Science.gov

Sample records for induced dna damages

  1. Triplex-Induced DNA Damage Response

    PubMed Central

    Rogers, Faye A.; Tiwari, Meetu Kaushik

    2013-01-01

    Cellular DNA damage response is critical to preserving genomic integrity following exposure to genotoxic stress. A complex series of networks and signaling pathways become activated after DNA damage and trigger the appropriate cellular response, including cell cycle arrest, DNA repair, and apoptosis. The response elicited is dependent upon the type and extent of damage sustained, with the ultimate goal of preventing propagation of the damaged DNA. A major focus of our studies is to determine the cellular pathways involved in processing damage induced by altered helical structures, specifically triplexes. Our lab has demonstrated that the TFIIH factor XPD occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. We have shown that XPD co-localizes with γH2AX, and its presence is required for the phosphorylation of H2AX tyrosine142, which stimulates the signaling pathway to recruit pro-apoptotic factors to the damage site. Herein, we examine the cellular pathways activated in response to triplex formation and discuss our finding that suggests that XPD-dependent apoptosis plays a role in preserving genomic integrity in the presence of excessive structurally induced DNA damage. PMID:24348211

  2. Persistent damage induces mitochondrial DNA degradation

    PubMed Central

    Shokolenko, Inna N.; Wilson, Glenn L.; Alexeyev, Mikhail F.

    2013-01-01

    Considerable progress has been made recently toward understanding the processes of mitochondrial DNA (mtDNA) damage and repair. However, a paucity of information still exists regarding the physiological effects of persistent mtDNA damage. This is due, in part, to experimental difficulties associated with targeting mtDNA for damage, while sparing nuclear DNA. Here, we characterize two systems designed for targeted mtDNA damage based on the inducible (Tet-ON) mitochondrial expression of the bacterial enzyme, exonuclease III, and the human enzyme, uracil-N-glyosylase containing the Y147A mutation. In both systems, damage was accompanied by degradation of mtDNA, which was detectable by six hours after induction of mutant uracil-N-glycosylase and by twelve hours after induction of exoIII. Unexpectedly, increases in the steady-state levels of single-strand lesions, which led to degradation, were small in absolute terms indicating that both abasic sites and single-strand gaps may be poorly tolerated in mtDNA. mtDNA degradation was accompanied by the loss of expression of mtDNA-encoded COX2. After withdrawal of the inducer, recovery from mtDNA depletion occurred faster in the system expressing exonuclease III, but in both systems reduced mtDNA levels persisted longer than 144h after doxycycline withdrawal. mtDNA degradation was followed by reduction and loss of respiration, decreased membrane potential, reduced cell viability, reduced intrinsic reactive oxygen species production, slowed proliferation, and changes in mitochondrial morphology (fragmentation of the mitochondrial network, rounding and “foaming” of the mitochondria). The mutagenic effects of abasic sites in mtDNA were low, which indicates that damaged mtDNA molecules may be degraded if not rapidly repaired. This study establishes, for the first time, that mtDNA degradation can be a direct and immediate consequence of persistent mtDNA damage and that increased ROS production is not an invariant consequence

  3. Heat Stress-Induced DNA Damage

    PubMed Central

    Kantidze, O.L.; Velichko, A.K.; Luzhin, A.V.; Razin, S.V.

    2016-01-01

    Although the heat-stress response has been extensively studied for decades, very little is known about its effects on nucleic acids and nucleic acid-associated processes. This is due to the fact that the research has focused on the study of heat shock proteins and factors (HSPs and HSFs), their involvement in the regulation of transcription, protein homeostasis, etc. Recently, there has been some progress in the study of heat stress effects on DNA integrity. In this review, we summarize and discuss well-known and potential mechanisms of formation of various heat stress-induced DNA damage. PMID:27437141

  4. Delayed chromosomal instability induced by DNA damage.

    PubMed Central

    Marder, B A; Morgan, W F

    1993-01-01

    DNA damage induced by ionizing radiation can result in gene mutation, gene amplification, chromosome rearrangements, cellular transformation, and cell death. Although many of these changes may be induced directly by the radiation, there is accumulating evidence for delayed genomic instability following X-ray exposure. We have investigated this phenomenon by studying delayed chromosomal instability in a hamster-human hybrid cell line by means of fluorescence in situ hybridization. We examined populations of metaphase cells several generations after expanding single-cell colonies that had survived 5 or 10 Gy of X rays. Delayed chromosomal instability, manifested as multiple rearrangements of human chromosome 4 in a background of hamster chromosomes, was observed in 29% of colonies surviving 5 Gy and in 62% of colonies surviving 10 Gy. A correlation of delayed chromosomal instability with delayed reproductive cell death, manifested as reduced plating efficiency in surviving clones, suggests a role for chromosome rearrangements in cytotoxicity. There were small differences in chromosome destabilization and plating efficiencies between cells irradiated with 5 or 10 Gy of X rays after a previous exposure to 10 Gy and cells irradiated only once. Cell clones showing delayed chromosomal instability had normal frequencies of sister chromatid exchange formation, indicating that at this cytogenetic endpoint the chromosomal instability was not apparent. The types of chromosomal rearrangements observed suggest that chromosome fusion, followed by bridge breakage and refusion, contributes to the observed delayed chromosomal instability. Images PMID:8413263

  5. DNA damage in cells exhibiting radiation-induced genomic instability

    DOE PAGESBeta

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  6. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.

  7. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  8. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest.

    PubMed

    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P; Chow, Vincent T K

    2016-01-01

    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  9. Pneumococcal Pneumolysin Induces DNA Damage and Cell Cycle Arrest

    PubMed Central

    Rai, Prashant; He, Fang; Kwang, Jimmy; Engelward, Bevin P.; Chow, Vincent T.K.

    2016-01-01

    Streptococcus pneumoniae produces pneumolysin toxin as a key virulence factor against host cells. Pneumolysin is a cholesterol-dependent cytolysin (CDC) toxin that forms lytic pores in host membranes and mediates pneumococcal disease pathogenesis by modulating inflammatory responses. Here, we show that pneumolysin, which is released during bacterial lysis, induces DNA double strand breaks (DSBs), as indicated by ataxia telangiectasia mutated (ATM)-mediated H2AX phosphorylation (γH2AX). Pneumolysin-induced γH2AX foci recruit mediator of DNA damage checkpoint 1 (MDC1) and p53 binding protein 1 (53BP1), to sites of DSBs. Importantly, results show that toxin-induced DNA damage precedes cell cycle arrest and causes apoptosis when DNA-dependent protein kinase (DNA-PK)-mediated non-homologous end joining is inhibited. Further, we observe that cells that were undergoing DNA replication harbored DSBs in greater frequency during pneumolysin treatment. This observation raises the possibility that DSBs might be arising as a result of replication fork breakdown. Additionally, neutralizing the oligomerization domain of pneumolysin with monoclonal antibody suppresses DNA damage and also cell cycle arrest, indicating that pneumolysin oligomerization is important for causing DNA damage. Taken together, this study reveals a previously unidentified ability of pneumolysin to induce cytotoxicity via DNA damage, with implications in the pathophysiology of S. pneumoniae infection. PMID:27026501

  10. Influenza infection induces host DNA damage and dynamic DNA damage responses during tissue regeneration

    PubMed Central

    Li, Na; Parrish, Marcus; Chan, Tze Khee; Yin, Lu; Rai, Prashant; Yoshiyuki, Yamada; Abolhassani, Nona; Tan, Kong Bing; Kiraly, Orsolya; Chow, Vincent TK; Engelward, Bevin P.

    2016-01-01

    Influenza viruses account for significant morbidity worldwide. Inflammatory responses, including excessive generation of reactive oxygen and nitrogen species (RONS), mediate lung injury in severe Influenza infections. However, the molecular basis of inflammation-induced lung damage is not fully understood. Here, we studied influenza H1N1 infected cells in vitro, as well as H1N1 infected mice, and we monitored molecular and cellular responses over the course of two weeks in vivo. We show that influenza induces DNA damage both when cells are directly exposed to virus in vitro (measured using the comet assay) and also when cells are exposed to virus in vivo (estimated via γH2AX foci). We show that DNA damage, as well as responses to DNA damage, persist in vivo until long after virus has been cleared, at times when there are inflammation associated RONS (measured by xanthine oxidase activity and oxidative products). The frequency of lung epithelial and immune cells with increased γH2AX foci is elevated in vivo, especially for dividing cells (Ki-67 positive) exposed to oxidative stress during tissue regeneration. Additionally, we observed a significant increase in apoptotic cells as well as increased levels of DSB repair proteins Ku70, Ku86 and Rad51 during the regenerative phase. In conclusion, results show that influenza induces DNA both in vitro and in vivo, and that DNA damage responses are activated, raising the possibility that DNA repair capacity may be a determining factor for tissue recovery and disease outcome. PMID:25809161

  11. DNA damage induced by the direct effect of radiation

    NASA Astrophysics Data System (ADS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.

    2008-10-01

    We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.

  12. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    2001-01-01

    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  13. Modulation of irinotecan-induced genomic DNA damage by theanine.

    PubMed

    Attia, Sabry

    2012-05-01

    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity. PMID:22414655

  14. Maintenance of the DNA-Damage Checkpoint Requires DNA-Damage-Induced Mediator Protein Oligomerization

    PubMed Central

    Usui, Takehiko; Foster, Steven S.; Petrini, John H.J.

    2010-01-01

    SUMMARY Oligomeric assembly of Brca1 C-terminal (BRCT) domain-containing mediator proteins occurs at sites of DNA damage. However, the functional significance and regulation of such assemblies are not well understood. In this study, we defined the molecular mechanism of DNA-damage-induced oligomerization of the S. cerevisiae BRCT protein Rad9. Our data suggest that Rad9’s tandem BRCT domain mediates Rad9 oligomerization via its interaction with its own Mec1/Tel1-phosphorylated SQ/TQ cluster domain (SCD). Rad53 activation is unaffected by mutations that impair Rad9 oligomerization, but checkpoint maintenance is lost, indicating that oligomerization is required to sustain checkpoint signaling. Once activated, Rad53 phosphorylates the Rad9 BRCT domain, which attenuates the BRCT-SCD interaction. Failure to phosphorylate the Rad9 BRCT results in cytologically visible Rad9 foci. This suggests a feedback loop wherein Rad53 activity and Rad9 oligomerization are regulated to tune the DNA-damage response. PMID:19187758

  15. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope

    2014-01-01

    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  16. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  17. Torin2 Suppresses Ionizing Radiation-Induced DNA Damage Repair.

    PubMed

    Udayakumar, Durga; Pandita, Raj K; Horikoshi, Nobuo; Liu, Yan; Liu, Qingsong; Wong, Kwok-Kin; Hunt, Clayton R; Gray, Nathanael S; Minna, John D; Pandita, Tej K; Westover, Kenneth D

    2016-05-01

    Several classes of inhibitors of the mammalian target of rapamycin (mTOR) have been developed based on its central role in sensing growth factor and nutrient levels to regulate cellular metabolism. However, its ATP-binding site closely resembles other phosphatidylinositol 3-kinase-related kinase (PIKK) family members, resulting in reactivity with these targets that may also be therapeutically useful. The ATP-competitive mTOR inhibitor, Torin2, shows biochemical activity against the DNA repair-associated proteins ATM, ATR and DNA-PK, which raises the possibility that Torin2 and related compounds might radiosensitize cancerous tumors. In this study Torin2 was also found to enhance ionizing radiation-induced cell killing in conditions where ATM was dispensable, confirming the requirement for multiple PIKK targets. Moreover, Torin2 did not influence the initial appearance of γ-H2AX foci after irradiation but significantly delayed the disappearance of radiation-induced γ-H2AX foci, indicating a DNA repair defect. Torin2 increased the number of radiation-induced S-phase specific chromosome aberrations and reduced the frequency of radiation-induced CtIP and Rad51 foci formation, suggesting that Torin2 works by blocking homologous recombination (HR)-mediated DNA repair resulting in an S-phase specific DNA repair defect. Accordingly, Torin2 reduced HR-mediated repair of I-Sce1-induced DNA damage and contributed to replication fork stalling. We conclude that radiosensitization of tumor cells by Torin2 is associated with disrupting ATR- and ATM-dependent DNA damage responses. Our findings support the concept of developing combination cancer therapies that incorporate ionizing radiation therapy and Torin2 or compounds with similar properties. PMID:27135971

  18. Proton-induced direct and indirect damage of plasmid DNA.

    PubMed

    Vyšín, Luděk; Pachnerová Brabcová, Kateřina; Štěpán, Václav; Moretto-Capelle, Patrick; Bugler, Beatrix; Legube, Gaelle; Cafarelli, Pierre; Casta, Romain; Champeaux, Jean Philippe; Sence, Martine; Vlk, Martin; Wagner, Richard; Štursa, Jan; Zach, Václav; Incerti, Sebastien; Juha, Libor; Davídková, Marie

    2015-08-01

    Clustered DNA damage induced by 10, 20 and 30 MeV protons in pBR322 plasmid DNA was investigated. Besides determination of strand breaks, additional lesions were detected using base excision repair enzymes. The plasmid was irradiated in dry form, where indirect radiation effects were almost fully suppressed, and in water solution containing only minimal residual radical scavenger. Simultaneous irradiation of the plasmid DNA in the dry form and in the solution demonstrated the contribution of the indirect effect as prevalent. The damage composition slightly differed when comparing the results for liquid and dry samples. The obtained data were also subjected to analysis concerning different methodological approaches, particularly the influence of irradiation geometry, models used for calculation of strand break yields and interpretation of the strand breaks detected with the enzymes. It was shown that these parameters strongly affect the results. PMID:26007308

  19. Fungicide prochloraz induces oxidative stress and DNA damage in vitro.

    PubMed

    Lundqvist, J; Hellman, B; Oskarsson, A

    2016-05-01

    Prochloraz is widely used in horticulture and agriculture, e.g. as a post-harvest anti-mold treatment. Prochloraz is a known endocrine disruptor causing developmental toxicity with multiple mechanisms of action. However, data are scarce concerning other toxic effects. Since oxidative stress response, with formation of reactive oxygen species (ROS), is a common mechanism for different toxic endpoints, e.g. genotoxicity, carcinogenicity and teratogenicity, the aim of this study was to investigate if prochloraz can induce oxidative stress and/or DNA damage in human cells. A cell culture based in vitro model was used to study oxidative stress response by prochloraz, as measured by the activity of the nuclear factor erythroid 2-related factor 2 (Nrf2), a key molecule in oxidative defense mechanisms. It was observed that prochloraz induced oxidative stress in cultured human adrenocortical H295R and hepatoma HepG2 cells at non-toxic concentrations. Further, we used Comet assay to investigate the DNA damaging potential of prochloraz, and found that non-toxic concentrations of prochloraz induced DNA damage in HepG2 cells. These are novel findings, contradicting previous studies in the field of prochloraz and genotoxicity. This study reports a new mechanism by which prochloraz may exert toxicity. Our findings suggest that prochloraz might have genotoxic properties. PMID:26945613

  20. Mitochondrial DNA damage induced autophagy, cell death, and disease

    PubMed Central

    Van Houten, Bennett; Hunter, Senyene E.; Meyer, Joel N.

    2016-01-01

    Mammalian mitochondria contain multiple small genomes. While these organelles have efficient base excision removal of oxidative DNA lesions and alkylation damage, many DNA repair systems that work on nuclear DNA damage are not active in mitochondria. What is the fate of DNA damage in the mitochondria that cannot be repaired or that overwhelms the repair system? Some forms of mitochondrial DNA damage can apparently trigger mitochondrial DNA destruction, either via direct degradation or through specific forms of autophagy, such as mitophagy. However, accumulation of certain types of mitochondrial damage, in the absence of DNA ligase III (Lig3) or exonuclease G (EXOG), enzymes required for repair, can directly trigger cell death. This review examines the cellular effects of persistent damage to mitochondrial genomes and discusses the very different cell fates that occur in response to different kinds of damage. PMID:26709760

  1. Analysis of alcohol-induced DNA damage in Escherichia coli by visualizing single genomic DNA molecules.

    PubMed

    Kang, Yujin; Lee, Jinyong; Kim, Jisoo; Oh, Yeeun; Kim, Dogeun; Lee, Jungyun; Lim, Sangyong; Jo, Kyubong

    2016-07-21

    Consumption of alcohol injures DNA, and such damage is considered to be a primary cause for the development of cancer and many other diseases essentially due to reactive oxygen species generated from alcohol. To sensitively detect alcohol-induced DNA lesions in a biological system, we introduced a novel analytical platform for visualization of single genomic DNA molecules using E. coli. By fluorescently labelling the DNA lesions, our approach demonstrated, with the highest sensitivity, that we could count the number of DNA lesions induced by alcohol metabolism in a single bacterial cell. Moreover, our results showed a linear relationship between ethanol concentration and the number of DNA lesions: 0.88 lesions per 1% ethanol. Using this approach, we quantitatively analysed the DNA damage induced by exposure to alcoholic beverages such as beer (5% ethanol), rice wine (13%), soju (20%), and whisky (40%). PMID:27186604

  2. DNA damage profiles induced by sunlight at different latitudes.

    PubMed

    Schuch, André Passaglia; Yagura, Teiti; Makita, Kazuo; Yamamoto, Hiromasa; Schuch, Nelson Jorge; Agnez-Lima, Lucymara Fassarella; MacMahon, Ricardo Monreal; Menck, Carlos Frederico Martins

    2012-04-01

    Despite growing knowledge on the biological effects of ultraviolet (UV) radiation on human health and ecosystems, it is still difficult to predict the negative impacts of the increasing incidence of solar UV radiation in a scenario of global warming and climate changes. Hence, the development and application of DNA-based biological sensors to monitor the solar UV radiation under different environmental conditions is of increasing importance. With a mind to rendering a molecular view-point of the genotoxic impact of sunlight, field experiments were undertaken with a DNA-dosimeter system in parallel with physical photometry of solar UVB/UVA radiation, at various latitudes in South America. On applying biochemical and immunological approaches based on specific DNA-repair enzymes and antibodies, for evaluating sunlight-induced DNA damage profiles, it became clear that the genotoxic potential of sunlight does indeed vary according to latitude. Notwithstanding, while induction of oxidized DNA bases is directly dependent on an increase in latitude, the generation of 6-4PPs is inversely so, whereby the latter can be regarded as a biomolecular marker of UVB incidence. This molecular DNA lesion-pattern largely reflects the relative incidence of UVA and UVB energy at any specific latitude. Hereby is demonstrated the applicability of this DNA-based biosensor for additional, continuous field experiments, as a means of registering variations in the genotoxic impact of solar UV radiation. PMID:22674547

  3. Inflammation-induced DNA damage and damage-induced inflammation: a vicious cycle.

    PubMed

    Pálmai-Pallag, Timea; Bachrati, Csanád Z

    2014-10-01

    Inflammation is the ultimate response to the constant challenges of the immune system by microbes, irritants or injury. The inflammatory cascade initiates with the recognition of microorganism-derived pathogen associated molecular patterns (PAMPs) and host cell-derived damage associated molecular patterns (DAMPs) by the pattern recognition receptors (PRRs). DNA as a molecular PAMP or DAMP is sensed directly or via specific binding proteins to instigate pro-inflammatory response. Some of these DNA binding proteins also participate in canonical DNA repair pathways and recognise damaged DNA to initiate DNA damage response. In this review we aim to capture the essence of the complex interplay between DNA damage response and the pro-inflammatory signalling through representative examples. PMID:25449753

  4. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.

    1984-01-01

    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  5. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  6. Stress-induced DNA damage biomarkers: applications and limitations.

    PubMed

    Nikitaki, Zacharenia; Hellweg, Christine E; Georgakilas, Alexandros G; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  7. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc

    2015-06-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  8. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation

    PubMed Central

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang

    2016-01-01

    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92–1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  9. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation.

    PubMed

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang

    2016-01-01

    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92-1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  10. Increased Sensitivity of DNA Damage Response-Deficient Cells to Stimulated Microgravity-Induced DNA Lesions

    PubMed Central

    Li, Nan; An, Lili; Hang, Haiying

    2015-01-01

    Microgravity is a major stress factor that astronauts have to face in space. In the past, the effects of microgravity on genomic DNA damage were studied, and it seems that the effect on genomic DNA depends on cell types and the length of exposure time to microgravity or simulated microgravity (SMG). In this study we used mouse embryonic stem (MES) and mouse embryonic fibroblast (MEF) cells to assess the effects of SMG on DNA lesions. To acquire the insight into potential mechanisms by which cells resist and/or adapt to SMG, we also included Rad9-deleted MES and Mdc1-deleted MEF cells in addition to wild type cells in this study. We observed significant SMG-induced DNA double strand breaks (DSBs) in Rad9-/- MES and Mdc1-/- MEF cells but not in their corresponding wild type cells. A similar pattern of DNA single strand break or modifications was also observed in Rad9-/- MES. As the exposure to SMG was prolonged, Rad9-/- MES cells adapted to the SMG disturbance by reducing the induced DNA lesions. The induced DNA lesions in Rad9-/- MES were due to SMG-induced reactive oxygen species (ROS). Interestingly, Mdc1-/- MEF cells were only partially adapted to the SMG disturbance. That is, the induced DNA lesions were reduced over time, but did not return to the control level while ROS returned to a control level. In addition, ROS was only partially responsible for the induced DNA lesions in Mdc1-/- MEF cells. Taken together, these data suggest that SMG is a weak genomic DNA stress and can aggravate genomic instability in cells with DNA damage response (DDR) defects. PMID:25915950

  11. Calculation of complex DNA damage induced by ions

    NASA Astrophysics Data System (ADS)

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.

    2011-11-01

    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  12. Calculation of complex DNA damage induced by ions

    SciTech Connect

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.

    2011-11-15

    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  13. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage.

    PubMed

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-03-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  14. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage

    PubMed Central

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-01-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  15. DNA damage response in peripheral nervous system: coping with cancer therapy-induced DNA lesions.

    PubMed

    Englander, Ella W

    2013-08-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons. PMID:23684797

  16. DNA Damage Response in Peripheral Nervous System: Coping with Cancer Therapy-Induced DNA Lesions

    PubMed Central

    Englander, Ella W

    2013-01-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons. PMID:23684797

  17. Oxidative DNA damage induced by a metabolite of 2-naphthylamine, a smoking-related bladder carcinogen.

    PubMed

    Ohnishi, Shiho; Murata, Mariko; Kawanishi, Shosuke

    2002-07-01

    2-Naphthylamine (2-NA), a bladder carcinogen, is contained in cigarette smoke. DNA adduct formation is thought to be a major cause of DNA damage by carcinogenic aromatic amines. We have investigated whether a metabolite of 2-NA, 2-nitroso-1-naphthol (NO-naphthol) causes oxidative DNA damage, using (32)P-labeled DNA fragments. We compared the mechanism of DNA damage induced by NO-naphthol with that by N-hydroxy-4-aminobiphenyl (4-ABP(NHOH)), a metabolite of 4-aminobiphenyl, another smoking-related bladder carcinogen. NO-naphthol caused Cu(II)-mediated DNA damage at T > C > G residues, with non-enzymatic reduction by NADH. Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited the DNA damage, suggesting the involvement of H(2)O(2) and Cu(I). Some free. OH scavengers also attenuated NO-naphthol-induced DNA damage, while free. OH scavengers had no effect on the DNA damage induced by 4-ABP(NHOH). This difference suggests that the reactive species formed by NO-naphthol has more free. OH-character than that by 4-ABP(NHOH). A high-pressure liquid chromatograph equipped with an electrochemical detector showed that NO-naphthol induced 8-oxo-7,8-dihydro-2'-deoxyguanosine formation in the presence of NADH and Cu(II). The oxidative DNA damage by these amino-aromatic compounds may participate in smoking-related bladder cancer, in addition to DNA adduct formation. PMID:12149138

  18. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENNTIAL FLUORESENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

  19. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

  20. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)

    2000-01-01

    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  1. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    PubMed

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. PMID:24861204

  2. Vorinostat Induces Reactive Oxygen Species and DNA Damage in Acute Myeloid Leukemia Cells

    PubMed Central

    Pettersson, Filippa; Retrouvey, Hélène; Skoulikas, Sophia; Miller, Wilson H.

    2011-01-01

    Histone deacetylase inhibitors (HDACi) are promising anti-cancer agents, however, their mechanisms of action remain unclear. In acute myeloid leukemia (AML) cells, HDACi have been reported to arrest growth and induce apoptosis. In this study, we elucidate details of the DNA damage induced by the HDACi vorinostat in AML cells. At clinically relevant concentrations, vorinostat induces double-strand breaks and oxidative DNA damage in AML cell lines. Additionally, AML patient blasts treated with vorinostat display increased DNA damage, followed by an increase in caspase-3/7 activity and a reduction in cell viability. Vorinostat-induced DNA damage is followed by a G2-M arrest and eventually apoptosis. We found that pre-treatment with the antioxidant N-acetyl cysteine (NAC) reduces vorinostat-induced DNA double strand breaks, G2-M arrest and apoptosis. These data implicate DNA damage as an important mechanism in vorinostat-induced growth arrest and apoptosis in both AML cell lines and patient-derived blasts. This supports the continued study and development of vorinostat in AMLs that may be sensitive to DNA-damaging agents and as a combination therapy with ionizing radiation and/or other DNA damaging agents. PMID:21695163

  3. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  4. DNA damage-induced type I interferon promotes senescence and inhibits stem cell function

    PubMed Central

    Carbone, Christopher J.; Zhao, Bin; Katlinski, Kanstantsin V.; Zheng, Hui; Guha, Manti; Li, Ning; Chen, Qijun; Yang, Ting; Lengner, Christopher J.; Greenberg, Roger A.; Johnson, F. Brad; Fuchs, Serge Y.

    2015-01-01

    Expression of type I interferons (IFN) can be induced by DNA damaging agents but the mechanisms and significance of this regulation are not completely understood. We found that the transcription factor IRF3, activated in an ATM-IKKα/β dependent manner, stimulates cell-autonomous IFNβ expression in response to double-stranded DNA breaks. Cells and tissues with accumulating DNA damage produce endogenous IFNβ and stimulate IFN signaling in vitro and in vivo. In turn, IFN acts to amplify DNA damage responses, activate the p53 pathway, promote senescence and inhibit stem cells function in response to telomere shortening. Inactivation of the IFN pathway abrogates the development of diverse progeric phenotypes and extends the life span of Terc knockout mice. These data identify DNA damage response-induced IFN signaling as a critical mechanism that links accumulating DNA damage with senescence and premature aging. PMID:25921537

  5. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint

    PubMed Central

    Collins, Josie K.; Lane, Simon I. R.; Merriman, Julie A.; Jones, Keith T.

    2015-01-01

    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule–kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  6. DNA damage induces a meiotic arrest in mouse oocytes mediated by the spindle assembly checkpoint.

    PubMed

    Collins, Josie K; Lane, Simon I R; Merriman, Julie A; Jones, Keith T

    2015-01-01

    Extensive damage to maternal DNA during meiosis causes infertility, birth defects and abortions. However, it is unknown if fully grown oocytes have a mechanism to prevent the creation of DNA-damaged embryos. Here we show that DNA damage activates a pathway involving the spindle assembly checkpoint (SAC) in response to chemically induced double strand breaks, UVB and ionizing radiation. DNA damage can occur either before or after nuclear envelope breakdown, and provides an effective block to anaphase-promoting complex activity, and consequently the formation of mature eggs. This contrasts with somatic cells, where DNA damage fails to affect mitotic progression. However, it uncovers a second function for the meiotic SAC, which in the context of detecting microtubule-kinetochore errors has hitherto been labelled as weak or ineffectual in mammalian oocytes. We propose that its essential role in the detection of DNA damage sheds new light on its biological purpose in mammalian female meiosis. PMID:26522232

  7. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.

    PubMed

    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji

    2016-03-01

    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV. PMID:26573366

  8. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed

    2014-01-01

    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  9. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  10. Oxidative DNA damage induced by di-(2-ethylhexyl) phthalate in HEK-293 cell line.

    PubMed

    Wang, Xuan; Jiang, Lijie; Ge, Lan; Chen, Min; Yang, Guang; Ji, Fang; Zhong, Laifu; Guan, Yingjie; Liu, Xiaofang

    2015-05-01

    Di-(2-ethylhexyl) phthalate (DEHP) is commonly employed as a plasticizer. We have found that exposure of human embryonic kidney cell line 293 (HEK-293) to DEHP resulted in a crucial dose-dependent increase of DNA strand breaks in a comet assay. To elucidate the role of glutathione (GSH) in the DNA damage, the cells were pretreated with buthionine-(S,R)-sulfoximine (BSO) and pretreated with N-acetylcysteine (NAC), a GSH precursor. Here we show that depletion of GSH in HEK-293 cells with BSO dramatically increased the susceptibility of HEK-293 cells to DEHP-induced DNA damage. Furthermore, when the intracellular GSH content was elevated by NAC, the DNA damage induced by DEHP was almost completely abolished. In addition, DEHP had effect on lysosomal or mitochondrial damage at high dose level. These results indicate that DEHP exerts genotoxic effects in HEK-293 cells, probably through DNA damage induced by oxidative stress; GSH is responsible for cellular defense against DEHP-induced DNA damage; lysosome and mitochondria may be the vital targets in DEHP-induced DNA damage. PMID:25899473

  11. Detection of DNA damage induced by heavy ion irradiation in the individual cells with comet assay

    NASA Astrophysics Data System (ADS)

    Wada, S.; Natsuhori, M.; Ito, N.; Funayama, T.; Kobayashi, Y.

    2003-05-01

    Investigating the biological effects of high-LET heavy ion irradiation at low fluence is important to evaluate the risk of charged particles. Especially it is important to detect radiation damage induced by the precise number of heavy ions in the individual cells. Thus we studied the relationship between the number of ions traversing the cell and DNA damage produced by the ion irradiation. We applied comet assay to measure the DNA damage in the individual cells. Cells attached on the ion track detector CR-39 were irradiated with ion beams at TIARA, JAERI-Takasaki. After irradiation, the cells were stained with ethidium bromide and the opposite side of the CR-39 was etched. We observed that the heavy ions with higher LET values induced the heavier DNA damage. The result indicated that the amount of DNA damage induced by one particle increased with the LET values of the heavy ions.

  12. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.

    1989-01-01

    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  13. Determination of the Action Spectrum of UVR-Induced Mitochondrial DNA Damage in Human Skin Cells.

    PubMed

    Latimer, Jennifer A; Lloyd, James J; Diffey, Brian L; Matts, Paul J; Birch-Machin, Mark A

    2015-10-01

    Biological responses of human skin to UVR including cancer and aging are largely wavelength-dependent, as shown by the action spectra of UVR-induced erythema and nuclear DNA (nDNA) damage. A molecular dosimeter of UVR exposure is therefore required. Although mitochondrial DNA (mtDNA) damage has been shown to be a reliable and sensitive biomarker of UVR exposure in human skin, its wavelength dependency is unknown. The current study solves this problem by determining the action spectrum of UVR-induced mtDNA damage in human skin. Human neonatal dermal fibroblasts and primary human adult keratinocyte cells were irradiated with increasing doses of UVR. Dose-response curves of mtDNA damage were produced for each of the UVR sources and cell types, and an action spectrum for each cell type was determined by mathematical induction. Similarities between these mtDNA damage action spectra and previously determined nDNA damage were observed, with the most detrimental effects occurring over the shorter UVR wavelengths. Notably, a statistically significant (P<0.0001) greater sensitivity to mtDNA damage was observed in dermal fibroblasts compared with keratinocytes at wavelengths >300 nm, possibly indicating a wider picture of depth dependence in sensitivity. This finding has implications for disease/photodamage mechanisms and interventions. PMID:26030182

  14. Autophosphorylation and Pin1 binding coordinate DNA damage-induced HIPK2 activation and cell death.

    PubMed

    Bitomsky, Nadja; Conrad, Elisa; Moritz, Christian; Polonio-Vallon, Tilman; Sombroek, Dirk; Schultheiss, Kathrin; Glas, Carolina; Greiner, Vera; Herbel, Christoph; Mantovani, Fiamma; del Sal, Giannino; Peri, Francesca; Hofmann, Thomas G

    2013-11-01

    Excessive genome damage activates the apoptosis response. Protein kinase HIPK2 is a key regulator of DNA damage-induced apoptosis. Here, we deciphered the molecular mechanism of HIPK2 activation and show its relevance for DNA damage-induced apoptosis in cellulo and in vivo. HIPK2 autointeracts and site-specifically autophosphorylates upon DNA damage at Thr880/Ser882. Autophosphorylation regulates HIPK2 activity and mutation of the phosphorylation-acceptor sites deregulates p53 Ser46 phosphorylation and apoptosis in cellulo. Moreover, HIPK2 autophosphorylation is conserved between human and zebrafish and is important for DNA damage-induced apoptosis in vivo. Mechanistically, autophosphorylation creates a binding signal for the phospho-specific isomerase Pin1. Pin1 links HIPK2 activation to its stabilization by inhibiting HIPK2 polyubiquitination and modulating Siah-1-HIPK2 interaction. Concordantly, Pin1 is required for DNA damage-induced HIPK2 stabilization and p53 Ser46 phosphorylation and is essential for induction of apotosis both in cellulo and in zebrafish. Our results identify an evolutionary conserved mechanism regulating DNA damage-induced apoptosis. PMID:24145406

  15. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  16. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells.

    PubMed

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells' molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  17. The role of nitric oxide on DNA damage induced by benzene metabolites

    PubMed Central

    MELIKIAN, ASSIEH A.; CHEN, KUN-MING; LI, HEYI; SODUM, RAMA; FIALA, EMERICH; EL-BAYOUMY, KARAM

    2013-01-01

    Benzene, a tobacco constituent, is a leukemogen in humans and a carcinogen in rodents. Several benzene metabolites generate superoxide anion (O2•−) and induce nitric oxide synthase in the bone marrow of mice. We hypothesized that the reaction of nitric oxide (•NO) with O2•− leads to the formation of peroxynitrite as an intermediate during benzene metabolism. This hypothesis was supported by demonstrating that the exposure of mice to benzene produced nitrated metabolites and enhanced the levels of protein-bound 3-nitrotyrosine in the bone marrow of mice in vivo. In the current study, we investigated the influence of nitric oxide, generated from sodium 1-(N,N-diethylamino)diazen-1-ium-1,2-diolate, on DNA strand breaks induced by each single or binary benzene metabolite at different doses and compared the levels of the DNA damage induced by each benzene metabolite in the presence of nitric oxide with the levels of DNA strand breaks induced by peroxynitrite at similar doses in vitro. We found that among benzene metabolites only 1,2,4-trihydroxybenzene (BT) can induce significant DNA damage in the absence of nitric oxide. While 1,4-dihydroxybenzene (HQ), 1,4-benzo-quinone (BQ) and 1,2-dihydroxybenzene (CAT) require •NO to induce DNA strand breaks, hydroquinone was the most potent DNA-damaging benzene metabolite in the presence of •NO. The order of DNA breaks by benzene metabolites in the presence of •NO is: Peroxynitrite = HQ > BT > BQ > CAT. The •NO and O2•− scavengers inhibited DNA damage induced by [HQ+•NO]. Benzene, trans,trans-muconaldehyde, and phenol, do not induce DNA strand breaks either in the absence or presence of •NO. However, adding phenol to [HQ+•NO] leads to greater DNA damage than [HQ+•NO] alone. Collectively, these results suggest that nitric oxide is an important factor in DNA damage induced by certain benzene metabolites, probably via the formation of the peroxynitrite intermediate. Phenol, the major benzene metabolite

  18. A facile method for the assessment of DNA damage induced by UV-activated nanomaterials

    NASA Astrophysics Data System (ADS)

    Yamazaki, Yuka; Zinchenko, Anatoly A.; Murata, Shizuaki

    2011-07-01

    Fluorescent microscopy observation of gene-size DNA (T4 phage DNA or λ phage DNA) was used to assess DNA damage induced by UV irradiation in the presence of nanomaterials, such as QDs (quantum dots: CdSe/ZnS semiconductor nanoparticles), the water-soluble fullerene derivative C60(OH)n (n = 6-12) and titanium oxide nanoparticles of 25 nm in diameter. The magnitude of DNA damage could be simply evaluated based on the degree of shortening of the stretched DNA image. This method showed that DNA damage was amplified by the action of QDs under irradiation by C-band (λmax = 254 nm) or B-band (λmax = 303 nm) UV. Smaller QDs that emitted higher-energy fluorescence (λemmax = 565 nm) induced more severe damage than medium- and larger-size QDs that emitted longer-wavelength fluorescence (λemmax = 605 and 705 nm, respectively). The fullerene derivative and TiO2 nanoparticles caused DNA damage even under irradiation by A-band UV (λmax = 365 nm) and showed more severe DNA damage than QDs under similar conditions.

