Science.gov

Sample records for induced dna damages

  1. Triplex-Induced DNA Damage Response

    PubMed Central

    Rogers, Faye A.; Tiwari, Meetu Kaushik

    2013-01-01

    Cellular DNA damage response is critical to preserving genomic integrity following exposure to genotoxic stress. A complex series of networks and signaling pathways become activated after DNA damage and trigger the appropriate cellular response, including cell cycle arrest, DNA repair, and apoptosis. The response elicited is dependent upon the type and extent of damage sustained, with the ultimate goal of preventing propagation of the damaged DNA. A major focus of our studies is to determine the cellular pathways involved in processing damage induced by altered helical structures, specifically triplexes. Our lab has demonstrated that the TFIIH factor XPD occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. We have shown that XPD co-localizes with γH2AX, and its presence is required for the phosphorylation of H2AX tyrosine142, which stimulates the signaling pathway to recruit pro-apoptotic factors to the damage site. Herein, we examine the cellular pathways activated in response to triplex formation and discuss our finding that suggests that XPD-dependent apoptosis plays a role in preserving genomic integrity in the presence of excessive structurally induced DNA damage. PMID:24348211

  2. Persistent damage induces mitochondrial DNA degradation

    PubMed Central

    Shokolenko, Inna N.; Wilson, Glenn L.; Alexeyev, Mikhail F.

    2013-01-01

    Considerable progress has been made recently toward understanding the processes of mitochondrial DNA (mtDNA) damage and repair. However, a paucity of information still exists regarding the physiological effects of persistent mtDNA damage. This is due, in part, to experimental difficulties associated with targeting mtDNA for damage, while sparing nuclear DNA. Here, we characterize two systems designed for targeted mtDNA damage based on the inducible (Tet-ON) mitochondrial expression of the bacterial enzyme, exonuclease III, and the human enzyme, uracil-N-glyosylase containing the Y147A mutation. In both systems, damage was accompanied by degradation of mtDNA, which was detectable by six hours after induction of mutant uracil-N-glycosylase and by twelve hours after induction of exoIII. Unexpectedly, increases in the steady-state levels of single-strand lesions, which led to degradation, were small in absolute terms indicating that both abasic sites and single-strand gaps may be poorly tolerated in mtDNA. mtDNA degradation was accompanied by the loss of expression of mtDNA-encoded COX2. After withdrawal of the inducer, recovery from mtDNA depletion occurred faster in the system expressing exonuclease III, but in both systems reduced mtDNA levels persisted longer than 144h after doxycycline withdrawal. mtDNA degradation was followed by reduction and loss of respiration, decreased membrane potential, reduced cell viability, reduced intrinsic reactive oxygen species production, slowed proliferation, and changes in mitochondrial morphology (fragmentation of the mitochondrial network, rounding and “foaming” of the mitochondria). The mutagenic effects of abasic sites in mtDNA were low, which indicates that damaged mtDNA molecules may be degraded if not rapidly repaired. This study establishes, for the first time, that mtDNA degradation can be a direct and immediate consequence of persistent mtDNA damage and that increased ROS production is not an invariant consequence

  3. Heat Stress-Induced DNA Damage

    PubMed Central

    Kantidze, O.L.; Velichko, A.K.; Luzhin, A.V.; Razin, S.V.

    2016-01-01

    Although the heat-stress response has been extensively studied for decades, very little is known about its effects on nucleic acids and nucleic acid-associated processes. This is due to the fact that the research has focused on the study of heat shock proteins and factors (HSPs and HSFs), their involvement in the regulation of transcription, protein homeostasis, etc. Recently, there has been some progress in the study of heat stress effects on DNA integrity. In this review, we summarize and discuss well-known and potential mechanisms of formation of various heat stress-induced DNA damage. PMID:27437141

  4. Delayed chromosomal instability induced by DNA damage.

    PubMed Central

    Marder, B A; Morgan, W F

    1993-01-01

    DNA damage induced by ionizing radiation can result in gene mutation, gene amplification, chromosome rearrangements, cellular transformation, and cell death. Although many of these changes may be induced directly by the radiation, there is accumulating evidence for delayed genomic instability following X-ray exposure. We have investigated this phenomenon by studying delayed chromosomal instability in a hamster-human hybrid cell line by means of fluorescence in situ hybridization. We examined populations of metaphase cells several generations after expanding single-cell colonies that had survived 5 or 10 Gy of X rays. Delayed chromosomal instability, manifested as multiple rearrangements of human chromosome 4 in a background of hamster chromosomes, was observed in 29% of colonies surviving 5 Gy and in 62% of colonies surviving 10 Gy. A correlation of delayed chromosomal instability with delayed reproductive cell death, manifested as reduced plating efficiency in surviving clones, suggests a role for chromosome rearrangements in cytotoxicity. There were small differences in chromosome destabilization and plating efficiencies between cells irradiated with 5 or 10 Gy of X rays after a previous exposure to 10 Gy and cells irradiated only once. Cell clones showing delayed chromosomal instability had normal frequencies of sister chromatid exchange formation, indicating that at this cytogenetic endpoint the chromosomal instability was not apparent. The types of chromosomal rearrangements observed suggest that chromosome fusion, followed by bridge breakage and refusion, contributes to the observed delayed chromosomal instability. Images PMID:8413263

  5. DNA damage in cells exhibiting radiation-induced genomic instability

    DOE PAGESBeta

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  6. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.

  7. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  8. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest.

    PubMed

    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P; Chow, Vincent T K

    2016-01-01

    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  9. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest

    PubMed Central

    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P.; Chow, Vincent T.K.

    2016-01-01

    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  10. Influenza infection induces host DNA damage and dynamic DNA damage responses during tissue regeneration

    PubMed Central

    Li, Na; Parrish, Marcus; Chan, Tze Khee; Yin, Lu; Rai, Prashant; Yoshiyuki, Yamada; Abolhassani, Nona; Tan, Kong Bing; Kiraly, Orsolya; Chow, Vincent TK; Engelward, Bevin P.

    2016-01-01

    Influenza viruses account for significant morbidity worldwide. Inflammatory responses, including excessive generation of reactive oxygen and nitrogen species (RONS), mediate lung injury in severe Influenza infections. However, the molecular basis of inflammation-induced lung damage is not fully understood. Here, we studied influenza H1N1 infected cells in vitro, as well as H1N1 infected mice, and we monitored molecular and cellular responses over the course of two weeks in vivo. We show that influenza induces DNA damage both when cells are directly exposed to virus in vitro (measured using the comet assay) and also when cells are exposed to virus in vivo (estimated via γH2AX foci). We show that DNA damage, as well as responses to DNA damage, persist in vivo until long after virus has been cleared, at times when there are inflammation associated RONS (measured by xanthine oxidase activity and oxidative products). The frequency of lung epithelial and immune cells with increased γH2AX foci is elevated in vivo, especially for dividing cells (Ki-67 positive) exposed to oxidative stress during tissue regeneration. Additionally, we observed a significant increase in apoptotic cells as well as increased levels of DSB repair proteins Ku70, Ku86 and Rad51 during the regenerative phase. In conclusion, results show that influenza induces DNA both in vitro and in vivo, and that DNA damage responses are activated, raising the possibility that DNA repair capacity may be a determining factor for tissue recovery and disease outcome. PMID:25809161

  11. DNA damage induced by the direct effect of radiation

    NASA Astrophysics Data System (ADS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.

    2008-10-01

    We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.

  12. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    2001-01-01

    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  13. Modulation of irinotecan-induced genomic DNA damage by theanine.

    PubMed

    Attia, Sabry

    2012-05-01

    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity. PMID:22414655

  14. Maintenance of the DNA-Damage Checkpoint Requires DNA-Damage-Induced Mediator Protein Oligomerization

    PubMed Central

    Usui, Takehiko; Foster, Steven S.; Petrini, John H.J.

    2010-01-01

    SUMMARY Oligomeric assembly of Brca1 C-terminal (BRCT) domain-containing mediator proteins occurs at sites of DNA damage. However, the functional significance and regulation of such assemblies are not well understood. In this study, we defined the molecular mechanism of DNA-damage-induced oligomerization of the S. cerevisiae BRCT protein Rad9. Our data suggest that Rad9’s tandem BRCT domain mediates Rad9 oligomerization via its interaction with its own Mec1/Tel1-phosphorylated SQ/TQ cluster domain (SCD). Rad53 activation is unaffected by mutations that impair Rad9 oligomerization, but checkpoint maintenance is lost, indicating that oligomerization is required to sustain checkpoint signaling. Once activated, Rad53 phosphorylates the Rad9 BRCT domain, which attenuates the BRCT-SCD interaction. Failure to phosphorylate the Rad9 BRCT results in cytologically visible Rad9 foci. This suggests a feedback loop wherein Rad53 activity and Rad9 oligomerization are regulated to tune the DNA-damage response. PMID:19187758

  15. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope

    2014-01-01

    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  16. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  17. Torin2 Suppresses Ionizing Radiation-Induced DNA Damage Repair.

    PubMed

    Udayakumar, Durga; Pandita, Raj K; Horikoshi, Nobuo; Liu, Yan; Liu, Qingsong; Wong, Kwok-Kin; Hunt, Clayton R; Gray, Nathanael S; Minna, John D; Pandita, Tej K; Westover, Kenneth D

    2016-05-01

    Several classes of inhibitors of the mammalian target of rapamycin (mTOR) have been developed based on its central role in sensing growth factor and nutrient levels to regulate cellular metabolism. However, its ATP-binding site closely resembles other phosphatidylinositol 3-kinase-related kinase (PIKK) family members, resulting in reactivity with these targets that may also be therapeutically useful. The ATP-competitive mTOR inhibitor, Torin2, shows biochemical activity against the DNA repair-associated proteins ATM, ATR and DNA-PK, which raises the possibility that Torin2 and related compounds might radiosensitize cancerous tumors. In this study Torin2 was also found to enhance ionizing radiation-induced cell killing in conditions where ATM was dispensable, confirming the requirement for multiple PIKK targets. Moreover, Torin2 did not influence the initial appearance of γ-H2AX foci after irradiation but significantly delayed the disappearance of radiation-induced γ-H2AX foci, indicating a DNA repair defect. Torin2 increased the number of radiation-induced S-phase specific chromosome aberrations and reduced the frequency of radiation-induced CtIP and Rad51 foci formation, suggesting that Torin2 works by blocking homologous recombination (HR)-mediated DNA repair resulting in an S-phase specific DNA repair defect. Accordingly, Torin2 reduced HR-mediated repair of I-Sce1-induced DNA damage and contributed to replication fork stalling. We conclude that radiosensitization of tumor cells by Torin2 is associated with disrupting ATR- and ATM-dependent DNA damage responses. Our findings support the concept of developing combination cancer therapies that incorporate ionizing radiation therapy and Torin2 or compounds with similar properties. PMID:27135971

  18. Proton-induced direct and indirect damage of plasmid DNA.

    PubMed

    Vyšín, Luděk; Pachnerová Brabcová, Kateřina; Štěpán, Václav; Moretto-Capelle, Patrick; Bugler, Beatrix; Legube, Gaelle; Cafarelli, Pierre; Casta, Romain; Champeaux, Jean Philippe; Sence, Martine; Vlk, Martin; Wagner, Richard; Štursa, Jan; Zach, Václav; Incerti, Sebastien; Juha, Libor; Davídková, Marie

    2015-08-01

    Clustered DNA damage induced by 10, 20 and 30 MeV protons in pBR322 plasmid DNA was investigated. Besides determination of strand breaks, additional lesions were detected using base excision repair enzymes. The plasmid was irradiated in dry form, where indirect radiation effects were almost fully suppressed, and in water solution containing only minimal residual radical scavenger. Simultaneous irradiation of the plasmid DNA in the dry form and in the solution demonstrated the contribution of the indirect effect as prevalent. The damage composition slightly differed when comparing the results for liquid and dry samples. The obtained data were also subjected to analysis concerning different methodological approaches, particularly the influence of irradiation geometry, models used for calculation of strand break yields and interpretation of the strand breaks detected with the enzymes. It was shown that these parameters strongly affect the results. PMID:26007308

  19. Fungicide prochloraz induces oxidative stress and DNA damage in vitro.

    PubMed

    Lundqvist, J; Hellman, B; Oskarsson, A

    2016-05-01

    Prochloraz is widely used in horticulture and agriculture, e.g. as a post-harvest anti-mold treatment. Prochloraz is a known endocrine disruptor causing developmental toxicity with multiple mechanisms of action. However, data are scarce concerning other toxic effects. Since oxidative stress response, with formation of reactive oxygen species (ROS), is a common mechanism for different toxic endpoints, e.g. genotoxicity, carcinogenicity and teratogenicity, the aim of this study was to investigate if prochloraz can induce oxidative stress and/or DNA damage in human cells. A cell culture based in vitro model was used to study oxidative stress response by prochloraz, as measured by the activity of the nuclear factor erythroid 2-related factor 2 (Nrf2), a key molecule in oxidative defense mechanisms. It was observed that prochloraz induced oxidative stress in cultured human adrenocortical H295R and hepatoma HepG2 cells at non-toxic concentrations. Further, we used Comet assay to investigate the DNA damaging potential of prochloraz, and found that non-toxic concentrations of prochloraz induced DNA damage in HepG2 cells. These are novel findings, contradicting previous studies in the field of prochloraz and genotoxicity. This study reports a new mechanism by which prochloraz may exert toxicity. Our findings suggest that prochloraz might have genotoxic properties. PMID:26945613

  20. Mitochondrial DNA damage induced autophagy, cell death, and disease

    PubMed Central

    Van Houten, Bennett; Hunter, Senyene E.; Meyer, Joel N.

    2016-01-01

    Mammalian mitochondria contain multiple small genomes. While these organelles have efficient base excision removal of oxidative DNA lesions and alkylation damage, many DNA repair systems that work on nuclear DNA damage are not active in mitochondria. What is the fate of DNA damage in the mitochondria that cannot be repaired or that overwhelms the repair system? Some forms of mitochondrial DNA damage can apparently trigger mitochondrial DNA destruction, either via direct degradation or through specific forms of autophagy, such as mitophagy. However, accumulation of certain types of mitochondrial damage, in the absence of DNA ligase III (Lig3) or exonuclease G (EXOG), enzymes required for repair, can directly trigger cell death. This review examines the cellular effects of persistent damage to mitochondrial genomes and discusses the very different cell fates that occur in response to different kinds of damage. PMID:26709760

  1. Analysis of alcohol-induced DNA damage in Escherichia coli by visualizing single genomic DNA molecules.

    PubMed

    Kang, Yujin; Lee, Jinyong; Kim, Jisoo; Oh, Yeeun; Kim, Dogeun; Lee, Jungyun; Lim, Sangyong; Jo, Kyubong

    2016-07-21

    Consumption of alcohol injures DNA, and such damage is considered to be a primary cause for the development of cancer and many other diseases essentially due to reactive oxygen species generated from alcohol. To sensitively detect alcohol-induced DNA lesions in a biological system, we introduced a novel analytical platform for visualization of single genomic DNA molecules using E. coli. By fluorescently labelling the DNA lesions, our approach demonstrated, with the highest sensitivity, that we could count the number of DNA lesions induced by alcohol metabolism in a single bacterial cell. Moreover, our results showed a linear relationship between ethanol concentration and the number of DNA lesions: 0.88 lesions per 1% ethanol. Using this approach, we quantitatively analysed the DNA damage induced by exposure to alcoholic beverages such as beer (5% ethanol), rice wine (13%), soju (20%), and whisky (40%). PMID:27186604

  2. DNA damage profiles induced by sunlight at different latitudes.

    PubMed

    Schuch, André Passaglia; Yagura, Teiti; Makita, Kazuo; Yamamoto, Hiromasa; Schuch, Nelson Jorge; Agnez-Lima, Lucymara Fassarella; MacMahon, Ricardo Monreal; Menck, Carlos Frederico Martins

    2012-04-01

    Despite growing knowledge on the biological effects of ultraviolet (UV) radiation on human health and ecosystems, it is still difficult to predict the negative impacts of the increasing incidence of solar UV radiation in a scenario of global warming and climate changes. Hence, the development and application of DNA-based biological sensors to monitor the solar UV radiation under different environmental conditions is of increasing importance. With a mind to rendering a molecular view-point of the genotoxic impact of sunlight, field experiments were undertaken with a DNA-dosimeter system in parallel with physical photometry of solar UVB/UVA radiation, at various latitudes in South America. On applying biochemical and immunological approaches based on specific DNA-repair enzymes and antibodies, for evaluating sunlight-induced DNA damage profiles, it became clear that the genotoxic potential of sunlight does indeed vary according to latitude. Notwithstanding, while induction of oxidized DNA bases is directly dependent on an increase in latitude, the generation of 6-4PPs is inversely so, whereby the latter can be regarded as a biomolecular marker of UVB incidence. This molecular DNA lesion-pattern largely reflects the relative incidence of UVA and UVB energy at any specific latitude. Hereby is demonstrated the applicability of this DNA-based biosensor for additional, continuous field experiments, as a means of registering variations in the genotoxic impact of solar UV radiation. PMID:22674547

  3. Inflammation-induced DNA damage and damage-induced inflammation: a vicious cycle.

    PubMed

    Pálmai-Pallag, Timea; Bachrati, Csanád Z

    2014-10-01

    Inflammation is the ultimate response to the constant challenges of the immune system by microbes, irritants or injury. The inflammatory cascade initiates with the recognition of microorganism-derived pathogen associated molecular patterns (PAMPs) and host cell-derived damage associated molecular patterns (DAMPs) by the pattern recognition receptors (PRRs). DNA as a molecular PAMP or DAMP is sensed directly or via specific binding proteins to instigate pro-inflammatory response. Some of these DNA binding proteins also participate in canonical DNA repair pathways and recognise damaged DNA to initiate DNA damage response. In this review we aim to capture the essence of the complex interplay between DNA damage response and the pro-inflammatory signalling through representative examples. PMID:25449753

  4. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.

    1984-01-01

    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  5. Stress-induced DNA damage biomarkers: applications and limitations.

    PubMed

    Nikitaki, Zacharenia; Hellweg, Christine E; Georgakilas, Alexandros G; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  6. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  7. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc

    2015-06-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  8. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation.

    PubMed

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang

    2016-01-01

    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92-1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  9. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation

    PubMed Central

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang

    2016-01-01

    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92–1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  10. Increased Sensitivity of DNA Damage Response-Deficient Cells to Stimulated Microgravity-Induced DNA Lesions

    PubMed Central

    Li, Nan; An, Lili; Hang, Haiying

    2015-01-01

    Microgravity is a major stress factor that astronauts have to face in space. In the past, the effects of microgravity on genomic DNA damage were studied, and it seems that the effect on genomic DNA depends on cell types and the length of exposure time to microgravity or simulated microgravity (SMG). In this study we used mouse embryonic stem (MES) and mouse embryonic fibroblast (MEF) cells to assess the effects of SMG on DNA lesions. To acquire the insight into potential mechanisms by which cells resist and/or adapt to SMG, we also included Rad9-deleted MES and Mdc1-deleted MEF cells in addition to wild type cells in this study. We observed significant SMG-induced DNA double strand breaks (DSBs) in Rad9-/- MES and Mdc1-/- MEF cells but not in their corresponding wild type cells. A similar pattern of DNA single strand break or modifications was also observed in Rad9-/- MES. As the exposure to SMG was prolonged, Rad9-/- MES cells adapted to the SMG disturbance by reducing the induced DNA lesions. The induced DNA lesions in Rad9-/- MES were due to SMG-induced reactive oxygen species (ROS). Interestingly, Mdc1-/- MEF cells were only partially adapted to the SMG disturbance. That is, the induced DNA lesions were reduced over time, but did not return to the control level while ROS returned to a control level. In addition, ROS was only partially responsible for the induced DNA lesions in Mdc1-/- MEF cells. Taken together, these data suggest that SMG is a weak genomic DNA stress and can aggravate genomic instability in cells with DNA damage response (DDR) defects. PMID:25915950

  11. Calculation of complex DNA damage induced by ions

    NASA Astrophysics Data System (ADS)

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.

    2011-11-01

    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  12. Calculation of complex DNA damage induced by ions

    SciTech Connect

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.

    2011-11-15

    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  13. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage

    PubMed Central

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-01-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  14. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage.

    PubMed

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-03-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  15. DNA damage response in peripheral nervous system: coping with cancer therapy-induced DNA lesions.

    PubMed

    Englander, Ella W

    2013-08-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons. PMID:23684797

  16. DNA Damage Response in Peripheral Nervous System: Coping with Cancer Therapy-Induced DNA Lesions

    PubMed Central

    Englander, Ella W

    2013-01-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons. PMID:23684797

  17. Oxidative DNA damage induced by a metabolite of 2-naphthylamine, a smoking-related bladder carcinogen.

    PubMed

    Ohnishi, Shiho; Murata, Mariko; Kawanishi, Shosuke

    2002-07-01

    2-Naphthylamine (2-NA), a bladder carcinogen, is contained in cigarette smoke. DNA adduct formation is thought to be a major cause of DNA damage by carcinogenic aromatic amines. We have investigated whether a metabolite of 2-NA, 2-nitroso-1-naphthol (NO-naphthol) causes oxidative DNA damage, using (32)P-labeled DNA fragments. We compared the mechanism of DNA damage induced by NO-naphthol with that by N-hydroxy-4-aminobiphenyl (4-ABP(NHOH)), a metabolite of 4-aminobiphenyl, another smoking-related bladder carcinogen. NO-naphthol caused Cu(II)-mediated DNA damage at T > C > G residues, with non-enzymatic reduction by NADH. Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited the DNA damage, suggesting the involvement of H(2)O(2) and Cu(I). Some free. OH scavengers also attenuated NO-naphthol-induced DNA damage, while free. OH scavengers had no effect on the DNA damage induced by 4-ABP(NHOH). This difference suggests that the reactive species formed by NO-naphthol has more free. OH-character than that by 4-ABP(NHOH). A high-pressure liquid chromatograph equipped with an electrochemical detector showed that NO-naphthol induced 8-oxo-7,8-dihydro-2'-deoxyguanosine formation in the presence of NADH and Cu(II). The oxidative DNA damage by these amino-aromatic compounds may participate in smoking-related bladder cancer, in addition to DNA adduct formation. PMID:12149138

  18. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENNTIAL FLUORESENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

  19. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

  20. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)

    2000-01-01

    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  1. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    PubMed

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. PMID:24861204

  2. Vorinostat Induces Reactive Oxygen Species and DNA Damage in Acute Myeloid Leukemia Cells

    PubMed Central

    Pettersson, Filippa; Retrouvey, Hélène; Skoulikas, Sophia; Miller, Wilson H.

    2011-01-01

    Histone deacetylase inhibitors (HDACi) are promising anti-cancer agents, however, their mechanisms of action remain unclear. In acute myeloid leukemia (AML) cells, HDACi have been reported to arrest growth and induce apoptosis. In this study, we elucidate details of the DNA damage induced by the HDACi vorinostat in AML cells. At clinically relevant concentrations, vorinostat induces double-strand breaks and oxidative DNA damage in AML cell lines. Additionally, AML patient blasts treated with vorinostat display increased DNA damage, followed by an increase in caspase-3/7 activity and a reduction in cell viability. Vorinostat-induced DNA damage is followed by a G2-M arrest and eventually apoptosis. We found that pre-treatment with the antioxidant N-acetyl cysteine (NAC) reduces vorinostat-induced DNA double strand breaks, G2-M arrest and apoptosis. These data implicate DNA damage as an important mechanism in vorinostat-induced growth arrest and apoptosis in both AML cell lines and patient-derived blasts. This supports the continued study and development of vorinostat in AMLs that may be sensitive to DNA-damaging agents and as a combination therapy with ionizing radiation and/or other DNA damaging agents. PMID:21695163

  3. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  4. DNA damage-induced type I interferon promotes senescence and inhibits stem cell function

    PubMed Central

    Carbone, Christopher J.; Zhao, Bin; Katlinski, Kanstantsin V.; Zheng, Hui; Guha, Manti; Li, Ning; Chen, Qijun; Yang, Ting; Lengner, Christopher J.; Greenberg, Roger A.; Johnson, F. Brad; Fuchs, Serge Y.

    2015-01-01

    Expression of type I interferons (IFN) can be induced by DNA damaging agents but the mechanisms and significance of this regulation are not completely understood. We found that the transcription factor IRF3, activated in an ATM-IKKα/β dependent manner, stimulates cell-autonomous IFNβ expression in response to double-stranded DNA breaks. Cells and tissues with accumulating DNA damage produce endogenous IFNβ and stimulate IFN signaling in vitro and in vivo. In turn, IFN acts to amplify DNA damage responses, activate the p53 pathway, promote senescence and inhibit stem cells function in response to telomere shortening. Inactivation of the IFN pathway abrogates the development of diverse progeric phenotypes and extends the life span of Terc knockout mice. These data identify DNA damage response-induced IFN signaling as a critical mechanism that links accumulating DNA damage with senescence and premature aging. PMID:25921537

  5. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint

    PubMed Central

    Collins, Josie K.; Lane, Simon I. R.; Merriman, Julie A.; Jones, Keith T.

    2015-01-01

    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule–kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  6. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint.

    PubMed

    Collins, Josie K; Lane, Simon I R; Merriman, Julie A; Jones, Keith T

    2015-01-01

    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule-kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  7. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.

    PubMed

    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji

    2016-03-01

    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV. PMID:26573366

  8. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed

    2014-01-01

    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  9. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  10. Oxidative DNA damage induced by di-(2-ethylhexyl) phthalate in HEK-293 cell line.

    PubMed

    Wang, Xuan; Jiang, Lijie; Ge, Lan; Chen, Min; Yang, Guang; Ji, Fang; Zhong, Laifu; Guan, Yingjie; Liu, Xiaofang

    2015-05-01

    Di-(2-ethylhexyl) phthalate (DEHP) is commonly employed as a plasticizer. We have found that exposure of human embryonic kidney cell line 293 (HEK-293) to DEHP resulted in a crucial dose-dependent increase of DNA strand breaks in a comet assay. To elucidate the role of glutathione (GSH) in the DNA damage, the cells were pretreated with buthionine-(S,R)-sulfoximine (BSO) and pretreated with N-acetylcysteine (NAC), a GSH precursor. Here we show that depletion of GSH in HEK-293 cells with BSO dramatically increased the susceptibility of HEK-293 cells to DEHP-induced DNA damage. Furthermore, when the intracellular GSH content was elevated by NAC, the DNA damage induced by DEHP was almost completely abolished. In addition, DEHP had effect on lysosomal or mitochondrial damage at high dose level. These results indicate that DEHP exerts genotoxic effects in HEK-293 cells, probably through DNA damage induced by oxidative stress; GSH is responsible for cellular defense against DEHP-induced DNA damage; lysosome and mitochondria may be the vital targets in DEHP-induced DNA damage. PMID:25899473

  11. Detection of DNA damage induced by heavy ion irradiation in the individual cells with comet assay

    NASA Astrophysics Data System (ADS)

    Wada, S.; Natsuhori, M.; Ito, N.; Funayama, T.; Kobayashi, Y.

    2003-05-01

    Investigating the biological effects of high-LET heavy ion irradiation at low fluence is important to evaluate the risk of charged particles. Especially it is important to detect radiation damage induced by the precise number of heavy ions in the individual cells. Thus we studied the relationship between the number of ions traversing the cell and DNA damage produced by the ion irradiation. We applied comet assay to measure the DNA damage in the individual cells. Cells attached on the ion track detector CR-39 were irradiated with ion beams at TIARA, JAERI-Takasaki. After irradiation, the cells were stained with ethidium bromide and the opposite side of the CR-39 was etched. We observed that the heavy ions with higher LET values induced the heavier DNA damage. The result indicated that the amount of DNA damage induced by one particle increased with the LET values of the heavy ions.

  12. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.

    1989-01-01

    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  13. Determination of the Action Spectrum of UVR-Induced Mitochondrial DNA Damage in Human Skin Cells.

    PubMed

    Latimer, Jennifer A; Lloyd, James J; Diffey, Brian L; Matts, Paul J; Birch-Machin, Mark A

    2015-10-01

    Biological responses of human skin to UVR including cancer and aging are largely wavelength-dependent, as shown by the action spectra of UVR-induced erythema and nuclear DNA (nDNA) damage. A molecular dosimeter of UVR exposure is therefore required. Although mitochondrial DNA (mtDNA) damage has been shown to be a reliable and sensitive biomarker of UVR exposure in human skin, its wavelength dependency is unknown. The current study solves this problem by determining the action spectrum of UVR-induced mtDNA damage in human skin. Human neonatal dermal fibroblasts and primary human adult keratinocyte cells were irradiated with increasing doses of UVR. Dose-response curves of mtDNA damage were produced for each of the UVR sources and cell types, and an action spectrum for each cell type was determined by mathematical induction. Similarities between these mtDNA damage action spectra and previously determined nDNA damage were observed, with the most detrimental effects occurring over the shorter UVR wavelengths. Notably, a statistically significant (P<0.0001) greater sensitivity to mtDNA damage was observed in dermal fibroblasts compared with keratinocytes at wavelengths >300 nm, possibly indicating a wider picture of depth dependence in sensitivity. This finding has implications for disease/photodamage mechanisms and interventions. PMID:26030182

  14. Autophosphorylation and Pin1 binding coordinate DNA damage-induced HIPK2 activation and cell death.

    PubMed

    Bitomsky, Nadja; Conrad, Elisa; Moritz, Christian; Polonio-Vallon, Tilman; Sombroek, Dirk; Schultheiss, Kathrin; Glas, Carolina; Greiner, Vera; Herbel, Christoph; Mantovani, Fiamma; del Sal, Giannino; Peri, Francesca; Hofmann, Thomas G

    2013-11-01

    Excessive genome damage activates the apoptosis response. Protein kinase HIPK2 is a key regulator of DNA damage-induced apoptosis. Here, we deciphered the molecular mechanism of HIPK2 activation and show its relevance for DNA damage-induced apoptosis in cellulo and in vivo. HIPK2 autointeracts and site-specifically autophosphorylates upon DNA damage at Thr880/Ser882. Autophosphorylation regulates HIPK2 activity and mutation of the phosphorylation-acceptor sites deregulates p53 Ser46 phosphorylation and apoptosis in cellulo. Moreover, HIPK2 autophosphorylation is conserved between human and zebrafish and is important for DNA damage-induced apoptosis in vivo. Mechanistically, autophosphorylation creates a binding signal for the phospho-specific isomerase Pin1. Pin1 links HIPK2 activation to its stabilization by inhibiting HIPK2 polyubiquitination and modulating Siah-1-HIPK2 interaction. Concordantly, Pin1 is required for DNA damage-induced HIPK2 stabilization and p53 Ser46 phosphorylation and is essential for induction of apotosis both in cellulo and in zebrafish. Our results identify an evolutionary conserved mechanism regulating DNA damage-induced apoptosis. PMID:24145406

  15. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  16. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells.

    PubMed

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells' molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  17. The role of nitric oxide on DNA damage induced by benzene metabolites

    PubMed Central

    MELIKIAN, ASSIEH A.; CHEN, KUN-MING; LI, HEYI; SODUM, RAMA; FIALA, EMERICH; EL-BAYOUMY, KARAM

    2013-01-01

    Benzene, a tobacco constituent, is a leukemogen in humans and a carcinogen in rodents. Several benzene metabolites generate superoxide anion (O2•−) and induce nitric oxide synthase in the bone marrow of mice. We hypothesized that the reaction of nitric oxide (•NO) with O2•− leads to the formation of peroxynitrite as an intermediate during benzene metabolism. This hypothesis was supported by demonstrating that the exposure of mice to benzene produced nitrated metabolites and enhanced the levels of protein-bound 3-nitrotyrosine in the bone marrow of mice in vivo. In the current study, we investigated the influence of nitric oxide, generated from sodium 1-(N,N-diethylamino)diazen-1-ium-1,2-diolate, on DNA strand breaks induced by each single or binary benzene metabolite at different doses and compared the levels of the DNA damage induced by each benzene metabolite in the presence of nitric oxide with the levels of DNA strand breaks induced by peroxynitrite at similar doses in vitro. We found that among benzene metabolites only 1,2,4-trihydroxybenzene (BT) can induce significant DNA damage in the absence of nitric oxide. While 1,4-dihydroxybenzene (HQ), 1,4-benzo-quinone (BQ) and 1,2-dihydroxybenzene (CAT) require •NO to induce DNA strand breaks, hydroquinone was the most potent DNA-damaging benzene metabolite in the presence of •NO. The order of DNA breaks by benzene metabolites in the presence of •NO is: Peroxynitrite = HQ > BT > BQ > CAT. The •NO and O2•− scavengers inhibited DNA damage induced by [HQ+•NO]. Benzene, trans,trans-muconaldehyde, and phenol, do not induce DNA strand breaks either in the absence or presence of •NO. However, adding phenol to [HQ+•NO] leads to greater DNA damage than [HQ+•NO] alone. Collectively, these results suggest that nitric oxide is an important factor in DNA damage induced by certain benzene metabolites, probably via the formation of the peroxynitrite intermediate. Phenol, the major benzene metabolite

  18. A facile method for the assessment of DNA damage induced by UV-activated nanomaterials

    NASA Astrophysics Data System (ADS)

    Yamazaki, Yuka; Zinchenko, Anatoly A.; Murata, Shizuaki

    2011-07-01

    Fluorescent microscopy observation of gene-size DNA (T4 phage DNA or λ phage DNA) was used to assess DNA damage induced by UV irradiation in the presence of nanomaterials, such as QDs (quantum dots: CdSe/ZnS semiconductor nanoparticles), the water-soluble fullerene derivative C60(OH)n (n = 6-12) and titanium oxide nanoparticles of 25 nm in diameter. The magnitude of DNA damage could be simply evaluated based on the degree of shortening of the stretched DNA image. This method showed that DNA damage was amplified by the action of QDs under irradiation by C-band (λmax = 254 nm) or B-band (λmax = 303 nm) UV. Smaller QDs that emitted higher-energy fluorescence (λemmax = 565 nm) induced more severe damage than medium- and larger-size QDs that emitted longer-wavelength fluorescence (λemmax = 605 and 705 nm, respectively). The fullerene derivative and TiO2 nanoparticles caused DNA damage even under irradiation by A-band UV (λmax = 365 nm) and showed more severe DNA damage than QDs under similar conditions.

