F

    2016-02-01

    Phosphoramide mustard (PM) is an ovotoxic metabolite of cyclophosphamide and destroys primordial and primary follicles potentially by DNA damage induction. The temporal pattern by which PM induces DNA damage and initiation of the ovarian response to DNA damage has not yet been well characterized. This study investigated DNA damage initiation, the DNA repair response, as well as induction of follicular demise using a neonatal rat ovarian culture system. Additionally, to delineate specific mechanisms involved in the ovarian response to PM exposure, utility was made of PKC delta (PKCδ) deficient mice as well as an ATM inhibitor (KU 55933; AI). Fisher 344 PND4 rat ovaries were cultured for 12, 24, 48 or 96h in medium containing DMSO ±60μM PM or KU 55933 (48h; 10nM). PM-induced activation of DNA damage repair genes was observed as early as 12h post-exposure. ATM, PARP1, E2F7, P73 and CASP3 abundance were increased but RAD51 and BCL2 protein decreased after 96h of PM exposure. PKCδ deficiency reduced numbers of all follicular stages, but did not have an additive impact on PM-induced ovotoxicity. ATM inhibition protected all follicle stages from PM-induced depletion. In conclusion, the ovarian DNA damage repair response is active post-PM exposure, supporting that DNA damage contributes to PM-induced ovotoxicity. PMID:26708502

  16. Zingerone protects against stannous chloride-induced and hydrogen peroxide-induced oxidative DNA damage in vitro.

    PubMed

    Rajan, Iyappan; Narayanan, Nithya; Rabindran, Remitha; Jayasree, P R; Manish Kumar, P R

    2013-12-01

    In this paper, we report the dose-dependent antioxidant activity and DNA protective effects of zingerone. At 500 μg/mL, the DPPH radical scavenging activity of zingerone and ascorbic acid as a standard was found to be 86.7 and 94.2 % respectively. At the same concentration, zingerone also showed significant reducing power (absorbance 0.471) compared to that of ascorbic acid (absorbance 0.394). The in vitro toxicity of stannous chloride (SnCl2) was evaluated using genomic and plasmid DNA. SnCl2-induced degradation of genomic DNA was found to occur at a concentration of 0.8 mM onwards with complete degradation at 1.02 mM and above. In the case of plasmid DNA, conversion of supercoiled DNA into the open circular form indicative of DNA nicking activity was observed at a concentration of 0.2 mM onwards; complete conversion was observed at a concentration of 1.02 mM and above. Zingerone was found to confer protection against SnCl2-induced oxidative damage to genomic and plasmid DNA at concentrations of 500 and 750 μg/mL onwards, respectively. This protective effect was further confirmed in the presence of UV/H2O2-a known reactive oxygen species (ROS) generating system-wherein protection by zingerone against ROS-mediated DNA damage was observed at a concentration of 250 μg/mL onwards in a dose-dependent manner. This study clearly indicated the in vitro DNA protective property of zingerone against SnCl2-induced, ROS-mediated DNA damage. PMID:24006104

  17. Epigenetic clustering of gastric carcinomas based on DNA methylation profiles at the precancerous stage: its correlation with tumor aggressiveness and patient outcome

    PubMed Central

    Yamanoi, Kazuhiro; Arai, Eri; Tian, Ying; Takahashi, Yoriko; Miyata, Sayaka; Sasaki, Hiroki; Chiwaki, Fumiko; Ichikawa, Hitoshi; Sakamoto, Hiromi; Kushima, Ryoji; Katai, Hitoshi; Yoshida, Teruhiko; Sakamoto, Michiie; Kanai, Yae

    2015-01-01

    The aim of this study was to clarify the significance of DNA methylation alterations during gastric carcinogenesis. Single-CpG resolution genome-wide DNA methylation analysis using the Infinium assay was performed on 109 samples of non-cancerous gastric mucosa (N) and 105 samples of tumorous tissue (T). DNA methylation alterations in T samples relative to N samples were evident for 3861 probes. Since N can be at the precancerous stage according to the field cancerization concept, unsupervised hierarchical clustering based on DNA methylation levels was performed on N samples (βN) using the 3861 probes. This divided the 109 patients into three clusters: A (n = 20), B1 (n = 20), and B2 (n = 69). Gastric carcinomas belonging to Cluster B1 showed tumor aggressiveness more frequently than those belonging to Clusters A and B2. The recurrence-free and overall survival rates of patients in Cluster B1 were lower than those of patients in Clusters A and B2. Sixty hallmark genes for which βN characterized the epigenetic clustering were identified. We then focused on DNA methylation levels in T samples (βT) of the 60 hallmark genes. In 48 of them, including the ADAM23, OLFM4, AMER2, GPSM1, CCL28, DTX1 and COL23A1 genes, βT was again significantly correlated with tumor aggressiveness, and the recurrence-free and/or overall survival rates. Multivariate analyses revealed that βT was a significant prognostic factor, being independent of clinicopathological parameters. These data indicate that DNA methylation profiles at the precancerous stage may be inherited by gastric carcinomas themselves, thus determining tumor aggressiveness and patient outcome. PMID:25740824

  18. The severity of alpha-particle-induced DNA damage is revealed by exposure to cell-free extracts

    SciTech Connect

    Hodgkins, P.S.; O`Neill, P.; Stevens, D.; Fairman, M.P.

    1996-12-01

    The rejoining of single-strand breaks induced by {alpha}-particle and {gamma} irradiation in plasmid DNA under two scavenging conditions has been compared. At the two scavenger conditions has been compared. At the two scavenger capacities used of 1.5 {times} 10{sup 7} and 3 {times} 10{sup 8}s{sup {minus}1} using Tris-HCl as the scavenger, the ratio of single- to double-strand breaks for {alpha} particles is fivefold less than the corresponding ratios for {gamma} irradiation. The repair of such radiation-induced single-strand breaks has been examined using a cell-free system derived from human whole-cell extracts. We show that the rejoining of single-strand breaks for both {alpha}-particle- and {gamma}-irradiated plasmid is dependent upon the scavenging capacity and that the efficiency of rejoining of {alpha}-particle-induced single-strand breaks is significantly less than that observed for {gamma}-ray-induced breaks. In addition, for DNA that had been irradiated under conditions that mimic the cellular environment with respect to the radical scavenging capacity, 50 of {alpha}-particle-induced single-strand breaks are converted to double-strand breaks, in contrast with only {approximately}12% conversion of {gamma}-ray-induced single-strand breaks, indicating that the initial damage caused by {alpha} particles is more severe. These studies provide experimental evidence for increased clustering of damage which may have important implications for the induction of cancer by low-level {alpha}-particle sources such as domestic radon. 37 refs., 5 figs., 1 tab.

  19. Epigenetic clustering of lung adenocarcinomas based on DNA methylation profiles in adjacent lung tissue: Its correlation with smoking history and chronic obstructive pulmonary disease.

    PubMed

    Sato, Takashi; Arai, Eri; Kohno, Takashi; Takahashi, Yoriko; Miyata, Sayaka; Tsuta, Koji; Watanabe, Shun-ichi; Soejima, Kenzo; Betsuyaku, Tomoko; Kanai, Yae

    2014-07-15

    The aim of this study was to clarify the significance of DNA methylation alterations during lung carcinogenesis. Infinium assay was performed using 139 paired samples of non-cancerous lung tissue (N) and tumorous tissue (T) from a learning cohort of patients with lung adenocarcinomas (LADCs). Fifty paired N and T samples from a validation cohort were also analyzed. DNA methylation alterations on 1,928 probes occurred in N samples relative to normal lung tissue from patients without primary lung tumors, and were inherited by, or strengthened in, T samples. Unsupervised hierarchical clustering using DNA methylation levels in N samples on all 26,447 probes subclustered patients into Cluster I (n = 32), Cluster II (n = 35) and Cluster III (n = 72). LADCs in Cluster I developed from the inflammatory background in chronic obstructive pulmonary disease (COPD) in heavy smokers and were locally invasive. Most patients in Cluster II were non-smokers and had a favorable outcome. LADCs in Cluster III developed in light smokers were most aggressive (frequently showing lymphatic and blood vessel invasion, lymph node metastasis and an advanced pathological stage), and had a poor outcome. DNA methylation levels of hallmark genes for each cluster, such as IRX2, HOXD8, SPARCL1, RGS5 and EI24, were again correlated with clinicopathological characteristics in the validation cohort. DNA methylation profiles reflecting carcinogenetic factors such as smoking and COPD appear to be established in non-cancerous lung tissue from patients with LADCs and may determine the aggressiveness of tumors developing in individual patients, and thus patient outcome. PMID:24921089

  20. Epigenetic clustering of lung adenocarcinomas based on DNA methylation profiles in adjacent lung tissue: Its correlation with smoking history and chronic obstructive pulmonary disease

    PubMed Central

    Sato, Takashi; Arai, Eri; Kohno, Takashi; Takahashi, Yoriko; Miyata, Sayaka; Tsuta, Koji; Watanabe, Shun-ichi; Soejima, Kenzo; Betsuyaku, Tomoko; Kanai, Yae

    2014-01-01

    The aim of this study was to clarify the significance of DNA methylation alterations during lung carcinogenesis. Infinium assay was performed using 139 paired samples of non-cancerous lung tissue (N) and tumorous tissue (T) from a learning cohort of patients with lung adenocarcinomas (LADCs). Fifty paired N and T samples from a validation cohort were also analyzed. DNA methylation alterations on 1,928 probes occurred in N samples relative to normal lung tissue from patients without primary lung tumors, and were inherited by, or strengthened in, T samples. Unsupervised hierarchical clustering using DNA methylation levels in N samples on all 26,447 probes subclustered patients into Cluster I (n = 32), Cluster II (n = 35) and Cluster III (n = 72). LADCs in Cluster I developed from the inflammatory background in chronic obstructive pulmonary disease (COPD) in heavy smokers and were locally invasive. Most patients in Cluster II were non-smokers and had a favorable outcome. LADCs in Cluster III developed in light smokers were most aggressive (frequently showing lymphatic and blood vessel invasion, lymph node metastasis and an advanced pathological stage), and had a poor outcome. DNA methylation levels of hallmark genes for each cluster, such as IRX2, HOXD8, SPARCL1, RGS5 and EI24, were again correlated with clinicopathological characteristics in the validation cohort. DNA methylation profiles reflecting carcinogenetic factors such as smoking and COPD appear to be established in non-cancerous lung tissue from patients with LADCs and may determine the aggressiveness of tumors developing in individual patients, and thus patient outcome. PMID:24921089

  1. Neutron stars and millisecond pulsars from accretion-induced collapse in globular clusters

    NASA Technical Reports Server (NTRS)

    Bailyn, Charles D.; Grindlay, Jonathan E.

    1990-01-01

    This paper examines the limits on the number of millisecond pulsars which could be formed in globular clusters by the generally accepted scenario (in which a neutron star is created by the supernova of an initially massive star and subsequently captures a companion to form a low-mass X-ray binary which eventually becomes a millisecond pulsar). It is found that, while the number of observed low-mass X-ray binaries can be adequately explained in this way, the reasonable assumption that the pulsar luminosity function in clusters extends below the current observational limits down to the luminosity of the faintest millisecond pulsars in the field suggests a cluster population of millisecond pulsars which is substantially larger than the standard model can produce. Alleviating this problem by postulating much shorter lifetimes for the X-ray binaries requires massive star populations sufficiently large that the mass loss resulting from their evolution would be likely to unbind the cluster. It is argued that neutron star formation in globular clusters by accretion-induced collapse of white dwarfs may resolve the discrepancy in birthrates.

  2. Susceptibility to Exercise-Induced Muscle Damage: a Cluster Analysis with a Large Sample.

    PubMed

    Damas, F; Nosaka, K; Libardi, C A; Chen, T C; Ugrinowitsch, C

    2016-07-01

    We investigated the responses of indirect markers of exercise-induced muscle damage (EIMD) among a large number of young men (N=286) stratified in clusters based on the largest decrease in maximal voluntary contraction torque (MVC) after an unaccustomed maximal eccentric exercise bout of the elbow flexors. Changes in MVC, muscle soreness (SOR), creatine kinase (CK) activity, range of motion (ROM) and upper-arm circumference (CIR) before and for several days after exercise were compared between 3 clusters established based on MVC decrease (low, moderate, and high responders; LR, MR and HR). Participants were allocated to LR (n=61), MR (n=152) and HR (n=73) clusters, which depicted significantly different cluster centers of 82%, 61% and 42% of baseline MVC, respectively. Once stratified by MVC decrease, all muscle damage markers were significantly different between clusters following the same pattern: small changes for LR, larger changes for MR, and the largest changes for HR. Stratification of individuals based on the magnitude of MVC decrease post-exercise greatly increases the precision in estimating changes in EIMD by proxy markers such as SOR, CK activity, ROM and CIR. This indicates that the most commonly used markers are valid and MVC orchestrates their responses, consolidating the role of MVC as the best EIMD indirect marker. PMID:27116346

  3. Plasma protein induced clustering of red blood cells in micro capillaries

    NASA Astrophysics Data System (ADS)

    Wagner, Christian; Brust, Mathias; Aouane, Othmane; Flormann, Daniel; Thiebaud, Marine; Verdier, Claude; Coupier, Gwennou; Podgorski, Thomas; Misbah, Chaouqi; Selmi, Hassib

    2013-11-01

    The plasma molecule fibrinogen induces aggregation of RBCs to clusters, the so called rouleaux. Higher shear rates in bulk flow can break them up which results in the pronounced shear thinning of blood. This led to the assumption that rouleaux formation does not take place in the microcapillaries of the vascular network where high shear rates are present. However, the question is of high medical relevance. Cardio vascular disorders are still the main cause of death in the western world and cardiac patients have often higher fibrinogen level. We performed AFM based single cell force spectroscopy to determine the work of separation. Measurements at low hematocrit in a microfluidic channel show that the number of size of clusters is determined by the adhesion strength and we found that cluster formation is strongly enhanced by fibrinogen at physiological concentrations, even at shear rate as high as 1000 1/s. Numerical simulations based on a boundary integral method confirm our findings and the clustering transition takes place both in the experiments and in the simulations at the same interaction energies. In vivo measurements with intravital fluorescence microscopy in a dorsal skin fold chamber in a mouse reveal that RBCs indeed form clusters in the micrcapillary flow. This work was supported by the German Science Foundation research imitative SFB1027.

  4. Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.

    PubMed

    Schellenberg, Matthew J; Perera, Lalith; Strom, Christina N; Waters, Crystal A; Monian, Brinda; Appel, C Denise; Vilas, Caroline K; Williams, Jason G; Ramsden, Dale A; Williams, R Scott

    2016-05-01

    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA-protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg(2+)-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg(2+) binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons. PMID:27060144

  5. Clustering-Induced Attraction in Granular Mixtures of Rods and Spheres

    PubMed Central

    2016-01-01

    Depletion-induced aggregation of rods enhanced by clustering is observed to produce a novel model of attractive pairs of rods separated by a line of spheres in a quasi-2D, vertically-shaken, granular gas of rods and spheres. We show that the stability of these peculiar granular aggregates increases as a function of shaking intensity. Velocity distributions of spheres inside and outside of a pair of rods trapping a line of spheres show a clear suppression of the momentum acquired by the trapped spheres. The condensed phase formed between the rods is caused by a clustering instability of the trapped spheres, enhanced by a vertical guidance produced by the confining rods. The liberated area corresponding to direct excluded-volume pairs and indirect depletion-aggregated pairs is measured as a function of time. The stability of rod pairs mediated by spheres reveals an attraction comparable in strength to the one purely induced by depletion forces. PMID:27218804

  6. The Cytosolic Iron-Sulfur Cluster Assembly Protein MMS19 Regulates Transcriptional Gene Silencing, DNA Repair, and Flowering Time in Arabidopsis.

    PubMed

    Han, Yong-Feng; Huang, Huan-Wei; Li, Lin; Cai, Tao; Chen, She; He, Xin-Jian

    2015-01-01

    MMS19 is an essential component of the cytoplasmic iron-sulfur (Fe-S) cluster assembly complex in fungi and mammals; the mms19 null mutant alleles are lethal. Our study demonstrates that MMS19/MET18 in Arabidopsis thaliana interacts with the cytoplasmic Fe-S cluster assembly complex but is not an essential component of the complex. We find that MMS19 also interacts with the catalytic subunits of DNA polymerases, which have been demonstrated to be involved in transcriptional gene silencing (TGS), DNA repair, and flowering time regulation. Our results indicate that MMS19 has a similar biological function, suggesting a functional link between MMS19 and DNA polymerases. In the mms19 null mutant, the assembly of Fe-S clusters on the catalytic subunit of DNA polymerase α is reduced but not blocked, which is consistent with the viability of the mutant. Our study suggests that MMS19 assists the assembly of Fe-S clusters on DNA polymerases in the cytosol, thereby facilitating transcriptional gene silencing, DNA repair, and flowering time control. PMID:26053632

  7. Genetic lineages of undifferentiated-type gastric carcinomas analysed by unsupervised clustering of genomic DNA microarray data

    PubMed Central

    2013-01-01

    Background It is suspected that early gastric carcinoma (GC) is a dormant variant that rarely progresses to advanced GC. We demonstrated that the dormant and aggressive variants of tubular adenocarcinomas (TUBs) of the stomach are characterized by loss of MYC and gain of TP53 and gain of MYC and/or loss of TP53, respectively. The aim of this study is to determine whether this is also the case in undifferentiated-type GCs (UGCs) of different genetic lineages: one with a layered structure (LS+), derived from early signet ring cell carcinomas (SIGs), and the other, mostly poorly differentiated adenocarcinomas, without LS but with a minor tubular component (TC), dedifferentiated from TUBs (LS−/TC+). Methods Using 29 surgically resected stomachs with 9 intramucosal and 20 invasive UGCs (11 LS+ and 9 LS−/TC+), 63 genomic DNA samples of mucosal and invasive parts and corresponding reference DNAs were prepared from formalin-fixed, paraffin-embedded tissues with laser microdissection, and were subjected to array-based comparative genomic hybridization (aCGH), using 60K microarrays, and subsequent unsupervised, hierarchical clustering. Of 979 cancer-related genes assessed, we selected genes with mean copy numbers significantly different between the two major clusters. Results Based on similarity in genomic copy-number profile, the 63 samples were classified into two major clusters. Clusters A and B, which were rich in LS+ UGC and LS−/TC+ UGC, respectively, were discriminated on the basis of 40 genes. The aggressive pattern was more frequently detected in LS−/TC+ UGCs, (20/26; 77%), than in LS+UGCs (17/37; 46%; P = 0.0195), whereas no dormant pattern was detected in any of the UGC samples. Conclusions In contrast to TUBs, copy number alterations of MYC and TP53 exhibited an aggressive pattern in LS+ SIG at early and advanced stages, indicating that early LS+ UGCs inevitably progress to an advanced GC. Cluster B (enriched in LS−/TC+) exhibited more

  8. Ultrasound-induced DNA damage and signal transductions indicated by gammaH2AX

    NASA Astrophysics Data System (ADS)

    Furusawa, Yukihiro; Fujiwara, Yoshisada; Zhao, Qing-Li; Hassan, Mariame Ali; Ogawa, Ryohei; Tabuchi, Yoshiaki; Takasaki, Ichiro; Takahashi, Akihisa; Ohnishi, Takeo; Kondo, Takashi

    2011-09-01

    Ultrasound (US) has been shown to induce cancer cell death via different forms including apoptosis. Here, we report the potential of low-intensity pulsed US (LIPUS) to induce genomic DNA damage and subsequent DNA damage response. Using the ionizing radiation-induced DNA double-strand breaks (DSBs) as the positive control, we were able to observe the induction of DSBs (as neutral comet tails) and the subsequent formation of gammaH2AX-positive foci (by immunofluorescence detection) in human leukemia cells following exposure to LIPUS. The LIPUS-induced DNA damage arose most likely from the mechanical, but not sonochemical, effect of cavitation, based on our observation that the suppression of inertial cavitation abrogated the gammH2AX foci formation, whereas scavenging of free radical formation (e.g., hydroxyl radical) had no protective effect on it. Treatment with the specific kinase inhibitor of ATM or DNA-PKcs, which can phosphorylate H2AX Ser139, revealed that US-induced gammaH2AX was inhibited more effectively by the DNA-PK inhibitor than ATM kinase inhibitor. Notably, these inhibitor effects were opposite to those with radiation-induced gammH2AX. In conclusion, we report, for the first time that US can induce DNA damage and the DNA damage response as indicated by gammaH2AX was triggered by the cavitational mechanical effects. Thus, it is expected that the data shown here may provide a better understanding of the cellular responses to US.

  9. Photo-induced transformation process at gold clusters-semiconductor interface: Implications for the complexity of gold clusters-based photocatalysis

    PubMed Central

    Liu, Siqi; Xu, Yi-Jun

    2016-01-01

    The recent thrust in utilizing atomically precise organic ligands protected gold clusters (Au clusters) as photosensitizer coupled with semiconductors for nano-catalysts has led to the claims of improved efficiency in photocatalysis. Nonetheless, the influence of photo-stability of organic ligands protected-Au clusters at the Au/semiconductor interface on the photocatalytic properties remains rather elusive. Taking Au clusters–TiO2 composites as a prototype, we for the first time demonstrate the photo-induced transformation of small molecular-like Au clusters to larger metallic Au nanoparticles under different illumination conditions, which leads to the diverse photocatalytic reaction mechanism. This transformation process undergoes a diffusion/aggregation mechanism accompanied with the onslaught of Au clusters by active oxygen species and holes resulting from photo-excited TiO2 and Au clusters. However, such Au clusters aggregation can be efficiently inhibited by tuning reaction conditions. This work would trigger rational structural design and fine condition control of organic ligands protected-metal clusters-semiconductor composites for diverse photocatalytic applications with long-term photo-stability. PMID:26947754

  10. Photo-induced transformation process at gold clusters-semiconductor interface: Implications for the complexity of gold clusters-based photocatalysis

    NASA Astrophysics Data System (ADS)

    Liu, Siqi; Xu, Yi-Jun

    2016-03-01

    The recent thrust in utilizing atomically precise organic ligands protected gold clusters (Au clusters) as photosensitizer coupled with semiconductors for nano-catalysts has led to the claims of improved efficiency in photocatalysis. Nonetheless, the influence of photo-stability of organic ligands protected-Au clusters at the Au/semiconductor interface on the photocatalytic properties remains rather elusive. Taking Au clusters–TiO2 composites as a prototype, we for the first time demonstrate the photo-induced transformation of small molecular-like Au clusters to larger metallic Au nanoparticles under different illumination conditions, which leads to the diverse photocatalytic reaction mechanism. This transformation process undergoes a diffusion/aggregation mechanism accompanied with the onslaught of Au clusters by active oxygen species and holes resulting from photo-excited TiO2 and Au clusters. However, such Au clusters aggregation can be efficiently inhibited by tuning reaction conditions. This work would trigger rational structural design and fine condition control of organic ligands protected-metal clusters-semiconductor composites for diverse photocatalytic applications with long-term photo-stability.