  19. Measurement of 60Co-gamma ray-induced DNA damage by capillary electrophoresis.

    PubMed

    Nackerdien, Z; Atha, D

    1996-08-01

    Capillary electrophoresis was employed in this study to monitor 60Co-gamma ray-induced damage to a 1 kb DNA ladder which consists of restriction fragments ranging from 75 to 12,000 bp. DNA samples (0.5 mg/ml) were exposed to 0-60 Gy of gamma-radiation in the presence and absence of 110 mumol/l ethidium bromide (EB). The analysis showed peak broadening without significant changes in the size distribution of irradiated fragments. Radiation-induced conformational changes may account for this peak broadening. EB addition caused small increases in the retention times of DNA fragments without affecting the overall DNA damage. This indicates that the presence of intercalated EB during radiation will not stabilize the DNA against 60Co-gamma ray-induced damage. PMID:8876442

  20. UV-induced DNA damage in Cyclops abyssorum tatricus populations from clear and turbid alpine lakes

    PubMed Central

    Tartarotti, Barbara; Saul, Nadine; Chakrabarti, Shumon; Trattner, Florian; Steinberg, Christian E. W.; Sommaruga, Ruben

    2014-01-01

    Zooplankton from clear alpine lakes thrive under high levels of solar UV radiation (UVR), but in glacially turbid ones they are more protected from this damaging radiation. Here, we present results from experiments done with Cyclops abyssorum tatricus to assess UV-induced DNA damage and repair processes using the comet assay. Copepods were collected from three alpine lakes of differing UV transparency ranging from clear to glacially turbid, and exposed to artificial UVR. In addition, photoprotection levels [mycosporine-like amino acids (MAAs) and lipophilic antioxidant capacity] were estimated in the test populations. Similar UV-induced DNA damage levels were observed among the copepods from all lakes, but background DNA damage (time zero and dark controls) was lowest in the copepods from the glacially turbid lake, resulting in a higher relative DNA damage accumulation. Most DNA strand breaks were repaired after recovery in the dark. Low MAA concentrations were found in the copepods from the glacially turbid lake, while the highest levels were observed in the population from the most UV transparent lake. However, the highest lipophilic antioxidant capacities were measured in the copepods from the lake with intermediate UV transparency. Photoprotection and the ability to repair DNA damage, and consequently reducing UV-induced damage, are part of the response mechanisms in zooplankton to changes in water transparency caused by glacier retreat. PMID:24616551

  1. DNA damage induced by m-phenylenediamine and its derivative in the presence of copper ion.

    PubMed

    Chen, F; Murata, M; Hiraku, Y; Yamashita, N; Oikawa, S; Kawanishi, S

    1998-09-01

    To clarify the mechanism of carcinogenesis by hair dyes, we compared the extent of DNA damage induced by mutagenic m-phenylenediamine and 4-methoxy-m-phenylenediamine, using 32P-5'-end-labeled DNA fragments obtained from the human c-Ha-ras-1 protooncogene and the p53 tumor suppressor gene. Carcinogenic 4-methoxy-m-phenylenediamine caused DNA damage at thymine and cytosine residues in the presence of Cu(II). Catalase and bathocuproine, a Cu(I)-specific chelator, inhibited 4-methoxy-m-phenylenediamine-induced DNA damage, suggesting the involvement of H2O2 and Cu(I). Superoxide dismutase (SOD) enhanced the DNA damage. Formation of 8-hydroxy-2'-deoxyguanosine (8-OH-dG) was induced by 4-methoxy-m-phenylenediamine in the presence of Cu(II). UV-visible spectroscopic studies have shown that Cu(II) mediated autoxidation of 4-methoxy-m-phenylenediamine and SOD accelerated the autoxidation. On the other hand, non-carcinogenic m-phenylenediamine did not cause clear DNA damage and significant autoxidation even in the presence of Cu(II). These results suggest that carcinogenicity of m-phenylenediamines is associated with ability to cause oxidative DNA damage rather than bacterial mutagenicity. PMID:9802551

  2. Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

    SciTech Connect

    Zheng, Juanjuan; Zhang, Yu; Xu, Wentao; Luo, YunBo; Hao, Junran; Shen, Xiao Li; Yang, Xuan; Li, Xiaohong; Huang, Kunlun

    2013-04-15

    Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did not affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage induced by

  3. Ochratoxin A induces oxidative DNA damage in liver and kidney after oral dosing to rats.

    PubMed

    Kamp, Hennicke G; Eisenbrand, Gerhard; Janzowski, Christine; Kiossev, Jetchko; Latendresse, John R; Schlatter, Josef; Turesky, Robert J

    2005-12-01

    The nephrotoxic/carcinogenic mycotoxin ochratoxin A (OTA) occurs as a contaminant in food and feed and may be linked to human endemic Balkan nephropathy. The mechanism of OTA-derived carcinogenicity is still under debate, since reactive metabolites of OTA and DNA adducts have not been unambiguously identified. Oxidative DNA damage, however, has been observed in vitro after incubation of mammalian cells with OTA. In this study, we investigated whether OTA induces oxidative DNA damage in vivo as well. Male F344 rats were dosed with 0, 0.03, 0.1, 0.3 mg/kg bw per day OTA for 4 wk (gavage, 7 days/wk, five animals per dose group). Subsequently, oxidative DNA damage was determined in liver and kidney by the comet assay (single cell gel electrophoresis) with/without use of the repair enzyme formamido-pyrimidine-DNA-glycosylase (FPG). The administration of OTA had no effect on basic DNA damage (determined without FPG); however, OTA-mediated oxidative damage was detected with FPG treatment in kidney and liver DNA of all dose groups. Since the doses were in a range that had caused kidney tumors in a 2-year carcinogenicity study with rats, the oxidative DNA damage induced by OTA may help to explain its mechanism of carcinogenicity. For the selective induction of tumors in the kidney, increased oxidative stress in connection with severe cytotoxicity and increased cell proliferation might represent driving factors. PMID:16302199

  4. The organophosphate insecticide chlorpyrifos confers its genotoxic effects by inducing DNA damage and cell apoptosis.

    PubMed

    Li, Diqiu; Huang, Qingchun; Lu, Miaoqing; Zhang, Lei; Yang, Zhichuan; Zong, Mimi; Tao, Liming

    2015-09-01

    The organophosphate insecticide chlorpyrifos (CPF) is known to induce neurological effects, malformation and micronucleus formation, persistent developmental disorders, and maternal toxicity in rats and mice. The binding of chlorpyrifos with DNA to produce DNA adducts leads to an increasing social concern about the genotoxic risk of CPF in human, but CPF-induced cytotoxicity through DNA damage and cell apoptosis is not well understood. Here, we quantified the cytotoxicity and potential genotoxicity of CPF using the alkaline comet assay, γH2AX foci formation, and the DNA laddering assay in order to detect DNA damage and apoptosis in human HeLa and HEK293 cells in vitro. Drosophila S2 cells were used as a positive control. The alkaline comet assay showed that sublethal concentrations of CPF induced significant concentration-dependent increases in single-strand DNA breaks in the treated cells compared with the control. The percentage of γH2AX-positive HeLa cells revealed that CPF also causes DNA double-strand breaks in a time-dependent manner. Moreover, DNA fragmentation analysis demonstrated that exposure to CPF induced a significant concentration- and time-dependent increase in cell apoptosis. We conclude that CPF is a strongly genotoxic agent that induces DNA damage and cell apoptosis. PMID:26002045

  5. DEVELOPMENT OF RAPID TECHNIQUES FOR DETECTION OF CHEMICALLY-INDUCED DNA DAMAGE

    EPA Science Inventory

    Rapid and cost-effective indicator assays are being developed which may be used as a rapid screen to assess the potential for exposure to hazardous compounds that can be related to a biological target (e.g., DNA). Chemically-induced DNA damage will be measured using surrogate DN...

  6. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.

    2011-01-01

    UVA has long been known for generating an oxidative stress in cells. In this paper we review the different types of DNA damage induced by UVA, i.e. strand breaks, bipyrimidine photoproducts, and oxidatively damaged bases. Emphasis is given to the mechanism of formation that is further illustrated by the presentation of new in vitro data. Examples of oxidation of proteins involved in DNA metabolism are also given.

  7. pRB plays an essential role in cell cycle arrest induced by DNA damage

    PubMed Central

    Harrington, Elizabeth A.; Bruce, Jacqueline L.; Harlow, Ed; Dyson, Nicholas

    1998-01-01

    To maintain genome stability, cells with damaged DNA must arrest to allow repair of mutations before replication. Although several key components required to elicit this arrest have been discovered, much of the pathway remains elusive. Here we report that pRB acts as a central mediator of the proliferative block induced by a diverse range of DNA damaging stimuli. Rb−/− mouse embryo fibroblasts are defective in arrest after γ-irradiation, UV irradiation, and treatment with a variety of chemotherapeutic drugs. In contrast, the pRB related proteins p107 and p130 do not play an essential part in the DNA damage response. pRB is required specifically for the G1/S phase checkpoint induced by γ-irradiation. Despite a defect in G1/S phase arrest, levels of p53 and p21 are increased normally in Rb−/− cells in response to γ-irradiation. These results lead us to propose a model in which pRB acts as an essential downstream target of the DNA damage-induced arrest pathway. The ability of pRB to prevent replication of damaged DNA is likely to inhibit the propagation of carcinogenic mutations and may therefore contribute to its role as a tumor suppressor. Furthermore, because many cancer therapies act by damaging DNA, these findings also have implications for the treatment of tumors in which pRB is inactivated. PMID:9751770

  8. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc.

    PubMed

    Cooper, Karen L; King, Brenee S; Sandoval, Monica M; Liu, Ke Jian; Hudson, Laurie G

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  9. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.

    PubMed

    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2014-07-01

    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma. PMID:24798949

  10. Ultrasound-induced DNA damage and signal transductions indicated by gammaH2AX

    NASA Astrophysics Data System (ADS)

    Furusawa, Yukihiro; Fujiwara, Yoshisada; Zhao, Qing-Li; Hassan, Mariame Ali; Ogawa, Ryohei; Tabuchi, Yoshiaki; Takasaki, Ichiro; Takahashi, Akihisa; Ohnishi, Takeo; Kondo, Takashi

    2011-09-01

    Ultrasound (US) has been shown to induce cancer cell death via different forms including apoptosis. Here, we report the potential of low-intensity pulsed US (LIPUS) to induce genomic DNA damage and subsequent DNA damage response. Using the ionizing radiation-induced DNA double-strand breaks (DSBs) as the positive control, we were able to observe the induction of DSBs (as neutral comet tails) and the subsequent formation of gammaH2AX-positive foci (by immunofluorescence detection) in human leukemia cells following exposure to LIPUS. The LIPUS-induced DNA damage arose most likely from the mechanical, but not sonochemical, effect of cavitation, based on our observation that the suppression of inertial cavitation abrogated the gammH2AX foci formation, whereas scavenging of free radical formation (e.g., hydroxyl radical) had no protective effect on it. Treatment with the specific kinase inhibitor of ATM or DNA-PKcs, which can phosphorylate H2AX Ser139, revealed that US-induced gammaH2AX was inhibited more effectively by the DNA-PK inhibitor than ATM kinase inhibitor. Notably, these inhibitor effects were opposite to those with radiation-induced gammH2AX. In conclusion, we report, for the first time that US can induce DNA damage and the DNA damage response as indicated by gammaH2AX was triggered by the cavitational mechanical effects. Thus, it is expected that the data shown here may provide a better understanding of the cellular responses to US.

  11. A DNA Damage-Induced, SOS-Independent Checkpoint Regulates Cell Division in Caulobacter crescentus

    PubMed Central

    Modell, Joshua W.; Kambara, Tracy K.; Perchuk, Barrett S.; Laub, Michael T.

    2014-01-01

    Cells must coordinate DNA replication with cell division, especially during episodes of DNA damage. The paradigm for cell division control following DNA damage in bacteria involves the SOS response where cleavage of the transcriptional repressor LexA induces a division inhibitor. However, in Caulobacter crescentus, cells lacking the primary SOS-regulated inhibitor, sidA, can often still delay division post-damage. Here we identify didA, a second cell division inhibitor that is induced by DNA damage, but in an SOS-independent manner. Together, DidA and SidA inhibit division, such that cells lacking both inhibitors divide prematurely following DNA damage, with lethal consequences. We show that DidA does not disrupt assembly of the division machinery and instead binds the essential division protein FtsN to block cytokinesis. Intriguingly, mutations in FtsW and FtsI, which drive the synthesis of septal cell wall material, can suppress the activity of both SidA and DidA, likely by causing the FtsW/I/N complex to hyperactively initiate cell division. Finally, we identify a transcription factor, DriD, that drives the SOS-independent transcription of didA following DNA damage. PMID:25350732

  12. DNA damage response during mitosis induces whole chromosome mis-segregation

    PubMed Central

    Bakhoum, Samuel F.; Kabeche, Lilian; Murnane, John P.; Zaki, Bassem I.; Compton, Duane A.

    2014-01-01

    Many cancers display both structural (s-CIN) and numerical (w-CIN) chromosomal instabilities. Defective chromosome segregation during mitosis has been shown to cause DNA damage that induces structural rearrangements of chromosomes (s-CIN). In contrast, whether DNA damage can disrupt mitotic processes to generate whole chromosomal instability (w-CIN) is unknown. Here we show that activation of the DNA damage response (DDR) during mitosis selectively stabilizes kinetochore-microtubule (k-MT) attachments to chromosomes through Aurora-A and Plk1 kinases, thereby increasing the frequency of lagging chromosomes during anaphase. Inhibition of DDR proteins, ATM or Chk2, abolishes the effect of DNA damage on k-MTs and chromosome segregation, whereas activation of the DDR in the absence of DNA damage is sufficient to induce chromosome segregation errors. Finally, inhibiting the DDR during mitosis in cancer cells with persistent DNA damage suppresses inherent chromosome segregation defects. Thus, DDR during mitosis inappropriately stabilizes k-MTs creating a link between s-CIN and w-CIN. PMID:25107667

  13. A DNA damage-induced, SOS-independent checkpoint regulates cell division in Caulobacter crescentus.

    PubMed

    Modell, Joshua W; Kambara, Tracy K; Perchuk, Barrett S; Laub, Michael T

    2014-10-01

    Cells must coordinate DNA replication with cell division, especially during episodes of DNA damage. The paradigm for cell division control following DNA damage in bacteria involves the SOS response where cleavage of the transcriptional repressor LexA induces a division inhibitor. However, in Caulobacter crescentus, cells lacking the primary SOS-regulated inhibitor, sidA, can often still delay division post-damage. Here we identify didA, a second cell division inhibitor that is induced by DNA damage, but in an SOS-independent manner. Together, DidA and SidA inhibit division, such that cells lacking both inhibitors divide prematurely following DNA damage, with lethal consequences. We show that DidA does not disrupt assembly of the division machinery and instead binds the essential division protein FtsN to block cytokinesis. Intriguingly, mutations in FtsW and FtsI, which drive the synthesis of septal cell wall material, can suppress the activity of both SidA and DidA, likely by causing the FtsW/I/N complex to hyperactively initiate cell division. Finally, we identify a transcription factor, DriD, that drives the SOS-independent transcription of didA following DNA damage. PMID:25350732

  14. Mcl-1 protects prostate cancer cells from cell death mediated by chemotherapy-induced DNA damage.

    PubMed

    Reiner, Teresita; de Las Pozas, Alicia; Parrondo, Ricardo; Palenzuela, Deanna; Cayuso, William; Rai, Priyamvada; Perez-Stable, Carlos

    2015-01-01

    The anti-apoptotic protein Mcl-1 is highly expressed in castration-resistant prostate cancer (CRPC), resulting in resistance to apoptosis and association with poor prognosis. Although predominantly localized in the cytoplasm, there is evidence that Mcl-1 exhibits nuclear localization where it is thought to protect against DNA damage-induced cell death. The role of Mcl-1 in mediating resistance to chemotherapy-induced DNA damage in prostate cancer (PCa) is not known. We show in human PCa cell lines and in TRAMP, a transgenic mouse model of PCa, that the combination of the antimitotic agent ENMD-1198 (analog of 2-methoxyestradiol) with betulinic acid (BA, increases proteotoxic stress) targets Mcl-1 by increasing its proteasomal degradation, resulting in increased γH2AX (DNA damage) and apoptotic/necrotic cell death. Knockdown of Mcl-1 in CRPC cells leads to elevated γH2AX, DNA strand breaks, and cell death after treatment with 1198 + BA- or doxorubicin. Additional knockdowns in PC3 cells suggests that cytoplasmic Mcl-1 protects against DNA damage by blocking the mitochondrial release of apoptosis-inducing factor and thereby preventing its nuclear translocation and subsequent interaction with the cyclophilin A endonuclease. Overall, our results suggest that chemotherapeutic agents that target Mcl-1 will promote cell death in response to DNA damage, particularly in CRPC. PMID:26425662

  15. The DNA damage-induced cell death response: a roadmap to kill cancer cells.

    PubMed

    Matt, Sonja; Hofmann, Thomas G

    2016-08-01

    Upon massive DNA damage cells fail to undergo productive DNA repair and trigger the cell death response. Resistance to cell death is linked to cellular transformation and carcinogenesis as well as radio- and chemoresistance, making the underlying signaling pathways a promising target for therapeutic intervention. Diverse DNA damage-induced cell death pathways are operative in mammalian cells and finally culminate in the induction of programmed cell death via activation of apoptosis or necroptosis. These signaling routes affect nuclear, mitochondria- and plasma membrane-associated key molecules to activate the apoptotic or necroptotic response. In this review, we highlight the main signaling pathways, molecular players and mechanisms guiding the DNA damage-induced cell death response. PMID:26791483

  16. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  17. Positive feedback regulation of p53 transactivity by DNA damage-induced ISG15 modification

    PubMed Central

    Park, Jong Ho; Yang, Seung Wook; Park, Jung Mi; Ka, Seung Hyeun; Kim, Ji-Hoon; Kong, Young-Yun; Jeon, Young Joo; Seol, Jae Hong; Chung, Chin Ha

    2016-01-01

    p53 plays a pivotal role in tumour suppression under stresses, such as DNA damage. ISG15 has been implicated in the control of tumorigenesis. Intriguingly, the expression of ISG15, UBE1L and UBCH8 is induced by DNA-damaging agents, such as ultraviolet and doxorubicin, which are known to induce p53. Here, we show that the genes encoding ISG15, UBE1L, UBCH8 and EFP, have the p53-responsive elements and their expression is induced in a p53-dependent fashion under DNA damage conditions. Furthermore, DNA damage induces ISG15 conjugation to p53 and this modification markedly enhances the binding of p53 to the promoters of its target genes (for example, CDKN1 and BAX) as well as of its own gene by promoting phosphorylation and acetylation, leading to suppression of cell growth and tumorigenesis. These findings establish a novel feedback circuit between p53 and ISG15-conjugating system for positive regulation of the tumour suppressive function of p53 under DNA damage conditions. PMID:27545325

  18. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    SciTech Connect

    Kim, G. J.; Lee, J. K.; Kim, W.; Kim, K. T.

    2010-01-11

    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  19. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    NASA Astrophysics Data System (ADS)

    Kim, G. J.; Kim, W.; Kim, K. T.; Lee, J. K.

    2010-01-01

    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  20. Tempol prevents genotoxicity induced by vorinostat: role of oxidative DNA damage.

    PubMed

    Alzoubi, Karem H; Khabour, Omar F; Jaber, Aya G; Al-Azzam, Sayer I; Mhaidat, Nizar M; Masadeh, Majed M

    2014-05-01

    Vorinostat is a member of histone deacetylase inhibitors, which represents a new class of anticancer agents for the treatment of solid and hematological malignancies. Studies have shown that these drugs induce DNA damage in blood lymphocytes, which is proposed to be due to the generation of oxidative lesions. The increase in DNA damage is sometimes associated with risk of developing secondary cancer. Thus, finding a treatment that limits DNA damage caused by anticancer drugs would be beneficial. Tempol is a potent antioxidant that was shown to prevent DNA damage induced by radiation. In this study, we aimed to investigate the harmful effects of vorinostat on DNA damage, and the possible protective effects of tempol against this damage. For that, the spontaneous frequency of sister chromatid exchanges (SCEs), chromosomal aberrations (CAs), and 8-hydroxy-2-deoxy guanosine (8-OHdG) levels were measured in cultured human lymphocytes treated with vorinostat and/or tempol. The results showed that vorinostat significantly increases the frequency of SCEs, CAs and 8-OHdG levels in human lymphocytes as compared to control. These increases were normalized by the treatment of cells with tempol. In conclusion, vorinostat is genotoxic to lymphocytes, and this toxicity is reduced by tempol. Such results could set the stage for future studies investigating the possible usefulness of antioxidants co-treatment in preventing the genotoxicity of vorinostat when used as anticancer in human. PMID:23761013

  1. Tirapazamine-induced cytotoxicity and DNA damage in transplanted tumors: relationship to tumor hypoxia.

    PubMed

    Siim, B G; Menke, D R; Dorie, M J; Brown, J M

    1997-07-15

    Tirapazamine (TPZ) is a hypoxia-selective bioreductive drug currently in Phases II and III clinical trials with both radiotherapy and chemotherapy. The response of tumors to TPZ is expected to depend both on the levels of reductive enzymes that activate the drug to a DNA-damaging and toxic species and on tumor oxygenation. Both of these parameters are likely to vary between individual tumors. In this study, we examined whether the enhancement of radiation damage to tumors by TPZ can be predicted from TPZ-induced DNA damage measured using the comet assay. DNA damage provides a functional end point that is directly related to cell killing and should be dependent on both reductive enzyme activity and hypoxia. We demonstrate that TPZ potentiates tumor cell kill by fractionated radiation in three murine tumors (SCCVII, RIF-1, and EMT6) and two human tumor xenografts (A549 and HT29), with no potentiation observed in a third xenograft (HT1080). Overall, there was no correlation of radiation potentiation and TPZ-induced DNA damage in the tumors, except that the nonresponsive tumor xenograft had significantly lower levels of DNA damage than the other five tumor types. However, there was a large tumor-to-tumor variability in DNA damage within each tumor type. This variability appeared not to result from differences in activity of the reductive enzymes but largely from differences in oxygenation between individual tumors, measured using fluorescent detection of the hypoxia marker EF5. The results, therefore, suggest that the sensitivity of individual tumors to TPZ, although not necessarily the response to TPZ plus radiation, might be assessed from measurements of DNA damage using the comet assay. PMID:9230202

  2. Radiation induced apoptosis and initial DNA damage are inversely related in locally advanced breast cancer patients

    PubMed Central

    2010-01-01

    Background DNA-damage assays, quantifying the initial number of DNA double-strand breaks induced by radiation, have been proposed as a predictive test for radiation-induced toxicity. Determination of radiation-induced apoptosis in peripheral blood lymphocytes by flow cytometry analysis has also been proposed as an approach for predicting normal tissue responses following radiotherapy. The aim of the present study was to explore the association between initial DNA damage, estimated by the number of double-strand breaks induced by a given radiation dose, and the radio-induced apoptosis rates observed. Methods Peripheral blood lymphocytes were taken from 26 consecutive patients with locally advanced breast carcinoma. Radiosensitivity of lymphocytes was quantified as the initial number of DNA double-strand breaks induced per Gy and per DNA unit (200 Mbp). Radio-induced apoptosis at 1, 2 and 8 Gy was measured by flow cytometry using annexin V/propidium iodide. Results Radiation-induced apoptosis increased in order to radiation dose and data fitted to a semi logarithmic mathematical model. A positive correlation was found among radio-induced apoptosis values at different radiation doses: 1, 2 and 8 Gy (p < 0.0001 in all cases). Mean DSB/Gy/DNA unit obtained was 1.70 ± 0.83 (range 0.63-4.08; median, 1.46). A statistically significant inverse correlation was found between initial damage to DNA and radio-induced apoptosis at 1 Gy (p = 0.034). A trend toward 2 Gy (p = 0.057) and 8 Gy (p = 0.067) was observed after 24 hours of incubation. Conclusions An inverse association was observed for the first time between these variables, both considered as predictive factors to radiation toxicity. PMID:20868468

  3. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.

    PubMed

    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena

    2012-06-01

    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. PMID:22556029

  4. Effects of (+)-catechin and (-)-epicatechin on heterocyclic amines-induced oxidative DNA damage.

    PubMed

    Haza, Ana Isabel; Morales, Paloma

    2011-01-01

    The aim of the present study was to evaluate the protective effect of (+)-catechin and (-)-epicatechin against 2-amino-3,8- dimethylimidazo[4,5-f]quinoxaline (8-MeIQx), 2-amino-3,4,8-trimethylimidazo[4,5-f]-quinoxaline (4,8-diMeIQx) and 2-amino-1-methyl-6-phenyl-imidazo[4,5-b]pyridine (PhIP)-induced DNA damage in human hepatoma cells (HepG2). DNA damage (strand breaks and oxidized purines/pyrimidines) was evaluated by the alkaline single-cell gel electrophoresis or comet assay. Increasing concentrations of 8-MeIQx, 4,8-diMeIQx and PhIP induced a significant increase in DNA strand breaks and oxidized purines and pyrimidines in a dose-dependent manner. Among those, PhIP (300 µm) exerted the highest genotoxicity. (+)-Catechin exerted protection against oxidized purines induced by 8-MeIQx, 4,8-diMeIQx and PhIP. Oxidized pyrimidines and DNA strand breaks induced by PhIP were also prevented by (+)-catechin. Otherwise, (-)-epicatechin protected against the oxidized pyrimidines induced by PhIP and the oxidized purines induced by 8-MeIQx and 4,8-diMeIQx. One feasible mechanism by which (+)-catechin and (-)-epicatechin exert their protective effect towards heterocyclic amines-induced oxidative DNA damage may be by modulation of phase I and II enzyme activities. The ethoxyresorufin O-deethylation (CYP1A1) activity was moderately inhibited by (+)-catechin, while little effect was observed by (-)-epicatechin. However, (+)-catechin showed the greatest increase in UDP-glucuronyltransferase activity. In conclusion, our results clearly indicate that (+)-catechin was more efficient than (-)-epicatechin in preventing DNA damage (strand breaks and oxidized purines/pyrimidines) induced by PhIP than that induced by 8-MeIQx and 4,8-diMeIQx. PMID:20583320

  5. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage-induced cell senescence.

    PubMed

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A; Kumar, Sheetal; Kalab, Petr

    2016-04-15

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase-regulated nuclear-cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage-induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β-dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP-regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  6. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.

    PubMed

    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A

    2013-09-01

    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity. PMID:23793613

  7. Spatiotemporal kinetics of γ-H2AX protein on charged particles induced DNA damage

    NASA Astrophysics Data System (ADS)

    Niu, H.; Chang, H. C.; Cho, I. C.; Chen, C. H.; Liu, C. S.; Chou, W. T.

    2014-08-01

    In several researches, it has been demonstrated that charged particles can induce more complex DNA damages. These complex damages have higher ability to cause the cell death or cell carcinogenesis. For this reason, clarifying the DNA repair mechanism after charged particle irradiation plays an important role in the development of charged particle therapy and space exploration. Unfortunately, the detail spatiotemporal kinetic of DNA damage repair is still unclear. In this study, we used γ-H2AX protein to investigate the spatiotemporal kinetics of DNA double strand breaks in alpha-particle irradiated HeLa cells. The result shows that the intensity of γ-H2AX foci increased gradually, and reached to its maximum at 30 min after irradiation. A good linear relationship can be observed between foci intensity and radiation dose. After 30 min, the γ-H2AX foci intensity was decreased with time passed, but remained a large portion (∼50%) at 48 h passed. The data show that the dissolution rate of γ-H2AX foci agreed with two components DNA repairing model. These results suggest that charged particles can induce more complex DNA damages and causing the retardation of DNA repair.

  8. Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.

    PubMed

    Schellenberg, Matthew J; Perera, Lalith; Strom, Christina N; Waters, Crystal A; Monian, Brinda; Appel, C Denise; Vilas, Caroline K; Williams, Jason G; Ramsden, Dale A; Williams, R Scott

    2016-05-01

    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA-protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg(2+)-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg(2+) binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons. PMID:27060144

  9. p53-dependent SIRT6 expression protects Aβ42-induced DNA damage

    PubMed Central

    Jung, Eun Sun; Choi, Hyunjung; Song, Hyundong; Hwang, Yu Jin; Kim, Ahbin; Ryu, Hoon; Mook-Jung, Inhee

    2016-01-01

    Alzheimer’s disease (AD) is the most common type of dementia and age-related neurodegenerative disease. Elucidating the cellular changes that occur during ageing is an important step towards understanding the pathogenesis and progression of neurodegenerative disorders. SIRT6 is a member of the mammalian sirtuin family of anti-aging genes. However, the relationship between SIRT6 and AD has not yet been elucidated. Here, we report that SIRT6 protein expression levels are reduced in the brains of both the 5XFAD AD mouse model and AD patients. Aβ42, a major component of senile plaques, decreases SIRT6 expression, and Aβ42-induced DNA damage is prevented by the overexpression of SIRT6 in HT22 mouse hippocampal neurons. Also, there is a strong negative correlation between Aβ42-induced DNA damage and p53 levels, a protein involved in DNA repair and apoptosis. In addition, upregulation of p53 protein by Nutlin-3 prevents SIRT6 reduction and DNA damage induced by Aβ42. Taken together, this study reveals that p53-dependent SIRT6 expression protects cells from Aβ42-induced DNA damage, making SIRT6 a promising new therapeutic target for the treatment of AD. PMID:27156849

  10. DNA damage sensor MRE11 recognizes cytosolic double-stranded DNA and induces type I interferon by regulating STING trafficking

    PubMed Central

    Kondo, Takeshi; Kobayashi, Junya; Saitoh, Tatsuya; Maruyama, Kenta; Ishii, Ken J.; Barber, Glen N.; Komatsu, Kenshi; Akira, Shizuo; Kawai, Taro

    2013-01-01

    Double-stranded DNA (dsDNA) derived from pathogen- or host-damaged cells triggers innate immune responses when exposed to cytoplasm. However, the machinery underlying the primary recognition of intracellular dsDNA is obscure. Here we show that the DNA damage sensor, meiotic recombination 11 homolog A (MRE11), serves as a cytosolic sensor for dsDNA. Cells with a mutation of MRE11 gene derived from a patient with ataxia-telangiectasia–like disorder, and cells in which Mre11 was knocked down, had defects in dsDNA-induced type I IFN production. MRE11 physically interacted with dsDNA in the cytoplasm and was required for activation of stimulator of IFN genes (STING) and IRF3. RAD50, a binding protein to MRE11, was also required for dsDNA responses, whereas NBS1, another binding protein to MRE11, was dispensable. Collectively, our results suggest that the MRE11–RAD50 complex plays important roles in recognition of dsDNA and initiation of STING-dependent signaling, in addition to its role in DNA-damage responses. PMID:23388631

  11. Exercise-induced oxidatively damaged DNA in humans: evaluation in plasma or urine?

    PubMed

    Karpouzi, Christina; Nikolaidis, Stefanos; Kabasakalis, Athanasios; Tsalis, George; Mougios, Vassilis

    2016-01-01

    Physical exercise can induce oxidative damage in humans. 8-Hydroxy-2'-deoxyguanosine (8-OHdG) is a widely known biomarker of DNA oxidation, which can be determined in blood and urine. The aim of the present study was to compare these two biological fluids in terms of which is more suitable for the estimation of the oxidative damage of DNA by measuring the concentration of 8-OHdG one hour after maximal exercise by enzyme immunoassay. The concentration of 8-OHdG increased with exercise only in plasma (p < 0.001), and values differed between exercise tests in both plasma and urine (p < 0.05). In conclusion, plasma appears to be more sensitive to exercise-induced 8-OHdG changes than urine and, hence, a more appropriate medium for assessing oxidative damage of DNA, although the poor repeatability of the measurement needs to be addressed in future studies. PMID:26849281

  12. UvrD helicase suppresses recombination and DNA damage-induced deletions.

    PubMed

    Kang, Josephine; Blaser, Martin J

    2006-08-01

    UvrD, a highly conserved helicase involved in mismatch repair, nucleotide excision repair (NER), and recombinational repair, plays a critical role in maintaining genomic stability and facilitating DNA lesion repair in many prokaryotic species. In this report, we focus on the UvrD homolog in Helicobacter pylori, a genetically diverse organism that lacks many known DNA repair proteins, including those involved in mismatch repair and recombinational repair, and that is noted for high levels of inter- and intragenomic recombination and mutation. H. pylori contains numerous DNA repeats in its compact genome and inhabits an environment rich in DNA-damaging agents that can lead to increased rearrangements between such repeats. We find that H. pylori UvrD functions to repair DNA damage and limit homologous recombination and DNA damage-induced genomic rearrangements between DNA repeats. Our results suggest that UvrD and other NER pathway proteins play a prominent role in maintaining genome integrity, especially after DNA damage; thus, NER may be especially critical in organisms such as H. pylori that face high-level genotoxic stress in vivo. PMID:16855234

  13. Damage to dry plasmid DNA induced by nanosecond XUV-laser pulses

    NASA Astrophysics Data System (ADS)

    Nováková, Eva; Davídková, Marie; Vyšín, Ludék; Burian, Tomáš; Grisham, Michael E.; Heinbuch, Scott; Rocca, Jorge J.; Juha, Libor

    2011-06-01

    Ionizing radiation induces a variety of DNA damages including single-strand breaks (SSBs), double-strand breaks (DSBs), abasic sites, modified sugar and bases. Most theoretical and experimental studies have been focused on DNA strand scissions, in particular production of DNA double-strand breaks. DSBs have been proven to be a key damage at a molecular level responsible for the formation of chromosomal aberrations, leading often to cell death. The complexity of lesions produced in DNA by ionizing radiations is thought to depend on the amount of energy deposited at the site of each lesion. We have studied the nature of DNA damage induced directly by the pulsed 46.9 nm radiation provided by a capillary-discharge Ne-like Ar laser (CDL). Different surface doses were delivered with a repetition rate of a few Hz and an average pulse energy ~ 1 μJ. A simple model DNA molecule, i.e., dried closed-circular plasmid DNA (pBR322), was irradiated. The agarose gel electrophoresis method was used for determination of both SSB and DSB yields. Results are compared with a previous study of plasmid DNA irradiated with a single sub-nanosecond 1-keV X-ray pulse produced by a large-scale, double-stream gas puff target, illuminated by sub-kJ, near-infrared (NIR) focused laser pulses at the PALS facility (Prague Asterix Laser System).