  19. Measurement of 60Co-gamma ray-induced DNA damage by capillary electrophoresis.

    PubMed

    Nackerdien, Z; Atha, D

    1996-08-01

    Capillary electrophoresis was employed in this study to monitor 60Co-gamma ray-induced damage to a 1 kb DNA ladder which consists of restriction fragments ranging from 75 to 12,000 bp. DNA samples (0.5 mg/ml) were exposed to 0-60 Gy of gamma-radiation in the presence and absence of 110 mumol/l ethidium bromide (EB). The analysis showed peak broadening without significant changes in the size distribution of irradiated fragments. Radiation-induced conformational changes may account for this peak broadening. EB addition caused small increases in the retention times of DNA fragments without affecting the overall DNA damage. This indicates that the presence of intercalated EB during radiation will not stabilize the DNA against 60Co-gamma ray-induced damage. PMID:8876442

  20. UV-induced DNA damage in Cyclops abyssorum tatricus populations from clear and turbid alpine lakes

    PubMed Central

    Tartarotti, Barbara; Saul, Nadine; Chakrabarti, Shumon; Trattner, Florian; Steinberg, Christian E. W.; Sommaruga, Ruben

    2014-01-01

    Zooplankton from clear alpine lakes thrive under high levels of solar UV radiation (UVR), but in glacially turbid ones they are more protected from this damaging radiation. Here, we present results from experiments done with Cyclops abyssorum tatricus to assess UV-induced DNA damage and repair processes using the comet assay. Copepods were collected from three alpine lakes of differing UV transparency ranging from clear to glacially turbid, and exposed to artificial UVR. In addition, photoprotection levels [mycosporine-like amino acids (MAAs) and lipophilic antioxidant capacity] were estimated in the test populations. Similar UV-induced DNA damage levels were observed among the copepods from all lakes, but background DNA damage (time zero and dark controls) was lowest in the copepods from the glacially turbid lake, resulting in a higher relative DNA damage accumulation. Most DNA strand breaks were repaired after recovery in the dark. Low MAA concentrations were found in the copepods from the glacially turbid lake, while the highest levels were observed in the population from the most UV transparent lake. However, the highest lipophilic antioxidant capacities were measured in the copepods from the lake with intermediate UV transparency. Photoprotection and the ability to repair DNA damage, and consequently reducing UV-induced damage, are part of the response mechanisms in zooplankton to changes in water transparency caused by glacier retreat. PMID:24616551

  1. DNA damage induced by m-phenylenediamine and its derivative in the presence of copper ion.

    PubMed

    Chen, F; Murata, M; Hiraku, Y; Yamashita, N; Oikawa, S; Kawanishi, S

    1998-09-01

    To clarify the mechanism of carcinogenesis by hair dyes, we compared the extent of DNA damage induced by mutagenic m-phenylenediamine and 4-methoxy-m-phenylenediamine, using 32P-5'-end-labeled DNA fragments obtained from the human c-Ha-ras-1 protooncogene and the p53 tumor suppressor gene. Carcinogenic 4-methoxy-m-phenylenediamine caused DNA damage at thymine and cytosine residues in the presence of Cu(II). Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited 4-methoxy-m-phenylenediamine-induced DNA damage, suggesting the involvement of H2O2 and Cu(I). Superoxide dismutase (SOD) enhanced the DNA damage. Formation of 8-hydroxy-2'-deoxyguanosine (8-OH-dG) was induced by 4-methoxy-m-phenylenediamine in the presence of Cu(II). UV-visible spectroscopic studies have shown that Cu(II) mediated autoxidation of 4-methoxy-m-phenylenediamine and SOD accelerated the autoxidation. On the other hand, non-carcinogenic m-phenylenediamine did not cause clear DNA damage and significant autoxidation even in the presence of Cu(II). These results suggest that carcinogenicity of m-phenylenediamines is associated with ability to cause oxidative DNA damage rather than bacterial mutagenicity. PMID:9802551

  2. Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

    SciTech Connect

    Zheng, Juanjuan; Zhang, Yu; Xu, Wentao; Luo, YunBo; Hao, Junran; Shen, Xiao Li; Yang, Xuan; Li, Xiaohong; Huang, Kunlun

    2013-04-15

    Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did not affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage induced by

  3. Ochratoxin A induces oxidative DNA damage in liver and kidney after oral dosing to rats.

    PubMed

    Kamp, Hennicke G; Eisenbrand, Gerhard; Janzowski, Christine; Kiossev, Jetchko; Latendresse, John R; Schlatter, Josef; Turesky, Robert J

    2005-12-01

    The nephrotoxic/carcinogenic mycotoxin ochratoxin A (OTA) occurs as a contaminant in food and feed and may be linked to human endemic Balkan nephropathy. The mechanism of OTA-derived carcinogenicity is still under debate, since reactive metabolites of OTA and DNA adducts have not been unambiguously identified. Oxidative DNA damage, however, has been observed in vitro after incubation of mammalian cells with OTA. In this study, we investigated whether OTA induces oxidative DNA damage in vivo as well. Male F344 rats were dosed with 0, 0.03, 0.1, 0.3 mg/kg bw per day OTA for 4 wk (gavage, 7 days/wk, five animals per dose group). Subsequently, oxidative DNA damage was determined in liver and kidney by the comet assay (single cell gel electrophoresis) with/without use of the repair enzyme formamido-pyrimidine-DNA-glycosylase (FPG). The administration of OTA had no effect on basic DNA damage (determined without FPG); however, OTA-mediated oxidative damage was detected with FPG treatment in kidney and liver DNA of all dose groups. Since the doses were in a range that had caused kidney tumors in a 2-year carcinogenicity study with rats, the oxidative DNA damage induced by OTA may help to explain its mechanism of carcinogenicity. For the selective induction of tumors in the kidney, increased oxidative stress in connection with severe cytotoxicity and increased cell proliferation might represent driving factors. PMID:16302199

  4. The organophosphate insecticide chlorpyrifos confers its genotoxic effects by inducing DNA damage and cell apoptosis.

    PubMed

    Li, Diqiu; Huang, Qingchun; Lu, Miaoqing; Zhang, Lei; Yang, Zhichuan; Zong, Mimi; Tao, Liming

    2015-09-01

    The organophosphate insecticide chlorpyrifos (CPF) is known to induce neurological effects, malformation and micronucleus formation, persistent developmental disorders, and maternal toxicity in rats and mice. The binding of chlorpyrifos with DNA to produce DNA adducts leads to an increasing social concern about the genotoxic risk of CPF in human, but CPF-induced cytotoxicity through DNA damage and cell apoptosis is not well understood. Here, we quantified the cytotoxicity and potential genotoxicity of CPF using the alkaline comet assay, γH2AX foci formation, and the DNA laddering assay in order to detect DNA damage and apoptosis in human HeLa and HEK293 cells in vitro. Drosophila S2 cells were used as a positive control. The alkaline comet assay showed that sublethal concentrations of CPF induced significant concentration-dependent increases in single-strand DNA breaks in the treated cells compared with the control. The percentage of γH2AX-positive HeLa cells revealed that CPF also causes DNA double-strand breaks in a time-dependent manner. Moreover, DNA fragmentation analysis demonstrated that exposure to CPF induced a significant concentration- and time-dependent increase in cell apoptosis. We conclude that CPF is a strongly genotoxic agent that induces DNA damage and cell apoptosis. PMID:26002045

  5. DEVELOPMENT OF RAPID TECHNIQUES FOR DETECTION OF CHEMICALLY-INDUCED DNA DAMAGE

    EPA Science Inventory

    Rapid and cost-effective indicator assays are being developed which may be used as a rapid screen to assess the potential for exposure to hazardous compounds that can be related to a biological target (e.g., DNA). Chemically-induced DNA damage will be measured using surrogate DN...

  6. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.

    2011-01-01

    UVA has long been known for generating an oxidative stress in cells. In this paper we review the different types of DNA damage induced by UVA, i.e. strand breaks, bipyrimidine photoproducts, and oxidatively damaged bases. Emphasis is given to the mechanism of formation that is further illustrated by the presentation of new in vitro data. Examples of oxidation of proteins involved in DNA metabolism are also given.

  7. pRB plays an essential role in cell cycle arrest induced by DNA damage

    PubMed Central

    Harrington, Elizabeth A.; Bruce, Jacqueline L.; Harlow, Ed; Dyson, Nicholas

    1998-01-01

    To maintain genome stability, cells with damaged DNA must arrest to allow repair of mutations before replication. Although several key components required to elicit this arrest have been discovered, much of the pathway remains elusive. Here we report that pRB acts as a central mediator of the proliferative block induced by a diverse range of DNA damaging stimuli. Rb−/− mouse embryo fibroblasts are defective in arrest after γ-irradiation, UV irradiation, and treatment with a variety of chemotherapeutic drugs. In contrast, the pRB related proteins p107 and p130 do not play an essential part in the DNA damage response. pRB is required specifically for the G1/S phase checkpoint induced by γ-irradiation. Despite a defect in G1/S phase arrest, levels of p53 and p21 are increased normally in Rb−/− cells in response to γ-irradiation. These results lead us to propose a model in which pRB acts as an essential downstream target of the DNA damage-induced arrest pathway. The ability of pRB to prevent replication of damaged DNA is likely to inhibit the propagation of carcinogenic mutations and may therefore contribute to its role as a tumor suppressor. Furthermore, because many cancer therapies act by damaging DNA, these findings also have implications for the treatment of tumors in which pRB is inactivated. PMID:9751770

  8. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc.

    PubMed

    Cooper, Karen L; King, Brenee S; Sandoval, Monica M; Liu, Ke Jian; Hudson, Laurie G

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  9. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.

    PubMed

    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2014-07-01

    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma. PMID:24798949

  10. Ultrasound-induced DNA damage and signal transductions indicated by gammaH2AX

    NASA Astrophysics Data System (ADS)

    Furusawa, Yukihiro; Fujiwara, Yoshisada; Zhao, Qing-Li; Hassan, Mariame Ali; Ogawa, Ryohei; Tabuchi, Yoshiaki; Takasaki, Ichiro; Takahashi, Akihisa; Ohnishi, Takeo; Kondo, Takashi

    2011-09-01

    Ultrasound (US) has been shown to induce cancer cell death via different forms including apoptosis. Here, we report the potential of low-intensity pulsed US (LIPUS) to induce genomic DNA damage and subsequent DNA damage response. Using the ionizing radiation-induced DNA double-strand breaks (DSBs) as the positive control, we were able to observe the induction of DSBs (as neutral comet tails) and the subsequent formation of gammaH2AX-positive foci (by immunofluorescence detection) in human leukemia cells following exposure to LIPUS. The LIPUS-induced DNA damage arose most likely from the mechanical, but not sonochemical, effect of cavitation, based on our observation that the suppression of inertial cavitation abrogated the gammH2AX foci formation, whereas scavenging of free radical formation (e.g., hydroxyl radical) had no protective effect on it. Treatment with the specific kinase inhibitor of ATM or DNA-PKcs, which can phosphorylate H2AX Ser139, revealed that US-induced gammaH2AX was inhibited more effectively by the DNA-PK inhibitor than ATM kinase inhibitor. Notably, these inhibitor effects were opposite to those with radiation-induced gammH2AX. In conclusion, we report, for the first time that US can induce DNA damage and the DNA damage response as indicated by gammaH2AX was triggered by the cavitational mechanical effects. Thus, it is expected that the data shown here may provide a better understanding of the cellular responses to US.

  11. DNA damage response during mitosis induces whole chromosome mis-segregation

    PubMed Central

    Bakhoum, Samuel F.; Kabeche, Lilian; Murnane, John P.; Zaki, Bassem I.; Compton, Duane A.

    2014-01-01

    Many cancers display both structural (s-CIN) and numerical (w-CIN) chromosomal instabilities. Defective chromosome segregation during mitosis has been shown to cause DNA damage that induces structural rearrangements of chromosomes (s-CIN). In contrast, whether DNA damage can disrupt mitotic processes to generate whole chromosomal instability (w-CIN) is unknown. Here we show that activation of the DNA damage response (DDR) during mitosis selectively stabilizes kinetochore-microtubule (k-MT) attachments to chromosomes through Aurora-A and Plk1 kinases, thereby increasing the frequency of lagging chromosomes during anaphase. Inhibition of DDR proteins, ATM or Chk2, abolishes the effect of DNA damage on k-MTs and chromosome segregation, whereas activation of the DDR in the absence of DNA damage is sufficient to induce chromosome segregation errors. Finally, inhibiting the DDR during mitosis in cancer cells with persistent DNA damage suppresses inherent chromosome segregation defects. Thus, DDR during mitosis inappropriately stabilizes k-MTs creating a link between s-CIN and w-CIN. PMID:25107667

  12. A DNA damage-induced, SOS-independent checkpoint regulates cell division in Caulobacter crescentus.

    PubMed

    Modell, Joshua W; Kambara, Tracy K; Perchuk, Barrett S; Laub, Michael T

    2014-10-01

    Cells must coordinate DNA replication with cell division, especially during episodes of DNA damage. The paradigm for cell division control following DNA damage in bacteria involves the SOS response where cleavage of the transcriptional repressor LexA induces a division inhibitor. However, in Caulobacter crescentus, cells lacking the primary SOS-regulated inhibitor, sidA, can often still delay division post-damage. Here we identify didA, a second cell division inhibitor that is induced by DNA damage, but in an SOS-independent manner. Together, DidA and SidA inhibit division, such that cells lacking both inhibitors divide prematurely following DNA damage, with lethal consequences. We show that DidA does not disrupt assembly of the division machinery and instead binds the essential division protein FtsN to block cytokinesis. Intriguingly, mutations in FtsW and FtsI, which drive the synthesis of septal cell wall material, can suppress the activity of both SidA and DidA, likely by causing the FtsW/I/N complex to hyperactively initiate cell division. Finally, we identify a transcription factor, DriD, that drives the SOS-independent transcription of didA following DNA damage. PMID:25350732

  13. A DNA Damage-Induced, SOS-Independent Checkpoint Regulates Cell Division in Caulobacter crescentus

    PubMed Central

    Modell, Joshua W.; Kambara, Tracy K.; Perchuk, Barrett S.; Laub, Michael T.

    2014-01-01

    Cells must coordinate DNA replication with cell division, especially during episodes of DNA damage. The paradigm for cell division control following DNA damage in bacteria involves the SOS response where cleavage of the transcriptional repressor LexA induces a division inhibitor. However, in Caulobacter crescentus, cells lacking the primary SOS-regulated inhibitor, sidA, can often still delay division post-damage. Here we identify didA, a second cell division inhibitor that is induced by DNA damage, but in an SOS-independent manner. Together, DidA and SidA inhibit division, such that cells lacking both inhibitors divide prematurely following DNA damage, with lethal consequences. We show that DidA does not disrupt assembly of the division machinery and instead binds the essential division protein FtsN to block cytokinesis. Intriguingly, mutations in FtsW and FtsI, which drive the synthesis of septal cell wall material, can suppress the activity of both SidA and DidA, likely by causing the FtsW/I/N complex to hyperactively initiate cell division. Finally, we identify a transcription factor, DriD, that drives the SOS-independent transcription of didA following DNA damage. PMID:25350732

  14. Mcl-1 protects prostate cancer cells from cell death mediated by chemotherapy-induced DNA damage.

    PubMed

    Reiner, Teresita; de Las Pozas, Alicia; Parrondo, Ricardo; Palenzuela, Deanna; Cayuso, William; Rai, Priyamvada; Perez-Stable, Carlos

    2015-01-01

    The anti-apoptotic protein Mcl-1 is highly expressed in castration-resistant prostate cancer (CRPC), resulting in resistance to apoptosis and association with poor prognosis. Although predominantly localized in the cytoplasm, there is evidence that Mcl-1 exhibits nuclear localization where it is thought to protect against DNA damage-induced cell death. The role of Mcl-1 in mediating resistance to chemotherapy-induced DNA damage in prostate cancer (PCa) is not known. We show in human PCa cell lines and in TRAMP, a transgenic mouse model of PCa, that the combination of the antimitotic agent ENMD-1198 (analog of 2-methoxyestradiol) with betulinic acid (BA, increases proteotoxic stress) targets Mcl-1 by increasing its proteasomal degradation, resulting in increased γH2AX (DNA damage) and apoptotic/necrotic cell death. Knockdown of Mcl-1 in CRPC cells leads to elevated γH2AX, DNA strand breaks, and cell death after treatment with 1198 + BA- or doxorubicin. Additional knockdowns in PC3 cells suggests that cytoplasmic Mcl-1 protects against DNA damage by blocking the mitochondrial release of apoptosis-inducing factor and thereby preventing its nuclear translocation and subsequent interaction with the cyclophilin A endonuclease. Overall, our results suggest that chemotherapeutic agents that target Mcl-1 will promote cell death in response to DNA damage, particularly in CRPC. PMID:26425662

  15. The DNA damage-induced cell death response: a roadmap to kill cancer cells.

    PubMed

    Matt, Sonja; Hofmann, Thomas G

    2016-08-01

    Upon massive DNA damage cells fail to undergo productive DNA repair and trigger the cell death response. Resistance to cell death is linked to cellular transformation and carcinogenesis as well as radio- and chemoresistance, making the underlying signaling pathways a promising target for therapeutic intervention. Diverse DNA damage-induced cell death pathways are operative in mammalian cells and finally culminate in the induction of programmed cell death via activation of apoptosis or necroptosis. These signaling routes affect nuclear, mitochondria- and plasma membrane-associated key molecules to activate the apoptotic or necroptotic response. In this review, we highlight the main signaling pathways, molecular players and mechanisms guiding the DNA damage-induced cell death response. PMID:26791483

  16. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  17. Positive feedback regulation of p53 transactivity by DNA damage-induced ISG15 modification

    PubMed Central

    Park, Jong Ho; Yang, Seung Wook; Park, Jung Mi; Ka, Seung Hyeun; Kim, Ji-Hoon; Kong, Young-Yun; Jeon, Young Joo; Seol, Jae Hong; Chung, Chin Ha

    2016-01-01

    p53 plays a pivotal role in tumour suppression under stresses, such as DNA damage. ISG15 has been implicated in the control of tumorigenesis. Intriguingly, the expression of ISG15, UBE1L and UBCH8 is induced by DNA-damaging agents, such as ultraviolet and doxorubicin, which are known to induce p53. Here, we show that the genes encoding ISG15, UBE1L, UBCH8 and EFP, have the p53-responsive elements and their expression is induced in a p53-dependent fashion under DNA damage conditions. Furthermore, DNA damage induces ISG15 conjugation to p53 and this modification markedly enhances the binding of p53 to the promoters of its target genes (for example, CDKN1 and BAX) as well as of its own gene by promoting phosphorylation and acetylation, leading to suppression of cell growth and tumorigenesis. These findings establish a novel feedback circuit between p53 and ISG15-conjugating system for positive regulation of the tumour suppressive function of p53 under DNA damage conditions. PMID:27545325

  18. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    NASA Astrophysics Data System (ADS)

    Kim, G. J.; Kim, W.; Kim, K. T.; Lee, J. K.

    2010-01-01

    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  19. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    SciTech Connect

    Kim, G. J.; Lee, J. K.; Kim, W.; Kim, K. T.

    2010-01-11

    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  20. Tempol prevents genotoxicity induced by vorinostat: role of oxidative DNA damage.

    PubMed

    Alzoubi, Karem H; Khabour, Omar F; Jaber, Aya G; Al-Azzam, Sayer I; Mhaidat, Nizar M; Masadeh, Majed M

    2014-05-01

    Vorinostat is a member of histone deacetylase inhibitors, which represents a new class of anticancer agents for the treatment of solid and hematological malignancies. Studies have shown that these drugs induce DNA damage in blood lymphocytes, which is proposed to be due to the generation of oxidative lesions. The increase in DNA damage is sometimes associated with risk of developing secondary cancer. Thus, finding a treatment that limits DNA damage caused by anticancer drugs would be beneficial. Tempol is a potent antioxidant that was shown to prevent DNA damage induced by radiation. In this study, we aimed to investigate the harmful effects of vorinostat on DNA damage, and the possible protective effects of tempol against this damage. For that, the spontaneous frequency of sister chromatid exchanges (SCEs), chromosomal aberrations (CAs), and 8-hydroxy-2-deoxy guanosine (8-OHdG) levels were measured in cultured human lymphocytes treated with vorinostat and/or tempol. The results showed that vorinostat significantly increases the frequency of SCEs, CAs and 8-OHdG levels in human lymphocytes as compared to control. These increases were normalized by the treatment of cells with tempol. In conclusion, vorinostat is genotoxic to lymphocytes, and this toxicity is reduced by tempol. Such results could set the stage for future studies investigating the possible usefulness of antioxidants co-treatment in preventing the genotoxicity of vorinostat when used as anticancer in human. PMID:23761013

  1. Tirapazamine-induced cytotoxicity and DNA damage in transplanted tumors: relationship to tumor hypoxia.

    PubMed

    Siim, B G; Menke, D R; Dorie, M J; Brown, J M

    1997-07-15

    Tirapazamine (TPZ) is a hypoxia-selective bioreductive drug currently in Phases II and III clinical trials with both radiotherapy and chemotherapy. The response of tumors to TPZ is expected to depend both on the levels of reductive enzymes that activate the drug to a DNA-damaging and toxic species and on tumor oxygenation. Both of these parameters are likely to vary between individual tumors. In this study, we examined whether the enhancement of radiation damage to tumors by TPZ can be predicted from TPZ-induced DNA damage measured using the comet assay. DNA damage provides a functional end point that is directly related to cell killing and should be dependent on both reductive enzyme activity and hypoxia. We demonstrate that TPZ potentiates tumor cell kill by fractionated radiation in three murine tumors (SCCVII, RIF-1, and EMT6) and two human tumor xenografts (A549 and HT29), with no potentiation observed in a third xenograft (HT1080). Overall, there was no correlation of radiation potentiation and TPZ-induced DNA damage in the tumors, except that the nonresponsive tumor xenograft had significantly lower levels of DNA damage than the other five tumor types. However, there was a large tumor-to-tumor variability in DNA damage within each tumor type. This variability appeared not to result from differences in activity of the reductive enzymes but largely from differences in oxygenation between individual tumors, measured using fluorescent detection of the hypoxia marker EF5. The results, therefore, suggest that the sensitivity of individual tumors to TPZ, although not necessarily the response to TPZ plus radiation, might be assessed from measurements of DNA damage using the comet assay. PMID:9230202

  2. Radiation induced apoptosis and initial DNA damage are inversely related in locally advanced breast cancer patients

    PubMed Central

    2010-01-01

    Background DNA-damage assays, quantifying the initial number of DNA double-strand breaks induced by radiation, have been proposed as a predictive test for radiation-induced toxicity. Determination of radiation-induced apoptosis in peripheral blood lymphocytes by flow cytometry analysis has also been proposed as an approach for predicting normal tissue responses following radiotherapy. The aim of the present study was to explore the association between initial DNA damage, estimated by the number of double-strand breaks induced by a given radiation dose, and the radio-induced apoptosis rates observed. Methods Peripheral blood lymphocytes were taken from 26 consecutive patients with locally advanced breast carcinoma. Radiosensitivity of lymphocytes was quantified as the initial number of DNA double-strand breaks induced per Gy and per DNA unit (200 Mbp). Radio-induced apoptosis at 1, 2 and 8 Gy was measured by flow cytometry using annexin V/propidium iodide. Results Radiation-induced apoptosis increased in order to radiation dose and data fitted to a semi logarithmic mathematical model. A positive correlation was found among radio-induced apoptosis values at different radiation doses: 1, 2 and 8 Gy (p < 0.0001 in all cases). Mean DSB/Gy/DNA unit obtained was 1.70 ± 0.83 (range 0.63-4.08; median, 1.46). A statistically significant inverse correlation was found between initial damage to DNA and radio-induced apoptosis at 1 Gy (p = 0.034). A trend toward 2 Gy (p = 0.057) and 8 Gy (p = 0.067) was observed after 24 hours of incubation. Conclusions An inverse association was observed for the first time between these variables, both considered as predictive factors to radiation toxicity. PMID:20868468

  3. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.

    PubMed

    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena

    2012-06-01

    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. PMID:22556029

  4. Effects of (+)-catechin and (-)-epicatechin on heterocyclic amines-induced oxidative DNA damage.

    PubMed

    Haza, Ana Isabel; Morales, Paloma

    2011-01-01

    The aim of the present study was to evaluate the protective effect of (+)-catechin and (-)-epicatechin against 2-amino-3,8- dimethylimidazo[4,5-f]quinoxaline (8-MeIQx), 2-amino-3,4,8-trimethylimidazo[4,5-f]-quinoxaline (4,8-diMeIQx) and 2-amino-1-methyl-6-phenyl-imidazo[4,5-b]pyridine (PhIP)-induced DNA damage in human hepatoma cells (HepG2). DNA damage (strand breaks and oxidized purines/pyrimidines) was evaluated by the alkaline single-cell gel electrophoresis or comet assay. Increasing concentrations of 8-MeIQx, 4,8-diMeIQx and PhIP induced a significant increase in DNA strand breaks and oxidized purines and pyrimidines in a dose-dependent manner. Among those, PhIP (300 µm) exerted the highest genotoxicity. (+)-Catechin exerted protection against oxidized purines induced by 8-MeIQx, 4,8-diMeIQx and PhIP. Oxidized pyrimidines and DNA strand breaks induced by PhIP were also prevented by (+)-catechin. Otherwise, (-)-epicatechin protected against the oxidized pyrimidines induced by PhIP and the oxidized purines induced by 8-MeIQx and 4,8-diMeIQx. One feasible mechanism by which (+)-catechin and (-)-epicatechin exert their protective effect towards heterocyclic amines-induced oxidative DNA damage may be by modulation of phase I and II enzyme activities. The ethoxyresorufin O-deethylation (CYP1A1) activity was moderately inhibited by (+)-catechin, while little effect was observed by (-)-epicatechin. However, (+)-catechin showed the greatest increase in UDP-glucuronyltransferase activity. In conclusion, our results clearly indicate that (+)-catechin was more efficient than (-)-epicatechin in preventing DNA damage (strand breaks and oxidized purines/pyrimidines) induced by PhIP than that induced by 8-MeIQx and 4,8-diMeIQx. PMID:20583320

  5. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage-induced cell senescence.

    PubMed

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A; Kumar, Sheetal; Kalab, Petr

    2016-04-15

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase-regulated nuclear-cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage-induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β-dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP-regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  6. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.

    PubMed

    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A

    2013-09-01

    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity. PMID:23793613

  7. Spatiotemporal kinetics of γ-H2AX protein on charged particles induced DNA damage

    NASA Astrophysics Data System (ADS)

    Niu, H.; Chang, H. C.; Cho, I. C.; Chen, C. H.; Liu, C. S.; Chou, W. T.

    2014-08-01

    In several researches, it has been demonstrated that charged particles can induce more complex DNA damages. These complex damages have higher ability to cause the cell death or cell carcinogenesis. For this reason, clarifying the DNA repair mechanism after charged particle irradiation plays an important role in the development of charged particle therapy and space exploration. Unfortunately, the detail spatiotemporal kinetic of DNA damage repair is still unclear. In this study, we used γ-H2AX protein to investigate the spatiotemporal kinetics of DNA double strand breaks in alpha-particle irradiated HeLa cells. The result shows that the intensity of γ-H2AX foci increased gradually, and reached to its maximum at 30 min after irradiation. A good linear relationship can be observed between foci intensity and radiation dose. After 30 min, the γ-H2AX foci intensity was decreased with time passed, but remained a large portion (∼50%) at 48 h passed. The data show that the dissolution rate of γ-H2AX foci agreed with two components DNA repairing model. These results suggest that charged particles can induce more complex DNA damages and causing the retardation of DNA repair.

  8. Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.

    PubMed

    Schellenberg, Matthew J; Perera, Lalith; Strom, Christina N; Waters, Crystal A; Monian, Brinda; Appel, C Denise; Vilas, Caroline K; Williams, Jason G; Ramsden, Dale A; Williams, R Scott

    2016-05-01

    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA-protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg(2+)-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg(2+) binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons. PMID:27060144

  9. p53-dependent SIRT6 expression protects Aβ42-induced DNA damage

    PubMed Central

    Jung, Eun Sun; Choi, Hyunjung; Song, Hyundong; Hwang, Yu Jin; Kim, Ahbin; Ryu, Hoon; Mook-Jung, Inhee

    2016-01-01

    Alzheimer’s disease (AD) is the most common type of dementia and age-related neurodegenerative disease. Elucidating the cellular changes that occur during ageing is an important step towards understanding the pathogenesis and progression of neurodegenerative disorders. SIRT6 is a member of the mammalian sirtuin family of anti-aging genes. However, the relationship between SIRT6 and AD has not yet been elucidated. Here, we report that SIRT6 protein expression levels are reduced in the brains of both the 5XFAD AD mouse model and AD patients. Aβ42, a major component of senile plaques, decreases SIRT6 expression, and Aβ42-induced DNA damage is prevented by the overexpression of SIRT6 in HT22 mouse hippocampal neurons. Also, there is a strong negative correlation between Aβ42-induced DNA damage and p53 levels, a protein involved in DNA repair and apoptosis. In addition, upregulation of p53 protein by Nutlin-3 prevents SIRT6 reduction and DNA damage induced by Aβ42. Taken together, this study reveals that p53-dependent SIRT6 expression protects cells from Aβ42-induced DNA damage, making SIRT6 a promising new therapeutic target for the treatment of AD. PMID:27156849

  10. DNA damage sensor MRE11 recognizes cytosolic double-stranded DNA and induces type I interferon by regulating STING trafficking

    PubMed Central

    Kondo, Takeshi; Kobayashi, Junya; Saitoh, Tatsuya; Maruyama, Kenta; Ishii, Ken J.; Barber, Glen N.; Komatsu, Kenshi; Akira, Shizuo; Kawai, Taro

    2013-01-01

    Double-stranded DNA (dsDNA) derived from pathogen- or host-damaged cells triggers innate immune responses when exposed to cytoplasm. However, the machinery underlying the primary recognition of intracellular dsDNA is obscure. Here we show that the DNA damage sensor, meiotic recombination 11 homolog A (MRE11), serves as a cytosolic sensor for dsDNA. Cells with a mutation of MRE11 gene derived from a patient with ataxia-telangiectasia–like disorder, and cells in which Mre11 was knocked down, had defects in dsDNA-induced type I IFN production. MRE11 physically interacted with dsDNA in the cytoplasm and was required for activation of stimulator of IFN genes (STING) and IRF3. RAD50, a binding protein to MRE11, was also required for dsDNA responses, whereas NBS1, another binding protein to MRE11, was dispensable. Collectively, our results suggest that the MRE11–RAD50 complex plays important roles in recognition of dsDNA and initiation of STING-dependent signaling, in addition to its role in DNA-damage responses. PMID:23388631

  11. Exercise-induced oxidatively damaged DNA in humans: evaluation in plasma or urine?

    PubMed

    Karpouzi, Christina; Nikolaidis, Stefanos; Kabasakalis, Athanasios; Tsalis, George; Mougios, Vassilis

    2016-01-01

    Physical exercise can induce oxidative damage in humans. 8-Hydroxy-2'-deoxyguanosine (8-OHdG) is a widely known biomarker of DNA oxidation, which can be determined in blood and urine. The aim of the present study was to compare these two biological fluids in terms of which is more suitable for the estimation of the oxidative damage of DNA by measuring the concentration of 8-OHdG one hour after maximal exercise by enzyme immunoassay. The concentration of 8-OHdG increased with exercise only in plasma (p < 0.001), and values differed between exercise tests in both plasma and urine (p < 0.05). In conclusion, plasma appears to be more sensitive to exercise-induced 8-OHdG changes than urine and, hence, a more appropriate medium for assessing oxidative damage of DNA, although the poor repeatability of the measurement needs to be addressed in future studies. PMID:26849281

  12. UvrD helicase suppresses recombination and DNA damage-induced deletions.

    PubMed

    Kang, Josephine; Blaser, Martin J

    2006-08-01

    UvrD, a highly conserved helicase involved in mismatch repair, nucleotide excision repair (NER), and recombinational repair, plays a critical role in maintaining genomic stability and facilitating DNA lesion repair in many prokaryotic species. In this report, we focus on the UvrD homolog in Helicobacter pylori, a genetically diverse organism that lacks many known DNA repair proteins, including those involved in mismatch repair and recombinational repair, and that is noted for high levels of inter- and intragenomic recombination and mutation. H. pylori contains numerous DNA repeats in its compact genome and inhabits an environment rich in DNA-damaging agents that can lead to increased rearrangements between such repeats. We find that H. pylori UvrD functions to repair DNA damage and limit homologous recombination and DNA damage-induced genomic rearrangements between DNA repeats. Our results suggest that UvrD and other NER pathway proteins play a prominent role in maintaining genome integrity, especially after DNA damage; thus, NER may be especially critical in organisms such as H. pylori that face high-level genotoxic stress in vivo. PMID:16855234

  13. Damage to dry plasmid DNA induced by nanosecond XUV-laser pulses

    NASA Astrophysics Data System (ADS)

    Nováková, Eva; Davídková, Marie; Vyšín, Ludék; Burian, Tomáš; Grisham, Michael E.; Heinbuch, Scott; Rocca, Jorge J.; Juha, Libor

    2011-06-01

    Ionizing radiation induces a variety of DNA damages including single-strand breaks (SSBs), double-strand breaks (DSBs), abasic sites, modified sugar and bases. Most theoretical and experimental studies have been focused on DNA strand scissions, in particular production of DNA double-strand breaks. DSBs have been proven to be a key damage at a molecular level responsible for the formation of chromosomal aberrations, leading often to cell death. The complexity of lesions produced in DNA by ionizing radiations is thought to depend on the amount of energy deposited at the site of each lesion. We have studied the nature of DNA damage induced directly by the pulsed 46.9 nm radiation provided by a capillary-discharge Ne-like Ar laser (CDL). Different surface doses were delivered with a repetition rate of a few Hz and an average pulse energy ~ 1 μJ. A simple model DNA molecule, i.e., dried closed-circular plasmid DNA (pBR322), was irradiated. The agarose gel electrophoresis method was used for determination of both SSB and DSB yields. Results are compared with a previous study of plasmid DNA irradiated with a single sub-nanosecond 1-keV X-ray pulse produced by a large-scale, double-stream gas puff target, illuminated by sub-kJ, near-infrared (NIR) focused laser pulses at the PALS facility (Prague Asterix Laser System).