  11. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome.

    PubMed Central

    Heilbronn, R; zur Hausen, H

    1989-01-01

    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of six HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensible for SV40 DNA amplification. Our results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo. Images PMID:2547992

  12. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

    SciTech Connect

    Heilbronn, R.; zur Hausen, H. )

    1989-09-01

    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

  13. Variable requirements for DNA-binding proteins at polycomb-dependent repressive regions in human HOX clusters.

    PubMed

    Woo, Caroline J; Kharchenko, Peter V; Daheron, Laurence; Park, Peter J; Kingston, Robert E

    2013-08-01

    Polycomb group (PcG)-mediated repression is an evolutionarily conserved process critical for cell fate determination and maintenance of gene expression during embryonic development. However, the mechanisms underlying PcG recruitment in mammals remain unclear since few regulatory sites have been identified. We report two novel prospective PcG-dependent regulatory elements within the human HOXB and HOXC clusters and compare their repressive activities to a previously identified element in the HOXD cluster. These regions recruited the PcG proteins BMI1 and SUZ12 to a reporter construct in mesenchymal stem cells and conferred repression that was dependent upon PcG expression. Furthermore, we examined the potential of two DNA-binding proteins, JARID2 and YY1, to regulate PcG activity at these three elements. JARID2 has differential requirements, whereas YY1 appears to be required for repressive activity at all 3 sites. We conclude that distinct elements of the mammalian HOX clusters can recruit components of the PcG complexes and confer repression, similar to what has been seen in Drosophila. These elements, however, have diverse requirements for binding factors, which, combined with previous data on other loci, speaks to the complexity of PcG targeting in mammals. PMID:23775117

  14. HMGB1-DNA Complex-induced Autophagy Limits AIM2 Inflammasome Activation through RAGE

    PubMed Central

    Liu, Liying; Yang, Minghua; Kang, Rui; Yu, Yan; Dai, Yunpen; Gao, Fei; Wang, Hongmei; Sun, Xiaojun; Li, Xiuli; Li, Jianhua; Wang, Haichao; Cao, Lizhi; Tang, Daolin

    2014-01-01

    High mobility group box 1 (HMGB1) is a prototype damage-associated molecular pattern (DAMP) that can induce inflammatory and immune responses alone as well as in combination with other molecules such as DNA. However, the intricate molecular mechanisms underlying HMGB1-DNA complex-mediated innate immune response remains largely elusive. In this study, we demonstrated that HMGB1-DNA complex initially induced absent in melanoma 2 (AIM2)-dependent inflammasome activation, and promoted rapid release of inflammasome-dependent early proinflammatory cytokines such as interleukin 1β (IL-1β). Subsequently, HMGB1-DNA complex stimulated an ATG5-dependent cellular degradation process, autophagy, which was paralleled by a cessation of AIM2 inflammasome activation and IL-1β release. These HMGB1-DNA complex-induced inflammasome activation and autophagy were both dependent on the receptor for advanced glycation endproducts (RAGE) that recognizes a wide array of ligands (including HMGB1 and DNA). Thus, autophagy may function as a negative counter-regulatory mechanism for HMGB1-DNA complex-induced inflammasome activation, and provide a checkpoint to limit the development of inflammation. PMID:24971542

  15. Fibrinogen-induced perivascular microglial clustering is required for the development of axonal damage in neuroinflammation

    PubMed Central

    Davalos, Dimitrios; Kyu Ryu, Jae; Merlini, Mario; Baeten, Kim M.; Le Moan, Natacha; Petersen, Mark A.; Deerinck, Thomas J.; Smirnoff, Dimitri S.; Bedard, Catherine; Hakozaki, Hiroyuki; Gonias Murray, Sara; Ling, Jennie B.; Lassmann, Hans; Degen, Jay L.; Ellisman, Mark H.; Akassoglou, Katerina

    2012-01-01

    Blood-brain barrier disruption, microglial activation and neurodegeneration are hallmarks of multiple sclerosis. However, the initial triggers that activate innate immune responses and their role in axonal damage remain unknown. Here we show that the blood protein fibrinogen induces rapid microglial responses toward the vasculature and is required for axonal damage in neuroinflammation. Using in vivo two-photon microscopy, we demonstrate that microglia form perivascular clusters before myelin loss or paralysis onset and that, of the plasma proteins, fibrinogen specifically induces rapid and sustained microglial responses in vivo. Fibrinogen leakage correlates with areas of axonal damage and induces reactive oxygen species release in microglia. Blocking fibrin formation with anticoagulant treatment or genetically eliminating the fibrinogen binding motif recognized by the microglial integrin receptor CD11b/CD18 inhibits perivascular microglial clustering and axonal damage. Thus, early and progressive perivascular microglial clustering triggered by fibrinogen leakage upon blood-brain barrier disruption contributes to axonal damage in neuroinflammatory disease. PMID:23187627

  16. DNase I hypersensitive sites within the inducible qa gene cluster of Neurospora crassa.

    PubMed Central

    Baum, J A; Giles, N H

    1986-01-01

    DNase I hypersensitive regions were mapped within the 17.3-kilobase qa (quinic acid) gene cluster of Neurospora crassa. The 5'-flanking regions of the five qa structural genes and the two qa regulatory genes each contain DNase I hypersensitive sites under noninducing conditions and generally exhibit increases in DNase I cleavage upon induction of transcription with quinic acid. The two large intergenic regions of the qa gene cluster appear to be similarly organized with respect to the positions of constitutive and inducible DNase I hypersensitive sites. Inducible hypersensitive sites on the 5' side of one qa gene, qa-x, appear to be differentially regulated. Employing these and previously published data, we have identified a conserved sequence element that may mediate the activator function of the qa-1F regulatory gene. Variants of the 16-base-pair consensus sequence are consistently found within DNase I-protected regions adjacent to inducible DNase I hypersensitive sites within the gene cluster. Images PMID:2944110

  17. Determination of the Action Spectrum of UVR-Induced Mitochondrial DNA Damage in Human Skin Cells.

    PubMed

    Latimer, Jennifer A; Lloyd, James J; Diffey, Brian L; Matts, Paul J; Birch-Machin, Mark A

    2015-10-01

    Biological responses of human skin to UVR including cancer and aging are largely wavelength-dependent, as shown by the action spectra of UVR-induced erythema and nuclear DNA (nDNA) damage. A molecular dosimeter of UVR exposure is therefore required. Although mitochondrial DNA (mtDNA) damage has been shown to be a reliable and sensitive biomarker of UVR exposure in human skin, its wavelength dependency is unknown. The current study solves this problem by determining the action spectrum of UVR-induced mtDNA damage in human skin. Human neonatal dermal fibroblasts and primary human adult keratinocyte cells were irradiated with increasing doses of UVR. Dose-response curves of mtDNA damage were produced for each of the UVR sources and cell types, and an action spectrum for each cell type was determined by mathematical induction. Similarities between these mtDNA damage action spectra and previously determined nDNA damage were observed, with the most detrimental effects occurring over the shorter UVR wavelengths. Notably, a statistically significant (P<0.0001) greater sensitivity to mtDNA damage was observed in dermal fibroblasts compared with keratinocytes at wavelengths >300 nm, possibly indicating a wider picture of depth dependence in sensitivity. This finding has implications for disease/photodamage mechanisms and interventions. PMID:26030182

  18. A facile method for the assessment of DNA damage induced by UV-activated nanomaterials

    NASA Astrophysics Data System (ADS)

    Yamazaki, Yuka; Zinchenko, Anatoly A.; Murata, Shizuaki

    2011-07-01

    Fluorescent microscopy observation of gene-size DNA (T4 phage DNA or λ phage DNA) was used to assess DNA damage induced by UV irradiation in the presence of nanomaterials, such as QDs (quantum dots: CdSe/ZnS semiconductor nanoparticles), the water-soluble fullerene derivative C60(OH)n (n = 6-12) and titanium oxide nanoparticles of 25 nm in diameter. The magnitude of DNA damage could be simply evaluated based on the degree of shortening of the stretched DNA image. This method showed that DNA damage was amplified by the action of QDs under irradiation by C-band (λmax = 254 nm) or B-band (λmax = 303 nm) UV. Smaller QDs that emitted higher-energy fluorescence (λemmax = 565 nm) induced more severe damage than medium- and larger-size QDs that emitted longer-wavelength fluorescence (λemmax = 605 and 705 nm, respectively). The fullerene derivative and TiO2 nanoparticles caused DNA damage even under irradiation by A-band UV (λmax = 365 nm) and showed more severe DNA damage than QDs under similar conditions.

  19. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells

    PubMed Central

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-01-01

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague–Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  20. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells.

    PubMed

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-01-01

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague-Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  1. Detection of DNA damage induced by heavy ion irradiation in the individual cells with comet assay

    NASA Astrophysics Data System (ADS)

    Wada, S.; Natsuhori, M.; Ito, N.; Funayama, T.; Kobayashi, Y.

    2003-05-01

    Investigating the biological effects of high-LET heavy ion irradiation at low fluence is important to evaluate the risk of charged particles. Especially it is important to detect radiation damage induced by the precise number of heavy ions in the individual cells. Thus we studied the relationship between the number of ions traversing the cell and DNA damage produced by the ion irradiation. We applied comet assay to measure the DNA damage in the individual cells. Cells attached on the ion track detector CR-39 were irradiated with ion beams at TIARA, JAERI-Takasaki. After irradiation, the cells were stained with ethidium bromide and the opposite side of the CR-39 was etched. We observed that the heavy ions with higher LET values induced the heavier DNA damage. The result indicated that the amount of DNA damage induced by one particle increased with the LET values of the heavy ions.

  2. Lac repressor: Crystallization of intact tetramer and its complexes with inducer and operator DNA

    SciTech Connect

    Pace, H.C.; Lu, P. ); Lewis, M. Smith Kline and French Labs., King of Prussia, PA )

    1990-03-01

    The intact lac repressor tetramer, which regulates expression of the lac operon in Escherichia coli, has been crystallized in the native form, with an inducer, and in a ternary complex with operator DNA and an anti-inducer. The crystals without DNA diffract to better than 3.5 {angstrom}. They belong to the monoclinic space group C2 and have cell dimensions a = 164.7 {angstrom}, b = 75.6 {angstrom}, and c = 161.2 {angstrom}, with {alpha} = {gamma} = 90{degree} and {beta} = 125.5{degree}. Cocrystals have been obtained with a number of different lac operator-related DNA fragments. The complex with a blunt-ended 16-base-pair strand yielded tetragonal bipyramids that diffract to 6.5 {angstrom}. These protein-DNA cocrystals crack upon exposure to the gratuitous inducer isopropyl {beta}-D-thiogalactoside, suggesting a conformational change in the repressor-operator complex.

  3. Autophosphorylation and Pin1 binding coordinate DNA damage-induced HIPK2 activation and cell death.

    PubMed

    Bitomsky, Nadja; Conrad, Elisa; Moritz, Christian; Polonio-Vallon, Tilman; Sombroek, Dirk; Schultheiss, Kathrin; Glas, Carolina; Greiner, Vera; Herbel, Christoph; Mantovani, Fiamma; del Sal, Giannino; Peri, Francesca; Hofmann, Thomas G

    2013-11-01

    Excessive genome damage activates the apoptosis response. Protein kinase HIPK2 is a key regulator of DNA damage-induced apoptosis. Here, we deciphered the molecular mechanism of HIPK2 activation and show its relevance for DNA damage-induced apoptosis in cellulo and in vivo. HIPK2 autointeracts and site-specifically autophosphorylates upon DNA damage at Thr880/Ser882. Autophosphorylation regulates HIPK2 activity and mutation of the phosphorylation-acceptor sites deregulates p53 Ser46 phosphorylation and apoptosis in cellulo. Moreover, HIPK2 autophosphorylation is conserved between human and zebrafish and is important for DNA damage-induced apoptosis in vivo. Mechanistically, autophosphorylation creates a binding signal for the phospho-specific isomerase Pin1. Pin1 links HIPK2 activation to its stabilization by inhibiting HIPK2 polyubiquitination and modulating Siah-1-HIPK2 interaction. Concordantly, Pin1 is required for DNA damage-induced HIPK2 stabilization and p53 Ser46 phosphorylation and is essential for induction of apotosis both in cellulo and in zebrafish. Our results identify an evolutionary conserved mechanism regulating DNA damage-induced apoptosis. PMID:24145406

  4. DNA cleavage within the MLL breakpoint cluster region is a specific event which occurs as part of higher-order chromatin fragmentation during the initial stages of apoptosis.

    PubMed Central

    Stanulla, M; Wang, J; Chervinsky, D S; Thandla, S; Aplan, P D

    1997-01-01

    A distinct population of therapy-related acute myeloid leukemia (t-AML) is strongly associated with prior administration of topoisomerase II (topo II) inhibitors. These t-AMLs display distinct cytogenetic alterations, most often disrupting the MLL gene on chromosome 11q23 within a breakpoint cluster region (bcr) of 8.3 kb. We recently identified a unique site within the MLL bcr that is highly susceptible to DNA double-strand cleavage by classic topo II inhibitors (e.g., etoposide and doxorubicin). Here, we report that site-specific cleavage within the MLL bcr can be induced by either catalytic topo II inhibitors, genotoxic chemotherapeutic agents which do not target topo II, or nongenotoxic stimuli of apoptotic cell death, suggesting that this site-specific cleavage is part of a generalized cellular response to an apoptotic stimulus. We also show that site-specific cleavage within the MLL bcr can be linked to the higher-order chromatin fragmentation that occurs during the initial stages of apoptosis, possibly through cleavage of DNA loops at their anchorage sites to the nuclear matrix. In addition, we show that site-specific cleavage is conserved between species, as specific DNA cleavage can also be demonstrated within the murine MLL locus. Lastly, site-specific cleavage during apoptosis can also be identified at the AML1 locus, a locus which is also frequently involved in chromosomal rearrangements present in t-AML patients. In conclusion, these results suggest the potential involvement of higher-order chromatin fragmentation which occurs as a part of a generalized apoptotic response in a mechanism leading to chromosomal translocation of the MLL and AML1 genes and subsequent t-AML. PMID:9199342

  5. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint

    PubMed Central

    Collins, Josie K.; Lane, Simon I. R.; Merriman, Julie A.; Jones, Keith T.

    2015-01-01

    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule–kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  6. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint.

    PubMed

    Collins, Josie K; Lane, Simon I R; Merriman, Julie A; Jones, Keith T

    2015-01-01

    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule-kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  7. DNase I induced DNA degradation is inhibited by neomycin.

    PubMed

    Woegerbauer, M; Burgmann, H; Davies, J; Graninger, W

    2000-03-01

    Preparations of antimicrobials from biotechnological sources containing nucleic acids may serve as vector for the dissemination of resistance genes. An essential prerequisite for the acquisition of a new resistance phenotype in a transformational scenario is the availability of physically intact DNA molecules capable of transforming competent microorganisms. DNA is thought to be an easy target for catabolic processes when present in the natural habitat of bacteria (e.g. gastrointestinal tract, soil) due to the overall presence of nucleolytic enzymes. Aminoglycoside antibiotics are known to display a strong affinity to nucleic acids rendering these compounds to be primary candidates for exerting DNA protective functions in the gastrointestinal tract when applied orally during antibiotic chemotherapy. Using a DNase I protection assay it could be demonstrated that neomycin B at a concentration of 2 mM completely inhibited degradation of plasmid DNA in vitro. No inhibition of degradation was observed with streptomycin and kanamycin and the non-aminoglycoside antibiotics oxytetracycline and ampicillin under identical assay conditions. Thus, neomycin preparations may be able to promote structural integrity of contaminating DNA-fragments in DNase-rich environments. PMID:10819299

  8. Computational and biological analysis of 680 kb of DNA sequence from the human 5q31 cytokine gene cluster region.

    PubMed

    Frazer, K A; Ueda, Y; Zhu, Y; Gifford, V R; Garofalo, M R; Mohandas, N; Martin, C H; Palazzolo, M J; Cheng, J F; Rubin, E M

    1997-05-01

    With the human genome project advancing into what will be a 7- to 10-year DNA sequencing phase, we are presented with the challenge of developing strategies to convert genomic sequence data, as they become available, into biologically meaningful information. We have analyzed 680 kb of noncontiguous DNA sequence from a 1-Mb region of human chromosome 5q31, coupling computational analysis with gene expression studies of tissues isolated from humans as well as from mice containing human YAC transgenes. This genomic interval has been noted previously for containing the cytokine gene cluster and a quantitative trait locus associated with inflammatory diseases. Our analysis identified and verified expression of 16 new genes, as well as 7 previously known genes. Of the total of 23 genes in this region, 78% had similarity matches to sequences in protein databases and 83% had exact expressed sequence tag (EST) database matches. Comparative mapping studies of eight of the new human genes discovered in the 5q31 region revealed that all are located in the syntenic region of mouse chromosome 11q. Our analysis demonstrates an approach for examining human sequence as it is made available from large sequencing programs and has resulted in the discovery of several biomedically important genes, including a cyclin, a transcription factor that is homologous to an oncogene, a protein involved in DNA repair, and several new members of a family of transporter proteins. PMID:9149945

  9. Prevention of Helicobacter pylori-induced gastric cancers in gerbils by a DNA demethylating agent.

    PubMed

    Niwa, Tohru; Toyoda, Takeshi; Tsukamoto, Tetsuya; Mori, Akiko; Tatematsu, Masae; Ushijima, Toshikazu

    2013-04-01

    Suppression of aberrant DNA methylation is a novel approach to cancer prevention, but, so far, the efficacy of the strategy has not been evaluated in cancers associated with chronic inflammation. Gastric cancers induced by Helicobacter pylori infection are known to involve aberrant DNA methylation and associated with severe chronic inflammation in their early stages. Here, we aimed to clarify whether suppression of aberrant DNA methylation can prevent H. pylori-induced gastric cancers using a Mongolian gerbil model. Administration of a DNA demethylating agent, 5-aza-2'-deoxycytidine (5-aza-dC), to gerbils (0.125 mg/kg for 50-55 weeks) decreased the incidence of gastric cancers induced by H. pylori infection and N-methyl-N-nitrosourea (MNU) treatment from 55.2% to 23.3% (P < 0.05). In gastric epithelial cells, DNA methylation levels of six CpG islands (HE6, HG2, SB1, SB5, SF12, and SH6) decreased to 46% to 68% (P < 0.05) of gerbils without 5-aza-dC treatment. Also, the global DNA methylation level decreased from 83.0% ± 4.5% to 80.3% ± 4.4% (mean ± SD) by 5-aza-dC treatment (P < 0.05). By 5-aza-dC treatment, Il1b and Nos2 were downregulated (42% and 58% of gerbils without, respectively) but Tnf was upregulated (187%), suggesting that 5-aza-dC treatment induced dysregulation of inflammatory responses. No obvious adverse effect of 5-aza-dC treatment was observed, besides testicular atrophy. These results showed that 5-aza-dC treatment can prevent H. pylori-induced gastric cancers and suggested that removal of induced DNA methylation and/or suppression of DNA methylation induction can become a target for prevention of chronic inflammation-associated cancers. PMID:23559452

  10. Electric-field–induced assembly and propulsion of chiral colloidal clusters

    PubMed Central

    Ma, Fuduo; Wang, Sijia; Wu, David T.; Wu, Ning

    2015-01-01

    Chiral molecules with opposite handedness exhibit distinct physical, chemical, or biological properties. They pose challenges as well as opportunities in understanding the phase behavior of soft matter, designing enantioselective catalysts, and manufacturing single-handed pharmaceuticals. Microscopic particles, arranged in a chiral configuration, could also exhibit unusual optical, electric, or magnetic responses. Here we report a simple method to assemble achiral building blocks, i.e., the asymmetric colloidal dimers, into a family of chiral clusters. Under alternating current electric fields, two to four lying dimers associate closely with a central standing dimer and form both right- and left-handed clusters on a conducting substrate. The cluster configuration is primarily determined by the induced dipolar interactions between constituent dimers. Our theoretical model reveals that in-plane dipolar repulsion between petals in the cluster favors the achiral configuration, whereas out-of-plane attraction between the central dimer and surrounding petals favors a chiral arrangement. It is the competition between these two interactions that dictates the final configuration. The theoretical chirality phase diagram is found to be in excellent agreement with experimental observations. We further demonstrate that the broken symmetry in chiral clusters induces an unbalanced electrohydrodynamic flow surrounding them. As a result, they rotate in opposite directions according to their handedness. Both the assembly and propulsion mechanisms revealed here can be potentially applied to other types of asymmetric particles. Such kinds of chiral colloids will be useful for fabricating metamaterials, making model systems for both chiral molecules and active matter, or building propellers for microscale transport. PMID:25941383

  11. Electric-field-induced assembly and propulsion of chiral colloidal clusters.

    PubMed

    Ma, Fuduo; Wang, Sijia; Wu, David T; Wu, Ning

    2015-05-19

    Chiral molecules with opposite handedness exhibit distinct physical, chemical, or biological properties. They pose challenges as well as opportunities in understanding the phase behavior of soft matter, designing enantioselective catalysts, and manufacturing single-handed pharmaceuticals. Microscopic particles, arranged in a chiral configuration, could also exhibit unusual optical, electric, or magnetic responses. Here we report a simple method to assemble achiral building blocks, i.e., the asymmetric colloidal dimers, into a family of chiral clusters. Under alternating current electric fields, two to four lying dimers associate closely with a central standing dimer and form both right- and left-handed clusters on a conducting substrate. The cluster configuration is primarily determined by the induced dipolar interactions between constituent dimers. Our theoretical model reveals that in-plane dipolar repulsion between petals in the cluster favors the achiral configuration, whereas out-of-plane attraction between the central dimer and surrounding petals favors a chiral arrangement. It is the competition between these two interactions that dictates the final configuration. The theoretical chirality phase diagram is found to be in excellent agreement with experimental observations. We further demonstrate that the broken symmetry in chiral clusters induces an unbalanced electrohydrodynamic flow surrounding them. As a result, they rotate in opposite directions according to their handedness. Both the assembly and propulsion mechanisms revealed here can be potentially applied to other types of asymmetric particles. Such kinds of chiral colloids will be useful for fabricating metamaterials, making model systems for both chiral molecules and active matter, or building propellers for microscale transport. PMID:25941383

  12. Effects of (+)-catechin and (-)-epicatechin on heterocyclic amines-induced oxidative DNA damage.

    PubMed

    Haza, Ana Isabel; Morales, Paloma

    2011-01-01

    The aim of the present study was to evaluate the protective effect of (+)-catechin and (-)-epicatechin against 2-amino-3,8- dimethylimidazo[4,5-f]quinoxaline (8-MeIQx), 2-amino-3,4,8-trimethylimidazo[4,5-f]-quinoxaline (4,8-diMeIQx) and 2-amino-1-methyl-6-phenyl-imidazo[4,5-b]pyridine (PhIP)-induced DNA damage in human hepatoma cells (HepG2). DNA damage (strand breaks and oxidized purines/pyrimidines) was evaluated by the alkaline single-cell gel electrophoresis or comet assay. Increasing concentrations of 8-MeIQx, 4,8-diMeIQx and PhIP induced a significant increase in DNA strand breaks and oxidized purines and pyrimidines in a dose-dependent manner. Among those, PhIP (300 µm) exerted the highest genotoxicity. (+)-Catechin exerted protection against oxidized purines induced by 8-MeIQx, 4,8-diMeIQx and PhIP. Oxidized pyrimidines and DNA strand breaks induced by PhIP were also prevented by (+)-catechin. Otherwise, (-)-epicatechin protected against the oxidized pyrimidines induced by PhIP and the oxidized purines induced by 8-MeIQx and 4,8-diMeIQx. One feasible mechanism by which (+)-catechin and (-)-epicatechin exert their protective effect towards heterocyclic amines-induced oxidative DNA damage may be by modulation of phase I and II enzyme activities. The ethoxyresorufin O-deethylation (CYP1A1) activity was moderately inhibited by (+)-catechin, while little effect was observed by (-)-epicatechin. However, (+)-catechin showed the greatest increase in UDP-glucuronyltransferase activity. In conclusion, our results clearly indicate that (+)-catechin was more efficient than (-)-epicatechin in preventing DNA damage (strand breaks and oxidized purines/pyrimidines) induced by PhIP than that induced by 8-MeIQx and 4,8-diMeIQx. PMID:20583320

  13. Nitric oxide is involved in phosphorus deficiency-induced cluster root development and citrate exudation in white lupin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White lupin (Lupinus albus) forms specialized cluster roots characterized by exudation of organic anions under phosphorus (P) deficiency. Here, we evaluated the role of nitric oxide (NO) in P deficiency-induced cluster-root formation and citrate exudation in white lupin. Plants were treated with NO ...