  14. DNA damage-induced metaphase I arrest is mediated by the spindle assembly checkpoint and maternal age

    PubMed Central

    Marangos, Petros; Stevense, Michelle; Niaka, Konstantina; Lagoudaki, Michaela; Nabti, Ibtissem; Jessberger, Rolf; Carroll, John

    2015-01-01

    In mammalian oocytes DNA damage can cause chromosomal abnormalities that potentially lead to infertility and developmental disorders. However, there is little known about the response of oocytes to DNA damage. Here we find that oocytes with DNA damage arrest at metaphase of the first meiosis (MI). The MI arrest is induced by the spindle assembly checkpoint (SAC) because inhibiting the SAC overrides the DNA damage-induced MI arrest. Furthermore, this MI checkpoint is compromised in oocytes from aged mice. These data lead us to propose that the SAC is a major gatekeeper preventing the progression of oocytes harbouring DNA damage. The SAC therefore acts to integrate protection against both aneuploidy and DNA damage by preventing production of abnormal mature oocytes and subsequent embryos. Finally, we suggest escaping this DNA damage checkpoint in maternal ageing may be one of the causes of increased chromosome anomalies in oocytes and embryos from older mothers. PMID:26522734

  15. DNA damage-induced metaphase I arrest is mediated by the spindle assembly checkpoint and maternal age.

    PubMed

    Marangos, Petros; Stevense, Michelle; Niaka, Konstantina; Lagoudaki, Michaela; Nabti, Ibtissem; Jessberger, Rolf; Carroll, John

    2015-01-01

    In mammalian oocytes DNA damage can cause chromosomal abnormalities that potentially lead to infertility and developmental disorders. However, there is little known about the response of oocytes to DNA damage. Here we find that oocytes with DNA damage arrest at metaphase of the first meiosis (MI). The MI arrest is induced by the spindle assembly checkpoint (SAC) because inhibiting the SAC overrides the DNA damage-induced MI arrest. Furthermore, this MI checkpoint is compromised in oocytes from aged mice. These data lead us to propose that the SAC is a major gatekeeper preventing the progression of oocytes harbouring DNA damage. The SAC therefore acts to integrate protection against both aneuploidy and DNA damage by preventing production of abnormal mature oocytes and subsequent embryos. Finally, we suggest escaping this DNA damage checkpoint in maternal ageing may be one of the causes of increased chromosome anomalies in oocytes and embryos from older mothers. PMID:26522734

  16. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu

    2015-01-01

    Living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, affects on the cellular response to DNA damage induced by exposures to radiation or other toxic chemicals will have an impact on the radiation risks for the astronauts, as well as on the mutation rate in microorganisms, is still an open question. Although the possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate the effects of spaceflight on the cellular response to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induces DNA damages including the double strand breaks (DSB) similar to the ionizing radiation. Damage in the DNA was measured by the phosphorylation of a histone protein H2AX (-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in the DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ti-67 signals. Our results suggested that the difference in -H2AX between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect the response of the DNA damage response genes to bleomycin treatment.

  17. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu

    2015-01-01

    Outside the protection of the geomagnetic field, astronauts and other living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, have effects on cellular responses to DNA damage induced by exposure to radiation or cytotoxic chemicals is still unknown, as is their impact on the radiation risks for astronauts and on the mutation rate in microorganisms. Although possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on cellular responses to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induced DNA damages including double-strand breaks (DSB) similar to the ionizing radiation. Damages in the DNA were measured by the phosphorylation of a histone protein H2AX (g-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ki-67 signals. Our results suggested that the difference in g-H2AX focus counts between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect initial transcriptional responses of the DNA damage response genes to

  18. Study on DNA Damage Induced by Neon Beam Irradiation in Saccharomyces Cerevisiae

    NASA Astrophysics Data System (ADS)

    Lu, Dong; Li, Wenjian; Wu, Xin; Wang, Jufang; Ma, Shuang; Liu, Qingfang; He, Jinyu; Jing, Xigang; Ding, Nan; Dai, Zhongying; Zhou, Jianping

    2010-12-01

    Yeast strain Saccharomyces cerevisiae was irradiated with different doses of 85 MeV/u 20Ne10+ to investigate DNA damage induced by heavy ion beam in eukaryotic microorganism. The survival rate, DNA double strand breaks (DSBs) and DNA polymorphic were tested after irradiation. The results showed that there were substantial differences in DNA between the control and irradiated samples. At the dose of 40 Gy, the yeast cell survival rate approached 50%, DNA double-strand breaks were barely detectable, and significant DNA polymorphism was observed. The alcohol dehydrogenase II gene was amplified and sequenced. It was observed that base changes in the mutant were mainly transversions of T→G and T→C. It can be concluded that heavy ion beam irradiation can lead to change in single gene and may be an effective way to induce mutation.

  19. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes

    PubMed Central

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W.; Agarwal, Rajesh

    2014-01-01

    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury. PMID:24732344

  20. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.

    PubMed

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh

    2014-01-01

    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury. PMID:24732344

  1. Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells

    PubMed Central

    Zhang, Zhuhong; Chen, Si; Mei, Hu; Xuan, Jiekun; Guo, Xiaoqing; Couch, Letha; Dobrovolsky, Vasily N.; Guo, Lei; Mei, Nan

    2015-01-01

    Ginkgo biloba leaf extract has been shown to increase the incidence in liver tumors in mice in a 2-year bioassay conducted by the National Toxicology Program. In this study, the DNA damaging effects of Ginkgo biloba leaf extract and many of its constituents were evaluated in human hepatic HepG2 cells and the underlying mechanism was determined. A molecular docking study revealed that quercetin, a flavonoid constituent of Ginkgo biloba, showed a higher potential to interact with topoisomerase II (Topo II) than did the other Ginkgo biloba constituents; this in silico prediction was confirmed by using a biochemical assay to study Topo II enzyme inhibition. Moreover, as measured by the Comet assay and the induction of γ-H2A.X, quercetin, followed by keampferol and isorhamnetin, appeared to be the most potent DNA damage inducer in HepG2 cells. In Topo II knockdown cells, DNA damage triggered by Ginkgo biloba leaf extract or quercetin was dramatically decreased, indicating that DNA damage is directly associated with Topo II. DNA damage was also observed when cells were treated with commercially available Ginkgo biloba extract product. Our findings suggest that Ginkgo biloba leaf extract- and quercetin-induced in vitro genotoxicity may be the result of Topo II inhibition. PMID:26419945

  2. Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells.

    PubMed

    Zhang, Zhuhong; Chen, Si; Mei, Hu; Xuan, Jiekun; Guo, Xiaoqing; Couch, Letha; Dobrovolsky, Vasily N; Guo, Lei; Mei, Nan

    2015-01-01

    Ginkgo biloba leaf extract has been shown to increase the incidence in liver tumors in mice in a 2-year bioassay conducted by the National Toxicology Program. In this study, the DNA damaging effects of Ginkgo biloba leaf extract and many of its constituents were evaluated in human hepatic HepG2 cells and the underlying mechanism was determined. A molecular docking study revealed that quercetin, a flavonoid constituent of Ginkgo biloba, showed a higher potential to interact with topoisomerase II (Topo II) than did the other Ginkgo biloba constituents; this in silico prediction was confirmed by using a biochemical assay to study Topo II enzyme inhibition. Moreover, as measured by the Comet assay and the induction of γ-H2A.X, quercetin, followed by keampferol and isorhamnetin, appeared to be the most potent DNA damage inducer in HepG2 cells. In Topo II knockdown cells, DNA damage triggered by Ginkgo biloba leaf extract or quercetin was dramatically decreased, indicating that DNA damage is directly associated with Topo II. DNA damage was also observed when cells were treated with commercially available Ginkgo biloba extract product. Our findings suggest that Ginkgo biloba leaf extract- and quercetin-induced in vitro genotoxicity may be the result of Topo II inhibition. PMID:26419945

  3. PEA15 Regulates the DNA Damage-Induced Cell Cycle Checkpoint and Oncogene-Directed Transformation

    PubMed Central

    Nagarajan, Arvindhan; Dogra, Shaillay Kumar; Liu, Alex Y.; Green, Michael R.

    2014-01-01

    Regulation of the DNA damage response and cell cycle progression is critical for maintaining genome integrity. Here, we report that in response to DNA damage, COPS5 deubiquitinates and stabilizes PEA15 in an ATM kinase-dependent manner. PEA15 expression oscillates throughout the cell cycle, and the loss of PEA15 accelerates cell cycle progression by activating CDK6 expression via the c-JUN transcription factor. Cells lacking PEA15 exhibit a DNA damage-induced G2/M checkpoint defect due to increased CDC25C activity and, consequentially, higher cyclin-dependent kinase 1 (CDK1)/cyclin B activity, and accordingly they have an increased rate of spontaneous mutagenesis. We find that oncogenic RAS inhibits PEA15 expression and that ectopic PEA15 expression blocks RAS-mediated transformation, which can be partially rescued by ectopic expression of CDK6. Finally, we show that PEA15 expression is downregulated in colon, breast, and lung cancer samples. Collectively, our results demonstrate that tumor suppressor PEA15 is a regulator of genome integrity and is an integral component of the DNA damage response pathway that regulates cell cycle progression, the DNA-damage-induced G2/M checkpoint, and cellular transformation. PMID:24710276

  4. PEA15 regulates the DNA damage-induced cell cycle checkpoint and oncogene-directed transformation.

    PubMed

    Nagarajan, Arvindhan; Dogra, Shaillay Kumar; Liu, Alex Y; Green, Michael R; Wajapeyee, Narendra

    2014-06-01

    Regulation of the DNA damage response and cell cycle progression is critical for maintaining genome integrity. Here, we report that in response to DNA damage, COPS5 deubiquitinates and stabilizes PEA15 in an ATM kinase-dependent manner. PEA15 expression oscillates throughout the cell cycle, and the loss of PEA15 accelerates cell cycle progression by activating CDK6 expression via the c-JUN transcription factor. Cells lacking PEA15 exhibit a DNA damage-induced G2/M checkpoint defect due to increased CDC25C activity and, consequentially, higher cyclin-dependent kinase 1 (CDK1)/cyclin B activity, and accordingly they have an increased rate of spontaneous mutagenesis. We find that oncogenic RAS inhibits PEA15 expression and that ectopic PEA15 expression blocks RAS-mediated transformation, which can be partially rescued by ectopic expression of CDK6. Finally, we show that PEA15 expression is downregulated in colon, breast, and lung cancer samples. Collectively, our results demonstrate that tumor suppressor PEA15 is a regulator of genome integrity and is an integral component of the DNA damage response pathway that regulates cell cycle progression, the DNA-damage-induced G2/M checkpoint, and cellular transformation. PMID:24710276

  5. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton

    SciTech Connect

    Malloy, K.D.; Holman, M.A.; Mitchell, D.

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlated with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. 54 refs., 4 figs., 2 tabs.

  6. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton.

    PubMed

    Malloy, K D; Holman, M A; Mitchell, D; Detrich, H W

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlate with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. PMID:9037040

  7. The radiomimetic enediyne C-1027 induces unusual DNA damage responses to double-strand breaks.

    PubMed

    Kennedy, Daniel R; Beerman, Terry A

    2006-03-21

    Cells lacking the protein kinase ataxia telangiectasia mutated (ATM) have defective responses to DNA double-strand breaks (DSBs), including an inability to activate damage response proteins such as p53. However, we previously showed that cells lacking ATM robustly activate p53 in response to DNA strand breaks induced by the radiomimetic enediyne C-1027. To gain insight into the nature of C-1027-induced ATM-independent damage responses to DNA DSBs, we further examined the molecular mechanisms underlying the cellular response to this unique radiomimetic agent. Like ionizing radiation (IR) and other radiomimetics, breaks induced by C-1027 efficiently activate ATM by phosphorylation at Ser1981, yet unlike other radiomimetics and IR, DNA breaks induced by C-1027 result in normal phosphorylation of p53 and the cell cycle checkpoint kinases (Chk1 and Chk2) in the absence of ATM. In the presence of ATM, but under ATM and Rad3-related kinase (ATR) deficient conditions, C-1027 treatment resulted in a decrease in the level of Chk1 phosphorylation but not in the level of p53 and Chk2 phosphorylation. Only when cells were deficient in both ATM and ATR was there a reduction in the level of phosphorylation of each of these DNA damage response proteins. This reduction was also accompanied by an increased level of cell death in comparison to that of wild-type cells or cells lacking either ATM or ATR. Our findings demonstrate a unique cellular response to C-1027-induced DNA DSBs in that DNA damage response proteins are unaffected by the absence of ATM, as long as ATR is present. PMID:16533058

  8. ORGANIC AND INORGANIC ARSENICALS SENSITIZE HUMAN BRONCHIAL EPITHELIAL CELLS TO HYDROGEN PEROXIDE-INDUCED DNA DAMAGE

    EPA Science Inventory

    The lungs are a target organ for arsenic carcinogenesis, however, its mechanism of action remains unclear. Furthermore, it has been suggested that inorganic arsenic (iAs) can potentiate DNA damage induced by other agents. Once inside the human body iAs generally undergoes two ...

  9. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B.

    PubMed

    Wemhoff, Sabrina; Klassen, Roland; Beetz, Anja; Meinhardt, Friedhelm

    2016-01-01

    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity. PMID:27472060

  10. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B

    PubMed Central

    Beetz, Anja; Meinhardt, Friedhelm

    2016-01-01

    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity. PMID:27472060

  11. Hyperprolinemia induces DNA, protein and lipid damage in blood of rats: antioxidant protection.

    PubMed

    Ferreira, Andréa G K; Scherer, Emilene B; da Cunha, Aline A; Manfredini, Vanusa; Biancini, Giovana Brondani; Vanzin, Camila Simioni; Vargas, Carmen R; Wyse, Angela T S

    2014-09-01

    The present study investigated the effects of hyperprolinemia on oxidative damage to biomolecules (protein, lipids and DNA) and the antioxidant status in blood of rats. The influence of the antioxidants on the effects elicited by proline was also examined. Wistar rats received two daily injections of proline and/or vitamin E plus C (6th-28th day of life) and were killed 12h after the last injection. Results showed that hyperprolinemia induced a significant oxidative damage to proteins, lipids and DNA demonstrated by increased carbonyl content, malondialdehyde levels and a greater damage index in comet assay, respectively. The concomitant antioxidants administration to proline treatment completely prevented oxidative damage to proteins, but partially prevented lipids and DNA damage. We also observed that the non-enzymatic antioxidant potential was decreased by proline treatment and partially prevented by antioxidant supplementation. The plasma levels of vitamins E and C significantly increased in rats treated exogenously with these vitamins but, interestingly, when proline was administered concomitantly with vitamin E plus C, the levels of these vitamins were similar to those found in plasma of control and proline rats. Our findings suggest that hyperprolinemia promotes oxidative damage to the three major classes of macromolecules in blood of rats. These effects were accomplished by decrease in non-enzymatic antioxidant potential and decrease in vitamins administered exogenously, which significantly decreased oxidative damage to biomolecules studied. These data suggest that antioxidants may be an effective adjuvant therapeutic to limit oxidative damage caused by proline. PMID:24980685

  12. Persistent and heritable structural damage induced in heterochromatic DNA from rat liver by N-nitrosodimethylamine

    SciTech Connect

    Ward, E.J.; Stewart, B.W.

    1987-03-24

    Analysis, by benzoylated DEAE-cellulose chromatography, has been made of structural change in eu- and heterochromatic DNA from rat liver following administration of the carcinogen N-nitrosodimethylamine. Either hepatic DNA was prelabeled with (/sup 3/H)thymidine administered 2-3 weeks before injection of the carcinogen or the labeled precursor was given during regenerative hyperplasia in rats treated earlier with N-nitrosodimethylamine. Following phenol extraction of either whole liver homogenate or nuclease-fractionated eu- and heterochromatin, carcinogen-modified DNA was examined by stepwise or caffeine gradient elution from benzoylated DEAE-cellulose. In whole DNA, nitrosamine-induced single-stranded character was maximal 4-24 h after treatment, declining rapidly thereafter; gradient elution of these DNA preparations also provided short-term evidence of structural change. Caffeine gradient chromatography suggested short-term nitrosamine-induced structural change in euchromatic DNA, while increased binding of heterochromatic DNA was evident for up to 3 months after carcinogen treatment. Preparations of newly synthesized heterochromatic DNA from animals subjected to hepatectomy up to 2 months after carcinogen treatment provided evidence of heritable structural damage. Carcinogen-induced binding of heterochromatic DNA to benzoylated DEAE-cellulose was indicative of specific structural lesions whose affinity equalled that of single-stranded DNA up to 1.0 kilobase in length. The data suggest that structural lesions in heterochromatin, which may be a consequence of incomplete repair, are preferentially degraded by endogenous nuclease(s).

  13. Clustered DNA damages induced in human hematopoietic cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Bennett, Paula V.; Cintron-Torres, Nela; Hada, Megumi; Trunk, John; Monteleone, Denise; Sutherland, John C.; Laval, Jacques; Stanislaus, Marisha; Gewirtz, Alan

    2002-01-01

    Ionizing radiation induces clusters of DNA damages--oxidized bases, abasic sites and strand breaks--on opposing strands within a few helical turns. Such damages have been postulated to be difficult to repair, as are double strand breaks (one type of cluster). We have shown that low doses of low and high linear energy transfer (LET) radiation induce such damage clusters in human cells. In human cells, DSB are about 30% of the total of complex damages, and the levels of DSBs and oxidized pyrimidine clusters are similar. The dose responses for cluster induction in cells can be described by a linear relationship, implying that even low doses of ionizing radiation can produce clustered damages. Studies are in progress to determine whether clusters can be produced by mechanisms other than ionizing radiation, as well as the levels of various cluster types formed by low and high LET radiation.

  14. Cytoprotective effect of 20S-Rg3 on benzo[a]pyrene-induced DNA damage.

    PubMed

    Poon, Po Ying; Kwok, Hoi Hin; Yue, Patrick Y K; Yang, Mildred S M; Mak, Nai Ki; Wong, Chris K C; Wong, Ricky N S

    2012-01-01

    Benzo[a]pyrene (BaP) is a polycyclic aromatic hydrocarbon ubiquitously existing in the environment. Its metabolites have been shown to cause DNA damage and cellular dysfunction in humans. Panax ginseng C.A. Meyer is a Chinese medicinal herb, and ginsenosides are the main active constituent of ginseng. Accumulating evidence had indicated that ginseng extract and ginsenosides possess cytoprotective effects. In this study, the protective effect of ginsenosides on BaP-induced DNA damage in human dermal fibroblasts (HDFs) and HepG2 cells was investigated. The genotoxic effect of BaP was measured by the comet assay. Results showed that tail moment was increased in BaP-treated cells, but cotreatment of ginsenoside 20(S)-Rg3 can significantly decrease BaP-induced DNA damage. A downstream mechanistic study revealed that 20(S)-Rg3 increased the gene expression of an important phase II detoxifying enzyme NAD(P)H:quinine oxidoreductase 1. The effect was also associated with the activation of protein kinase B (Akt) and nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2). These results indicated that 20(S)-Rg3 might protect HDFs from BaP-induced DNA damage through the activation of the phosphatidylinositol 3-kinase/Akt/Nrf2 pathway. Our results also demonstrated that 20(S)-Rg3 is a functional ligand of pregnane X receptor (PXR), a nuclear receptor that mediates the induction of drug clearance pathways. Subsequent knockdown of PXR expression by small interfering RNA confirmed the involvement of PXR on the protective effects of 20(S)-Rg3 against BaP-induced DNA damage. In summary, ginsenoside 20(S)-Rg3 can protect against BaP-induced genotoxicity in human cells, suggesting that ginseng may serve as a natural cytoprotective agent against environmental carcinogens. PMID:21956953

  15. The eucalyptus oil ingredient 1,8-cineol induces oxidative DNA damage.

    PubMed

    Dörsam, Bastian; Wu, Ching-Fen; Efferth, Thomas; Kaina, Bernd; Fahrer, Jörg

    2015-05-01

    The natural compound 1,8-cineol, also known as eucalyptol, is a major constituent of eucalyptus oil. This epoxy-monoterpene is used as flavor and fragrance in consumer goods as well as medical therapies. Due to its anti-inflammatory properties, 1,8-cineol is also applied to treat upper and lower airway diseases. Despite its widespread use, only little is known about the genotoxicity of 1,8-cineol in mammalian cells. This study investigates the genotoxicity and cytotoxicity of 1,8-cineol in human and hamster cells. First, we observed a significant and concentration-dependent increase in oxidative DNA damage in human colon cancer cells, as detected by the Formamidopyrimidine-DNA glycosylase (Fpg)-modified alkaline comet assay. Pre-treatment of cells with the antioxidant N-acetylcysteine prevented the formation of Fpg-sensitive sites after 1,8-cineol treatment, supporting the notion that 1,8-cineol induces oxidative DNA damage. In the dose range of DNA damage induction, 1,8-cineol did neither reduce the viability of colon cancer cells nor affected their cell cycle distribution, suggesting that cells tolerate 1,8-cineol-induced oxidative DNA damage by engaging DNA repair. To test this hypothesis, hamster cell lines with defects in BRCA2 and Rad51, which are essentials players of homologous recombination (HR)-mediated repair, were treated with 1,8-cineol. The monoterpene induced oxidative DNA damage and subsequent DNA double-strand breaks in the hamster cell lines tested. Intriguingly, we detected a significant concentration-dependent decrease in viability of the HR-defective cells, whereas the corresponding wild-type cell lines with functional HR were not affected. Based on these findings, we conclude that 1,8-cineol is weakly genotoxic, inducing primarily oxidative DNA damage, which is most likely tolerated in DNA repair proficient cells without resulting in cell cycle arrest and cell death. However, cells with deficiency in HR were compromised after 1,8-cineol

  16. Cdt1 and Cdc6 Are Destabilized by Rereplication-induced DNA Damage*S⃞

    PubMed Central

    Hall, Jonathan R.; Lee, Hyun O.; Bunker, Brandon D.; Dorn, Elizabeth S.; Rogers, Greg C.; Duronio, Robert J.; Cook, Jeanette Gowen

    2008-01-01

    The replication factors Cdt1 and Cdc6 are essential for origin licensing, a prerequisite for DNA replication initiation. Mechanisms to ensure that metazoan origins initiate once per cell cycle include degradation of Cdt1 during S phase and inhibition of Cdt1 by the geminin protein. Geminin depletion or overexpression of Cdt1 or Cdc6 in human cells causes rereplication, a form of endogenous DNA damage. Rereplication induced by these manipulations is however uneven and incomplete, suggesting that one or more mechanisms restrain rereplication once it begins. We find that both Cdt1 and Cdc6 are degraded in geminin-depleted cells. We further show that Cdt1 degradation in cells that have rereplicated requires the PCNA binding site of Cdt1 and the Cul4DDB1 ubiquitin ligase, and Cdt1 can induce its own degradation when overproduced. Cdc6 degradation in geminin-depleted cells requires Huwe1, the ubiquitin ligase that regulates Cdc6 after DNA damage. Moreover, perturbations that specifically disrupt Cdt1 and Cdc6 degradation in response to DNA damage exacerbate rereplication when combined with geminin depletion, and this enhanced rereplication occurs in both human cells and in Drosophila melanogaster cells. We conclude that rereplication-associated DNA damage triggers Cdt1 and Cdc6 ubiquitination and destruction, and propose that this pathway represents an evolutionarily conserved mechanism that minimizes the extent of rereplication. PMID:18617514

  17. Repair of DNA Damage Induced by the Cytidine Analog Zebularine Requires ATR and ATM in Arabidopsis[OPEN

    PubMed Central

    Liu, Chun-Hsin; Finke, Andreas; Díaz, Mariana; Rozhon, Wilfried; Poppenberger, Brigitte; Baubec, Tuncay; Pecinka, Ales

    2015-01-01

    DNA damage repair is an essential cellular mechanism that maintains genome stability. Here, we show that the nonmethylable cytidine analog zebularine induces a DNA damage response in Arabidopsis thaliana, independent of changes in DNA methylation. In contrast to genotoxic agents that induce damage in a cell cycle stage-independent manner, zebularine induces damage specifically during strand synthesis in DNA replication. The signaling of this damage is mediated by additive activity of ATAXIA TELANGIECTASIA MUTATED AND RAD3-RELATED and ATAXIA TELANGIECTASIA MUTATED kinases, which cause postreplicative cell cycle arrest and increased endoreplication. The repair requires a functional STRUCTURAL MAINTENANCE OF CHROMOSOMES5 (SMC5)-SMC6 complex and is accomplished predominantly by synthesis-dependent strand-annealing homologous recombination. Here, we provide insight into the response mechanism for coping with the genotoxic effects of zebularine and identify several components of the zebularine-induced DNA damage repair pathway. PMID:26023162

  18. Facilitation of DNA damage-induced apoptosis by endoplasmic reticulum protein mitsugumin23

    SciTech Connect

    Yamazaki, Tetsuo; Sasaki, Nozomi; Nishi, Miyuki; Takeshima, Hiroshi

    2010-02-05

    The endoplasmic reticulum (ER) emanates context-dependent signals, thereby mediating cellular response to a variety of stresses. However, the underlying molecular mechanisms have been enigmatic. To better understand the signaling capacity of the ER, we focused on roles played by mitsugumin23 (MG23), a protein residing predominantly in this organelle. Overexpression of MG23 in human embryonic kidney 293T cells specifically enhanced apoptosis triggered by etoposide, a DNA-damaging anti-cancer drug. Conversely, genetic deletion of MG23 reduced susceptibility of thymocytes to DNA damage-induced apoptosis, which was demonstrated by whole-body irradiation experiments. In this setting, induction of the tumor-suppressor gene p53 was attenuated in MG23-knockout thymocytes as compared with their wild-type counterparts, consistent with the elevated radioresistance. It is therefore suggested that MG23 is an essential component of ER-generated lethal signals provoked upon DNA damage, specifying cell fate under pathophysiological conditions.

  19. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  20. Conformational Change of Human Checkpoint Kinase 1 (Chk1) Induced by DNA Damage.

    PubMed

    Han, Xiangzi; Tang, Jinshan; Wang, Jingna; Ren, Feng; Zheng, Jinhua; Gragg, Megan; Kiser, Philip; Park, Paul S H; Palczewski, Krzysztof; Yao, Xinsheng; Zhang, Youwei

    2016-06-17

    Phosphorylation of Chk1 by ataxia telangiectasia-mutated and Rad3-related (ATR) is critical for checkpoint activation upon DNA damage. However, how phosphorylation activates Chk1 remains unclear. Many studies suggest a conformational change model of Chk1 activation in which phosphorylation shifts Chk1 from a closed inactive conformation to an open active conformation during the DNA damage response. However, no structural study has been reported to support this Chk1 activation model. Here we used FRET and bimolecular fluorescence complementary techniques to show that Chk1 indeed maintains a closed conformation in the absence of DNA damage through an intramolecular interaction between a region (residues 31-87) at the N-terminal kinase domain and the distal C terminus. A highly conserved Leu-449 at the C terminus is important for this intramolecular interaction. We further showed that abolishing the intramolecular interaction by a Leu-449 to Arg mutation or inducing ATR-dependent Chk1 phosphorylation by DNA damage disrupts the closed conformation, leading to an open and activated conformation of Chk1. These data provide significant insight into the mechanisms of Chk1 activation during the DNA damage response. PMID:27129240

  1. TGF-{beta}{sub 1}-induced cardiac myofibroblasts are nonproliferating functional cells carrying DNA damages

    SciTech Connect

    Petrov, Victor V. Pelt, Jos F. van; Vermeesch, Joris R.; Van Duppen, Viktor J.; Vekemans, Katrien; Fagard, Robert H.; Lijnen, Paul J.

    2008-04-15

    TGF-{beta}{sub 1} induces differentiation and total inhibition of cardiac MyoFb cell division and DNA synthesis. These effects of TGF-{beta}{sub 1} are irreversible. Inhibition of MyoFb proliferation is accompanied with the expression of Smad1, Mad1, p15Ink4B and total inhibition of telomerase activity. Surprisingly, TGF-{beta}{sub 1}-activated MyoFbs are growth-arrested not only at G1-phase but also at S-phase of the cell cycle. Staining with TUNEL indicates that these cells carry DNA damages. However, the absolute majority of MyoFbs are non-apoptotic cells as established with two apoptosis-specific methods, flow cytometry and caspase-dependent cleavage of cytokeratin 18. Expression in MyoFbs of proliferative cell nuclear antigen even in the absence of serum confirms that these MyoFbs perform repair of DNA damages. These results suggest that TGF-{beta}{sub 1}-activated MyoFbs can be growth-arrested by two checkpoints, the G1/S checkpoint, which prevents cells from entering S-phase and the intra-S checkpoint, which is activated by encountering DNA damage during the S phase or by unrepaired damage that escapes the G1/S checkpoint. Despite carrying of the DNA damages TGF-{beta}{sub 1}-activated MyoFbs are highly functional cells producing lysyl oxidase and contracting the collagen matrix.

  2. DNA damage and oxidative stress induced by acetylsalicylic acid in Daphnia magna.

    PubMed

    Gómez-Oliván, Leobardo Manuel; Galar-Martínez, Marcela; Islas-Flores, Hariz; García-Medina, Sandra; SanJuan-Reyes, Nely

    2014-08-01

    Acetylsalicylic acid is a nonsteroidal anti-inflammatory widely used due to its low cost and high effectiveness. This compound has been found in water bodies worldwide and is toxic to aquatic organisms; nevertheless its capacity to induce oxidative stress in bioindicators like Daphnia magna remains unknown. This study aimed to evaluate toxicity in D. magna induced by acetylsalicylic acid in water, using oxidative stress and DNA damage biomarkers. An acute toxicity test was conducted in order to determine the median lethal concentration (48-h LC50) and the concentrations to be used in the subsequent subacute toxicity test in which the following biomarkers were evaluated: lipid peroxidation, oxidized protein content, activity of the antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase, and level of DNA damage. Lipid peroxidation level and oxidized protein content were significantly increased (p<0.05), and antioxidant enzymes significantly altered with respect to controls; while the DNA damage were significantly increased (p<0.05) too. In conclusion, acetylsalicylic acid induces oxidative stress and DNA damage in D. magna. PMID:24747829

  3. Heavy ion induced damage to plasmid DNA: plateau region vs. spread out Bragg-peak

    NASA Astrophysics Data System (ADS)

    Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlathölter, T.

    2011-08-01

    We have investigated the damage of synthetic plasmid pBR322 DNA in dilute aqueous solutions induced by fast carbon ions. The relative contribution of indirect damage and direct damage to the DNA itself is expected to vary with linear energy transfer along the ion track, with the direct damage contribution increasing towards the Bragg peak. Therefore, 12C ions at the spread-out Bragg peak (dose averaged LET∞ = 189 ± 15 keV/ μm) and in the plateau region of the Bragg curve (LET = 40 keV/ μm) were employed and the radical scavenger concentration in the plasmid solution was varied to quantify the indirect effect. In order to minimize the influence of 12C break-up fragments, a relatively low initial energy of 90 MeV/nucleon was employed for the carbon ions. DNA damage has been quantified by subsequent electrophoresis on agarose gels. We find that strand breaks due to both indirect and direct effects are systematically higher in the plateau region as compared to the Bragg peak region with the difference being smallest at high scavenging capacities. In view of the fact that the relative biological effectiveness for many biological endpoints is maximum at the Bragg peak our findings imply that DNA damage at the Bragg peak is qualitatively most severe.

  4. Involvement of DNA polymerase beta in repairing oxidative damages induced by antitumor drug adriamycin

    SciTech Connect

    Liu Shukun; Wu Mei; Zhang Zunzhen

    2010-08-01

    Adriamycin (ADM) is a widely used antineoplastic drug. However, the increasing cellular resistance has become a serious limitation to ADM clinical application. The most important mechanism related to ADM-induced cell death is oxidative DNA damage mediated by reactive oxygen species (ROS). Base excision repair (BER) is a major pathway in the repair of DNA single strand break (SSB) and oxidized base. In this study, we firstly applied the murine embryo fibroblasts wild-type (pol {beta} +/+) and homozygous pol {beta} null cell (pol {beta} -/-) as a model to investigate ADM DNA-damaging effects and the molecular basis underlying these effects. Here, cellular sensitivity to ADM was examined using colorimetric assay and colony forming assay. ADM-induced cellular ROS level and the alteration of superoxide dismutase (SOD) activity were measured by commercial kits. Further, DNA strand break, chromosomal damage and gene mutation were assessed by comet assay, micronucleus test and hprt gene mutation assay, respectively. The results showed that pol {beta} -/- cells were more sensitive to ADM compared with pol {beta} +/+ cells and more severe SSB and chromosomal damage as well as higher hprt gene mutation frequency were observed in pol {beta} -/- cells. ROS level in pol {beta} -/- cells increased along with decreased activity of SOD. These results demonstrated that pol {beta} deficiency could enable ROS accumulation with SOD activity decrease, further elevate oxidative DNA damage, and subsequently result in SSB, chromosome cleavage as well as gene mutation, which may be partly responsible for the cytotoxicity of ADM and the hypersensitivity of pol {beta} -/- cells to ADM. These findings suggested that pol {beta} is vital for repairing oxidative damage induced by ADM.

  5. Oxidative DNA damage induced by benz[a]anthracene dihydrodiols in the presence of dihydrodiol dehydrogenase.

    PubMed

    Seike, Kazuharu; Murata, Mariko; Hirakawa, Kazutaka; Deyashiki, Yoshihiro; Kawanishi, Shosuke

    2004-11-01

    Tobacco smoke and polluted air are risk factors for lung cancer and contain many kinds of polycyclic aromatic hydrocarbons (PAHs) including benzo[a]pyrene (B[a]P) and benz[a]anthracene (BA). BA, as well as B[a]P, is assessed as probably carcinogenic to humans (IARC group 2A). BA is metabolized to several dihydrodiols. Dihydrodiol dehydrogenase (DD), a member of the aldo-keto reductase superfamily, catalyzes NAD(P)+-linked oxidation of dihydrodiols of aromatic hydrocarbons to corresponding catechols. To clarify the role of DD on PAH carcinogenesis, we examined oxidative DNA damage induced by trans-dihydrodiols of BA and B[a]P treated with DD using 32P-5'-end-labeled DNA fragments obtained from the human p53 tumor suppressor gene. In addition, we investigated the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), an indicator of oxidative DNA damage, in calf thymus DNA by using HPLC with an electrochemical detector. DD-catalyzed BA-1,2-dihydrodiol caused Cu(II)-mediated DNA damage including 8-oxodG formation in the presence of NAD+. BA-1,2-dihydrodiol induced a Fpg sensitive and piperidine labile G lesion at the 5'-ACG-3' sequence complementary to codon 273 of the human p53 tumor suppressor gene, which is known as a hotspot. DNA damage was inhibited by catalase and bathocuproine, suggesting the involvement of H2O2 and Cu(I). The observation of NADH production by UV-visible spectroscopy suggested that DD catalyzed BA-1,2-dihydrodiol most efficiently to the corresponding catechol among the PAH-dihydrodiols tested. A time-of-flight mass spectroscopic study showed that the catechol form of BA-1,2-dihydrodiol formed after DD treatment. In conclusion, BA-1,2-dihydrodiol can induce DNA damage more efficiently than B[a]P-7,8-dihydrodiol and other BA-dihydrodiols in the presence of DD. The reaction mechanism on oxidative DNA damage may be explained by theoretical calculations with an enthalpy change of dihydrodiols and oxidation potential of their catechol forms. DD

  6. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    NASA Astrophysics Data System (ADS)

    Han, Xu; Klas, Matej; Liu, Yueying; Sharon Stack, M.; Ptasinska, Sylwia

    2013-06-01

    The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

  7. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    SciTech Connect

    Han, Xu; Ptasinska, Sylwia; Klas, Matej; Liu, Yueying; Sharon Stack, M.