  14. DNA damage-induced metaphase I arrest is mediated by the spindle assembly checkpoint and maternal age

    PubMed Central

    Marangos, Petros; Stevense, Michelle; Niaka, Konstantina; Lagoudaki, Michaela; Nabti, Ibtissem; Jessberger, Rolf; Carroll, John

    2015-01-01

    In mammalian oocytes DNA damage can cause chromosomal abnormalities that potentially lead to infertility and developmental disorders. However, there is little known about the response of oocytes to DNA damage. Here we find that oocytes with DNA damage arrest at metaphase of the first meiosis (MI). The MI arrest is induced by the spindle assembly checkpoint (SAC) because inhibiting the SAC overrides the DNA damage-induced MI arrest. Furthermore, this MI checkpoint is compromised in oocytes from aged mice. These data lead us to propose that the SAC is a major gatekeeper preventing the progression of oocytes harbouring DNA damage. The SAC therefore acts to integrate protection against both aneuploidy and DNA damage by preventing production of abnormal mature oocytes and subsequent embryos. Finally, we suggest escaping this DNA damage checkpoint in maternal ageing may be one of the causes of increased chromosome anomalies in oocytes and embryos from older mothers. PMID:26522734

  15. DNA damage-induced metaphase I arrest is mediated by the spindle assembly checkpoint and maternal age.

    PubMed

    Marangos, Petros; Stevense, Michelle; Niaka, Konstantina; Lagoudaki, Michaela; Nabti, Ibtissem; Jessberger, Rolf; Carroll, John

    2015-01-01

    In mammalian oocytes DNA damage can cause chromosomal abnormalities that potentially lead to infertility and developmental disorders. However, there is little known about the response of oocytes to DNA damage. Here we find that oocytes with DNA damage arrest at metaphase of the first meiosis (MI). The MI arrest is induced by the spindle assembly checkpoint (SAC) because inhibiting the SAC overrides the DNA damage-induced MI arrest. Furthermore, this MI checkpoint is compromised in oocytes from aged mice. These data lead us to propose that the SAC is a major gatekeeper preventing the progression of oocytes harbouring DNA damage. The SAC therefore acts to integrate protection against both aneuploidy and DNA damage by preventing production of abnormal mature oocytes and subsequent embryos. Finally, we suggest escaping this DNA damage checkpoint in maternal ageing may be one of the causes of increased chromosome anomalies in oocytes and embryos from older mothers. PMID:26522734

  16. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu

    2015-01-01

    Living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, affects on the cellular response to DNA damage induced by exposures to radiation or other toxic chemicals will have an impact on the radiation risks for the astronauts, as well as on the mutation rate in microorganisms, is still an open question. Although the possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate the effects of spaceflight on the cellular response to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induces DNA damages including the double strand breaks (DSB) similar to the ionizing radiation. Damage in the DNA was measured by the phosphorylation of a histone protein H2AX (-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in the DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ti-67 signals. Our results suggested that the difference in -H2AX between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect the response of the DNA damage response genes to bleomycin treatment.

  17. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu

    2015-01-01

    Outside the protection of the geomagnetic field, astronauts and other living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, have effects on cellular responses to DNA damage induced by exposure to radiation or cytotoxic chemicals is still unknown, as is their impact on the radiation risks for astronauts and on the mutation rate in microorganisms. Although possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on cellular responses to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induced DNA damages including double-strand breaks (DSB) similar to the ionizing radiation. Damages in the DNA were measured by the phosphorylation of a histone protein H2AX (g-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ki-67 signals. Our results suggested that the difference in g-H2AX focus counts between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect initial transcriptional responses of the DNA damage response genes to

  18. Study on DNA Damage Induced by Neon Beam Irradiation in Saccharomyces Cerevisiae

    NASA Astrophysics Data System (ADS)

    Lu, Dong; Li, Wenjian; Wu, Xin; Wang, Jufang; Ma, Shuang; Liu, Qingfang; He, Jinyu; Jing, Xigang; Ding, Nan; Dai, Zhongying; Zhou, Jianping

    2010-12-01

    Yeast strain Saccharomyces cerevisiae was irradiated with different doses of 85 MeV/u 20Ne10+ to investigate DNA damage induced by heavy ion beam in eukaryotic microorganism. The survival rate, DNA double strand breaks (DSBs) and DNA polymorphic were tested after irradiation. The results showed that there were substantial differences in DNA between the control and irradiated samples. At the dose of 40 Gy, the yeast cell survival rate approached 50%, DNA double-strand breaks were barely detectable, and significant DNA polymorphism was observed. The alcohol dehydrogenase II gene was amplified and sequenced. It was observed that base changes in the mutant were mainly transversions of T→G and T→C. It can be concluded that heavy ion beam irradiation can lead to change in single gene and may be an effective way to induce mutation.

  19. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.

    PubMed

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh

    2014-01-01

    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury. PMID:24732344

  20. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes

    PubMed Central

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W.; Agarwal, Rajesh

    2014-01-01

    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury. PMID:24732344

  1. Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells

    PubMed Central

    Zhang, Zhuhong; Chen, Si; Mei, Hu; Xuan, Jiekun; Guo, Xiaoqing; Couch, Letha; Dobrovolsky, Vasily N.; Guo, Lei; Mei, Nan

    2015-01-01

    Ginkgo biloba leaf extract has been shown to increase the incidence in liver tumors in mice in a 2-year bioassay conducted by the National Toxicology Program. In this study, the DNA damaging effects of Ginkgo biloba leaf extract and many of its constituents were evaluated in human hepatic HepG2 cells and the underlying mechanism was determined. A molecular docking study revealed that quercetin, a flavonoid constituent of Ginkgo biloba, showed a higher potential to interact with topoisomerase II (Topo II) than did the other Ginkgo biloba constituents; this in silico prediction was confirmed by using a biochemical assay to study Topo II enzyme inhibition. Moreover, as measured by the Comet assay and the induction of γ-H2A.X, quercetin, followed by keampferol and isorhamnetin, appeared to be the most potent DNA damage inducer in HepG2 cells. In Topo II knockdown cells, DNA damage triggered by Ginkgo biloba leaf extract or quercetin was dramatically decreased, indicating that DNA damage is directly associated with Topo II. DNA damage was also observed when cells were treated with commercially available Ginkgo biloba extract product. Our findings suggest that Ginkgo biloba leaf extract- and quercetin-induced in vitro genotoxicity may be the result of Topo II inhibition. PMID:26419945

  2. Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells.

    PubMed

    Zhang, Zhuhong; Chen, Si; Mei, Hu; Xuan, Jiekun; Guo, Xiaoqing; Couch, Letha; Dobrovolsky, Vasily N; Guo, Lei; Mei, Nan

    2015-01-01

    Ginkgo biloba leaf extract has been shown to increase the incidence in liver tumors in mice in a 2-year bioassay conducted by the National Toxicology Program. In this study, the DNA damaging effects of Ginkgo biloba leaf extract and many of its constituents were evaluated in human hepatic HepG2 cells and the underlying mechanism was determined. A molecular docking study revealed that quercetin, a flavonoid constituent of Ginkgo biloba, showed a higher potential to interact with topoisomerase II (Topo II) than did the other Ginkgo biloba constituents; this in silico prediction was confirmed by using a biochemical assay to study Topo II enzyme inhibition. Moreover, as measured by the Comet assay and the induction of γ-H2A.X, quercetin, followed by keampferol and isorhamnetin, appeared to be the most potent DNA damage inducer in HepG2 cells. In Topo II knockdown cells, DNA damage triggered by Ginkgo biloba leaf extract or quercetin was dramatically decreased, indicating that DNA damage is directly associated with Topo II. DNA damage was also observed when cells were treated with commercially available Ginkgo biloba extract product. Our findings suggest that Ginkgo biloba leaf extract- and quercetin-induced in vitro genotoxicity may be the result of Topo II inhibition. PMID:26419945

  3. PEA15 Regulates the DNA Damage-Induced Cell Cycle Checkpoint and Oncogene-Directed Transformation

    PubMed Central

    Nagarajan, Arvindhan; Dogra, Shaillay Kumar; Liu, Alex Y.; Green, Michael R.

    2014-01-01

    Regulation of the DNA damage response and cell cycle progression is critical for maintaining genome integrity. Here, we report that in response to DNA damage, COPS5 deubiquitinates and stabilizes PEA15 in an ATM kinase-dependent manner. PEA15 expression oscillates throughout the cell cycle, and the loss of PEA15 accelerates cell cycle progression by activating CDK6 expression via the c-JUN transcription factor. Cells lacking PEA15 exhibit a DNA damage-induced G2/M checkpoint defect due to increased CDC25C activity and, consequentially, higher cyclin-dependent kinase 1 (CDK1)/cyclin B activity, and accordingly they have an increased rate of spontaneous mutagenesis. We find that oncogenic RAS inhibits PEA15 expression and that ectopic PEA15 expression blocks RAS-mediated transformation, which can be partially rescued by ectopic expression of CDK6. Finally, we show that PEA15 expression is downregulated in colon, breast, and lung cancer samples. Collectively, our results demonstrate that tumor suppressor PEA15 is a regulator of genome integrity and is an integral component of the DNA damage response pathway that regulates cell cycle progression, the DNA-damage-induced G2/M checkpoint, and cellular transformation. PMID:24710276

  4. PEA15 regulates the DNA damage-induced cell cycle checkpoint and oncogene-directed transformation.

    PubMed

    Nagarajan, Arvindhan; Dogra, Shaillay Kumar; Liu, Alex Y; Green, Michael R; Wajapeyee, Narendra

    2014-06-01

    Regulation of the DNA damage response and cell cycle progression is critical for maintaining genome integrity. Here, we report that in response to DNA damage, COPS5 deubiquitinates and stabilizes PEA15 in an ATM kinase-dependent manner. PEA15 expression oscillates throughout the cell cycle, and the loss of PEA15 accelerates cell cycle progression by activating CDK6 expression via the c-JUN transcription factor. Cells lacking PEA15 exhibit a DNA damage-induced G2/M checkpoint defect due to increased CDC25C activity and, consequentially, higher cyclin-dependent kinase 1 (CDK1)/cyclin B activity, and accordingly they have an increased rate of spontaneous mutagenesis. We find that oncogenic RAS inhibits PEA15 expression and that ectopic PEA15 expression blocks RAS-mediated transformation, which can be partially rescued by ectopic expression of CDK6. Finally, we show that PEA15 expression is downregulated in colon, breast, and lung cancer samples. Collectively, our results demonstrate that tumor suppressor PEA15 is a regulator of genome integrity and is an integral component of the DNA damage response pathway that regulates cell cycle progression, the DNA-damage-induced G2/M checkpoint, and cellular transformation. PMID:24710276

  5. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton

    SciTech Connect

    Malloy, K.D.; Holman, M.A.; Mitchell, D.

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlated with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. 54 refs., 4 figs., 2 tabs.

  6. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton.

    PubMed

    Malloy, K D; Holman, M A; Mitchell, D; Detrich, H W

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlate with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. PMID:9037040

  7. The radiomimetic enediyne C-1027 induces unusual DNA damage responses to double-strand breaks.

    PubMed

    Kennedy, Daniel R; Beerman, Terry A

    2006-03-21

    Cells lacking the protein kinase ataxia telangiectasia mutated (ATM) have defective responses to DNA double-strand breaks (DSBs), including an inability to activate damage response proteins such as p53. However, we previously showed that cells lacking ATM robustly activate p53 in response to DNA strand breaks induced by the radiomimetic enediyne C-1027. To gain insight into the nature of C-1027-induced ATM-independent damage responses to DNA DSBs, we further examined the molecular mechanisms underlying the cellular response to this unique radiomimetic agent. Like ionizing radiation (IR) and other radiomimetics, breaks induced by C-1027 efficiently activate ATM by phosphorylation at Ser1981, yet unlike other radiomimetics and IR, DNA breaks induced by C-1027 result in normal phosphorylation of p53 and the cell cycle checkpoint kinases (Chk1 and Chk2) in the absence of ATM. In the presence of ATM, but under ATM and Rad3-related kinase (ATR) deficient conditions, C-1027 treatment resulted in a decrease in the level of Chk1 phosphorylation but not in the level of p53 and Chk2 phosphorylation. Only when cells were deficient in both ATM and ATR was there a reduction in the level of phosphorylation of each of these DNA damage response proteins. This reduction was also accompanied by an increased level of cell death in comparison to that of wild-type cells or cells lacking either ATM or ATR. Our findings demonstrate a unique cellular response to C-1027-induced DNA DSBs in that DNA damage response proteins are unaffected by the absence of ATM, as long as ATR is present. PMID:16533058

  8. ORGANIC AND INORGANIC ARSENICALS SENSITIZE HUMAN BRONCHIAL EPITHELIAL CELLS TO HYDROGEN PEROXIDE-INDUCED DNA DAMAGE

    EPA Science Inventory

    The lungs are a target organ for arsenic carcinogenesis, however, its mechanism of action remains unclear. Furthermore, it has been suggested that inorganic arsenic (iAs) can potentiate DNA damage induced by other agents. Once inside the human body iAs generally undergoes two ...

  9. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B.

    PubMed

    Wemhoff, Sabrina; Klassen, Roland; Beetz, Anja; Meinhardt, Friedhelm

    2016-01-01

    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity. PMID:27472060

  10. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B

    PubMed Central

    Beetz, Anja; Meinhardt, Friedhelm

    2016-01-01

    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity. PMID:27472060

  11. Hyperprolinemia induces DNA, protein and lipid damage in blood of rats: antioxidant protection.

    PubMed

    Ferreira, Andréa G K; Scherer, Emilene B; da Cunha, Aline A; Manfredini, Vanusa; Biancini, Giovana Brondani; Vanzin, Camila Simioni; Vargas, Carmen R; Wyse, Angela T S

    2014-09-01

    The present study investigated the effects of hyperprolinemia on oxidative damage to biomolecules (protein, lipids and DNA) and the antioxidant status in blood of rats. The influence of the antioxidants on the effects elicited by proline was also examined. Wistar rats received two daily injections of proline and/or vitamin E plus C (6th-28th day of life) and were killed 12h after the last injection. Results showed that hyperprolinemia induced a significant oxidative damage to proteins, lipids and DNA demonstrated by increased carbonyl content, malondialdehyde levels and a greater damage index in comet assay, respectively. The concomitant antioxidants administration to proline treatment completely prevented oxidative damage to proteins, but partially prevented lipids and DNA damage. We also observed that the non-enzymatic antioxidant potential was decreased by proline treatment and partially prevented by antioxidant supplementation. The plasma levels of vitamins E and C significantly increased in rats treated exogenously with these vitamins but, interestingly, when proline was administered concomitantly with vitamin E plus C, the levels of these vitamins were similar to those found in plasma of control and proline rats. Our findings suggest that hyperprolinemia promotes oxidative damage to the three major classes of macromolecules in blood of rats. These effects were accomplished by decrease in non-enzymatic antioxidant potential and decrease in vitamins administered exogenously, which significantly decreased oxidative damage to biomolecules studied. These data suggest that antioxidants may be an effective adjuvant therapeutic to limit oxidative damage caused by proline. PMID:24980685

  12. Persistent and heritable structural damage induced in heterochromatic DNA from rat liver by N-nitrosodimethylamine

    SciTech Connect

    Ward, E.J.; Stewart, B.W.

    1987-03-24

    Analysis, by benzoylated DEAE-cellulose chromatography, has been made of structural change in eu- and heterochromatic DNA from rat liver following administration of the carcinogen N-nitrosodimethylamine. Either hepatic DNA was prelabeled with (/sup 3/H)thymidine administered 2-3 weeks before injection of the carcinogen or the labeled precursor was given during regenerative hyperplasia in rats treated earlier with N-nitrosodimethylamine. Following phenol extraction of either whole liver homogenate or nuclease-fractionated eu- and heterochromatin, carcinogen-modified DNA was examined by stepwise or caffeine gradient elution from benzoylated DEAE-cellulose. In whole DNA, nitrosamine-induced single-stranded character was maximal 4-24 h after treatment, declining rapidly thereafter; gradient elution of these DNA preparations also provided short-term evidence of structural change. Caffeine gradient chromatography suggested short-term nitrosamine-induced structural change in euchromatic DNA, while increased binding of heterochromatic DNA was evident for up to 3 months after carcinogen treatment. Preparations of newly synthesized heterochromatic DNA from animals subjected to hepatectomy up to 2 months after carcinogen treatment provided evidence of heritable structural damage. Carcinogen-induced binding of heterochromatic DNA to benzoylated DEAE-cellulose was indicative of specific structural lesions whose affinity equalled that of single-stranded DNA up to 1.0 kilobase in length. The data suggest that structural lesions in heterochromatin, which may be a consequence of incomplete repair, are preferentially degraded by endogenous nuclease(s).

  13. Clustered DNA damages induced in human hematopoietic cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Bennett, Paula V.; Cintron-Torres, Nela; Hada, Megumi; Trunk, John; Monteleone, Denise; Sutherland, John C.; Laval, Jacques; Stanislaus, Marisha; Gewirtz, Alan

    2002-01-01

    Ionizing radiation induces clusters of DNA damages--oxidized bases, abasic sites and strand breaks--on opposing strands within a few helical turns. Such damages have been postulated to be difficult to repair, as are double strand breaks (one type of cluster). We have shown that low doses of low and high linear energy transfer (LET) radiation induce such damage clusters in human cells. In human cells, DSB are about 30% of the total of complex damages, and the levels of DSBs and oxidized pyrimidine clusters are similar. The dose responses for cluster induction in cells can be described by a linear relationship, implying that even low doses of ionizing radiation can produce clustered damages. Studies are in progress to determine whether clusters can be produced by mechanisms other than ionizing radiation, as well as the levels of various cluster types formed by low and high LET radiation.

  14. Cytoprotective effect of 20S-Rg3 on benzo[a]pyrene-induced DNA damage.

    PubMed

    Poon, Po Ying; Kwok, Hoi Hin; Yue, Patrick Y K; Yang, Mildred S M; Mak, Nai Ki; Wong, Chris K C; Wong, Ricky N S

    2012-01-01

    Benzo[a]pyrene (BaP) is a polycyclic aromatic hydrocarbon ubiquitously existing in the environment. Its metabolites have been shown to cause DNA damage and cellular dysfunction in humans. Panax ginseng C.A. Meyer is a Chinese medicinal herb, and ginsenosides are the main active constituent of ginseng. Accumulating evidence had indicated that ginseng extract and ginsenosides possess cytoprotective effects. In this study, the protective effect of ginsenosides on BaP-induced DNA damage in human dermal fibroblasts (HDFs) and HepG2 cells was investigated. The genotoxic effect of BaP was measured by the comet assay. Results showed that tail moment was increased in BaP-treated cells, but cotreatment of ginsenoside 20(S)-Rg3 can significantly decrease BaP-induced DNA damage. A downstream mechanistic study revealed that 20(S)-Rg3 increased the gene expression of an important phase II detoxifying enzyme NAD(P)H:quinine oxidoreductase 1. The effect was also associated with the activation of protein kinase B (Akt) and nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2). These results indicated that 20(S)-Rg3 might protect HDFs from BaP-induced DNA damage through the activation of the phosphatidylinositol 3-kinase/Akt/Nrf2 pathway. Our results also demonstrated that 20(S)-Rg3 is a functional ligand of pregnane X receptor (PXR), a nuclear receptor that mediates the induction of drug clearance pathways. Subsequent knockdown of PXR expression by small interfering RNA confirmed the involvement of PXR on the protective effects of 20(S)-Rg3 against BaP-induced DNA damage. In summary, ginsenoside 20(S)-Rg3 can protect against BaP-induced genotoxicity in human cells, suggesting that ginseng may serve as a natural cytoprotective agent against environmental carcinogens. PMID:21956953

  15. The eucalyptus oil ingredient 1,8-cineol induces oxidative DNA damage.

    PubMed

    Dörsam, Bastian; Wu, Ching-Fen; Efferth, Thomas; Kaina, Bernd; Fahrer, Jörg

    2015-05-01

    The natural compound 1,8-cineol, also known as eucalyptol, is a major constituent of eucalyptus oil. This epoxy-monoterpene is used as flavor and fragrance in consumer goods as well as medical therapies. Due to its anti-inflammatory properties, 1,8-cineol is also applied to treat upper and lower airway diseases. Despite its widespread use, only little is known about the genotoxicity of 1,8-cineol in mammalian cells. This study investigates the genotoxicity and cytotoxicity of 1,8-cineol in human and hamster cells. First, we observed a significant and concentration-dependent increase in oxidative DNA damage in human colon cancer cells, as detected by the Formamidopyrimidine-DNA glycosylase (Fpg)-modified alkaline comet assay. Pre-treatment of cells with the antioxidant N-acetylcysteine prevented the formation of Fpg-sensitive sites after 1,8-cineol treatment, supporting the notion that 1,8-cineol induces oxidative DNA damage. In the dose range of DNA damage induction, 1,8-cineol did neither reduce the viability of colon cancer cells nor affected their cell cycle distribution, suggesting that cells tolerate 1,8-cineol-induced oxidative DNA damage by engaging DNA repair. To test this hypothesis, hamster cell lines with defects in BRCA2 and Rad51, which are essentials players of homologous recombination (HR)-mediated repair, were treated with 1,8-cineol. The monoterpene induced oxidative DNA damage and subsequent DNA double-strand breaks in the hamster cell lines tested. Intriguingly, we detected a significant concentration-dependent decrease in viability of the HR-defective cells, whereas the corresponding wild-type cell lines with functional HR were not affected. Based on these findings, we conclude that 1,8-cineol is weakly genotoxic, inducing primarily oxidative DNA damage, which is most likely tolerated in DNA repair proficient cells without resulting in cell cycle arrest and cell death. However, cells with deficiency in HR were compromised after 1,8-cineol

  16. Repair of DNA Damage Induced by the Cytidine Analog Zebularine Requires ATR and ATM in Arabidopsis[OPEN

    PubMed Central

    Liu, Chun-Hsin; Finke, Andreas; Díaz, Mariana; Rozhon, Wilfried; Poppenberger, Brigitte; Baubec, Tuncay; Pecinka, Ales

    2015-01-01

    DNA damage repair is an essential cellular mechanism that maintains genome stability. Here, we show that the nonmethylable cytidine analog zebularine induces a DNA damage response in Arabidopsis thaliana, independent of changes in DNA methylation. In contrast to genotoxic agents that induce damage in a cell cycle stage-independent manner, zebularine induces damage specifically during strand synthesis in DNA replication. The signaling of this damage is mediated by additive activity of ATAXIA TELANGIECTASIA MUTATED AND RAD3-RELATED and ATAXIA TELANGIECTASIA MUTATED kinases, which cause postreplicative cell cycle arrest and increased endoreplication. The repair requires a functional STRUCTURAL MAINTENANCE OF CHROMOSOMES5 (SMC5)-SMC6 complex and is accomplished predominantly by synthesis-dependent strand-annealing homologous recombination. Here, we provide insight into the response mechanism for coping with the genotoxic effects of zebularine and identify several components of the zebularine-induced DNA damage repair pathway. PMID:26023162

  17. Cdt1 and Cdc6 Are Destabilized by Rereplication-induced DNA Damage*S⃞

    PubMed Central

    Hall, Jonathan R.; Lee, Hyun O.; Bunker, Brandon D.; Dorn, Elizabeth S.; Rogers, Greg C.; Duronio, Robert J.; Cook, Jeanette Gowen

    2008-01-01

    The replication factors Cdt1 and Cdc6 are essential for origin licensing, a prerequisite for DNA replication initiation. Mechanisms to ensure that metazoan origins initiate once per cell cycle include degradation of Cdt1 during S phase and inhibition of Cdt1 by the geminin protein. Geminin depletion or overexpression of Cdt1 or Cdc6 in human cells causes rereplication, a form of endogenous DNA damage. Rereplication induced by these manipulations is however uneven and incomplete, suggesting that one or more mechanisms restrain rereplication once it begins. We find that both Cdt1 and Cdc6 are degraded in geminin-depleted cells. We further show that Cdt1 degradation in cells that have rereplicated requires the PCNA binding site of Cdt1 and the Cul4DDB1 ubiquitin ligase, and Cdt1 can induce its own degradation when overproduced. Cdc6 degradation in geminin-depleted cells requires Huwe1, the ubiquitin ligase that regulates Cdc6 after DNA damage. Moreover, perturbations that specifically disrupt Cdt1 and Cdc6 degradation in response to DNA damage exacerbate rereplication when combined with geminin depletion, and this enhanced rereplication occurs in both human cells and in Drosophila melanogaster cells. We conclude that rereplication-associated DNA damage triggers Cdt1 and Cdc6 ubiquitination and destruction, and propose that this pathway represents an evolutionarily conserved mechanism that minimizes the extent of rereplication. PMID:18617514

  18. Facilitation of DNA damage-induced apoptosis by endoplasmic reticulum protein mitsugumin23

    SciTech Connect

    Yamazaki, Tetsuo; Sasaki, Nozomi; Nishi, Miyuki; Takeshima, Hiroshi

    2010-02-05

    The endoplasmic reticulum (ER) emanates context-dependent signals, thereby mediating cellular response to a variety of stresses. However, the underlying molecular mechanisms have been enigmatic. To better understand the signaling capacity of the ER, we focused on roles played by mitsugumin23 (MG23), a protein residing predominantly in this organelle. Overexpression of MG23 in human embryonic kidney 293T cells specifically enhanced apoptosis triggered by etoposide, a DNA-damaging anti-cancer drug. Conversely, genetic deletion of MG23 reduced susceptibility of thymocytes to DNA damage-induced apoptosis, which was demonstrated by whole-body irradiation experiments. In this setting, induction of the tumor-suppressor gene p53 was attenuated in MG23-knockout thymocytes as compared with their wild-type counterparts, consistent with the elevated radioresistance. It is therefore suggested that MG23 is an essential component of ER-generated lethal signals provoked upon DNA damage, specifying cell fate under pathophysiological conditions.

  19. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  20. TGF-{beta}{sub 1}-induced cardiac myofibroblasts are nonproliferating functional cells carrying DNA damages

    SciTech Connect

    Petrov, Victor V. Pelt, Jos F. van; Vermeesch, Joris R.; Van Duppen, Viktor J.; Vekemans, Katrien; Fagard, Robert H.; Lijnen, Paul J.

    2008-04-15

    TGF-{beta}{sub 1} induces differentiation and total inhibition of cardiac MyoFb cell division and DNA synthesis. These effects of TGF-{beta}{sub 1} are irreversible. Inhibition of MyoFb proliferation is accompanied with the expression of Smad1, Mad1, p15Ink4B and total inhibition of telomerase activity. Surprisingly, TGF-{beta}{sub 1}-activated MyoFbs are growth-arrested not only at G1-phase but also at S-phase of the cell cycle. Staining with TUNEL indicates that these cells carry DNA damages. However, the absolute majority of MyoFbs are non-apoptotic cells as established with two apoptosis-specific methods, flow cytometry and caspase-dependent cleavage of cytokeratin 18. Expression in MyoFbs of proliferative cell nuclear antigen even in the absence of serum confirms that these MyoFbs perform repair of DNA damages. These results suggest that TGF-{beta}{sub 1}-activated MyoFbs can be growth-arrested by two checkpoints, the G1/S checkpoint, which prevents cells from entering S-phase and the intra-S checkpoint, which is activated by encountering DNA damage during the S phase or by unrepaired damage that escapes the G1/S checkpoint. Despite carrying of the DNA damages TGF-{beta}{sub 1}-activated MyoFbs are highly functional cells producing lysyl oxidase and contracting the collagen matrix.

  1. Conformational Change of Human Checkpoint Kinase 1 (Chk1) Induced by DNA Damage.

    PubMed

    Han, Xiangzi; Tang, Jinshan; Wang, Jingna; Ren, Feng; Zheng, Jinhua; Gragg, Megan; Kiser, Philip; Park, Paul S H; Palczewski, Krzysztof; Yao, Xinsheng; Zhang, Youwei

    2016-06-17

    Phosphorylation of Chk1 by ataxia telangiectasia-mutated and Rad3-related (ATR) is critical for checkpoint activation upon DNA damage. However, how phosphorylation activates Chk1 remains unclear. Many studies suggest a conformational change model of Chk1 activation in which phosphorylation shifts Chk1 from a closed inactive conformation to an open active conformation during the DNA damage response. However, no structural study has been reported to support this Chk1 activation model. Here we used FRET and bimolecular fluorescence complementary techniques to show that Chk1 indeed maintains a closed conformation in the absence of DNA damage through an intramolecular interaction between a region (residues 31-87) at the N-terminal kinase domain and the distal C terminus. A highly conserved Leu-449 at the C terminus is important for this intramolecular interaction. We further showed that abolishing the intramolecular interaction by a Leu-449 to Arg mutation or inducing ATR-dependent Chk1 phosphorylation by DNA damage disrupts the closed conformation, leading to an open and activated conformation of Chk1. These data provide significant insight into the mechanisms of Chk1 activation during the DNA damage response. PMID:27129240

  2. DNA damage and oxidative stress induced by acetylsalicylic acid in Daphnia magna.

    PubMed

    Gómez-Oliván, Leobardo Manuel; Galar-Martínez, Marcela; Islas-Flores, Hariz; García-Medina, Sandra; SanJuan-Reyes, Nely

    2014-08-01

    Acetylsalicylic acid is a nonsteroidal anti-inflammatory widely used due to its low cost and high effectiveness. This compound has been found in water bodies worldwide and is toxic to aquatic organisms; nevertheless its capacity to induce oxidative stress in bioindicators like Daphnia magna remains unknown. This study aimed to evaluate toxicity in D. magna induced by acetylsalicylic acid in water, using oxidative stress and DNA damage biomarkers. An acute toxicity test was conducted in order to determine the median lethal concentration (48-h LC50) and the concentrations to be used in the subsequent subacute toxicity test in which the following biomarkers were evaluated: lipid peroxidation, oxidized protein content, activity of the antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase, and level of DNA damage. Lipid peroxidation level and oxidized protein content were significantly increased (p<0.05), and antioxidant enzymes significantly altered with respect to controls; while the DNA damage were significantly increased (p<0.05) too. In conclusion, acetylsalicylic acid induces oxidative stress and DNA damage in D. magna. PMID:24747829

  3. Heavy ion induced damage to plasmid DNA: plateau region vs. spread out Bragg-peak

    NASA Astrophysics Data System (ADS)

    Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlathölter, T.

    2011-08-01

    We have investigated the damage of synthetic plasmid pBR322 DNA in dilute aqueous solutions induced by fast carbon ions. The relative contribution of indirect damage and direct damage to the DNA itself is expected to vary with linear energy transfer along the ion track, with the direct damage contribution increasing towards the Bragg peak. Therefore, 12C ions at the spread-out Bragg peak (dose averaged LET∞ = 189 ± 15 keV/ μm) and in the plateau region of the Bragg curve (LET = 40 keV/ μm) were employed and the radical scavenger concentration in the plasmid solution was varied to quantify the indirect effect. In order to minimize the influence of 12C break-up fragments, a relatively low initial energy of 90 MeV/nucleon was employed for the carbon ions. DNA damage has been quantified by subsequent electrophoresis on agarose gels. We find that strand breaks due to both indirect and direct effects are systematically higher in the plateau region as compared to the Bragg peak region with the difference being smallest at high scavenging capacities. In view of the fact that the relative biological effectiveness for many biological endpoints is maximum at the Bragg peak our findings imply that DNA damage at the Bragg peak is qualitatively most severe.

  4. Involvement of DNA polymerase beta in repairing oxidative damages induced by antitumor drug adriamycin

    SciTech Connect

    Liu Shukun; Wu Mei; Zhang Zunzhen

    2010-08-01

    Adriamycin (ADM) is a widely used antineoplastic drug. However, the increasing cellular resistance has become a serious limitation to ADM clinical application. The most important mechanism related to ADM-induced cell death is oxidative DNA damage mediated by reactive oxygen species (ROS). Base excision repair (BER) is a major pathway in the repair of DNA single strand break (SSB) and oxidized base. In this study, we firstly applied the murine embryo fibroblasts wild-type (pol {beta} +/+) and homozygous pol {beta} null cell (pol {beta} -/-) as a model to investigate ADM DNA-damaging effects and the molecular basis underlying these effects. Here, cellular sensitivity to ADM was examined using colorimetric assay and colony forming assay. ADM-induced cellular ROS level and the alteration of superoxide dismutase (SOD) activity were measured by commercial kits. Further, DNA strand break, chromosomal damage and gene mutation were assessed by comet assay, micronucleus test and hprt gene mutation assay, respectively. The results showed that pol {beta} -/- cells were more sensitive to ADM compared with pol {beta} +/+ cells and more severe SSB and chromosomal damage as well as higher hprt gene mutation frequency were observed in pol {beta} -/- cells. ROS level in pol {beta} -/- cells increased along with decreased activity of SOD. These results demonstrated that pol {beta} deficiency could enable ROS accumulation with SOD activity decrease, further elevate oxidative DNA damage, and subsequently result in SSB, chromosome cleavage as well as gene mutation, which may be partly responsible for the cytotoxicity of ADM and the hypersensitivity of pol {beta} -/- cells to ADM. These findings suggested that pol {beta} is vital for repairing oxidative damage induced by ADM.