  14. Kinetics and localization of wound-induced DNA biosynthesis in potato tuber

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tuber wounding induces a cascade of biological responses that are involved in processes required to heal and protect surviving plant tissues. Little is known about the coordination of these processes, including essential wound-induced DNA synthesis, yet they play critical roles in maintaining marke...

  15. Conformational selection and induced fit for RNA polymerase and RNA/DNA hybrid backtracked recognition

    PubMed Central

    Wu, Jian; Ye, Wei; Yang, Jingxu; Chen, Hai-Feng

    2015-01-01

    RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD) simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15, and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS) P-test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein. PMID:26594643

  16. Resection is a major repair pathway of heavy ion-induced DNA lesions

    NASA Astrophysics Data System (ADS)

    Durante, Marco; Averbeck, Nicole; Taucher-Scholz, Gisela

    Space radiation include densely ionizing heavy ions, which can produce clustered DNA damage with high frequency in human cells. Repair of these complex lesions is generally assumed to be more difficult than for simple double-strand breaks. We show here that human cells use break resection with increasing frequency after exposure to heavy ions. Resection can lead to misrepair of the DNA lesion, via microhomology mediated end-joining. Resection can therefore be responsible for the increased effectiveness of heavy ions in the induction of mutations and genetic late effects.

  17. DNA Methylation in the Medial Prefrontal Cortex Regulates Alcohol-Induced Behavior and Plasticity

    PubMed Central

    Tapocik, Jenica D.; Juergens, Nathan; Pitcairn, Caleb; Borich, Abbey; Schank, Jesse R.; Sun, Hui; Schuebel, Kornel; Zhou, Zhifeng; Yuan, Qiaoping; Vendruscolo, Leandro F.; Goldman, David; Heilig, Markus

    2015-01-01

    Recent studies have suggested an association between alcoholism and DNA methylation, a mechanism that can mediate long-lasting changes in gene transcription. Here, we examined the contribution of DNA methylation to the long-term behavioral and molecular changes induced by a history of alcohol dependence. In search of mechanisms underlying persistent rather than acute dependence-induced neuroadaptations, we studied the role of DNA methylation regulating medial prefrontal cortex (mPFC) gene expression and alcohol-related behaviors in rats 3 weeks into abstinence following alcohol dependence. Postdependent rats showed escalated alcohol intake, which was associated with increased DNA methylation as well as decreased expression of genes encoding synaptic proteins involved in neurotransmitter release in the mPFC. Infusion of the DNA methyltransferase inhibitor RG108 prevented both escalation of alcohol consumption and dependence-induced downregulation of 4 of the 7 transcripts modified in postdependent rats. Specifically, RG108 treatment directly reversed both downregulation of synaptotagmin 2 (Syt2) gene expression and hypermethylation on CpG#5 of its first exon. Lentiviral inhibition of Syt2 expression in the mPFC increased aversion-resistant alcohol drinking, supporting a mechanistic role of Syt2 in compulsive-like behavior. Our findings identified a functional role of DNA methylation in alcohol dependence-like behavioral phenotypes and a candidate gene network that may mediate its effects. Together, these data provide novel evidence for DNA methyltransferases as potential therapeutic targets in alcoholism. PMID:25878287

  18. DNA damage induced by m-phenylenediamine and its derivative in the presence of copper ion.

    PubMed

    Chen, F; Murata, M; Hiraku, Y; Yamashita, N; Oikawa, S; Kawanishi, S

    1998-09-01

    To clarify the mechanism of carcinogenesis by hair dyes, we compared the extent of DNA damage induced by mutagenic m-phenylenediamine and 4-methoxy-m-phenylenediamine, using 32P-5'-end-labeled DNA fragments obtained from the human c-Ha-ras-1 protooncogene and the p53 tumor suppressor gene. Carcinogenic 4-methoxy-m-phenylenediamine caused DNA damage at thymine and cytosine residues in the presence of Cu(II). Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited 4-methoxy-m-phenylenediamine-induced DNA damage, suggesting the involvement of H2O2 and Cu(I). Superoxide dismutase (SOD) enhanced the DNA damage. Formation of 8-hydroxy-2'-deoxyguanosine (8-OH-dG) was induced by 4-methoxy-m-phenylenediamine in the presence of Cu(II). UV-visible spectroscopic studies have shown that Cu(II) mediated autoxidation of 4-methoxy-m-phenylenediamine and SOD accelerated the autoxidation. On the other hand, non-carcinogenic m-phenylenediamine did not cause clear DNA damage and significant autoxidation even in the presence of Cu(II). These results suggest that carcinogenicity of m-phenylenediamines is associated with ability to cause oxidative DNA damage rather than bacterial mutagenicity. PMID:9802551

  19. DNA methylation in the medial prefrontal cortex regulates alcohol-induced behavior and plasticity.

    PubMed

    Barbier, Estelle; Tapocik, Jenica D; Juergens, Nathan; Pitcairn, Caleb; Borich, Abbey; Schank, Jesse R; Sun, Hui; Schuebel, Kornel; Zhou, Zhifeng; Yuan, Qiaoping; Vendruscolo, Leandro F; Goldman, David; Heilig, Markus

    2015-04-15

    Recent studies have suggested an association between alcoholism and DNA methylation, a mechanism that can mediate long-lasting changes in gene transcription. Here, we examined the contribution of DNA methylation to the long-term behavioral and molecular changes induced by a history of alcohol dependence. In search of mechanisms underlying persistent rather than acute dependence-induced neuroadaptations, we studied the role of DNA methylation regulating medial prefrontal cortex (mPFC) gene expression and alcohol-related behaviors in rats 3 weeks into abstinence following alcohol dependence. Postdependent rats showed escalated alcohol intake, which was associated with increased DNA methylation as well as decreased expression of genes encoding synaptic proteins involved in neurotransmitter release in the mPFC. Infusion of the DNA methyltransferase inhibitor RG108 prevented both escalation of alcohol consumption and dependence-induced downregulation of 4 of the 7 transcripts modified in postdependent rats. Specifically, RG108 treatment directly reversed both downregulation of synaptotagmin 2 (Syt2) gene expression and hypermethylation on CpG#5 of its first exon. Lentiviral inhibition of Syt2 expression in the mPFC increased aversion-resistant alcohol drinking, supporting a mechanistic role of Syt2 in compulsive-like behavior. Our findings identified a functional role of DNA methylation in alcohol dependence-like behavioral phenotypes and a candidate gene network that may mediate its effects. Together, these data provide novel evidence for DNA methyltransferases as potential therapeutic targets in alcoholism. PMID:25878287

  20. Role of DNA repair inhibition in lead- and cadmium-induced genotoxicity: a review.

    PubMed Central

    Hartwig, A

    1994-01-01

    Compounds of lead and cadmium have been shown to be carcinogenic to humans and experimental animals. However, the underlying mechanisms are still not understood. In mammalian cells in culture, lead(II) is weakly mutagenic after long incubation times and generates DNA strand breaks only after treatment with high, toxic doses. Cadmium(II) induces DNA strand breaks and chromosomal aberrations, but its mutagenic potential is rather weak. However, both metals exert pronounced indirect genotoxic effects. Lead(II) is comutagenic towards UV and N-methyl-N-nitro-N-nitrosoguanidine (MNNG) and enhances the number of UV-induced sister chromatid exchanges in V79 Chinese hamster cells. With regard to DNA repair, lead(II) causes an accumulation of DNA strand breaks after UV-irradiation in HeLa cells, indicating an interference with the polymerization or ligation step in excision repair. Cadmium(II) enhances the mutagenicity of UV light in V79 Chinese hamster cells and an increased sensitivity toward UV light is observed in various rodent and human cell lines. Furthermore, an inhibition of unscheduled DNA synthesis after UV-irradiation and a partial inhibition of the removal of UV-induced DNA lesions has been shown. For both metals, the indirect genotoxic effects are observed at low, nontoxic concentrations, suggesting that an interference with DNA repair processes may be predominant at biologically relevant concentrations. This might also explain the conflicting results of epidemiological studies obtained for both metals. Possible mechanisms of repair inhibition are discussed. PMID:7843136

  1. Crowding-Induced Hybridization of Single DNA Hairpins.

    PubMed

    Baltierra-Jasso, Laura E; Morten, Michael J; Laflör, Linda; Quinn, Steven D; Magennis, Steven W

    2015-12-30

    It is clear that a crowded environment influences the structure, dynamics, and interactions of biological molecules, but the complexity of this phenomenon demands the development of new experimental and theoretical approaches. Here we use two complementary single-molecule FRET techniques to show that the kinetics of DNA base pairing and unpairing, which are fundamental to both the biological role of DNA and its technological applications, are strongly modulated by a crowded environment. We directly observed single DNA hairpins, which are excellent model systems for studying hybridization, either freely diffusing in solution or immobilized on a surface under crowding conditions. The hairpins followed two-state folding dynamics with a closing rate increasing by 4-fold and the opening rate decreasing 2-fold, for only modest concentrations of crowder [10% (w/w) polyethylene glycol (PEG)]. These experiments serve both to unambiguously highlight the impact of a crowded environment on a fundamental biological process, DNA base pairing, and to illustrate the benefits of single-molecule approaches to probing the structure and dynamics of complex biomolecular systems. PMID:26654490

  2. Cytometric analysis of DNA changes induced by sulfur mustard

    SciTech Connect

    Smith, W.J.; Sanders, K.M.; Ruddle, S.E.; Gross, C.L.

    1993-05-13

    Sulfur mustard is an alkylating agent which causes severe, potentially debilitating blisters following cutaneous exposure. Its mechanism of pathogenesis is unknown and no antidote exists to prevent its pathology. The biochemical basis of sulfur mustard's vesicating activity has been hypothesized to be a cascade of events beginning with alkylation of DNA. Using human cells in culture, we have assessed the effects of sulfur mustard on cell cycle activity using flow cytometry with propidium iodide. Two distinct patterns emerged, a Gl/S interface block at concentrations equivalent to vesicating doses (>50-micronM) and a G2 block at 10-fold lower concentrations. In addition, noticeable increases in amount of dye uptake were observed at 4 and 24 hours after sulfur mustard exposure. These increases are believed to be related to DNA repair activities and can be prevented by treatment of the cells with niacinamide, which inhibits DNA repair. Other drugs which provide alternate alkylating sites or inhibit cell cycle progression were shown to lower the cytotoxicity of sulfur mustard and to protect against its direct DNA damaging effects.

  3. Ligand-Dependent Nanoparticle Clustering within Lipid Membranes Induced by Surrounding Medium.

    PubMed

    Šegota, Suzana; Vojta, Danijela; Kendziora, Dania; Ahmed, Ishtiaq; Fruk, Ljiljana; Baranović, Goran

    2015-04-23

    The interactions between hydrophobic or semihydrophobic gold and silver nanoparticles (NPs) and a dimyristoylphosphatidylcholine (DMPC) bilayer as a model cell membrane in two ionic solutions result in the structural reorganization within the bilayer manifested as locally increased nanomechanical compaction in the vicinity of NP clusters as well as changed overall thermotropic properties. The effects of NP surface charge and hydrophobicity were examined using AFM imaging, force spectroscopy and IR spectroscopy. The NP clustering occurred during hydration process of dry films containing both the DMPC molecules and the NPs by the mechanism in which the number of bilayer deformations was reduced by NP clustering. The force spectroscopy showed increased bilayer density around (semi)hydrophobic NP clusters and thus locally increased lateral compaction of the bilayer. The strengthening effect was observed for both the silver and the gold NPs in a high ionic strength solution such as seawater, while it was absent under physiological conditions. The local lipid rearrangement induces the long-range lipid reorganization resulting in the bilayer phase transition shifting toward lower or higher temperatures depending on the solution ionic strength (at the most by -1.0 °C in phosphate buffered saline and at the most by +0.5 °C in seawater). PMID:25831116

  4. Scaling of shear-induced diffusion and clustering in a blood-like suspension

    NASA Astrophysics Data System (ADS)

    Mountrakis, L.; Lorenz, E.; Hoekstra, A. G.

    2016-04-01

    The transport of cells and substances in dense suspensions like blood heavily depends on the microstructure and the dynamics arising from their interactions with red blood cells (RBCs). Computer simulations are used to probe into the detailed transport-related characteristics of a blood-like suspension, for a wide range of volume fractions and shear rates. The shear-induced diffusion of RBCs does not follow the established linear scaling with shear rate for higher volume fractions. The properties directly related to RBC deformability —stretching and flow orientation— are not sufficient to explain this departure according to the model of Breedveld, pointing to the dominance of collective effects in the suspension. A cluster size analysis confirms that collective effects dominate high volume fractions, as the mean cluster size is above 2 and the number of “free RBCs” is significantly decreased in denser suspensions. The mean duration of RBC contacts in clusters is increased in the high volume fraction and shear rate cases, showing that these clusters live longer.

  5. The role of prenucleation clusters in surface-induced calcium phosphate crystallization

    NASA Astrophysics Data System (ADS)

    Dey, Archan; Bomans, Paul H. H.; Müller, Frank A.; Will, Julia; Frederik, Peter M.; de With, Gijsbertus; Sommerdijk, Nico A. J. M.

    2010-12-01

    Unravelling the processes of calcium phosphate formation is important in our understanding of both bone and tooth formation, and also of pathological mineralization, for example in cardiovascular disease. Serum is a metastable solution from which calcium phosphate precipitates in the presence of calcifiable templates such as collagen, elastin and cell debris. A pathological deficiency of inhibitors leads to the uncontrolled deposition of calcium phosphate. In bone and teeth the formation of apatite crystals is preceded by an amorphous calcium phosphate (ACP) precursor phase. ACP formation is thought to proceed through prenucleation clusters-stable clusters that are present in solution already before nucleation-as was recently demonstrated for CaCO3 (refs 15,16). However, the role of such nanometre-sized clusters as building blocks for ACP has been debated for many years. Here we demonstrate that the surface-induced formation of apatite from simulated body fluid starts with the aggregation of prenucleation clusters leading to the nucleation of ACP before the development of oriented apatite crystals.

  6. Epigenomic reorganization of the clustered Hox genes in embryonic stem cells induced by retinoic acid.

    PubMed

    Kashyap, Vasundhra; Gudas, Lorraine J; Brenet, Fabienne; Funk, Patricia; Viale, Agnes; Scandura, Joseph M

    2011-02-01

    Retinoic acid (RA) regulates clustered Hox gene expression during embryogenesis and is required to establish the anterior-posterior body plan. Using mutant embryonic stem cell lines deficient in the RA receptor γ (RARγ) or Hoxa1 3'-RA-responsive element, we studied the kinetics of transcriptional and epigenomic patterning responses to RA. RARγ is essential for RA-induced Hox transcriptional activation, and deletion of its binding site in the Hoxa1 enhancer attenuates transcriptional and epigenomic activation of both Hoxa and Hoxb gene clusters. The kinetics of epigenomic reorganization demonstrate that complete erasure of the polycomb repressive mark H3K27me3 is not necessary to initiate Hox transcription. RARγ is not required to establish the bivalent character of Hox clusters, but RA/RARγ signaling is necessary to erase H3K27me3 from activated Hox genes during embryonic stem cell differentiation. Highly coordinated, long range epigenetic Hox cluster reorganization is closely linked to transcriptional activation and is triggered by RARγ located at the Hoxa1 3'-RA-responsive element. PMID:21087926

  7. Dynamics of photoprocesses induced by femtosecond infrared radiation in free molecules and clusters of iron pentacarbonyl

    NASA Astrophysics Data System (ADS)

    Kompanets, V. O.; Lokhman, V. N.; Poydashev, D. G.; Chekalin, S. V.; Ryabov, E. A.

    2016-04-01

    The dynamics of photoprocesses induced by femtosecond infrared radiation in free Fe(CO)5 molecules and their clusters owing to the resonant excitation of vibrations of CO bonds in the 5-μm range has been studied. The technique of infrared excitation and photoionization probing (λ = 400 nm) by femtosecond pulses has been used in combination with time-of-flight mass spectrometry. It has been found that an infrared pulse selectively excites vibrations of CO bonds in free molecules, which results in a decrease in the yield of the Fe(CO)5 + molecular ion. Subsequent relaxation processes have been analyzed and the results have been interpreted. The time of the energy transfer from excited vibrations to other vibrations of the molecule owing to intramolecular relaxation has been measured. The dynamics of dissociation of [Fe(CO)5] n clusters irradiated by femtosecond infrared radiation has been studied. The time dependence of the yield of free molecules has been measured under different infrared laser excitation conditions. We have proposed a model that well describes the results of the experiment and makes it possible, in particular, to calculate the profile of variation of the temperature of clusters within the "evaporation ensemble" concept. The intramolecular and intracluster vibrational relaxation rates in [Fe(CO)5] n clusters have been estimated.

  8. Extracellular DNA Acidifies Biofilms and Induces Aminoglycoside Resistance in Pseudomonas aeruginosa

    PubMed Central

    Wilton, Mike; Charron-Mazenod, Laetitia; Moore, Richard

    2015-01-01

    Biofilms consist of surface-adhered bacterial communities encased in an extracellular matrix composed of DNA, exopolysaccharides, and proteins. Extracellular DNA (eDNA) has a structural role in the formation of biofilms, can bind and shield biofilms from aminoglycosides, and induces antimicrobial peptide resistance mechanisms. Here, we provide evidence that eDNA is responsible for the acidification of Pseudomonas aeruginosa planktonic cultures and biofilms. Further, we show that acidic pH and acidification via eDNA constitute a signal that is perceived by P. aeruginosa to induce the expression of genes regulated by the PhoPQ and PmrAB two-component regulatory systems. Planktonic P. aeruginosa cultured in exogenous 0.2% DNA or under acidic conditions demonstrates a 2- to 8-fold increase in aminoglycoside resistance. This resistance phenotype requires the aminoarabinose modification of lipid A and the production of spermidine on the bacterial outer membrane, which likely reduce the entry of aminoglycosides. Interestingly, the additions of the basic amino acid l-arginine and sodium bicarbonate neutralize the pH and restore P. aeruginosa susceptibility to aminoglycosides, even in the presence of eDNA. These data illustrate that the accumulation of eDNA in biofilms and infection sites can acidify the local environment and that acidic pH promotes the P. aeruginosa antibiotic resistance phenotype. PMID:26552982

  9. Ochratoxin A induces oxidative DNA damage in liver and kidney after oral dosing to rats.

    PubMed

    Kamp, Hennicke G; Eisenbrand, Gerhard; Janzowski, Christine; Kiossev, Jetchko; Latendresse, John R; Schlatter, Josef; Turesky, Robert J

    2005-12-01

    The nephrotoxic/carcinogenic mycotoxin ochratoxin A (OTA) occurs as a contaminant in food and feed and may be linked to human endemic Balkan nephropathy. The mechanism of OTA-derived carcinogenicity is still under debate, since reactive metabolites of OTA and DNA adducts have not been unambiguously identified. Oxidative DNA damage, however, has been observed in vitro after incubation of mammalian cells with OTA. In this study, we investigated whether OTA induces oxidative DNA damage in vivo as well. Male F344 rats were dosed with 0, 0.03, 0.1, 0.3 mg/kg bw per day OTA for 4 wk (gavage, 7 days/wk, five animals per dose group). Subsequently, oxidative DNA damage was determined in liver and kidney by the comet assay (single cell gel electrophoresis) with/without use of the repair enzyme formamido-pyrimidine-DNA-glycosylase (FPG). The administration of OTA had no effect on basic DNA damage (determined without FPG); however, OTA-mediated oxidative damage was detected with FPG treatment in kidney and liver DNA of all dose groups. Since the doses were in a range that had caused kidney tumors in a 2-year carcinogenicity study with rats, the oxidative DNA damage induced by OTA may help to explain its mechanism of carcinogenicity. For the selective induction of tumors in the kidney, increased oxidative stress in connection with severe cytotoxicity and increased cell proliferation might represent driving factors. PMID:16302199

  10. Damage to dry plasmid DNA induced by nanosecond XUV-laser pulses

    NASA Astrophysics Data System (ADS)

    Nováková, Eva; Davídková, Marie; Vyšín, Ludék; Burian, Tomáš; Grisham, Michael E.; Heinbuch, Scott; Rocca, Jorge J.; Juha, Libor

    2011-06-01

    Ionizing radiation induces a variety of DNA damages including single-strand breaks (SSBs), double-strand breaks (DSBs), abasic sites, modified sugar and bases. Most theoretical and experimental studies have been focused on DNA strand scissions, in particular production of DNA double-strand breaks. DSBs have been proven to be a key damage at a molecular level responsible for the formation of chromosomal aberrations, leading often to cell death. The complexity of lesions produced in DNA by ionizing radiations is thought to depend on the amount of energy deposited at the site of each lesion. We have studied the nature of DNA damage induced directly by the pulsed 46.9 nm radiation provided by a capillary-discharge Ne-like Ar laser (CDL). Different surface doses were delivered with a repetition rate of a few Hz and an average pulse energy ~ 1 μJ. A simple model DNA molecule, i.e., dried closed-circular plasmid DNA (pBR322), was irradiated. The agarose gel electrophoresis method was used for determination of both SSB and DSB yields. Results are compared with a previous study of plasmid DNA irradiated with a single sub-nanosecond 1-keV X-ray pulse produced by a large-scale, double-stream gas puff target, illuminated by sub-kJ, near-infrared (NIR) focused laser pulses at the PALS facility (Prague Asterix Laser System).