    2013-06-10

    The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

  8. Mitochondria regulate DNA damage and genomic instability induced by high LET radiation

    NASA Astrophysics Data System (ADS)

    Zhang, Bo; Davidson, Mercy M.; Hei, Tom K.

    2014-04-01

    High linear energy transfer (LET) radiation including α particles and heavy ions is the major type of radiation found in space and is considered a potential health risk for astronauts. Even though the chance that these high LET particles traversing through the cytoplasm of cells is higher than that through the nuclei, the contribution of targeted cytoplasmic irradiation to the induction of genomic instability and other chromosomal damages induced by high LET radiation is not known. In the present study, we investigated whether mitochondria are the potential cytoplasmic target of high LET radiation in mediating cellular damage using a mitochondrial DNA (mtDNA) depleted (ρ0) human small airway epithelial (SAE) cell model and a precision charged particle microbeam with a beam width of merely one micron. Targeted cytoplasmic irradiation by high LET α particles induced DNA oxidative damage and double strand breaks in wild type ρ+ SAE cells. Furthermore, there was a significant increase in autophagy and micronuclei, which is an indication of genomic instability, together with the activation of nuclear factor kappa-B (NF-κB) and mitochondrial inducible nitric oxide synthase (iNOS) signaling pathways in ρ+ SAE cells. In contrast, ρ0 SAE cells exhibited a significantly lower response to these same endpoints examined after cytoplasmic irradiation with high LET α particles. The results indicate that mitochondria are essential in mediating cytoplasmic radiation induced genotoxic damage in mammalian cells. Furthermore, the findings may shed some light in the design of countermeasures for space radiation.

  9. Mitochondria regulate DNA damage and genomic instability induced by high LET radiation

    PubMed Central

    Zhang, Bo; Davidson, Mercy M.; Hei, Tom K.

    2014-01-01

    High linear energy transfer (LET) radiation including α particles and heavy ions is the major type of radiation find in space and is considered a potential health risk for astronauts. Even though the chance that these high LET particles traversing through the cytoplasm of cells is higher than that through the nuclei, the contribution of targeted cytoplasmic irradiation, to the induction of genomic instability and other chromosomal damages induced by high LET radiation is not known. In the present study, we investigated whether mitochondria are the potential cytoplasmic target of high LET radiation in mediating cellular damage using a mitochondrial DNA (mtDNA) depleted (ρ0) human small airway epithelial (SAE) cell model and a precision charged particle microbeam with a beam width of merely one micron. Targeted cytoplasmic irradiation by high LET α particles induced DNA oxidative damage and double strand breaks in wild type ρ+ SAE cells. Furthermore, there was a significant increase in autophagy, micronuclei, which is an indication of genomic instability, together with the activation of nuclear factor kappa-B (NF-κB) and mitochondrial inducible nitric oxide synthase (iNOS) signaling pathways in ρ+ SAE cells. In contrast, ρ0 SAE cells exhibited a significantly lower response to these same endpoints examined after cytoplasmic irradiation with high LET α particles. The results indicate that mitochondria are essential in mediating cytoplasmic radiation induced genotoxic damage in mammalian cells. Furthermore, the findings may shed some light in the design of countermeasures for space radiation. PMID:25072018

  10. Protection of cisplatin-induced spermatotoxicity, DNA damage and chromatin abnormality by selenium nano-particles

    SciTech Connect

    Rezvanfar, Mohammad Amin; Rezvanfar, Mohammad Ali; Shahverdi, Ahmad Reza; Ahmadi, Abbas; Baeeri, Maryam; Mohammadirad, Azadeh; Abdollahi, Mohammad

    2013-02-01

    Cisplatin (CIS), an anticancer alkylating agent, induces DNA adducts and effectively cross links the DNA strands and so affects spermatozoa as a male reproductive toxicant. The present study investigated the cellular/biochemical mechanisms underlying possible protective effect of selenium nano-particles (Nano-Se) as an established strong antioxidant with more bioavailability and less toxicity, on reproductive toxicity of CIS by assessment of sperm characteristics, sperm DNA integrity, chromatin quality and spermatogenic disorders. To determine the role of oxidative stress (OS) in the pathogenesis of CIS gonadotoxicity, the level of lipid peroxidation (LPO), antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and peroxynitrite (ONOO) as a marker of nitrosative stress (NS) and testosterone (T) concentration as a biomarker of testicular function were measured in the blood and testes. Thirty-two male Wistar rats were equally divided into four groups. A single IP dose of CIS (7 mg/kg) and protective dose of Nano-Se (2 mg/kg/day) were administered alone or in combination. The CIS-exposed rats showed a significant increase in testicular and serum LPO and ONOO level, along with a significant decrease in enzymatic antioxidants levels, diminished serum T concentration and abnormal histologic findings with impaired sperm quality associated with increased DNA damage and decreased chromatin quality. Coadministration of Nano-Se significantly improved the serum T, sperm quality, and spermatogenesis and reduced CIS-induced free radical toxic stress and spermatic DNA damage. In conclusion, the current study demonstrated that Nano-Se may be useful to prevent CIS-induced gonadotoxicity through its antioxidant potential. Highlights: ► Cisplatin (CIS) affects spermatozoa as a male reproductive toxicant. ► Effect of Nano-Se on CIS-induced spermatotoxicity was investigated. ► CIS-exposure induces oxidative sperm DNA damage

  11. Clustered DNA damages induced by high and low LET radiation, including heavy ions

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Schenk, H.; Sidorkina, O.; Laval, J.; Trunk, J.; Monteleone, D.; Sutherland, J.; Lowenstein, D. I. (Principal Investigator)

    2001-01-01

    Clustered DNA damages--here defined as two or more lesions (strand breaks, oxidized purines, oxidized pyrimidines or abasic sites) within a few helical turns--have been postulated as difficult to repair accurately, and thus highly significant biological lesions. Further, attempted repair of clusters may produce double strand breaks (DSBs). However, until recently, there was no way to measure ionizing radiation-induced clustered damages, except DSB. We recently described an approach for measuring classes of clustered damages (oxidized purine clusters, oxidized pyrimidine clusters, abasic clusters, along with DSB). We showed that ionizing radiation (gamma rays and Fe ions, 1 GeV/amu) does induce such clusters in genomic DNA in solution and in human cells. These studies also showed that each damage cluster results from one radiation hit (and its track), thus indicating that they can be induced by very low doses of radiation, i.e. two independent hits are not required for cluster induction. Further, among all complex damages, double strand breaks comprise--at most-- 20%, with the other clustered damages being at least 80%.

  12. MCPIP is induced by cholesterol and participated in cholesterol-caused DNA damage in HUVEC

    PubMed Central

    Da, Jingjing; Zhuo, Ming; Qian, Minzhang

    2015-01-01

    Hypercholesterolemia is an important risk factor for atherosclerosis and cholesterol treatment would cause multiple damages, including DNA damage, on endothelial cells. In this work, we have used human umbilical vein endothelial cell line (HUVEC) to explore the mechanism of cholesterol induced damage. We have found that cholesterol treatment on HUVEC could induce the expression of MCPIP1. When given 12.5 mg/L cholesterol on HUVEC, the expression of MCPIP1 starts to increase since 4 hr after treatment and at 24 hr after treatment it could reach to 10 fold of base line level. We hypothesis this induction of MCPIP1 may contribute to the damaging process and we have used siRNA of MCPIP1 in further research. This MCPIP1 siRNA (siMCPIP) could down regulate MCPIP1 by 73.4% and when using this siRNA on HUVECs, we could see the cholesterol induced DNA damage have been reduced. We have detected DNA damage by γH2AX foci formation in nuclear, γH2AX protein level and COMET assay. Compare to cholesterol alone group, siMCPIP group shows much less γH2AX foci formation in nuclear after cholesterol treatment, less γH2AX protein level in cell and also less tail moment detected in COMET assay. We have also seen that using siMCPIP1 could result in less reactive oxygen species (ROS) in cell after cholesterol treatment. We have also seen that using siMCPIP could reduce the protein level of Nox4 and p47phox, two major regulators in ROS production. These results suggest that MCPIP1 may play an important role in cholesterol induced damage. PMID:26617772

  13. Nitroglycerin induces DNA damage and vascular cell death in the setting of nitrate tolerance.

    PubMed

    Mikhed, Yuliya; Fahrer, Jörg; Oelze, Matthias; Kröller-Schön, Swenja; Steven, Sebastian; Welschof, Philipp; Zinßius, Elena; Stamm, Paul; Kashani, Fatemeh; Roohani, Siyer; Kress, Joana Melanie; Ullmann, Elisabeth; Tran, Lan P; Schulz, Eberhard; Epe, Bernd; Kaina, Bernd; Münzel, Thomas; Daiber, Andreas

    2016-07-01

    Nitroglycerin (GTN) and other organic nitrates are widely used vasodilators. Their side effects are development of nitrate tolerance and endothelial dysfunction. Given the potential of GTN to induce nitro-oxidative stress, we investigated the interaction between nitro-oxidative DNA damage and vascular dysfunction in experimental nitrate tolerance. Cultured endothelial hybridoma cells (EA.hy 926) and Wistar rats were treated with GTN (ex vivo: 10-1000 µM; in vivo: 10, 20 and 50 mg/kg/day for 3 days, s.c.). The level of DNA strand breaks, 8-oxoguanine and O (6)-methylguanine DNA adducts was determined by Comet assay, dot blot and immunohistochemistry. Vascular function was determined by isometric tension recording. DNA adducts and strand breaks were induced by GTN in cells in vitro in a concentration-dependent manner. GTN in vivo administration leads to endothelial dysfunction, nitrate tolerance, aortic and cardiac oxidative stress, formation of DNA adducts, stabilization of p53 and apoptotic death of vascular cells in a dose-dependent fashion. Mice lacking O (6)-methylguanine-DNA methyltransferase displayed more vascular O (6)-methylguanine adducts and oxidative stress under GTN therapy than wild-type mice. Although we were not able to prove a causal role of DNA damage in the etiology of nitrate tolerance, the finding of GTN-induced DNA damage such as the mutagenic and toxic adduct O (6)-methylguanine, and cell death supports the notion that GTN based therapy may provoke adverse side effects, including endothelial function. Further studies are warranted to clarify whether GTN pro-apoptotic effects are related to an impaired recovery of patients upon myocardial infarction. PMID:27357950

  14. Molecular Regulation of DNA Damage-Induced Apoptosis in Neurons of Cerebral Cortex

    PubMed Central

    Liu, Zhiping; Pipino, Jacqueline; Chestnut, Barry; Landek, Melissa A.

    2009-01-01

    Cerebral cortical neuron degeneration occurs in brain disorders manifesting throughout life, but the mechanisms are understood poorly. We used cultured embryonic mouse cortical neurons and an in vivo mouse model to study mechanisms of DNA damaged-induced apoptosis in immature and differentiated neurons. p53 drives apoptosis of immature and differentiated cortical neurons through its rapid and prominent activation stimulated by DNA strand breaks induced by topoisomerase-I and -II inhibition. Blocking p53-DNA transactivation with α-pifithrin protects immature neurons; blocking p53-mitochondrial functions with μ-pifithrin protects differentiated neurons. Mitochondrial death proteins are upregulated in apoptotic immature and differentiated neurons and have nonredundant proapoptotic functions; Bak is more dominant than Bax in differentiated neurons. p53 phosphorylation is mediated by ataxia telangiectasia mutated (ATM) kinase. ATM inactivation is antiapoptotic, particularly in differentiated neurons, whereas inhibition of c-Abl protects immature neurons but not differentiated neurons. Cell death protein expression patterns in mouse forebrain are mostly similar to cultured neurons. DNA damage induces prominent p53 activation and apoptosis in cerebral cortex in vivo. Thus, DNA strand breaks in cortical neurons induce rapid p53-mediated apoptosis through actions of upstream ATM and c-Abl kinases and downstream mitochondrial death proteins. This molecular network operates through variations depending on neuron maturity. PMID:18820287

  15. Low energy electron induced damage to plasmid DNA pQE30

    NASA Astrophysics Data System (ADS)

    Kumar, S. V. K.; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D.; Rao, Basuthkar J.

    2012-07-01

    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and ˜18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  16. Low energy electron induced damage to plasmid DNA pQE30

    SciTech Connect

    Kumar, S. V. K.; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D.; Rao, Basuthkar J.

    2012-07-28

    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and {approx}18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  17. Leukotriene C4 is the major trigger of stress-induced oxidative DNA damage

    PubMed Central

    Dvash, Efrat; Har-Tal, Michal; Barak, Sara; Meir, Ofir; Rubinstein, Menachem

    2015-01-01

    Endoplasmic reticulum (ER) stress and major chemotherapeutic agents damage DNA by generating reactive oxygen species (ROS). Here we show that ER stress and chemotherapy induce leukotriene C4 (LTC4) biosynthesis by transcriptionally upregulating and activating the enzyme microsomal glutathione-S-transferase 2 (MGST2) in cells of non-haematopoietic lineage. ER stress and chemotherapy also trigger nuclear translocation of the two LTC4 receptors. Acting in an intracrine manner, LTC4 then elicits nuclear translocation of NADPH oxidase 4 (NOX4), ROS accumulation and oxidative DNA damage. Mgst2 deficiency, RNAi and LTC4 receptor antagonists abolish ER stress- and chemotherapy-induced ROS and oxidative DNA damage in vitro and in mouse kidneys. Cell death and mouse morbidity are also significantly attenuated. Hence, MGST2-generated LTC4 is a major mediator of ER stress- and chemotherapy-triggered oxidative stress and oxidative DNA damage. LTC4 inhibitors, commonly used for asthma, could find broad clinical use in major human pathologies associated with ER stress-activated NOX4. PMID:26656251

  18. Geraniin down regulates gamma radiation-induced apoptosis by suppressing DNA damage.

    PubMed

    Bing, So Jin; Ha, Danbee; Kim, Min Ju; Park, Eunjin; Ahn, Ginnae; Kim, Dae Seung; Ko, Ryeo Kyeong; Park, Jae Woo; Lee, Nam Ho; Jee, Youngheun

    2013-07-01

    Gamma ray irradiation triggers DNA damage and apoptosis of proliferating stem cells and peripheral immune cells, resulting in the destruction of intestinal crypts and lymphoid system. Geraniin is a natural compound extracts from an aquatic plant Nymphaea tetragona and possesses good antioxidant property. In this study, we demonstrate that geraniin rescues radiosensitive splenocytes and jejunal crypt cells from radiation-induced DNA damage and apoptosis. Isolated splenocytes from C57BL/6 mice treated with geraniin were protected against radiation injury of 2 Gy irradiation through the enhancement of the proliferation and attenuation of DNA damage. Also, geraniin inhibited apoptosis in radiosensitive splenocytes by reducing the expression level and immunoreactivity of proapoptotic p53 and Bax and increasing those of anti-apoptotic Bcl-2. In mice exposed to radiation, geraniin treatment protected splenocytes and intestinal crypt cells from radiation-induced cell death. Our results suggest that geraniin presents radioprotective effects by regulating DNA damage on splenocytes, exerting immunostimulatory capacities and inhibiting apoptosis of radiosensitive immune cells and jejunal crypt cells. Therefore, geraniin can be a radioprotective agent against γ-irradiation exposure. PMID:23541438

  19. Rescue of Hippo coactivator YAP1 triggers DNA damage-induced apoptosis in hematological cancers.

    PubMed

    Cottini, Francesca; Hideshima, Teru; Xu, Chunxiao; Sattler, Martin; Dori, Martina; Agnelli, Luca; ten Hacken, Elisa; Bertilaccio, Maria Teresa; Antonini, Elena; Neri, Antonino; Ponzoni, Maurilio; Marcatti, Magda; Richardson, Paul G; Carrasco, Ruben; Kimmelman, Alec C; Wong, Kwok-Kin; Caligaris-Cappio, Federico; Blandino, Giovanni; Kuehl, W Michael; Anderson, Kenneth C; Tonon, Giovanni

    2014-06-01

    Oncogene-induced DNA damage elicits genomic instability in epithelial cancer cells, but apoptosis is blocked through inactivation of the tumor suppressor p53. In hematological cancers, the relevance of ongoing DNA damage and the mechanisms by which apoptosis is suppressed are largely unknown. We found pervasive DNA damage in hematologic malignancies, including multiple myeloma, lymphoma and leukemia, which leads to activation of a p53-independent, proapoptotic network centered on nuclear relocalization of ABL1 kinase. Although nuclear ABL1 triggers cell death through its interaction with the Hippo pathway coactivator YAP1 in normal cells, we show that low YAP1 levels prevent nuclear ABL1-induced apoptosis in these hematologic malignancies. YAP1 is under the control of a serine-threonine kinase, STK4. Notably, genetic inactivation of STK4 restores YAP1 levels, triggering cell death in vitro and in vivo. Our data therefore identify a new synthetic-lethal strategy to selectively target cancer cells presenting with endogenous DNA damage and low YAP1 levels. PMID:24813251

  20. Imaging of the DNA damage-induced dynamics of nuclear proteins via nonlinear photoperturbation.

    PubMed

    Tomas, Martin; Blumhardt, Philipp; Deutzmann, Anja; Schwarz, Tobias; Kromm, Dimitri; Leitenstorfer, Alfred; Ferrando-May, Elisa

    2013-08-01

    Understanding the cellular response to DNA strand breaks is crucial to decipher the mechanisms maintaining the integrity of our genome. We present a novel method to visualize how the mobility of nuclear proteins changes in response to localized DNA damage. DNA strand breaks are induced via nonlinear excitation with femtosecond laser pulses at λ = 1050 nm in a 3D-confined subnuclear volume. After a time delay of choice, protein mobility within this volume is analysed by two-photon photoactivation of PA-GFP fusion proteins at λ = 775 nm. By changing the position of the photoactivation spot with respect to the zone of lesion the influence of chromatin structure and of the distance from damage are investigated. As first applications we demonstrate a locally confined, time-dependent mobility increase of histone H1.2, and a progressive retardation of the DNA repair factor XRCC1 at damaged sites. This assay can be used to map the response of nuclear proteins to DNA damage in time and space. PMID:23420601

  1. Cadmium Chloride Induces DNA Damage and Apoptosis of Human Liver Carcinoma Cells via Oxidative Stress

    PubMed Central

    Skipper, Anthony; Sims, Jennifer N.; Yedjou, Clement G.; Tchounwou, Paul B.

    2016-01-01

    Cadmium is a heavy metal that has been shown to cause its toxicity in humans and animals. Many documented studies have shown that cadmium produces various genotoxic effects such as DNA damage and chromosomal aberrations. Ailments such as bone disease, renal damage, and several forms of cancer are attributed to overexposure to cadmium.  Although there have been numerous studies examining the effects of cadmium in animal models and a few case studies involving communities where cadmium contamination has occurred, its molecular mechanisms of action are not fully elucidated. In this research, we hypothesized that oxidative stress plays a key role in cadmium chloride-induced toxicity, DNA damage, and apoptosis of human liver carcinoma (HepG2) cells. To test our hypothesis, cell viability was determined by MTT assay. Lipid hydroperoxide content stress was estimated by lipid peroxidation assay. Genotoxic damage was tested by the means of alkaline single cell gel electrophoresis (Comet) assay. Cell apoptosis was measured by flow cytometry assessment (Annexin-V/PI assay). The result of MTT assay indicated that cadmium chloride induces toxicity to HepG2 cells in a concentration-dependent manner, showing a 48 hr-LD50 of 3.6 µg/mL. Data generated from lipid peroxidation assay resulted in a significant (p < 0.05) increase of hydroperoxide production, specifically at the highest concentration tested. Data obtained from the Comet assay indicated that cadmium chloride causes DNA damage in HepG2 cells in a concentration-dependent manner. A strong concentration-response relationship (p < 0.05) was recorded between annexin V positive cells and cadmium chloride exposure. In summary, these in vitro studies provide clear evidence that cadmium chloride induces oxidative stress, DNA damage, and programmed cell death in human liver carcinoma (HepG2) cells. PMID:26729151

  2. A DNA-damage-induced cell cycle checkpoint in Arabidopsis.

    PubMed Central

    Preuss, S B; Britt, A B

    2003-01-01

    Although it is well established that plant seeds treated with high doses of gamma radiation arrest development as seedlings, the cause of this arrest is unknown. The uvh1 mutant of Arabidopsis is defective in a homolog of the human repair endonuclease XPF, and uvh1 mutants are sensitive to both the toxic effects of UV and the cytostatic effects of gamma radiation. Here we find that gamma irradiation of uvh1 plants specifically triggers a G(2)-phase cell cycle arrest. Mutants, termed suppressor of gamma (sog), that suppress this radiation-induced arrest and proceed through the cell cycle unimpeded were recovered in the uvh1 background; the resulting irradiated plants are genetically unstable. The sog mutations fall into two complementation groups. They are second-site suppressors of the uvh1 mutant's sensitivity to gamma radiation but do not affect the susceptibility of the plant to UV radiation. In addition to rendering the plants resistant to the growth inhibitory effects of gamma radiation, the sog1 mutation affects the proper development of the pollen tetrad, suggesting that SOG1 might also play a role in the regulation of cell cycle progression during meiosis. PMID:12750343

  3. Oxidative stress-related DNA damage and homologous recombination repairing induced by N,N-dimethylformamide.

    PubMed

    Wang, Cui; Yang, Jinhuan; Lu, Dezhao; Fan, Yongsheng; Zhao, Meirong; Li, Zhuoyu

    2016-07-01

    The intensified anthropogenic release of N,N-dimethylformamide (DMF) has been proven to have hepatotoxic effects. However, the potential mechanism for DMF-induced toxicity has rarely been investigated. Our research implicated that DMF induced a significantly dose-dependent increase in reactive oxygen species (ROS) in HL-7702 human liver cells. Moreover, oxidative stress-related DNA damage, marked as 8-hydroxy-2'-deoxyguanosine, was increased 1.5-fold at 100 mmol l(-1) . The most severe DNA lesion (double-strand break, DSB), measured as the formation of γH2AX foci, was increased at/above 6.4 mmol l(-1) , and approximately 50% of cells underwent DSB at the peak induction. Subsequently, the DNA repair system triggered by molecules of RAD50 and MRE11A induced the homologous recombination (HR) pathway by upregulation of both gene and protein levels of RAD50, RAD51, XRCC2 and XRCC3 at 16 mmol l(-1) and was attenuated at 40 mmol l(-1) . Consequently, cellular death observed at 40 mmol l(-1) was exaggerated compared with exposure at 16 mmol l(-1) . Although the exact mechanism relying on the DMF-induced hepatotoxicity needs further clarification, oxidative stress and DNA damage involved in DSBs partially explain the reason for DMF-induced liver injury. Oxidative stress-induced DNA damage should be first considered during risk assessment on liver-targeted chemicals. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26387567

  4. Piperlongumine induces pancreatic cancer cell death by enhancing reactive oxygen species and DNA damage

    PubMed Central

    Dhillon, Harsharan; Chikara, Shireen; Reindl, Katie M.

    2014-01-01

    Pancreatic cancer is one of the most deadly cancers with a nearly 95% mortality rate. The poor response of pancreatic cancer to currently available therapies and the extremely low survival rate of pancreatic cancer patients point to a critical need for alternative therapeutic strategies. The use of reactive oxygen species (ROS)-inducing agents has emerged as an innovative and effective strategy to treat various cancers. In this study, we investigated the potential of a known ROS inducer, piperlongumine (PPLGM), a bioactive agent found in long peppers, to induce pancreatic cancer cell death in cell culture and animal models. We found that PPLGM inhibited the growth of pancreatic cancer cell cultures by elevating ROS levels and causing DNA damage. PPLGM-induced DNA damage and pancreatic cancer cell death was reversed by treating the cells with an exogenous antioxidant. Similar to the in vitro studies, PPLGM caused a reduction in tumor growth in a xenograft mouse model of human pancreatic cancer. Tumors from the PPLGM-treated animals showed decreased Ki-67 and increased 8-OHdG expression, suggesting PPLGM inhibited tumor cell proliferation and enhanced oxidative stress. Taken together, our results show that PPLGM is an effective inhibitor for in vitro and in vivo growth of pancreatic cancer cells, and that it works through a ROS-mediated DNA damage pathway. These findings suggest that PPLGM has the potential to be used for treatment of pancreatic cancer. PMID:25530945

  5. The ovarian DNA damage repair response is induced prior to phosphoramide mustard-induced follicle depletion, and ataxia telangiectasia mutated inhibition prevents PM-induced follicle depletion.

    PubMed

    Ganesan, Shanthi; Keating, Aileen F

    2016-02-01

    Phosphoramide mustard (PM) is an ovotoxic metabolite of cyclophosphamide and destroys primordial and primary follicles potentially by DNA damage induction. The temporal pattern by which PM induces DNA damage and initiation of the ovarian response to DNA damage has not yet been well characterized. This study investigated DNA damage initiation, the DNA repair response, as well as induction of follicular demise using a neonatal rat ovarian culture system. Additionally, to delineate specific mechanisms involved in the ovarian response to PM exposure, utility was made of PKC delta (PKCδ) deficient mice as well as an ATM inhibitor (KU 55933; AI). Fisher 344 PND4 rat ovaries were cultured for 12, 24, 48 or 96h in medium containing DMSO ±60μM PM or KU 55933 (48h; 10nM). PM-induced activation of DNA damage repair genes was observed as early as 12h post-exposure. ATM, PARP1, E2F7, P73 and CASP3 abundance were increased but RAD51 and BCL2 protein decreased after 96h of PM exposure. PKCδ deficiency reduced numbers of all follicular stages, but did not have an additive impact on PM-induced ovotoxicity. ATM inhibition protected all follicle stages from PM-induced depletion. In conclusion, the ovarian DNA damage repair response is active post-PM exposure, supporting that DNA damage contributes to PM-induced ovotoxicity. PMID:26708502

  6. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.

    PubMed

    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth

    2012-09-01

    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound. PMID:22828439

  7. Plasma induced DNA damage: Comparison with the effects of ionizing radiation

    NASA Astrophysics Data System (ADS)

    Lazović, S.; Maletić, D.; Leskovac, A.; Filipović, J.; Puač, N.; Malović, G.; Joksić, G.; Petrović, Z. Lj.

    2014-09-01

    We use human primary fibroblasts for comparing plasma and gamma rays induced DNA damage. In both cases, DNA strand breaks occur, but of fundamentally different nature. Unlike gamma exposure, contact with plasma predominantly leads to single strand breaks and base-damages, while double strand breaks are mainly consequence of the cell repair mechanisms. Different cell signaling mechanisms are detected confirming this (ataxia telangiectasia mutated - ATM and ataxia telangiectasia and Rad3 related - ATR, respectively). The effective plasma doses can be tuned to match the typical therapeutic doses of 2 Gy. Tailoring the effective dose through plasma power and duration of the treatment enables safety precautions mainly by inducing apoptosis and consequently reduced frequency of micronuclei.

  8. Plasma induced DNA damage: Comparison with the effects of ionizing radiation

    SciTech Connect

    Lazović, S.; Maletić, D.; Puač, N.; Malović, G.; Petrović, Z. Lj.; Leskovac, A.; Filipović, J.; Joksić, G.

    2014-09-22

    We use human primary fibroblasts for comparing plasma and gamma rays induced DNA damage. In both cases, DNA strand breaks occur, but of fundamentally different nature. Unlike gamma exposure, contact with plasma predominantly leads to single strand breaks and base-damages, while double strand breaks are mainly consequence of the cell repair mechanisms. Different cell signaling mechanisms are detected confirming this (ataxia telangiectasia mutated - ATM and ataxia telangiectasia and Rad3 related - ATR, respectively). The effective plasma doses can be tuned to match the typical therapeutic doses of 2 Gy. Tailoring the effective dose through plasma power and duration of the treatment enables safety precautions mainly by inducing apoptosis and consequently reduced frequency of micronuclei.

  9. Low Dose Iron Treatments Induce a DNA Damage Response in Human Endothelial Cells within Minutes

    PubMed Central

    Mollet, Inês G.; Giess, Adam; Paschalaki, Koralia; Periyasamy, Manikandan; Lidington, Elaine C.; Mason, Justin C.; Jones, Michael D.; Game, Laurence; Ali, Simak; Shovlin, Claire L.

    2016-01-01

    , and induce a DNA damage response. PMID:26866805

  10. A microsuspension adaptation of the Bacillus subtilis ''rec'' assay. [Detection of chemically induced DNA damage

    SciTech Connect

    McCarroll, N.E.; Keech, B.H.; Piper, C.E.

    1981-01-01

    We have demonstrated the utility of an Escherichia coli microsuspension assay to detect and characterize chemical mediation of DNA damage by a wide variety of mutagens and carcinogens. The assay have been improved by the development of a microsuspension modification to the Bacillus subtilis ''rec'' assay. The addition of these gram-positive organisms has allowed detection of DNA damage induced by benzo(a)pyrene (B(a)P), 3-aminopyrene (3-AP), 7, 12-dimethylbenz(a)anthrancene (DMBA), 3-methylcholanthrene (3-MC), and 4-nitrobiphenyl (4-NBP). Data presented in this paper from tests of 61 additional compounds, including a representative number of direct and promutagenic agents, indicate that the B subtilis H17 and M45 strains provide an effective microbial system for identification of DNA damage susceptible to postreplicational repair. The results of this study further suggests that the inclusion of these strains in the microsuspension assay for DNA damage will markedly enhance the detection of agents which cannot readily penetrate the intact cell wall of E coli.

  11. DNA damage-induced translocation of S100A11 into the nucleus regulates cell proliferation

    PubMed Central

    2010-01-01

    Background Proteins are able to react in response to distinct stress stimuli by alteration of their subcellular distribution. The stress-responsive protein S100A11 belongs to the family of multifunctional S100 proteins which have been implicated in several key biological processes. Previously, we have shown that S100A11 is directly involved in DNA repair processes at damaged chromatin in the nucleus. To gain further insight into the underlying mechanism subcellular trafficking of S100A11 in response to DNA damage was analyzed. Results We show that DNA damage induces a nucleolin-mediated translocation of S100A11 from the cytoplasm into the nucleus. This translocation is impeded by inhibition of the phosphorylation activity of PKCα. Translocation of S100A11 into the nucleus correlates with an increased cellular p21 protein level. Depletion of nucleolin by siRNA severely impairs translocation of S100A11 into the nucleus resulting in a decreased p21 protein level. Additionally, cells lacking nucleolin showed a reduced colony forming capacity. Conclusions These observations suggest that regulation of the subcellular distribution of S100A11 plays an important role in the DNA damage response and p21-mediated cell cycle control. PMID:21167017

  12. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells

    PubMed Central

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-01-01

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague–Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  13. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells.

    PubMed

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-01-01

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague-Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  14. Molecular and sensory mechanisms to mitigate sunlight-induced DNA damage in treefrog tadpoles.

    PubMed

    Schuch, André P; Lipinski, Victor M; Santos, Mauricio B; Santos, Caroline P; Jardim, Sinara S; Cechin, Sonia Z; Loreto, Elgion L S

    2015-10-01

    The increased incidence of solar ultraviolet B (UVB) radiation has been proposed as an environmental stressor, which may help to explain the enigmatic decline of amphibian populations worldwide. Despite growing knowledge regarding the UV-induced biological effects in several amphibian models, little is known about the efficacy of DNA repair pathways. In addition, little attention has been given to the interplay between these molecular mechanisms with other physiological strategies that avoid the damage induced by sunlight. Here, DNA lesions induced by environmental doses of solar UVB and UVA radiation were detected in genomic DNA samples of treefrog tadpoles (Hypsiboas pulchellus) and their DNA repair activity was evaluated. These data were complemented by monitoring the induction of apoptosis in blood cells and tadpole survival. Furthermore, the tadpoles' ability to perceive and escape from UV wavelengths was evaluated as an additional strategy of photoprotection. The results show that tadpoles are very sensitive to UVB light, which could be explained by the slow DNA repair rates for both cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6,4) pyrimidone photoproducts (6,4PPs). However, they were resistant to UVA, probably as a result of the activation of photolyases during UVA irradiation. Surprisingly, a sensory mechanism that triggers their escape from UVB and UVA light avoids the generation of DNA damage and helps to maintain the genomic integrity. This work demonstrates the genotoxic impact of both UVB and UVA radiation on tadpoles and emphasizes the importance of the interplay between molecular and sensory mechanisms to minimize the damage caused by sunlight. PMID:26447197

  15. Laser microbeam-induced DNA damage inhibits cell division in fertilized eggs and early embryos.

    PubMed

    Wang, Zhong-Wei; Ma, Xue-Shan; Ma, Jun-Yu; Luo, Yi-Bo; Lin, Fei; Wang, Zhen-Bo; Fan, Heng-Yu; Schatten, Heide; Sun, Qing-Yuan

    2013-10-15

    DNA double-strand breaks are caused by both intracellular physiological processes and environmental stress. In this study, we used laser microbeam cut (abbreviated microcut or cut), which allows specific DNA damage in the pronucleus of a fertilized egg and in individual blastomere(s) of an early embryo, to investigate the response of early embryos to DNA double-strand breaks. Line type γH2AX foci were detected in the cut region, while Chk2 phosphorylation staining was observed in the whole nuclear region of the cut pronuclei or blastomeres. Zygotes with cut male or female pronucleus showed poor developmental capability: the percentage of cleavage embryos was significantly decreased, and the embryos failed to complete further development to blastocysts. The cut blastomeres in 2-cell, 4-cell, and 8-cell embryos ceased cleavage, and they failed to incorporate into compacted morulae, but instead underwent apoptosis and cell death at the blastocyst stage; the uncut part of embryos could develop to blastocysts, with a reduced percentage or decreased cell number. When both blastomeres of the 2-cell embryos were cut by laser microbeam, cell death occurred 24 h earlier, suggesting important functions of the uncut blastomere in delaying cell death of the cut blastomere. Taken together, we conclude that microbeam-induced DNA damage in early embryos causes compromised development, and that embryos may have their own mechanisms to exclude DNA-damaged blastomeres from participating in further development. PMID:24036543

  16. Experimental setup and first measurement of DNA damage induced along and around an antiproton beam

    NASA Astrophysics Data System (ADS)

    Kavanagh, J. N.; Currell, F. J.; Timson, D. J.; Holzscheiter, M. H.; Bassler, N.; Herrmann, R.; Prise, K. M.; Schettino, G.

    2010-10-01

    Radiotherapy employs ionizing radiation to induce lethal DNA lesions in cancer cells while minimizing damage to healthy tissues. Due to their pattern of energy deposition, better therapeutic outcomes can, in theory, be achieved with ions compared to photons. Antiprotons have been proposed to offer a further enhancement due to their annihilation at the end of the path. The work presented here aimed to establish and validate an experimental procedure for the quantification of plasmid and genomic DNA damage resulting from antiproton exposure. Immunocytochemistry was used to assess DNA damage in directly and indirectly exposed human fibroblasts irradiated in both plateau and Bragg peak regions of a 126 MeV antiproton beam at CERN. Cells were stained post irradiation with an anti- γ-H2AX antibody. Quantification of the γ-H2AX foci-dose relationship is consistent with a linear increase in the Bragg peak region. A qualitative analysis of the foci detected in the Bragg peak and plateau region indicates significant differences highlighting the different severity of DNA lesions produced along the particle path. Irradiation of desalted plasmid DNA with 5 Gy antiprotons at the Bragg peak resulted in a significant portion of linear plasmid in the resultant solution.

  17. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].

    PubMed

    2013-01-01

    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells. PMID:25507621

  18. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].

    PubMed

    Smetanina, N M; Pustovalova, M V; Osipov, A N

    2013-01-01

    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells. PMID:25427371

  19. Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis.