  5. Oxidative DNA damage induced by benz[a]anthracene dihydrodiols in the presence of dihydrodiol dehydrogenase.

    PubMed

    Seike, Kazuharu; Murata, Mariko; Hirakawa, Kazutaka; Deyashiki, Yoshihiro; Kawanishi, Shosuke

    2004-11-01

    Tobacco smoke and polluted air are risk factors for lung cancer and contain many kinds of polycyclic aromatic hydrocarbons (PAHs) including benzo[a]pyrene (B[a]P) and benz[a]anthracene (BA). BA, as well as B[a]P, is assessed as probably carcinogenic to humans (IARC group 2A). BA is metabolized to several dihydrodiols. Dihydrodiol dehydrogenase (DD), a member of the aldo-keto reductase superfamily, catalyzes NAD(P)+-linked oxidation of dihydrodiols of aromatic hydrocarbons to corresponding catechols. To clarify the role of DD on PAH carcinogenesis, we examined oxidative DNA damage induced by trans-dihydrodiols of BA and B[a]P treated with DD using 32P-5'-end-labeled DNA fragments obtained from the human p53 tumor suppressor gene. In addition, we investigated the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), an indicator of oxidative DNA damage, in calf thymus DNA by using HPLC with an electrochemical detector. DD-catalyzed BA-1,2-dihydrodiol caused Cu(II)-mediated DNA damage including 8-oxodG formation in the presence of NAD+. BA-1,2-dihydrodiol induced a Fpg sensitive and piperidine labile G lesion at the 5'-ACG-3' sequence complementary to codon 273 of the human p53 tumor suppressor gene, which is known as a hotspot. DNA damage was inhibited by catalase and bathocuproine, suggesting the involvement of H2O2 and Cu(I). The observation of NADH production by UV-visible spectroscopy suggested that DD catalyzed BA-1,2-dihydrodiol most efficiently to the corresponding catechol among the PAH-dihydrodiols tested. A time-of-flight mass spectroscopic study showed that the catechol form of BA-1,2-dihydrodiol formed after DD treatment. In conclusion, BA-1,2-dihydrodiol can induce DNA damage more efficiently than B[a]P-7,8-dihydrodiol and other BA-dihydrodiols in the presence of DD. The reaction mechanism on oxidative DNA damage may be explained by theoretical calculations with an enthalpy change of dihydrodiols and oxidation potential of their catechol forms. DD

  6. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    SciTech Connect

    Han, Xu; Ptasinska, Sylwia; Klas, Matej; Liu, Yueying; Sharon Stack, M.

    2013-06-10

    The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

  7. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    NASA Astrophysics Data System (ADS)

    Han, Xu; Klas, Matej; Liu, Yueying; Sharon Stack, M.; Ptasinska, Sylwia

    2013-06-01

    The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

  8. Mitochondria regulate DNA damage and genomic instability induced by high LET radiation

    NASA Astrophysics Data System (ADS)

    Zhang, Bo; Davidson, Mercy M.; Hei, Tom K.

    2014-04-01

    High linear energy transfer (LET) radiation including α particles and heavy ions is the major type of radiation found in space and is considered a potential health risk for astronauts. Even though the chance that these high LET particles traversing through the cytoplasm of cells is higher than that through the nuclei, the contribution of targeted cytoplasmic irradiation to the induction of genomic instability and other chromosomal damages induced by high LET radiation is not known. In the present study, we investigated whether mitochondria are the potential cytoplasmic target of high LET radiation in mediating cellular damage using a mitochondrial DNA (mtDNA) depleted (ρ0) human small airway epithelial (SAE) cell model and a precision charged particle microbeam with a beam width of merely one micron. Targeted cytoplasmic irradiation by high LET α particles induced DNA oxidative damage and double strand breaks in wild type ρ+ SAE cells. Furthermore, there was a significant increase in autophagy and micronuclei, which is an indication of genomic instability, together with the activation of nuclear factor kappa-B (NF-κB) and mitochondrial inducible nitric oxide synthase (iNOS) signaling pathways in ρ+ SAE cells. In contrast, ρ0 SAE cells exhibited a significantly lower response to these same endpoints examined after cytoplasmic irradiation with high LET α particles. The results indicate that mitochondria are essential in mediating cytoplasmic radiation induced genotoxic damage in mammalian cells. Furthermore, the findings may shed some light in the design of countermeasures for space radiation.

  9. Mitochondria regulate DNA damage and genomic instability induced by high LET radiation

    PubMed Central

    Zhang, Bo; Davidson, Mercy M.; Hei, Tom K.

    2014-01-01

    High linear energy transfer (LET) radiation including α particles and heavy ions is the major type of radiation find in space and is considered a potential health risk for astronauts. Even though the chance that these high LET particles traversing through the cytoplasm of cells is higher than that through the nuclei, the contribution of targeted cytoplasmic irradiation, to the induction of genomic instability and other chromosomal damages induced by high LET radiation is not known. In the present study, we investigated whether mitochondria are the potential cytoplasmic target of high LET radiation in mediating cellular damage using a mitochondrial DNA (mtDNA) depleted (ρ0) human small airway epithelial (SAE) cell model and a precision charged particle microbeam with a beam width of merely one micron. Targeted cytoplasmic irradiation by high LET α particles induced DNA oxidative damage and double strand breaks in wild type ρ+ SAE cells. Furthermore, there was a significant increase in autophagy, micronuclei, which is an indication of genomic instability, together with the activation of nuclear factor kappa-B (NF-κB) and mitochondrial inducible nitric oxide synthase (iNOS) signaling pathways in ρ+ SAE cells. In contrast, ρ0 SAE cells exhibited a significantly lower response to these same endpoints examined after cytoplasmic irradiation with high LET α particles. The results indicate that mitochondria are essential in mediating cytoplasmic radiation induced genotoxic damage in mammalian cells. Furthermore, the findings may shed some light in the design of countermeasures for space radiation. PMID:25072018

  10. Protection of cisplatin-induced spermatotoxicity, DNA damage and chromatin abnormality by selenium nano-particles

    SciTech Connect

    Rezvanfar, Mohammad Amin; Rezvanfar, Mohammad Ali; Shahverdi, Ahmad Reza; Ahmadi, Abbas; Baeeri, Maryam; Mohammadirad, Azadeh; Abdollahi, Mohammad

    2013-02-01

    Cisplatin (CIS), an anticancer alkylating agent, induces DNA adducts and effectively cross links the DNA strands and so affects spermatozoa as a male reproductive toxicant. The present study investigated the cellular/biochemical mechanisms underlying possible protective effect of selenium nano-particles (Nano-Se) as an established strong antioxidant with more bioavailability and less toxicity, on reproductive toxicity of CIS by assessment of sperm characteristics, sperm DNA integrity, chromatin quality and spermatogenic disorders. To determine the role of oxidative stress (OS) in the pathogenesis of CIS gonadotoxicity, the level of lipid peroxidation (LPO), antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and peroxynitrite (ONOO) as a marker of nitrosative stress (NS) and testosterone (T) concentration as a biomarker of testicular function were measured in the blood and testes. Thirty-two male Wistar rats were equally divided into four groups. A single IP dose of CIS (7 mg/kg) and protective dose of Nano-Se (2 mg/kg/day) were administered alone or in combination. The CIS-exposed rats showed a significant increase in testicular and serum LPO and ONOO level, along with a significant decrease in enzymatic antioxidants levels, diminished serum T concentration and abnormal histologic findings with impaired sperm quality associated with increased DNA damage and decreased chromatin quality. Coadministration of Nano-Se significantly improved the serum T, sperm quality, and spermatogenesis and reduced CIS-induced free radical toxic stress and spermatic DNA damage. In conclusion, the current study demonstrated that Nano-Se may be useful to prevent CIS-induced gonadotoxicity through its antioxidant potential. Highlights: ► Cisplatin (CIS) affects spermatozoa as a male reproductive toxicant. ► Effect of Nano-Se on CIS-induced spermatotoxicity was investigated. ► CIS-exposure induces oxidative sperm DNA damage

  11. Clustered DNA damages induced by high and low LET radiation, including heavy ions

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Schenk, H.; Sidorkina, O.; Laval, J.; Trunk, J.; Monteleone, D.; Sutherland, J.; Lowenstein, D. I. (Principal Investigator)

    2001-01-01

    Clustered DNA damages--here defined as two or more lesions (strand breaks, oxidized purines, oxidized pyrimidines or abasic sites) within a few helical turns--have been postulated as difficult to repair accurately, and thus highly significant biological lesions. Further, attempted repair of clusters may produce double strand breaks (DSBs). However, until recently, there was no way to measure ionizing radiation-induced clustered damages, except DSB. We recently described an approach for measuring classes of clustered damages (oxidized purine clusters, oxidized pyrimidine clusters, abasic clusters, along with DSB). We showed that ionizing radiation (gamma rays and Fe ions, 1 GeV/amu) does induce such clusters in genomic DNA in solution and in human cells. These studies also showed that each damage cluster results from one radiation hit (and its track), thus indicating that they can be induced by very low doses of radiation, i.e. two independent hits are not required for cluster induction. Further, among all complex damages, double strand breaks comprise--at most-- 20%, with the other clustered damages being at least 80%.

  12. MCPIP is induced by cholesterol and participated in cholesterol-caused DNA damage in HUVEC

    PubMed Central

    Da, Jingjing; Zhuo, Ming; Qian, Minzhang

    2015-01-01

    Hypercholesterolemia is an important risk factor for atherosclerosis and cholesterol treatment would cause multiple damages, including DNA damage, on endothelial cells. In this work, we have used human umbilical vein endothelial cell line (HUVEC) to explore the mechanism of cholesterol induced damage. We have found that cholesterol treatment on HUVEC could induce the expression of MCPIP1. When given 12.5 mg/L cholesterol on HUVEC, the expression of MCPIP1 starts to increase since 4 hr after treatment and at 24 hr after treatment it could reach to 10 fold of base line level. We hypothesis this induction of MCPIP1 may contribute to the damaging process and we have used siRNA of MCPIP1 in further research. This MCPIP1 siRNA (siMCPIP) could down regulate MCPIP1 by 73.4% and when using this siRNA on HUVECs, we could see the cholesterol induced DNA damage have been reduced. We have detected DNA damage by γH2AX foci formation in nuclear, γH2AX protein level and COMET assay. Compare to cholesterol alone group, siMCPIP group shows much less γH2AX foci formation in nuclear after cholesterol treatment, less γH2AX protein level in cell and also less tail moment detected in COMET assay. We have also seen that using siMCPIP1 could result in less reactive oxygen species (ROS) in cell after cholesterol treatment. We have also seen that using siMCPIP could reduce the protein level of Nox4 and p47phox, two major regulators in ROS production. These results suggest that MCPIP1 may play an important role in cholesterol induced damage. PMID:26617772

  13. Nitroglycerin induces DNA damage and vascular cell death in the setting of nitrate tolerance.

    PubMed

    Mikhed, Yuliya; Fahrer, Jörg; Oelze, Matthias; Kröller-Schön, Swenja; Steven, Sebastian; Welschof, Philipp; Zinßius, Elena; Stamm, Paul; Kashani, Fatemeh; Roohani, Siyer; Kress, Joana Melanie; Ullmann, Elisabeth; Tran, Lan P; Schulz, Eberhard; Epe, Bernd; Kaina, Bernd; Münzel, Thomas; Daiber, Andreas

    2016-07-01

    Nitroglycerin (GTN) and other organic nitrates are widely used vasodilators. Their side effects are development of nitrate tolerance and endothelial dysfunction. Given the potential of GTN to induce nitro-oxidative stress, we investigated the interaction between nitro-oxidative DNA damage and vascular dysfunction in experimental nitrate tolerance. Cultured endothelial hybridoma cells (EA.hy 926) and Wistar rats were treated with GTN (ex vivo: 10-1000 µM; in vivo: 10, 20 and 50 mg/kg/day for 3 days, s.c.). The level of DNA strand breaks, 8-oxoguanine and O (6)-methylguanine DNA adducts was determined by Comet assay, dot blot and immunohistochemistry. Vascular function was determined by isometric tension recording. DNA adducts and strand breaks were induced by GTN in cells in vitro in a concentration-dependent manner. GTN in vivo administration leads to endothelial dysfunction, nitrate tolerance, aortic and cardiac oxidative stress, formation of DNA adducts, stabilization of p53 and apoptotic death of vascular cells in a dose-dependent fashion. Mice lacking O (6)-methylguanine-DNA methyltransferase displayed more vascular O (6)-methylguanine adducts and oxidative stress under GTN therapy than wild-type mice. Although we were not able to prove a causal role of DNA damage in the etiology of nitrate tolerance, the finding of GTN-induced DNA damage such as the mutagenic and toxic adduct O (6)-methylguanine, and cell death supports the notion that GTN based therapy may provoke adverse side effects, including endothelial function. Further studies are warranted to clarify whether GTN pro-apoptotic effects are related to an impaired recovery of patients upon myocardial infarction. PMID:27357950

  14. Low energy electron induced damage to plasmid DNA pQE30

    NASA Astrophysics Data System (ADS)

    Kumar, S. V. K.; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D.; Rao, Basuthkar J.

    2012-07-01

    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and ˜18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  15. Low energy electron induced damage to plasmid DNA pQE30

    SciTech Connect

    Kumar, S. V. K.; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D.; Rao, Basuthkar J.

    2012-07-28

    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and {approx}18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  16. Molecular Regulation of DNA Damage-Induced Apoptosis in Neurons of Cerebral Cortex

    PubMed Central

    Liu, Zhiping; Pipino, Jacqueline; Chestnut, Barry; Landek, Melissa A.

    2009-01-01

    Cerebral cortical neuron degeneration occurs in brain disorders manifesting throughout life, but the mechanisms are understood poorly. We used cultured embryonic mouse cortical neurons and an in vivo mouse model to study mechanisms of DNA damaged-induced apoptosis in immature and differentiated neurons. p53 drives apoptosis of immature and differentiated cortical neurons through its rapid and prominent activation stimulated by DNA strand breaks induced by topoisomerase-I and -II inhibition. Blocking p53-DNA transactivation with α-pifithrin protects immature neurons; blocking p53-mitochondrial functions with μ-pifithrin protects differentiated neurons. Mitochondrial death proteins are upregulated in apoptotic immature and differentiated neurons and have nonredundant proapoptotic functions; Bak is more dominant than Bax in differentiated neurons. p53 phosphorylation is mediated by ataxia telangiectasia mutated (ATM) kinase. ATM inactivation is antiapoptotic, particularly in differentiated neurons, whereas inhibition of c-Abl protects immature neurons but not differentiated neurons. Cell death protein expression patterns in mouse forebrain are mostly similar to cultured neurons. DNA damage induces prominent p53 activation and apoptosis in cerebral cortex in vivo. Thus, DNA strand breaks in cortical neurons induce rapid p53-mediated apoptosis through actions of upstream ATM and c-Abl kinases and downstream mitochondrial death proteins. This molecular network operates through variations depending on neuron maturity. PMID:18820287

  17. Rescue of Hippo coactivator YAP1 triggers DNA damage-induced apoptosis in hematological cancers.

    PubMed

    Cottini, Francesca; Hideshima, Teru; Xu, Chunxiao; Sattler, Martin; Dori, Martina; Agnelli, Luca; ten Hacken, Elisa; Bertilaccio, Maria Teresa; Antonini, Elena; Neri, Antonino; Ponzoni, Maurilio; Marcatti, Magda; Richardson, Paul G; Carrasco, Ruben; Kimmelman, Alec C; Wong, Kwok-Kin; Caligaris-Cappio, Federico; Blandino, Giovanni; Kuehl, W Michael; Anderson, Kenneth C; Tonon, Giovanni

    2014-06-01

    Oncogene-induced DNA damage elicits genomic instability in epithelial cancer cells, but apoptosis is blocked through inactivation of the tumor suppressor p53. In hematological cancers, the relevance of ongoing DNA damage and the mechanisms by which apoptosis is suppressed are largely unknown. We found pervasive DNA damage in hematologic malignancies, including multiple myeloma, lymphoma and leukemia, which leads to activation of a p53-independent, proapoptotic network centered on nuclear relocalization of ABL1 kinase. Although nuclear ABL1 triggers cell death through its interaction with the Hippo pathway coactivator YAP1 in normal cells, we show that low YAP1 levels prevent nuclear ABL1-induced apoptosis in these hematologic malignancies. YAP1 is under the control of a serine-threonine kinase, STK4. Notably, genetic inactivation of STK4 restores YAP1 levels, triggering cell death in vitro and in vivo. Our data therefore identify a new synthetic-lethal strategy to selectively target cancer cells presenting with endogenous DNA damage and low YAP1 levels. PMID:24813251

  18. Leukotriene C4 is the major trigger of stress-induced oxidative DNA damage

    PubMed Central

    Dvash, Efrat; Har-Tal, Michal; Barak, Sara; Meir, Ofir; Rubinstein, Menachem

    2015-01-01

    Endoplasmic reticulum (ER) stress and major chemotherapeutic agents damage DNA by generating reactive oxygen species (ROS). Here we show that ER stress and chemotherapy induce leukotriene C4 (LTC4) biosynthesis by transcriptionally upregulating and activating the enzyme microsomal glutathione-S-transferase 2 (MGST2) in cells of non-haematopoietic lineage. ER stress and chemotherapy also trigger nuclear translocation of the two LTC4 receptors. Acting in an intracrine manner, LTC4 then elicits nuclear translocation of NADPH oxidase 4 (NOX4), ROS accumulation and oxidative DNA damage. Mgst2 deficiency, RNAi and LTC4 receptor antagonists abolish ER stress- and chemotherapy-induced ROS and oxidative DNA damage in vitro and in mouse kidneys. Cell death and mouse morbidity are also significantly attenuated. Hence, MGST2-generated LTC4 is a major mediator of ER stress- and chemotherapy-triggered oxidative stress and oxidative DNA damage. LTC4 inhibitors, commonly used for asthma, could find broad clinical use in major human pathologies associated with ER stress-activated NOX4. PMID:26656251

  19. Geraniin down regulates gamma radiation-induced apoptosis by suppressing DNA damage.

    PubMed

    Bing, So Jin; Ha, Danbee; Kim, Min Ju; Park, Eunjin; Ahn, Ginnae; Kim, Dae Seung; Ko, Ryeo Kyeong; Park, Jae Woo; Lee, Nam Ho; Jee, Youngheun

    2013-07-01

    Gamma ray irradiation triggers DNA damage and apoptosis of proliferating stem cells and peripheral immune cells, resulting in the destruction of intestinal crypts and lymphoid system. Geraniin is a natural compound extracts from an aquatic plant Nymphaea tetragona and possesses good antioxidant property. In this study, we demonstrate that geraniin rescues radiosensitive splenocytes and jejunal crypt cells from radiation-induced DNA damage and apoptosis. Isolated splenocytes from C57BL/6 mice treated with geraniin were protected against radiation injury of 2 Gy irradiation through the enhancement of the proliferation and attenuation of DNA damage. Also, geraniin inhibited apoptosis in radiosensitive splenocytes by reducing the expression level and immunoreactivity of proapoptotic p53 and Bax and increasing those of anti-apoptotic Bcl-2. In mice exposed to radiation, geraniin treatment protected splenocytes and intestinal crypt cells from radiation-induced cell death. Our results suggest that geraniin presents radioprotective effects by regulating DNA damage on splenocytes, exerting immunostimulatory capacities and inhibiting apoptosis of radiosensitive immune cells and jejunal crypt cells. Therefore, geraniin can be a radioprotective agent against γ-irradiation exposure. PMID:23541438

  20. Imaging of the DNA damage-induced dynamics of nuclear proteins via nonlinear photoperturbation.

    PubMed

    Tomas, Martin; Blumhardt, Philipp; Deutzmann, Anja; Schwarz, Tobias; Kromm, Dimitri; Leitenstorfer, Alfred; Ferrando-May, Elisa

    2013-08-01

    Understanding the cellular response to DNA strand breaks is crucial to decipher the mechanisms maintaining the integrity of our genome. We present a novel method to visualize how the mobility of nuclear proteins changes in response to localized DNA damage. DNA strand breaks are induced via nonlinear excitation with femtosecond laser pulses at λ = 1050 nm in a 3D-confined subnuclear volume. After a time delay of choice, protein mobility within this volume is analysed by two-photon photoactivation of PA-GFP fusion proteins at λ = 775 nm. By changing the position of the photoactivation spot with respect to the zone of lesion the influence of chromatin structure and of the distance from damage are investigated. As first applications we demonstrate a locally confined, time-dependent mobility increase of histone H1.2, and a progressive retardation of the DNA repair factor XRCC1 at damaged sites. This assay can be used to map the response of nuclear proteins to DNA damage in time and space. PMID:23420601

  1. Cadmium Chloride Induces DNA Damage and Apoptosis of Human Liver Carcinoma Cells via Oxidative Stress

    PubMed Central

    Skipper, Anthony; Sims, Jennifer N.; Yedjou, Clement G.; Tchounwou, Paul B.

    2016-01-01

    Cadmium is a heavy metal that has been shown to cause its toxicity in humans and animals. Many documented studies have shown that cadmium produces various genotoxic effects such as DNA damage and chromosomal aberrations. Ailments such as bone disease, renal damage, and several forms of cancer are attributed to overexposure to cadmium.  Although there have been numerous studies examining the effects of cadmium in animal models and a few case studies involving communities where cadmium contamination has occurred, its molecular mechanisms of action are not fully elucidated. In this research, we hypothesized that oxidative stress plays a key role in cadmium chloride-induced toxicity, DNA damage, and apoptosis of human liver carcinoma (HepG2) cells. To test our hypothesis, cell viability was determined by MTT assay. Lipid hydroperoxide content stress was estimated by lipid peroxidation assay. Genotoxic damage was tested by the means of alkaline single cell gel electrophoresis (Comet) assay. Cell apoptosis was measured by flow cytometry assessment (Annexin-V/PI assay). The result of MTT assay indicated that cadmium chloride induces toxicity to HepG2 cells in a concentration-dependent manner, showing a 48 hr-LD50 of 3.6 µg/mL. Data generated from lipid peroxidation assay resulted in a significant (p < 0.05) increase of hydroperoxide production, specifically at the highest concentration tested. Data obtained from the Comet assay indicated that cadmium chloride causes DNA damage in HepG2 cells in a concentration-dependent manner. A strong concentration-response relationship (p < 0.05) was recorded between annexin V positive cells and cadmium chloride exposure. In summary, these in vitro studies provide clear evidence that cadmium chloride induces oxidative stress, DNA damage, and programmed cell death in human liver carcinoma (HepG2) cells. PMID:26729151

  2. A DNA-damage-induced cell cycle checkpoint in Arabidopsis.

    PubMed Central

    Preuss, S B; Britt, A B

    2003-01-01

    Although it is well established that plant seeds treated with high doses of gamma radiation arrest development as seedlings, the cause of this arrest is unknown. The uvh1 mutant of Arabidopsis is defective in a homolog of the human repair endonuclease XPF, and uvh1 mutants are sensitive to both the toxic effects of UV and the cytostatic effects of gamma radiation. Here we find that gamma irradiation of uvh1 plants specifically triggers a G(2)-phase cell cycle arrest. Mutants, termed suppressor of gamma (sog), that suppress this radiation-induced arrest and proceed through the cell cycle unimpeded were recovered in the uvh1 background; the resulting irradiated plants are genetically unstable. The sog mutations fall into two complementation groups. They are second-site suppressors of the uvh1 mutant's sensitivity to gamma radiation but do not affect the susceptibility of the plant to UV radiation. In addition to rendering the plants resistant to the growth inhibitory effects of gamma radiation, the sog1 mutation affects the proper development of the pollen tetrad, suggesting that SOG1 might also play a role in the regulation of cell cycle progression during meiosis. PMID:12750343

  3. Oxidative stress-related DNA damage and homologous recombination repairing induced by N,N-dimethylformamide.

    PubMed

    Wang, Cui; Yang, Jinhuan; Lu, Dezhao; Fan, Yongsheng; Zhao, Meirong; Li, Zhuoyu

    2016-07-01

    The intensified anthropogenic release of N,N-dimethylformamide (DMF) has been proven to have hepatotoxic effects. However, the potential mechanism for DMF-induced toxicity has rarely been investigated. Our research implicated that DMF induced a significantly dose-dependent increase in reactive oxygen species (ROS) in HL-7702 human liver cells. Moreover, oxidative stress-related DNA damage, marked as 8-hydroxy-2'-deoxyguanosine, was increased 1.5-fold at 100 mmol l(-1) . The most severe DNA lesion (double-strand break, DSB), measured as the formation of γH2AX foci, was increased at/above 6.4 mmol l(-1) , and approximately 50% of cells underwent DSB at the peak induction. Subsequently, the DNA repair system triggered by molecules of RAD50 and MRE11A induced the homologous recombination (HR) pathway by upregulation of both gene and protein levels of RAD50, RAD51, XRCC2 and XRCC3 at 16 mmol l(-1) and was attenuated at 40 mmol l(-1) . Consequently, cellular death observed at 40 mmol l(-1) was exaggerated compared with exposure at 16 mmol l(-1) . Although the exact mechanism relying on the DMF-induced hepatotoxicity needs further clarification, oxidative stress and DNA damage involved in DSBs partially explain the reason for DMF-induced liver injury. Oxidative stress-induced DNA damage should be first considered during risk assessment on liver-targeted chemicals. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26387567

  4. Piperlongumine induces pancreatic cancer cell death by enhancing reactive oxygen species and DNA damage

    PubMed Central

    Dhillon, Harsharan; Chikara, Shireen; Reindl, Katie M.

    2014-01-01

    Pancreatic cancer is one of the most deadly cancers with a nearly 95% mortality rate. The poor response of pancreatic cancer to currently available therapies and the extremely low survival rate of pancreatic cancer patients point to a critical need for alternative therapeutic strategies. The use of reactive oxygen species (ROS)-inducing agents has emerged as an innovative and effective strategy to treat various cancers. In this study, we investigated the potential of a known ROS inducer, piperlongumine (PPLGM), a bioactive agent found in long peppers, to induce pancreatic cancer cell death in cell culture and animal models. We found that PPLGM inhibited the growth of pancreatic cancer cell cultures by elevating ROS levels and causing DNA damage. PPLGM-induced DNA damage and pancreatic cancer cell death was reversed by treating the cells with an exogenous antioxidant. Similar to the in vitro studies, PPLGM caused a reduction in tumor growth in a xenograft mouse model of human pancreatic cancer. Tumors from the PPLGM-treated animals showed decreased Ki-67 and increased 8-OHdG expression, suggesting PPLGM inhibited tumor cell proliferation and enhanced oxidative stress. Taken together, our results show that PPLGM is an effective inhibitor for in vitro and in vivo growth of pancreatic cancer cells, and that it works through a ROS-mediated DNA damage pathway. These findings suggest that PPLGM has the potential to be used for treatment of pancreatic cancer. PMID:25530945

  5. The ovarian DNA damage repair response is induced prior to phosphoramide mustard-induced follicle depletion, and ataxia telangiectasia mutated inhibition prevents PM-induced follicle depletion.

    PubMed

    Ganesan, Shanthi; Keating, Aileen F

    2016-02-01

    Phosphoramide mustard (PM) is an ovotoxic metabolite of cyclophosphamide and destroys primordial and primary follicles potentially by DNA damage induction. The temporal pattern by which PM induces DNA damage and initiation of the ovarian response to DNA damage has not yet been well characterized. This study investigated DNA damage initiation, the DNA repair response, as well as induction of follicular demise using a neonatal rat ovarian culture system. Additionally, to delineate specific mechanisms involved in the ovarian response to PM exposure, utility was made of PKC delta (PKCδ) deficient mice as well as an ATM inhibitor (KU 55933; AI). Fisher 344 PND4 rat ovaries were cultured for 12, 24, 48 or 96h in medium containing DMSO ±60μM PM or KU 55933 (48h; 10nM). PM-induced activation of DNA damage repair genes was observed as early as 12h post-exposure. ATM, PARP1, E2F7, P73 and CASP3 abundance were increased but RAD51 and BCL2 protein decreased after 96h of PM exposure. PKCδ deficiency reduced numbers of all follicular stages, but did not have an additive impact on PM-induced ovotoxicity. ATM inhibition protected all follicle stages from PM-induced depletion. In conclusion, the ovarian DNA damage repair response is active post-PM exposure, supporting that DNA damage contributes to PM-induced ovotoxicity. PMID:26708502

  6. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.

    PubMed

    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth

    2012-09-01

    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound. PMID:22828439

  7. Plasma induced DNA damage: Comparison with the effects of ionizing radiation

    SciTech Connect

    Lazović, S.; Maletić, D.; Puač, N.; Malović, G.; Petrović, Z. Lj.; Leskovac, A.; Filipović, J.; Joksić, G.

    2014-09-22

    We use human primary fibroblasts for comparing plasma and gamma rays induced DNA damage. In both cases, DNA strand breaks occur, but of fundamentally different nature. Unlike gamma exposure, contact with plasma predominantly leads to single strand breaks and base-damages, while double strand breaks are mainly consequence of the cell repair mechanisms. Different cell signaling mechanisms are detected confirming this (ataxia telangiectasia mutated - ATM and ataxia telangiectasia and Rad3 related - ATR, respectively). The effective plasma doses can be tuned to match the typical therapeutic doses of 2 Gy. Tailoring the effective dose through plasma power and duration of the treatment enables safety precautions mainly by inducing apoptosis and consequently reduced frequency of micronuclei.

  8. Plasma induced DNA damage: Comparison with the effects of ionizing radiation

    NASA Astrophysics Data System (ADS)

    Lazović, S.; Maletić, D.; Leskovac, A.; Filipović, J.; Puač, N.; Malović, G.; Joksić, G.; Petrović, Z. Lj.

    2014-09-01

    We use human primary fibroblasts for comparing plasma and gamma rays induced DNA damage. In both cases, DNA strand breaks occur, but of fundamentally different nature. Unlike gamma exposure, contact with plasma predominantly leads to single strand breaks and base-damages, while double strand breaks are mainly consequence of the cell repair mechanisms. Different cell signaling mechanisms are detected confirming this (ataxia telangiectasia mutated - ATM and ataxia telangiectasia and Rad3 related - ATR, respectively). The effective plasma doses can be tuned to match the typical therapeutic doses of 2 Gy. Tailoring the effective dose through plasma power and duration of the treatment enables safety precautions mainly by inducing apoptosis and consequently reduced frequency of micronuclei.

  9. Low Dose Iron Treatments Induce a DNA Damage Response in Human Endothelial Cells within Minutes

    PubMed Central

    Mollet, Inês G.; Giess, Adam; Paschalaki, Koralia; Periyasamy, Manikandan; Lidington, Elaine C.; Mason, Justin C.; Jones, Michael D.; Game, Laurence; Ali, Simak; Shovlin, Claire L.

    2016-01-01

    , and induce a DNA damage response. PMID:26866805

  10. A microsuspension adaptation of the Bacillus subtilis ''rec'' assay. [Detection of chemically induced DNA damage

    SciTech Connect

    McCarroll, N.E.; Keech, B.H.; Piper, C.E.

    1981-01-01

    We have demonstrated the utility of an Escherichia coli microsuspension assay to detect and characterize chemical mediation of DNA damage by a wide variety of mutagens and carcinogens. The assay have been improved by the development of a microsuspension modification to the Bacillus subtilis ''rec'' assay. The addition of these gram-positive organisms has allowed detection of DNA damage induced by benzo(a)pyrene (B(a)P), 3-aminopyrene (3-AP), 7, 12-dimethylbenz(a)anthrancene (DMBA), 3-methylcholanthrene (3-MC), and 4-nitrobiphenyl (4-NBP). Data presented in this paper from tests of 61 additional compounds, including a representative number of direct and promutagenic agents, indicate that the B subtilis H17 and M45 strains provide an effective microbial system for identification of DNA damage susceptible to postreplicational repair. The results of this study further suggests that the inclusion of these strains in the microsuspension assay for DNA damage will markedly enhance the detection of agents which cannot readily penetrate the intact cell wall of E coli.

  11. DNA damage-induced translocation of S100A11 into the nucleus regulates cell proliferation

    PubMed Central

    2010-01-01

    Background Proteins are able to react in response to distinct stress stimuli by alteration of their subcellular distribution. The stress-responsive protein S100A11 belongs to the family of multifunctional S100 proteins which have been implicated in several key biological processes. Previously, we have shown that S100A11 is directly involved in DNA repair processes at damaged chromatin in the nucleus. To gain further insight into the underlying mechanism subcellular trafficking of S100A11 in response to DNA damage was analyzed. Results We show that DNA damage induces a nucleolin-mediated translocation of S100A11 from the cytoplasm into the nucleus. This translocation is impeded by inhibition of the phosphorylation activity of PKCα. Translocation of S100A11 into the nucleus correlates with an increased cellular p21 protein level. Depletion of nucleolin by siRNA severely impairs translocation of S100A11 into the nucleus resulting in a decreased p21 protein level. Additionally, cells lacking nucleolin showed a reduced colony forming capacity. Conclusions These observations suggest that regulation of the subcellular distribution of S100A11 plays an important role in the DNA damage response and p21-mediated cell cycle control. PMID:21167017

  12. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells

    PubMed Central

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-01-01

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague–Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  13. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells.