  11. Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells

    NASA Astrophysics Data System (ADS)

    Yu, L. D.; Sangwijit, K.; Prakrajang, K.; Phanchaisri, B.; Thongkumkoon, P.; Thopan, P.; Singkarat, S.; Anuntalabhochai, S.

    2014-05-01

    As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10-20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence.

  12. Intranasal vaccination with proinsulin DNA induces regulatory CD4+ T cells that prevent experimental autoimmune diabetes.

    PubMed

    Every, Alison L; Kramer, David R; Mannering, Stuart I; Lew, Andrew M; Harrison, Leonard C

    2006-04-15

    Insulin, an autoantigen in type 1 diabetes, when administered mucosally to diabetes-prone NOD mice induces regulatory T cells (T(reg)) that protect against diabetes. Compared with protein, Ag encoded as DNA has potential advantages as a therapeutic agent. We found that intranasal vaccination of NOD mice with plasmid DNA encoding mouse proinsulin II-induced CD4+ T(reg) that suppressed diabetes development, both after adoptive cotransfer with "diabetogenic" spleen cells and after transfer into NOD mice given cyclophosphamide to accelerate diabetes onset. In contrast to prototypic CD4+ CD25+ T(reg), CD4+ T(reg) induced by proinsulin DNA were both CD25+ and CD25- and not defined by markers such as glucocorticoid-induced TNFR-related protein (GITR), CD103, or Foxp3. Intriguingly, despite induction of T(reg) and reduced islet inflammation, diabetes incidence in proinsulin DNA-treated mice was unchanged. However, diabetes was prevented when DNA vaccination was performed under the cover of CD40 ligand blockade, known to prevent priming of CTL by mucosal Ag. Thus, intranasal vaccination with proinsulin DNA has therapeutic potential to prevent diabetes, as demonstrated by induction of protective T(reg), but further modifications are required to improve its efficacy, which could be compromised by concomitant induction of pathogenic immunity. PMID:16585551

  13. Quantum speciation in Aegilops: Molecular cytogenetic evidence from rDNA cluster variability in natural populations

    PubMed Central

    Raskina, Olga; Belyayev, Alexander; Nevo, Eviatar

    2004-01-01

    Data are presented on quantum speciation in the Sitopsis section of the genus Aegilops (Poaceae, Monocotyledones). Two small, peripheral, isolated, wild populations of annual cross-pollinated Ae. speltoides and annual self-pollinated Ae. sharonensis are located 30 m apart on different soil types. Despite the close proximity of the two species and their close relatedness, no mixed groups are known. Comparative molecular cytogenetic analysis based on the intrapopulation variability of rRNA-encoding DNA (rDNA) chromosomal patterns of individual Ae. speltoides geno-types revealed an ongoing dynamic process of permanent chromosomal rearrangements. Chromosomal mutations can arise de novo and can be eliminated. Analysis of the progeny of the investigated genotypes testifies that inheritance of de novo rDNA sites happens frequently. Heterologous recombination and/or transposable elements-mediated rDNA transfer seem to be the mechanisms for observed chromosomal repatterning. Consequently, several modified genomic forms, intermediate between Ae. speltoides and Ae. sharonensis, permanently arise in the studied wild population of Ae. speltoides, which make it possible to recognize Ae. sharonensis as a derivative species of Ae. speltoides, as well as to propose rapidness and canalization of quantum speciation in Sitopsis species. PMID:15466712

  14. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton

    SciTech Connect

    Malloy, K.D.; Holman, M.A.; Mitchell, D.

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlated with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. 54 refs., 4 figs., 2 tabs.

  15. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton.

    PubMed

    Malloy, K D; Holman, M A; Mitchell, D; Detrich, H W

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlate with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. PMID:9037040

  16. Complete Spectrum of CRISPR/Cas9-induced Mutations on HBV cccDNA.

    PubMed

    Seeger, Christoph; Sohn, Ji A

    2016-08-01

    Hepatitis B virus (HBV) causes chronic infections that cannot yet be cured. The virus persists in infected hepatocytes, because covalently closed circular DNA (cccDNA), the template for the transcription of viral RNAs, is stable in nondividing cells. Antiviral therapies with nucleoside analogues inhibit HBV DNA synthesis in capsids in the cytoplasm of infected hepatocytes, but do not destroy nuclear cccDNA. Because over 200 million people are still infected, a cure for chronic hepatitis B (CHB) has become one of the major challenges in antiviral therapy. As a first step toward the development of curative therapies, we previously demonstrated that the CRISPR/Cas9 system can be used to functionally inactivate cccDNA derived from infectious HBV. Moreover, some evidence suggests that certain cytokines might induce an APOBEC-mediated cascade leading to the destruction of cccDNA. In this report we investigated whether a combination of the two mechanisms could act synergistically to inactivate cccDNA. Using next generation sequencing (NGS), we determined the complete spectrum of mutations in cccDNA following Cas9 cleavage and repair by nonhomologous end joining (NHEJ). We found that over 90% of HBV DNA was cleaved by Cas9. In addition our results showed that editing of HBV DNA after Cas9 cleavage is at least 15,000 times more efficient that APOBEC-mediated cytosine deamination following treatment of infected cells with interferon alpha (IFNα). We also found that a previously used method to detect cytosine deaminated DNA, termed 3D-PCR, overestimates the amount and frequency of edited HBV DNA. Taken together, our results demonstrated that the CRISPR/Cas9 system is so far the best method to functionally inactivate HBV cccDNA and provide a cure for CHB. PMID:27203444

  17. Activity-induced clustering in model dumbbell swimmers: the role of hydrodynamic interactions.

    PubMed

    Furukawa, Akira; Marenduzzo, Davide; Cates, Michael E

    2014-08-01

    Using a fluid-particle dynamics approach, we numerically study the effects of hydrodynamic interactions on the collective dynamics of active suspensions within a simple model for bacterial motility: each microorganism is modeled as a stroke-averaged dumbbell swimmer with prescribed dipolar force pairs. Using both simulations and qualitative arguments, we show that, when the separation between swimmers is comparable to their size, the swimmers' motions are strongly affected by activity-induced hydrodynamic forces. To further understand these effects, we investigate semidilute suspensions of swimmers in the presence of thermal fluctuations. A direct comparison between simulations with and without hydrodynamic interactions shows these to enhance the dynamic clustering at a relatively small volume fraction; with our chosen model the key ingredient for this clustering behavior is hydrodynamic trapping of one swimmer by another, induced by the active forces. Furthermore, the density dependence of the motility (of both the translational and rotational motions) exhibits distinctly different behaviors with and without hydrodynamic interactions; we argue that this is linked to the clustering tendency. Our study illustrates the fact that hydrodynamic interactions not only affect kinetic pathways in active suspensions, but also cause major changes in their steady state properties. PMID:25215734

  18. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc.

    PubMed

    Cooper, Karen L; King, Brenee S; Sandoval, Monica M; Liu, Ke Jian; Hudson, Laurie G

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  19. Agents that reverse UV-induced immune suppression and photocarcinogenesis affect DNA repair

    PubMed Central

    Sreevidya, Coimbatore S.; Fukunaga, Atsushi; Khaskhely, Noor M.; Masaki, Taro; Ono, Ryusuke; Nishigori, Chikako; Ullrich, Stephen E.

    2010-01-01

    UV exposure induces skin cancer, in part by inducing immune suppression. Repairing DNA damage, neutralizing the activity of cis-urocanic acid (cis-UCA), and reversing oxidative stress abrogates UV-induced immune suppression and skin cancer induction, suggesting the DNA, UCA and lipid photo-oxidation serves as UV photoreceptors. What is not clear is whether signaling through each of these different photoreceptors activates independent pathways to induce biological effects or whether there is a common checkpoint where these pathways converge. Here we show that agents known to reverse photocarcinogenesis and photoimmune suppression, such as platelet activating factor (PAF) and serotonin (5-HT) receptor antagonists regulate DNA repair. Pyrimidine dimer repair was accelerated in UV-irradiated mice injected with PAF and 5-HT receptor antagonists. Nucleotide excision repair, as measured by unscheduled DNA synthesis, was accelerated by PAF and 5-HT receptor antagonists. Injecting PAF and 5-HT receptor antagonists into UV-irradiated Xeroderma pigmentosum complementation group A (XPA) deficient mice, which lack the enzymes responsible for nucleotide excision repair, did not accelerate photoproduct repair. Similarly, UV-induced formation of 8-oxo-deoxyguanosine (8-oxo-dG) was reduced by PAF and 5-HT receptor antagonists. We conclude that PAF and 5-HT receptor antagonists accelerate DNA repair caused by UV radiation, which prevents immune suppression and interferes with photocarcinogenesis. PMID:19829299

  20. Toll-like Receptor 9 Can be Activated by Endogenous Mitochondrial DNA to Induce Podocyte Apoptosis

    PubMed Central

    Bao, Wenduona; Xia, Hong; Liang, Yaojun; Ye, Yuting; Lu, Yuqiu; Xu, Xiaodong; Duan, Aiping; He, Jing; Chen, Zhaohong; Wu, Yan; Wang, Xia; Zheng, Chunxia; Liu, Zhihong; Shi, Shaolin

    2016-01-01

    Toll-like receptor 9 (TLR9) senses bacterial DNA characteristic of unmethylated CpG motifs to induce innate immune response. TLR9 is de novo expressed in podocytes of some patients with glomerular diseases, but its role in podocyte injury remains undetermined. Since TLR9 activates p38 MAPK and NFkB that are known to mediate podocyte apoptosis, we hypothesized that TLR9 induces podocyte apoptosis in glomerular diseases. We treated immortalized podocytes with puromycin aminonucleosides (PAN) and observed podocyte apoptosis, accompanied by TLR9 upregulation. Prevention of TLR9 upregulation by siRNA significantly attenuated NFκB p65 or p38 activity and apoptosis, demonstrating that TLR9 mediates podocyte apoptosis. We next showed that endogenous mitochondrial DNA (mtDNA), whose CpG motifs are also unmethylated, is the ligand for TLR9, because PAN induced mtDNA accumulation in endolysosomes where TLR9 is localized, overexpression of endolysosomal DNase 2 attenuated PAN-induced p38 or p65 activity and podocyte apoptosis, and DNase 2 silencing was sufficient to activate p38 or p65 and induce apoptosis. In PAN-treated rats, TLR9 was upregulated in the podocytes, accompanied by increase of apoptosis markers. Thus, de novo expressed TLR9 may utilize endogenous mtDNA as the ligand to facilitate podocyte apoptosis, a novel mechanism underlying podocyte injury in glomerular diseases. PMID:26934958

  1. Induced topological changes in DNA complexes: influence of DNA sequences and small molecule structures

    PubMed Central

    Hunt, Rebecca A.; Munde, Manoj; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Arafa, Reem K.; Say, Martial; Batista-Parra, Adalgisa; Tevis, Denise; Boykin, David W.; Wilson, W. David

    2011-01-01

    Heterocyclic diamidines are compounds with antiparasitic properties that target the minor groove of kinetoplast DNA. The mechanism of action of these compounds is unknown, but topological changes to DNA structures are likely to be involved. In this study, we have developed a polyacrylamide gel electrophoresis-based screening method to determine topological effects of heterocyclic diamidines on four minor groove target sequences: AAAAA, TTTAA, AAATT and ATATA. The AAAAA and AAATT sequences have the largest intrinsic bend, whereas the TTTAA and ATATA sequences are relatively straight. The changes caused by binding of the compounds are sequence dependent, but generally the topological effects on AAAAA and AAATT are similar as are the effects on TTTAA and ATATA. A total of 13 compounds with a variety of structural differences were evaluated for topological changes to DNA. All compounds decrease the mobility of the ATATA sequence that is consistent with decreased minor groove width and bending of the relatively straight DNA into the minor groove. Similar, but generally smaller, effects are seen with TTTAA. The intrinsically bent AAAAA and AAATT sequences, which have more narrow minor grooves, have smaller mobility changes on binding that are consistent with increased or decreased bending depending on compound structure. PMID:21266485

  2. Controlling the Adsorption of Carbon Monoxide on Platinum Clusters by Dopant-Induced Electronic Structure Modification.

    PubMed

    Ferrari, Piero; Molina, Luis M; Kaydashev, Vladimir E; Alonso, Julio A; Lievens, Peter; Janssens, Ewald

    2016-09-01

    A major drawback of state-of-the-art proton exchange membrane fuel cells is the CO poisoning of platinum catalysts. It is known that CO poisoning is reduced if platinum alloys are used, but the underlying mechanism therefore is still under debate. We study the influence of dopant atoms on the CO adsorption on small platinum clusters using mass spectrometry experiments and density functional calculations. A significant reduction in the reactivity for Nb- and Mo-doped clusters is attributed to electron transfer from those highly coordinated dopants to the Pt atoms and the concomitant lower CO binding energies. On the other hand Sn and Ag dopants have a lower Pt coordination and have a limited effect on the CO adsorption. Analysis of the density of states demonstrates a correlation of dopant-induced changes in the electronic structure with the enhanced tolerance to CO poisoning. PMID:27464653

  3. A splice variant of RILP induces lysosomal clustering independent of dynein recruitment

    SciTech Connect

    Marsman, Marije; Jordens, Ingrid; Rocha, Nuno; Kuijl, Coenraad; Janssen, Lennert; Neefjes, Jacques . E-mail: j.neefjes@nki.nl

    2006-06-09

    The small GTPase Rab7 controls fusion and transport of late endocytic compartments. A critical mediator is the Rab7 effector RILP that recruits the minus-end dynein-dynactin motor complex to these compartments. We identified a natural occurring splice variant of RILP (RILPsv) lacking only 27 amino acids encoded by exon VII. Both variants bind Rab7, prolong its GTP-bound state, and induce clustering of late endocytic compartments. However, RILPsv does not recruit the dynein-dynactin complex, implicating exon VII in motor recruitment. Clustering might still occur via dimerization, since both RILP and RILPsv are able to form hetero- and homo-dimers. Moreover, both effectors compete for Rab7 binding but with different outcome for dynein-dynactin recruitment and transport. Hence, RILPsv provides an extra dimension to the control of vesicle fusion and transport by the small GTPase Rab7.

  4. Bacteria clustering by polymers induces the expression of quorum sense controlled phenotypes

    PubMed Central

    Lui, Leong T.; Xue, Xuan; Sui, Cheng; Brown, Alan; Pritchard, David I.; Halliday, Nigel; Winzer, Klaus; Howdle, Steven M.; Fernandez-Trillo, Francisco; Krasnogor, Natalio; Alexander, Cameron

    2014-01-01

    Bacteria deploy a range of chemistries to regulate their behaviour and respond to their environment. Quorum sensing is one mean by which bacteria use chemical reactions to modulate pre-infection behaviour such as surface attachment. Polymers that can interfere with bacterial adhesion or the chemical reactions used for quorum sensing are thus a potential means to control bacterial population responses. Here we report how polymeric “bacteria sequestrants”, designed to bind to bacteria through electrostatic interactions and thus inhibit bacterial adhesion to surfaces, induce the expression of quorum sensing controlled phenotypes as a consequence of cell clustering. A combination of polymer and analytical chemistry, biological assays and computational modelling has been used to characterise the feedback between bacteria clustering and quorum sensing signaling. We have also derived design principles and chemical strategies for controlling bacterial behaviour at the population level. PMID:24256871

  5. Bacteria clustering by polymers induces the expression of quorum-sensing-controlled phenotypes

    NASA Astrophysics Data System (ADS)

    Lui, Leong T.; Xue, Xuan; Sui, Cheng; Brown, Alan; Pritchard, David I.; Halliday, Nigel; Winzer, Klaus; Howdle, Steven M.; Fernandez-Trillo, Francisco; Krasnogor, Natalio; Alexander, Cameron

    2013-12-01

    Bacteria deploy a range of chemistries to regulate their behaviour and respond to their environment. Quorum sensing is one method by which bacteria use chemical reactions to modulate pre-infection behaviour such as surface attachment. Polymers that can interfere with bacterial adhesion or the chemical reactions used for quorum sensing are therefore a potential means to control bacterial population responses. Here, we report how polymeric ‘bacteria sequestrants’, designed to bind to bacteria through electrostatic interactions and therefore inhibit bacterial adhesion to surfaces, induce the expression of quorum-sensing-controlled phenotypes as a consequence of cell clustering. A combination of polymer and analytical chemistry, biological assays and computational modelling has been used to characterize the feedback between bacteria clustering and quorum sensing signalling. We have also derived design principles and chemical strategies for controlling bacterial behaviour at the population level.

  6. Cyclic GMP-AMP Synthase is Activated by Double-stranded DNA-Induced Oligomerization

    PubMed Central

    Li, Xin; Shu, Chang; Yi, Guanghui; Chaton, Catherine T.; Shelton, Catherine L.; Diao, Jiasheng; Zuo, Xiaobing; Kao, C Cheng; Herr, Andrew B.; Li, Pingwei

    2013-01-01

    Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor mediating innate antimicrobial immunity. It catalyzes the synthesis of a noncanonical cyclic dinucleotide 2′,5′ cGAMP that binds to STING and mediates the activation of TBK1 and IRF-3. Activated IRF-3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The structure of mouse cGAS bound to an 18 bp dsDNA revealed that cGAS interacts with dsDNA through two binding sites, forming a 2:2 complex. Enzyme assays and IFN-β reporter assays of cGAS mutants demonstrated that interactions at both DNA binding sites are essential for cGAS activation. Mutagenesis and DNA binding studies showed that the two sites bind dsDNA cooperatively and site B plays a critical role in DNA binding. The structure of mouse cGAS bound to dsDNA and 2′,5′ cGAMP provided insight into the catalytic mechanism of cGAS. These results demonstrated that cGAS is activated by dsDNA-induced oligomerization. PMID:24332030

  7. Crystal Structure of the Lactose Operon Repressor and Its Complexes with DNA and Inducer

    NASA Astrophysics Data System (ADS)

    Lewis, Mitchell; Chang, Geoffrey; Horton, Nancy C.; Kercher, Michele A.; Pace, Helen C.; Schumacher, Maria A.; Brennan, Richard G.; Lu, Ponzy

    1996-03-01

    The lac operon of Escherichia coli is the paradigm for gene regulation. Its key component is the lac repressor, a product of the lacI gene. The three-dimensional structures of the intact lac repressor, the lac repressor bound to the gratuitous inducer isopropyl-β-D-1-thiogalactoside (IPTG) and the lac repressor complexed with a 21-base pair symmetric operator DNA have been determined. These three structures show the conformation of the molecule in both the induced and repressed states and provide a framework for understanding a wealth of biochemical and genetic information. The DNA sequence of the lac operon has three lac repressor recognition sites in a stretch of 500 base pairs. The crystallographic structure of the complex with DNA suggests that the tetrameric repressor functions synergistically with catabolite gene activator protein (CAP) and participates in the quaternary formation of repression loops in which one tetrameric repressor interacts simultaneously with two sites on the genomic DNA.

  8. The DNA damage-induced cell death response: a roadmap to kill cancer cells.

    PubMed

    Matt, Sonja; Hofmann, Thomas G

    2016-08-01

    Upon massive DNA damage cells fail to undergo productive DNA repair and trigger the cell death response. Resistance to cell death is linked to cellular transformation and carcinogenesis as well as radio- and chemoresistance, making the underlying signaling pathways a promising target for therapeutic intervention. Diverse DNA damage-induced cell death pathways are operative in mammalian cells and finally culminate in the induction of programmed cell death via activation of apoptosis or necroptosis. These signaling routes affect nuclear, mitochondria- and plasma membrane-associated key molecules to activate the apoptotic or necroptotic response. In this review, we highlight the main signaling pathways, molecular players and mechanisms guiding the DNA damage-induced cell death response. PMID:26791483

  9. Geometry of a complex formed by double strand break repair proteins at a single DNA end: recruitment of DNA-PKcs induces inward translocation of Ku protein.

    PubMed

    Yoo, S; Dynan, W S

    1999-12-15

    Ku protein and the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) are essential components of the double-strand break repair machinery in higher eukaryotic cells. Ku protein binds to broken DNA ends and recruits DNA-PKcs to form an enzymatically active complex. To characterize the arrangement of proteins in this complex, we developed a set of photocross-linking probes, each with a single free end. We have previously used this approach to characterize the contacts in an initial Ku-DNA complex, and we have now applied the same technology to define the events that occur when Ku recruits DNA-PKcs. The new probes allow the binding of one molecule of Ku protein and one molecule of DNA-PKcs in a defined position and orientation. Photocross-linking reveals that DNA-PKcs makes direct contact with the DNA termini, occupying an approximately 10 bp region proximal to the free end. Characterization of the Ku protein cross-linking pattern in the presence and absence of DNA-PKcs suggests that Ku binds to form an initial complex at the DNA ends, and that recruitment of DNA-PKcs induces an inward translocation of this Ku molecule by about one helical turn. The presence of ATP had no effect on protein-DNA contacts, suggesting that neither DNA-PK-mediated phosphorylation nor a putative Ku helicase activity plays a role in modulating protein conformation under the conditions tested. PMID:10572166

  10. Low Incubation Temperature Induces DNA Hypomethylation in Lizard Brains.

    PubMed

    Paredes, Ursula; Radersma, Reinder; Cannell, Naomi; While, Geoffrey M; Uller, Tobias

    2016-07-01

    Developmental stress can have organizational effects on suites of physiological, morphological, and behavioral characteristics. In lizards, incubation temperature is perhaps the most significant environmental variable affecting embryonic development. Wall lizards (Podarcis muralis) recently introduced by humans from Italy to England experience stressfully cool incubation conditions, which we here show reduce growth and increase the incidence of scale malformations. Using a methylation-sensitive AFLP protocol optimized for vertebrates, we demonstrate that this low incubation temperature also causes hypomethylation of DNA in brain tissue. A consistent pattern across methylation-susceptible AFLP loci suggests that hypomethylation is a general response and not limited to certain CpG sites. The functional consequences of hypomethylation are unknown, but it could contribute to genome stability and regulation of gene expression. Further studies of the effects of incubation temperature on DNA methylation in ectotherm vertebrates may reveal mechanisms that explain why the embryonic thermal environment often has physiological and behavioral consequences for offspring. PMID:27328739

  11. UV-Induced Proton Transfer between DNA Strands.

    PubMed

    Zhang, Yuyuan; de La Harpe, Kimberly; Beckstead, Ashley A; Improta, Roberto; Kohler, Bern

    2015-06-10

    UV radiation creates excited states in DNA that lead to mutagenic photoproducts. Photoexcitation of single-stranded DNA can transfer an electron between stacked bases, but the fate of excited states in the double helix has been intensely debated. Here, photoinduced interstrand proton transfer (PT) triggered by intrastrand electron transfer (ET) is detected for the first time by time-resolved vibrational spectroscopy and quantum mechanical calculations. Long-lived excited states are shown to be oppositely charged base pair radical ions. In two of the duplexes, the base pair radical anions are present as tautomers formed by interstrand PT. Charge recombination occurs on the picosecond time scale preventing the accumulation of damaging radicals or mutagenic tautomers. PMID:26005794

  12. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.