    PubMed

    Wang, Kaile; Ma, Xiaolu; Zhang, Xue; Wu, Dafei; Sun, Chenyi; Sun, Yazhou; Lu, Xuemei; Wu, Chung-I; Guo, Caixia; Ruan, Jue

    2016-01-01

    Next generation sequencing (NGS) technologies have dramatically improved studies in biology and biomedical science. However, no optimal NGS approach is available to conveniently analyze low frequency mutations caused by DNA damage treatments. Here, by developing an exquisite ultra-sensitive NGS (USNGS) platform "EasyMF" and incorporating it with a widely used supF shuttle vector-based mutagenesis system, we can conveniently dissect roles of lesion bypass polymerases in damage-induced mutagenesis. In this improved mutagenesis analysis pipeline, the initial steps are the same as in the supF mutation assay, involving damaging the pSP189 plasmid followed by its transfection into human 293T cells to allow replication to occur. Then "EasyMF" is employed to replace downstream MBM7070 bacterial transformation and other steps for analyzing damage-induced mutation frequencies and spectra. This pipeline was validated by using UV damaged plasmid after its replication in lesion bypass polymerase-deficient 293T cells. The increased throughput and reduced cost of this system will allow us to conveniently screen regulators of translesion DNA synthesis pathway and monitor environmental genotoxic substances, which can ultimately provide insight into the mechanisms of genome stability and mutagenesis. PMID:27122023

  20. Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis

    PubMed Central

    Wang, Kaile; Ma, Xiaolu; Zhang, Xue; Wu, Dafei; Sun, Chenyi; Sun, Yazhou; Lu, Xuemei; Wu, Chung-I; Guo, Caixia; Ruan, Jue

    2016-01-01

    Next generation sequencing (NGS) technologies have dramatically improved studies in biology and biomedical science. However, no optimal NGS approach is available to conveniently analyze low frequency mutations caused by DNA damage treatments. Here, by developing an exquisite ultra-sensitive NGS (USNGS) platform “EasyMF” and incorporating it with a widely used supF shuttle vector-based mutagenesis system, we can conveniently dissect roles of lesion bypass polymerases in damage-induced mutagenesis. In this improved mutagenesis analysis pipeline, the initial steps are the same as in the supF mutation assay, involving damaging the pSP189 plasmid followed by its transfection into human 293T cells to allow replication to occur. Then “EasyMF” is employed to replace downstream MBM7070 bacterial transformation and other steps for analyzing damage-induced mutation frequencies and spectra. This pipeline was validated by using UV damaged plasmid after its replication in lesion bypass polymerase-deficient 293T cells. The increased throughput and reduced cost of this system will allow us to conveniently screen regulators of translesion DNA synthesis pathway and monitor environmental genotoxic substances, which can ultimately provide insight into the mechanisms of genome stability and mutagenesis. PMID:27122023

  1. Study of terahertz-radiation-induced DNA damage in human blood leukocytes

    SciTech Connect

    Angeluts, A A; Esaulkov, M N; Kosareva, O G; Solyankin, P M; Shkurinov, A P; Gapeyev, A B; Pashovkin, T N; Matyunin, S N; Nazarov, M M; Cherkasova, O P

    2014-03-28

    We have carried out the studies aimed at assessing the effect of terahertz radiation on DNA molecules in human blood leukocytes. Genotoxic testing of terahertz radiation was performed in three different oscillation regimes, the blood leukocytes from healthy donors being irradiated for 20 minutes with the mean intensity of 8 – 200 μW cm{sup -2} within the frequency range of 0.1 – 6.5 THz. Using the comet assay it is shown that in the selected regimes such radiation does not induce a direct DNA damage in viable human blood leukocytes. (biophotonics)

  2. Study of terahertz-radiation-induced DNA damage in human blood leukocytes

    NASA Astrophysics Data System (ADS)

    Angeluts, A. A.; Gapeyev, A. B.; Esaulkov, M. N.; Kosareva, O. G.; Matyunin, S. N.; Nazarov, M. M.; Pashovkin, T. N.; Solyankin, P. M.; Cherkasova, O. P.; Shkurinov, A. P.

    2014-03-01

    We have carried out the studies aimed at assessing the effect of terahertz radiation on DNA molecules in human blood leukocytes. Genotoxic testing of terahertz radiation was performed in three different oscillation regimes, the blood leukocytes from healthy donors being irradiated for 20 minutes with the mean intensity of 8 - 200 μW cm-2 within the frequency range of 0.1 - 6.5 THz. Using the comet assay it is shown that in the selected regimes such radiation does not induce a direct DNA damage in viable human blood leukocytes.

  3. Pro-oxidant Induced DNA Damage in Human Lymphoblastoid Cells: Homeostatic Mechanisms of Genotoxic Tolerance

    PubMed Central

    Seager, Anna L.

    2012-01-01

    Oxidative stress contributes to many disease etiologies including ageing, neurodegeneration, and cancer, partly through DNA damage induction (genotoxicity). Understanding the i nteractions of free radicals with DNA is fundamental to discern mutation risks. In genetic toxicology, regulatory authorities consider that most genotoxins exhibit a linear relationship between dose and mutagenic response. Yet, homeostatic mechanisms, including DNA repair, that allow cells to tolerate low levels of genotoxic exposure exist. Acceptance of thresholds for genotoxicity has widespread consequences in terms of understanding cancer risk and regulating human exposure to chemicals/drugs. Three pro-oxidant chemicals, hydrogen peroxide (H2O2), potassium bromate (KBrO3), and menadione, were examined for low dose-response curves in human lymphoblastoid cells. DNA repair and antioxidant capacity were assessed as possible threshold mechanisms. H2O2 and KBrO3, but not menadione, exhibited thresholded responses, containing a range of nongenotoxic low doses. Levels of the DNA glycosylase 8-oxoguanine glycosylase were unchanged in response to pro- oxidant stress. DNA repair–focused gene expression arrays reported changes in ATM and BRCA1, involved in double-strand break repair, in response to low-dose pro-oxidant exposure; however, these alterations were not substantiated at the protein level. Determination of oxidatively induced DNA damage in H2O2-treated AHH-1 cells reported accumulation of thymine glycol above the genotoxic threshold. Further, the H2O2 dose-response curve was shifted by modulating the antioxidant glutathione. Hence, observed pro- oxidant thresholds were due to protective capacities of base excision repair enzymes and antioxidants against DNA damage, highlighting the importance of homeostatic mechanisms in “genotoxic tolerance.” PMID:22539617

  4. Oxidative Stress Induces Persistent Telomeric DNA Damage Responsible for Nuclear Morphology Change in Mammalian Cells

    PubMed Central

    Coluzzi, Elisa; Colamartino, Monica; Cozzi, Renata; Leone, Stefano; Meneghini, Carlo; O’Callaghan, Nathan; Sgura, Antonella

    2014-01-01

    One main function of telomeres is to maintain chromosome and genome stability. The rate of telomere shortening can be accelerated significantly by chemical and physical environmental agents. Reactive oxygen species are a source of oxidative stress and can produce modified bases (mainly 8-oxoG) and single strand breaks anywhere in the genome. The high incidence of guanine residues in telomeric DNA sequences makes the telomere a preferred target for oxidative damage. Our aim in this work is to evaluate whether chromosome instability induced by oxidative stress is related specifically to telomeric damage. We treated human primary fibroblasts (MRC-5) in vitro with hydrogen peroxide (100 and 200 µM) for 1 hr and collected data at several time points. To evaluate the persistence of oxidative stress-induced DNA damage up to 24 hrs after treatment, we analysed telomeric and genomic oxidative damage by qPCR and a modified comet assay, respectively. The results demonstrate that the genomic damage is completely repaired, while the telomeric oxidative damage persists. The analysis of telomere length reveals a significant telomere shortening 48 hrs after treatment, leading us to hypothesise that residual telomere damage could be responsible for the telomere shortening observed. Considering the influence of telomere length modulation on genomic stability, we quantified abnormal nuclear morphologies (Nucleoplasmic Bridges, Nuclear Buds and Micronuclei) and observed an increase of chromosome instability in the same time frame as telomere shortening. At subsequent times (72 and 96 hrs), we observed a restoration of telomere length and a reduction of chromosome instability, leaving us to conjecture a correlation between telomere shortening/dysfunction and chromosome instability. We can conclude that oxidative base damage leads to abnormal nuclear morphologies and that telomere dysfunction is an important contributor to this effect. PMID:25354277

  5. Zingerone protects against stannous chloride-induced and hydrogen peroxide-induced oxidative DNA damage in vitro.

    PubMed

    Rajan, Iyappan; Narayanan, Nithya; Rabindran, Remitha; Jayasree, P R; Manish Kumar, P R

    2013-12-01

    In this paper, we report the dose-dependent antioxidant activity and DNA protective effects of zingerone. At 500 μg/mL, the DPPH radical scavenging activity of zingerone and ascorbic acid as a standard was found to be 86.7 and 94.2 % respectively. At the same concentration, zingerone also showed significant reducing power (absorbance 0.471) compared to that of ascorbic acid (absorbance 0.394). The in vitro toxicity of stannous chloride (SnCl2) was evaluated using genomic and plasmid DNA. SnCl2-induced degradation of genomic DNA was found to occur at a concentration of 0.8 mM onwards with complete degradation at 1.02 mM and above. In the case of plasmid DNA, conversion of supercoiled DNA into the open circular form indicative of DNA nicking activity was observed at a concentration of 0.2 mM onwards; complete conversion was observed at a concentration of 1.02 mM and above. Zingerone was found to confer protection against SnCl2-induced oxidative damage to genomic and plasmid DNA at concentrations of 500 and 750 μg/mL onwards, respectively. This protective effect was further confirmed in the presence of UV/H2O2-a known reactive oxygen species (ROS) generating system-wherein protection by zingerone against ROS-mediated DNA damage was observed at a concentration of 250 μg/mL onwards in a dose-dependent manner. This study clearly indicated the in vitro DNA protective property of zingerone against SnCl2-induced, ROS-mediated DNA damage. PMID:24006104

  6. Aluminium induced oxidative stress and DNA damage in root cells of Allium cepa L.

    PubMed

    Achary, V Mohan Murali; Jena, Suprava; Panda, Kamal K; Panda, Brahma B

    2008-06-01

    Aluminium (Al) was evaluated for induction of oxidative stress and DNA damage employing the growing roots of Allium cepa L. as the assay system. Intact roots of A. cepa were treated with different concentrations, 0, 1, 10, 50, 100, or 200 microM of aluminium chloride, at pH 4.5 for 4 h (or 2 h for comet assay) at room temperature, 25+/-1 degrees C. Following treatment the parameters investigated in root tissue were Al-uptake, cell death, extra cellular generation of reactive oxygen intermediates (ROI), viz. O(2)(*-), H(2)O(2) and (*)OH, lipid peroxidation, protein oxidation, activities of antioxidant enzymes namely catalase (CAT), superoxide dismutase (SOD), guaiacol peroxidase (GPX), ascorbate peroxidase (APX); and DNA damage, assessed by comet assay. The findings indicated that Al triggered generation of extra-cellular ROI following a dose-response. Through application of specific enzyme inhibitors it was demonstrated that extra-cellular generation of ROI was primarily due to the activity of cell wall bound NADH-PX. Generation of ROI in root tissue as well as cell death was better correlated to the levels of root Al-uptake rather than to the concentrations of Al in ambient experimental solutions. Induction of lipid peroxidation and protein oxidation by Al were statistically significant. Whereas Al inhibited CAT activity, enhanced SOD, GPX and APX activities significantly; that followed dose-response. Comet assay provided evidence that Al induced DNA damage in a range of concentrations 50-200 microM, which was comparable to that induced by ethylmethane sulfonate (EMS), an alkylating mutagen served as the positive control. The findings provided evidence that Al comparable to biotic stress induced oxidative burst at the cell surface through up- or down-regulation of some of the key enzymes of oxidative metabolism ultimately resulting in oxidative stress leading to DNA damage and cell death in root cells of A. cepa. PMID:18068230

  7. A novel alkylating agent Melflufen induces irreversible DNA damage and cytotoxicity in multiple myeloma cells.

    PubMed

    Ray, Arghya; Ravillah, Durgadevi; Das, Deepika S; Song, Yan; Nordström, Eva; Gullbo, Joachim; Richardson, Paul G; Chauhan, Dharminder; Anderson, Kenneth C

    2016-08-01

    Our prior study utilized both in vitro and in vivo multiple myeloma (MM) xenograft models to show that a novel alkylator melphalan-flufenamide (Melflufen) is a more potent anti-MM agent than melphalan and overcomes conventional drug resistance. Here we examined whether this potent anti-MM activity of melflufen versus melphalan is due to their differential effect on DNA damage and repair signalling pathways via γ-H2AX/ATR/CHK1/Ku80. Melflufen-induced apoptosis was associated with dose- and time-dependent rapid phosphorylation of γ-H2AX. Melflufen induces γ-H2AX, ATR, and CHK1 as early as after 2 h exposure in both melphalan-sensitive and -resistant cells. However, melphalan induces γ-H2AX in melphalan-sensitive cells at 6 h and 24 h; no γ-H2AX induction was observed in melphalan-resistant cells even after 24 h exposure. Similar kinetics was observed for ATR and CHK1 in meflufen- versus melphalan-treated cells. DNA repair is linked to melphalan-resistance; and importantly, we found that melphalan, but not melflufen, upregulates Ku80 that repairs DNA double-strand breaks. Washout experiments showed that a brief (2 h) exposure of MM cells to melflufen is sufficient to initiate an irreversible DNA damage and cytotoxicity. Our data therefore suggest that melflufen triggers a rapid, robust, and an irreversible DNA damage which may account for its ability to overcome melphalan-resistance in MM cells. PMID:27098276

  8. Infrared A radiation promotes survival of human melanocytes carrying ultraviolet radiation-induced DNA damage.

    PubMed

    Kimeswenger, Susanne; Schwarz, Agatha; Födinger, Dagmar; Müller, Susanne; Pehamberger, Hubert; Schwarz, Thomas; Jantschitsch, Christian

    2016-06-01

    The link between solar radiation and melanoma is still elusive. Although infrared radiation (IR) accounts for over 50% of terrestrial solar energy, its influence on human skin is not well explored. There is increasing evidence that IR influences the expression patterns of several molecules independently of heat. A previous in vivo study revealed that pretreatment with IR might promote the development of UVR-induced non-epithelial skin cancer and possibly of melanoma in mice. To expand on this, the aim of the present study was to evaluate the impact of IR on UVR-induced apoptosis and DNA repair in normal human epidermal melanocytes. The balance between these two effects is a key factor of malignant transformation. Human melanocytes were exposed to physiologic doses of IR and UVR. Compared to cells irradiated with UVR only, simultaneous exposure to IR significantly reduced the apoptotic rate. However, IR did not influence the repair of UVR-induced DNA damage. IR partly reversed the pro-apoptotic effects of UVR via modification of the expression and activity of proteins mainly of the extrinsic apoptotic pathway. In conclusion, IR enhances the survival of melanocytes carrying UVR-induced DNA damage and thereby might contribute to melanomagenesis. PMID:26844814

  9. Energy Thresholds of DNA Damage Induced by UV Radiation: An XPS Study.

    PubMed

    Gomes, P J; Ferraria, A M; Botelho do Rego, A M; Hoffmann, S V; Ribeiro, P A; Raposo, M

    2015-04-30

    This work stresses on damage at the molecular level caused by ultraviolet radiation (UV) in the range from 3.5 to 8 eV, deoxyribonucleic acid (DNA) films observed by X-ray photoelectron spectroscopy (XPS). Detailed quantitative XPS analysis, in which all the amounts are relative to sodium-assumed not to be released from the samples, of the carbon, oxygen, and particularly, nitrogen components, reveals that irradiation leads to sugar degradation with CO-based compounds release for energies above 6.9 eV and decrease of nitrogen groups which are not involved in hydrogen bonding at energies above 4.2 eV. Also the phosphate groups are seen to decrease to energies above 4.2 eV. Analysis of XPS spectra allowed to conclude that the damage on bases peripheral nitrogen atoms are following the damage on phosphates. It suggests that very low kinetic energy photoelectrons are ejected from the DNA bases, as a result of UV light induced breaking of the phosphate ester groups which forms a transient anion with resonance formation and whereby most of the nitrogen DNA peripheral groups are removed. The degree of ionization of DNA was observed to increase with radiation energy, indicating that the ionized phosphate groups are kept unchanged. This result was interpreted by the shielding of phosphate groups caused by water molecules hydration near sodium atoms. PMID:25844940

  10. Tomato oleoresin inhibits DNA damage but not diethylnitrosamine-induced rat hepatocarcinogenesis.

    PubMed

    Scolastici, Clarissa; Lopes, Gisele A D; Barbisan, Luís F; Salvadori, Daisy M F

    2008-06-01

    Various studies have shown that lycopene, a non-provitamin A carotenoid, exerts antioxidant, antimutagenic and anticarcinogenic activities in different in vitro and in vivo systems. However, the results concerning its chemopreventive potential on rat hepatocarcinogenesis are ambiguous. The aim of the present study was to investigate the antigenotoxic and anticarcinogenic effects of dietary tomato oleoresin adjusted to lycopene concentration at 30, 100 or 300 ppm (administered 2 weeks before and during or 8 weeks after carcinogen exposure) on liver of male Wistar rats treated with a single intraperitoneal dose of 20 or 100mg/kg of diethylnitrosamine (DEN), respectively. The level of DNA damage in liver cells and the development of putative preneoplastic single hepatocytes, minifoci and foci of altered hepatocytes (FHA) positive for glutathione S-transferase (GST-P) were used as endpoints. Significant reduction of DNA damage was detected when the highest lycopene concentration was administered before and during the DEN exposure (20mg/kg). However, the results also showed that lycopene consumption did not reduce cell proliferation in normal hepatocytes or the growth of initiated hepatocytes into minifoci positive for GST-P during early regenerative response after 70% partial hepatectomy, or the number and area of GST-P positive FHA induced by DEN (100mg/kg) at the end of week 10. Taken together, the data suggest a chemopreventive effect of tomato oleoresin against DNA damage induced by DEN but no clear effectiveness in initiating or promoting phases of rat hepatocarcinogenesis. PMID:18434113

  11. Inhibition of KDM6 activity during murine ESC differentiation induces DNA damage.

    PubMed

    Hofstetter, Christine; Kampka, Justyna M; Huppertz, Sascha; Weber, Heike; Schlosser, Andreas; Müller, Albrecht M; Becker, Matthias

    2016-02-15

    Pluripotent embryonic stem cells (ESCs) are characterised by their capacity to self-renew indefinitely while maintaining the potential to differentiate into all cell types of an adult organism. Both the undifferentiated and differentiated states are defined by specific gene expression programs that are regulated at the chromatin level. Here, we have analysed the contribution of the H3K27me2- and H3K27me23-specific demethylases KDM6A and KDM6B to murine ESC differentiation by employing the GSK-J4 inhibitor, which is specific for KDM6 proteins, and by targeted gene knockout (KO) and knockdown. We observe that inhibition of the H3K27 demethylase activity induces DNA damage along with activation of the DNA damage response (DDR) and cell death in differentiating but not in undifferentiated ESCs. Laser microirradiation experiments revealed that the H3K27me3 mark, but not the KDM6B protein, colocalise with γH2AX-positive sites of DNA damage in differentiating ESCs. Lack of H3K27me3 attenuates the GSK-J4-induced DDR in differentiating Eed-KO ESCs. Collectively, our findings indicate that differentiating ESCs depend on KDM6 and that the H3K27me3 demethylase activity is crucially involved in DDR and survival of differentiating ESCs. PMID:26759175

  12. Increased Oxidative DNA Damage in Placenta Contributes to Cadmium-Induced Preeclamptic Conditions in Rat.

    PubMed

    Zhang, Xiaojie; Xu, Zhangye; Lin, Feng; Wang, Fan; Ye, Duyun; Huang, Yinping

    2016-03-01

    To explore the possible mechanisms of cadmium (Cd)-induced preeclamptic conditions in rats. In the present study, we introduced the in vivo model of preeclampsia by giving intraperitoneal injections of cadmium chloride (CdCl2) to pregnant rats from gestational day (GD) 4 to 19. Maternal body weights were recorded on GD 0, 14, and 20, while their systolic blood pressures (SBPs) monitored on GD 3, 11, and 18. On GD 20, rats were sacrificed and the specimens were collected. The morphological changes of placenta and kidney tissues of pregnant rats were examined by hematoxylin and eosin staining assay. Blood Cd level was detected by inductively coupled plasma mass spectrometry. Total antioxidant capacity (TAC) was evaluated using FRAP method and total nitrite (NOx) was detected with Griess reagent. Antioxidative factors and DNA damage/repair biomarkers were measured by real-time qPCR, western blot or immunohistochemistry study. The current results showed that CdCl2-treated pregnant rats developed preeclampsia (PE)-like manifestations, such as hypertension, albuminuria, with decreased TAC and increased blood Cd level, and pro-oxidative/antioxidative or DNA damage/repair biomarkers. Our study demonstrated that increased oxidative DNA damage in placenta could contribute to Cd-induced preeclamptic conditions in rat. PMID:26194818

  13. Buckwheat Honey Attenuates Carbon Tetrachloride-Induced Liver and DNA Damage in Mice.

    PubMed

    Cheng, Ni; Wu, Liming; Zheng, Jianbin; Cao, Wei

    2015-01-01

    Buckwheat honey, which is widely consumed in China, has a characteristic dark color. The objective of this study was to investigate the protective effects of buckwheat honey on liver and DNA damage induced by carbon tetrachloride in mice. The results revealed that buckwheat honey had high total phenolic content, and rutin, hesperetin, and p-coumaric acid were the main phenolic compounds present. Buckwheat honey possesses super DPPH radical scavenging activity and strong ferric reducing antioxidant power. Administration of buckwheat honey for 10 weeks significantly inhibited serum lipoprotein oxidation and increased serum oxygen radical absorbance capacity. Moreover, buckwheat honey significantly inhibited aspartate aminotransferase and alanine aminotransferase activities, which are enhanced by carbon tetrachloride. Hepatic malondialdehyde decreased and hepatic antioxidant enzymes (superoxide dismutase and glutathione peroxidase) increased in the presence of buckwheat honey. In a comet assay, lymphocyte DNA damage induced by carbon tetrachloride was significantly inhibited by buckwheat honey. Therefore, buckwheat honey has a hepatoprotective effect and inhibits DNA damage, activities that are primarily attributable to its high antioxidant capacity. PMID:26508989

  14. The thyroid hormone receptor β induces DNA damage and premature senescence

    PubMed Central

    Zambrano, Alberto; García-Carpizo, Verónica; Gallardo, María Esther; Villamuera, Raquel; Gómez-Ferrería, Maria Ana; Pascual, Angel; Buisine, Nicolas; Sachs, Laurent M.; Garesse, Rafael

    2014-01-01

    There is increasing evidence that the thyroid hormone (TH) receptors (THRs) can play a role in aging, cancer and degenerative diseases. In this paper, we demonstrate that binding of TH T3 (triiodothyronine) to THRB induces senescence and deoxyribonucleic acid (DNA) damage in cultured cells and in tissues of young hyperthyroid mice. T3 induces a rapid activation of ATM (ataxia telangiectasia mutated)/PRKAA (adenosine monophosphate–activated protein kinase) signal transduction and recruitment of the NRF1 (nuclear respiratory factor 1) and THRB to the promoters of genes with a key role on mitochondrial respiration. Increased respiration leads to production of mitochondrial reactive oxygen species, which in turn causes oxidative stress and DNA double-strand breaks and triggers a DNA damage response that ultimately leads to premature senescence of susceptible cells. Our findings provide a mechanism for integrating metabolic effects of THs with the tumor suppressor activity of THRB, the effect of thyroidal status on longevity, and the occurrence of tissue damage in hyperthyroidism. PMID:24395638

  15. Buckwheat Honey Attenuates Carbon Tetrachloride-Induced Liver and DNA Damage in Mice

    PubMed Central

    Cheng, Ni; Wu, Liming; Zheng, Jianbin; Cao, Wei

    2015-01-01

    Buckwheat honey, which is widely consumed in China, has a characteristic dark color. The objective of this study was to investigate the protective effects of buckwheat honey on liver and DNA damage induced by carbon tetrachloride in mice. The results revealed that buckwheat honey had high total phenolic content, and rutin, hesperetin, and p-coumaric acid were the main phenolic compounds present. Buckwheat honey possesses super DPPH radical scavenging activity and strong ferric reducing antioxidant power. Administration of buckwheat honey for 10 weeks significantly inhibited serum lipoprotein oxidation and increased serum oxygen radical absorbance capacity. Moreover, buckwheat honey significantly inhibited aspartate aminotransferase and alanine aminotransferase activities, which are enhanced by carbon tetrachloride. Hepatic malondialdehyde decreased and hepatic antioxidant enzymes (superoxide dismutase and glutathione peroxidase) increased in the presence of buckwheat honey. In a comet assay, lymphocyte DNA damage induced by carbon tetrachloride was significantly inhibited by buckwheat honey. Therefore, buckwheat honey has a hepatoprotective effect and inhibits DNA damage, activities that are primarily attributable to its high antioxidant capacity. PMID:26508989

  16. Amorphous nanosilica induce endocytosis-dependent ROS generation and DNA damage in human keratinocytes

    PubMed Central

    2011-01-01

    Background Clarifying the physicochemical properties of nanomaterials is crucial for hazard assessment and the safe application of these substances. With this in mind, we analyzed the relationship between particle size and the in vitro effect of amorphous nanosilica (nSP). Specifically, we evaluated the relationship between particle size of nSP and the in vitro biological effects using human keratinocyte cells (HaCaT). Results Our results indicate that exposure to nSP of 70 nm diameter (nSP70) induced an elevated level of reactive oxygen species (ROS), leading to DNA damage. A markedly reduced response was observed using submicron-sized silica particles of 300 and 1000 nm diameter. In addition, cytochalasin D-treatment reduced nSP70-mediated ROS generation and DNA damage, suggesting that endocytosis is involved in nSP70-mediated cellular effects. Conclusions Thus, particle size affects amorphous silica-induced ROS generation and DNA damage of HaCaT cells. We believe clarification of the endocytosis pathway of nSP will provide useful information for hazard assessment as well as the design of safer forms of nSPs. PMID:21235812

  17. Myricetin, quercetin, (+)-catechin and (-)-epicatechin protect against N-nitrosamines-induced DNA damage in human hepatoma cells.

    PubMed

    Delgado, M E; Haza, A I; García, A; Morales, P

    2009-10-01

    The aim of this study was to investigate the protective effect of myricetin, quercetin, (+)-catechin and (-)-epicatechin, against N-nitrosodibutylamine (NDBA) and N-nitrosopiperidine (NPIP)-induced DNA damage in human hepatoma cells (HepG2). DNA damage (strand breaks and oxidized purines/pyrimidines) was evaluated by the alkaline single-cell gel electrophoresis or Comet assay. (+)-Catechin at the lowest concentration (10 microM) showed the maximum reduction of DNA strand breaks (23%), the formation of endonuclease III (Endo III, 19-21%) and formamidopyrimidine-DNA glycosylase (Fpg, 28-40%) sensitive sites induced by NDBA or NPIP. (-)-Epicatechin also decreased DNA strand breaks (10 microM, 20%) and the oxidized pyrimidines/purines (33-39%) induced by NDBA or NPIP, respectively. DNA strand breaks induced by NDBA or NPIP were weakly reduced by myricetin at the lowest concentration (0.1 microM, 10-19%, respectively). Myricetin also reduced the oxidized purines (0.1 microM, 17%) and pyrimidines (0.1 microM, 15%) induced by NDBA, but not the oxidized pyrimidines induced by NPIP. Quercetin did not protect against NDBA-induced DNA damage, but it reduced the formation of Endo III and Fpg sensitive sites induced by NPIP (0.1 microM, 17-20%, respectively). In conclusion, our results indicate that (+)-catechin and (-)-epicatechin at the concentrations tested protect human derived cells against oxidative DNA damage effects of NDBA and NPIP. However, myricetin at the concentrations tested only protects human cells against oxidative DNA damage induced by NDBA and quercetin against oxidative DNA damage induced by NPIP. PMID:19628030

  18. High-throughput genotoxicity assay identifies antioxidants as inducers of DNA damage response and cell death

    PubMed Central

    Fox, Jennifer T.; Sakamuru, Srilatha; Huang, Ruili; Teneva, Nedelina; Simmons, Steven O.; Xia, Menghang; Tice, Raymond R.; Austin, Christopher P.; Myung, Kyungjae

    2012-01-01

    Human ATAD5 is a biomarker for identifying genotoxic compounds because ATAD5 protein levels increase posttranscriptionally in response to DNA damage. We screened over 4,000 compounds with a cell-based quantitative high-throughput ATAD5-luciferase assay detecting genotoxic compounds. We identified 22 antioxidants, including resveratrol, genistein, and baicalein, that are currently used or investigated for the treatment of cardiovascular disease, type 2 diabetes, osteopenia, osteoporosis, and chronic hepatitis, as well as for antiaging. Treatment of dividing cells with these compounds induced DNA damage and resulted in cell death. Despite their genotoxic effects, resveratrol, genistein, and baicalein did not cause mutagenesis, which is a major side effect of conventional anticancer drugs. Furthermore, resveratrol and genistein killed multidrug-resistant cancer cells. We therefore propose that resveratrol, genistein, and baicalein are attractive candidates for improved chemotherapeutic agents. PMID:22431602

  19. Quercetin ameliorates polychlorinated biphenyls-induced testicular DNA damage in rats.

    PubMed

    Lovato, F L; de Oliveira, C R; Adedara, I A; Barbisan, F; Moreira, K L S; Dalberto, M; da Rocha, M I U M; Marroni, N P; da Cruz, I B; Costabeber, I B

    2016-02-01

    Polychlorinated biphenyls (PCBs) are a group of environmental contaminants widely reported to cause gonadal toxicity in both humans and animals. This study investigated the amelioratory role of quercetin in PCBs-induced DNA damage in male Wistar rats. Polychlorinated biphenyls were administered intraperitoneally at a dose of 2 mg kg(-1) alone or in combination with quercetin (orally) at 50 mg kg(-1) for 25 days. Quercetin modulation of PCBs-induced gonadal toxicity was evaluated using selected oxidative stress indices, comet assay, measurement of DNA concentration and histology of the testes. Administration of PCBs alone caused a significant (P < 0.05) depletion in the total thiol level in testes of treated rats. Conversely, the levels of reactive oxygen species (ROS) and thiobarbituric acid reactive substances (TBARS) production were markedly elevated in testes of PCBs-treated rats compared with control. Further, PCBs exposure produced statistically significant increases in DNA tail migration, degraded double-stranded DNA (dsDNA) concentration and histological alterations of testes of the treated rats compared to control. Quercetin cotreatment significantly improved the testicular antioxidant status, decreased DNA fragmentation and restored the testicular histology, thus demonstrating the protective effect of quercetin in PCBs-treated rats. PMID:25892208

  20. Zinc protects against ultraviolet A1-induced DNA damage and apoptosis in cultured human fibroblasts.

    PubMed

    Leccia, M T; Richard, M J; Favier, A; Béani, J C

    1999-09-01

    Ultraviolet A1 (UVA1) radiation generates reactive oxygen species and the oxidative stress is known as a mediator of DNA damage and of apoptosis. We exposed cultured human cutaneous fibroblasts to UVA1 radiation (wavelengths in the 340-450-nm range with emission peak at 365 nm) and, using the alkaline unwinding method, we showed an immediate significant increase of DNA strand breaks in exposed cells. Apoptosis was determined by detecting cytoplasmic nucleosomes (enzyme-linked immunosorbent assay method) at different time points in fibroblasts exposed to different irradiation doses. In our conditions, UVA1 radiation induced an early (8 h) and a delayed (18 h) apoptosis. Delayed apoptosis increased in a UVA dose-dependent manner. Zinc is an important metal for DNA protection and has been shown to have inhibitory effects on apoptosis. The addition of zinc (6.5 mg/L) as zinc chloride to the culture medium significantly decreased immediate DNA strand breaks in human skin fibroblasts. Moreover, zinc chloride significantly decreased UVA1-induced early and delayed apoptosis. Thus, these data show for the first time in normal cutaneous cultured cells that UVA1 radiation induces apoptosis. This apoptosis is biphasic and appears higher 18 h after the stress. Zinc supplementation can prevent both immediate DNA strand breakage and early and delayed apoptosis, suggesting that this metal could be of interest for skin cell protection against UVA1 irradiation. PMID:10468155

  1. Oxidative stress induced sperm DNA damage, a possible reason for male infertility

    PubMed Central

    Hosen, Md Bayejid; Islam, Md Rakibul; Begum, Firoza; Kabir, Yearul; Howlader, M Zakir Hossain

    2015-01-01

    Background: Sperm DNA damage is an important factor in the etiology of male infertility. Objective: The aim of the study was to evaluate the association of oxidative stress induced sperm DNA damage with the pathogenesis of male infertility. Materials and Methods: The study comprised a total of 66 subjects, including fertile men (n=25) and infertile men (n=41) matched by age. Seminal malondialdehyde (MDA), phospholipid hydroperoxide (PHP), superoxide dismutase (SOD), total antioxidant status (TAS) and 8-hydroxy-2'-deoxy guanosine (8-OHdG) were estimated by spectrophotometric and ELISA based methods and the association with the sperm parameters was assessed. Results: The percentages of motile and morphologically normal cells were significantly lower (p < 0.001, p <0.001, respectivly) in infertile men. Seminal levels of MDA, PHP and 8-OHdG were significantly higher (p < 0.001, p < 0.001, and p=0. 02, respectively) while the SOD and TAS were significantly lower (p=0. 0003, p< 0.001, respectively) in infertile men. Sperm parameters were negatively correlated with MDA, PHP and 8-OHdG while positively correlated with SOD and TAS. A positive correlation of 8-OHdG with MDA and PHP and a negative correlation with TAS and SOD were also found. Conclusion: These results suggested that oxidative stress induced sperm DNA damage might have a critical effect on the etiology of infertility. Therefore, evaluation of oxidative status, antioxidant defense systems and DNA damage, together with sperm parameters might be a useful tool for diagnosis and treatment of male infertility. PMID:26568756

  2. DETECTION OF LOW DOSE RADIATION-AND CHEMICALLY-INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAYS

    EPA Science Inventory

    Rapid, sensitive and simple assays for radiation- and chemically-induced DNA damage can be of significant benefit to a number of fields including radiation biology, clinical research, and environmental monitoring. Although temperature-induced DNA strand separation has been use...

  3. Oxidative Stress and DNA Damage Induced by Chromium in Liver and Kidney of Goldfish, Carassius auratus

    PubMed Central

    Velma, Venkatramreddy; Tchounwou, Paul B.