    PubMed

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-01-01

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague-Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  14. Molecular and sensory mechanisms to mitigate sunlight-induced DNA damage in treefrog tadpoles.

    PubMed

    Schuch, André P; Lipinski, Victor M; Santos, Mauricio B; Santos, Caroline P; Jardim, Sinara S; Cechin, Sonia Z; Loreto, Elgion L S

    2015-10-01

    The increased incidence of solar ultraviolet B (UVB) radiation has been proposed as an environmental stressor, which may help to explain the enigmatic decline of amphibian populations worldwide. Despite growing knowledge regarding the UV-induced biological effects in several amphibian models, little is known about the efficacy of DNA repair pathways. In addition, little attention has been given to the interplay between these molecular mechanisms with other physiological strategies that avoid the damage induced by sunlight. Here, DNA lesions induced by environmental doses of solar UVB and UVA radiation were detected in genomic DNA samples of treefrog tadpoles (Hypsiboas pulchellus) and their DNA repair activity was evaluated. These data were complemented by monitoring the induction of apoptosis in blood cells and tadpole survival. Furthermore, the tadpoles' ability to perceive and escape from UV wavelengths was evaluated as an additional strategy of photoprotection. The results show that tadpoles are very sensitive to UVB light, which could be explained by the slow DNA repair rates for both cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6,4) pyrimidone photoproducts (6,4PPs). However, they were resistant to UVA, probably as a result of the activation of photolyases during UVA irradiation. Surprisingly, a sensory mechanism that triggers their escape from UVB and UVA light avoids the generation of DNA damage and helps to maintain the genomic integrity. This work demonstrates the genotoxic impact of both UVB and UVA radiation on tadpoles and emphasizes the importance of the interplay between molecular and sensory mechanisms to minimize the damage caused by sunlight. PMID:26447197

  15. Laser microbeam-induced DNA damage inhibits cell division in fertilized eggs and early embryos.

    PubMed

    Wang, Zhong-Wei; Ma, Xue-Shan; Ma, Jun-Yu; Luo, Yi-Bo; Lin, Fei; Wang, Zhen-Bo; Fan, Heng-Yu; Schatten, Heide; Sun, Qing-Yuan

    2013-10-15

    DNA double-strand breaks are caused by both intracellular physiological processes and environmental stress. In this study, we used laser microbeam cut (abbreviated microcut or cut), which allows specific DNA damage in the pronucleus of a fertilized egg and in individual blastomere(s) of an early embryo, to investigate the response of early embryos to DNA double-strand breaks. Line type γH2AX foci were detected in the cut region, while Chk2 phosphorylation staining was observed in the whole nuclear region of the cut pronuclei or blastomeres. Zygotes with cut male or female pronucleus showed poor developmental capability: the percentage of cleavage embryos was significantly decreased, and the embryos failed to complete further development to blastocysts. The cut blastomeres in 2-cell, 4-cell, and 8-cell embryos ceased cleavage, and they failed to incorporate into compacted morulae, but instead underwent apoptosis and cell death at the blastocyst stage; the uncut part of embryos could develop to blastocysts, with a reduced percentage or decreased cell number. When both blastomeres of the 2-cell embryos were cut by laser microbeam, cell death occurred 24 h earlier, suggesting important functions of the uncut blastomere in delaying cell death of the cut blastomere. Taken together, we conclude that microbeam-induced DNA damage in early embryos causes compromised development, and that embryos may have their own mechanisms to exclude DNA-damaged blastomeres from participating in further development. PMID:24036543

  16. Experimental setup and first measurement of DNA damage induced along and around an antiproton beam

    NASA Astrophysics Data System (ADS)

    Kavanagh, J. N.; Currell, F. J.; Timson, D. J.; Holzscheiter, M. H.; Bassler, N.; Herrmann, R.; Prise, K. M.; Schettino, G.

    2010-10-01

    Radiotherapy employs ionizing radiation to induce lethal DNA lesions in cancer cells while minimizing damage to healthy tissues. Due to their pattern of energy deposition, better therapeutic outcomes can, in theory, be achieved with ions compared to photons. Antiprotons have been proposed to offer a further enhancement due to their annihilation at the end of the path. The work presented here aimed to establish and validate an experimental procedure for the quantification of plasmid and genomic DNA damage resulting from antiproton exposure. Immunocytochemistry was used to assess DNA damage in directly and indirectly exposed human fibroblasts irradiated in both plateau and Bragg peak regions of a 126 MeV antiproton beam at CERN. Cells were stained post irradiation with an anti- γ-H2AX antibody. Quantification of the γ-H2AX foci-dose relationship is consistent with a linear increase in the Bragg peak region. A qualitative analysis of the foci detected in the Bragg peak and plateau region indicates significant differences highlighting the different severity of DNA lesions produced along the particle path. Irradiation of desalted plasmid DNA with 5 Gy antiprotons at the Bragg peak resulted in a significant portion of linear plasmid in the resultant solution.

  17. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].

    PubMed

    2013-01-01

    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells. PMID:25507621

  18. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].

    PubMed

    Smetanina, N M; Pustovalova, M V; Osipov, A N

    2013-01-01

    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells. PMID:25427371

  19. Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis.

    PubMed

    Wang, Kaile; Ma, Xiaolu; Zhang, Xue; Wu, Dafei; Sun, Chenyi; Sun, Yazhou; Lu, Xuemei; Wu, Chung-I; Guo, Caixia; Ruan, Jue

    2016-01-01

    Next generation sequencing (NGS) technologies have dramatically improved studies in biology and biomedical science. However, no optimal NGS approach is available to conveniently analyze low frequency mutations caused by DNA damage treatments. Here, by developing an exquisite ultra-sensitive NGS (USNGS) platform "EasyMF" and incorporating it with a widely used supF shuttle vector-based mutagenesis system, we can conveniently dissect roles of lesion bypass polymerases in damage-induced mutagenesis. In this improved mutagenesis analysis pipeline, the initial steps are the same as in the supF mutation assay, involving damaging the pSP189 plasmid followed by its transfection into human 293T cells to allow replication to occur. Then "EasyMF" is employed to replace downstream MBM7070 bacterial transformation and other steps for analyzing damage-induced mutation frequencies and spectra. This pipeline was validated by using UV damaged plasmid after its replication in lesion bypass polymerase-deficient 293T cells. The increased throughput and reduced cost of this system will allow us to conveniently screen regulators of translesion DNA synthesis pathway and monitor environmental genotoxic substances, which can ultimately provide insight into the mechanisms of genome stability and mutagenesis. PMID:27122023

  20. Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis

    PubMed Central

    Wang, Kaile; Ma, Xiaolu; Zhang, Xue; Wu, Dafei; Sun, Chenyi; Sun, Yazhou; Lu, Xuemei; Wu, Chung-I; Guo, Caixia; Ruan, Jue

    2016-01-01

    Next generation sequencing (NGS) technologies have dramatically improved studies in biology and biomedical science. However, no optimal NGS approach is available to conveniently analyze low frequency mutations caused by DNA damage treatments. Here, by developing an exquisite ultra-sensitive NGS (USNGS) platform “EasyMF” and incorporating it with a widely used supF shuttle vector-based mutagenesis system, we can conveniently dissect roles of lesion bypass polymerases in damage-induced mutagenesis. In this improved mutagenesis analysis pipeline, the initial steps are the same as in the supF mutation assay, involving damaging the pSP189 plasmid followed by its transfection into human 293T cells to allow replication to occur. Then “EasyMF” is employed to replace downstream MBM7070 bacterial transformation and other steps for analyzing damage-induced mutation frequencies and spectra. This pipeline was validated by using UV damaged plasmid after its replication in lesion bypass polymerase-deficient 293T cells. The increased throughput and reduced cost of this system will allow us to conveniently screen regulators of translesion DNA synthesis pathway and monitor environmental genotoxic substances, which can ultimately provide insight into the mechanisms of genome stability and mutagenesis. PMID:27122023

  1. Study of terahertz-radiation-induced DNA damage in human blood leukocytes

    NASA Astrophysics Data System (ADS)

    Angeluts, A. A.; Gapeyev, A. B.; Esaulkov, M. N.; Kosareva, O. G.; Matyunin, S. N.; Nazarov, M. M.; Pashovkin, T. N.; Solyankin, P. M.; Cherkasova, O. P.; Shkurinov, A. P.

    2014-03-01

    We have carried out the studies aimed at assessing the effect of terahertz radiation on DNA molecules in human blood leukocytes. Genotoxic testing of terahertz radiation was performed in three different oscillation regimes, the blood leukocytes from healthy donors being irradiated for 20 minutes with the mean intensity of 8 - 200 μW cm-2 within the frequency range of 0.1 - 6.5 THz. Using the comet assay it is shown that in the selected regimes such radiation does not induce a direct DNA damage in viable human blood leukocytes.

  2. Study of terahertz-radiation-induced DNA damage in human blood leukocytes

    SciTech Connect

    Angeluts, A A; Esaulkov, M N; Kosareva, O G; Solyankin, P M; Shkurinov, A P; Gapeyev, A B; Pashovkin, T N; Matyunin, S N; Nazarov, M M; Cherkasova, O P

    2014-03-28

    We have carried out the studies aimed at assessing the effect of terahertz radiation on DNA molecules in human blood leukocytes. Genotoxic testing of terahertz radiation was performed in three different oscillation regimes, the blood leukocytes from healthy donors being irradiated for 20 minutes with the mean intensity of 8 – 200 μW cm{sup -2} within the frequency range of 0.1 – 6.5 THz. Using the comet assay it is shown that in the selected regimes such radiation does not induce a direct DNA damage in viable human blood leukocytes. (biophotonics)

  3. Pro-oxidant Induced DNA Damage in Human Lymphoblastoid Cells: Homeostatic Mechanisms of Genotoxic Tolerance

    PubMed Central

    Seager, Anna L.

    2012-01-01

    Oxidative stress contributes to many disease etiologies including ageing, neurodegeneration, and cancer, partly through DNA damage induction (genotoxicity). Understanding the i nteractions of free radicals with DNA is fundamental to discern mutation risks. In genetic toxicology, regulatory authorities consider that most genotoxins exhibit a linear relationship between dose and mutagenic response. Yet, homeostatic mechanisms, including DNA repair, that allow cells to tolerate low levels of genotoxic exposure exist. Acceptance of thresholds for genotoxicity has widespread consequences in terms of understanding cancer risk and regulating human exposure to chemicals/drugs. Three pro-oxidant chemicals, hydrogen peroxide (H2O2), potassium bromate (KBrO3), and menadione, were examined for low dose-response curves in human lymphoblastoid cells. DNA repair and antioxidant capacity were assessed as possible threshold mechanisms. H2O2 and KBrO3, but not menadione, exhibited thresholded responses, containing a range of nongenotoxic low doses. Levels of the DNA glycosylase 8-oxoguanine glycosylase were unchanged in response to pro- oxidant stress. DNA repair–focused gene expression arrays reported changes in ATM and BRCA1, involved in double-strand break repair, in response to low-dose pro-oxidant exposure; however, these alterations were not substantiated at the protein level. Determination of oxidatively induced DNA damage in H2O2-treated AHH-1 cells reported accumulation of thymine glycol above the genotoxic threshold. Further, the H2O2 dose-response curve was shifted by modulating the antioxidant glutathione. Hence, observed pro- oxidant thresholds were due to protective capacities of base excision repair enzymes and antioxidants against DNA damage, highlighting the importance of homeostatic mechanisms in “genotoxic tolerance.” PMID:22539617

  4. Oxidative Stress Induces Persistent Telomeric DNA Damage Responsible for Nuclear Morphology Change in Mammalian Cells

    PubMed Central

    Coluzzi, Elisa; Colamartino, Monica; Cozzi, Renata; Leone, Stefano; Meneghini, Carlo; O’Callaghan, Nathan; Sgura, Antonella

    2014-01-01

    One main function of telomeres is to maintain chromosome and genome stability. The rate of telomere shortening can be accelerated significantly by chemical and physical environmental agents. Reactive oxygen species are a source of oxidative stress and can produce modified bases (mainly 8-oxoG) and single strand breaks anywhere in the genome. The high incidence of guanine residues in telomeric DNA sequences makes the telomere a preferred target for oxidative damage. Our aim in this work is to evaluate whether chromosome instability induced by oxidative stress is related specifically to telomeric damage. We treated human primary fibroblasts (MRC-5) in vitro with hydrogen peroxide (100 and 200 µM) for 1 hr and collected data at several time points. To evaluate the persistence of oxidative stress-induced DNA damage up to 24 hrs after treatment, we analysed telomeric and genomic oxidative damage by qPCR and a modified comet assay, respectively. The results demonstrate that the genomic damage is completely repaired, while the telomeric oxidative damage persists. The analysis of telomere length reveals a significant telomere shortening 48 hrs after treatment, leading us to hypothesise that residual telomere damage could be responsible for the telomere shortening observed. Considering the influence of telomere length modulation on genomic stability, we quantified abnormal nuclear morphologies (Nucleoplasmic Bridges, Nuclear Buds and Micronuclei) and observed an increase of chromosome instability in the same time frame as telomere shortening. At subsequent times (72 and 96 hrs), we observed a restoration of telomere length and a reduction of chromosome instability, leaving us to conjecture a correlation between telomere shortening/dysfunction and chromosome instability. We can conclude that oxidative base damage leads to abnormal nuclear morphologies and that telomere dysfunction is an important contributor to this effect. PMID:25354277

  5. Zingerone protects against stannous chloride-induced and hydrogen peroxide-induced oxidative DNA damage in vitro.

    PubMed

    Rajan, Iyappan; Narayanan, Nithya; Rabindran, Remitha; Jayasree, P R; Manish Kumar, P R

    2013-12-01

    In this paper, we report the dose-dependent antioxidant activity and DNA protective effects of zingerone. At 500 μg/mL, the DPPH radical scavenging activity of zingerone and ascorbic acid as a standard was found to be 86.7 and 94.2 % respectively. At the same concentration, zingerone also showed significant reducing power (absorbance 0.471) compared to that of ascorbic acid (absorbance 0.394). The in vitro toxicity of stannous chloride (SnCl2) was evaluated using genomic and plasmid DNA. SnCl2-induced degradation of genomic DNA was found to occur at a concentration of 0.8 mM onwards with complete degradation at 1.02 mM and above. In the case of plasmid DNA, conversion of supercoiled DNA into the open circular form indicative of DNA nicking activity was observed at a concentration of 0.2 mM onwards; complete conversion was observed at a concentration of 1.02 mM and above. Zingerone was found to confer protection against SnCl2-induced oxidative damage to genomic and plasmid DNA at concentrations of 500 and 750 μg/mL onwards, respectively. This protective effect was further confirmed in the presence of UV/H2O2-a known reactive oxygen species (ROS) generating system-wherein protection by zingerone against ROS-mediated DNA damage was observed at a concentration of 250 μg/mL onwards in a dose-dependent manner. This study clearly indicated the in vitro DNA protective property of zingerone against SnCl2-induced, ROS-mediated DNA damage. PMID:24006104

  6. Aluminium induced oxidative stress and DNA damage in root cells of Allium cepa L.

    PubMed

    Achary, V Mohan Murali; Jena, Suprava; Panda, Kamal K; Panda, Brahma B

    2008-06-01

    Aluminium (Al) was evaluated for induction of oxidative stress and DNA damage employing the growing roots of Allium cepa L. as the assay system. Intact roots of A. cepa were treated with different concentrations, 0, 1, 10, 50, 100, or 200 microM of aluminium chloride, at pH 4.5 for 4 h (or 2 h for comet assay) at room temperature, 25+/-1 degrees C. Following treatment the parameters investigated in root tissue were Al-uptake, cell death, extra cellular generation of reactive oxygen intermediates (ROI), viz. O(2)(*-), H(2)O(2) and (*)OH, lipid peroxidation, protein oxidation, activities of antioxidant enzymes namely catalase (CAT), superoxide dismutase (SOD), guaiacol peroxidase (GPX), ascorbate peroxidase (APX); and DNA damage, assessed by comet assay. The findings indicated that Al triggered generation of extra-cellular ROI following a dose-response. Through application of specific enzyme inhibitors it was demonstrated that extra-cellular generation of ROI was primarily due to the activity of cell wall bound NADH-PX. Generation of ROI in root tissue as well as cell death was better correlated to the levels of root Al-uptake rather than to the concentrations of Al in ambient experimental solutions. Induction of lipid peroxidation and protein oxidation by Al were statistically significant. Whereas Al inhibited CAT activity, enhanced SOD, GPX and APX activities significantly; that followed dose-response. Comet assay provided evidence that Al induced DNA damage in a range of concentrations 50-200 microM, which was comparable to that induced by ethylmethane sulfonate (EMS), an alkylating mutagen served as the positive control. The findings provided evidence that Al comparable to biotic stress induced oxidative burst at the cell surface through up- or down-regulation of some of the key enzymes of oxidative metabolism ultimately resulting in oxidative stress leading to DNA damage and cell death in root cells of A. cepa. PMID:18068230

  7. A novel alkylating agent Melflufen induces irreversible DNA damage and cytotoxicity in multiple myeloma cells.

    PubMed

    Ray, Arghya; Ravillah, Durgadevi; Das, Deepika S; Song, Yan; Nordström, Eva; Gullbo, Joachim; Richardson, Paul G; Chauhan, Dharminder; Anderson, Kenneth C

    2016-08-01

    Our prior study utilized both in vitro and in vivo multiple myeloma (MM) xenograft models to show that a novel alkylator melphalan-flufenamide (Melflufen) is a more potent anti-MM agent than melphalan and overcomes conventional drug resistance. Here we examined whether this potent anti-MM activity of melflufen versus melphalan is due to their differential effect on DNA damage and repair signalling pathways via γ-H2AX/ATR/CHK1/Ku80. Melflufen-induced apoptosis was associated with dose- and time-dependent rapid phosphorylation of γ-H2AX. Melflufen induces γ-H2AX, ATR, and CHK1 as early as after 2 h exposure in both melphalan-sensitive and -resistant cells. However, melphalan induces γ-H2AX in melphalan-sensitive cells at 6 h and 24 h; no γ-H2AX induction was observed in melphalan-resistant cells even after 24 h exposure. Similar kinetics was observed for ATR and CHK1 in meflufen- versus melphalan-treated cells. DNA repair is linked to melphalan-resistance; and importantly, we found that melphalan, but not melflufen, upregulates Ku80 that repairs DNA double-strand breaks. Washout experiments showed that a brief (2 h) exposure of MM cells to melflufen is sufficient to initiate an irreversible DNA damage and cytotoxicity. Our data therefore suggest that melflufen triggers a rapid, robust, and an irreversible DNA damage which may account for its ability to overcome melphalan-resistance in MM cells. PMID:27098276

  8. Infrared A radiation promotes survival of human melanocytes carrying ultraviolet radiation-induced DNA damage.

    PubMed

    Kimeswenger, Susanne; Schwarz, Agatha; Födinger, Dagmar; Müller, Susanne; Pehamberger, Hubert; Schwarz, Thomas; Jantschitsch, Christian

    2016-06-01

    The link between solar radiation and melanoma is still elusive. Although infrared radiation (IR) accounts for over 50% of terrestrial solar energy, its influence on human skin is not well explored. There is increasing evidence that IR influences the expression patterns of several molecules independently of heat. A previous in vivo study revealed that pretreatment with IR might promote the development of UVR-induced non-epithelial skin cancer and possibly of melanoma in mice. To expand on this, the aim of the present study was to evaluate the impact of IR on UVR-induced apoptosis and DNA repair in normal human epidermal melanocytes. The balance between these two effects is a key factor of malignant transformation. Human melanocytes were exposed to physiologic doses of IR and UVR. Compared to cells irradiated with UVR only, simultaneous exposure to IR significantly reduced the apoptotic rate. However, IR did not influence the repair of UVR-induced DNA damage. IR partly reversed the pro-apoptotic effects of UVR via modification of the expression and activity of proteins mainly of the extrinsic apoptotic pathway. In conclusion, IR enhances the survival of melanocytes carrying UVR-induced DNA damage and thereby might contribute to melanomagenesis. PMID:26844814

  9. Energy Thresholds of DNA Damage Induced by UV Radiation: An XPS Study.

    PubMed

    Gomes, P J; Ferraria, A M; Botelho do Rego, A M; Hoffmann, S V; Ribeiro, P A; Raposo, M

    2015-04-30

    This work stresses on damage at the molecular level caused by ultraviolet radiation (UV) in the range from 3.5 to 8 eV, deoxyribonucleic acid (DNA) films observed by X-ray photoelectron spectroscopy (XPS). Detailed quantitative XPS analysis, in which all the amounts are relative to sodium-assumed not to be released from the samples, of the carbon, oxygen, and particularly, nitrogen components, reveals that irradiation leads to sugar degradation with CO-based compounds release for energies above 6.9 eV and decrease of nitrogen groups which are not involved in hydrogen bonding at energies above 4.2 eV. Also the phosphate groups are seen to decrease to energies above 4.2 eV. Analysis of XPS spectra allowed to conclude that the damage on bases peripheral nitrogen atoms are following the damage on phosphates. It suggests that very low kinetic energy photoelectrons are ejected from the DNA bases, as a result of UV light induced breaking of the phosphate ester groups which forms a transient anion with resonance formation and whereby most of the nitrogen DNA peripheral groups are removed. The degree of ionization of DNA was observed to increase with radiation energy, indicating that the ionized phosphate groups are kept unchanged. This result was interpreted by the shielding of phosphate groups caused by water molecules hydration near sodium atoms. PMID:25844940

  10. Increased Oxidative DNA Damage in Placenta Contributes to Cadmium-Induced Preeclamptic Conditions in Rat.

    PubMed

    Zhang, Xiaojie; Xu, Zhangye; Lin, Feng; Wang, Fan; Ye, Duyun; Huang, Yinping

    2016-03-01

    To explore the possible mechanisms of cadmium (Cd)-induced preeclamptic conditions in rats. In the present study, we introduced the in vivo model of preeclampsia by giving intraperitoneal injections of cadmium chloride (CdCl2) to pregnant rats from gestational day (GD) 4 to 19. Maternal body weights were recorded on GD 0, 14, and 20, while their systolic blood pressures (SBPs) monitored on GD 3, 11, and 18. On GD 20, rats were sacrificed and the specimens were collected. The morphological changes of placenta and kidney tissues of pregnant rats were examined by hematoxylin and eosin staining assay. Blood Cd level was detected by inductively coupled plasma mass spectrometry. Total antioxidant capacity (TAC) was evaluated using FRAP method and total nitrite (NOx) was detected with Griess reagent. Antioxidative factors and DNA damage/repair biomarkers were measured by real-time qPCR, western blot or immunohistochemistry study. The current results showed that CdCl2-treated pregnant rats developed preeclampsia (PE)-like manifestations, such as hypertension, albuminuria, with decreased TAC and increased blood Cd level, and pro-oxidative/antioxidative or DNA damage/repair biomarkers. Our study demonstrated that increased oxidative DNA damage in placenta could contribute to Cd-induced preeclamptic conditions in rat. PMID:26194818

  11. Buckwheat Honey Attenuates Carbon Tetrachloride-Induced Liver and DNA Damage in Mice.

    PubMed

    Cheng, Ni; Wu, Liming; Zheng, Jianbin; Cao, Wei

    2015-01-01

    Buckwheat honey, which is widely consumed in China, has a characteristic dark color. The objective of this study was to investigate the protective effects of buckwheat honey on liver and DNA damage induced by carbon tetrachloride in mice. The results revealed that buckwheat honey had high total phenolic content, and rutin, hesperetin, and p-coumaric acid were the main phenolic compounds present. Buckwheat honey possesses super DPPH radical scavenging activity and strong ferric reducing antioxidant power. Administration of buckwheat honey for 10 weeks significantly inhibited serum lipoprotein oxidation and increased serum oxygen radical absorbance capacity. Moreover, buckwheat honey significantly inhibited aspartate aminotransferase and alanine aminotransferase activities, which are enhanced by carbon tetrachloride. Hepatic malondialdehyde decreased and hepatic antioxidant enzymes (superoxide dismutase and glutathione peroxidase) increased in the presence of buckwheat honey. In a comet assay, lymphocyte DNA damage induced by carbon tetrachloride was significantly inhibited by buckwheat honey. Therefore, buckwheat honey has a hepatoprotective effect and inhibits DNA damage, activities that are primarily attributable to its high antioxidant capacity. PMID:26508989

  12. The thyroid hormone receptor β induces DNA damage and premature senescence

    PubMed Central

    Zambrano, Alberto; García-Carpizo, Verónica; Gallardo, María Esther; Villamuera, Raquel; Gómez-Ferrería, Maria Ana; Pascual, Angel; Buisine, Nicolas; Sachs, Laurent M.; Garesse, Rafael

    2014-01-01

    There is increasing evidence that the thyroid hormone (TH) receptors (THRs) can play a role in aging, cancer and degenerative diseases. In this paper, we demonstrate that binding of TH T3 (triiodothyronine) to THRB induces senescence and deoxyribonucleic acid (DNA) damage in cultured cells and in tissues of young hyperthyroid mice. T3 induces a rapid activation of ATM (ataxia telangiectasia mutated)/PRKAA (adenosine monophosphate–activated protein kinase) signal transduction and recruitment of the NRF1 (nuclear respiratory factor 1) and THRB to the promoters of genes with a key role on mitochondrial respiration. Increased respiration leads to production of mitochondrial reactive oxygen species, which in turn causes oxidative stress and DNA double-strand breaks and triggers a DNA damage response that ultimately leads to premature senescence of susceptible cells. Our findings provide a mechanism for integrating metabolic effects of THs with the tumor suppressor activity of THRB, the effect of thyroidal status on longevity, and the occurrence of tissue damage in hyperthyroidism. PMID:24395638

  13. Tomato oleoresin inhibits DNA damage but not diethylnitrosamine-induced rat hepatocarcinogenesis.

    PubMed

    Scolastici, Clarissa; Lopes, Gisele A D; Barbisan, Luís F; Salvadori, Daisy M F

    2008-06-01

    Various studies have shown that lycopene, a non-provitamin A carotenoid, exerts antioxidant, antimutagenic and anticarcinogenic activities in different in vitro and in vivo systems. However, the results concerning its chemopreventive potential on rat hepatocarcinogenesis are ambiguous. The aim of the present study was to investigate the antigenotoxic and anticarcinogenic effects of dietary tomato oleoresin adjusted to lycopene concentration at 30, 100 or 300 ppm (administered 2 weeks before and during or 8 weeks after carcinogen exposure) on liver of male Wistar rats treated with a single intraperitoneal dose of 20 or 100mg/kg of diethylnitrosamine (DEN), respectively. The level of DNA damage in liver cells and the development of putative preneoplastic single hepatocytes, minifoci and foci of altered hepatocytes (FHA) positive for glutathione S-transferase (GST-P) were used as endpoints. Significant reduction of DNA damage was detected when the highest lycopene concentration was administered before and during the DEN exposure (20mg/kg). However, the results also showed that lycopene consumption did not reduce cell proliferation in normal hepatocytes or the growth of initiated hepatocytes into minifoci positive for GST-P during early regenerative response after 70% partial hepatectomy, or the number and area of GST-P positive FHA induced by DEN (100mg/kg) at the end of week 10. Taken together, the data suggest a chemopreventive effect of tomato oleoresin against DNA damage induced by DEN but no clear effectiveness in initiating or promoting phases of rat hepatocarcinogenesis. PMID:18434113

  14. Inhibition of KDM6 activity during murine ESC differentiation induces DNA damage.

    PubMed

    Hofstetter, Christine; Kampka, Justyna M; Huppertz, Sascha; Weber, Heike; Schlosser, Andreas; Müller, Albrecht M; Becker, Matthias

    2016-02-15

    Pluripotent embryonic stem cells (ESCs) are characterised by their capacity to self-renew indefinitely while maintaining the potential to differentiate into all cell types of an adult organism. Both the undifferentiated and differentiated states are defined by specific gene expression programs that are regulated at the chromatin level. Here, we have analysed the contribution of the H3K27me2- and H3K27me23-specific demethylases KDM6A and KDM6B to murine ESC differentiation by employing the GSK-J4 inhibitor, which is specific for KDM6 proteins, and by targeted gene knockout (KO) and knockdown. We observe that inhibition of the H3K27 demethylase activity induces DNA damage along with activation of the DNA damage response (DDR) and cell death in differentiating but not in undifferentiated ESCs. Laser microirradiation experiments revealed that the H3K27me3 mark, but not the KDM6B protein, colocalise with γH2AX-positive sites of DNA damage in differentiating ESCs. Lack of H3K27me3 attenuates the GSK-J4-induced DDR in differentiating Eed-KO ESCs. Collectively, our findings indicate that differentiating ESCs depend on KDM6 and that the H3K27me3 demethylase activity is crucially involved in DDR and survival of differentiating ESCs. PMID:26759175

  15. Buckwheat Honey Attenuates Carbon Tetrachloride-Induced Liver and DNA Damage in Mice

    PubMed Central

    Cheng, Ni; Wu, Liming; Zheng, Jianbin; Cao, Wei

    2015-01-01

    Buckwheat honey, which is widely consumed in China, has a characteristic dark color. The objective of this study was to investigate the protective effects of buckwheat honey on liver and DNA damage induced by carbon tetrachloride in mice. The results revealed that buckwheat honey had high total phenolic content, and rutin, hesperetin, and p-coumaric acid were the main phenolic compounds present. Buckwheat honey possesses super DPPH radical scavenging activity and strong ferric reducing antioxidant power. Administration of buckwheat honey for 10 weeks significantly inhibited serum lipoprotein oxidation and increased serum oxygen radical absorbance capacity. Moreover, buckwheat honey significantly inhibited aspartate aminotransferase and alanine aminotransferase activities, which are enhanced by carbon tetrachloride. Hepatic malondialdehyde decreased and hepatic antioxidant enzymes (superoxide dismutase and glutathione peroxidase) increased in the presence of buckwheat honey. In a comet assay, lymphocyte DNA damage induced by carbon tetrachloride was significantly inhibited by buckwheat honey. Therefore, buckwheat honey has a hepatoprotective effect and inhibits DNA damage, activities that are primarily attributable to its high antioxidant capacity. PMID:26508989

  16. Amorphous nanosilica induce endocytosis-dependent ROS generation and DNA damage in human keratinocytes

    PubMed Central

    2011-01-01

    Background Clarifying the physicochemical properties of nanomaterials is crucial for hazard assessment and the safe application of these substances. With this in mind, we analyzed the relationship between particle size and the in vitro effect of amorphous nanosilica (nSP). Specifically, we evaluated the relationship between particle size of nSP and the in vitro biological effects using human keratinocyte cells (HaCaT). Results Our results indicate that exposure to nSP of 70 nm diameter (nSP70) induced an elevated level of reactive oxygen species (ROS), leading to DNA damage. A markedly reduced response was observed using submicron-sized silica particles of 300 and 1000 nm diameter. In addition, cytochalasin D-treatment reduced nSP70-mediated ROS generation and DNA damage, suggesting that endocytosis is involved in nSP70-mediated cellular effects. Conclusions Thus, particle size affects amorphous silica-induced ROS generation and DNA damage of HaCaT cells. We believe clarification of the endocytosis pathway of nSP will provide useful information for hazard assessment as well as the design of safer forms of nSPs. PMID:21235812

  17. Myricetin, quercetin, (+)-catechin and (-)-epicatechin protect against N-nitrosamines-induced DNA damage in human hepatoma cells.