    1989-01-01

    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  13. Photothermolysis by laser-induced microbubbles generated around gold nanorod clusters selectively formed in leukemia cells

    NASA Astrophysics Data System (ADS)

    Lapotko, Dmitri; Lukianova-Hleb, Ekaterina; Zhdanok, Sergei; Rostro, Betty; Simonette, Rebecca; Hafner, Jason; Konopleva, Marina; Andreeff, Michael; Conjusteau, Andre; Oraevsky, Alexander

    2008-02-01

    In an effort of developing clinical LANTCET (laser-activated nano-thermolysis as cell elimination technology) we achieved selective destruction of individual tumor cells through laser generation of vapor microbubbles around clusters of light absorbing gold nanorods (GNR) selectively formed in target tumor cells. Among all gold nanoparticles, nanorods offer the highest optical absorption in the near-infrared. We applied covalent conjugates of gold nanorods with targeting vectors such as monoclonal antibodies CD33 (specific for Acute Myeloid Leukemia), while GNR conjugates with polyethylene-glycol (PEG) were used as nonspecific targeting control. GNR clusters were formed inside the tumor cells at 37 °C due to endocytosis of large concentration of nanorods accumulated on the surface of tumor cells targeted at 4 °C. Formation of GNR clusters significantly reduces the threshold of tumor cell damage making LANTCET safe for normal cells. Appearance of GNR clusters was verified directly with optical resonance scattering microscopy. LANTCET was performed in vitro with living cells of (1) model myeloid K562 cells (CD33 positive), (2) primary human bone marrow CD33-positive blast cells from patients diagnosed with acute myeloid leukemia. Laser-induced microbubbles were generated and detected with a photothermal microscope equipped with a tunable Ti-Sa pulsed laser. GNT cluster formation caused a 100-fold decrease in the threshold optical fluence for laser microbubble generation in tumor cells compared with that in normal cells under the same targeting and irradiation conditions. Combining imaging based on resonance optical scattering with photothermal imaging of microbubbles, we developed a method for detection, image-guided treatment and monitoring of LANTCET. Pilot experiments were performed in flow mode bringing LANTCET closer to reality of clinical procedure of purging tumor cells from bone marrow grafts.

  14. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.

    2011-01-01

    UVA has long been known for generating an oxidative stress in cells. In this paper we review the different types of DNA damage induced by UVA, i.e. strand breaks, bipyrimidine photoproducts, and oxidatively damaged bases. Emphasis is given to the mechanism of formation that is further illustrated by the presentation of new in vitro data. Examples of oxidation of proteins involved in DNA metabolism are also given.

  15. Polyethylene glycol and divalent salt-induced DNA reentrant condensation revealed by single molecule measurements.

    PubMed

    Cheng, Chao; Jia, Jun-Li; Ran, Shi-Yong

    2015-05-21

    In this study, we investigated the DNA condensation induced by polyethylene glycol (PEG) with different molecular weights (PEG 600 and PEG 6000) in the presence of NaCl or MgCl2 by using magnetic tweezers (MT) and atomic force microscopy (AFM). The MT measurements show that with increasing NaCl concentration, the critical condensation force in the PEG 600-DNA or PEG 6000-DNA system increased approximately linearly. PEG 6000 solution has a larger critical force than PEG 600 solution at a given NaCl concentration. In comparison, a parabolic trend of the critical condensation force was observed with increasing MgCl2 concentration, indicating that DNA undergoes a reentrant condensation. The AFM results show that the morphologies of the compacted DNA-PEG complexes depended on the salt concentration and were consistent with the MT results. PMID:25871460

  16. DNA demethylation caused by 5-Aza-2′-deoxycytidine induces mitotic alterations and aneuploidy

    PubMed Central

    Lentini, Laura; Cilluffo, Danilo; Di Leonardo, Aldo

    2016-01-01

    Aneuploidy, the unbalanced number of chromosomes in a cell, is considered a prevalent form of genetic instability and is largely acknowledged as a condition implicated in tumorigenesis. Epigenetic alterations like DNA hypomethylation have been correlated with cancer initiation/progression. Furthermore, a growing body of evidence suggests the involvement of epigenome-wide disruption as a cause of global DNA hypomethylation in aneuploidy generation. Here, we report that the DNA hypomethylating drug 5-aza-2′-deoxycytidine (DAC), affects the correct ploidy of nearly diploid HCT-116 human cells by altering the methylation pattern of the chromosomes. Specifically, we show that a DAC-induced reduction of 5-Methyl Cytosine at the pericentromeric region of chromosomes correlates with aneuploidy and mitotic defects. Our results suggest that DNA hypomethylation leads to aneuploidy by altering the DNA methylation landscape at the centromere that is necessary to ensure proper chromosomes segregation by recruiting the proteins necessary to build up a functional kinetochore. PMID:26771138

  17. Human papillomavirus type 16 DNA-induced malignant transformation of NIH 3T3 cells

    SciTech Connect

    Yasumoto, S.; Burkhardt, A.L.; Doniger, J.; DiPaolo, J.A.

    1986-02-01

    A biological function for human papillomavirus 16 (HPV 16) DNA was demonstrated by transformation of NIH 3T3 cells. HPV 16 DNA has been found frequently in genital cancer and has been classified as a papillomavirus on the basis of DNA homology. A recombinant HPV 16 DNA (pSHPV16d), which contains a head-to-tail dimer of the full-length HPV 16 genome, induced morphologic transformation; the transformed cells were tumorigenic in nude mice. Expression of transforming activity was unique because of the long latency period (more than 4 weeks) required for induction of morphologic transformation and because the transfected DNA existed primarily in a multimeric form with some rearrangement. Furthermore, virus-specific RNAs were expressed in the transformants. The transformation of NIH 3T3 cells provides a model for analyzing the functions of HPV 16, which is associated with cervical carcinomas.

  18. Condensations of single DNA molecules induced by heptaplatin and its chiral isomer

    SciTech Connect

    Zhang, Hong-Yan; Liu, Yu-Ru; Li, Wei; Li, Hui; Dou, Shuo-Xing; Xie, Ping; Wang, Wei-Chi; Wang, Peng-Ye

    2014-08-15

    Heptaplatin is a third-generation platinum antitumor drug. It has a chiral isomer. We studied the interactions between the two isomers and DNA by using magnetic tweezers and atomic force microscopy (AFM) to investigate the effect of chiralities of the isomers on the interactions. We found that the extension curves and average condensation rates of DNA molecules incubated with heptaplatin were nearly the same as those incubated with its chiral isomer. In addition, the structures of DNA molecules incubated with heptaplatin were also similar to those incubated with its chiral isomer. These results indicate the difference in chirality of the two isomers does not induce different interactions of the isomers with DNA. Our study may facilitate the understanding of interactions of platinum complexes with DNA and the design of new antitumor platinum complexes.

  19. The Potential Role of 8-Oxoguanine DNA Glycosylase-Driven DNA Base Excision Repair in Exercise-Induced Asthma

    PubMed Central

    Belanger, KarryAnne K.; Ameredes, Bill T.; Boldogh, Istvan

    2016-01-01

    Asthma is characterized by reversible airway narrowing, shortness of breath, wheezing, coughing, and other symptoms driven by chronic inflammatory processes, commonly triggered by allergens. In 90% of asthmatics, most of these symptoms can also be triggered by intense physical activities and severely exacerbated by environmental factors. This condition is known as exercise-induced asthma (EIA). Current theories explaining EIA pathogenesis involve osmotic and/or thermal alterations in the airways caused by changes in respiratory airflow during exercise. These changes, along with existing airway inflammatory conditions, are associated with increased cellular levels of reactive oxygen species (ROS) affecting important biomolecules including DNA, although the underlying molecular mechanisms have not been completely elucidated. One of the most abundant oxidative DNA lesions is 8-oxoguanine (8-oxoG), which is repaired by 8-oxoguanine DNA glycosylase 1 (OGG1) during the base excision repair (BER) pathway. Whole-genome expression analyses suggest a cellular response to OGG1-BER, involving genes that may have a role in the pathophysiology of EIA leading to mast cell degranulation, airway hyperresponsiveness, and bronchoconstriction. Accordingly, this review discusses a potential new hypothesis in which OGG1-BER-induced gene expression is associated with EIA symptoms. PMID:27524866

  20. Mycobacterium tuberculosis DNA fingerprint clusters and its relationship with RDRio genotype in Brazil

    PubMed Central

    Vinhas, Solange Alves; Palaci, Moisés; Marques, Hebert Silva; de Aguiar, Paola Poloni Lobo; Ribeiro, Fabíola Karla; Peres, Renata Lyrio; Dietze, Reynaldo; Gomes, Harrison Magdinier; Suffys, Philip Noel; Golub, Jonathan E.; Riley, Lee W.; Maciel, Ethel Leonor Noia

    2013-01-01

    SUMMARY Mycobacterium tuberculosis (Mtb) strains designated as RDRio are responsible for a large cluster of new cases of tuberculosis (TB) in Rio de Janeiro. They were previously shown to be associated with severe manifestations of TB. Here, we used three genotyping methods (IS6110 RFLP, spoligotyping, and multiplex PCR) to characterize RDRio and non-RDRio strains from the metropolitan area of Vitória, State of Espirito Santo in southeast Brazil to determine strain diversity and transmission patterns. Strains with identical IS6110 RFLP patterns were considered to belong to a cluster indicative of recent transmission. Between 2000 and 2010, we identified 5470 new TB patients and genotyped 981 Mtb strains. Of these, 376 (38%) were RDRio. By RFLP, 180 (48%) of 376 RDRio strains and 235 (40%) of 593 non-RDRio strains belonged to RFLP cluster pattern groups (p = 0.023). Simpson’s diversity index based on RFLP patterns was 0.96 for RDRio and 0.98 for non-RDRio strains. Thus, although RDRio strains appear to be comprised of a fewer number of RFLP genotypes, they represent a heterogeneous group. While TB cases caused by RDRio appear more likely to be due to recent transmission than cases caused by non-RDRio strains, the difference is small. These observations suggest that factors other than inherent biological characteristic of RDRio lineages are more important in determining recent transmission, and that public health measures to interrupt new transmissions need to be emphasized for TB control in Vitória. PMID:23232111

  1. The radiomimetic enediyne C-1027 induces unusual DNA damage responses to double-strand breaks.

    PubMed

    Kennedy, Daniel R; Beerman, Terry A

    2006-03-21

    Cells lacking the protein kinase ataxia telangiectasia mutated (ATM) have defective responses to DNA double-strand breaks (DSBs), including an inability to activate damage response proteins such as p53. However, we previously showed that cells lacking ATM robustly activate p53 in response to DNA strand breaks induced by the radiomimetic enediyne C-1027. To gain insight into the nature of C-1027-induced ATM-independent damage responses to DNA DSBs, we further examined the molecular mechanisms underlying the cellular response to this unique radiomimetic agent. Like ionizing radiation (IR) and other radiomimetics, breaks induced by C-1027 efficiently activate ATM by phosphorylation at Ser1981, yet unlike other radiomimetics and IR, DNA breaks induced by C-1027 result in normal phosphorylation of p53 and the cell cycle checkpoint kinases (Chk1 and Chk2) in the absence of ATM. In the presence of ATM, but under ATM and Rad3-related kinase (ATR) deficient conditions, C-1027 treatment resulted in a decrease in the level of Chk1 phosphorylation but not in the level of p53 and Chk2 phosphorylation. Only when cells were deficient in both ATM and ATR was there a reduction in the level of phosphorylation of each of these DNA damage response proteins. This reduction was also accompanied by an increased level of cell death in comparison to that of wild-type cells or cells lacking either ATM or ATR. Our findings demonstrate a unique cellular response to C-1027-induced DNA DSBs in that DNA damage response proteins are unaffected by the absence of ATM, as long as ATR is present. PMID:16533058

  2. UV-induced DNA damage in Cyclops abyssorum tatricus populations from clear and turbid alpine lakes

    PubMed Central

    Tartarotti, Barbara; Saul, Nadine; Chakrabarti, Shumon; Trattner, Florian; Steinberg, Christian E. W.; Sommaruga, Ruben

    2014-01-01

    Zooplankton from clear alpine lakes thrive under high levels of solar UV radiation (UVR), but in glacially turbid ones they are more protected from this damaging radiation. Here, we present results from experiments done with Cyclops abyssorum tatricus to assess UV-induced DNA damage and repair processes using the comet assay. Copepods were collected from three alpine lakes of differing UV transparency ranging from clear to glacially turbid, and exposed to artificial UVR. In addition, photoprotection levels [mycosporine-like amino acids (MAAs) and lipophilic antioxidant capacity] were estimated in the test populations. Similar UV-induced DNA damage levels were observed among the copepods from all lakes, but background DNA damage (time zero and dark controls) was lowest in the copepods from the glacially turbid lake, resulting in a higher relative DNA damage accumulation. Most DNA strand breaks were repaired after recovery in the dark. Low MAA concentrations were found in the copepods from the glacially turbid lake, while the highest levels were observed in the population from the most UV transparent lake. However, the highest lipophilic antioxidant capacities were measured in the copepods from the lake with intermediate UV transparency. Photoprotection and the ability to repair DNA damage, and consequently reducing UV-induced damage, are part of the response mechanisms in zooplankton to changes in water transparency caused by glacier retreat. PMID:24616551

  3. Immune response induced by candidate Sarcoptes scabiei var. cuniculi DNA vaccine encoding paramyosin in mice.

    PubMed

    Gu, Xiaobin; Xie, Yue; Wang, Shuxian; Peng, Xuerong; Lai, Songjia; Yang, Guangyou

    2014-07-01

    Sarcoptes scabiei is the causal agent of the highly contagious disease sarcoptic mange (scabies) that affects animals and humans worldwide. An increasing number of cases of treatment failure is being reported because of drug resistance. The development of a specific vaccine would be a sustainable option for control of this disease. In this study, we cloned and expressed a S. scabiei gene encoding paramyosin (PAR) and investigated the immune response elicited by DNA encoding PAR in mice. The ability of the DNA vaccine to express antigen in COS-7 cells was confirmed by RT-PCR and IFA. The immune response induced by DNA vaccine was investigated by ELISA, splenocyte proliferation assay, and cytokine production assay. Compared to the pVAX1 control group, the PAR DNA vaccination group showed the higher levels of IgG, IgG1, IgG2a, IgE, IgM, stronger lymphocyte proliferation in mouse spleen, and larger production of IL-2, IL-4, IL-5, and IFN-γ in the supernatant of cultures from splenocytes. These results indicated that the PAR DNA vaccine induced a mixed Th1/Th2 response in mice. In conclusion, our results revealed that the S. scabiei PAR DNA vaccine induced both a humoral and cellular immune response, which would provide basic data for the further study to develop an effective vaccine against sarcoptic mange. PMID:24729069

  4. The adeno-associated virus rep gene suppresses herpes simplex virus-induced DNA amplification.

    PubMed Central

    Heilbronn, R; Bürkle, A; Stephan, S; zur Hausen, H

    1990-01-01

    Herpes simplex virus (HSV) induces within the host cell genome DNA amplification which can be suppressed by coinfection with adeno-associated virus (AAV). To characterize the AAV functions mediating this effect, cloned AAV type 2 wild-type or mutant genomes were transfected into simian virus 40 (SV40)-transformed hamster cells together with the six HSV replication genes (encoding UL5, UL8, major DNA-binding protein, DNA polymerase, UL42, and UL52) which together are necessary and sufficient for the induction of SV40 DNA amplification (R. Heilbronn and H. zur Hausen, J. Virol. 63:3683-3692, 1989). The AAV rep gene was identified as being responsible for the complete inhibition of HSV-induced SV40 DNA amplification. Likewise, rep inhibited origin-dependent HSV replication. rep neither killed the transfected host cells nor interfered with gene expression from the cotransfected amplification genes. This points to a specific interference with HSV-induced DNA amplification. Images PMID:2159559

  5. Viral Single-Strand DNA Induces p53-Dependent Apoptosis in Human Embryonic Stem Cells

    PubMed Central

    Hirsch, Matthew L.; Fagan, B. Matthew; Dumitru, Raluca; Bower, Jacquelyn J.; Yadav, Swati; Porteus, Matthew H.; Pevny, Larysa H.; Samulski, R. Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication. PMID:22114676

  6. Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks.

    PubMed

    Kuhar, Ryan; Gwiazda, Kamila S; Humbert, Olivier; Mandt, Tyler; Pangallo, Joey; Brault, Michelle; Khan, Iram; Maizels, Nancy; Rawlings, David J; Scharenberg, Andrew M; Certo, Michael T

    2014-01-01

    The creation of a DNA break at a specific locus by a designer endonuclease can be harnessed to edit a genome. However, DNA breaks may engage one of several competing repair pathways that lead to distinct types of genomic alterations. Therefore, understanding the contribution of different repair pathways following the introduction of a targeted DNA break is essential to further advance the safety and efficiency of nuclease-induced genome modification. To gain insight into the role of different DNA repair pathways in resolving nuclease-induced DNA breaks into genome editing outcomes, we previously developed a fluorescent-based reporter system, designated the Traffic Light Reporter, which provides a readout of gene targeting and gene disruption downstream of a targeted DNA double-strand break. Here we describe two related but novel reporters that extend this technology: one that allows monitoring of the transcriptional activity at the reporter locus, and thus can be applied to interrogate break resolution at active and repressed loci; and a second that reads out single-strand annealing in addition to gene targeting and gene disruption. Application of these reporters to assess repair pathway usage in several common gene editing contexts confirms the importance that chromatin status and initiation of end resection have on the resolution of nuclease-induced breaks. PMID:24121685

  7. Importance of Endosomal Cathelicidin Degradation To Enhance DNA-Induced Chicken Macrophage Activation.

    PubMed

    Coorens, Maarten; van Dijk, Albert; Bikker, Floris; Veldhuizen, Edwin J A; Haagsman, Henk P

    2015-10-15

    Cathelicidins are essential in the protection against invading pathogens through both their direct antimicrobial activity and their immunomodulatory functions. Although cathelicidins are known to modulate activation by several TLR ligands, little is known about their influence on DNA-induced macrophage activation. In this study, we explored the effects of cathelicidins on DNA-induced activation of chicken macrophages and elucidated the intracellular processes underlying these effects. Our results show that chicken cathelicidin (CATH)-2 strongly enhances DNA-induced activation of both chicken and mammalian macrophages because of enhanced endocytosis of DNA-CATH-2 complexes. After endocytosis, DNA is liberated from the complex because of proteolytic breakdown of CATH-2, after which TLR21 is activated. This leads to increased cytokine expression and NO production. Through the interaction with DNA, CATH-2 can play an important role in modulating the immune response at sites of infection. These observations underline the importance of cathelicidins in sensing bacterial products and regulating immune responses. PMID:26378074

  8. Cytogenetic evidence that DNA topoisomerase II is not involved in radiation induced chromsome-type aberrations.

    PubMed

    Mosesso, P; Pepe, G; Ottavianelli, A; Schinoppi, A; Cinelli, S

    2015-11-01

    ICRF-187 (Cardioxane™, Chiron) is a catalytic inhibitor of DNA topoisomerase II (Topo II), proposed to act by blocking Topo II-mediated DNA cleavage without stabilizing DNA-Topo II-"cleavable complexes". In this study ICRF-187 was used to evaluate the potential involvement of DNA topoisomerase II in the formation of the radiation-induced chromosome-type aberrations in the G0 phase of the cell cycle in human lymphocytes from three healthy male donors. This is based on many evidences that DNA topoisomerases are involved in DNA recombination, mainly of illegitimate type (non-homologous) both in vitro and in vivo. The results obtained clearly indicated that ICRF-187 did not induce per se any chromosomal damage. When challenged with the non-catalytic Topo II poison VP-16 (etoposide), which acts by stabilizing the "cleavable complex" generating "protein concealed" DSB's and thus chromosomal aberrations, it completely abolished the significant induction of chromosome-type aberrations and formation of dicentric chromosomes. This indicates that ICRF-187 acts effectively as catalytic inhibitor of Topo II. On the other hand, when X-ray treatments were challenged with ICRF-187 using experimental conditions as for VP-16 treatments, no modification of the incidence of chromosome-type aberrations and dicentric chromosomes was observed. On this basis, we conclude that Topo II is not involved in the formation of X-ray-induced chromosome-type aberrations and dicentric chromosomes in human lymphocytes in the G0 phase of the cell cycle. PMID:26520368

  9. pRB plays an essential role in cell cycle arrest induced by DNA damage

    PubMed Central

    Harrington, Elizabeth A.; Bruce, Jacqueline L.; Harlow, Ed; Dyson, Nicholas

    1998-01-01

    To maintain genome stability, cells with damaged DNA must arrest to allow repair of mutations before replication. Although several key components required to elicit this arrest have been discovered, much of the pathway remains elusive. Here we report that pRB acts as a central mediator of the proliferative block induced by a diverse range of DNA damaging stimuli. Rb−/− mouse embryo fibroblasts are defective in arrest after γ-irradiation, UV irradiation, and treatment with a variety of chemotherapeutic drugs. In contrast, the pRB related proteins p107 and p130 do not play an essential part in the DNA damage response. pRB is required specifically for the G1/S phase checkpoint induced by γ-irradiation. Despite a defect in G1/S phase arrest, levels of p53 and p21 are increased normally in Rb−/− cells in response to γ-irradiation. These results lead us to propose a model in which pRB acts as an essential downstream target of the DNA damage-induced arrest pathway. The ability of pRB to prevent replication of damaged DNA is likely to inhibit the propagation of carcinogenic mutations and may therefore contribute to its role as a tumor suppressor. Furthermore, because many cancer therapies act by damaging DNA, these findings also have implications for the treatment of tumors in which pRB is inactivated. PMID:9751770

  10. Mcl-1 protects prostate cancer cells from cell death mediated by chemotherapy-induced DNA damage.

    PubMed

    Reiner, Teresita; de Las Pozas, Alicia; Parrondo, Ricardo; Palenzuela, Deanna; Cayuso, William; Rai, Priyamvada; Perez-Stable, Carlos

    2015-01-01

    The anti-apoptotic protein Mcl-1 is highly expressed in castration-resistant prostate cancer (CRPC), resulting in resistance to apoptosis and association with poor prognosis. Although predominantly localized in the cytoplasm, there is evidence that Mcl-1 exhibits nuclear localization where it is thought to protect against DNA damage-induced cell death. The role of Mcl-1 in mediating resistance to chemotherapy-induced DNA damage in prostate cancer (PCa) is not known. We show in human PCa cell lines and in TRAMP, a transgenic mouse model of PCa, that the combination of the antimitotic agent ENMD-1198 (analog of 2-methoxyestradiol) with betulinic acid (BA, increases proteotoxic stress) targets Mcl-1 by increasing its proteasomal degradation, resulting in increased γH2AX (DNA damage) and apoptotic/necrotic cell death. Knockdown of Mcl-1 in CRPC cells leads to elevated γH2AX, DNA strand breaks, and cell death after treatment with 1198 + BA- or doxorubicin. Additional knockdowns in PC3 cells suggests that cytoplasmic Mcl-1 protects against DNA damage by blocking the mitochondrial release of apoptosis-inducing factor and thereby preventing its nuclear translocation and subsequent interaction with the cyclophilin A endonuclease. Overall, our results suggest that chemotherapeutic agents that target Mcl-1 will promote cell death in response to DNA damage, particularly in CRPC. PMID:26425662

  11. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    NASA Astrophysics Data System (ADS)

    Han, Xu; Klas, Matej; Liu, Yueying; Sharon Stack, M.; Ptasinska, Sylwia

    2013-06-01

    The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

  12. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    SciTech Connect

    Kim, G. J.; Lee, J. K.; Kim, W.; Kim, K. T.