    2013-01-01

    Chromium (Cr) is an abundant element in the Earth’s crust. It exhibits various oxidation states, from divalent to hexavalent forms. Cr has diverse applications in various industrial processes and inadequate treatment of the industrial effluents leads to the contamination of the surrounding water resources. Hexavalent chromium (Cr (VI)) is the most toxic form, and its toxicity has been associated with oxidative stress. The present study was designed to investigate the toxic potential of Cr (VI) in fish. In this research, we investigated the role of oxidative stress in chromium-induced genotoxicity in the liver and kidney cells of goldfish, Carassius auratus. Goldfish were acclimatized to the laboratory conditions and exposed them to 5% and 10% of 96 hr-LC50 (85.7 mg/L) of aqueous Cr (VI) in a continuous flow through system. Fish were sampled every 7 days for a period of 28 days to analyze the lipid hydroperoxides (LHP) levels and genotoxic potentials in the liver and kidney. LHP levels were analyzed by spectrophotometry while genotoxicity was assessed by single cell gel electrophoresis (comet) assay. LHP levels in the liver increased significantly at week 1, followed by a decrease. LHP levels in the kidney increased significantly at weeks 1, 2, and 3, and decreased at week 4 compared to the control. The percentage of DNA damage increased in both liver and kidney at both test concentrations. The results clearly indicate that Cr (VI) induces significant levels of DNA damage in liver and kidney cells of goldfish. The induced LHP levels in both organs were concentration-dependent and were directly correlated with the levels of DNA damage. The two tested Cr (VI) concentrations induced significant levels of oxidative stress in both organs, however the kidney appears to be more vulnerable and sensitive to Cr-induced toxicity than the liver. PMID:23700361

  4. Role of mitochondria, ROS, and DNA damage in arsenic induced carcinogenesis.

    PubMed

    Lee, Chih-Hung; Yu, Hsin-Su

    2016-01-01

    The International Agency for Research on Cancer (IARC) declared arsenic a class I carcinogen. Arsenic exposure induces several forms of human cancers, including cancers of skin, lung, liver, and urinary bladder. The majority of the arsenic-induced cancers occur in skin. Among these, the most common is Bowen's disease, characterized by epidermal hyperplasia, full layer epidermal dysplasia, leading to intraepidermal carcinoma as well as apoptosis, and moderate dermal infiltrates, which require the participation of mitochondria. The exact mechanism underlying arsenic induced carcinogenesis remains unclear, although increased reactive oxidative stresses, leading to chromosome abnormalities and uncontrolled growth, and aberrant immune regulations might be involved. Here, we highlight how increased mitochondrial biogenesis and oxidative stress lead to mitochondrial DNA damage and mutation in arsenic induced cancers. We also provide therapeutic rationale for targeting mitochondria in the treatment of arsenic induced cancers. PMID:27100709

  5. Ginsenoside-Rg5 induces apoptosis and DNA damage in human cervical cancer cells

    PubMed Central

    LIANG, LI-DAN; HE, TAO; DU, TING-WEI; FAN, YONG-GANG; CHEN, DIAN-SEN; WANG, YAN

    2015-01-01

    Panax ginseng is traditionally used as a remedy for cancer, inflammation, stress and aging, and ginsenoside-Rg5 is a major bioactive constituent of steamed ginseng. The present study aimed to evaluate whether ginsenoside-Rg5 had any marked cytotoxic, apoptotic or DNA-damaging effects in human cervical cancer cells. Five human cervical cancer cell lines (HeLa, MS751, C33A, Me180 and HT-3) were used to investigate the cytotoxicity of ginsenoside-Rg5 using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Additionally, the effects of ginsenoside-Rg5 on the apoptosis of HeLa and MS751 cells were detected using DNA ladder assays and flow cytometry. DNA damage was assessed in the HeLa and MS751 cells using alkaline comet assays and by detection of γH2AX focus formation. The HeLa and MS751 cells were significantly more sensitive to ginsenoside-Rg5 treatment compared with the C-33A, HT-3 and Me180 cells. As expected, ginsenoside-Rg5 induced significant concentration- and time-dependent increases in apoptosis. In addition, ginsenoside-Rg5 induced significant concentration-dependent increases in the level of DNA damage compared with the negative control. Consistent with the comet assay data, the percentage of γH2AX-positive HeLa and MS751 cells also revealed that ginsenoside-Rg5 caused DNA double-strands to break in a concentration-dependent manner. In conclusion, ginsenoside-Rg5 had marked genotoxic effects in the HeLa and MS751 cells and, thus, demonstrates potential as a genotoxic or cytotoxic drug for the treatment of cervical cancer. PMID:25355274

  6. Plant Nuclei Move to Escape Ultraviolet-Induced DNA Damage and Cell Death1[OPEN

    PubMed Central

    Hidema, Jun; Tamura, Kentaro

    2016-01-01

    A striking feature of plant nuclei is their light-dependent movement. In Arabidopsis (Arabidopsis thaliana) leaf mesophyll cells, the nuclei move to the side walls of cells within 1 to 3 h after blue-light reception, although the reason is unknown. Here, we show that the nuclear movement is a rapid and effective strategy to avoid ultraviolet B (UVB)-induced damages. Mesophyll nuclei were positioned on the cell bottom in the dark, but sudden exposure of these cells to UVB caused severe DNA damage and cell death. The damage was remarkably reduced in both blue-light-treated leaves and mutant leaves defective in the actin cytoskeleton. Intriguingly, in plants grown under high-light conditions, the mesophyll nuclei remained on the side walls even in the dark. These results suggest that plants have two strategies for reducing UVB exposure: rapid nuclear movement against acute exposure and nuclear anchoring against chronic exposure. PMID:26681797

  7. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY STYRENE OXIDE

    EPA Science Inventory

    A rapid and simple assay to detect DNA damage to calf thymus DNA caused by styrene oxide (SO) is reported. This assay is based on changes observed in the melting and annealing behavior of the damaged DNA. The melting annealing process was monitored using a fluorescence indicat...

  8. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY TOXIC INDUSTRIAL CHEMICALS

    EPA Science Inventory

    One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...

  9. SPATA12 and Its Possible Role in DNA Damage Induced by Ultraviolet-C

    PubMed Central

    Lin, Yiting; Rong, Zhuoxian; Liu, Xiaowen; Li, Dan

    2013-01-01

    Our previous studies indicated that SPATA12, a novel spermatogenesis-associated gene, might be an inhibitor involved in spermatogenesis and tumorigenesis. To obtain a better understanding of the functions of SPATA12, a yeast two-hybrid screening system was used to search for interacting proteins, and chromodomain helicase DNA binding protein 2 (CHD2) was successfully identified. Bimolecular fluorescence complementation (BiFC) and subcellular co-localization assays further suggested a possible interaction between SPATA12 and CHD2 in the nuclei. CHD2 is known to be involved in the later stage of the DNA damage response pathway by influencing the transcriptional activity of p53. Thus, our hypothesis is that SPATA12 might play a role in DNA damage signaling. Western blotting results showed that SPATA12 expression could be induced in ultraviolet-C (UV-C) irradiated cells. Through reporter gene assays and the activator protein-1 (AP-1) decoy oligodeoxynucleotide method, we demonstrated that SPATA12 promoter activity could be up-regulated in response to UV-C radiation exposure and an AP-1 binding site in the SPATA12 promoter may have a role in transcriptional regulation of SPATA12. Using colony formation and host cell reactivation assays, it was demonstrated that SPATA12 might lead to inhibition of cellular proliferation in UV-C-irradiated DNA damage. Furthermore, SPATA12 was transfected into H1299, MCF-7 and HeLa cells, and flow cytometry (FCM) results suggested that there are some biological association between SPATA12 and p53 in UV-C-irradiated DNA damage. In addition, we investigated whether SPATA12 could up-regulate the expression of p53. Taken together, these findings indicate that SPATA12 could be induced under UV-C stress. During DNA damage process, AP-1 involves in the transcriptional up-regulation of SPATA12 in response to UV-C radiation and p53 involves in growth inhibitory effects of SPATA12 on UV-C irradiated cells. PMID:24205157

  10. DNA Damage Response in Neonatal and Adult Stromal Cells Compared With Induced Pluripotent Stem Cells

    PubMed Central

    Liedtke, Stefanie; Biebernick, Sophie; Radke, Teja Falk; Stapelkamp, Daniela; Coenen, Carolin; Zaehres, Holm; Fritz, Gerhard; Kogler, Gesine

    2015-01-01

    Comprehensive analyses comparing individual DNA damage response (DDR) of induced pluripotent stem cells (iPSCs) with neonatal stromal cells with respect to their developmental age are limited. The imperative necessity of providing developmental age-matched cell sources for meaningful toxicological drug safety assessments in replacement of animal-based testing strategies is evident. Here, DDR after radiation or treatment with N-methyl-N-nitrosurea (MNU) was determined in iPSCs compared with neonatal and bone marrow stromal cells. Neonatal and adult stromal cells showed no significant morphologically detectable cytotoxicity following treatment with 1 Gy or 1 mM MNU, whereas iPSCs revealed a much higher sensitivity. Foci analyses revealed an effective DNA repair in stromal cell types and iPSCs, as reflected by a rapid formation and disappearance of phosphorylated ATM and γH2AX foci. Furthermore, quantitative polymerase chain reaction analyses revealed the highest basic expression level of DDR and repair-associated genes in iPSCs, followed by neonatal stromal cells and adult stromal cells with the lowest expression levels. In addition, the influence of genotoxic stress prior to and during osteogenic differentiation of neonatal and adult stromal cells was analyzed applying common differentiation procedures. Experiments presented here suggest a developmental age-dependent basic expression level of genes involved in the processing of DNA damage. In addition a differentiation-dependent downregulation of repair genes was observed during osteogenesis. These results strongly support the requirement to provide adequate cell sources for toxicological in vitro drug testing strategies that match to the developmental age and differentiation status of the presumptive target cell of interest. Significance The results obtained in this study advance the understanding of DNA damage processing in human neonatal stromal cells as compared with adult stromal cells and induced pluripotent

  11. A comet assay study reveals that aluminium induces DNA damage and inhibits the repair of radiation-induced lesions in human peripheral blood lymphocytes.

    PubMed

    Lankoff, Anna; Banasik, Anna; Duma, Anna; Ochniak, Edyta; Lisowska, Halina; Kuszewski, Tomasz; Góźdź, Stanisław; Wojcik, Andrzej

    2006-02-01

    Although it is known that many metals induce DNA damage and inhibit DNA repair, information regarding aluminium (Al) is scarce. The aim of this study was to analyze the level of DNA damage in human peripheral blood lymphocytes treated with Al and the impact of Al on the repair of DNA damage induced by ionizing radiation. Cells were treated with different doses of aluminium chloride (1, 2, 5, 10 and 25 microg/ml AlCl(3)) for 72 h. The level of DNA damage and of apoptosis was determined by the comet assay. The level of oxidative damage was determined by the application of endonuclease III and formamidopyrimidine DNA glycosylase. The results on apoptosis were confirmed by flow cytometry. Based on the fluorescence intensity, cells were divided into cohorts of different relative DNA content that corresponds to G(1), S and G(2) phases of the cell cycle. Our results revealed that Al induces DNA damage in a dose-dependent manner, however, at the dose of 25 microg/ml the level of damage declined. This decline was accompanied by a high level of apoptosis indicating selective elimination of damaged cells. Cells pre-treated with Al showed a decreased repair capacity indicating that Al inhibits DNA repair. The possible mechanisms by which Al induces DNA damage and inhibits the repair are discussed. PMID:16139969

  12. Recombination induced by triple-helix-targeted DNA damage in mammalian cells.

    PubMed Central

    Faruqi, A F; Seidman, M M; Segal, D J; Carroll, D; Glazer, P M

    1996-01-01

    Gene therapy has been hindered by the low frequency of homologous recombination in mammalian cells. To stimulate recombination, we investigated the use of triple-helix-forming oligonucleotides (TFOs) to target DNA damage to a selected site within cells. By treating cells with TFOs linked to psoralen, recombination was induced within a simian virus 40 vector carrying two mutant copies of the supF tRNA reporter gene. Gene conversion events, as well as mutations at the target site, were also observed. The variety of products suggests that multiple cellular pathways can act on the targeted damage, and data showing that the triple helix can influence these pathways are presented. The ability to specifically induce recombination or gene conversion within mammalian cells by using TFOs may provide a new research tool and may eventually lead to novel applications in gene therapy. PMID:8943337

  13. Human SAD1 kinase is involved in UV-induced DNA damage checkpoint function.

    PubMed

    Lu, Rui; Niida, Hiroyuki; Nakanishi, Makoto

    2004-07-23

    Checkpoint activation by DNA damage during G(2) prevents activation of cyclin B/Cdc2 complexes, and as a consequence, mitotic entry is blocked. Although initiation and maintenance of G(2) arrest are known to be regulated by at least two distinct signaling pathways, including those of p38MAPK and ataxia-telangiectasia-mutated (ATM)- and Rad3-related (ATR)-Chk1 in higher eukaryotes, the actual number of signaling pathways involved in this regulation is still elusive. In the present study, we identified human SAD1 (hsSAD1) by searching a sequence data base. The predicted hsSAD1 protein comprises 778 amino acids and shares significant homology with the fission yeast Cdr2, a mitosis-regulatory kinase, and Caenorhabditis elegans SAD1, a neuronal cell polarity regulator. HsSAD1 transcript was expressed ubiquitously with the highest levels of expression in brain and testis. HsSAD1 specifically phosphorylated Wee1A, Cdc25-C, and -B on Ser-642, Ser-216, and Ser-361 in vitro, respectively. Overexpression of hsSAD1 resulted in an increased phosphorylation of Cdc25C on Ser-216 in vivo. DNA damage induced by UV or methyl methane sulfonate but not by IR enhanced endogenous hsSAD1 kinase activity in a caffeine-sensitive manner and caused translocation of its protein from cytoplasm to nucleus. Overexpression of wild-type hsSAD1 induced G(2)/M arrest in HeLa S2 cells. Furthermore, UV-induced G(2)/M arrest was partially abrogated by the reduced expression of hsSAD1 using small interfering RNA. These results suggest that hsSAD1 acts as checkpoint kinase upon DNA damage induced by UV or methyl methane sulfonate. The identification of this new kinase suggests the existence of an alternative checkpoint pathway other than those of ATR-Chk1 and p38MAPK. PMID:15150265

  14. Protection of cisplatin-induced spermatotoxicity, DNA damage and chromatin abnormality by selenium nano-particles.

    PubMed

    Rezvanfar, Mohammad Amin; Rezvanfar, Mohammad Ali; Shahverdi, Ahmad Reza; Ahmadi, Abbas; Baeeri, Maryam; Mohammadirad, Azadeh; Abdollahi, Mohammad

    2013-02-01

    Cisplatin (CIS), an anticancer alkylating agent, induces DNA adducts and effectively cross links the DNA strands and so affects spermatozoa as a male reproductive toxicant. The present study investigated the cellular/biochemical mechanisms underlying possible protective effect of selenium nano-particles (Nano-Se) as an established strong antioxidant with more bioavailability and less toxicity, on reproductive toxicity of CIS by assessment of sperm characteristics, sperm DNA integrity, chromatin quality and spermatogenic disorders. To determine the role of oxidative stress (OS) in the pathogenesis of CIS gonadotoxicity, the level of lipid peroxidation (LPO), antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and peroxynitrite (ONOO) as a marker of nitrosative stress (NS) and testosterone (T) concentration as a biomarker of testicular function were measured in the blood and testes. Thirty-two male Wistar rats were equally divided into four groups. A single IP dose of CIS (7 mg/kg) and protective dose of Nano-Se (2 mg/kg/day) were administered alone or in combination. The CIS-exposed rats showed a significant increase in testicular and serum LPO and ONOO level, along with a significant decrease in enzymatic antioxidants levels, diminished serum T concentration and abnormal histologic findings with impaired sperm quality associated with increased DNA damage and decreased chromatin quality. Coadministration of Nano-Se significantly improved the serum T, sperm quality, and spermatogenesis and reduced CIS-induced free radical toxic stress and spermatic DNA damage. In conclusion, the current study demonstrated that Nano-Se may be useful to prevent CIS-induced gonadotoxicity through its antioxidant potential. PMID:23260366

  15. Firpronil induced spermotoxicity is associated with oxidative stress, DNA damage and apoptosis in male rats.

    PubMed

    Khan, Saleem; Jan, M H; Kumar, Dhirendra; Telang, A G

    2015-10-01

    The present study is the first to investigate and characterize the fipronil (FPN) induced spermotoxicity in male rats. Male rats were orally given FPN (2.5, 5.0 and 10 mg/kg/day) for 4 weeks. Epididymal sperms were collected and remaining testis was processed for histopathological evaluation. FPN treatment significantly reduced sperm density, motility, viability and per cent intact acrosome along with concomitant increase in spermatozoa abnormalities. Exposure of FPN caused excessive ROS generation, lipid peroxidation and alteration in mitochondrial membrane potential leading to apoptosis of spermatozoa in dose dependent manner. Higher FPN doses (5 and 10 mg/kg) markedly reduced the DNA integrity of spermatozoa. These data suggest that FPN causes male reproductive toxicity through oxidative stress induced DNA damage and apoptosis of spermatozoa. PMID:26453224

  16. Quantitative Analysis of Clustered DNA Damages Induced by Silicon Beams of Different Kinetic Energy

    SciTech Connect

    Keszenman D. J.; Keszenman, D.J.; Bennett, P.V.; Sutherland, B.M.; Wilson, P.F.

    2013-05-14

    Humans may b exposed to highly energetic charged particle radiation as a result of medical treatments, occupational activitie or accidental events. In recent years, our increasing presence and burgeoning interest in space exploration beyond low Earth orbit has led to a large increase in the research of the biological effects ofcharged particle radiation typical of that encountered in the space radiation environment. The study of the effects of these types of radiation qualities in terms ofDNA damage induction and repair is fundamental to understand mechanisms both underlying their greater biological effectiveness as we)) as the short and long term risks of health effects such as carcinogenesis, degen rative diseases and premature aging. Charged particle radiation induces a variety of DNA alterations, notably bistranded clustered damages, defined as two or more closely-opposed strand break , oxidized bases or abasic sites within a few helical turns. The induction of such highly complex DNA damage enhances the probability of incorrect or incomplete repair and thus constitutes greater potential for genomic instability, cell death and transformation.

  17. YAP activation protects urothelial cell carcinoma from treatment-induced DNA damage.

    PubMed

    Ciamporcero, E; Shen, H; Ramakrishnan, S; Yu Ku, S; Chintala, S; Shen, L; Adelaiye, R; Miles, K M; Ullio, C; Pizzimenti, S; Daga, M; Azabdaftari, G; Attwood, K; Johnson, C; Zhang, J; Barrera, G; Pili, R

    2016-03-24

    Current standard of care for muscle-invasive urothelial cell carcinoma (UCC) is surgery along with perioperative platinum-based chemotherapy. UCC is sensitive to cisplatin-based regimens, but acquired resistance eventually occurs, and a subset of tumors is intrinsically resistant. Thus, there is an unmet need for new therapeutic approaches to target chemotherapy-resistant UCC. Yes-associated protein (YAP) is a transcriptional co-activator that has been associated with bladder cancer progression and cisplatin resistance in ovarian cancer. In contrast, YAP has been shown to induce DNA damage associated apoptosis in non-small cell lung carcinoma. However, no data have been reported on the YAP role in UCC chemo-resistance. Thus, we have investigated the potential dichotomous role of YAP in UCC response to chemotherapy utilizing two patient-derived xenograft models recently established. Constitutive expression and activation of YAP inversely correlated with in vitro and in vivo cisplatin sensitivity. YAP overexpression protected while YAP knockdown sensitized UCC cells to chemotherapy and radiation effects via increased accumulation of DNA damage and apoptosis. Furthermore, pharmacological YAP inhibition with verteporfin inhibited tumor cell proliferation and restored sensitivity to cisplatin. In addition, nuclear YAP expression was associated with poor outcome in UCC patients who received perioperative chemotherapy. In conclusion, these results suggest that YAP activation exerts a protective role and represents a pharmacological target to enhance the anti-tumor effects of DNA damaging modalities in the treatment of UCC. PMID:26119935

  18. YAP activation protects urothelial cell carcinoma from treatment-induced DNA damage

    PubMed Central

    Ciamporcero, Eric; Shen, He; Ramakrishnan, Swathi; Ku, Sheng Yu; Chintala, Sreenivasulu; Shen, Li; Adelaiye, Remi; Miles, Kiersten Marie; Ullio, Chiara; Pizzimenti, Stefania; Daga, Martina; Azabdaftari, Gissou; Attwood, Kris; Johnson, Candace; Zhang, Jianmin; Barrera, Giuseppina; Pili, Roberto

    2015-01-01

    Current standard of care for muscle-invasive urothelial cell carcinoma (UCC) is surgery along with perioperative platinum-based chemotherapy. UCC is sensitive to cisplatin-based regimens, but acquired resistance eventually occurs, and a subset of tumors is intrinsically resistant. Thus, there is an unmet need for new therapeutic approaches to target chemotherapy-resistant UCC. Yes-associated protein (YAP) is a transcriptional co-activator that has been associated with bladder cancer progression and cisplatin resistance in ovarian cancer. In contrast, YAP has been shown to induce DNA damage associated apoptosis in non-small cell lung carcinoma. However, no data have been reported on the YAP role in UCC chemo-resistance. Thus, we have investigated the potential dichotomous role of YAP in UCC response to chemotherapy utilizing two patient-derived xenograft models recently established. Constitutive expression and activation of YAP inversely correlated with in vitro and in vivo cisplatin sensitivity. YAP overexpression protected while YAP knock-down sensitized UCC cells to chemotherapy and radiation effects via increased accumulation of DNA damage and apoptosis. Furthermore, pharmacological YAP inhibition with verteporfin inhibited tumor cell proliferation and restored sensitivity to cisplatin. In addition, nuclear YAP expression was associated with poor outcome in UCC patients who received perioperative chemotherapy. In conclusion, these results suggest that YAP activation exerts a protective role and represents a pharmacological target to enhance the anti-tumor effects of DNA damaging modalities in the treatment of UCC. PMID:26119935

  19. Oncogene-induced reactive oxygen species fuel hyperproliferation and DNA damage response activation

    PubMed Central

    Ogrunc, M; Di Micco, R; Liontos, M; Bombardelli, L; Mione, M; Fumagalli, M; Gorgoulis, V G; d'Adda di Fagagna, F

    2014-01-01

    Oncogene-induced reactive oxygen species (ROS) have been proposed to be signaling molecules that mediate proliferative cues. However, ROS may also cause DNA damage and proliferative arrest. How these apparently opposite roles can be reconciled, especially in the context of oncogene-induced cellular senescence, which is associated both with aberrant mitogenic signaling and DNA damage response (DDR)-mediated arrest, is unclear. Here, we show that ROS are indeed mitogenic signaling molecules that fuel oncogene-driven aberrant cell proliferation. However, by their very same ability to mediate cell hyperproliferation, ROS eventually cause DDR activation. We also show that oncogenic Ras-induced ROS are produced in a Rac1 and NADPH oxidase (Nox4)-dependent manner. In addition, we show that Ras-induced ROS can be detected and modulated in a living transparent animal: the zebrafish. Finally, in cancer we show that Nox4 is increased in both human tumors and a mouse model of pancreatic cancer and specific Nox4 small-molecule inhibitors act synergistically with existing chemotherapic agents. PMID:24583638

  20. Proteomic analysis of mismatch repair-mediated alkylating agent-induced DNA damage response

    PubMed Central

    2013-01-01

    Background Mediating DNA damage-induced apoptosis is an important genome-maintenance function of the mismatch repair (MMR) system. Defects in MMR not only cause carcinogenesis, but also render cancer cells highly resistant to chemotherapeutics, including alkylating agents. To understand the mechanisms of MMR-mediated apoptosis and MMR-deficiency-caused drug resistance, we analyze a model alkylating agent (N-methyl-N’-nitro-N-nitrosoguanidine, MNNG)-induced changes in protein phosphorylation and abundance in two cell lines, the MMR-proficient TK6 and its derivative MMR-deficient MT1. Results Under an experimental condition that MNNG-induced apoptosis was only observed in MutSα-proficient (TK6), but not in MutSα-deficient (MT1) cells, quantitative analysis of the proteomic data revealed differential expression and phosphorylation of numerous individual proteins and clusters of protein kinase substrates, as well differential activation of response pathways/networks in MNNG-treated TK6 and MT1 cells. Many alterations in TK6 cells are in favor of turning on the apoptotic machinery, while many of those in MT1 cells are to promote cell proliferation and anti-apoptosis. Conclusions Our work provides novel molecular insights into the mechanism of MMR-mediated DNA damage-induced apoptosis. PMID:24330662

  1. Mechanisms of Hg species induced toxicity in cultured human astrocytes: genotoxicity and DNA-damage response.

    PubMed

    Pieper, Imke; Wehe, Christoph A; Bornhorst, Julia; Ebert, Franziska; Leffers, Larissa; Holtkamp, Michael; Höseler, Pia; Weber, Till; Mangerich, Aswin; Bürkle, Alexander; Karst, Uwe; Schwerdtle, Tanja

    2014-03-01

    The toxicologically most relevant mercury (Hg) species for human exposure is methylmercury (MeHg). Thiomersal is a common preservative used in some vaccine formulations. The aim of this study is to get further mechanistic insight into the yet not fully understood neurotoxic modes of action of organic Hg species. Mercury species investigated include MeHgCl and thiomersal. Additionally HgCl2 was studied, since in the brain mercuric Hg can be formed by dealkylation of the organic species. As a cellular system astrocytes were used. In vivo astrocytes provide the environment necessary for neuronal function. In the present study, cytotoxic effects of the respective mercuricals increased with rising alkylation level and correlated with their cellular bioavailability. Further experiments revealed for all species at subcytotoxic concentrations no induction of DNA strand breaks, whereas all species massively increased H2O2-induced DNA strand breaks. This co-genotoxic effect is likely due to a disturbance of the cellular DNA damage response. Thus, at nanomolar, sub-cytotoxic concentrations, all three mercury species strongly disturbed poly(ADP-ribosyl)ation, a signalling reaction induced by DNA strand breaks. Interestingly, the molecular mechanism behind this inhibition seems to be different for the species. Since chronic PARP-1 inhibition is also discussed to sacrifice neurogenesis and learning abilities, further experiments on neurons and in vivo studies could be helpful to clarify whether the inhibition of poly(ADP-ribosyl)ation contributes to organic Hg induced neurotoxicity. PMID:24549367

  2. The Effect of a Grape Seed Extract on Radiation-Induced DNA Damage in Human Lymphocytes

    NASA Astrophysics Data System (ADS)

    Dicu, Tiberius; Postescu, Ion D.; Foriş, Vasile; Brie, Ioana; Fischer-Fodor, Eva; Cernea, Valentin; Moldovan, Mircea; Cosma, Constantin

    2009-05-01

    Plant-derived antioxidants due to their phenolic compounds content are reported as potential candidates for reducing the levels of oxidative stress in living organisms. Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Hydroethanolic (50/50, v/v) standardized extract was obtained from red grape seed (Vitis vinifera, variety Burgund Mare—BM). The total polyphenols content was evaluated by Folin-Ciocalteu procedure and expressed as μEq Gallic Acid/ml. The aim of this study was to evaluate the potential antioxidant effects of different concentrations of BM extract against 60Co γ-rays induced DNA damage in human lymphocytes. Samples of human lymphocytes were incubated with BM extract (12.5, 25.0 and 37.5 μEq GA/ml, respectively) administered at 30 minutes before in vitro irradiation with γ-rays (2 Gy). The DNA damage and repair in lymphocytes were evaluated using alkaline comet assay. Using the lesion score, the radiation-induced DNA damage was found to be significantly different (p<0.05) from control, both in the absence and presence of BM extract (except the lymphocytes treated with 37.5 μEq GA/ml BM extract). DNA repair analyzed by incubating the irradiated cells at 37° C and 5% CO2 atmosphere for 2 h, indicated a significant difference (p<0.05) in the lymphocytes group treated with 25.0 μEq GA/ml BM extract, immediately and two hours after irradiation. These results suggest radioprotective effects after treatment with BM extract in human lymphocytes.

  3. DNA damage and oxidative stress induced by imidacloprid exposure in the earthworm Eisenia fetida.

    PubMed

    Wang, Juan; Wang, Jinhua; Wang, Guangchi; Zhu, Lusheng; Wang, Jun

    2016-02-01

    To investigate the soil ecological effect of imidacloprid, earthworm Eisenia fetida was exposed to various concentrations of imidacloprid (0.10, 0.50, and 1.00 mg kg(-1) soil) respectively after 7, 14, 21, and 28 d. The effect of imidacloprid on reactive oxygen species (ROS) generation, antioxidant enzymes activity [superoxide dismutase (SOD) and catalase (CAT), glutathione S-transferase enzyme (GST)], malondialdehyde (MDA) content and DNA damage of the E. fetida was investigated. Significant increase of the ROS level was observed. The SOD and GST activity were significantly induced at most exposure intervals. CAT activity was inhibited and reflected a dose-dependent relationship on days 7, 14 and 21. High MDA levels were observed and the olive tail moment (OTM) as well as the percentage of DNA in the comet tail (tail DNA%) in comet assay declined with increasing concentrations and exposure time after 7 d. Our results suggested that the sub-chronic exposure of imidacloprid caused DNA damage and lipid peroxidation (LPO) leading to antioxidant responses in earthworm E. fetida. PMID:26397468

  4. Switch telomerase to ALT mechanism by inducing telomeric DNA damages and dysfunction of ATRX and DAXX.

    PubMed

    Hu, Yang; Shi, Guang; Zhang, Laichen; Li, Feng; Jiang, Yuanling; Jiang, Shuai; Ma, Wenbin; Zhao, Yong; Songyang, Zhou; Huang, Junjiu

    2016-01-01

    Activation of telomerase or alternative lengthening of telomeres (ALT) is necessary for tumours to escape from dysfunctional telomere-mediated senescence. Anti-telomerase drugs might be effective in suppressing tumour growth in approximately 85-90% of telomerase-positive cancer cells. However, there are still chances for these cells to bypass drug treatment after switching to the ALT mechanism to maintain their telomere integrity. But the mechanism underlying this switch is unknown. In this study, we used telomerase-positive cancer cells (HTC75) to discover the mechanism of the telomerase-ALT switch by inducing telomere-specific DNA damage, alpha-thalassemia X-linked syndrome protein (ATRX) knockdown and deletion of death associated protein (DAXX). Surprisingly, two important ALT hallmarks in the ALT-like HTC75 cells were observed after treatments: ALT-associated promyelocytic leukaemia bodies (APBs) and extrachromosomal circular DNA of telomeric repeats. Moreover, knocking out hTERT by utilizing the CRISPR/Cas9 technique led to telomere elongation in a telomerase-independent manner in ALT-like HTC75 cells. In summary, this is the first report to show that inducing telomeric DNA damage, disrupting the ATRX/DAXX complex and inhibiting telomerase activity in telomerase-positive cancer cells lead to the ALT switch. PMID:27578458

  5. Regulation of homologous recombinational repair by lamin B1 in radiation-induced DNA damage.

    PubMed

    Liu, Ning-Ang; Sun, Jiying; Kono, Kazuteru; Horikoshi, Yasunori; Ikura, Tsuyoshi; Tong, Xing; Haraguchi, Tokuko; Tashiro, Satoshi

    2015-06-01

    DNA double-strand breaks (DSBs) are the major lethal lesion induced by ionizing radiation (IR). RAD51-dependent homologous recombination (HR) is one of the most important pathways in DSB repair and genome integrity maintenance. However, the mechanism of HR regulation by RAD51 remains unclear. To understand the mechanism of RAD51-dependent HR, we searched for interacting partners of RAD51 by a proteomics analysis and identified lamin B1 in human cells. Lamins are nuclear lamina proteins that play important roles in the structural organization of the nucleus and the regulation of chromosome functions. Immunoblotting analyses revealed that siRNA-mediated lamin B1 depletion repressed the DNA damage-dependent increase of RAD51 after IR. The repression was abolished by the proteasome inhibitor MG132, suggesting that lamin B1 stabilizes RAD51 by preventing proteasome-mediated degradation in cells with IR-induced DNA damage. We also showed that lamin B1 depletion repressed RAD51 focus formation and decreased the survival rates after IR. On the basis of these results, we propose that lamin B1 promotes DSB repair and cell survival by maintaining the RAD51 protein levels for HR upon DSB induction after IR. PMID:25733566

  6. Switch telomerase to ALT mechanism by inducing telomeric DNA damages and dysfunction of ATRX and DAXX

    PubMed Central

    Hu, Yang; Shi, Guang; Zhang, Laichen; Li, Feng; Jiang, Yuanling; Jiang, Shuai; Ma, Wenbin; Zhao, Yong; Songyang, Zhou; Huang, Junjiu

    2016-01-01

    Activation of telomerase or alternative lengthening of telomeres (ALT) is necessary for tumours to escape from dysfunctional telomere-mediated senescence. Anti-telomerase drugs might be effective in suppressing tumour growth in approximately 85–90% of telomerase-positive cancer cells. However, there are still chances for these cells to bypass drug treatment after switching to the ALT mechanism to maintain their telomere integrity. But the mechanism underlying this switch is unknown. In this study, we used telomerase-positive cancer cells (HTC75) to discover the mechanism of the telomerase-ALT switch by inducing telomere-specific DNA damage, alpha-thalassemia X-linked syndrome protein (ATRX) knockdown and deletion of death associated protein (DAXX). Surprisingly, two important ALT hallmarks in the ALT-like HTC75 cells were observed after treatments: ALT-associated promyelocytic leukaemia bodies (APBs) and extrachromosomal circular DNA of telomeric repeats. Moreover, knocking out hTERT by utilizing the CRISPR/Cas9 technique led to telomere elongation in a telomerase-independent manner in ALT-like HTC75 cells. In summary, this is the first report to show that inducing telomeric DNA damage, disrupting the ATRX/DAXX complex and inhibiting telomerase activity in telomerase-positive cancer cells lead to the ALT switch. PMID:27578458

  7. Autophagy induced by cathepsin S inhibition induces early ROS production, oxidative DNA damage, and cell death via xanthine oxidase.

    PubMed

    Huang, Chien-Chang; Chen, Kuo-Li; Cheung, Chun Hei Antonio; Chang, Jang-Yang

    2013-12-01

    Cathepsin S plays multiple roles in MHC class II antigen presentation, extracellular matrix degradation, angiogenesis, and tumorogenesis. Our previous study revealed that targeting cathepsin S could induce cellular cytotoxicity and reduce cell viability. For the current study, we further investigated the molecular mechanism responsible for targeting cathepsin S-induced cell death and its association with autophagy. Distinct from regulation of the classic autophagy pathway by reactive oxygen species (ROS), we demonstrated that autophagy is the genuine regulator of early ROS production. The molecular silencing of autophagy-dependent ATG genes (ATG5, ATG7, and LC3) and the pharmacologic inhibition of autophagy with 3-MA and wortmannin reduced ROS production significantly. In addition, xanthine oxidase (XO), which is upregulated by autophagy, is required for early ROS production, oxidative DNA damage, and consequent cell death. Autophagy inhibition suppresses the upregulation of XO, which is induced by cathepsin S inhibition, resulting in reduced ROS generation, DNA damage, and cell death. Collectively, our study reveals a noncanonical molecular pathway in which, after the inhibition of cathepsin S, autophagy induces early ROS production for oxidative DNA damage and cell death through XO. PMID:23892358

  8. Optical detection of DNA damage

    NASA Astrophysics Data System (ADS)

    Rogers, Kim R.; Apostol, A.; Cembrano, J.

    1999-02-01

    A rapid and sensitive fluorescence assay for oxidative damage to calf thymus DNA is reported. A decrease in the transition temperature for strand separation resulted from exposure of the DNA to the reactive decomposition products of 3- morpholinosydnonimine (SIN-1) (i.e., nitric oxide, superoxide, peroxynitrite, hydrogen peroxide, and hydroxyl radicals). A decrease in melting temperature of 12 degrees Celsius was indicative of oxidative damage including single strand chain breaks. Double stranded (ds) and single stranded (ss) forms of DNA were determined using the indicator dyes ethidium bromide and PicoGreen. The change in DNA 'melting' curves was dependant on the concentration of SIN-1 and was most pronounced at 75 degrees Celsius. This chemically induced damage was significantly inhibited by sodium citrate, tris(hydroxymethyl)aminomethane (Tris), and diethylenetriaminepentaacetic acid (DTPA), but was unaffected by superoxide dismutase (SOD), catalase, ethylenediamine tetraacietic acid (EDTA), or deferoxamine. Lowest observable effect level for SIN-1-induced damage was 200 (mu) M.