    PubMed

    Delgado, M E; Haza, A I; García, A; Morales, P

    2009-10-01

    The aim of this study was to investigate the protective effect of myricetin, quercetin, (+)-catechin and (-)-epicatechin, against N-nitrosodibutylamine (NDBA) and N-nitrosopiperidine (NPIP)-induced DNA damage in human hepatoma cells (HepG2). DNA damage (strand breaks and oxidized purines/pyrimidines) was evaluated by the alkaline single-cell gel electrophoresis or Comet assay. (+)-Catechin at the lowest concentration (10 microM) showed the maximum reduction of DNA strand breaks (23%), the formation of endonuclease III (Endo III, 19-21%) and formamidopyrimidine-DNA glycosylase (Fpg, 28-40%) sensitive sites induced by NDBA or NPIP. (-)-Epicatechin also decreased DNA strand breaks (10 microM, 20%) and the oxidized pyrimidines/purines (33-39%) induced by NDBA or NPIP, respectively. DNA strand breaks induced by NDBA or NPIP were weakly reduced by myricetin at the lowest concentration (0.1 microM, 10-19%, respectively). Myricetin also reduced the oxidized purines (0.1 microM, 17%) and pyrimidines (0.1 microM, 15%) induced by NDBA, but not the oxidized pyrimidines induced by NPIP. Quercetin did not protect against NDBA-induced DNA damage, but it reduced the formation of Endo III and Fpg sensitive sites induced by NPIP (0.1 microM, 17-20%, respectively). In conclusion, our results indicate that (+)-catechin and (-)-epicatechin at the concentrations tested protect human derived cells against oxidative DNA damage effects of NDBA and NPIP. However, myricetin at the concentrations tested only protects human cells against oxidative DNA damage induced by NDBA and quercetin against oxidative DNA damage induced by NPIP. PMID:19628030

  18. High-throughput genotoxicity assay identifies antioxidants as inducers of DNA damage response and cell death

    PubMed Central

    Fox, Jennifer T.; Sakamuru, Srilatha; Huang, Ruili; Teneva, Nedelina; Simmons, Steven O.; Xia, Menghang; Tice, Raymond R.; Austin, Christopher P.; Myung, Kyungjae

    2012-01-01

    Human ATAD5 is a biomarker for identifying genotoxic compounds because ATAD5 protein levels increase posttranscriptionally in response to DNA damage. We screened over 4,000 compounds with a cell-based quantitative high-throughput ATAD5-luciferase assay detecting genotoxic compounds. We identified 22 antioxidants, including resveratrol, genistein, and baicalein, that are currently used or investigated for the treatment of cardiovascular disease, type 2 diabetes, osteopenia, osteoporosis, and chronic hepatitis, as well as for antiaging. Treatment of dividing cells with these compounds induced DNA damage and resulted in cell death. Despite their genotoxic effects, resveratrol, genistein, and baicalein did not cause mutagenesis, which is a major side effect of conventional anticancer drugs. Furthermore, resveratrol and genistein killed multidrug-resistant cancer cells. We therefore propose that resveratrol, genistein, and baicalein are attractive candidates for improved chemotherapeutic agents. PMID:22431602

  19. Quercetin ameliorates polychlorinated biphenyls-induced testicular DNA damage in rats.

    PubMed

    Lovato, F L; de Oliveira, C R; Adedara, I A; Barbisan, F; Moreira, K L S; Dalberto, M; da Rocha, M I U M; Marroni, N P; da Cruz, I B; Costabeber, I B

    2016-02-01

    Polychlorinated biphenyls (PCBs) are a group of environmental contaminants widely reported to cause gonadal toxicity in both humans and animals. This study investigated the amelioratory role of quercetin in PCBs-induced DNA damage in male Wistar rats. Polychlorinated biphenyls were administered intraperitoneally at a dose of 2 mg kg(-1) alone or in combination with quercetin (orally) at 50 mg kg(-1) for 25 days. Quercetin modulation of PCBs-induced gonadal toxicity was evaluated using selected oxidative stress indices, comet assay, measurement of DNA concentration and histology of the testes. Administration of PCBs alone caused a significant (P < 0.05) depletion in the total thiol level in testes of treated rats. Conversely, the levels of reactive oxygen species (ROS) and thiobarbituric acid reactive substances (TBARS) production were markedly elevated in testes of PCBs-treated rats compared with control. Further, PCBs exposure produced statistically significant increases in DNA tail migration, degraded double-stranded DNA (dsDNA) concentration and histological alterations of testes of the treated rats compared to control. Quercetin cotreatment significantly improved the testicular antioxidant status, decreased DNA fragmentation and restored the testicular histology, thus demonstrating the protective effect of quercetin in PCBs-treated rats. PMID:25892208

  20. Zinc protects against ultraviolet A1-induced DNA damage and apoptosis in cultured human fibroblasts.

    PubMed

    Leccia, M T; Richard, M J; Favier, A; Béani, J C

    1999-09-01

    Ultraviolet A1 (UVA1) radiation generates reactive oxygen species and the oxidative stress is known as a mediator of DNA damage and of apoptosis. We exposed cultured human cutaneous fibroblasts to UVA1 radiation (wavelengths in the 340-450-nm range with emission peak at 365 nm) and, using the alkaline unwinding method, we showed an immediate significant increase of DNA strand breaks in exposed cells. Apoptosis was determined by detecting cytoplasmic nucleosomes (enzyme-linked immunosorbent assay method) at different time points in fibroblasts exposed to different irradiation doses. In our conditions, UVA1 radiation induced an early (8 h) and a delayed (18 h) apoptosis. Delayed apoptosis increased in a UVA dose-dependent manner. Zinc is an important metal for DNA protection and has been shown to have inhibitory effects on apoptosis. The addition of zinc (6.5 mg/L) as zinc chloride to the culture medium significantly decreased immediate DNA strand breaks in human skin fibroblasts. Moreover, zinc chloride significantly decreased UVA1-induced early and delayed apoptosis. Thus, these data show for the first time in normal cutaneous cultured cells that UVA1 radiation induces apoptosis. This apoptosis is biphasic and appears higher 18 h after the stress. Zinc supplementation can prevent both immediate DNA strand breakage and early and delayed apoptosis, suggesting that this metal could be of interest for skin cell protection against UVA1 irradiation. PMID:10468155

  1. Oxidative stress induced sperm DNA damage, a possible reason for male infertility

    PubMed Central

    Hosen, Md Bayejid; Islam, Md Rakibul; Begum, Firoza; Kabir, Yearul; Howlader, M Zakir Hossain

    2015-01-01

    Background: Sperm DNA damage is an important factor in the etiology of male infertility. Objective: The aim of the study was to evaluate the association of oxidative stress induced sperm DNA damage with the pathogenesis of male infertility. Materials and Methods: The study comprised a total of 66 subjects, including fertile men (n=25) and infertile men (n=41) matched by age. Seminal malondialdehyde (MDA), phospholipid hydroperoxide (PHP), superoxide dismutase (SOD), total antioxidant status (TAS) and 8-hydroxy-2'-deoxy guanosine (8-OHdG) were estimated by spectrophotometric and ELISA based methods and the association with the sperm parameters was assessed. Results: The percentages of motile and morphologically normal cells were significantly lower (p < 0.001, p <0.001, respectivly) in infertile men. Seminal levels of MDA, PHP and 8-OHdG were significantly higher (p < 0.001, p < 0.001, and p=0. 02, respectively) while the SOD and TAS were significantly lower (p=0. 0003, p< 0.001, respectively) in infertile men. Sperm parameters were negatively correlated with MDA, PHP and 8-OHdG while positively correlated with SOD and TAS. A positive correlation of 8-OHdG with MDA and PHP and a negative correlation with TAS and SOD were also found. Conclusion: These results suggested that oxidative stress induced sperm DNA damage might have a critical effect on the etiology of infertility. Therefore, evaluation of oxidative status, antioxidant defense systems and DNA damage, together with sperm parameters might be a useful tool for diagnosis and treatment of male infertility. PMID:26568756

  2. DETECTION OF LOW DOSE RADIATION-AND CHEMICALLY-INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAYS

    EPA Science Inventory

    Rapid, sensitive and simple assays for radiation- and chemically-induced DNA damage can be of significant benefit to a number of fields including radiation biology, clinical research, and environmental monitoring. Although temperature-induced DNA strand separation has been use...

  3. Oxidative Stress and DNA Damage Induced by Chromium in Liver and Kidney of Goldfish, Carassius auratus

    PubMed Central

    Velma, Venkatramreddy; Tchounwou, Paul B.

    2013-01-01

    Chromium (Cr) is an abundant element in the Earth’s crust. It exhibits various oxidation states, from divalent to hexavalent forms. Cr has diverse applications in various industrial processes and inadequate treatment of the industrial effluents leads to the contamination of the surrounding water resources. Hexavalent chromium (Cr (VI)) is the most toxic form, and its toxicity has been associated with oxidative stress. The present study was designed to investigate the toxic potential of Cr (VI) in fish. In this research, we investigated the role of oxidative stress in chromium-induced genotoxicity in the liver and kidney cells of goldfish, Carassius auratus. Goldfish were acclimatized to the laboratory conditions and exposed them to 5% and 10% of 96 hr-LC50 (85.7 mg/L) of aqueous Cr (VI) in a continuous flow through system. Fish were sampled every 7 days for a period of 28 days to analyze the lipid hydroperoxides (LHP) levels and genotoxic potentials in the liver and kidney. LHP levels were analyzed by spectrophotometry while genotoxicity was assessed by single cell gel electrophoresis (comet) assay. LHP levels in the liver increased significantly at week 1, followed by a decrease. LHP levels in the kidney increased significantly at weeks 1, 2, and 3, and decreased at week 4 compared to the control. The percentage of DNA damage increased in both liver and kidney at both test concentrations. The results clearly indicate that Cr (VI) induces significant levels of DNA damage in liver and kidney cells of goldfish. The induced LHP levels in both organs were concentration-dependent and were directly correlated with the levels of DNA damage. The two tested Cr (VI) concentrations induced significant levels of oxidative stress in both organs, however the kidney appears to be more vulnerable and sensitive to Cr-induced toxicity than the liver. PMID:23700361

  4. Role of mitochondria, ROS, and DNA damage in arsenic induced carcinogenesis.

    PubMed

    Lee, Chih-Hung; Yu, Hsin-Su

    2016-01-01

    The International Agency for Research on Cancer (IARC) declared arsenic a class I carcinogen. Arsenic exposure induces several forms of human cancers, including cancers of skin, lung, liver, and urinary bladder. The majority of the arsenic-induced cancers occur in skin. Among these, the most common is Bowen's disease, characterized by epidermal hyperplasia, full layer epidermal dysplasia, leading to intraepidermal carcinoma as well as apoptosis, and moderate dermal infiltrates, which require the participation of mitochondria. The exact mechanism underlying arsenic induced carcinogenesis remains unclear, although increased reactive oxidative stresses, leading to chromosome abnormalities and uncontrolled growth, and aberrant immune regulations might be involved. Here, we highlight how increased mitochondrial biogenesis and oxidative stress lead to mitochondrial DNA damage and mutation in arsenic induced cancers. We also provide therapeutic rationale for targeting mitochondria in the treatment of arsenic induced cancers. PMID:27100709

  5. Ginsenoside-Rg5 induces apoptosis and DNA damage in human cervical cancer cells

    PubMed Central

    LIANG, LI-DAN; HE, TAO; DU, TING-WEI; FAN, YONG-GANG; CHEN, DIAN-SEN; WANG, YAN

    2015-01-01

    Panax ginseng is traditionally used as a remedy for cancer, inflammation, stress and aging, and ginsenoside-Rg5 is a major bioactive constituent of steamed ginseng. The present study aimed to evaluate whether ginsenoside-Rg5 had any marked cytotoxic, apoptotic or DNA-damaging effects in human cervical cancer cells. Five human cervical cancer cell lines (HeLa, MS751, C33A, Me180 and HT-3) were used to investigate the cytotoxicity of ginsenoside-Rg5 using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Additionally, the effects of ginsenoside-Rg5 on the apoptosis of HeLa and MS751 cells were detected using DNA ladder assays and flow cytometry. DNA damage was assessed in the HeLa and MS751 cells using alkaline comet assays and by detection of γH2AX focus formation. The HeLa and MS751 cells were significantly more sensitive to ginsenoside-Rg5 treatment compared with the C-33A, HT-3 and Me180 cells. As expected, ginsenoside-Rg5 induced significant concentration- and time-dependent increases in apoptosis. In addition, ginsenoside-Rg5 induced significant concentration-dependent increases in the level of DNA damage compared with the negative control. Consistent with the comet assay data, the percentage of γH2AX-positive HeLa and MS751 cells also revealed that ginsenoside-Rg5 caused DNA double-strands to break in a concentration-dependent manner. In conclusion, ginsenoside-Rg5 had marked genotoxic effects in the HeLa and MS751 cells and, thus, demonstrates potential as a genotoxic or cytotoxic drug for the treatment of cervical cancer. PMID:25355274

  6. Plant Nuclei Move to Escape Ultraviolet-Induced DNA Damage and Cell Death1[OPEN

    PubMed Central

    Hidema, Jun; Tamura, Kentaro

    2016-01-01

    A striking feature of plant nuclei is their light-dependent movement. In Arabidopsis (Arabidopsis thaliana) leaf mesophyll cells, the nuclei move to the side walls of cells within 1 to 3 h after blue-light reception, although the reason is unknown. Here, we show that the nuclear movement is a rapid and effective strategy to avoid ultraviolet B (UVB)-induced damages. Mesophyll nuclei were positioned on the cell bottom in the dark, but sudden exposure of these cells to UVB caused severe DNA damage and cell death. The damage was remarkably reduced in both blue-light-treated leaves and mutant leaves defective in the actin cytoskeleton. Intriguingly, in plants grown under high-light conditions, the mesophyll nuclei remained on the side walls even in the dark. These results suggest that plants have two strategies for reducing UVB exposure: rapid nuclear movement against acute exposure and nuclear anchoring against chronic exposure. PMID:26681797

  7. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY STYRENE OXIDE

    EPA Science Inventory

    A rapid and simple assay to detect DNA damage to calf thymus DNA caused by styrene oxide (SO) is reported. This assay is based on changes observed in the melting and annealing behavior of the damaged DNA. The melting annealing process was monitored using a fluorescence indicat...

  8. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY TOXIC INDUSTRIAL CHEMICALS

    EPA Science Inventory

    One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...

  9. SPATA12 and Its Possible Role in DNA Damage Induced by Ultraviolet-C

    PubMed Central

    Lin, Yiting; Rong, Zhuoxian; Liu, Xiaowen; Li, Dan

    2013-01-01

    Our previous studies indicated that SPATA12, a novel spermatogenesis-associated gene, might be an inhibitor involved in spermatogenesis and tumorigenesis. To obtain a better understanding of the functions of SPATA12, a yeast two-hybrid screening system was used to search for interacting proteins, and chromodomain helicase DNA binding protein 2 (CHD2) was successfully identified. Bimolecular fluorescence complementation (BiFC) and subcellular co-localization assays further suggested a possible interaction between SPATA12 and CHD2 in the nuclei. CHD2 is known to be involved in the later stage of the DNA damage response pathway by influencing the transcriptional activity of p53. Thus, our hypothesis is that SPATA12 might play a role in DNA damage signaling. Western blotting results showed that SPATA12 expression could be induced in ultraviolet-C (UV-C) irradiated cells. Through reporter gene assays and the activator protein-1 (AP-1) decoy oligodeoxynucleotide method, we demonstrated that SPATA12 promoter activity could be up-regulated in response to UV-C radiation exposure and an AP-1 binding site in the SPATA12 promoter may have a role in transcriptional regulation of SPATA12. Using colony formation and host cell reactivation assays, it was demonstrated that SPATA12 might lead to inhibition of cellular proliferation in UV-C-irradiated DNA damage. Furthermore, SPATA12 was transfected into H1299, MCF-7 and HeLa cells, and flow cytometry (FCM) results suggested that there are some biological association between SPATA12 and p53 in UV-C-irradiated DNA damage. In addition, we investigated whether SPATA12 could up-regulate the expression of p53. Taken together, these findings indicate that SPATA12 could be induced under UV-C stress. During DNA damage process, AP-1 involves in the transcriptional up-regulation of SPATA12 in response to UV-C radiation and p53 involves in growth inhibitory effects of SPATA12 on UV-C irradiated cells. PMID:24205157

  10. DNA Damage Response in Neonatal and Adult Stromal Cells Compared With Induced Pluripotent Stem Cells

    PubMed Central

    Liedtke, Stefanie; Biebernick, Sophie; Radke, Teja Falk; Stapelkamp, Daniela; Coenen, Carolin; Zaehres, Holm; Fritz, Gerhard; Kogler, Gesine

    2015-01-01

    Comprehensive analyses comparing individual DNA damage response (DDR) of induced pluripotent stem cells (iPSCs) with neonatal stromal cells with respect to their developmental age are limited. The imperative necessity of providing developmental age-matched cell sources for meaningful toxicological drug safety assessments in replacement of animal-based testing strategies is evident. Here, DDR after radiation or treatment with N-methyl-N-nitrosurea (MNU) was determined in iPSCs compared with neonatal and bone marrow stromal cells. Neonatal and adult stromal cells showed no significant morphologically detectable cytotoxicity following treatment with 1 Gy or 1 mM MNU, whereas iPSCs revealed a much higher sensitivity. Foci analyses revealed an effective DNA repair in stromal cell types and iPSCs, as reflected by a rapid formation and disappearance of phosphorylated ATM and γH2AX foci. Furthermore, quantitative polymerase chain reaction analyses revealed the highest basic expression level of DDR and repair-associated genes in iPSCs, followed by neonatal stromal cells and adult stromal cells with the lowest expression levels. In addition, the influence of genotoxic stress prior to and during osteogenic differentiation of neonatal and adult stromal cells was analyzed applying common differentiation procedures. Experiments presented here suggest a developmental age-dependent basic expression level of genes involved in the processing of DNA damage. In addition a differentiation-dependent downregulation of repair genes was observed during osteogenesis. These results strongly support the requirement to provide adequate cell sources for toxicological in vitro drug testing strategies that match to the developmental age and differentiation status of the presumptive target cell of interest. Significance The results obtained in this study advance the understanding of DNA damage processing in human neonatal stromal cells as compared with adult stromal cells and induced pluripotent

  11. A comet assay study reveals that aluminium induces DNA damage and inhibits the repair of radiation-induced lesions in human peripheral blood lymphocytes.

    PubMed

    Lankoff, Anna; Banasik, Anna; Duma, Anna; Ochniak, Edyta; Lisowska, Halina; Kuszewski, Tomasz; Góźdź, Stanisław; Wojcik, Andrzej

    2006-02-01

    Although it is known that many metals induce DNA damage and inhibit DNA repair, information regarding aluminium (Al) is scarce. The aim of this study was to analyze the level of DNA damage in human peripheral blood lymphocytes treated with Al and the impact of Al on the repair of DNA damage induced by ionizing radiation. Cells were treated with different doses of aluminium chloride (1, 2, 5, 10 and 25 microg/ml AlCl(3)) for 72 h. The level of DNA damage and of apoptosis was determined by the comet assay. The level of oxidative damage was determined by the application of endonuclease III and formamidopyrimidine DNA glycosylase. The results on apoptosis were confirmed by flow cytometry. Based on the fluorescence intensity, cells were divided into cohorts of different relative DNA content that corresponds to G(1), S and G(2) phases of the cell cycle. Our results revealed that Al induces DNA damage in a dose-dependent manner, however, at the dose of 25 microg/ml the level of damage declined. This decline was accompanied by a high level of apoptosis indicating selective elimination of damaged cells. Cells pre-treated with Al showed a decreased repair capacity indicating that Al inhibits DNA repair. The possible mechanisms by which Al induces DNA damage and inhibits the repair are discussed. PMID:16139969

  12. Recombination induced by triple-helix-targeted DNA damage in mammalian cells.

    PubMed Central

    Faruqi, A F; Seidman, M M; Segal, D J; Carroll, D; Glazer, P M

    1996-01-01

    Gene therapy has been hindered by the low frequency of homologous recombination in mammalian cells. To stimulate recombination, we investigated the use of triple-helix-forming oligonucleotides (TFOs) to target DNA damage to a selected site within cells. By treating cells with TFOs linked to psoralen, recombination was induced within a simian virus 40 vector carrying two mutant copies of the supF tRNA reporter gene. Gene conversion events, as well as mutations at the target site, were also observed. The variety of products suggests that multiple cellular pathways can act on the targeted damage, and data showing that the triple helix can influence these pathways are presented. The ability to specifically induce recombination or gene conversion within mammalian cells by using TFOs may provide a new research tool and may eventually lead to novel applications in gene therapy. PMID:8943337

  13. Human SAD1 kinase is involved in UV-induced DNA damage checkpoint function.

    PubMed

    Lu, Rui; Niida, Hiroyuki; Nakanishi, Makoto

    2004-07-23

    Checkpoint activation by DNA damage during G(2) prevents activation of cyclin B/Cdc2 complexes, and as a consequence, mitotic entry is blocked. Although initiation and maintenance of G(2) arrest are known to be regulated by at least two distinct signaling pathways, including those of p38MAPK and ataxia-telangiectasia-mutated (ATM)- and Rad3-related (ATR)-Chk1 in higher eukaryotes, the actual number of signaling pathways involved in this regulation is still elusive. In the present study, we identified human SAD1 (hsSAD1) by searching a sequence data base. The predicted hsSAD1 protein comprises 778 amino acids and shares significant homology with the fission yeast Cdr2, a mitosis-regulatory kinase, and Caenorhabditis elegans SAD1, a neuronal cell polarity regulator. HsSAD1 transcript was expressed ubiquitously with the highest levels of expression in brain and testis. HsSAD1 specifically phosphorylated Wee1A, Cdc25-C, and -B on Ser-642, Ser-216, and Ser-361 in vitro, respectively. Overexpression of hsSAD1 resulted in an increased phosphorylation of Cdc25C on Ser-216 in vivo. DNA damage induced by UV or methyl methane sulfonate but not by IR enhanced endogenous hsSAD1 kinase activity in a caffeine-sensitive manner and caused translocation of its protein from cytoplasm to nucleus. Overexpression of wild-type hsSAD1 induced G(2)/M arrest in HeLa S2 cells. Furthermore, UV-induced G(2)/M arrest was partially abrogated by the reduced expression of hsSAD1 using small interfering RNA. These results suggest that hsSAD1 acts as checkpoint kinase upon DNA damage induced by UV or methyl methane sulfonate. The identification of this new kinase suggests the existence of an alternative checkpoint pathway other than those of ATR-Chk1 and p38MAPK. PMID:15150265

  14. Protection of cisplatin-induced spermatotoxicity, DNA damage and chromatin abnormality by selenium nano-particles.

    PubMed

    Rezvanfar, Mohammad Amin; Rezvanfar, Mohammad Ali; Shahverdi, Ahmad Reza; Ahmadi, Abbas; Baeeri, Maryam; Mohammadirad, Azadeh; Abdollahi, Mohammad

    2013-02-01

    Cisplatin (CIS), an anticancer alkylating agent, induces DNA adducts and effectively cross links the DNA strands and so affects spermatozoa as a male reproductive toxicant. The present study investigated the cellular/biochemical mechanisms underlying possible protective effect of selenium nano-particles (Nano-Se) as an established strong antioxidant with more bioavailability and less toxicity, on reproductive toxicity of CIS by assessment of sperm characteristics, sperm DNA integrity, chromatin quality and spermatogenic disorders. To determine the role of oxidative stress (OS) in the pathogenesis of CIS gonadotoxicity, the level of lipid peroxidation (LPO), antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and peroxynitrite (ONOO) as a marker of nitrosative stress (NS) and testosterone (T) concentration as a biomarker of testicular function were measured in the blood and testes. Thirty-two male Wistar rats were equally divided into four groups. A single IP dose of CIS (7 mg/kg) and protective dose of Nano-Se (2 mg/kg/day) were administered alone or in combination. The CIS-exposed rats showed a significant increase in testicular and serum LPO and ONOO level, along with a significant decrease in enzymatic antioxidants levels, diminished serum T concentration and abnormal histologic findings with impaired sperm quality associated with increased DNA damage and decreased chromatin quality. Coadministration of Nano-Se significantly improved the serum T, sperm quality, and spermatogenesis and reduced CIS-induced free radical toxic stress and spermatic DNA damage. In conclusion, the current study demonstrated that Nano-Se may be useful to prevent CIS-induced gonadotoxicity through its antioxidant potential. PMID:23260366

  15. Firpronil induced spermotoxicity is associated with oxidative stress, DNA damage and apoptosis in male rats.

    PubMed

    Khan, Saleem; Jan, M H; Kumar, Dhirendra; Telang, A G

    2015-10-01

    The present study is the first to investigate and characterize the fipronil (FPN) induced spermotoxicity in male rats. Male rats were orally given FPN (2.5, 5.0 and 10 mg/kg/day) for 4 weeks. Epididymal sperms were collected and remaining testis was processed for histopathological evaluation. FPN treatment significantly reduced sperm density, motility, viability and per cent intact acrosome along with concomitant increase in spermatozoa abnormalities. Exposure of FPN caused excessive ROS generation, lipid peroxidation and alteration in mitochondrial membrane potential leading to apoptosis of spermatozoa in dose dependent manner. Higher FPN doses (5 and 10 mg/kg) markedly reduced the DNA integrity of spermatozoa. These data suggest that FPN causes male reproductive toxicity through oxidative stress induced DNA damage and apoptosis of spermatozoa. PMID:26453224

  16. Quantitative Analysis of Clustered DNA Damages Induced by Silicon Beams of Different Kinetic Energy

    SciTech Connect

    Keszenman D. J.; Keszenman, D.J.; Bennett, P.V.; Sutherland, B.M.; Wilson, P.F.

    2013-05-14

    Humans may b exposed to highly energetic charged particle radiation as a result of medical treatments, occupational activitie or accidental events. In recent years, our increasing presence and burgeoning interest in space exploration beyond low Earth orbit has led to a large increase in the research of the biological effects ofcharged particle radiation typical of that encountered in the space radiation environment. The study of the effects of these types of radiation qualities in terms ofDNA damage induction and repair is fundamental to understand mechanisms both underlying their greater biological effectiveness as we)) as the short and long term risks of health effects such as carcinogenesis, degen rative diseases and premature aging. Charged particle radiation induces a variety of DNA alterations, notably bistranded clustered damages, defined as two or more closely-opposed strand break , oxidized bases or abasic sites within a few helical turns. The induction of such highly complex DNA damage enhances the probability of incorrect or incomplete repair and thus constitutes greater potential for genomic instability, cell death and transformation.

  17. YAP activation protects urothelial cell carcinoma from treatment-induced DNA damage.

    PubMed

    Ciamporcero, E; Shen, H; Ramakrishnan, S; Yu Ku, S; Chintala, S; Shen, L; Adelaiye, R; Miles, K M; Ullio, C; Pizzimenti, S; Daga, M; Azabdaftari, G; Attwood, K; Johnson, C; Zhang, J; Barrera, G; Pili, R

    2016-03-24

    Current standard of care for muscle-invasive urothelial cell carcinoma (UCC) is surgery along with perioperative platinum-based chemotherapy. UCC is sensitive to cisplatin-based regimens, but acquired resistance eventually occurs, and a subset of tumors is intrinsically resistant. Thus, there is an unmet need for new therapeutic approaches to target chemotherapy-resistant UCC. Yes-associated protein (YAP) is a transcriptional co-activator that has been associated with bladder cancer progression and cisplatin resistance in ovarian cancer. In contrast, YAP has been shown to induce DNA damage associated apoptosis in non-small cell lung carcinoma. However, no data have been reported on the YAP role in UCC chemo-resistance. Thus, we have investigated the potential dichotomous role of YAP in UCC response to chemotherapy utilizing two patient-derived xenograft models recently established. Constitutive expression and activation of YAP inversely correlated with in vitro and in vivo cisplatin sensitivity. YAP overexpression protected while YAP knockdown sensitized UCC cells to chemotherapy and radiation effects via increased accumulation of DNA damage and apoptosis. Furthermore, pharmacological YAP inhibition with verteporfin inhibited tumor cell proliferation and restored sensitivity to cisplatin. In addition, nuclear YAP expression was associated with poor outcome in UCC patients who received perioperative chemotherapy. In conclusion, these results suggest that YAP activation exerts a protective role and represents a pharmacological target to enhance the anti-tumor effects of DNA damaging modalities in the treatment of UCC. PMID:26119935

  18. YAP activation protects urothelial cell carcinoma from treatment-induced DNA damage

    PubMed Central

    Ciamporcero, Eric; Shen, He; Ramakrishnan, Swathi; Ku, Sheng Yu; Chintala, Sreenivasulu; Shen, Li; Adelaiye, Remi; Miles, Kiersten Marie; Ullio, Chiara; Pizzimenti, Stefania; Daga, Martina; Azabdaftari, Gissou; Attwood, Kris; Johnson, Candace; Zhang, Jianmin; Barrera, Giuseppina; Pili, Roberto

    2015-01-01

    Current standard of care for muscle-invasive urothelial cell carcinoma (UCC) is surgery along with perioperative platinum-based chemotherapy. UCC is sensitive to cisplatin-based regimens, but acquired resistance eventually occurs, and a subset of tumors is intrinsically resistant. Thus, there is an unmet need for new therapeutic approaches to target chemotherapy-resistant UCC. Yes-associated protein (YAP) is a transcriptional co-activator that has been associated with bladder cancer progression and cisplatin resistance in ovarian cancer. In contrast, YAP has been shown to induce DNA damage associated apoptosis in non-small cell lung carcinoma. However, no data have been reported on the YAP role in UCC chemo-resistance. Thus, we have investigated the potential dichotomous role of YAP in UCC response to chemotherapy utilizing two patient-derived xenograft models recently established. Constitutive expression and activation of YAP inversely correlated with in vitro and in vivo cisplatin sensitivity. YAP overexpression protected while YAP knock-down sensitized UCC cells to chemotherapy and radiation effects via increased accumulation of DNA damage and apoptosis. Furthermore, pharmacological YAP inhibition with verteporfin inhibited tumor cell proliferation and restored sensitivity to cisplatin. In addition, nuclear YAP expression was associated with poor outcome in UCC patients who received perioperative chemotherapy. In conclusion, these results suggest that YAP activation exerts a protective role and represents a pharmacological target to enhance the anti-tumor effects of DNA damaging modalities in the treatment of UCC. PMID:26119935

  19. Oncogene-induced reactive oxygen species fuel hyperproliferation and DNA damage response activation

    PubMed Central

    Ogrunc, M; Di Micco, R; Liontos, M; Bombardelli, L; Mione, M; Fumagalli, M; Gorgoulis, V G; d'Adda di Fagagna, F

    2014-01-01

    Oncogene-induced reactive oxygen species (ROS) have been proposed to be signaling molecules that mediate proliferative cues. However, ROS may also cause DNA damage and proliferative arrest. How these apparently opposite roles can be reconciled, especially in the context of oncogene-induced cellular senescence, which is associated both with aberrant mitogenic signaling and DNA damage response (DDR)-mediated arrest, is unclear. Here, we show that ROS are indeed mitogenic signaling molecules that fuel oncogene-driven aberrant cell proliferation. However, by their very same ability to mediate cell hyperproliferation, ROS eventually cause DDR activation. We also show that oncogenic Ras-induced ROS are produced in a Rac1 and NADPH oxidase (Nox4)-dependent manner. In addition, we show that Ras-induced ROS can be detected and modulated in a living transparent animal: the zebrafish. Finally, in cancer we show that Nox4 is increased in both human tumors and a mouse model of pancreatic cancer and specific Nox4 small-molecule inhibitors act synergistically with existing chemotherapic agents. PMID:24583638

  20. Proteomic analysis of mismatch repair-mediated alkylating agent-induced DNA damage response

    PubMed Central

    2013-01-01

    Background Mediating DNA damage-induced apoptosis is an important genome-maintenance function of the mismatch repair (MMR) system. Defects in MMR not only cause carcinogenesis, but also render cancer cells highly resistant to chemotherapeutics, including alkylating agents. To understand the mechanisms of MMR-mediated apoptosis and MMR-deficiency-caused drug resistance, we analyze a model alkylating agent (N-methyl-N’-nitro-N-nitrosoguanidine, MNNG)-induced changes in protein phosphorylation and abundance in two cell lines, the MMR-proficient TK6 and its derivative MMR-deficient MT1. Results Under an experimental condition that MNNG-induced apoptosis was only observed in MutSα-proficient (TK6), but not in MutSα-deficient (MT1) cells, quantitative analysis of the proteomic data revealed differential expression and phosphorylation of numerous individual proteins and clusters of protein kinase substrates, as well differential activation of response pathways/networks in MNNG-treated TK6 and MT1 cells. Many alterations in TK6 cells are in favor of turning on the apoptotic machinery, while many of those in MT1 cells are to promote cell proliferation and anti-apoptosis. Conclusions Our work provides novel molecular insights into the mechanism of MMR-mediated DNA damage-induced apoptosis. PMID:24330662

  1. Mechanisms of Hg species induced toxicity in cultured human astrocytes: genotoxicity and DNA-damage response.

    PubMed

    Pieper, Imke; Wehe, Christoph A; Bornhorst, Julia; Ebert, Franziska; Leffers, Larissa; Holtkamp, Michael; Höseler, Pia; Weber, Till; Mangerich, Aswin; Bürkle, Alexander; Karst, Uwe; Schwerdtle, Tanja

    2014-03-01

    The toxicologically most relevant mercury (Hg) species for human exposure is methylmercury (MeHg). Thiomersal is a common preservative used in some vaccine formulations. The aim of this study is to get further mechanistic insight into the yet not fully understood neurotoxic modes of action of organic Hg species. Mercury species investigated include MeHgCl and thiomersal. Additionally HgCl2 was studied, since in the brain mercuric Hg can be formed by dealkylation of the organic species. As a cellular system astrocytes were used. In vivo astrocytes provide the environment necessary for neuronal function. In the present study, cytotoxic effects of the respective mercuricals increased with rising alkylation level and correlated with their cellular bioavailability. Further experiments revealed for all species at subcytotoxic concentrations no induction of DNA strand breaks, whereas all species massively increased H2O2-induced DNA strand breaks. This co-genotoxic effect is likely due to a disturbance of the cellular DNA damage response. Thus, at nanomolar, sub-cytotoxic concentrations, all three mercury species strongly disturbed poly(ADP-ribosyl)ation, a signalling reaction induced by DNA strand breaks. Interestingly, the molecular mechanism behind this inhibition seems to be different for the species. Since chronic PARP-1 inhibition is also discussed to sacrifice neurogenesis and learning abilities, further experiments on neurons and in vivo studies could be helpful to clarify whether the inhibition of poly(ADP-ribosyl)ation contributes to organic Hg induced neurotoxicity. PMID:24549367

  2. The Effect of a Grape Seed Extract on Radiation-Induced DNA Damage in Human Lymphocytes

    NASA Astrophysics Data System (ADS)

    Dicu, Tiberius; Postescu, Ion D.; Foriş, Vasile; Brie, Ioana; Fischer-Fodor, Eva; Cernea, Valentin; Moldovan, Mircea; Cosma, Constantin

    2009-05-01

    Plant-derived antioxidants due to their phenolic compounds content are reported as potential candidates for reducing the levels of oxidative stress in living organisms. Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Hydroethanolic (50/50, v/v) standardized extract was obtained from red grape seed (Vitis vinifera, variety Burgund Mare—BM). The total polyphenols content was evaluated by Folin-Ciocalteu procedure and expressed as μEq Gallic Acid/ml. The aim of this study was to evaluate the potential antioxidant effects of different concentrations of BM extract against 60Co γ-rays induced DNA damage in human lymphocytes. Samples of human lymphocytes were incubated with BM extract (12.5, 25.0 and 37.5 μEq GA/ml, respectively) administered at 30 minutes before in vitro irradiation with γ-rays (2 Gy). The DNA damage and repair in lymphocytes were evaluated using alkaline comet assay. Using the lesion score, the radiation-induced DNA damage was found to be significantly different (p<0.05) from control, both in the absence and presence of BM extract (except the lymphocytes treated with 37.5 μEq GA/ml BM extract). DNA repair analyzed by incubating the irradiated cells at 37° C and 5% CO2 atmosphere for 2 h, indicated a significant difference (p<0.05) in the lymphocytes group treated with 25.0 μEq GA/ml BM extract, immediately and two hours after irradiation. These results suggest radioprotective effects after treatment with BM extract in human lymphocytes.