    2010-01-11

    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  13. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    NASA Astrophysics Data System (ADS)

    Kim, G. J.; Kim, W.; Kim, K. T.; Lee, J. K.

    2010-01-01

    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  14. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    SciTech Connect

    Han, Xu; Ptasinska, Sylwia; Klas, Matej; Liu, Yueying; Sharon Stack, M.

    2013-06-10

    The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

  15. DNA mediated wire-like clusters of self-assembled TiO₂ nanomaterials: supercapacitor and dye sensitized solar cell applications.

    PubMed

    Nithiyanantham, U; Ramadoss, Ananthakumar; Ede, Sivasankara Rao; Kundu, Subrata

    2014-07-21

    A new route for the formation of wire-like clusters of TiO₂ nanomaterials self-assembled in DNA scaffold within an hour of reaction time is reported. TiO₂ nanomaterials are synthesized by the reaction of titanium-isopropoxide with ethanol and water in the presence of DNA under continuous stirring and heating at 60 °C. The individual size of the TiO₂ NPs self-assembled in DNA and the diameter of the wires can be tuned by controlling the DNA to Ti-salt molar ratios and other reaction parameters. The eventual diameter of the individual particles varies between 15 ± 5 nm ranges, whereas the length of the nanowires varies in the 2-3 μm range. The synthesized wire-like DNA-TiO₂ nanomaterials are excellent materials for electrochemical supercapacitor and DSSC applications. From the electrochemical supercapacitor experiment, it was found that the TiO₂ nanomaterials showed different specific capacitance (Cs) values for the various nanowires, and the order of Cs values are as follows: wire-like clusters (small size) > wire-like clusters (large size). The highest Cs of 2.69 F g(-1) was observed for TiO₂ having wire-like structure with small sizes. The study of the long term cycling stability of wire-like clusters (small size) electrode were shown to be stable, retaining ca. 80% of the initial specific capacitance, even after 5000 cycles. The potentiality of the DNA-TiO₂ nanomaterials was also tested in photo-voltaic applications and the observed efficiency was found higher in the case of wire-like TiO₂ nanostructures with larger sizes compared to smaller sizes. In future, the described method can be extended for the synthesis of other oxide based materials on DNA scaffold and can be further used in other applications like sensors, Li-ion battery materials or treatment for environmental waste water. PMID:24905088

  16. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation.

    PubMed

    McDonald, James I; Celik, Hamza; Rois, Lisa E; Fishberger, Gregory; Fowler, Tolison; Rees, Ryan; Kramer, Ashley; Martens, Andrew; Edwards, John R; Challen, Grant A

    2016-01-01

    Advances in sequencing technology allow researchers to map genome-wide changes in DNA methylation in development and disease. However, there is a lack of experimental tools to site-specifically manipulate DNA methylation to discern the functional consequences. We developed a CRISPR/Cas9 DNA methyltransferase 3A (DNMT3A) fusion to induce DNA methylation at specific loci in the genome. We induced DNA methylation at up to 50% of alleles for targeted CpG dinucleotides. DNA methylation levels peaked within 50 bp of the short guide RNA (sgRNA) binding site and between pairs of sgRNAs. We used our approach to target methylation across the entire CpG island at the CDKN2A promoter, three CpG dinucleotides at the ARF promoter, and the CpG island within the Cdkn1a promoter to decrease expression of the target gene. These tools permit mechanistic studies of DNA methylation and its role in guiding molecular processes that determine cellular fate. PMID:27170255

  17. Heat shock induces a loss of rRNA-encoding DNA repeats in Brassica nigra.

    PubMed Central

    Waters, E R; Schaal, B A

    1996-01-01

    Stress-induced mutations may play an important role in the evolution of plants. Plants do not sequester a germ line, and thus any stress-induced mutations could be passed on to future generations. We report a study of the effects of heat shock on genomic components of Brassica nigra Brassicaceae. Plants were submitted to heat stress, and the copy number of two nuclear-encoded single-copy genes, rRNA-encoding DNA (rDNA) and a chloroplast DNA gene, was determined and compared to a nonstressed control group. We determined whether genomic changes were inherited by examining copy number in the selfed progeny of control and heat-treated individuals. No effects of heat shock on copy number of the single-copy nuclear genes or on chloroplast DNA are found. However, heat shock did cause a statistically significant reduction in rDNA copies inherited by the F1 generation. In addition, we propose a DNA damage-reppair hypothesis to explain the reduction in rDNA caused by heat shock. Images Fig. 1 PMID:8643652

  18. Spatiotemporal kinetics of γ-H2AX protein on charged particles induced DNA damage

    NASA Astrophysics Data System (ADS)

    Niu, H.; Chang, H. C.; Cho, I. C.; Chen, C. H.; Liu, C. S.; Chou, W. T.

    2014-08-01

    In several researches, it has been demonstrated that charged particles can induce more complex DNA damages. These complex damages have higher ability to cause the cell death or cell carcinogenesis. For this reason, clarifying the DNA repair mechanism after charged particle irradiation plays an important role in the development of charged particle therapy and space exploration. Unfortunately, the detail spatiotemporal kinetic of DNA damage repair is still unclear. In this study, we used γ-H2AX protein to investigate the spatiotemporal kinetics of DNA double strand breaks in alpha-particle irradiated HeLa cells. The result shows that the intensity of γ-H2AX foci increased gradually, and reached to its maximum at 30 min after irradiation. A good linear relationship can be observed between foci intensity and radiation dose. After 30 min, the γ-H2AX foci intensity was decreased with time passed, but remained a large portion (∼50%) at 48 h passed. The data show that the dissolution rate of γ-H2AX foci agreed with two components DNA repairing model. These results suggest that charged particles can induce more complex DNA damages and causing the retardation of DNA repair.

  19. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B.

    PubMed

    Wemhoff, Sabrina; Klassen, Roland; Beetz, Anja; Meinhardt, Friedhelm

    2016-01-01

    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity. PMID:27472060

  20. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation

    PubMed Central

    McDonald, James I.; Celik, Hamza; Rois, Lisa E.; Fishberger, Gregory; Fowler, Tolison; Rees, Ryan; Kramer, Ashley; Martens, Andrew; Edwards, John R.

    2016-01-01

    ABSTRACT Advances in sequencing technology allow researchers to map genome-wide changes in DNA methylation in development and disease. However, there is a lack of experimental tools to site-specifically manipulate DNA methylation to discern the functional consequences. We developed a CRISPR/Cas9 DNA methyltransferase 3A (DNMT3A) fusion to induce DNA methylation at specific loci in the genome. We induced DNA methylation at up to 50% of alleles for targeted CpG dinucleotides. DNA methylation levels peaked within 50 bp of the short guide RNA (sgRNA) binding site and between pairs of sgRNAs. We used our approach to target methylation across the entire CpG island at the CDKN2A promoter, three CpG dinucleotides at the ARF promoter, and the CpG island within the Cdkn1a promoter to decrease expression of the target gene. These tools permit mechanistic studies of DNA methylation and its role in guiding molecular processes that determine cellular fate. PMID:27170255

  1. Inhibition of DNA Methylation Suppresses Intestinal Tumor Organoids by Inducing an Anti-Viral Response

    PubMed Central

    Saito, Yoshimasa; Nakaoka, Toshiaki; Sakai, Kasumi; Muramatsu, Toshihide; Toshimitsu, Kohta; Kimura, Masaki; Kanai, Takanori; Sato, Toshiro; Saito, Hidetsugu

    2016-01-01

    Recent studies have proposed that the major anti-tumor effect of DNA methylation inhibitors is induction of interferon-responsive genes via dsRNAs-containing endogenous retroviruses. Recently, a 3D culture system for stem cells known as organoid culture has been developed. Lgr5-positive stem cells form organoids that closely recapitulate the properties of original tissues. To investigate the effect of DNA demethylation on tumor organoids, we have established organoids from intestinal tumors of ApcMin/+ (Min) mice and subjected them to 5-aza-2′-deoxycytidine (5-Aza-CdR) treatment and Dnmt1 knockdown. DNA demethylation induced by 5-Aza-CdR treatment and Dnmt1 knockdown significantly reduced the cell proliferation of the tumor organoids. Microarray analyses of the tumor organoids after 5-Aza-CdR treatment and Dnmt1 knockdown revealed that interferon-responsive genes were activated by DNA demethylation. Gene ontology and pathway analyses clearly demonstrated that these genes activated by DNA demethylation are involved in the anti-viral response. These findings indicate that DNA demethylation suppresses the proliferation of intestinal tumor organoids by inducing an anti-viral response including activation of interferon-responsive genes. Treatment with DNA methylation inhibitors to activate a growth-inhibiting immune response may be an effective therapeutic approach for colon cancers. PMID:27143627

  2. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B

    PubMed Central

    Beetz, Anja; Meinhardt, Friedhelm

    2016-01-01

    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity. PMID:27472060

  3. LPS-induced clustering of CD14 triggers generation of PI(4,5)P2.

    PubMed

    Płóciennikowska, Agnieszka; Zdioruk, Mykola I; Traczyk, Gabriela; Świątkowska, Anna; Kwiatkowska, Katarzyna

    2015-11-15

    Bacterial lipopolysaccharide (LPS) induces strong pro-inflammatory reactions after sequential binding to CD14 protein and TLR4 receptor. Here, we show that CD14 controls generation of phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] in response to LPS binding. In J774 cells and HEK293 cells expressing CD14 exposed to 10-100 ng/ml LPS, the level of PI(4,5)P2 rose in a biphasic manner with peaks at 5-10 min and 60 min. After 5-10 min of LPS stimulation, CD14 underwent prominent clustering in the plasma membrane, accompanied by accumulation of PI(4,5)P2 and type-I phosphatidylinositol 4-phosphate 5-kinase (PIP5K) isoforms Iα and Iγ (encoded by Pip5k1a and Pip5k1c, respectively) in the CD14 region. Clustering of CD14 with antibodies, without LPS and TLR4 participation, was sufficient to trigger PI(4,5)P2 elevation. The newly generated PI(4,5)P2 accumulated in rafts, which also accommodated CD14 and a large portion of PIP5K Iα and PIP5K Iγ. Silencing of PIP5K Iα and PIP5K Iγ, or application of drugs interfering with PI(4,5)P2 synthesis and availability, abolished the LPS-induced PI(4,5)P2 elevation and inhibited downstream pro-inflammatory reactions. Taken together, these data indicate that LPS induces clustering of CD14, which triggers PI(4,5)P2 generation in rafts that is required for maximal pro-inflammatory signaling of TLR4. PMID:26446256

  4. GST-Induced dimerization of DNA-binding domains alters characteristics of their interaction with DNA.

    PubMed

    Niedziela-Majka, A; Rymarczyk, G; Kochman, M; Ozyhar, A

    1998-11-01

    The steroid hormone 20-hydroxyecdysone (20E) plays a key role in the induction and modulation of morphogenetic events throughout Drosophila melanogaster development. Two members of the nuclear receptor superfamily, the product of the EcR (EcR) and of the ultraspiracle genes (Usp), heterodimerize to form its functional receptor. To study the receptor-DNA interaction, critical for regulating 20E-dependent gene expression, it is necessary to produce large quantities of EcR and Usp DNA-binding domains. Toward this end DNA-binding domains of EcR and Usp (EcRDBD and UspDBD, respectively) were cloned and expressed in Escherichia coli as fusion proteins with glutathione S-transferase (GST). However, the results of DNA-binding studies obtained with purified GST-DBDs were found to be questionable because the fused proteins oligomerized in solution due to the presence of GST. Therefore DBDs were released from GST-chimeric proteins by thrombin cleavage and then purified by glutathione-Sepharose 4B chromatography and by gel filtration on Superdex 75 HR. The gel mobility-shift experiments showed that UspDBD exhibited higher affinity than EcRDBD toward a 20-hydroxyecdysone response element from the Drosophila hsp 27 gene (hsp 27pal). Furthermore, formation of the heterodimeric EcRDBD-UspDBD complex was observed to be synergistic when equimolar mixture of both DBDs was incubated with hsp 27pal. Surprisingly, GST-EcRDBD bound hsp 27pal with higher affinity than GST-UspDBD. This difference was accompanied by the impaired ability of the GST-DBDs to interact synergistically with hsp 27pal. This is the first report on expression and purification of the soluble DBDs of the functional ecdysteroid receptor with satisfying yields. Furthermore, our results add to the recent findings which indicate the need for caution in interpreting the activities of GST fusion proteins. PMID:9790883

  5. Contributions of DNA repair, cell cycle checkpoints and cell death to suppressing the DNA damage-induced tumorigenic behavior of Drosophila epithelial cells.

    PubMed

    Dekanty, A; Barrio, L; Milán, M

    2015-02-19

    When exposed to DNA-damaging agents, components of the DNA damage response (DDR) pathway trigger apoptosis, cell cycle arrest and DNA repair. Although failures in this pathway are associated with cancer development, the tumor suppressor roles of cell cycle arrest and apoptosis have recently been questioned in mouse models. Using Drosophila epithelial cells that are unable to activate the apoptotic program, we provide evidence that ionizing radiation (IR)-induced DNA damage elicits a tumorigenic behavior in terms of E-cadherin delocalization, cell delamination, basement membrane degradation and neoplasic overgrowth. The tumorigenic response of the tissue to IR is enhanced by depletion of Okra/DmRAD54 or spnA/DmRAD51--genes required for homologous recombination (HR) repair of DNA double-strand breaks in G2--and it is independent of the activity of Lig4, a ligase required for nonhomologous end-joining repair in G1. Remarkably, depletion of Grapes/DmChk1 or Mei-41/dATR-genes affecting DNA damage-induced cell cycle arrest in G2--compromised DNA repair and enhanced the tumorigenic response of the tissue to IR. On the contrary, DDR-independent lengthening of G2 had a positive impact on the dynamics of DNA repair and suppressed the tumorigenic response of the tissue to IR. Our results support a tumor suppressor role of apoptosis, DNA repair by HR and cell cycle arrest in G2 in simple epithelia subject to IR-induced DNA damage. PMID:24632609

  6. p53-dependent SIRT6 expression protects Aβ42-induced DNA damage

    PubMed Central

    Jung, Eun Sun; Choi, Hyunjung; Song, Hyundong; Hwang, Yu Jin; Kim, Ahbin; Ryu, Hoon; Mook-Jung, Inhee

    2016-01-01

    Alzheimer’s disease (AD) is the most common type of dementia and age-related neurodegenerative disease. Elucidating the cellular changes that occur during ageing is an important step towards understanding the pathogenesis and progression of neurodegenerative disorders. SIRT6 is a member of the mammalian sirtuin family of anti-aging genes. However, the relationship between SIRT6 and AD has not yet been elucidated. Here, we report that SIRT6 protein expression levels are reduced in the brains of both the 5XFAD AD mouse model and AD patients. Aβ42, a major component of senile plaques, decreases SIRT6 expression, and Aβ42-induced DNA damage is prevented by the overexpression of SIRT6 in HT22 mouse hippocampal neurons. Also, there is a strong negative correlation between Aβ42-induced DNA damage and p53 levels, a protein involved in DNA repair and apoptosis. In addition, upregulation of p53 protein by Nutlin-3 prevents SIRT6 reduction and DNA damage induced by Aβ42. Taken together, this study reveals that p53-dependent SIRT6 expression protects cells from Aβ42-induced DNA damage, making SIRT6 a promising new therapeutic target for the treatment of AD. PMID:27156849

  7. Positive feedback regulation of p53 transactivity by DNA damage-induced ISG15 modification

    PubMed Central

    Park, Jong Ho; Yang, Seung Wook; Park, Jung Mi; Ka, Seung Hyeun; Kim, Ji-Hoon; Kong, Young-Yun; Jeon, Young Joo; Seol, Jae Hong; Chung, Chin Ha

    2016-01-01

    p53 plays a pivotal role in tumour suppression under stresses, such as DNA damage. ISG15 has been implicated in the control of tumorigenesis. Intriguingly, the expression of ISG15, UBE1L and UBCH8 is induced by DNA-damaging agents, such as ultraviolet and doxorubicin, which are known to induce p53. Here, we show that the genes encoding ISG15, UBE1L, UBCH8 and EFP, have the p53-responsive elements and their expression is induced in a p53-dependent fashion under DNA damage conditions. Furthermore, DNA damage induces ISG15 conjugation to p53 and this modification markedly enhances the binding of p53 to the promoters of its target genes (for example, CDKN1 and BAX) as well as of its own gene by promoting phosphorylation and acetylation, leading to suppression of cell growth and tumorigenesis. These findings establish a novel feedback circuit between p53 and ISG15-conjugating system for positive regulation of the tumour suppressive function of p53 under DNA damage conditions. PMID:27545325

  8. Molecular Regulation of DNA Damage-Induced Apoptosis in Neurons of Cerebral Cortex

    PubMed Central

    Liu, Zhiping; Pipino, Jacqueline; Chestnut, Barry; Landek, Melissa A.

    2009-01-01

    Cerebral cortical neuron degeneration occurs in brain disorders manifesting throughout life, but the mechanisms are understood poorly. We used cultured embryonic mouse cortical neurons and an in vivo mouse model to study mechanisms of DNA damaged-induced apoptosis in immature and differentiated neurons. p53 drives apoptosis of immature and differentiated cortical neurons through its rapid and prominent activation stimulated by DNA strand breaks induced by topoisomerase-I and -II inhibition. Blocking p53-DNA transactivation with α-pifithrin protects immature neurons; blocking p53-mitochondrial functions with μ-pifithrin protects differentiated neurons. Mitochondrial death proteins are upregulated in apoptotic immature and differentiated neurons and have nonredundant proapoptotic functions; Bak is more dominant than Bax in differentiated neurons. p53 phosphorylation is mediated by ataxia telangiectasia mutated (ATM) kinase. ATM inactivation is antiapoptotic, particularly in differentiated neurons, whereas inhibition of c-Abl protects immature neurons but not differentiated neurons. Cell death protein expression patterns in mouse forebrain are mostly similar to cultured neurons. DNA damage induces prominent p53 activation and apoptosis in cerebral cortex in vivo. Thus, DNA strand breaks in cortical neurons induce rapid p53-mediated apoptosis through actions of upstream ATM and c-Abl kinases and downstream mitochondrial death proteins. This molecular network operates through variations depending on neuron maturity. PMID:18820287

  9. Low energy electron induced damage to plasmid DNA pQE30

    NASA Astrophysics Data System (ADS)

    Kumar, S. V. K.; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D.; Rao, Basuthkar J.

    2012-07-01

    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and ˜18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  10. Low energy electron induced damage to plasmid DNA pQE30

    SciTech Connect

    Kumar, S. V. K.; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D.; Rao, Basuthkar J.

    2012-07-28

    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and {approx}18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  11. Protection of cisplatin-induced spermatotoxicity, DNA damage and chromatin abnormality by selenium nano-particles

    SciTech Connect

    Rezvanfar, Mohammad Amin; Rezvanfar, Mohammad Ali; Shahverdi, Ahmad Reza; Ahmadi, Abbas; Baeeri, Maryam; Mohammadirad, Azadeh; Abdollahi, Mohammad

    2013-02-01

    Cisplatin (CIS), an anticancer alkylating agent, induces DNA adducts and effectively cross links the DNA strands and so affects spermatozoa as a male reproductive toxicant. The present study investigated the cellular/biochemical mechanisms underlying possible protective effect of selenium nano-particles (Nano-Se) as an established strong antioxidant with more bioavailability and less toxicity, on reproductive toxicity of CIS by assessment of sperm characteristics, sperm DNA integrity, chromatin quality and spermatogenic disorders. To determine the role of oxidative stress (OS) in the pathogenesis of CIS gonadotoxicity, the level of lipid peroxidation (LPO), antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and peroxynitrite (ONOO) as a marker of nitrosative stress (NS) and testosterone (T) concentration as a biomarker of testicular function were measured in the blood and testes. Thirty-two male Wistar rats were equally divided into four groups. A single IP dose of CIS (7 mg/kg) and protective dose of Nano-Se (2 mg/kg/day) were administered alone or in combination. The CIS-exposed rats showed a significant increase in testicular and serum LPO and ONOO level, along with a significant decrease in enzymatic antioxidants levels, diminished serum T concentration and abnormal histologic findings with impaired sperm quality associated with increased DNA damage and decreased chromatin quality. Coadministration of Nano-Se significantly improved the serum T, sperm quality, and spermatogenesis and reduced CIS-induced free radical toxic stress and spermatic DNA damage. In conclusion, the current study demonstrated that Nano-Se may be useful to prevent CIS-induced gonadotoxicity through its antioxidant potential. Highlights: ► Cisplatin (CIS) affects spermatozoa as a male reproductive toxicant. ► Effect of Nano-Se on CIS-induced spermatotoxicity was investigated. ► CIS-exposure induces oxidative sperm DNA damage

  12. Ion-induced annealing and amorphization of isolated damage clusters in Si

    SciTech Connect

    Battaglia, A. ); Priolo, F.; Rimini, E. ); Ferla, G. )

    1990-06-25

    The interaction between high-energy ion irradiation and pre-existing damage clusters dispersed in single-crystal Si is discussed. Silicon substrates were predamaged by low-dose 150 keV Au ions. Post-irradiation by 600 keV Kr{sup 2+} ions resulted in either damage annealing or damage accumulation, depending on the substrate temperature. The transition temperature between these two different regimes is 420 K. These data are discussed and compared with the ion beam induced epitaxy and amorphization of continuous surface amorphous layers.