  9. The role of reactive oxygen species in the herbicide acetochlor-induced DNA damage on Bufo raddei tadpole liver.

    PubMed

    Liu, Yang; Zhang, Yingmei; Liu, Jianghai; Huang, Dejun

    2006-06-10

    After exposure of Bufo raddei tadpoles to acetochlor (ACETO) for 14 days, malondialdehyde (MDA) and DNA-single strand break (DNA-SSB) in livers were analyzed. An enhanced accumulation of MDA suggests that ACETO causes oxidative stress, and the significant increase in the level of DNA-SSB indicates that ACETO induces DNA damage in a dose-dependent manner as well. On the basis of the fact that oxidative stress is caused by excessive production of reactive oxygen species (ROS), and the present results, we speculate that ACETO-induced DNA damage may be a consequence of the generation of ROS. To evaluate this hypothesis, tadpoles were treated with ROS scavenger, N-acetyl-L-cysteine (NAC) or melatonin (MEL), prior to ACETO exposure. The decrease of DNA-SSB level and the increase of total antioxidant capability (TAC) show that ACETO-caused DNA damage can be attenuated by NAC and MEL. In addition, a negative correlation was observed between the extent of DNA damage and the level of TAC in tadpole liver. In conclusion, the results suggest that ACETO-induced DNA damage is mediated by ROS. PMID:16513190

  10. Rapamycin‐induced autophagy sensitizes A549 cells to radiation associated with DNA damage repair inhibition

    PubMed Central

    Li, Yong; Liu, Fen; Wang, Yong; Li, Donghai; Guo, Fei; Xu, Liyao; Zeng, Zhengguo; Zhong, Xiaojun

    2016-01-01

    Abstract Background Autophagy has been reported to increase in cancer cells after radiation. However, it remains unknown whether increased autophagy as a result of radiation affects DNA damage repair and sensitizes cancer cells. In this study, the radiosensitization effect of rapamycin, a mammalian target of rapamycin inhibitor that induces autophagy, on human lung adenocarcinoma A549 cells was investigated. Methods A549 cells were treated with different concentrations of rapamycin. Cell viability was evaluated by methyl‐thiazolyl‐tetrazolium assay. Survival fraction values of A549 cells after radiotherapy were detected by colony formation assay. Autophagosome was observed by a transmission electron microscope. Furthermore, Western blot was employed to examine alterations in autophagy protein LC3 and p62, DNA damage protein γ–H2AX, and DNA damage repair proteins Rad51, Ku70, and Ku80. Rad51, Ku70, and Ku80 messenger ribonucleic acid (mRNA) expression levels were examined by real‐time polymerase chain reaction. Results Rapamycin suppressed A549 cell proliferation in dose and time‐dependent manners. An inhibitory concentration (IC) 10 dose of rapamycin could induce autophagy in A549 cells. Rapamycin combined with radiation significantly decreased the colony forming ability of cells, compared with rapamycin or radiation alone. Rapamycin and radiation combined increased γ–H2AX expression levels and decreased Rad51 and Ku80 expression levels, compared with single regimens. However, rapamycin treatment did not induce any change in Rad51, Ku70, and Ku80 mRNA levels, regardless of radiation. Conclusions These findings indicate that increasing autophagy sensitizes lung cancer cells to radiation. PMID:27385978

  11. XPD-dependent activation of apoptosis in response to triplex-induced DNA damage

    PubMed Central

    Kaushik Tiwari, Meetu; Rogers, Faye A.

    2013-01-01

    DNA sequences capable of forming triplexes are prevalent in the human genome and have been found to be intrinsically mutagenic. Consequently, a balance between DNA repair and apoptosis is critical to counteract their effect on genomic integrity. Using triplex-forming oligonucleotides to synthetically create altered helical distortions, we have determined that pro-apoptotic pathways are activated by the formation of triplex structures. Moreover, the TFIIH factor, XPD, occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. Here, we show that triplexes are capable of inducing XPD-independent double strand breaks, which result in the formation of γH2AX foci. XPD was subsequently recruited to the triplex-induced double strand breaks and co-localized with γH2AX at the damage site. Furthermore, phosphorylation of H2AX tyrosine 142 was found to stimulate the signaling pathway of XPD-dependent apoptosis. We suggest that this mechanism may play an active role in minimizing genomic instability induced by naturally occurring noncanonical structures, perhaps protecting against cancer initiation. PMID:23913414

  12. Hsp90 induces increased genomic instability toward DNA-damaging agents by tuning down RAD53 transcription.

    PubMed

    Khurana, Nidhi; Laskar, Shyamasree; Bhattacharyya, Mrinal K; Bhattacharyya, Sunanda

    2016-08-01

    It is well documented that elevated body temperature causes tumors to regress upon radiotherapy. However, how hyperthermia induces DNA damage sensitivity is not clear. We show that a transient heat shock and particularly the concomitant induction of Hsp90 lead to increased genomic instability under DNA-damaging conditions. Using Saccharomyces cerevisiae as a model eukaryote, we demonstrate that elevated levels of Hsp90 attenuate efficient DNA damage signaling and dictate preferential use of the potentially mutagenic double-strand break repair pathway. We show that under normal physiological conditions, Hsp90 negatively regulates RAD53 transcription to suppress DNA damage checkpoint activation. However, under DNA damaging conditions, RAD53 is derepressed, and the increased level of Rad53p triggers an efficient DNA damage response. A higher abundance of Hsp90 causes increased transcriptional repression on RAD53 in a dose-dependent manner, which could not be fully derepressed even in the presence of DNA damage. Accordingly, cells behave like a rad53 loss-of-function mutant and show reduced NHEJ efficiency, with a drastic failure to up-regulate RAD51 expression and manifestly faster accumulation of CLN1 and CLN2 in DNA-damaged G1, cells leading to premature release from checkpoint arrest. We further demonstrate that Rad53 overexpression is able to rescue all of the aforementioned deleterious effects caused by Hsp90 overproduction. PMID:27307581

  13. DNA Damage Response

    PubMed Central

    Giglia-Mari, Giuseppina; Zotter, Angelika; Vermeulen, Wim

    2011-01-01

    Structural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network of DNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance processes, and cell-cycle checkpoints safeguard genomic integrity. Like transcription and replication, DDR is a chromatin-associated process that is generally tightly controlled in time and space. As DNA damage can occur at any time on any genomic location, a specialized spatio-temporal orchestration of this defense apparatus is required. PMID:20980439

  14. Enhanced susceptibility of ovaries from obese mice to 7,12-dimethylbenz[a]anthracene-induced DNA damage

    SciTech Connect

    Ganesan, Shanthi Nteeba, Jackson Keating, Aileen F.

    2014-12-01

    7,12-Dimethylbenz[a]anthracene (DMBA) depletes ovarian follicles and induces DNA damage in extra-ovarian tissues, thus, we investigated ovarian DMBA-induced DNA damage. Additionally, since obesity is associated with increased offspring birth defect incidence, we hypothesized that a DMBA-induced DNA damage response (DDR) is compromised in ovaries from obese females. Wild type (lean) non agouti (a/a) and KK.Cg-Ay/J heterozygote (obese) mice were dosed with sesame oil or DMBA (1 mg/kg; intraperitoneal injection) at 18 weeks of age, for 14 days. Total ovarian RNA and protein were isolated and abundance of Ataxia telangiectasia mutated (Atm), X-ray repair complementing defective repair in Chinese hamster cells 6 (Xrcc6), breast cancer type 1 (Brca1), Rad 51 homolog (Rad51), poly [ADP-ribose] polymerase 1 (Parp1) and protein kinase, DNA-activated, catalytic polypeptide (Prkdc) were quantified by RT-PCR or Western blot. Phosphorylated histone H2AX (γH2AX) level was determined by Western blotting. Obesity decreased (P < 0.05) basal protein abundance of PRKDC and BRCA1 proteins but increased (P < 0.05) γH2AX and PARP1 proteins. Ovarian ATM, XRCC6, PRKDC, RAD51 and PARP1 proteins were increased (P < 0.05) by DMBA exposure in lean mice. A blunted DMBA-induced increase (P < 0.05) in XRCC6, PRKDC, RAD51 and BRCA1 was observed in ovaries from obese mice, relative to lean counterparts. Taken together, DMBA exposure induced γH2AX as well as the ovarian DDR, supporting that DMBA causes ovarian DNA damage. Additionally, ovarian DDR was partially attenuated in obese females raising concern that obesity may be an additive factor during chemical-induced ovotoxicity. - Highlights: • DMBA induces markers of ovarian DNA damage. • Obesity induces low level ovarian DNA damage. • DMBA-induced DNA repair response is altered by obesity.

  15. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    SciTech Connect

    Yoshimura, Akari; Kobayashi, Yume; Tada, Shusuke; Seki, Masayuki; Enomoto, Takemi

    2014-09-12

    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  16. Prion-induced neurotoxicity: Possible role for cell cycle activity and DNA damage response

    PubMed Central

    Bujdoso, Raymond; Landgraf, Matthias; Jackson, Walker S; Thackray, Alana M

    2015-01-01

    Protein misfolding neurodegenerative diseases arise through neurotoxicity induced by aggregation of host proteins. These conditions include Alzheimer’s disease, Huntington’s disease, Parkinson’s disease, motor neuron disease, tauopathies and prion diseases. Collectively, these conditions are a challenge to society because of the increasing aged population and through the real threat to human food security by animal prion diseases. It is therefore important to understand the cellular and molecular mechanisms that underlie protein misfolding-induced neurotoxicity as this will form the basis for designing strategies to alleviate their burden. Prion diseases are an important paradigm for neurodegenerative conditions in general since several of these maladies have now been shown to display prion-like phenomena. Increasingly, cell cycle activity and the DNA damage response are recognised as cellular events that participate in the neurotoxic process of various neurodegenerative diseases, and their associated animal models, which suggests they are truly involved in the pathogenic process and are not merely epiphenomena. Here we review the role of cell cycle activity and the DNA damage response in neurodegeneration associated with protein misfolding diseases, and suggest that these events contribute towards prion-induced neurotoxicity. In doing so, we highlight PrP transgenic Drosophila as a tractable model for the genetic analysis of transmissible mammalian prion disease. PMID:26279981

  17. Perfluorooctane sulfonate exposure causes gonadal developmental toxicity in Caenorhabditis elegans through ROS-induced DNA damage.

    PubMed

    Guo, Xiaoying; Li, Qingqing; Shi, Jue; Shi, Liulin; Li, Buqing; Xu, An; Zhao, Guoping; Wu, Lijun

    2016-07-01

    Perfluorooctane sulfonate (PFOS), a common persistent organic pollutant, has been reported to show potential developmental toxicity in many animal studies. However, little was known about its effects on reproductive tissues, especially in the germ line. In the present study, Caenorhabditis elegans was used as an in vivo experimental model to study the developmental toxicity caused by PFOS exposure, especially in the gonads. Our results showed that PFOS exposure significantly retarded gonadal development, as shown by the increased number of worms that remained in the larval stages after hatched L1-stage larvae were exposed to PFOS for 72 h. Investigation of germ line proliferation following PFOS exposure showed that the number of total germ cells reduced in a dose-dependent manner when L1-stage larvae were exposed to 0-25.0 μM PFOS. PFOS exposure induced transient mitotic cell cycle arrest and apoptosis in the germ line. Quantification of DNA damage in proliferating germ cells and production of reactive oxygen species (ROS) showed that distinct foci of HUS-1:GFP and ROS significantly increased in the PFOS-treated groups, whereas the decrease in mitotic germ cell number and the enhanced apoptosis induced by PFOS exposure were effectively rescued upon addition of dimethyl sulfoxide (DMSO) and mannitol (MNT). These results suggested that ROS-induced DNA damage might play a pivotal role in the impairment of gonadal development indicated by the reduction in total germ cells, transient mitotic cell cycle arrest, and apoptosis. PMID:27108369

  18. Effects of Spaceflight on Molecular and Cellular Responses to Bleomycin-Induced DNA Damages in Confluent Human Fibroblasts

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu

    2016-01-01

    Spaceflights expose human beings to various risk factors. Among them are microgravity related physiological stresses in immune, cytoskeletal, and cardiovascular systems, and space radiation related elevation of cancer risk. Cosmic radiation consists of energetic protons and other heavier charged particles that induce DNA damages. Effective DNA damage response and repair mechanism is important to maintain genomic integrity and reduce cancer risk. There were studies on effects of spaceflight and microgravity on DNA damage response in cell and animal models, but the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on molecular and cellular responses to DNA damages, bleomycin, an anti-cancer drug and radiomimetic reagent, was used to induce DNA damages in confluent human fibroblasts flown to the International Space Station (ISS) and on ground. After exposure to 1.0 µg/ml bleomycin for 3 hours, cells were fixed for immunofluorescence assays and for RNA preparation. Extents of DNA damages were quantified by foci and pattern counting of phosphorylated histone protein H2AX (?-H2AX). The cells on the ISS showed modestly increased average foci counts per nucleus while the distribution of patterns was similar to that on the ground. PCR array analysis showed that expressions of several genes, including CDKN1A and PCNA, were significantly changed in response to DNA damages induced by bleomycin in both flight and ground control cells. However, there were no significant differences in the overall expression profile of DNA damage response genes between the flight and ground samples. Analysis of cellular proliferation status with Ki-67 staining showed a slightly higher proliferating population in cells on the ISS than those on ground. Our results suggested that the difference in ?-H2AX focus counts between flight and ground was due to the higher percentage of proliferating cells in space, but spaceflight did not significantly affect

  19. XRCC1 Arg399Gln was associated with repair capacity for DNA damage induced by occupational chromium exposure

    PubMed Central

    2012-01-01

    Background Occupational chromium exposure may induce DNA damage and lead to lung cancer and other work-related diseases. DNA repair gene polymorphisms, which may alter the efficiency of DNA repair, thus may contribute to genetic susceptibility of DNA damage. The aim of this study was to test the hypothesis that the genetic variations of 9 major DNA repair genes could modulate the hexavalent chromium (Cr (VI))-induced DNA damage. Findings The median (P25-P75) of Olive tail moment was 0.93 (0.58–1.79) for individuals carrying GG genotype of XRCC1 Arg399Gln (G/A), 0.73 (0.46–1.35) for GA heterozygote and 0.50 (0.43–0.93) for AA genotype. Significant difference was found among the subjects with three different genotypes (P = 0.048) after adjusting the confounding factors. The median of Olive tail moment of the subjects carrying A allele (the genotypes of AA and GA) was 0.66 (0.44–1.31), which was significantly lower than that of subjects with GG genotype (P = 0.043). The A allele conferred a significantly reduced risk of DNA damage with the OR of 0.39 (95% CI: 0.15–0.99, P = 0.048). No significant association was found between the XRCC1Arg194Trp, ERCC1 C8092A, ERCC5 His1104Asp, ERCC6 Gly399Asp, GSTP1 Ile105Val, OGG1 Ser326Cys, XPC Lys939Gln, XPD Lys751Gln and DNA damage. Conclusion The polymorphism of Arg399Gln in XRCC1 was associated with the Cr (VI)- induced DNA damage. XRCC1 Arg399Gln may serve as a genetic biomarker of susceptibility for Cr (VI)- induced DNA damage. PMID:22642904

  20. XPC is essential for nucleotide excision repair of zidovudine-induced DNA damage in human hepatoma cells

    SciTech Connect

    Wu Qiangen; Beland, Frederick A.; Chang, Ching-Wei; Fang Jialong

    2011-03-01

    Zidovudine (3'-azido-3'-dexoythymidine, AZT), a nucleoside reverse transcriptase inhibitor, can be incorporated into DNA and cause DNA damage. The mechanisms underlying the repair of AZT-induced DNA damage are unknown. To investigate the pathways involved in the recognition and repair of AZT-induced DNA damage, human hepatoma HepG2 cells were incubated with AZT for 2 weeks and the expression of DNA damage signaling pathways was determined using a pathway-based real-time PCR array. Compared to control cultures, damaged DNA binding and nucleotide excision repair (NER) pathways showed significantly increased gene expression. Further analysis indicated that AZT treatment increased the expression of genes associated with NER, including XPC, XPA, RPA1, GTF2H1, and ERCC1. Western blot analysis demonstrated that the protein levels of XPC and GTF2H1 were also significantly up-regulated. To explore further the function of XPC in the repair of AZT-induced DNA damage, XPC expression was stably knocked down by 71% using short hairpin RNA interference. In the XPC knocked-down cells, 100 {mu}M AZT treatment significantly increased [{sup 3}H]AZT incorporation into DNA, decreased the total number of viable cells, increased the release of lactate dehydrogenase, induced apoptosis, and caused a more extensive G2/M cell cycle arrest when compared to non-transfected HepG2 cells or HepG2 cells transfected with a scrambled short hairpin RNA sequence. Overall, these data indicate that XPC plays an essential role in the NER repair of AZT-induced DNA damage.

  1. Demethoxycurcumin-induced DNA Damage Decreases DNA Repair-associated Protein Expression Levels in NCI-H460 Human Lung Cancer Cells.

    PubMed

    Ko, Yang-Ching; Lien, Jin-Cherng; Liu, Hsin-Chung; Hsu, Shu-Chun; Lin, Hui-Yi; Chueh, Fu-Shin; Ji, Bin-Chuan; Yang, Mei-Due; Hsu, Wu-Huei; Chung, Jing-Gung

    2015-05-01

    Demethoxycurcumin (DMC) is a key component of Chinese medicine (Turmeric) and has been proven effective in killing various cancer cells. Its role in inducing cytotoxic effects in many cancer cells has been reported, but its role regarding DNA damage on lung cancer cells has not been studied in detail. In the present study, we demonstrated DMC-induced DNA damage and condensation in NCI-H460 cells by using the Comet assay and DAPI staining examinations, respectively. Western blotting indicated that DMC suppressed the protein levels associated with DNA damage and repair, such as 14-3-3σ (an important checkpoint keeper of DNA damage response), DNA repair proteins breast cancer 1, early onset (BRCA1), O6-methylguanine-DNA methyltransferase (MGMT), mediator of DNA damage checkpoint 1 (MDC1), and p53 (tumor suppressor protein). DMC activated phosphorylated p53 and p-H2A.X (phospho Ser140) in NCI-H460 cells. Furthermore, we used confocal laser systems microscopy to examine the protein translocation. The results showed that DMC promotes the translocation of p-p53 and p-H2A.X from the cytosol to the nuclei in NCI-H460 cells. Taken together, DMC induced DNA damage and affected DNA repair proteins in NCI-H460 cells in vitro. PMID:25964547

  2. 8-Hydroxy-2'-deoxyguanosine as a biomarker of oxidative DNA damage induced by perfluorinated compounds in TK6 cells.

    PubMed

    Yahia, Doha; Haruka, Igarashi; Kagashi, Yae; Tsuda, Shuji

    2016-02-01

    8-Hydroxy-2'-deoxyguanosine (8-OHdG) is the most common biomarker of oxidative DNA damage, it is formed by chemical carcinogens and can be measured in any species. Perfluorooctanoic acid (PFOA) and perfluorononanoic acid (PFNA) are suspected genotoxic carcinogens through induction of reactive oxygen species that are responsible for oxidative DNA damage. This study was conducted to investigate the in vitro genotoxicity of PFOA and PFNA in human lymphoblastoid (TK6) cell line. TK6 cells were exposed to PFOA at 0, 125, 250, and 500 ppm and PFNA at 125 and 250 ppm for 2 h. Single cell gel electrophoresis (comet assay) was used to measure DNA damage; at least 50 cells per sample were analyzed using comet Assay Software Project (CASP). 8-OHdG was measured in DNA of exposed cells using high-performance liquid chromatography (HPLC)-mass spectrometry (MS)/MS. Results showed that both PFOA and PFNA induced DNA damage indicated by increased tail length (DNA migration). The level of 8-OHdG was increased in a dose-dependent manner in both PFOA and PFNA exposure. We concluded that PFOA and PFNA induced DNA damage and the biomarker of oxidative DNA damage (8-OHdG) could be measured by HPLC-MS/MS. In addition, PFNA produced high level of 8-OHdG at concentrations lower than PFOA, this may indicate that PFNA is more potent genotoxicant for TK6 cells than PFOA. PMID:25113910

  3. Roles of PCNA ubiquitination and TLS polymerases κ and η in the bypass of methyl methanesulfonate-induced DNA damage

    PubMed Central

    Wit, Niek; Buoninfante, Olimpia Alessandra; van den Berk, Paul C.M.; Jansen, Jacob G.; Hogenbirk, Marc A.; de Wind, Niels; Jacobs, Heinz

    2015-01-01

    Translesion synthesis (TLS) provides a highly conserved mechanism that enables DNA synthesis on a damaged template. TLS is performed by specialized DNA polymerases of which polymerase (Pol) κ is important for the cellular response to DNA damage induced by benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), ultraviolet (UV) light and the alkylating agent methyl methanesulfonate (MMS). As TLS polymerases are intrinsically error-prone, tight regulation of their activity is required. One level of control is provided by ubiquitination of the homotrimeric DNA clamp PCNA at lysine residue 164 (PCNA-Ub). We here show that Polκ can function independently of PCNA modification and that Polη can function as a backup during TLS of MMS-induced lesions. Compared to cell lines deficient for PCNA modification (PcnaK164R) or Polκ, double mutant cell lines display hypersensitivity to MMS but not to BPDE or UV-C. Double mutant cells also displayed delayed post-replicative TLS, accumulate higher levels of replication stress and delayed S-phase progression. Furthermore, we show that Polη and Polκ are redundant in the DNA damage bypass of MMS-induced DNA damage. Taken together, we provide evidence for PCNA-Ub-independent activation of Polκ and establish Polη as an important backup polymerase in the absence of Polκ in response to MMS-induced DNA damage. PMID:25505145

  4. Levetiracetam mitigates doxorubicin-induced DNA and synaptic damage in neurons.

    PubMed

    Manchon, Jose Felix Moruno; Dabaghian, Yuri; Uzor, Ndidi-Ese; Kesler, Shelli R; Wefel, Jeffrey S; Tsvetkov, Andrey S

    2016-01-01

    Neurotoxicity may occur in cancer patients and survivors during or after chemotherapy. Cognitive deficits associated with neurotoxicity can be subtle or disabling and frequently include disturbances in memory, attention, executive function and processing speed. Searching for pathways altered by anti-cancer treatments in cultured primary neurons, we discovered that doxorubicin, a commonly used anti-neoplastic drug, significantly decreased neuronal survival. The drug promoted the formation of DNA double-strand breaks in primary neurons and reduced synaptic and neurite density. Pretreatment of neurons with levetiracetam, an FDA-approved anti-epileptic drug, enhanced survival of chemotherapy drug-treated neurons, reduced doxorubicin-induced formation of DNA double-strand breaks, and mitigated synaptic and neurite loss. Thus, levetiracetam might be part of a valuable new approach for mitigating synaptic damage and, perhaps, for treating cognitive disturbances in cancer patients and survivors. PMID:27168474

  5. Human mismatch repair, drug-induced DNA damage, and secondary cancer.

    PubMed

    Karran, Peter; Offman, Judith; Bignami, Margherita

    2003-11-01

    DNA mismatch repair (MMR) is an important replication error avoidance mechanism that prevents mutation. The association of defective MMR with familial and sporadic gastrointestinal and endometrial cancer has been acknowledged for some years. More recently, it has become apparent that MMR defects are common in acute myeloid leukaemia/myelodysplastic syndrome (AML/MDS) that follows successful chemotherapy for a primary malignancy. Therapy-related haematological malignancies are often associated with treatment with alkylating agents. Their frequency is increasing and they now account for at least 10% of all AML cases. There is also evidence for an association between MMR deficient AML/MDS and immunosuppressive treatment with thiopurine drugs. Here we review how MMR interacts with alkylating agent and thiopurine-induced DNA damage and suggest possible ways in which MMR defects may arise in therapy-related AML/MDS. PMID:14726020

  6. Levetiracetam mitigates doxorubicin-induced DNA and synaptic damage in neurons

    PubMed Central

    Manchon, Jose Felix Moruno; Dabaghian, Yuri; Uzor, Ndidi-Ese; Kesler, Shelli R.; Wefel, Jeffrey S.; Tsvetkov, Andrey S.

    2016-01-01

    Neurotoxicity may occur in cancer patients and survivors during or after chemotherapy. Cognitive deficits associated with neurotoxicity can be subtle or disabling and frequently include disturbances in memory, attention, executive function and processing speed. Searching for pathways altered by anti-cancer treatments in cultured primary neurons, we discovered that doxorubicin, a commonly used anti-neoplastic drug, significantly decreased neuronal survival. The drug promoted the formation of DNA double-strand breaks in primary neurons and reduced synaptic and neurite density. Pretreatment of neurons with levetiracetam, an FDA-approved anti-epileptic drug, enhanced survival of chemotherapy drug-treated neurons, reduced doxorubicin-induced formation of DNA double-strand breaks, and mitigated synaptic and neurite loss. Thus, levetiracetam might be part of a valuable new approach for mitigating synaptic damage and, perhaps, for treating cognitive disturbances in cancer patients and survivors. PMID:27168474

  7. Contributions of DNA repair, cell cycle checkpoints and cell death to suppressing the DNA damage-induced tumorigenic behavior of Drosophila epithelial cells.

    PubMed

    Dekanty, A; Barrio, L; Milán, M

    2015-02-19

    When exposed to DNA-damaging agents, components of the DNA damage response (DDR) pathway trigger apoptosis, cell cycle arrest and DNA repair. Although failures in this pathway are associated with cancer development, the tumor suppressor roles of cell cycle arrest and apoptosis have recently been questioned in mouse models. Using Drosophila epithelial cells that are unable to activate the apoptotic program, we provide evidence that ionizing radiation (IR)-induced DNA damage elicits a tumorigenic behavior in terms of E-cadherin delocalization, cell delamination, basement membrane degradation and neoplasic overgrowth. The tumorigenic response of the tissue to IR is enhanced by depletion of Okra/DmRAD54 or spnA/DmRAD51--genes required for homologous recombination (HR) repair of DNA double-strand breaks in G2--and it is independent of the activity of Lig4, a ligase required for nonhomologous end-joining repair in G1. Remarkably, depletion of Grapes/DmChk1 or Mei-41/dATR-genes affecting DNA damage-induced cell cycle arrest in G2--compromised DNA repair and enhanced the tumorigenic response of the tissue to IR. On the contrary, DDR-independent lengthening of G2 had a positive impact on the dynamics of DNA repair and suppressed the tumorigenic response of the tissue to IR. Our results support a tumor suppressor role of apoptosis, DNA repair by HR and cell cycle arrest in G2 in simple epithelia subject to IR-induced DNA damage. PMID:24632609

  8. Inactivation of NADPH Oxidases NOX4 and NOX5 Protects Human Primary Fibroblasts from Ionizing Radiation-Induced DNA Damage

    PubMed Central

    Weyemi, Urbain; Redon, Christophe E.; Aziz, Towqir; Choudhuri, Rohini; Maeda, Daisuke; Parekh, Palak R.; Bonner, Michael Y.; Arbiser, Jack L.; Bonner, William M.

    2015-01-01

    Human exposure to ionizing radiation from medical procedures has increased sharply in the last three decades. Recent epidemiological studies suggest a direct relationship between exposure to ionizing radiation and health problems, including cancer incidence. Therefore, minimizing the impact of radiation exposure in patients has become a priority in the development of future clinical practices. Crucial players in radiation-induced DNA damage include reactive oxygen species (ROS), but the sources of these have remained elusive. To the best of our knowledge, we show here for the first time that two members of the ROS-generating NADPH oxidase family (NOXs), NOX4 and NOX5, are involved in radiation-induced DNA damage. Depleting these two NOXs in human primary fibroblasts resulted in reduced levels of DNA damage as measured by levels of radiation-induced foci, a marker of DNA double-strand breaks (DSBs) and the comet assay coupled with increased cell survival. NOX involvement was substantiated with fulvene-5, a NOXs-specific inhibitor. Moreover, fulvene-5 mitigated radiation-induced DNA damage in human peripheral blood mononuclear cells ex vivo. Our results provide evidence that the inactivation of NOXs protects cells from radiation-induced DNA damage and cell death. These findings suggest that NOXs inhibition may be considered as a future pharmacological target to help minimize the negative effects of radiation exposure for millions of patients each year. PMID:25706776

  9. Formation, Accumulation, and Hydrolysis of Endogenous and Exogenous Formaldehyde-Induced DNA Damage.

    PubMed

    Yu, Rui; Lai, Yongquan; Hartwell, Hadley J; Moeller, Benjamin C; Doyle-Eisele, Melanie; Kracko, Dean; Bodnar, Wanda M; Starr, Thomas B; Swenberg, James A

    2015-07-01

    Formaldehyde is not only a widely used chemical with well-known carcinogenicity but is also a normal metabolite of living cells. It thus poses unique challenges for understanding risks associated with exposure. N(2-)hydroxymethyl-dG (N(2)-HOMe-dG) is the main formaldehyde-induced DNA mono-adduct, which together with DNA-protein crosslinks (DPCs) and toxicity-induced cell proliferation, play important roles in a mutagenic mode of action for cancer. In this study, N(2)-HOMe-dG was shown to be an excellent biomarker for direct adduction of formaldehyde to DNA and the hydrolysis of DPCs. The use of inhaled [(13)CD2]-formaldehyde exposures of rats and primates coupled with ultrasensitive nano ultra performance liquid chromatography-tandem mass spectrometry permitted accurate determinations of endogenous and exogenous formaldehyde DNA damage. The results show that inhaled formaldehyde only reached rat and monkey noses, but not tissues distant to the site of initial contact. The amounts of exogenous adducts were remarkably lower than those of endogenous adducts in exposed nasal epithelium. Moreover, exogenous adducts accumulated in rat nasal epithelium over the 28-days exposure to reach steady-state concentrations, followed by elimination with a half-life (t1/2) of 7.1 days. Additionally, we examined artifact formation during DNA preparation to ensure the accuracy of nonlabeled N(2)-HOMe-dG measurements. These novel findings provide critical new data for understanding major issues identified by the National Research Council Review of the 2010 Environmental Protection Agency's Draft Integrated Risk Information System Formaldehyde Risk Assessment. They support a data-driven need for reflection on whether risks have been overestimated for inhaled formaldehyde, whereas underappreciating endogenous formaldehyde as the primary source of exposure that results in bone marrow toxicity and leukemia in susceptible humans and rodents deficient in DNA repair. PMID:25904104

  10. Biomolecular Damage Induced by Ionizing Radiation: The Direct and Indirect Effects of Low-Energy Electrons on DNA

    NASA Astrophysics Data System (ADS)

    Alizadeh, Elahe; Orlando, Thomas M.; Sanche, Léon

    2015-04-01

    Many experimental and theoretical advances have recently allowed the study of direct and indirect effects of low-energy electrons (LEEs) on DNA damage. In an effort to explain how LEEs damage the human genome, researchers have focused efforts on LEE interactions with bacterial plasmids, DNA bases, sugar analogs, phosphate groups, and longer DNA moieties. Here, we summarize the current understanding of the fundamental mechanisms involved in LEE-induced damage of DNA and complex biomolecule films. Results obtained by several laboratories on films prepared and analyzed by different methods and irradiated with different electron-beam current densities and fluencies are presented. Despite varied conditions (e.g., film thicknesses and morphologies, intrinsic water content, substrate interactions, and extrinsic atmospheric compositions), comparisons show a striking resemblance in the types of damage produced and their yield functions. The potential of controlling this damage using molecular and nanoparticle targets with high LEE yields in targeted radiation-based cancer therapies is also discussed.

  11. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE: INDUCED BY RADIATION, CHEMICALS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This assay is based on the ability of certain dyes to fluoresce upon intercalation with dsDNA. Damage caused by ultraviolet (UV) radiation, chemicals or restriction enzymes is detected using this assay. UV radiation at...

  12. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY RADIATION, CHEMICAL MUTAGENS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This novel assay is based on changes in melting/annealing behavior and facilitated using certain dyes that increase their fluorescence upon association with double stranded (ds)DNA. Damage caused by ultraviolet (UV) ra...

  13. Spatiotemporal characterization of ionizing radiation induced DNA damage foci and their relation to chromatin organization

    SciTech Connect

    Costes, Sylvain V; Chiolo, Irene; Pluth, Janice M.; Barcellos-Hoff, Mary Helen; Jakob, Burkhard

    2009-09-15

    DNA damage sensing proteins have been shown to localize to the sites of DSB within seconds to minutes following ionizing radiation (IR) exposure, resulting in the formation of microscopically visible nuclear domains referred to as radiation-induced foci (RIF). This review characterizes the spatio-temporal properties of RIF at physiological doses, minutes to hours following exposure to ionizing radiation, and it proposes a model describing RIF formation and resolution as a function of radiation quality and nuclear densities. Discussion is limited to RIF formed by three interrelated proteins ATM (Ataxia telangiectasia mutated), 53BP1 (p53 binding protein 1) and ?H2AX (phosphorylated variant histone H2AX). Early post-IR, we propose that RIF mark chromatin reorganization, leading to a local nuclear scaffold rigid enough to keep broken DNA from diffusing away, but open enough to allow the repair machinery. We review data indicating clear kinetic and physical differences between RIF emerging from dense and uncondensed regions of the nucleus. At later time post-IR, we propose that persistent RIF observed days following exposure to ionizing radiation are nuclear ?scars? marking permanent disruption of the chromatin architecture. When DNA damage is resolved, such chromatin modifications should not necessarily lead to growth arrest and it has been shown that persistent RIF can replicate during mitosis. Thus, heritable persistent RIF spanning over tens of Mbp may affect the transcriptome of a large progeny of cells. This opens the door for a non DNA mutation-based mechanism of radiation-induced phenotypes.

  14. Oxidative damage of DNA induced by X-irradiation decreases the uterine endometrial receptivity which involves mitochondrial and lysosomal dysfunction

    PubMed Central

    Gao, Wei; Liang, Jin-Xiao; Liu, Shuai; Liu, Chang; Liu, Xiao-Fang; Wang, Xiao-Qi; Yan, Qiu

    2015-01-01

    X irradiation may lead to female infertility and the mechanism is still not clear. After X irradiation exposure, significantly morphological changes and functional decline in endometrial epithelial cells were observed. The mitochondrial and lysosomal dysfunction and oxidative DNA damage were noticed after X irradiation. In addition, pretreatment with NAC, NH4Cl or Pep A reduced the X irradiation induced damages. These studies demonstrate that the oxidative DNA damage which involved dysfunctional lysosomal and mitochondrial contribute to X irradiation-induced impaired receptive state of uterine endometrium and proper protective reagents can be helpful in improving endometrial function. PMID:26064230

  15. The effect of brevenal on brevetoxin-induced DNA damage in human lymphocytes

    PubMed Central

    Sayer, Andrew; Hu, Qing; Bourdelais, Andrea J.; Baden, Daniel G.; Gibson, James E.