  3. DNA damage and oxidative stress induced by imidacloprid exposure in the earthworm Eisenia fetida.

    PubMed

    Wang, Juan; Wang, Jinhua; Wang, Guangchi; Zhu, Lusheng; Wang, Jun

    2016-02-01

    To investigate the soil ecological effect of imidacloprid, earthworm Eisenia fetida was exposed to various concentrations of imidacloprid (0.10, 0.50, and 1.00 mg kg(-1) soil) respectively after 7, 14, 21, and 28 d. The effect of imidacloprid on reactive oxygen species (ROS) generation, antioxidant enzymes activity [superoxide dismutase (SOD) and catalase (CAT), glutathione S-transferase enzyme (GST)], malondialdehyde (MDA) content and DNA damage of the E. fetida was investigated. Significant increase of the ROS level was observed. The SOD and GST activity were significantly induced at most exposure intervals. CAT activity was inhibited and reflected a dose-dependent relationship on days 7, 14 and 21. High MDA levels were observed and the olive tail moment (OTM) as well as the percentage of DNA in the comet tail (tail DNA%) in comet assay declined with increasing concentrations and exposure time after 7 d. Our results suggested that the sub-chronic exposure of imidacloprid caused DNA damage and lipid peroxidation (LPO) leading to antioxidant responses in earthworm E. fetida. PMID:26397468

  4. Regulation of homologous recombinational repair by lamin B1 in radiation-induced DNA damage.

    PubMed

    Liu, Ning-Ang; Sun, Jiying; Kono, Kazuteru; Horikoshi, Yasunori; Ikura, Tsuyoshi; Tong, Xing; Haraguchi, Tokuko; Tashiro, Satoshi

    2015-06-01

    DNA double-strand breaks (DSBs) are the major lethal lesion induced by ionizing radiation (IR). RAD51-dependent homologous recombination (HR) is one of the most important pathways in DSB repair and genome integrity maintenance. However, the mechanism of HR regulation by RAD51 remains unclear. To understand the mechanism of RAD51-dependent HR, we searched for interacting partners of RAD51 by a proteomics analysis and identified lamin B1 in human cells. Lamins are nuclear lamina proteins that play important roles in the structural organization of the nucleus and the regulation of chromosome functions. Immunoblotting analyses revealed that siRNA-mediated lamin B1 depletion repressed the DNA damage-dependent increase of RAD51 after IR. The repression was abolished by the proteasome inhibitor MG132, suggesting that lamin B1 stabilizes RAD51 by preventing proteasome-mediated degradation in cells with IR-induced DNA damage. We also showed that lamin B1 depletion repressed RAD51 focus formation and decreased the survival rates after IR. On the basis of these results, we propose that lamin B1 promotes DSB repair and cell survival by maintaining the RAD51 protein levels for HR upon DSB induction after IR. PMID:25733566

  5. Switch telomerase to ALT mechanism by inducing telomeric DNA damages and dysfunction of ATRX and DAXX.

    PubMed

    Hu, Yang; Shi, Guang; Zhang, Laichen; Li, Feng; Jiang, Yuanling; Jiang, Shuai; Ma, Wenbin; Zhao, Yong; Songyang, Zhou; Huang, Junjiu

    2016-01-01

    Activation of telomerase or alternative lengthening of telomeres (ALT) is necessary for tumours to escape from dysfunctional telomere-mediated senescence. Anti-telomerase drugs might be effective in suppressing tumour growth in approximately 85-90% of telomerase-positive cancer cells. However, there are still chances for these cells to bypass drug treatment after switching to the ALT mechanism to maintain their telomere integrity. But the mechanism underlying this switch is unknown. In this study, we used telomerase-positive cancer cells (HTC75) to discover the mechanism of the telomerase-ALT switch by inducing telomere-specific DNA damage, alpha-thalassemia X-linked syndrome protein (ATRX) knockdown and deletion of death associated protein (DAXX). Surprisingly, two important ALT hallmarks in the ALT-like HTC75 cells were observed after treatments: ALT-associated promyelocytic leukaemia bodies (APBs) and extrachromosomal circular DNA of telomeric repeats. Moreover, knocking out hTERT by utilizing the CRISPR/Cas9 technique led to telomere elongation in a telomerase-independent manner in ALT-like HTC75 cells. In summary, this is the first report to show that inducing telomeric DNA damage, disrupting the ATRX/DAXX complex and inhibiting telomerase activity in telomerase-positive cancer cells lead to the ALT switch. PMID:27578458

  6. Switch telomerase to ALT mechanism by inducing telomeric DNA damages and dysfunction of ATRX and DAXX

    PubMed Central

    Hu, Yang; Shi, Guang; Zhang, Laichen; Li, Feng; Jiang, Yuanling; Jiang, Shuai; Ma, Wenbin; Zhao, Yong; Songyang, Zhou; Huang, Junjiu

    2016-01-01

    Activation of telomerase or alternative lengthening of telomeres (ALT) is necessary for tumours to escape from dysfunctional telomere-mediated senescence. Anti-telomerase drugs might be effective in suppressing tumour growth in approximately 85–90% of telomerase-positive cancer cells. However, there are still chances for these cells to bypass drug treatment after switching to the ALT mechanism to maintain their telomere integrity. But the mechanism underlying this switch is unknown. In this study, we used telomerase-positive cancer cells (HTC75) to discover the mechanism of the telomerase-ALT switch by inducing telomere-specific DNA damage, alpha-thalassemia X-linked syndrome protein (ATRX) knockdown and deletion of death associated protein (DAXX). Surprisingly, two important ALT hallmarks in the ALT-like HTC75 cells were observed after treatments: ALT-associated promyelocytic leukaemia bodies (APBs) and extrachromosomal circular DNA of telomeric repeats. Moreover, knocking out hTERT by utilizing the CRISPR/Cas9 technique led to telomere elongation in a telomerase-independent manner in ALT-like HTC75 cells. In summary, this is the first report to show that inducing telomeric DNA damage, disrupting the ATRX/DAXX complex and inhibiting telomerase activity in telomerase-positive cancer cells lead to the ALT switch. PMID:27578458

  7. Autophagy induced by cathepsin S inhibition induces early ROS production, oxidative DNA damage, and cell death via xanthine oxidase.

    PubMed

    Huang, Chien-Chang; Chen, Kuo-Li; Cheung, Chun Hei Antonio; Chang, Jang-Yang

    2013-12-01

    Cathepsin S plays multiple roles in MHC class II antigen presentation, extracellular matrix degradation, angiogenesis, and tumorogenesis. Our previous study revealed that targeting cathepsin S could induce cellular cytotoxicity and reduce cell viability. For the current study, we further investigated the molecular mechanism responsible for targeting cathepsin S-induced cell death and its association with autophagy. Distinct from regulation of the classic autophagy pathway by reactive oxygen species (ROS), we demonstrated that autophagy is the genuine regulator of early ROS production. The molecular silencing of autophagy-dependent ATG genes (ATG5, ATG7, and LC3) and the pharmacologic inhibition of autophagy with 3-MA and wortmannin reduced ROS production significantly. In addition, xanthine oxidase (XO), which is upregulated by autophagy, is required for early ROS production, oxidative DNA damage, and consequent cell death. Autophagy inhibition suppresses the upregulation of XO, which is induced by cathepsin S inhibition, resulting in reduced ROS generation, DNA damage, and cell death. Collectively, our study reveals a noncanonical molecular pathway in which, after the inhibition of cathepsin S, autophagy induces early ROS production for oxidative DNA damage and cell death through XO. PMID:23892358

  8. The role of reactive oxygen species in the herbicide acetochlor-induced DNA damage on Bufo raddei tadpole liver.

    PubMed

    Liu, Yang; Zhang, Yingmei; Liu, Jianghai; Huang, Dejun

    2006-06-10

    After exposure of Bufo raddei tadpoles to acetochlor (ACETO) for 14 days, malondialdehyde (MDA) and DNA-single strand break (DNA-SSB) in livers were analyzed. An enhanced accumulation of MDA suggests that ACETO causes oxidative stress, and the significant increase in the level of DNA-SSB indicates that ACETO induces DNA damage in a dose-dependent manner as well. On the basis of the fact that oxidative stress is caused by excessive production of reactive oxygen species (ROS), and the present results, we speculate that ACETO-induced DNA damage may be a consequence of the generation of ROS. To evaluate this hypothesis, tadpoles were treated with ROS scavenger, N-acetyl-L-cysteine (NAC) or melatonin (MEL), prior to ACETO exposure. The decrease of DNA-SSB level and the increase of total antioxidant capability (TAC) show that ACETO-caused DNA damage can be attenuated by NAC and MEL. In addition, a negative correlation was observed between the extent of DNA damage and the level of TAC in tadpole liver. In conclusion, the results suggest that ACETO-induced DNA damage is mediated by ROS. PMID:16513190

  9. Optical detection of DNA damage

    NASA Astrophysics Data System (ADS)

    Rogers, Kim R.; Apostol, A.; Cembrano, J.

    1999-02-01

    A rapid and sensitive fluorescence assay for oxidative damage to calf thymus DNA is reported. A decrease in the transition temperature for strand separation resulted from exposure of the DNA to the reactive decomposition products of 3- morpholinosydnonimine (SIN-1) (i.e., nitric oxide, superoxide, peroxynitrite, hydrogen peroxide, and hydroxyl radicals). A decrease in melting temperature of 12 degrees Celsius was indicative of oxidative damage including single strand chain breaks. Double stranded (ds) and single stranded (ss) forms of DNA were determined using the indicator dyes ethidium bromide and PicoGreen. The change in DNA 'melting' curves was dependant on the concentration of SIN-1 and was most pronounced at 75 degrees Celsius. This chemically induced damage was significantly inhibited by sodium citrate, tris(hydroxymethyl)aminomethane (Tris), and diethylenetriaminepentaacetic acid (DTPA), but was unaffected by superoxide dismutase (SOD), catalase, ethylenediamine tetraacietic acid (EDTA), or deferoxamine. Lowest observable effect level for SIN-1-induced damage was 200 (mu) M.

  10. Rapamycin‐induced autophagy sensitizes A549 cells to radiation associated with DNA damage repair inhibition

    PubMed Central

    Li, Yong; Liu, Fen; Wang, Yong; Li, Donghai; Guo, Fei; Xu, Liyao; Zeng, Zhengguo; Zhong, Xiaojun

    2016-01-01

    Abstract Background Autophagy has been reported to increase in cancer cells after radiation. However, it remains unknown whether increased autophagy as a result of radiation affects DNA damage repair and sensitizes cancer cells. In this study, the radiosensitization effect of rapamycin, a mammalian target of rapamycin inhibitor that induces autophagy, on human lung adenocarcinoma A549 cells was investigated. Methods A549 cells were treated with different concentrations of rapamycin. Cell viability was evaluated by methyl‐thiazolyl‐tetrazolium assay. Survival fraction values of A549 cells after radiotherapy were detected by colony formation assay. Autophagosome was observed by a transmission electron microscope. Furthermore, Western blot was employed to examine alterations in autophagy protein LC3 and p62, DNA damage protein γ–H2AX, and DNA damage repair proteins Rad51, Ku70, and Ku80. Rad51, Ku70, and Ku80 messenger ribonucleic acid (mRNA) expression levels were examined by real‐time polymerase chain reaction. Results Rapamycin suppressed A549 cell proliferation in dose and time‐dependent manners. An inhibitory concentration (IC) 10 dose of rapamycin could induce autophagy in A549 cells. Rapamycin combined with radiation significantly decreased the colony forming ability of cells, compared with rapamycin or radiation alone. Rapamycin and radiation combined increased γ–H2AX expression levels and decreased Rad51 and Ku80 expression levels, compared with single regimens. However, rapamycin treatment did not induce any change in Rad51, Ku70, and Ku80 mRNA levels, regardless of radiation. Conclusions These findings indicate that increasing autophagy sensitizes lung cancer cells to radiation. PMID:27385978

  11. XPD-dependent activation of apoptosis in response to triplex-induced DNA damage

    PubMed Central

    Kaushik Tiwari, Meetu; Rogers, Faye A.

    2013-01-01

    DNA sequences capable of forming triplexes are prevalent in the human genome and have been found to be intrinsically mutagenic. Consequently, a balance between DNA repair and apoptosis is critical to counteract their effect on genomic integrity. Using triplex-forming oligonucleotides to synthetically create altered helical distortions, we have determined that pro-apoptotic pathways are activated by the formation of triplex structures. Moreover, the TFIIH factor, XPD, occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. Here, we show that triplexes are capable of inducing XPD-independent double strand breaks, which result in the formation of γH2AX foci. XPD was subsequently recruited to the triplex-induced double strand breaks and co-localized with γH2AX at the damage site. Furthermore, phosphorylation of H2AX tyrosine 142 was found to stimulate the signaling pathway of XPD-dependent apoptosis. We suggest that this mechanism may play an active role in minimizing genomic instability induced by naturally occurring noncanonical structures, perhaps protecting against cancer initiation. PMID:23913414

  12. Hsp90 induces increased genomic instability toward DNA-damaging agents by tuning down RAD53 transcription.

    PubMed

    Khurana, Nidhi; Laskar, Shyamasree; Bhattacharyya, Mrinal K; Bhattacharyya, Sunanda

    2016-08-01

    It is well documented that elevated body temperature causes tumors to regress upon radiotherapy. However, how hyperthermia induces DNA damage sensitivity is not clear. We show that a transient heat shock and particularly the concomitant induction of Hsp90 lead to increased genomic instability under DNA-damaging conditions. Using Saccharomyces cerevisiae as a model eukaryote, we demonstrate that elevated levels of Hsp90 attenuate efficient DNA damage signaling and dictate preferential use of the potentially mutagenic double-strand break repair pathway. We show that under normal physiological conditions, Hsp90 negatively regulates RAD53 transcription to suppress DNA damage checkpoint activation. However, under DNA damaging conditions, RAD53 is derepressed, and the increased level of Rad53p triggers an efficient DNA damage response. A higher abundance of Hsp90 causes increased transcriptional repression on RAD53 in a dose-dependent manner, which could not be fully derepressed even in the presence of DNA damage. Accordingly, cells behave like a rad53 loss-of-function mutant and show reduced NHEJ efficiency, with a drastic failure to up-regulate RAD51 expression and manifestly faster accumulation of CLN1 and CLN2 in DNA-damaged G1, cells leading to premature release from checkpoint arrest. We further demonstrate that Rad53 overexpression is able to rescue all of the aforementioned deleterious effects caused by Hsp90 overproduction. PMID:27307581

  13. Enhanced susceptibility of ovaries from obese mice to 7,12-dimethylbenz[a]anthracene-induced DNA damage

    SciTech Connect

    Ganesan, Shanthi Nteeba, Jackson Keating, Aileen F.

    2014-12-01

    7,12-Dimethylbenz[a]anthracene (DMBA) depletes ovarian follicles and induces DNA damage in extra-ovarian tissues, thus, we investigated ovarian DMBA-induced DNA damage. Additionally, since obesity is associated with increased offspring birth defect incidence, we hypothesized that a DMBA-induced DNA damage response (DDR) is compromised in ovaries from obese females. Wild type (lean) non agouti (a/a) and KK.Cg-Ay/J heterozygote (obese) mice were dosed with sesame oil or DMBA (1 mg/kg; intraperitoneal injection) at 18 weeks of age, for 14 days. Total ovarian RNA and protein were isolated and abundance of Ataxia telangiectasia mutated (Atm), X-ray repair complementing defective repair in Chinese hamster cells 6 (Xrcc6), breast cancer type 1 (Brca1), Rad 51 homolog (Rad51), poly [ADP-ribose] polymerase 1 (Parp1) and protein kinase, DNA-activated, catalytic polypeptide (Prkdc) were quantified by RT-PCR or Western blot. Phosphorylated histone H2AX (γH2AX) level was determined by Western blotting. Obesity decreased (P < 0.05) basal protein abundance of PRKDC and BRCA1 proteins but increased (P < 0.05) γH2AX and PARP1 proteins. Ovarian ATM, XRCC6, PRKDC, RAD51 and PARP1 proteins were increased (P < 0.05) by DMBA exposure in lean mice. A blunted DMBA-induced increase (P < 0.05) in XRCC6, PRKDC, RAD51 and BRCA1 was observed in ovaries from obese mice, relative to lean counterparts. Taken together, DMBA exposure induced γH2AX as well as the ovarian DDR, supporting that DMBA causes ovarian DNA damage. Additionally, ovarian DDR was partially attenuated in obese females raising concern that obesity may be an additive factor during chemical-induced ovotoxicity. - Highlights: • DMBA induces markers of ovarian DNA damage. • Obesity induces low level ovarian DNA damage. • DMBA-induced DNA repair response is altered by obesity.

  14. DNA Damage Response

    PubMed Central

    Giglia-Mari, Giuseppina; Zotter, Angelika; Vermeulen, Wim

    2011-01-01

    Structural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network of DNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance processes, and cell-cycle checkpoints safeguard genomic integrity. Like transcription and replication, DDR is a chromatin-associated process that is generally tightly controlled in time and space. As DNA damage can occur at any time on any genomic location, a specialized spatio-temporal orchestration of this defense apparatus is required. PMID:20980439

  15. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    SciTech Connect

    Yoshimura, Akari; Kobayashi, Yume; Tada, Shusuke; Seki, Masayuki; Enomoto, Takemi

    2014-09-12

    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  16. Perfluorooctane sulfonate exposure causes gonadal developmental toxicity in Caenorhabditis elegans through ROS-induced DNA damage.

    PubMed

    Guo, Xiaoying; Li, Qingqing; Shi, Jue; Shi, Liulin; Li, Buqing; Xu, An; Zhao, Guoping; Wu, Lijun

    2016-07-01

    Perfluorooctane sulfonate (PFOS), a common persistent organic pollutant, has been reported to show potential developmental toxicity in many animal studies. However, little was known about its effects on reproductive tissues, especially in the germ line. In the present study, Caenorhabditis elegans was used as an in vivo experimental model to study the developmental toxicity caused by PFOS exposure, especially in the gonads. Our results showed that PFOS exposure significantly retarded gonadal development, as shown by the increased number of worms that remained in the larval stages after hatched L1-stage larvae were exposed to PFOS for 72 h. Investigation of germ line proliferation following PFOS exposure showed that the number of total germ cells reduced in a dose-dependent manner when L1-stage larvae were exposed to 0-25.0 μM PFOS. PFOS exposure induced transient mitotic cell cycle arrest and apoptosis in the germ line. Quantification of DNA damage in proliferating germ cells and production of reactive oxygen species (ROS) showed that distinct foci of HUS-1:GFP and ROS significantly increased in the PFOS-treated groups, whereas the decrease in mitotic germ cell number and the enhanced apoptosis induced by PFOS exposure were effectively rescued upon addition of dimethyl sulfoxide (DMSO) and mannitol (MNT). These results suggested that ROS-induced DNA damage might play a pivotal role in the impairment of gonadal development indicated by the reduction in total germ cells, transient mitotic cell cycle arrest, and apoptosis. PMID:27108369

  17. Prion-induced neurotoxicity: Possible role for cell cycle activity and DNA damage response

    PubMed Central

    Bujdoso, Raymond; Landgraf, Matthias; Jackson, Walker S; Thackray, Alana M

    2015-01-01

    Protein misfolding neurodegenerative diseases arise through neurotoxicity induced by aggregation of host proteins. These conditions include Alzheimer’s disease, Huntington’s disease, Parkinson’s disease, motor neuron disease, tauopathies and prion diseases. Collectively, these conditions are a challenge to society because of the increasing aged population and through the real threat to human food security by animal prion diseases. It is therefore important to understand the cellular and molecular mechanisms that underlie protein misfolding-induced neurotoxicity as this will form the basis for designing strategies to alleviate their burden. Prion diseases are an important paradigm for neurodegenerative conditions in general since several of these maladies have now been shown to display prion-like phenomena. Increasingly, cell cycle activity and the DNA damage response are recognised as cellular events that participate in the neurotoxic process of various neurodegenerative diseases, and their associated animal models, which suggests they are truly involved in the pathogenic process and are not merely epiphenomena. Here we review the role of cell cycle activity and the DNA damage response in neurodegeneration associated with protein misfolding diseases, and suggest that these events contribute towards prion-induced neurotoxicity. In doing so, we highlight PrP transgenic Drosophila as a tractable model for the genetic analysis of transmissible mammalian prion disease. PMID:26279981

  18. Effects of Spaceflight on Molecular and Cellular Responses to Bleomycin-Induced DNA Damages in Confluent Human Fibroblasts

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu

    2016-01-01

    Spaceflights expose human beings to various risk factors. Among them are microgravity related physiological stresses in immune, cytoskeletal, and cardiovascular systems, and space radiation related elevation of cancer risk. Cosmic radiation consists of energetic protons and other heavier charged particles that induce DNA damages. Effective DNA damage response and repair mechanism is important to maintain genomic integrity and reduce cancer risk. There were studies on effects of spaceflight and microgravity on DNA damage response in cell and animal models, but the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on molecular and cellular responses to DNA damages, bleomycin, an anti-cancer drug and radiomimetic reagent, was used to induce DNA damages in confluent human fibroblasts flown to the International Space Station (ISS) and on ground. After exposure to 1.0 µg/ml bleomycin for 3 hours, cells were fixed for immunofluorescence assays and for RNA preparation. Extents of DNA damages were quantified by foci and pattern counting of phosphorylated histone protein H2AX (?-H2AX). The cells on the ISS showed modestly increased average foci counts per nucleus while the distribution of patterns was similar to that on the ground. PCR array analysis showed that expressions of several genes, including CDKN1A and PCNA, were significantly changed in response to DNA damages induced by bleomycin in both flight and ground control cells. However, there were no significant differences in the overall expression profile of DNA damage response genes between the flight and ground samples. Analysis of cellular proliferation status with Ki-67 staining showed a slightly higher proliferating population in cells on the ISS than those on ground. Our results suggested that the difference in ?-H2AX focus counts between flight and ground was due to the higher percentage of proliferating cells in space, but spaceflight did not significantly affect

  19. XRCC1 Arg399Gln was associated with repair capacity for DNA damage induced by occupational chromium exposure

    PubMed Central

    2012-01-01

    Background Occupational chromium exposure may induce DNA damage and lead to lung cancer and other work-related diseases. DNA repair gene polymorphisms, which may alter the efficiency of DNA repair, thus may contribute to genetic susceptibility of DNA damage. The aim of this study was to test the hypothesis that the genetic variations of 9 major DNA repair genes could modulate the hexavalent chromium (Cr (VI))-induced DNA damage. Findings The median (P25-P75) of Olive tail moment was 0.93 (0.58–1.79) for individuals carrying GG genotype of XRCC1 Arg399Gln (G/A), 0.73 (0.46–1.35) for GA heterozygote and 0.50 (0.43–0.93) for AA genotype. Significant difference was found among the subjects with three different genotypes (P = 0.048) after adjusting the confounding factors. The median of Olive tail moment of the subjects carrying A allele (the genotypes of AA and GA) was 0.66 (0.44–1.31), which was significantly lower than that of subjects with GG genotype (P = 0.043). The A allele conferred a significantly reduced risk of DNA damage with the OR of 0.39 (95% CI: 0.15–0.99, P = 0.048). No significant association was found between the XRCC1Arg194Trp, ERCC1 C8092A, ERCC5 His1104Asp, ERCC6 Gly399Asp, GSTP1 Ile105Val, OGG1 Ser326Cys, XPC Lys939Gln, XPD Lys751Gln and DNA damage. Conclusion The polymorphism of Arg399Gln in XRCC1 was associated with the Cr (VI)- induced DNA damage. XRCC1 Arg399Gln may serve as a genetic biomarker of susceptibility for Cr (VI)- induced DNA damage. PMID:22642904

  20. XPC is essential for nucleotide excision repair of zidovudine-induced DNA damage in human hepatoma cells

    SciTech Connect

    Wu Qiangen; Beland, Frederick A.; Chang, Ching-Wei; Fang Jialong

    2011-03-01

    Zidovudine (3'-azido-3'-dexoythymidine, AZT), a nucleoside reverse transcriptase inhibitor, can be incorporated into DNA and cause DNA damage. The mechanisms underlying the repair of AZT-induced DNA damage are unknown. To investigate the pathways involved in the recognition and repair of AZT-induced DNA damage, human hepatoma HepG2 cells were incubated with AZT for 2 weeks and the expression of DNA damage signaling pathways was determined using a pathway-based real-time PCR array. Compared to control cultures, damaged DNA binding and nucleotide excision repair (NER) pathways showed significantly increased gene expression. Further analysis indicated that AZT treatment increased the expression of genes associated with NER, including XPC, XPA, RPA1, GTF2H1, and ERCC1. Western blot analysis demonstrated that the protein levels of XPC and GTF2H1 were also significantly up-regulated. To explore further the function of XPC in the repair of AZT-induced DNA damage, XPC expression was stably knocked down by 71% using short hairpin RNA interference. In the XPC knocked-down cells, 100 {mu}M AZT treatment significantly increased [{sup 3}H]AZT incorporation into DNA, decreased the total number of viable cells, increased the release of lactate dehydrogenase, induced apoptosis, and caused a more extensive G2/M cell cycle arrest when compared to non-transfected HepG2 cells or HepG2 cells transfected with a scrambled short hairpin RNA sequence. Overall, these data indicate that XPC plays an essential role in the NER repair of AZT-induced DNA damage.

  1. Demethoxycurcumin-induced DNA Damage Decreases DNA Repair-associated Protein Expression Levels in NCI-H460 Human Lung Cancer Cells.

    PubMed

    Ko, Yang-Ching; Lien, Jin-Cherng; Liu, Hsin-Chung; Hsu, Shu-Chun; Lin, Hui-Yi; Chueh, Fu-Shin; Ji, Bin-Chuan; Yang, Mei-Due; Hsu, Wu-Huei; Chung, Jing-Gung

    2015-05-01

    Demethoxycurcumin (DMC) is a key component of Chinese medicine (Turmeric) and has been proven effective in killing various cancer cells. Its role in inducing cytotoxic effects in many cancer cells has been reported, but its role regarding DNA damage on lung cancer cells has not been studied in detail. In the present study, we demonstrated DMC-induced DNA damage and condensation in NCI-H460 cells by using the Comet assay and DAPI staining examinations, respectively. Western blotting indicated that DMC suppressed the protein levels associated with DNA damage and repair, such as 14-3-3σ (an important checkpoint keeper of DNA damage response), DNA repair proteins breast cancer 1, early onset (BRCA1), O6-methylguanine-DNA methyltransferase (MGMT), mediator of DNA damage checkpoint 1 (MDC1), and p53 (tumor suppressor protein). DMC activated phosphorylated p53 and p-H2A.X (phospho Ser140) in NCI-H460 cells. Furthermore, we used confocal laser systems microscopy to examine the protein translocation. The results showed that DMC promotes the translocation of p-p53 and p-H2A.X from the cytosol to the nuclei in NCI-H460 cells. Taken together, DMC induced DNA damage and affected DNA repair proteins in NCI-H460 cells in vitro. PMID:25964547

  2. 8-Hydroxy-2'-deoxyguanosine as a biomarker of oxidative DNA damage induced by perfluorinated compounds in TK6 cells.

    PubMed

    Yahia, Doha; Haruka, Igarashi; Kagashi, Yae; Tsuda, Shuji

    2016-02-01

    8-Hydroxy-2'-deoxyguanosine (8-OHdG) is the most common biomarker of oxidative DNA damage, it is formed by chemical carcinogens and can be measured in any species. Perfluorooctanoic acid (PFOA) and perfluorononanoic acid (PFNA) are suspected genotoxic carcinogens through induction of reactive oxygen species that are responsible for oxidative DNA damage. This study was conducted to investigate the in vitro genotoxicity of PFOA and PFNA in human lymphoblastoid (TK6) cell line. TK6 cells were exposed to PFOA at 0, 125, 250, and 500 ppm and PFNA at 125 and 250 ppm for 2 h. Single cell gel electrophoresis (comet assay) was used to measure DNA damage; at least 50 cells per sample were analyzed using comet Assay Software Project (CASP). 8-OHdG was measured in DNA of exposed cells using high-performance liquid chromatography (HPLC)-mass spectrometry (MS)/MS. Results showed that both PFOA and PFNA induced DNA damage indicated by increased tail length (DNA migration). The level of 8-OHdG was increased in a dose-dependent manner in both PFOA and PFNA exposure. We concluded that PFOA and PFNA induced DNA damage and the biomarker of oxidative DNA damage (8-OHdG) could be measured by HPLC-MS/MS. In addition, PFNA produced high level of 8-OHdG at concentrations lower than PFOA, this may indicate that PFNA is more potent genotoxicant for TK6 cells than PFOA. PMID:25113910

  3. Roles of PCNA ubiquitination and TLS polymerases κ and η in the bypass of methyl methanesulfonate-induced DNA damage

    PubMed Central

    Wit, Niek; Buoninfante, Olimpia Alessandra; van den Berk, Paul C.M.; Jansen, Jacob G.; Hogenbirk, Marc A.; de Wind, Niels; Jacobs, Heinz

    2015-01-01

    Translesion synthesis (TLS) provides a highly conserved mechanism that enables DNA synthesis on a damaged template. TLS is performed by specialized DNA polymerases of which polymerase (Pol) κ is important for the cellular response to DNA damage induced by benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), ultraviolet (UV) light and the alkylating agent methyl methanesulfonate (MMS). As TLS polymerases are intrinsically error-prone, tight regulation of their activity is required. One level of control is provided by ubiquitination of the homotrimeric DNA clamp PCNA at lysine residue 164 (PCNA-Ub). We here show that Polκ can function independently of PCNA modification and that Polη can function as a backup during TLS of MMS-induced lesions. Compared to cell lines deficient for PCNA modification (PcnaK164R) or Polκ, double mutant cell lines display hypersensitivity to MMS but not to BPDE or UV-C. Double mutant cells also displayed delayed post-replicative TLS, accumulate higher levels of replication stress and delayed S-phase progression. Furthermore, we show that Polη and Polκ are redundant in the DNA damage bypass of MMS-induced DNA damage. Taken together, we provide evidence for PCNA-Ub-independent activation of Polκ and establish Polη as an important backup polymerase in the absence of Polκ in response to MMS-induced DNA damage. PMID:25505145

  4. Human mismatch repair, drug-induced DNA damage, and secondary cancer.

    PubMed

    Karran, Peter; Offman, Judith; Bignami, Margherita

    2003-11-01

    DNA mismatch repair (MMR) is an important replication error avoidance mechanism that prevents mutation. The association of defective MMR with familial and sporadic gastrointestinal and endometrial cancer has been acknowledged for some years. More recently, it has become apparent that MMR defects are common in acute myeloid leukaemia/myelodysplastic syndrome (AML/MDS) that follows successful chemotherapy for a primary malignancy. Therapy-related haematological malignancies are often associated with treatment with alkylating agents. Their frequency is increasing and they now account for at least 10% of all AML cases. There is also evidence for an association between MMR deficient AML/MDS and immunosuppressive treatment with thiopurine drugs. Here we review how MMR interacts with alkylating agent and thiopurine-induced DNA damage and suggest possible ways in which MMR defects may arise in therapy-related AML/MDS. PMID:14726020

  5. Levetiracetam mitigates doxorubicin-induced DNA and synaptic damage in neurons

    PubMed Central

    Manchon, Jose Felix Moruno; Dabaghian, Yuri; Uzor, Ndidi-Ese; Kesler, Shelli R.; Wefel, Jeffrey S.; Tsvetkov, Andrey S.

    2016-01-01

    Neurotoxicity may occur in cancer patients and survivors during or after chemotherapy. Cognitive deficits associated with neurotoxicity can be subtle or disabling and frequently include disturbances in memory, attention, executive function and processing speed. Searching for pathways altered by anti-cancer treatments in cultured primary neurons, we discovered that doxorubicin, a commonly used anti-neoplastic drug, significantly decreased neuronal survival. The drug promoted the formation of DNA double-strand breaks in primary neurons and reduced synaptic and neurite density. Pretreatment of neurons with levetiracetam, an FDA-approved anti-epileptic drug, enhanced survival of chemotherapy drug-treated neurons, reduced doxorubicin-induced formation of DNA double-strand breaks, and mitigated synaptic and neurite loss. Thus, levetiracetam might be part of a valuable new approach for mitigating synaptic damage and, perhaps, for treating cognitive disturbances in cancer patients and survivors. PMID:27168474

  6. Levetiracetam mitigates doxorubicin-induced DNA and synaptic damage in neurons.

    PubMed

    Manchon, Jose Felix Moruno; Dabaghian, Yuri; Uzor, Ndidi-Ese; Kesler, Shelli R; Wefel, Jeffrey S; Tsvetkov, Andrey S

    2016-01-01

    Neurotoxicity may occur in cancer patients and survivors during or after chemotherapy. Cognitive deficits associated with neurotoxicity can be subtle or disabling and frequently include disturbances in memory, attention, executive function and processing speed. Searching for pathways altered by anti-cancer treatments in cultured primary neurons, we discovered that doxorubicin, a commonly used anti-neoplastic drug, significantly decreased neuronal survival. The drug promoted the formation of DNA double-strand breaks in primary neurons and reduced synaptic and neurite density. Pretreatment of neurons with levetiracetam, an FDA-approved anti-epileptic drug, enhanced survival of chemotherapy drug-treated neurons, reduced doxorubicin-induced formation of DNA double-strand breaks, and mitigated synaptic and neurite loss. Thus, levetiracetam might be part of a valuable new approach for mitigating synaptic damage and, perhaps, for treating cognitive disturbances in cancer patients and survivors. PMID:27168474

  7. Contributions of DNA repair, cell cycle checkpoints and cell death to suppressing the DNA damage-induced tumorigenic behavior of Drosophila epithelial cells.