  13. UvrD helicase suppresses recombination and DNA damage-induced deletions.

    PubMed

    Kang, Josephine; Blaser, Martin J

    2006-08-01

    UvrD, a highly conserved helicase involved in mismatch repair, nucleotide excision repair (NER), and recombinational repair, plays a critical role in maintaining genomic stability and facilitating DNA lesion repair in many prokaryotic species. In this report, we focus on the UvrD homolog in Helicobacter pylori, a genetically diverse organism that lacks many known DNA repair proteins, including those involved in mismatch repair and recombinational repair, and that is noted for high levels of inter- and intragenomic recombination and mutation. H. pylori contains numerous DNA repeats in its compact genome and inhabits an environment rich in DNA-damaging agents that can lead to increased rearrangements between such repeats. We find that H. pylori UvrD functions to repair DNA damage and limit homologous recombination and DNA damage-induced genomic rearrangements between DNA repeats. Our results suggest that UvrD and other NER pathway proteins play a prominent role in maintaining genome integrity, especially after DNA damage; thus, NER may be especially critical in organisms such as H. pylori that face high-level genotoxic stress in vivo. PMID:16855234

  14. Dynamic Local Polymorphisms in the Gbx1 Homeodomain Induced by DNA Binding.

    PubMed

    Proudfoot, Andrew; Geralt, Michael; Elsliger, Marc-Andre; Wilson, Ian A; Wüthrich, Kurt; Serrano, Pedro

    2016-08-01

    The Gastrulation Brain Homeobox 1 (Gbx1) gene encodes the Gbx1 homeodomain that targets TAATTA motifs in double-stranded DNA (dsDNA). Residues Glu17 and Arg52 in Gbx1 form a salt bridge, which is preserved in crystal structures and molecular dynamics simulations of homologous homeodomain-DNA complexes. In contrast, our nuclear magnetic resonance (NMR) studies show that DNA binding to Gbx1 induces dynamic local polymorphisms, which include breaking of the Glu17-Arg52 salt bridge. To study this interaction, we produced a variant with Glu17Arg and Arg52Glu mutations, which exhibited the same fold as the wild-type protein, but a 2-fold reduction in affinity for dsDNA. Analysis of the NMR structures of the Gbx1 homeodomain in the free form, the Gbx1[E17R,R52E] variant, and a Gbx1 homeodomain-DNA complex showed that stabilizing interactions of the Arg52 side chain with the DNA backbone are facilitated by transient breakage of the Glu17-Arg52 salt bridge in the DNA-bound Gbx1. PMID:27396829

  15. Oxidative Stress and Replication-Independent DNA Breakage Induced by Arsenic in Saccharomyces cerevisiae

    PubMed Central

    Litwin, Ireneusz; Bocer, Tomasz; Dziadkowiec, Dorota; Wysocki, Robert

    2013-01-01

    Arsenic is a well-established human carcinogen of poorly understood mechanism of genotoxicity. It is generally accepted that arsenic acts indirectly by generating oxidative DNA damage that can be converted to replication-dependent DNA double-strand breaks (DSBs), as well as by interfering with DNA repair pathways and DNA methylation. Here we show that in budding yeast arsenic also causes replication and transcription-independent DSBs in all phases of the cell cycle, suggesting a direct genotoxic mode of arsenic action. This is accompanied by DNA damage checkpoint activation resulting in cell cycle delays in S and G2/M phases in wild type cells. In G1 phase, arsenic activates DNA damage response only in the absence of the Yku70–Yku80 complex which normally binds to DNA ends and inhibits resection of DSBs. This strongly indicates that DSBs are produced by arsenic in G1 but DNA ends are protected by Yku70–Yku80 and thus invisible for the checkpoint response. Arsenic-induced DSBs are processed by homologous recombination (HR), as shown by Rfa1 and Rad52 nuclear foci formation and requirement of HR proteins for cell survival during arsenic exposure. We show further that arsenic greatly sensitizes yeast to phleomycin as simultaneous treatment results in profound accumulation of DSBs. Importantly, we observed a similar response in fission yeast Schizosaccharomyces pombe, suggesting that the mechanisms of As(III) genotoxicity may be conserved in other organisms. PMID:23935510

  16. Nitroglycerin induces DNA damage and vascular cell death in the setting of nitrate tolerance.

    PubMed

    Mikhed, Yuliya; Fahrer, Jörg; Oelze, Matthias; Kröller-Schön, Swenja; Steven, Sebastian; Welschof, Philipp; Zinßius, Elena; Stamm, Paul; Kashani, Fatemeh; Roohani, Siyer; Kress, Joana Melanie; Ullmann, Elisabeth; Tran, Lan P; Schulz, Eberhard; Epe, Bernd; Kaina, Bernd; Münzel, Thomas; Daiber, Andreas

    2016-07-01

    Nitroglycerin (GTN) and other organic nitrates are widely used vasodilators. Their side effects are development of nitrate tolerance and endothelial dysfunction. Given the potential of GTN to induce nitro-oxidative stress, we investigated the interaction between nitro-oxidative DNA damage and vascular dysfunction in experimental nitrate tolerance. Cultured endothelial hybridoma cells (EA.hy 926) and Wistar rats were treated with GTN (ex vivo: 10-1000 µM; in vivo: 10, 20 and 50 mg/kg/day for 3 days, s.c.). The level of DNA strand breaks, 8-oxoguanine and O (6)-methylguanine DNA adducts was determined by Comet assay, dot blot and immunohistochemistry. Vascular function was determined by isometric tension recording. DNA adducts and strand breaks were induced by GTN in cells in vitro in a concentration-dependent manner. GTN in vivo administration leads to endothelial dysfunction, nitrate tolerance, aortic and cardiac oxidative stress, formation of DNA adducts, stabilization of p53 and apoptotic death of vascular cells in a dose-dependent fashion. Mice lacking O (6)-methylguanine-DNA methyltransferase displayed more vascular O (6)-methylguanine adducts and oxidative stress under GTN therapy than wild-type mice. Although we were not able to prove a causal role of DNA damage in the etiology of nitrate tolerance, the finding of GTN-induced DNA damage such as the mutagenic and toxic adduct O (6)-methylguanine, and cell death supports the notion that GTN based therapy may provoke adverse side effects, including endothelial function. Further studies are warranted to clarify whether GTN pro-apoptotic effects are related to an impaired recovery of patients upon myocardial infarction. PMID:27357950

  17. DNA Damage Signals and Space Radiation Risk

    NASA Technical Reports Server (NTRS)

    Cucinotta, Francis A.

    2011-01-01

    Space radiation is comprised of high-energy and charge (HZE) nuclei and protons. The initial DNA damage from HZE nuclei is qualitatively different from X-rays or gamma rays due to the clustering of damage sites which increases their complexity. Clustering of DNA damage occurs on several scales. First there is clustering of single strand breaks (SSB), double strand breaks (DSB), and base damage within a few to several hundred base pairs (bp). A second form of damage clustering occurs on the scale of a few kbp where several DSB?s may be induced by single HZE nuclei. These forms of damage clusters do not occur at low to moderate doses of X-rays or gamma rays thus presenting new challenges to DNA repair systems. We review current knowledge of differences that occur in DNA repair pathways for different types of radiation and possible relationships to mutations, chromosomal aberrations and cancer risks.

  18. DNA repair by MGMT, but not AAG, causes a threshold in alkylation-induced colorectal carcinogenesis.

    PubMed

    Fahrer, Jörg; Frisch, Janina; Nagel, Georg; Kraus, Alexander; Dörsam, Bastian; Thomas, Adam D; Reißig, Sonja; Waisman, Ari; Kaina, Bernd

    2015-10-01

    Epidemiological studies indicate that N-nitroso compounds (NOC) are causally linked to colorectal cancer (CRC). NOC induce DNA alkylations, including O (6)-methylguanine (O (6)-MeG) and N-methylated purines, which are repaired by O (6)-MeG-DNA methyltransferase (MGMT) and N-alkyladenine-DNA glycosylase (AAG)-initiated base excision repair, respectively. In view of recent evidence of nonlinear mutagenicity for NOC-like compounds, the question arises as to the existence of threshold doses in CRC formation. Here, we set out to determine the impact of DNA repair on the dose-response of alkylation-induced CRC. DNA repair proficient (WT) and deficient (Mgmt (-/-), Aag (-/-) and Mgmt (-/-)/Aag (-/-)) mice were treated with azoxymethane (AOM) and dextran sodium sulfate to trigger CRC. Tumors were quantified by non-invasive mini-endoscopy. A non-linear increase in CRC formation was observed in WT and Aag (-/-) mice. In contrast, a linear dose-dependent increase in tumor frequency was found in Mgmt (-/-) and Mgmt (-/-)/Aag (-/-) mice. The data were corroborated by hockey stick modeling, yielding similar carcinogenic thresholds for WT and Aag (-/-) and no threshold for MGMT lacking mice. O (6)-MeG levels and depletion of MGMT correlated well with the observed dose-response in CRC formation. AOM induced dose-dependently DNA double-strand breaks in colon crypts including Lgr5-positive colon stem cells, which coincided with ATR-Chk1-p53 signaling. Intriguingly, Mgmt (-/-) mice displayed significantly enhanced levels of γ-H2AX, suggesting the usefulness of γ-H2AX as an early genotoxicity marker in the colorectum. This study demonstrates for the first time a non-linear dose-response for alkylation-induced colorectal carcinogenesis and reveals DNA repair by MGMT, but not AAG, as a key node in determining a carcinogenic threshold. PMID:26243310

  19. Salamander Hox clusters contain repetitive DNA and expanded non-coding regions: a typical Hox structure for non-mammalian tetrapod vertebrates?

    PubMed Central

    2013-01-01

    Hox genes encode transcription factors that regulate embryonic and post-embryonic developmental processes. The expression of Hox genes is regulated in part by the tight, spatial arrangement of conserved coding and non-coding sequences. The potential for evolutionary changes in Hox cluster structure is thought to be low among vertebrates; however, recent studies of a few non-mammalian taxa suggest greater variation than originally thought. Using next generation sequencing of large genomic fragments (>100 kb) from the red spotted newt (Notophthalamus viridescens), we found that the arrangement of Hox cluster genes was conserved relative to orthologous regions from other vertebrates, but the length of introns and intergenic regions varied. In particular, the distance between hoxd13 and hoxd11 is longer in newt than orthologous regions from vertebrate species with expanded Hox clusters and is predicted to exceed the length of the entire HoxD clusters (hoxd13–hoxd4) of humans, mice, and frogs. Many repetitive DNA sequences were identified for newt Hox clusters, including an enrichment of DNA transposon-like sequences relative to non-coding genomic fragments. Our results suggest that Hox cluster expansion and transposon accumulation are common features of non-mammalian tetrapod vertebrates. PMID:23561734

  20. An automated method for gridding and clustering-based segmentation of cDNA microarray images.

    PubMed

    Giannakeas, Nikolaos; Fotiadis, Dimitrios I

    2009-01-01

    Microarrays are widely used to quantify gene expression levels. Microarray image analysis is one of the tools, which are necessary when dealing with vast amounts of biological data. In this work we propose a new method for the automated analysis of microarray images. The proposed method consists of two stages: gridding and segmentation. Initially, the microarray images are preprocessed using template matching, and block and spot finding takes place. Then, the non-expressed spots are detected and a grid is fit on the image using a Voronoi diagram. In the segmentation stage, K-means and Fuzzy C means (FCM) clustering are employed. The proposed method was evaluated using images from the Stanford Microarray Database (SMD). The results that are presented in the segmentation stage show the efficiency of our Fuzzy C means-based work compared to the two already developed K-means-based methods. The proposed method can handle images with artefacts and it is fully automated. PMID:19046850

  1. Inflammation-induced DNA damage and damage-induced inflammation: a vicious cycle.

    PubMed

    Pálmai-Pallag, Timea; Bachrati, Csanád Z

    2014-10-01

    Inflammation is the ultimate response to the constant challenges of the immune system by microbes, irritants or injury. The inflammatory cascade initiates with the recognition of microorganism-derived pathogen associated molecular patterns (PAMPs) and host cell-derived damage associated molecular patterns (DAMPs) by the pattern recognition receptors (PRRs). DNA as a molecular PAMP or DAMP is sensed directly or via specific binding proteins to instigate pro-inflammatory response. Some of these DNA binding proteins also participate in canonical DNA repair pathways and recognise damaged DNA to initiate DNA damage response. In this review we aim to capture the essence of the complex interplay between DNA damage response and the pro-inflammatory signalling through representative examples. PMID:25449753

  2. DNA breakage induced by piceatannol and copper(II): Mechanism and anticancer properties

    PubMed Central

    LI, ZHENSHENG; YANG, XIAOZHAN; DONG, SHIWU; LI, XIAOHUI

    2012-01-01

    Piceatannol (3,3′,4,5′-tetrahydroxy-trans-stilbene; Pice), found in a variety of plant sources including grapes, red wine, peanuts and rhubarb, is known as a metabolite and analog of Resveratrol (3,5,4′-trihydroxy-trans-stilbene; Res) and has higher bioactivity than Res. To explore the mechanism of DNA damage induced by Pice in the presence of copper (Cu)(II), gel electrophoresis, UV-visible spectroscopy, fluorescence spectroscopy and Fourier transform infrared spectroscopy were used. The results of gel electrophoresis demonstrated that the hydroxyl radical played a critical role in DNA cleavage. Spectroscopy confirmed that the mechanism of DNA cleavage induced by Pice-Cu(II) involves the Haber Weiss and Fenton reactions. Pice chelates with Cu(II) as a bidentate ligand, and the Pice-Cu(II) complex undergoes intramolecular electron transfer to form the semiquinone radical anion and Cu(I), which may be reoxidated by O2 to form Cu(II) with hydroxyl radical generation. In brief, the formation of the hydroxyl radical and the Cu(II)/Cu(I) redox cycle play a key role in inducing DNA damage. In this process, Pice demonstrated pro-oxidant properties. Oxidative product(s) of Pice, semiquinone, was formed and Cu(I) was reoxidized to Cu(II). The redox cycling of copper generated reactive oxygen species, which induced DNA cleavage, the hallmark of cell apoptosis. The mechanism of DNA breakage induced by Pice-Cu(II) may be a significant pathway through which cancer cells are killed. PMID:22783397

  3. Semi-Automatically Inducing Semantic Classes of Clinical Research Eligibility Criteria Using UMLS and Hierarchical Clustering.

    PubMed

    Luo, Zhihui; Johnson, Stephen B; Weng, Chunhua

    2010-01-01

    This paper presents a novel approach to learning semantic classes of clinical research eligibility criteria. It uses the UMLS Semantic Types to represent semantic features and the Hierarchical Clustering method to group similar eligibility criteria. By establishing a gold standard using two independent raters, we evaluated the coverage and accuracy of the induced semantic classes. On 2,718 random eligibility criteria sentences, the inter-rater classification agreement was 85.73%. In a 10-fold validation test, the average Precision, Recall and F-score of the classification results of a decision-tree classifier were 87.8%, 88.0%, and 87.7% respectively. Our induced classes well aligned with 16 out of 17 eligibility criteria classes defined by the BRIDGE model. We discuss the potential of this method and our future work. PMID:21347026

  4. Earthworms repair H2O2-induced oxidative DNA adducts without removing UV-induced pyrimidine dimers.

    PubMed

    Chang, Wen-Shin; Tsai, Chia-Wen; Lin, Cheng-Chieh; Lin, Chih-Hsueh; Shen, Wu-Chung; Lin, Song-Shei; Bau, Da-Tian

    2011-01-01

    Ultraviolet (UV) radiation is a natural insult to various organisms. Earthworms, although possessing similar biomolecules to those in mammalian skin, do not suffer from skin cancer nor any other types of cancer as humans do. However, little is known about the molecular mechanism of the earthworm's tolerance to UV. In this study, we evaluated the genotoxicity of UV and the capacity of earthworm cell to repair UV-induced damage. The T4 UV endonuclease UV-incorporated comet assay was used to examine the excision and rejoining steps of UV-induced pyrimidine dimer. Earthworm testis cells were treated with a combination of 5 mM hydroxyurea plus 50 μM cytosine-β-D-arabinofuranoside for 6 h to block DNA rejoining capacity and to investigate excision dynamics. Compared with H(2)O(2)-induced oxidative repair capacity, the excision step of repair of UV-induced lesions in earthworm testis cells was significantly lower. After 6-h treatment of 5 mM hydroxyurea plus 50 μM cytosine-β-D-arabinofuranoside, the medium was totally replaced with fresh medium and cells were allowed to rejoin the accumulated DNA strand breaks. We found that the capacity for rejoining UV-induced breaks was also significantly lower than that for the H(2)O(2)-induced breaks. Our results strongly suggest that earthworms seem to be efficient at repairing H(2)O(2)-induced oxidative DNA adducts, but not so capable of removing UV-induced pyrimidine dimers from their genome. PMID:22021692

  5. Mechanistic Modelling of DNA Repair and Cellular Survival Following Radiation-Induced DNA Damage.

    PubMed

    McMahon, Stephen J; Schuemann, Jan; Paganetti, Harald; Prise, Kevin M

    2016-01-01

    Characterising and predicting the effects of ionising radiation on cells remains challenging, with the lack of robust models of the underlying mechanism of radiation responses providing a significant limitation to the development of personalised radiotherapy. In this paper we present a mechanistic model of cellular response to radiation that incorporates the kinetics of different DNA repair processes, the spatial distribution of double strand breaks and the resulting probability and severity of misrepair. This model enables predictions to be made of a range of key biological endpoints (DNA repair kinetics, chromosome aberration and mutation formation, survival) across a range of cell types based on a set of 11 mechanistic fitting parameters that are common across all cells. Applying this model to cellular survival showed its capacity to stratify the radiosensitivity of cells based on aspects of their phenotype and experimental conditions such as cell cycle phase and plating delay (correlation between modelled and observed Mean Inactivation Doses R(2) > 0.9). By explicitly incorporating underlying mechanistic factors, this model can integrate knowledge from a wide range of biological studies to provide robust predictions and may act as a foundation for future calculations of individualised radiosensitivity. PMID:27624453

  6. Cell nonhomologous end joining capacity controls SAF-A phosphorylation by DNA-PK in response to DNA double-strand breaks inducers.

    PubMed

    Britton, Sébastien; Froment, Carine; Frit, Philippe; Monsarrat, Bernard; Salles, Bernard; Calsou, Patrick

    2009-11-15

    Aiming to identify novel phosphorylation sites in response to DNA double-strand breaks (DSB) inducers, we have isolated a phosphorylation site on KU70. Unexpectedly, a rabbit antiserum raised against this site cross-reacted with a 120 kDa protein in cells treated by DNA DSB inducers. We identified this protein as SAF-A/hnRNP U, an abundant and essential nuclear protein containing regions binding DNA or RNA. The phosphorylation site was mapped at S59 position in a sequence context favoring a "S-hydrophobic" consensus model for DNA-PK phosphorylation site in vivo. This site was exclusively phosphorylated by DNA-PK in response to DNA DSB inducers. In addition, the extent and duration of this phosphorylation was in inverse correlation with the capacity of the cells to repair DSB by Nonhomologous End Joining. These results bring a new link between the hnRNP family and the DNA damage response. Addtionaly, the mapped phospho-site on SAF-A might serve as a potential bio-marker for DNA-PK activity in academic studies and clinical analyses of DNA-PK activators or inhibitors. PMID:19844162

  7. Demethoxycurcumin-induced DNA Damage Decreases DNA Repair-associated Protein Expression Levels in NCI-H460 Human Lung Cancer Cells.

    PubMed

    Ko, Yang-Ching; Lien, Jin-Cherng; Liu, Hsin-Chung; Hsu, Shu-Chun; Lin, Hui-Yi; Chueh, Fu-Shin; Ji, Bin-Chuan; Yang, Mei-Due; Hsu, Wu-Huei; Chung, Jing-Gung

    2015-05-01

    Demethoxycurcumin (DMC) is a key component of Chinese medicine (Turmeric) and has been proven effective in killing various cancer cells. Its role in inducing cytotoxic effects in many cancer cells has been reported, but its role regarding DNA damage on lung cancer cells has not been studied in detail. In the present study, we demonstrated DMC-induced DNA damage and condensation in NCI-H460 cells by using the Comet assay and DAPI staining examinations, respectively. Western blotting indicated that DMC suppressed the protein levels associated with DNA damage and repair, such as 14-3-3σ (an important checkpoint keeper of DNA damage response), DNA repair proteins breast cancer 1, early onset (BRCA1), O6-methylguanine-DNA methyltransferase (MGMT), mediator of DNA damage checkpoint 1 (MDC1), and p53 (tumor suppressor protein). DMC activated phosphorylated p53 and p-H2A.X (phospho Ser140) in NCI-H460 cells. Furthermore, we used confocal laser systems microscopy to examine the protein translocation. The results showed that DMC promotes the translocation of p-p53 and p-H2A.X from the cytosol to the nuclei in NCI-H460 cells. Taken together, DMC induced DNA damage and affected DNA repair proteins in NCI-H460 cells in vitro. PMID:25964547

  8. Evidence for and Localization of Vegetative Viral DNA Replication by Autoradiographic Detection of RNA·DNA Hybrids in Sections of Tumors Induced by Shope Papilloma Virus

    PubMed Central

    Orth, Gérard; Jeanteur, Philippe; Croissant, Odile

    1971-01-01

    The occurrence and localization of vegetative viral DNA replication was studied in sections of tumors induced by the rabbit Shope papilloma virus, in cottontail and domestic rabbit papillomas, in primary domestic rabbit carcinoma, and in transplantable VX2 carcinoma, by in situ hybridization of radioactive RNA complementary to viral DNA. Vegetative viral DNA replication and viral protein synthesis were compared by means of cytological hybridization and immunofluorescence techniques on adjacent frozen sections. Vegetative viral DNA replication is completely repressed in the proliferating cellular layers of these tumors, which suggests a provirus state of the viral genome, as in other cells transformed by oncogenic DNA viruses. Vegetative viral DNA replication is induced, after initiation of the keratinization, in cells of cottonail rabbit papillomas, where it is usually followed by viral protein synthesis; this illustrates the influence of the physiological state of the host cell on the control of viral functions. Vegetative viral DNA replication is deteced only in a few cells of domestic rabbit papillomas, at the end of the keratinization process; this observation provides indirect evidence that the DNA synthesis specifically induced in these tumors after the onset of keratinization reflects mostly the induction of cellular DNA synthesis. Images PMID:4331563

  9. A DNA Damage-Induced, SOS-Independent Checkpoint Regulates Cell Division in Caulobacter crescentus

    PubMed Central

    Modell, Joshua W.; Kambara, Tracy K.; Perchuk, Barrett S.; Laub, Michael T.