    PubMed

    Dekanty, A; Barrio, L; Milán, M

    2015-02-19

    When exposed to DNA-damaging agents, components of the DNA damage response (DDR) pathway trigger apoptosis, cell cycle arrest and DNA repair. Although failures in this pathway are associated with cancer development, the tumor suppressor roles of cell cycle arrest and apoptosis have recently been questioned in mouse models. Using Drosophila epithelial cells that are unable to activate the apoptotic program, we provide evidence that ionizing radiation (IR)-induced DNA damage elicits a tumorigenic behavior in terms of E-cadherin delocalization, cell delamination, basement membrane degradation and neoplasic overgrowth. The tumorigenic response of the tissue to IR is enhanced by depletion of Okra/DmRAD54 or spnA/DmRAD51--genes required for homologous recombination (HR) repair of DNA double-strand breaks in G2--and it is independent of the activity of Lig4, a ligase required for nonhomologous end-joining repair in G1. Remarkably, depletion of Grapes/DmChk1 or Mei-41/dATR-genes affecting DNA damage-induced cell cycle arrest in G2--compromised DNA repair and enhanced the tumorigenic response of the tissue to IR. On the contrary, DDR-independent lengthening of G2 had a positive impact on the dynamics of DNA repair and suppressed the tumorigenic response of the tissue to IR. Our results support a tumor suppressor role of apoptosis, DNA repair by HR and cell cycle arrest in G2 in simple epithelia subject to IR-induced DNA damage. PMID:24632609

  8. Inactivation of NADPH Oxidases NOX4 and NOX5 Protects Human Primary Fibroblasts from Ionizing Radiation-Induced DNA Damage

    PubMed Central

    Weyemi, Urbain; Redon, Christophe E.; Aziz, Towqir; Choudhuri, Rohini; Maeda, Daisuke; Parekh, Palak R.; Bonner, Michael Y.; Arbiser, Jack L.; Bonner, William M.

    2015-01-01

    Human exposure to ionizing radiation from medical procedures has increased sharply in the last three decades. Recent epidemiological studies suggest a direct relationship between exposure to ionizing radiation and health problems, including cancer incidence. Therefore, minimizing the impact of radiation exposure in patients has become a priority in the development of future clinical practices. Crucial players in radiation-induced DNA damage include reactive oxygen species (ROS), but the sources of these have remained elusive. To the best of our knowledge, we show here for the first time that two members of the ROS-generating NADPH oxidase family (NOXs), NOX4 and NOX5, are involved in radiation-induced DNA damage. Depleting these two NOXs in human primary fibroblasts resulted in reduced levels of DNA damage as measured by levels of radiation-induced foci, a marker of DNA double-strand breaks (DSBs) and the comet assay coupled with increased cell survival. NOX involvement was substantiated with fulvene-5, a NOXs-specific inhibitor. Moreover, fulvene-5 mitigated radiation-induced DNA damage in human peripheral blood mononuclear cells ex vivo. Our results provide evidence that the inactivation of NOXs protects cells from radiation-induced DNA damage and cell death. These findings suggest that NOXs inhibition may be considered as a future pharmacological target to help minimize the negative effects of radiation exposure for millions of patients each year. PMID:25706776

  9. Biomolecular Damage Induced by Ionizing Radiation: The Direct and Indirect Effects of Low-Energy Electrons on DNA

    NASA Astrophysics Data System (ADS)

    Alizadeh, Elahe; Orlando, Thomas M.; Sanche, Léon

    2015-04-01

    Many experimental and theoretical advances have recently allowed the study of direct and indirect effects of low-energy electrons (LEEs) on DNA damage. In an effort to explain how LEEs damage the human genome, researchers have focused efforts on LEE interactions with bacterial plasmids, DNA bases, sugar analogs, phosphate groups, and longer DNA moieties. Here, we summarize the current understanding of the fundamental mechanisms involved in LEE-induced damage of DNA and complex biomolecule films. Results obtained by several laboratories on films prepared and analyzed by different methods and irradiated with different electron-beam current densities and fluencies are presented. Despite varied conditions (e.g., film thicknesses and morphologies, intrinsic water content, substrate interactions, and extrinsic atmospheric compositions), comparisons show a striking resemblance in the types of damage produced and their yield functions. The potential of controlling this damage using molecular and nanoparticle targets with high LEE yields in targeted radiation-based cancer therapies is also discussed.

  10. Formation, Accumulation, and Hydrolysis of Endogenous and Exogenous Formaldehyde-Induced DNA Damage.

    PubMed

    Yu, Rui; Lai, Yongquan; Hartwell, Hadley J; Moeller, Benjamin C; Doyle-Eisele, Melanie; Kracko, Dean; Bodnar, Wanda M; Starr, Thomas B; Swenberg, James A

    2015-07-01

    Formaldehyde is not only a widely used chemical with well-known carcinogenicity but is also a normal metabolite of living cells. It thus poses unique challenges for understanding risks associated with exposure. N(2-)hydroxymethyl-dG (N(2)-HOMe-dG) is the main formaldehyde-induced DNA mono-adduct, which together with DNA-protein crosslinks (DPCs) and toxicity-induced cell proliferation, play important roles in a mutagenic mode of action for cancer. In this study, N(2)-HOMe-dG was shown to be an excellent biomarker for direct adduction of formaldehyde to DNA and the hydrolysis of DPCs. The use of inhaled [(13)CD2]-formaldehyde exposures of rats and primates coupled with ultrasensitive nano ultra performance liquid chromatography-tandem mass spectrometry permitted accurate determinations of endogenous and exogenous formaldehyde DNA damage. The results show that inhaled formaldehyde only reached rat and monkey noses, but not tissues distant to the site of initial contact. The amounts of exogenous adducts were remarkably lower than those of endogenous adducts in exposed nasal epithelium. Moreover, exogenous adducts accumulated in rat nasal epithelium over the 28-days exposure to reach steady-state concentrations, followed by elimination with a half-life (t1/2) of 7.1 days. Additionally, we examined artifact formation during DNA preparation to ensure the accuracy of nonlabeled N(2)-HOMe-dG measurements. These novel findings provide critical new data for understanding major issues identified by the National Research Council Review of the 2010 Environmental Protection Agency's Draft Integrated Risk Information System Formaldehyde Risk Assessment. They support a data-driven need for reflection on whether risks have been overestimated for inhaled formaldehyde, whereas underappreciating endogenous formaldehyde as the primary source of exposure that results in bone marrow toxicity and leukemia in susceptible humans and rodents deficient in DNA repair. PMID:25904104

  11. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE: INDUCED BY RADIATION, CHEMICALS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This assay is based on the ability of certain dyes to fluoresce upon intercalation with dsDNA. Damage caused by ultraviolet (UV) radiation, chemicals or restriction enzymes is detected using this assay. UV radiation at...

  12. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY RADIATION, CHEMICAL MUTAGENS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This novel assay is based on changes in melting/annealing behavior and facilitated using certain dyes that increase their fluorescence upon association with double stranded (ds)DNA. Damage caused by ultraviolet (UV) ra...

  13. Spatiotemporal characterization of ionizing radiation induced DNA damage foci and their relation to chromatin organization

    SciTech Connect

    Costes, Sylvain V; Chiolo, Irene; Pluth, Janice M.; Barcellos-Hoff, Mary Helen; Jakob, Burkhard

    2009-09-15

    DNA damage sensing proteins have been shown to localize to the sites of DSB within seconds to minutes following ionizing radiation (IR) exposure, resulting in the formation of microscopically visible nuclear domains referred to as radiation-induced foci (RIF). This review characterizes the spatio-temporal properties of RIF at physiological doses, minutes to hours following exposure to ionizing radiation, and it proposes a model describing RIF formation and resolution as a function of radiation quality and nuclear densities. Discussion is limited to RIF formed by three interrelated proteins ATM (Ataxia telangiectasia mutated), 53BP1 (p53 binding protein 1) and ?H2AX (phosphorylated variant histone H2AX). Early post-IR, we propose that RIF mark chromatin reorganization, leading to a local nuclear scaffold rigid enough to keep broken DNA from diffusing away, but open enough to allow the repair machinery. We review data indicating clear kinetic and physical differences between RIF emerging from dense and uncondensed regions of the nucleus. At later time post-IR, we propose that persistent RIF observed days following exposure to ionizing radiation are nuclear ?scars? marking permanent disruption of the chromatin architecture. When DNA damage is resolved, such chromatin modifications should not necessarily lead to growth arrest and it has been shown that persistent RIF can replicate during mitosis. Thus, heritable persistent RIF spanning over tens of Mbp may affect the transcriptome of a large progeny of cells. This opens the door for a non DNA mutation-based mechanism of radiation-induced phenotypes.

  14. Oxidative damage of DNA induced by X-irradiation decreases the uterine endometrial receptivity which involves mitochondrial and lysosomal dysfunction

    PubMed Central

    Gao, Wei; Liang, Jin-Xiao; Liu, Shuai; Liu, Chang; Liu, Xiao-Fang; Wang, Xiao-Qi; Yan, Qiu

    2015-01-01

    X irradiation may lead to female infertility and the mechanism is still not clear. After X irradiation exposure, significantly morphological changes and functional decline in endometrial epithelial cells were observed. The mitochondrial and lysosomal dysfunction and oxidative DNA damage were noticed after X irradiation. In addition, pretreatment with NAC, NH4Cl or Pep A reduced the X irradiation induced damages. These studies demonstrate that the oxidative DNA damage which involved dysfunctional lysosomal and mitochondrial contribute to X irradiation-induced impaired receptive state of uterine endometrium and proper protective reagents can be helpful in improving endometrial function. PMID:26064230

  15. The effect of brevenal on brevetoxin-induced DNA damage in human lymphocytes

    PubMed Central

    Sayer, Andrew; Hu, Qing; Bourdelais, Andrea J.; Baden, Daniel G.; Gibson, James E.

    2008-01-01

    Brevenal is a nontoxic short-chain trans-syn polyether that competes with brevetoxin (PbTx) for the active site on voltage-sensitive sodium channels. The PbTxs are highly potent polyether toxins produced during blooms of several species of marine dinoflagellates, most notably Karenia brevis. Blooms of K. brevis have been associated with massive fish kills, marine mammal poisoning, and are potentially responsible for adverse human health effects such as respiratory irritation and airway constriction in beach-goers. Additionally, the consumption of shellfish contaminated with PbTxs results in neurotoxic shellfish poisoning (NSP). The purpose of the present study was to determine whether PbTx could induce DNA damage in a human cell type, the lymphocyte, and if so, whether the damage could be antagonized or ameliorated by brevenal, a brevetoxin antagonist. The DNA damage may occur through both endogenous and exogenous physiological and pathophysiological processes. Unrepaired or erroneously repaired DNA damage may result in gene mutation, chromosome aberration, and modulation of gene regulation, which have been associated with immunotoxicity and carcinogenesis. A single-cell gel electrophoresis assay, or comet assay, was used to determine and compare DNA damage following various treatments. The data were expressed as tail moments, which is the percentage of DNA in the tail multiplied by the length between the center of the head and center of the tail (in arbitrary units). The negative control tail moment was 29.2 (SE=±0.9), whereas the positive control (hydrogen peroxide) was 72.1 (1.5) and solvent (ethanol) was 24.2 (2.1). The PbTx-2 (from Sigma, St. Louis, MO, USA), 10−8 M was 41.3 (3.6), PbTx-9 (Sigma), 10−8 M was 57.0 (5.3), PbTx-2 (from University of North Carolina at Wilmington, UNCW), 10−8 M was 49.4 (9.9), and PbTx-3 (UNCW), 10−8 M was 64.0 (6.4). 1.0 μg/ml brevenal applied 1 h before the PbTxs protected the lymphocytes from DNA damage; PbTx-2 (Sigma

  16. The effect of brevenal on brevetoxin-induced DNA damage in human lymphocytes.

    PubMed

    Sayer, Andrew; Hu, Qing; Bourdelais, Andrea J; Baden, Daniel G; Gibson, James E

    2005-11-01

    Brevenal is a nontoxic short-chain trans-syn polyether that competes with brevetoxin (PbTx) for the active site on voltage-sensitive sodium channels. The PbTxs are highly potent polyether toxins produced during blooms of several species of marine dinoflagellates, most notably Karenia brevis. Blooms of K. brevis have been associated with massive fish kills, marine mammal poisoning, and are potentially responsible for adverse human health effects such as respiratory irritation and airway constriction in beach-goers. Additionally, the consumption of shellfish contaminated with PbTxs results in neurotoxic shellfish poisoning (NSP). The purpose of the present study was to determine whether PbTx could induce DNA damage in a human cell type, the lymphocyte, and if so, whether the damage could be antagonized or ameliorated by brevenal, a brevetoxin antagonist. The DNA damage may occur through both endogenous and exogenous physiological and pathophysiological processes. Unrepaired or erroneously repaired DNA damage may result in gene mutation, chromosome aberration, and modulation of gene regulation, which have been associated with immunotoxicity and carcinogenesis. A single-cell gel electrophoresis assay, or comet assay, was used to determine and compare DNA damage following various treatments. The data were expressed as tail moments, which is the percentage of DNA in the tail multiplied by the length between the center of the head and center of the tail (in arbitrary units). The negative control tail moment was 29.2 (SE=+/-0.9), whereas the positive control (hydrogen peroxide) was 72.1 (1.5) and solvent (ethanol) was 24.2 (2.1). The PbTx-2 (from Sigma, St. Louis, MO, USA), 10(-8) M was 41.3 (3.6), PbTx-9 (Sigma), 10(-8) M was 57.0 (5.3), PbTx-2 (from University of North Carolina at Wilmington, UNCW), 10(-8) M was 49.4 (9.9), and PbTx-3 (UNCW), 10(-8) M was 64.0 (6.4). 1.0 microg/ml brevenal applied 1 h before the PbTxs protected the lymphocytes from DNA damage; PbTx-2

  17. Polyphenols as possible bioprotectors against cytotoxicity and DNA damage induced by ochratoxin A.

    PubMed

    Cariddi, L N; Sabini, M C; Escobar, F M; Montironi, I; Mañas, F; Iglesias, D; Comini, L R; Sabini, L I; Dalcero, A M

    2015-05-01

    The present study aimed to investigate the protective effects of luteolin (L), chlorogenic acid (ChlA) and caffeic acid (CafA) against cyto-genotoxic effects caused by OTA. Vero cells and rat lymphocytes were used and viability was measured by neutral red uptake, MTT and trypan blue dye exclusion method. L (50 and 100μg/mL), ChlA (100 and 200μg/mL) and CafA (10-50μg/mL) reduced the damage induced by OTA (10μg/mL) on both cells type shown a good protective effect. The comet and micronucleus tests in Balb/c mice were performed. ChlA (10mg/kg bw) reduced OTA (0.85mg/kg bw)-induced DNA damage on blood and bone marrow cells, CafA (10mg/kg bw) showed protective effect only in blood cells and luteolin (2.5mg/kg bw) failed to protect DNA integrity on cells. In conclusion, polyphenols tested reduced the toxicity caused by OTA on different target cells with good protective effect, being ChlA the compound that showed the best effects. PMID:25867686

  18. Denbinobin induces apoptosis by apoptosis-inducing factor releasing and DNA damage in human colorectal cancer HCT-116 cells.

    PubMed

    Chen, Tzu-Hsuan; Pan, Shiow-Lin; Guh, Jih-Hwa; Chen, Chien-Chih; Huang, Yao-Ting; Pai, Hui-Chen; Teng, Che-Ming

    2008-11-01

    Denbinobin is a phenanthraquinone derivative present in the stems of Ephemerantha lonchophylla. We showed that denbinobin induces apoptosis in human colorectal cancer cells (HCT-116) in a concentration-dependent manner. The addition of a pan-caspase inhibitor (zVAD-fmk) did not suppress the denbinobin-induced apoptotic effect, and denbinobin-induced apoptosis was not accompanied by processing of procaspase-3, -6, -7, -9, and -8. However, denbinobin triggered the translocation of the apoptosis-inducing factor (AIF) from the mitochondria into the nucleus. Small interfering RNA targeting of AIF effectively protected HCT-116 cells against denbinobin-induced apoptosis. Denbinobin treatment also caused DNA damage, activation of the p53 tumor suppressor gene, and upregulation of numerous downstream effectors (p21WAF1/CIP1, Bax, PUMA, and NOXA). A HCT-116 xenograft model demonstrated the in vivo efficacy and low toxicity of denbinobin. Taken together, our findings suggest that denbinobin induces apoptosis of human colorectal cancer HCT-116 cells via DNA damage and an AIF-mediated pathway. These results indicate that denbinobin has potential as a novel anticancer agent. PMID:18607570

  19. Platelet-activating factor induces cell cycle arrest and disrupts the DNA damage response in mast cells

    PubMed Central

    Puebla-Osorio, N; Damiani, E; Bover, L; Ullrich, S E

    2015-01-01

    Platelet-activating factor (PAF) is a potent phospholipid modulator of inflammation that has diverse physiological and pathological functions. Previously, we demonstrated that PAF has an essential role in ultraviolet (UV)-induced immunosuppression and reduces the repair of damaged DNA, suggesting that UV-induced PAF is contributing to skin cancer initiation by inducing immune suppression and also affecting a proper DNA damage response. The exact role of PAF in modulating cell proliferation, differentiation or transformation is unclear. Here, we investigated the mechanism(s) by which PAF affects the cell cycle and impairs early DNA damage response. PAF arrests proliferation in transformed and nontransformed human mast cells by reducing the expression of cyclin-B1 and promoting the expression of p21. PAF-treated cells show a dose-dependent cell cycle arrest mainly at G2–M, and a decrease in the DNA damage response elements MCPH1/BRIT-1 and ataxia telangiectasia and rad related (ATR). In addition, PAF disrupts the localization of p-ataxia telangiectasia mutated (p-ATM), and phosphorylated-ataxia telangiectasia and rad related (p-ATR) at the site of DNA damage. Whereas the potent effect on cell cycle arrest may imply a tumor suppressor activity for PAF, the impairment of proper DNA damage response might implicate PAF as a tumor promoter. The outcome of these diverse effects may be dependent on specific cues in the microenvironment. PMID:25950475

  20. Isoliquiritigenin induces G2 and M phase arrest by inducing DNA damage and by inhibiting the metaphase/anaphase transition.

    PubMed

    Park, Iha; Park, Kwang-Kyun; Park, Jung Han Yoon; Chung, Won-Yoon

    2009-05-18

    Isoliquiritigenin, a natural flavonoid found in licorice, shallots, and bean sprouts, has been demonstrated to inhibit proliferation and to induce apoptosis in a variety of human cancer cells. We attempted to ascertain the underlying mechanism by which isoliquiritigenin induced cell cycle arrest and cytotoxicity in HeLa human cervical cancer cells. Isoliquiritigenin treatment arrested cells in both G2 and M phase. The cells arrested in interphase (G2) showed markers for DNA damage including the formation of gamma-H2AX foci and the phosphorylation of ATM and Chk2, whereas the cells arrested in M phase evidenced separate poles and mitotic metaphase-like spindles with partially unaligned chromosomes. The induction of DNA damage and blockade at the metaphase/anaphase transition implied that isoliquiritigenin might function as a topoisomerase II poison, which was further demonstrated via an in vitro topoisomerase II inhibition assay. These results show that isoliquiritigenin inhibits topoiosmerase II activity, and the resultant DNA damage and arrest in mitotic metaphase-like stage contributes to the antiproliferative effects of isoliquiritigenin. PMID:19167809

  1. In vivo antigenotoxic activity of watercress juice (Nasturtium officinale) against induced DNA damage.

    PubMed

    Casanova, Natalia A; Ariagno, Julia I; López Nigro, Marcela M; Mendeluk, Gabriela R; de los A Gette, María; Petenatti, Elisa; Palaoro, Luis A; Carballo, Marta A

    2013-09-01

    The present study was carried out to investigate the genotoxicity as well as possible protective activity against damage induced by cyclophosphamide (CP) of the aqueous juice of watercress (Nasturtium officinale, W.T. Aiton) in vivo. Male and female Swiss mice 7-8 weeks old (N = 48) were treated by gavage with 1 g kg(-1) body weight and 0.5 g kg(-1) body weight of watercress juice during 15 consecutive days. Genotoxicity and its possible protective effect were tested by the comet assay in peripheral blood cells and the micronucleus test in bone marrow. In addition, biopsies of the bladder, epididymis and testicles of mice were performed to extend the experimental design. Watercress juice per se did not induce genetic damage according to the comet assay and micronucleus study, exhibiting a protective activity against CP (P < 0.05 and P < 0.001, respectively). The comparative analysis of bladder histological changes obtained in the watercress plus CP group against those treated with CP alone suggests a probable protective effect. Further studies are needed in order to establish the protective role of watercress juice against DNA damage. PMID:22488040

  2. Cell cycle-dependent DNA damage signaling induced by ICRF-193 involves ATM, ATR, CHK2, and BRCA1

    SciTech Connect

    Park, Iha; Avraham, Hava Karsenty . E-mail: havraham@bidmc.harvard.edu

    2006-07-01

    Topoisomerase II is essential for cell proliferation and survival and has been a target of various anticancer drugs. ICRF-193 has long been used as a catalytic inhibitor to study the function of topoisomerase II. Here, we show that ICRF-193 treatment induces DNA damage signaling. Treatment with ICRF-193 induced G2 arrest and DNA damage signaling involving {gamma}-H2AX foci formation and CHK2 phosphorylation. DNA damage by ICRF-193 was further demonstrated by formation of the nuclear foci of 53BP1, NBS1, BRCA1, MDC1, and FANCD2 and increased comet tail moment. The DNA damage signaling induced by ICRF-193 was mediated by ATM and ATR and was restricted to cells in specific cell cycle stages such as S, G2, and mitosis including late and early G1 phases. Downstream signaling of ATM and ATR involved the phosphorylation of CHK2 and BRCA1. Altogether, our results demonstrate that ICRF-193 induces DNA damage signaling in a cell cycle-dependent manner and suggest that topoisomerase II might be essential for the progression of the cell cycle at several stages including DNA decondensation.

  3. Oxidative DNA damage caused by inflammation may link to stress-induced non-targeted effects

    PubMed Central

    Sprung, Carl N.; Ivashkevich, Alesia; Forrester, Helen B.; Redon, Christophe E.; Georgakilas, Alexandros; Martin, Olga A.

    2013-01-01

    A spectrum of radiation-induced non-targeted effects has been reported during the last two decades since Nagasawa and Little first described a phenomenon in cultured cells that was later called the “bystander effect”. These non-targeted effects include radiotherapy-related abscopal effects, where changes in organs or tissues occur distant from the irradiated region. The spectrum of non-targeted effects continue to broaden over time and now embrace many types of exogenous and endogenous stressors that induce a systemic genotoxic response including a widely studied tumor microenvironment. Here we discuss processes and factors leading to DNA damage induction in non-targeted cells and tissues and highlight similarities in the regulation of systemic effects caused by different stressors. PMID:24041866

  4. Mitochondria-targeted Ogg1 and Aconitase-2 Prevent Oxidant-induced Mitochondrial DNA Damage in Alveolar Epithelial Cells*

    PubMed Central

    Kim, Seok-Jo; Cheresh, Paul; Williams, David; Cheng, Yuan; Ridge, Karen; Schumacker, Paul T.; Weitzman, Sigmund; Bohr, Vilhelm A.; Kamp, David W.

    2014-01-01

    Mitochondria-targeted human 8-oxoguanine DNA glycosylase (mt-hOgg1) and aconitase-2 (Aco-2) each reduce oxidant-induced alveolar epithelial cell (AEC) apoptosis, but it is unclear whether protection occurs by preventing AEC mitochondrial DNA (mtDNA) damage. Using quantitative PCR-based measurements of mitochondrial and nuclear DNA damage, mtDNA damage was preferentially noted in AEC after exposure to oxidative stress (e.g. amosite asbestos (5–25 μg/cm2) or H2O2 (100–250 μm)) for 24 h. Overexpression of wild-type mt-hOgg1 or mt-long α/β 317–323 hOgg1 mutant incapable of DNA repair (mt-hOgg1-Mut) each blocked A549 cell oxidant-induced mtDNA damage, mitochondrial p53 translocation, and intrinsic apoptosis as assessed by DNA fragmentation and cleaved caspase-9. In contrast, compared with controls, knockdown of Ogg1 (using Ogg1 shRNA in A549 cells or primary alveolar type 2 cells from ogg1−/− mice) augmented mtDNA lesions and intrinsic apoptosis at base line, and these effects were increased further after exposure to oxidative stress. Notably, overexpression of Aco-2 reduced oxidant-induced mtDNA lesions, mitochondrial p53 translocation, and apoptosis, whereas siRNA for Aco-2 (siAco-2) enhanced mtDNA damage, mitochondrial p53 translocation, and apoptosis. Finally, siAco-2 attenuated the protective effects of mt-hOgg1-Mut but not wild-type mt-hOgg1 against oxidant-induced mtDNA damage and apoptosis. Collectively, these data demonstrate a novel role for mt-hOgg1 and Aco-2 in preserving AEC mtDNA integrity, thereby preventing oxidant-induced mitochondrial dysfunction, p53 mitochondrial translocation, and intrinsic apoptosis. Furthermore, mt-hOgg1 chaperoning of Aco-2 in preventing oxidant-mediated mtDNA damage and apoptosis may afford an innovative target for the molecular events underlying oxidant-induced toxicity. PMID:24429287

  5. 3,3'-Dihydroxyisorenieratene and isorenieratene prevent UV-induced DNA damage in human skin fibroblasts.

    PubMed

    Wagener, Sarah; Völker, Tanja; De Spirt, Silke; Ernst, Hansgeorg; Stahl, Wilhelm

    2012-08-01

    Skin cancer is among the most frequent neoplastic malignancies and exposure to UV irradiation is a major risk factor. In addition to topical sunscreens, photoprotection by dietary antioxidants such as carotenoids or polyphenols has been suggested as a means of prevention. Isorenieratene (IR) and dihydroxyisorenieratene (DHIR) are aromatic carotenoids with particular antioxidant properties produced by Brevibacterium linens. The aim of this study was to investigate the photoprotective and antioxidant activities of DHIR and IR in comparison to the nonaromatic carotenoid lutein in human dermal fibroblasts. Incubation of the cells with DHIR and IR significantly decreased the UV-induced formation of cyclobutane pyrimidine dimers and formation of DNA strand breaks. Lipid oxidation was lowered as determined by the formation of malondialdehyde as a biomarker. Both aromatic carotenoids also prevented oxidatively generated damage to DNA as demonstrated by a decrease in DNA strand breaks associated with the formation of oxidized DNA bases. These data highlight the multifunctional photoprotective properties of aromatic carotenoids, which may be suitable natural compounds for the prevention of skin cancer. PMID:22634149

  6. DNA damage checkpoints in mammals.

    PubMed

    Niida, Hiroyuki; Nakanishi, Makoto

    2006-01-01

    DNA damage is a common event and probably leads to mutation or deletion within chromosomal DNA, which may cause cancer or premature aging. DNA damage induces several cellular responses including DNA repair, checkpoint activity and the triggering of apoptotic pathways. DNA damage checkpoints are associated with biochemical pathways that end delay or arrest of cell-cycle progression. These checkpoints engage damage sensor proteins, such as the Rad9-Rad1-Hus1 (9-1-1) complex, and the Rad17-RFC complex, in the detection of DNA damage and transduction of signals to ATM, ATR, Chk1 and Chk2 kinases. Chk1 and Chk2 kinases regulate Cdc25, Wee1 and p53 that ultimately inactivate cyclin-dependent kinases (Cdks) which inhibit cell-cycle progression. In this review, we discuss the molecular mechanisms by which DNA damage is recognized by sensor proteins and signals are transmitted to Cdks. We classify the genes involved in checkpoint signaling into four categories, namely sensors, mediators, transducers and effectors, although their proteins have the broad activity, and thus this classification is for convenience and is not definitive. PMID:16314342

  7. Targeting DNA damage response in cancer therapy

    PubMed Central

    Hosoya, Noriko; Miyagawa, Kiyoshi

    2014-01-01

    Cancer chemotherapy and radiotherapy are designed to kill cancer cells mostly by inducing DNA damage. DNA damage is normally recognized and repaired by the intrinsic DNA damage response machinery. If the damaged lesions are successfully repaired, the cells will survive. In order to specifically and effectively kill cancer cells by therapies that induce DNA damage, it is important to take advantage of specific abnormalities in the DNA damage response machinery that are present in cancer cells but not in normal cells. Such properties of cancer cells can provide biomarkers or targets for sensitization. For example, defects or upregulation of the specific pathways that recognize or repair specific types of DNA damage can serve as biomarkers of favorable or poor response to therapies that induce such types of DNA damage. Inhibition of a DNA damage response pathway may enhance the therapeutic effects in combination with the DNA-damaging agents. Moreover, it may also be useful as a monotherapy when it achieves synthetic lethality, in which inhibition of a complementary DNA damage response pathway selectively kills cancer cells that have a defect in a particular DNA repair pathway. The most striking application of this strategy is the treatment of cancers deficient in homologous recombination by poly(ADP-ribose) polymerase inhibitors. In this review, we describe the impact of targeting the cancer-specific aberrations in the DNA damage response by explaining how these treatment strategies are currently being evaluated in preclinical or clinical trials. PMID:24484288

  8. [Exercise training in hypoxia prevents hypoxia induced mitochondrial DNA oxidative damage in skeletal muscle].

    PubMed

    Bo, Hai; Li, Ling; Duan, Fu-Qiang; Zhu, Jiang

    2014-10-25

    This study was undertaken to investigate the effect of exercise training on mitochondrial DNA (mtDNA) oxidative damage and 8-oxoguanine DNA glycosylase-1 (OGG1) expression in skeletal muscle of rats under continuous exposure to hypoxia. Male Sprague-Dawley rats were randomly divided into 4 groups (n = 8): normoxia control group (NC), normoxia training group (NT), hypoxia control group (HC), and hypoxia training group (HT). The hypoxia-treated animals were housed in normobaric hypoxic tent containing 11.3% oxygen for consecutive 4 weeks. The exercise-trained animals were exercised on a motor-driven rodent treadmill at a speed of 15 m/min, 5% grade for 60 min/day, 5 days per week for 4 weeks. The results showed that, compared with NC group, hypoxia attenuated complex I, II, IV and ATP synthase activities of the electron transport chain, and the level of mitochondrial membrane potential in HC group (P < 0.05 or P < 0.01). Moreover, hypoxia decreased mitochondrial OGG1, MnSOD, and GPx activities (P < 0.05 or P < 0.01), whereas elevated reactive oxygen species (ROS) generation and the level of 8-oxo-deoxyguanosine (8-oxodG) in mtDNA (P < 0.01). Furthermore, hypoxia attenuated muscle and mitochondrial [NAD⁺]/ [NADH] ratio, and SIRT3 protein expression (P < 0.05 or P < 0.01). Compared with HC group, exercise training in hypoxia elevated complex I, II, IV and ATP synthase activities, and the level of mitochondrial membrane potential in HT group (P < 0.05 or P < 0.01). Moreover, exercise training in hypoxia increased MnSOD and GPx activities and mitochondrial OGG1 level (P < 0.01), whereas decreased ROS generation and the level of 8-oxodG in mtDNA (P < 0.01). Furthermore, exercise training in hypoxia increased muscle and mitochondrial [NAD⁺]/[NADH] ratio, as well as SIRT3 protein expression (P < 0.05 or P < 0.01). These findings suggest that exercise training in hypoxia can decrease hypoxia-induced mtDNA oxidative damage in the skeletal muscle through up

  9. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.

    PubMed

    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke

    2014-07-01

    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles. PMID:24769180

  10. Characterization of the DNA damage-inducible helicase DinG from Escherichia coli.

    PubMed

    Voloshin, Oleg N; Vanevski, Filip; Khil, Pavel P; Camerini-Otero, R Daniel

    2003-07-25

    The dinG promoter was first isolated in a genetic screen scoring for damage-inducible loci in Escherichia coli (Lewis, L. K., Jenkins, M. E., and Mount, D. W. (1992) J. Bacteriol. 174, 3377-3385). Sequence analysis suggests that the dinG gene encodes a putative helicase related to a group of eukaryotic helicases that includes mammalian XPD (Koonin, E. V. (1993) Nucleic Acids Res. 21, 1497), an enzyme involved in transcription-coupled nucleotide excision repair and basal transcription. We have characterized the dinG gene product from E. coli using genetic and biochemical approaches. Deletion of dinG has no severe phenotype, indicating that it is non-essential for cell viability. Both dinG deletion and over-expression of the DinG protein from a multicopy plasmid result in a slight reduction of UV resistance. DinG, purified as a fusion protein from E. coli cells, behaves as a monomer in solution, as judged from gel filtration experiments. DinG is an ATP-hydrolyzing enzyme; single-stranded (ss) DNA stimulates the ATPase activity 15-fold. Kinetic data yield a Hill coefficient of 1, consistent with one ATP-hydrolyzing site per DinG molecule. DinG possesses a DNA helicase activity; it translocates along ssDNA in a 5' --> 3' direction, as revealed in experiments with substrates containing non-natural 5'-5' and 3'-3' linkages. The ATP-dependent DNA helicase activity of DinG requires divalent cations (Mg2+, Ca2+, and Mn2+) but is not observed in the presence of Zn2+. The DinG helicase does not discriminate between ribonucleotide and deoxyribonucleotide triphosphates, and it unwinds duplex DNA with similar efficiency in the presence of ATP or dATP. We discuss the possible involvement of the DinG helicase in DNA replication and repair processes. PMID:12748189