    2014-01-01

    Cells must coordinate DNA replication with cell division, especially during episodes of DNA damage. The paradigm for cell division control following DNA damage in bacteria involves the SOS response where cleavage of the transcriptional repressor LexA induces a division inhibitor. However, in Caulobacter crescentus, cells lacking the primary SOS-regulated inhibitor, sidA, can often still delay division post-damage. Here we identify didA, a second cell division inhibitor that is induced by DNA damage, but in an SOS-independent manner. Together, DidA and SidA inhibit division, such that cells lacking both inhibitors divide prematurely following DNA damage, with lethal consequences. We show that DidA does not disrupt assembly of the division machinery and instead binds the essential division protein FtsN to block cytokinesis. Intriguingly, mutations in FtsW and FtsI, which drive the synthesis of septal cell wall material, can suppress the activity of both SidA and DidA, likely by causing the FtsW/I/N complex to hyperactively initiate cell division. Finally, we identify a transcription factor, DriD, that drives the SOS-independent transcription of didA following DNA damage. PMID:25350732

  10. DNA damage response during mitosis induces whole chromosome mis-segregation

    PubMed Central

    Bakhoum, Samuel F.; Kabeche, Lilian; Murnane, John P.; Zaki, Bassem I.; Compton, Duane A.

    2014-01-01

    Many cancers display both structural (s-CIN) and numerical (w-CIN) chromosomal instabilities. Defective chromosome segregation during mitosis has been shown to cause DNA damage that induces structural rearrangements of chromosomes (s-CIN). In contrast, whether DNA damage can disrupt mitotic processes to generate whole chromosomal instability (w-CIN) is unknown. Here we show that activation of the DNA damage response (DDR) during mitosis selectively stabilizes kinetochore-microtubule (k-MT) attachments to chromosomes through Aurora-A and Plk1 kinases, thereby increasing the frequency of lagging chromosomes during anaphase. Inhibition of DDR proteins, ATM or Chk2, abolishes the effect of DNA damage on k-MTs and chromosome segregation, whereas activation of the DDR in the absence of DNA damage is sufficient to induce chromosome segregation errors. Finally, inhibiting the DDR during mitosis in cancer cells with persistent DNA damage suppresses inherent chromosome segregation defects. Thus, DDR during mitosis inappropriately stabilizes k-MTs creating a link between s-CIN and w-CIN. PMID:25107667

  11. A DNA damage-induced, SOS-independent checkpoint regulates cell division in Caulobacter crescentus.

    PubMed

    Modell, Joshua W; Kambara, Tracy K; Perchuk, Barrett S; Laub, Michael T

    2014-10-01

    Cells must coordinate DNA replication with cell division, especially during episodes of DNA damage. The paradigm for cell division control following DNA damage in bacteria involves the SOS response where cleavage of the transcriptional repressor LexA induces a division inhibitor. However, in Caulobacter crescentus, cells lacking the primary SOS-regulated inhibitor, sidA, can often still delay division post-damage. Here we identify didA, a second cell division inhibitor that is induced by DNA damage, but in an SOS-independent manner. Together, DidA and SidA inhibit division, such that cells lacking both inhibitors divide prematurely following DNA damage, with lethal consequences. We show that DidA does not disrupt assembly of the division machinery and instead binds the essential division protein FtsN to block cytokinesis. Intriguingly, mutations in FtsW and FtsI, which drive the synthesis of septal cell wall material, can suppress the activity of both SidA and DidA, likely by causing the FtsW/I/N complex to hyperactively initiate cell division. Finally, we identify a transcription factor, DriD, that drives the SOS-independent transcription of didA following DNA damage. PMID:25350732

  12. Quercetin ameliorates polychlorinated biphenyls-induced testicular DNA damage in rats.

    PubMed

    Lovato, F L; de Oliveira, C R; Adedara, I A; Barbisan, F; Moreira, K L S; Dalberto, M; da Rocha, M I U M; Marroni, N P; da Cruz, I B; Costabeber, I B

    2016-02-01

    Polychlorinated biphenyls (PCBs) are a group of environmental contaminants widely reported to cause gonadal toxicity in both humans and animals. This study investigated the amelioratory role of quercetin in PCBs-induced DNA damage in male Wistar rats. Polychlorinated biphenyls were administered intraperitoneally at a dose of 2 mg kg(-1) alone or in combination with quercetin (orally) at 50 mg kg(-1) for 25 days. Quercetin modulation of PCBs-induced gonadal toxicity was evaluated using selected oxidative stress indices, comet assay, measurement of DNA concentration and histology of the testes. Administration of PCBs alone caused a significant (P < 0.05) depletion in the total thiol level in testes of treated rats. Conversely, the levels of reactive oxygen species (ROS) and thiobarbituric acid reactive substances (TBARS) production were markedly elevated in testes of PCBs-treated rats compared with control. Further, PCBs exposure produced statistically significant increases in DNA tail migration, degraded double-stranded DNA (dsDNA) concentration and histological alterations of testes of the treated rats compared to control. Quercetin cotreatment significantly improved the testicular antioxidant status, decreased DNA fragmentation and restored the testicular histology, thus demonstrating the protective effect of quercetin in PCBs-treated rats. PMID:25892208

  13. Mercury-induced DNA polymorphism: Probing the conformation of Hg(II)-DNA via Staphylococcal nuclease digestion and circular dichroism measurements

    SciTech Connect

    Gruenwedel, D.W.; Cruikshank, M.K. )

    1990-02-27

    Exposing native calf thymus DNA to increasing concentrations of Hg(ClO{sub 4}){sub 2} not only produces dramatic changes in its circular dichroism (CD) but results also in the decrease, and ultimate cessation, of endonucleolytic DNA cleavage by staphylococcal nuclease. DNA cleavage proceeds at or near the rates exhibited by untreated DNA. At Hg(II) levels of 0.08 < r < 0.5, the rate of DNA hydrolysis decreases monotonically with increasing Hg(II) concentrations, and at r > 0.4, DNA cleavage ceases. Both the CD changes and the changes in the rate of DNA digestion are totally reversible upon the removal of Hg(II). For comparison purposes, native calf thymus DNA was also treated with methylmercury (CH{sub 3}Hg(II)), an agent known to disrupt the secondary structure of DNA. The treatment yielded single-stranded methylmercurated DNA with preserved right-handed helix screwness. The authors interpret the Hg(II)-induced alterations in the CD of native calf thymus DNA, and the hydrolysis rate changes observed with staphylococcal nuclease, to indicate that Hg(II) either produces in DNA reversible B {leftrightarrow} Z transitions, passing transiently through C-like conformations, or generates non-B-conformational structures of presumably left-handed geometry.

  14. Zinc protects against ultraviolet A1-induced DNA damage and apoptosis in cultured human fibroblasts.

    PubMed

    Leccia, M T; Richard, M J; Favier, A; Béani, J C

    1999-09-01

    Ultraviolet A1 (UVA1) radiation generates reactive oxygen species and the oxidative stress is known as a mediator of DNA damage and of apoptosis. We exposed cultured human cutaneous fibroblasts to UVA1 radiation (wavelengths in the 340-450-nm range with emission peak at 365 nm) and, using the alkaline unwinding method, we showed an immediate significant increase of DNA strand breaks in exposed cells. Apoptosis was determined by detecting cytoplasmic nucleosomes (enzyme-linked immunosorbent assay method) at different time points in fibroblasts exposed to different irradiation doses. In our conditions, UVA1 radiation induced an early (8 h) and a delayed (18 h) apoptosis. Delayed apoptosis increased in a UVA dose-dependent manner. Zinc is an important metal for DNA protection and has been shown to have inhibitory effects on apoptosis. The addition of zinc (6.5 mg/L) as zinc chloride to the culture medium significantly decreased immediate DNA strand breaks in human skin fibroblasts. Moreover, zinc chloride significantly decreased UVA1-induced early and delayed apoptosis. Thus, these data show for the first time in normal cutaneous cultured cells that UVA1 radiation induces apoptosis. This apoptosis is biphasic and appears higher 18 h after the stress. Zinc supplementation can prevent both immediate DNA strand breakage and early and delayed apoptosis, suggesting that this metal could be of interest for skin cell protection against UVA1 irradiation. PMID:10468155

  15. Oxidative stress-related DNA damage and homologous recombination repairing induced by N,N-dimethylformamide.

    PubMed

    Wang, Cui; Yang, Jinhuan; Lu, Dezhao; Fan, Yongsheng; Zhao, Meirong; Li, Zhuoyu

    2016-07-01

    The intensified anthropogenic release of N,N-dimethylformamide (DMF) has been proven to have hepatotoxic effects. However, the potential mechanism for DMF-induced toxicity has rarely been investigated. Our research implicated that DMF induced a significantly dose-dependent increase in reactive oxygen species (ROS) in HL-7702 human liver cells. Moreover, oxidative stress-related DNA damage, marked as 8-hydroxy-2'-deoxyguanosine, was increased 1.5-fold at 100 mmol l(-1) . The most severe DNA lesion (double-strand break, DSB), measured as the formation of γH2AX foci, was increased at/above 6.4 mmol l(-1) , and approximately 50% of cells underwent DSB at the peak induction. Subsequently, the DNA repair system triggered by molecules of RAD50 and MRE11A induced the homologous recombination (HR) pathway by upregulation of both gene and protein levels of RAD50, RAD51, XRCC2 and XRCC3 at 16 mmol l(-1) and was attenuated at 40 mmol l(-1) . Consequently, cellular death observed at 40 mmol l(-1) was exaggerated compared with exposure at 16 mmol l(-1) . Although the exact mechanism relying on the DMF-induced hepatotoxicity needs further clarification, oxidative stress and DNA damage involved in DSBs partially explain the reason for DMF-induced liver injury. Oxidative stress-induced DNA damage should be first considered during risk assessment on liver-targeted chemicals. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26387567

  16. The eucalyptus oil ingredient 1,8-cineol induces oxidative DNA damage.

    PubMed

    Dörsam, Bastian; Wu, Ching-Fen; Efferth, Thomas; Kaina, Bernd; Fahrer, Jörg

    2015-05-01

    The natural compound 1,8-cineol, also known as eucalyptol, is a major constituent of eucalyptus oil. This epoxy-monoterpene is used as flavor and fragrance in consumer goods as well as medical therapies. Due to its anti-inflammatory properties, 1,8-cineol is also applied to treat upper and lower airway diseases. Despite its widespread use, only little is known about the genotoxicity of 1,8-cineol in mammalian cells. This study investigates the genotoxicity and cytotoxicity of 1,8-cineol in human and hamster cells. First, we observed a significant and concentration-dependent increase in oxidative DNA damage in human colon cancer cells, as detected by the Formamidopyrimidine-DNA glycosylase (Fpg)-modified alkaline comet assay. Pre-treatment of cells with the antioxidant N-acetylcysteine prevented the formation of Fpg-sensitive sites after 1,8-cineol treatment, supporting the notion that 1,8-cineol induces oxidative DNA damage. In the dose range of DNA damage induction, 1,8-cineol did neither reduce the viability of colon cancer cells nor affected their cell cycle distribution, suggesting that cells tolerate 1,8-cineol-induced oxidative DNA damage by engaging DNA repair. To test this hypothesis, hamster cell lines with defects in BRCA2 and Rad51, which are essentials players of homologous recombination (HR)-mediated repair, were treated with 1,8-cineol. The monoterpene induced oxidative DNA damage and subsequent DNA double-strand breaks in the hamster cell lines tested. Intriguingly, we detected a significant concentration-dependent decrease in viability of the HR-defective cells, whereas the corresponding wild-type cell lines with functional HR were not affected. Based on these findings, we conclude that 1,8-cineol is weakly genotoxic, inducing primarily oxidative DNA damage, which is most likely tolerated in DNA repair proficient cells without resulting in cell cycle arrest and cell death. However, cells with deficiency in HR were compromised after 1,8-cineol

  17. Growth Arrest and DNA-Damage-Inducible, Beta (GADD45b)-Mediated DNA Demethylation in Major Psychosis

    PubMed Central

    Gavin, David P; Sharma, Rajiv P; Chase, Kayla A; Matrisciano, Francesco; Dong, Erbo; Guidotti, Alessandro

    2012-01-01

    Aberrant neocortical DNA methylation has been suggested to be a pathophysiological contributor to psychotic disorders. Recently, a growth arrest and DNA-damage-inducible, beta (GADD45b) protein-coordinated DNA demethylation pathway, utilizing cytidine deaminases and thymidine glycosylases, has been identified in the brain. We measured expression of several members of this pathway in parietal cortical samples from the Stanley Foundation Neuropathology Consortium (SFNC) cohort. We find an increase in GADD45b mRNA and protein in patients with psychosis. In immunohistochemistry experiments using samples from the Harvard Brain Tissue Resource Center, we report an increased number of GADD45b-stained cells in prefrontal cortical layers II, III, and V in psychotic patients. Brain-derived neurotrophic factor IX (BDNF IXabcd) was selected as a readout gene to determine the effects of GADD45b expression and promoter binding. We find that there is less GADD45b binding to the BDNF IXabcd promoter in psychotic subjects. Further, there is reduced BDNF IXabcd mRNA expression, and an increase in 5-methylcytosine and 5-hydroxymethylcytosine at its promoter. On the basis of these results, we conclude that GADD45b may be increased in psychosis compensatory to its inability to access gene promoter regions. PMID:22048458

  18. Titanium dioxide nanoparticles induce oxidative stress and DNA-adduct formation but not DNA-breakage in human lung cells

    PubMed Central

    Bhattacharya, Kunal; Davoren, Maria; Boertz, Jens; Schins, Roel PF; Hoffmann, Eik; Dopp, Elke

    2009-01-01

    Titanium dioxide (TiO2), also known as titanium (IV) oxide or anatase, is the naturally occurring oxide of titanium. It is also one of the most commercially used form. To date, no parameter has been set for the average ambient air concentration of TiO2 nanoparticles (NP) by any regulatory agency. Previously conducted studies had established these nanoparticles to be mainly non-cyto- and -genotoxic, although they had been found to generate free radicals both acellularly (specially through photocatalytic activity) and intracellularly. The present study determines the role of TiO2-NP (anatase, ∅ < 100 nm) using several parameters such as cyto- and genotoxicity, DNA-adduct formation and generation of free radicals following its uptake by human lung cells in vitro. For comparison, iron containing nanoparticles (hematite, Fe2O3, ∅ < 100 nm) were used. The results of this study showed that both types of NP were located in the cytosol near the nucleus. No particles were found inside the nucleus, in mitochondria or ribosomes. Human lung fibroblasts (IMR-90) were more sensitive regarding cyto- and genotoxic effects caused by the NP than human bronchial epithelial cells (BEAS-2B). In contrast to hematite NP, TiO2-NP did not induce DNA-breakage measured by the Comet-assay in both cell types. Generation of reactive oxygen species (ROS) was measured acellularly (without any photocatalytic activity) as well as intracellularly for both types of particles, however, the iron-containing NP needed special reducing conditions before pronounced radical generation. A high level of DNA adduct formation (8-OHdG) was observed in IMR-90 cells exposed to TiO2-NP, but not in cells exposed to hematite NP. Our study demonstrates different modes of action for TiO2- and Fe2O3-NP. Whereas TiO2-NP were able to generate elevated amounts of free radicals, which induced indirect genotoxicity mainly by DNA-adduct formation, Fe2O3-NP were clastogenic (induction of DNA-breakage) and required reducing

  19. Modelization of DNA fragmentation induced in human fibroblasts by Fe-56 ions

    NASA Astrophysics Data System (ADS)

    Ballarini, F.; Belli, M.; Campa, A.; Esposito, G.; Friedland, W.; Ottolenghi, A.; Paretzke, H.

    DNA double-strand breaks DSB are widely recognized as cellular critical lesions in the pathways leading from initial energy deposition by radiation to the formation of relevant biological endpoints such as gene mutations chromosome aberrations and cell death Chromatin conformation and radiation track structure are expected to have a strong influence on the spatial modulation of DSB induction at the scale of the nucleosome i e 100 base pairs bp and of the low-level chromatin fiber organization i e 1 kbp At larger scales the DNA fragmentation pattern induced by sparsely ionizing radiation approaches a scenario resulting from a random distribution of DSB However the pattern induced by high-LET irradiation can lead to deviation from randomness also at these scales This feature can have important biological consequences since spatial correlation of DSB is thought to affect their reparability Therefore studies on fragment size distributions induced by radiations of various qualities can help to link the physical characteristics of radiation with the cellular endpoints This is an important issue for understanding the main mechanisms of cell damage induced by HZE particles In this work we have compared the pattern of DNA fragmentation in the range 1-5700 kbp induced in human fibroblasts by gamma -rays with that induced by high-energy Fe-ions which have biological significance for radiation protection issues during long term astronauts travels The study has taken into account the comparison of the experimental fragmentation spectra

  20. DNA sequence analysis of X-ray induced Adh null mutations in Drosophila melanogaster

    SciTech Connect

    Mahmoud, J.; Fossett, N.G.; Arbour-Reily, P.; McDaniel, M.; Tucker, A.; Chang, S.H.; Lee, W.R. )

    1991-01-01

    The mutational spectrum for 28 X-ray induced mutations and 2 spontaneous mutations, previously determined by genetic and cytogenetic methods, consisted of 20 multilocus deficiencies (19 induced and 1 spontaneous) and 10 intragenic mutations (9 induced and 1 spontaneous). One of the X-ray induced intragenic mutations was lost, and another was determined to be a recombinant with the allele used in the recovery scheme. The DNA sequence of two X-ray induced intragenic mutations has been published. This paper reports the results of DNA sequence analysis of the remaining intragenic mutations and a summary of the X-ray induced mutational spectrum. The combination of DNA sequence analysis with genetic complementation analysis shows a continuous distribution in size of deletions rather than two different types of mutations consisting of deletions and point mutations'. Sequencing is shown to be essential for detecting intragenic deletions. Of particular importance for future studies is the observation that all of the intragenic deletions consist of a direct repeat adjacent to the breakpoint with one of the repeats deleted.

  1. Heavy ion induced DNA-DSB in yeast and mammalian cells

    NASA Technical Reports Server (NTRS)

    Loebrich, M.; Ikpeme, S.; Kiefer, J.

    1994-01-01

    Molecular changes at the DNA are assumed to be the main cause for radiation effects in a number of organisms. During the course of the last decades techniques have been developed for measuring DNA double-strand breaks (dsb), generally assumed to be the most critical DNA lesions. The outcome of all those different approaches portrays a collection of data useful for a theoretical description of radiation action mechanisms. However, in the case of heavy ion induced DNA dsb the picture is not quite clear yet and further projects and strategies have to be developed. The biological systems studied in our group are yeast and mammalian cells. While in the case of yeast cells technical and methodical reasons highlight these organisms mammalian cells reach greater importance when dsb repair studies are performed. In both types of organisms the technique of pulsed-field gel electrophoresis (PFGE) is applied, although with different modifications and evaluation procedures mainly due to the different genome sizes.

  2. Radiation induced DNA double strand breaks are rejoined by ligation and recombination processes.

    PubMed Central

    Weibezahn, K F; Coquerelle, T

    1981-01-01

    Using the method of filter elution of double stranded DNA under neutral conditions we have shown that most of gamma-ray induced double strand breaks (DSB) are rejoined in both mammalian and bacterial cells. Rejoining also occurs in the G1 phase in V79 Chinese hamster cells and under different growth conditions. Within 8 minutes at 37 C, half the breaks are rejoined. The rejoining in E. coli is equally fast and depends on the presence of DNA ligase. Some of the breaks in E. coli rejoin slowly, and these require rec+. The non-rejoined DSB are distributed over the DNA without any preference for the nucleosomal or the linker structure in the chromosome. Two kinds of DSB rejoining are discriminated, a fast process of DNA ligation and a slower process involving rec functions. PMID:7024911

  3. Macromolecular crowding induced elongation and compaction of single DNA molecules confined in a nanochannel

    PubMed Central

    Zhang, Ce; Shao, Pei Ge; van Kan, Jeroen A.; van der Maarel, Johan R. C.

    2009-01-01

    The effect of dextran nanoparticles on the conformation and compaction of single DNA molecules confined in a nanochannel was investigated with fluorescence microscopy. It was observed that the DNA molecules elongate and eventually condense into a compact form with increasing volume fraction of the crowding agent. Under crowded conditions, the channel diameter is effectively reduced, which is interpreted in terms of depletion in DNA segment density in the interfacial region next to the channel wall. Confinement in a nanochannel also facilitates compaction with a neutral crowding agent at low ionic strength. The threshold volume fraction for condensation is proportional to the size of the nanoparticle, due to depletion induced attraction between DNA segments. We found that the effect of crowding is not only related to the colligative properties of the agent and that confinement is also important. It is the interplay between anisotropic confinement and osmotic pressure which gives the elongated conformation and the possibility for condensation at low ionic strength. PMID:19805352

  4. Light-induced Release of DNA from Gold Nanoparticles: Nanoshells and Nanorods

    PubMed Central

    Huschka, Ryan; Zuloaga, Jorge; Knight, Mark; Brown, Lisa V.; Nordlander, Peter; Halas, Naomi J.

    2013-01-01

    Plasmon-resonant nanoparticle complexes show highly promising potential for light-triggered, remote-controlled delivery of oligonucleotides on demand, for research and therapeutic purposes. Here we investigate the light-triggered release of DNA from two types of nanoparticle substrates: Au nanoshells and Au nanorods. Both light-triggered and thermally induced release are distinctly observable from nanoshell-based complexes, with light-triggered release occurring at an ambient solution temperature well below the DNA melting temperature. Surprisingly, no analogous measureable release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in plasmon resonant, light-triggered DNA release. PMID:21736347

  5. Exercise-induced