    2008-01-01

    Brevenal is a nontoxic short-chain trans-syn polyether that competes with brevetoxin (PbTx) for the active site on voltage-sensitive sodium channels. The PbTxs are highly potent polyether toxins produced during blooms of several species of marine dinoflagellates, most notably Karenia brevis. Blooms of K. brevis have been associated with massive fish kills, marine mammal poisoning, and are potentially responsible for adverse human health effects such as respiratory irritation and airway constriction in beach-goers. Additionally, the consumption of shellfish contaminated with PbTxs results in neurotoxic shellfish poisoning (NSP). The purpose of the present study was to determine whether PbTx could induce DNA damage in a human cell type, the lymphocyte, and if so, whether the damage could be antagonized or ameliorated by brevenal, a brevetoxin antagonist. The DNA damage may occur through both endogenous and exogenous physiological and pathophysiological processes. Unrepaired or erroneously repaired DNA damage may result in gene mutation, chromosome aberration, and modulation of gene regulation, which have been associated with immunotoxicity and carcinogenesis. A single-cell gel electrophoresis assay, or comet assay, was used to determine and compare DNA damage following various treatments. The data were expressed as tail moments, which is the percentage of DNA in the tail multiplied by the length between the center of the head and center of the tail (in arbitrary units). The negative control tail moment was 29.2 (SE=±0.9), whereas the positive control (hydrogen peroxide) was 72.1 (1.5) and solvent (ethanol) was 24.2 (2.1). The PbTx-2 (from Sigma, St. Louis, MO, USA), 10−8 M was 41.3 (3.6), PbTx-9 (Sigma), 10−8 M was 57.0 (5.3), PbTx-2 (from University of North Carolina at Wilmington, UNCW), 10−8 M was 49.4 (9.9), and PbTx-3 (UNCW), 10−8 M was 64.0 (6.4). 1.0 μg/ml brevenal applied 1 h before the PbTxs protected the lymphocytes from DNA damage; PbTx-2 (Sigma

  16. The effect of brevenal on brevetoxin-induced DNA damage in human lymphocytes.

    PubMed

    Sayer, Andrew; Hu, Qing; Bourdelais, Andrea J; Baden, Daniel G; Gibson, James E

    2005-11-01

    Brevenal is a nontoxic short-chain trans-syn polyether that competes with brevetoxin (PbTx) for the active site on voltage-sensitive sodium channels. The PbTxs are highly potent polyether toxins produced during blooms of several species of marine dinoflagellates, most notably Karenia brevis. Blooms of K. brevis have been associated with massive fish kills, marine mammal poisoning, and are potentially responsible for adverse human health effects such as respiratory irritation and airway constriction in beach-goers. Additionally, the consumption of shellfish contaminated with PbTxs results in neurotoxic shellfish poisoning (NSP). The purpose of the present study was to determine whether PbTx could induce DNA damage in a human cell type, the lymphocyte, and if so, whether the damage could be antagonized or ameliorated by brevenal, a brevetoxin antagonist. The DNA damage may occur through both endogenous and exogenous physiological and pathophysiological processes. Unrepaired or erroneously repaired DNA damage may result in gene mutation, chromosome aberration, and modulation of gene regulation, which have been associated with immunotoxicity and carcinogenesis. A single-cell gel electrophoresis assay, or comet assay, was used to determine and compare DNA damage following various treatments. The data were expressed as tail moments, which is the percentage of DNA in the tail multiplied by the length between the center of the head and center of the tail (in arbitrary units). The negative control tail moment was 29.2 (SE=+/-0.9), whereas the positive control (hydrogen peroxide) was 72.1 (1.5) and solvent (ethanol) was 24.2 (2.1). The PbTx-2 (from Sigma, St. Louis, MO, USA), 10(-8) M was 41.3 (3.6), PbTx-9 (Sigma), 10(-8) M was 57.0 (5.3), PbTx-2 (from University of North Carolina at Wilmington, UNCW), 10(-8) M was 49.4 (9.9), and PbTx-3 (UNCW), 10(-8) M was 64.0 (6.4). 1.0 microg/ml brevenal applied 1 h before the PbTxs protected the lymphocytes from DNA damage; PbTx-2

  17. Polyphenols as possible bioprotectors against cytotoxicity and DNA damage induced by ochratoxin A.

    PubMed

    Cariddi, L N; Sabini, M C; Escobar, F M; Montironi, I; Mañas, F; Iglesias, D; Comini, L R; Sabini, L I; Dalcero, A M

    2015-05-01

    The present study aimed to investigate the protective effects of luteolin (L), chlorogenic acid (ChlA) and caffeic acid (CafA) against cyto-genotoxic effects caused by OTA. Vero cells and rat lymphocytes were used and viability was measured by neutral red uptake, MTT and trypan blue dye exclusion method. L (50 and 100μg/mL), ChlA (100 and 200μg/mL) and CafA (10-50μg/mL) reduced the damage induced by OTA (10μg/mL) on both cells type shown a good protective effect. The comet and micronucleus tests in Balb/c mice were performed. ChlA (10mg/kg bw) reduced OTA (0.85mg/kg bw)-induced DNA damage on blood and bone marrow cells, CafA (10mg/kg bw) showed protective effect only in blood cells and luteolin (2.5mg/kg bw) failed to protect DNA integrity on cells. In conclusion, polyphenols tested reduced the toxicity caused by OTA on different target cells with good protective effect, being ChlA the compound that showed the best effects. PMID:25867686

  18. Denbinobin induces apoptosis by apoptosis-inducing factor releasing and DNA damage in human colorectal cancer HCT-116 cells.

    PubMed

    Chen, Tzu-Hsuan; Pan, Shiow-Lin; Guh, Jih-Hwa; Chen, Chien-Chih; Huang, Yao-Ting; Pai, Hui-Chen; Teng, Che-Ming

    2008-11-01

    Denbinobin is a phenanthraquinone derivative present in the stems of Ephemerantha lonchophylla. We showed that denbinobin induces apoptosis in human colorectal cancer cells (HCT-116) in a concentration-dependent manner. The addition of a pan-caspase inhibitor (zVAD-fmk) did not suppress the denbinobin-induced apoptotic effect, and denbinobin-induced apoptosis was not accompanied by processing of procaspase-3, -6, -7, -9, and -8. However, denbinobin triggered the translocation of the apoptosis-inducing factor (AIF) from the mitochondria into the nucleus. Small interfering RNA targeting of AIF effectively protected HCT-116 cells against denbinobin-induced apoptosis. Denbinobin treatment also caused DNA damage, activation of the p53 tumor suppressor gene, and upregulation of numerous downstream effectors (p21WAF1/CIP1, Bax, PUMA, and NOXA). A HCT-116 xenograft model demonstrated the in vivo efficacy and low toxicity of denbinobin. Taken together, our findings suggest that denbinobin induces apoptosis of human colorectal cancer HCT-116 cells via DNA damage and an AIF-mediated pathway. These results indicate that denbinobin has potential as a novel anticancer agent. PMID:18607570

  19. Platelet-activating factor induces cell cycle arrest and disrupts the DNA damage response in mast cells

    PubMed Central

    Puebla-Osorio, N; Damiani, E; Bover, L; Ullrich, S E

    2015-01-01

    Platelet-activating factor (PAF) is a potent phospholipid modulator of inflammation that has diverse physiological and pathological functions. Previously, we demonstrated that PAF has an essential role in ultraviolet (UV)-induced immunosuppression and reduces the repair of damaged DNA, suggesting that UV-induced PAF is contributing to skin cancer initiation by inducing immune suppression and also affecting a proper DNA damage response. The exact role of PAF in modulating cell proliferation, differentiation or transformation is unclear. Here, we investigated the mechanism(s) by which PAF affects the cell cycle and impairs early DNA damage response. PAF arrests proliferation in transformed and nontransformed human mast cells by reducing the expression of cyclin-B1 and promoting the expression of p21. PAF-treated cells show a dose-dependent cell cycle arrest mainly at G2–M, and a decrease in the DNA damage response elements MCPH1/BRIT-1 and ataxia telangiectasia and rad related (ATR). In addition, PAF disrupts the localization of p-ataxia telangiectasia mutated (p-ATM), and phosphorylated-ataxia telangiectasia and rad related (p-ATR) at the site of DNA damage. Whereas the potent effect on cell cycle arrest may imply a tumor suppressor activity for PAF, the impairment of proper DNA damage response might implicate PAF as a tumor promoter. The outcome of these diverse effects may be dependent on specific cues in the microenvironment. PMID:25950475

  20. Isoliquiritigenin induces G2 and M phase arrest by inducing DNA damage and by inhibiting the metaphase/anaphase transition.

    PubMed

    Park, Iha; Park, Kwang-Kyun; Park, Jung Han Yoon; Chung, Won-Yoon

    2009-05-18

    Isoliquiritigenin, a natural flavonoid found in licorice, shallots, and bean sprouts, has been demonstrated to inhibit proliferation and to induce apoptosis in a variety of human cancer cells. We attempted to ascertain the underlying mechanism by which isoliquiritigenin induced cell cycle arrest and cytotoxicity in HeLa human cervical cancer cells. Isoliquiritigenin treatment arrested cells in both G2 and M phase. The cells arrested in interphase (G2) showed markers for DNA damage including the formation of gamma-H2AX foci and the phosphorylation of ATM and Chk2, whereas the cells arrested in M phase evidenced separate poles and mitotic metaphase-like spindles with partially unaligned chromosomes. The induction of DNA damage and blockade at the metaphase/anaphase transition implied that isoliquiritigenin might function as a topoisomerase II poison, which was further demonstrated via an in vitro topoisomerase II inhibition assay. These results show that isoliquiritigenin inhibits topoiosmerase II activity, and the resultant DNA damage and arrest in mitotic metaphase-like stage contributes to the antiproliferative effects of isoliquiritigenin. PMID:19167809

  1. In vivo antigenotoxic activity of watercress juice (Nasturtium officinale) against induced DNA damage.

    PubMed

    Casanova, Natalia A; Ariagno, Julia I; López Nigro, Marcela M; Mendeluk, Gabriela R; de los A Gette, María; Petenatti, Elisa; Palaoro, Luis A; Carballo, Marta A

    2013-09-01

    The present study was carried out to investigate the genotoxicity as well as possible protective activity against damage induced by cyclophosphamide (CP) of the aqueous juice of watercress (Nasturtium officinale, W.T. Aiton) in vivo. Male and female Swiss mice 7-8 weeks old (N = 48) were treated by gavage with 1 g kg(-1) body weight and 0.5 g kg(-1) body weight of watercress juice during 15 consecutive days. Genotoxicity and its possible protective effect were tested by the comet assay in peripheral blood cells and the micronucleus test in bone marrow. In addition, biopsies of the bladder, epididymis and testicles of mice were performed to extend the experimental design. Watercress juice per se did not induce genetic damage according to the comet assay and micronucleus study, exhibiting a protective activity against CP (P < 0.05 and P < 0.001, respectively). The comparative analysis of bladder histological changes obtained in the watercress plus CP group against those treated with CP alone suggests a probable protective effect. Further studies are needed in order to establish the protective role of watercress juice against DNA damage. PMID:22488040

  2. Cell cycle-dependent DNA damage signaling induced by ICRF-193 involves ATM, ATR, CHK2, and BRCA1

    SciTech Connect

    Park, Iha; Avraham, Hava Karsenty . E-mail: havraham@bidmc.harvard.edu

    2006-07-01

    Topoisomerase II is essential for cell proliferation and survival and has been a target of various anticancer drugs. ICRF-193 has long been used as a catalytic inhibitor to study the function of topoisomerase II. Here, we show that ICRF-193 treatment induces DNA damage signaling. Treatment with ICRF-193 induced G2 arrest and DNA damage signaling involving {gamma}-H2AX foci formation and CHK2 phosphorylation. DNA damage by ICRF-193 was further demonstrated by formation of the nuclear foci of 53BP1, NBS1, BRCA1, MDC1, and FANCD2 and increased comet tail moment. The DNA damage signaling induced by ICRF-193 was mediated by ATM and ATR and was restricted to cells in specific cell cycle stages such as S, G2, and mitosis including late and early G1 phases. Downstream signaling of ATM and ATR involved the phosphorylation of CHK2 and BRCA1. Altogether, our results demonstrate that ICRF-193 induces DNA damage signaling in a cell cycle-dependent manner and suggest that topoisomerase II might be essential for the progression of the cell cycle at several stages including DNA decondensation.

  3. Oxidative DNA damage caused by inflammation may link to stress-induced non-targeted effects

    PubMed Central

    Sprung, Carl N.; Ivashkevich, Alesia; Forrester, Helen B.; Redon, Christophe E.; Georgakilas, Alexandros; Martin, Olga A.

    2013-01-01

    A spectrum of radiation-induced non-targeted effects has been reported during the last two decades since Nagasawa and Little first described a phenomenon in cultured cells that was later called the “bystander effect”. These non-targeted effects include radiotherapy-related abscopal effects, where changes in organs or tissues occur distant from the irradiated region. The spectrum of non-targeted effects continue to broaden over time and now embrace many types of exogenous and endogenous stressors that induce a systemic genotoxic response including a widely studied tumor microenvironment. Here we discuss processes and factors leading to DNA damage induction in non-targeted cells and tissues and highlight similarities in the regulation of systemic effects caused by different stressors. PMID:24041866

  4. Mitochondria-targeted Ogg1 and Aconitase-2 Prevent Oxidant-induced Mitochondrial DNA Damage in Alveolar Epithelial Cells*

    PubMed Central

    Kim, Seok-Jo; Cheresh, Paul; Williams, David; Cheng, Yuan; Ridge, Karen; Schumacker, Paul T.; Weitzman, Sigmund; Bohr, Vilhelm A.; Kamp, David W.

    2014-01-01

    Mitochondria-targeted human 8-oxoguanine DNA glycosylase (mt-hOgg1) and aconitase-2 (Aco-2) each reduce oxidant-induced alveolar epithelial cell (AEC) apoptosis, but it is unclear whether protection occurs by preventing AEC mitochondrial DNA (mtDNA) damage. Using quantitative PCR-based measurements of mitochondrial and nuclear DNA damage, mtDNA damage was preferentially noted in AEC after exposure to oxidative stress (e.g. amosite asbestos (5–25 μg/cm2) or H2O2 (100–250 μm)) for 24 h. Overexpression of wild-type mt-hOgg1 or mt-long α/β 317–323 hOgg1 mutant incapable of DNA repair (mt-hOgg1-Mut) each blocked A549 cell oxidant-induced mtDNA damage, mitochondrial p53 translocation, and intrinsic apoptosis as assessed by DNA fragmentation and cleaved caspase-9. In contrast, compared with controls, knockdown of Ogg1 (using Ogg1 shRNA in A549 cells or primary alveolar type 2 cells from ogg1−/− mice) augmented mtDNA lesions and intrinsic apoptosis at base line, and these effects were increased further after exposure to oxidative stress. Notably, overexpression of Aco-2 reduced oxidant-induced mtDNA lesions, mitochondrial p53 translocation, and apoptosis, whereas siRNA for Aco-2 (siAco-2) enhanced mtDNA damage, mitochondrial p53 translocation, and apoptosis. Finally, siAco-2 attenuated the protective effects of mt-hOgg1-Mut but not wild-type mt-hOgg1 against oxidant-induced mtDNA damage and apoptosis. Collectively, these data demonstrate a novel role for mt-hOgg1 and Aco-2 in preserving AEC mtDNA integrity, thereby preventing oxidant-induced mitochondrial dysfunction, p53 mitochondrial translocation, and intrinsic apoptosis. Furthermore, mt-hOgg1 chaperoning of Aco-2 in preventing oxidant-mediated mtDNA damage and apoptosis may afford an innovative target for the molecular events underlying oxidant-induced toxicity. PMID:24429287

  5. 3,3'-Dihydroxyisorenieratene and isorenieratene prevent UV-induced DNA damage in human skin fibroblasts.

    PubMed

    Wagener, Sarah; Völker, Tanja; De Spirt, Silke; Ernst, Hansgeorg; Stahl, Wilhelm

    2012-08-01

    Skin cancer is among the most frequent neoplastic malignancies and exposure to UV irradiation is a major risk factor. In addition to topical sunscreens, photoprotection by dietary antioxidants such as carotenoids or polyphenols has been suggested as a means of prevention. Isorenieratene (IR) and dihydroxyisorenieratene (DHIR) are aromatic carotenoids with particular antioxidant properties produced by Brevibacterium linens. The aim of this study was to investigate the photoprotective and antioxidant activities of DHIR and IR in comparison to the nonaromatic carotenoid lutein in human dermal fibroblasts. Incubation of the cells with DHIR and IR significantly decreased the UV-induced formation of cyclobutane pyrimidine dimers and formation of DNA strand breaks. Lipid oxidation was lowered as determined by the formation of malondialdehyde as a biomarker. Both aromatic carotenoids also prevented oxidatively generated damage to DNA as demonstrated by a decrease in DNA strand breaks associated with the formation of oxidized DNA bases. These data highlight the multifunctional photoprotective properties of aromatic carotenoids, which may be suitable natural compounds for the prevention of skin cancer. PMID:22634149

  6. DNA damage checkpoints in mammals.

    PubMed

    Niida, Hiroyuki; Nakanishi, Makoto

    2006-01-01

    DNA damage is a common event and probably leads to mutation or deletion within chromosomal DNA, which may cause cancer or premature aging. DNA damage induces several cellular responses including DNA repair, checkpoint activity and the triggering of apoptotic pathways. DNA damage checkpoints are associated with biochemical pathways that end delay or arrest of cell-cycle progression. These checkpoints engage damage sensor proteins, such as the Rad9-Rad1-Hus1 (9-1-1) complex, and the Rad17-RFC complex, in the detection of DNA damage and transduction of signals to ATM, ATR, Chk1 and Chk2 kinases. Chk1 and Chk2 kinases regulate Cdc25, Wee1 and p53 that ultimately inactivate cyclin-dependent kinases (Cdks) which inhibit cell-cycle progression. In this review, we discuss the molecular mechanisms by which DNA damage is recognized by sensor proteins and signals are transmitted to Cdks. We classify the genes involved in checkpoint signaling into four categories, namely sensors, mediators, transducers and effectors, although their proteins have the broad activity, and thus this classification is for convenience and is not definitive. PMID:16314342

  7. Targeting DNA damage response in cancer therapy

    PubMed Central

    Hosoya, Noriko; Miyagawa, Kiyoshi

    2014-01-01

    Cancer chemotherapy and radiotherapy are designed to kill cancer cells mostly by inducing DNA damage. DNA damage is normally recognized and repaired by the intrinsic DNA damage response machinery. If the damaged lesions are successfully repaired, the cells will survive. In order to specifically and effectively kill cancer cells by therapies that induce DNA damage, it is important to take advantage of specific abnormalities in the DNA damage response machinery that are present in cancer cells but not in normal cells. Such properties of cancer cells can provide biomarkers or targets for sensitization. For example, defects or upregulation of the specific pathways that recognize or repair specific types of DNA damage can serve as biomarkers of favorable or poor response to therapies that induce such types of DNA damage. Inhibition of a DNA damage response pathway may enhance the therapeutic effects in combination with the DNA-damaging agents. Moreover, it may also be useful as a monotherapy when it achieves synthetic lethality, in which inhibition of a complementary DNA damage response pathway selectively kills cancer cells that have a defect in a particular DNA repair pathway. The most striking application of this strategy is the treatment of cancers deficient in homologous recombination by poly(ADP-ribose) polymerase inhibitors. In this review, we describe the impact of targeting the cancer-specific aberrations in the DNA damage response by explaining how these treatment strategies are currently being evaluated in preclinical or clinical trials. PMID:24484288

  8. [Exercise training in hypoxia prevents hypoxia induced mitochondrial DNA oxidative damage in skeletal muscle].

    PubMed

    Bo, Hai; Li, Ling; Duan, Fu-Qiang; Zhu, Jiang

    2014-10-25

    This study was undertaken to investigate the effect of exercise training on mitochondrial DNA (mtDNA) oxidative damage and 8-oxoguanine DNA glycosylase-1 (OGG1) expression in skeletal muscle of rats under continuous exposure to hypoxia. Male Sprague-Dawley rats were randomly divided into 4 groups (n = 8): normoxia control group (NC), normoxia training group (NT), hypoxia control group (HC), and hypoxia training group (HT). The hypoxia-treated animals were housed in normobaric hypoxic tent containing 11.3% oxygen for consecutive 4 weeks. The exercise-trained animals were exercised on a motor-driven rodent treadmill at a speed of 15 m/min, 5% grade for 60 min/day, 5 days per week for 4 weeks. The results showed that, compared with NC group, hypoxia attenuated complex I, II, IV and ATP synthase activities of the electron transport chain, and the level of mitochondrial membrane potential in HC group (P < 0.05 or P < 0.01). Moreover, hypoxia decreased mitochondrial OGG1, MnSOD, and GPx activities (P < 0.05 or P < 0.01), whereas elevated reactive oxygen species (ROS) generation and the level of 8-oxo-deoxyguanosine (8-oxodG) in mtDNA (P < 0.01). Furthermore, hypoxia attenuated muscle and mitochondrial [NAD⁺]/ [NADH] ratio, and SIRT3 protein expression (P < 0.05 or P < 0.01). Compared with HC group, exercise training in hypoxia elevated complex I, II, IV and ATP synthase activities, and the level of mitochondrial membrane potential in HT group (P < 0.05 or P < 0.01). Moreover, exercise training in hypoxia increased MnSOD and GPx activities and mitochondrial OGG1 level (P < 0.01), whereas decreased ROS generation and the level of 8-oxodG in mtDNA (P < 0.01). Furthermore, exercise training in hypoxia increased muscle and mitochondrial [NAD⁺]/[NADH] ratio, as well as SIRT3 protein expression (P < 0.05 or P < 0.01). These findings suggest that exercise training in hypoxia can decrease hypoxia-induced mtDNA oxidative damage in the skeletal muscle through up

  9. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.

    PubMed

    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke

    2014-07-01

    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles. PMID:24769180

  10. Characterization of the DNA damage-inducible helicase DinG from Escherichia coli.

    PubMed

    Voloshin, Oleg N; Vanevski, Filip; Khil, Pavel P; Camerini-Otero, R Daniel

    2003-07-25

    The dinG promoter was first isolated in a genetic screen scoring for damage-inducible loci in Escherichia coli (Lewis, L. K., Jenkins, M. E., and Mount, D. W. (1992) J. Bacteriol. 174, 3377-3385). Sequence analysis suggests that the dinG gene encodes a putative helicase related to a group of eukaryotic helicases that includes mammalian XPD (Koonin, E. V. (1993) Nucleic Acids Res. 21, 1497), an enzyme involved in transcription-coupled nucleotide excision repair and basal transcription. We have characterized the dinG gene product from E. coli using genetic and biochemical approaches. Deletion of dinG has no severe phenotype, indicating that it is non-essential for cell viability. Both dinG deletion and over-expression of the DinG protein from a multicopy plasmid result in a slight reduction of UV resistance. DinG, purified as a fusion protein from E. coli cells, behaves as a monomer in solution, as judged from gel filtration experiments. DinG is an ATP-hydrolyzing enzyme; single-stranded (ss) DNA stimulates the ATPase activity 15-fold. Kinetic data yield a Hill coefficient of 1, consistent with one ATP-hydrolyzing site per DinG molecule. DinG possesses a DNA helicase activity; it translocates along ssDNA in a 5' --> 3' direction, as revealed in experiments with substrates containing non-natural 5'-5' and 3'-3' linkages. The ATP-dependent DNA helicase activity of DinG requires divalent cations (Mg2+, Ca2+, and Mn2+) but is not observed in the presence of Zn2+. The DinG helicase does not discriminate between ribonucleotide and deoxyribonucleotide triphosphates, and it unwinds duplex DNA with similar efficiency in the presence of ATP or dATP. We discuss the possible involvement of the DinG helicase in DNA replication and repair processes. PMID:12748189

  11. Oxidative DNA damage induced by hair dye components ortho-phenylenediamines and the enhancement by superoxide dismutase.

    PubMed

    Murata, Mariko; Nishimura, Tomoko; Chen, Fang; Kawanishi, Shosuke

    2006-09-01

    There is an association between occupational exposure to hair dyes and incidence of cancers. Permanent oxidant hair dyes are consisted of many chemical components including ortho-phenylenediamines. To clarify the mechanism of carcinogenesis by hair dyes, we examined DNA damage induced by mutagenic ortho-phenylenediamine (o-PD) and its derivatives, 4-chloro-ortho-phenylenediamine (Cl-PD) and 4-nitro-ortho-phenylenediamine (NO(2)-PD), using (32)P-labeled DNA fragments obtained from the human p16 and the p53 tumor suppressor gene. We also measured the content of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), a marker of oxidative DNA damage, in calf thymus DNA with an electrochemical detector coupled to a high performance liquid chromatograph. Carcinogenic o-PD and Cl-PD caused Cu(II)-mediated DNA damage, including 8-oxodG formation, and antioxidant enzyme superoxide dismutase (SOD) enhanced DNA damage. o-PD and Cl-PD caused piperidine-labile and formamidopyrimidine-DNA glycosylase-sensitive lesions at cytosine and guanine residues respectively in the 5'-ACG-3' sequence, complementary to codon 273, a well-known hotspot of the human p53 tumor suppressor gene. UV-vis spectroscopic studies showed that the spectral change of o-PD and Cl-PD required Cu(II), and addition of SOD enhanced it. This suggested that SOD enhanced the rate of Cu(II)-mediated autoxidation of o-PD and Cl-PD, leading to enhancement of DNA damage. On the other hand, mutagenic but non-carcinogenic NO(2)-PD induced no DNA damage. These results suggest that carcinogenicity of ortho-phenylenediamines is associated with ability to cause oxidative DNA damage rather than bacterial mutagenicity. PMID:16798066

  12. Critical role for IL-1β in DNA damage-induced mucositis

    PubMed Central

    Kanarek, Naama; Grivennikov, Sergei I.; Leshets, Michael; Lasry, Audrey; Alkalay, Irit; Horwitz, Elad; Shaul, Yoav D.; Stachler, Matthew; Voronov, Elena; Apte, Ron N.; Pagano, Michele; Pikarsky, Eli; Karin, Michael; Ghosh, Sankar; Ben-Neriah, Yinon

    2014-01-01

    β-TrCP, the substrate recognition subunit of SCF-type ubiquitin ligases, is ubiquitously expressed from two distinct paralogs, targeting for degradation many regulatory proteins, among which is the NF-κB inhibitor IκB. To appreciate tissue-specific roles of β-TrCP, we studied the consequences of inducible ablation of three or all four alleles of the E3 in the mouse gut. The ablation resulted in mucositis, a destructive gut mucosal inflammation, which is a common complication of different cancer therapies and represents a major obstacle to successful chemoradiation therapy. We identified epithelial-derived IL-1β as the culprit of mucositis onset, inducing mucosal barrier breach. Surprisingly, epithelial IL-1β is induced by DNA damage via an NF-κB–independent mechanism. Tissue damage caused by gut barrier disruption is exacerbated in the absence of NF-κB, with failure to express the endogenous IL-1β receptor antagonist IL-1Ra upon four-allele loss. Antibody neutralization of IL-1β prevents epithelial tight junction dysfunction and alleviates mucositis in β-TrCP–deficient mice. IL-1β antagonists should thus be considered for prevention and treatment of severe morbidity associated with mucositis. PMID:24469832

  13. Inhibition of the mitochondrial respiratory chain function abrogates quartz induced DNA damage in lung epithelial cells.

    PubMed

    Li, Hui; Haberzettl, Petra; Albrecht, Catrin; Höhr, Doris; Knaapen, Ad M; Borm, Paul J A; Schins, Roel P F

    2007-04-01

    Respirable quartz dust has been classified as a human carcinogen by the International Agency for Research on Cancer. The aim of our study was to investigate the mechanisms of DNA damage by DQ12 quartz in RLE-6TN rat lung epithelial type II cells (RLE). Transmission electron microscopy and flow-cytometry analysis showed a rapid particle uptake (30 min to 4 h) of quartz by the RLE cells, but particles were not found within the cell nuclei. This suggests that DNA strand breakage and induction of 8-hydroxydeoxyguanosine - as also observed in these cells during these treatment intervals - did not result from direct physical interactions between particles and DNA, or from short-lived particle surface-derived reactive oxygen species. DNA damage by quartz was significantly reduced in the presence of the mitochondrial inhibitors rotenone and antimycin-A. In the absence of quartz, these inhibitors did not affect DNA damage, but they reduced cellular oxygen consumption. No signs of apoptosis were observed by quartz. Flow-cytometry analysis indicated that the reduced DNA damage by rotenone was not due to a possible mitochondria-mediated reduction of particle uptake by the RLE cells. Further proof of concept for the role of mitochondria was shown by the failure of quartz to elicit DNA damage in mitochondria-depleted 143B (rho-0) osteosarcoma cells, at concentrations where it elicited DNA damage in the parental 143B cell line. In conclusion, our data show that respirable quartz particles can elicit oxidative DNA damage in vitro without entering the nuclei of type II cells, which are considered to be important target cells in quartz carcinogenesis. Furthermore, our observations indicate that such indirect DNA damage involves the mitochondrial electron transport chain function, by an as-yet-to-be elucidated mechanism. PMID:17239409

  14. Intracellular accumulation of indium ions released from nanoparticles induces oxidative stress, proinflammatory response and DNA damage.

    PubMed

    Tabei, Yosuke; Sonoda, Akinari; Nakajima, Yoshihiro; Biju, Vasudevanpillai; Makita, Yoji; Yoshida, Yasukazu; Horie, Masanori

    2016-02-01

    Due to the widespread use of indium tin oxide (ITO), it is important to investigate its effect on human health. In this study, we evaluated the cellular effects of ITO nanoparticles (NPs), indium chloride (InCl3) and tin chloride (SnCl3) using human lung epithelial A549 cells. Transmission electron microscopy and inductively coupled plasma mass spectrometry were employed to study cellular ITO NP uptake. Interestingly, greater uptake of ITO NPs was observed, as compared with soluble salts. ITO NP species released could be divided into two types: 'indium release ITO' or 'tin release ITO'. We incubated A549 cells with indium release ITO, tin release ITO, InCl3 or SnCl2 and investigated oxidative stress, proinflammatory response, cytotoxicity and DNA damage. We found that intracellular reactive oxygen species were increased in cells incubated with indium release ITO, but not tin release ITO, InCl3 or SnCl2. Messenger RNA and protein levels of the inflammatory marker, interleukin-8, also increased following exposure to indium release ITO. Furthermore, the alkaline comet assay revealed that intracellular accumulation of indium ions induced DNA damage. Our results demonstrate that the accumulation of ionic indium, but not ionic tin, from ITO NPs in the intracellular matrix has extensive cellular effects. PMID:26378248

  15. Radiation-induced oxidative damage to the DNA-binding domain of the lactose repressor.

    PubMed

    Gillard, Nathalie; Goffinont, Stephane; Buré, Corinne; Davidkova, Marie; Maurizot, Jean-Claude; Cadene, Martine; Spotheim-Maurizot, Melanie

    2007-05-01

    Understanding the cellular effects of radiation-induced oxidation requires the unravelling of key molecular events, particularly damage to proteins with important cellular functions. The Escherichia coli lactose operon is a classical model of gene regulation systems. Its functional mechanism involves the specific binding of a protein, the repressor, to a specific DNA sequence, the operator. We have shown previously that upon irradiation with gamma-rays in solution, the repressor loses its ability to bind the operator. Water radiolysis generates hydroxyl radicals (OH* radicals) which attack the protein. Damage of the repressor DNA-binding domain, called the headpiece, is most likely to be responsible of this loss of function. Using CD, fluorescence spectroscopy and a combination of proteolytic cleavage with MS, we have examined the state of the irradiated headpiece. CD measurements revealed a dose-dependent conformational change involving metastable intermediate states. Fluorescence measurements showed a gradual degradation of tyrosine residues. MS was used to count the number of oxidations in different regions of the headpiece and to narrow down the parts of the sequence bearing oxidized residues. By calculating the relative probabilities of reaction of each amino acid with OH. radicals, we can predict the most probable oxidation targets. By comparing the experimental results with the predictions we conclude that Tyr7, Tyr12, Tyr17, Met42 and Tyr47 are the most likely hotspots of oxidation. The loss of repressor function is thus correlated with chemical modifications and conformational changes of the headpiece. PMID:17263689

  16. Protein kinase Cη activates NF-κB in response to camptothecin-induced DNA damage.

    PubMed

    Raveh-Amit, Hadas; Hai, Naama; Rotem-Dai, Noa; Shahaf, Galit; Gopas, Jacob; Livneh, Etta

    2011-08-26

    The nuclear factor κB (NF-κB) family of transcription factors participates in the regulation of genes involved in innate- and adaptive-immune responses, cell death and inflammation. The involvement of the Protein kinase C (PKC) family in the regulation of NF-κB in inflammation and immune-related signaling has been extensively studied. However, not much is known on the role of PKC in NF-κB regulation in response to DNA damage. Here we demonstrate for the first time that PKC-eta (PKCη) regulates NF-κB upstream signaling by activating the IκB kinase (IKK) and the degradation of IκB. Furthermore, PKCη enhances the nuclear translocation and transactivation of NF-κB under non-stressed conditions and in response to the anticancer drug camptothecin. We and others have previously shown that PKCη confers protection against DNA damage-induced apoptosis. Our present study suggests that PKCη is involved in NF-κB signaling leading to drug resistance. PMID:21820409

  17. Age-dependent oxidative stress-induced DNA damage in Down's lymphocytes

    SciTech Connect

    Zana, Marianna . E-mail: mzana@freemail.hu; Szecsenyi, Anita; Czibula, Agnes; Bjelik, Annamaria; Juhasz, Anna; Rimanoczy, Agnes; Vetro, Agnes; Pakaski, Magdolna; Janka, Zoltan; Kalman, Janos; Szabo, Krisztina; Szucs, Peter; Varkonyi, Agnes; Boda, Krisztina; Rasko, Istvan

    2006-06-30

    The aim of the present study was to investigate the oxidative status of lymphocytes from children (n = 7) and adults (n = 18) with Down's syndrome (DS). The basal oxidative condition, the vulnerability to in vitro hydrogen peroxide exposure, and the repair capacity were measured by means of the damage-specific alkaline comet assay. Significantly and age-independently elevated numbers of single strand breaks and oxidized bases (pyrimidines and purines) were found in the nuclear DNA of the lymphocytes in the DS group in the basal condition. These results may support the role of an increased level of endogenous oxidative stress in DS and are similar to those previously demonstrated in Alzheimer's disease. In the in vitro oxidative stress-induced state, a markedly higher extent of DNA damage was observed in DS children as compared with age- and gender-matched healthy controls, suggesting that young trisomic lymphocytes are more sensitive to oxidative stress than normal ones. However, the repair ability itself was not found to be deteriorated in either DS children or DS adults.

  18. Radiation-induced oxidative damage to the DNA-binding domain of the lactose repressor

    PubMed Central

    Gillard, Nathalie; Goffinont, Stephane; Buré, Corinne; Davidkova, Marie; Maurizot, Jean-Claude; Cadene, Martine; Spotheim-Maurizot, Melanie

    2007-01-01

    Understanding the cellular effects of radiation-induced oxidation requires the unravelling of key molecular events, particularly damage to proteins with important cellular functions. The Escherichia coli lactose operon is a classical model of gene regulation systems. Its functional mechanism involves the specific binding of a protein, the repressor, to a specific DNA sequence, the operator. We have shown previously that upon irradiation with γ-rays in solution, the repressor loses its ability to bind the operator. Water radiolysis generates hydroxyl radicals (OH· radicals) which attack the protein. Damage of the repressor DNA-binding domain, called the headpiece, is most likely to be responsible of this loss of function. Using CD, fluorescence spectroscopy and a combination of proteolytic cleavage with MS, we have examined the state of the irradiated headpiece. CD measurements revealed a dose-dependent conformational change involving metastable intermediate states. Fluorescence measurements showed a gradual degradation of tyrosine residues. MS was used to count the number of oxidations in different regions of the headpiece and to narrow down the parts of the sequence bearing oxidized residues. By calculating the relative probabilities of reaction of each amino acid with OH· radicals, we can predict the most probable oxidation targets. By comparing the experimental results with the predictions we conclude that Tyr7, Tyr12, Tyr17, Met42 and Tyr47 are the most likely hotspots of oxidation. The loss of repressor function is thus correlated with chemical modifications and conformational changes of the headpiece. PMID:17263689

  19. Effects of motexafin gadolinium on DNA damage and X-ray-induced DNA damage repair, as assessed by the Comet assay

    SciTech Connect

    Donnelly, Erling T.; Liu Yanfeng; Paul, Tracy K.; Rockwell, Sara . E-mail: sara.rockwell@yale.edu

    2005-07-15

    Purpose: To investigate the effects of motexafin gadolinium (MGd) on the levels of reactive oxygen species (ROS), glutathione (GSH), and DNA damage in EMT6 mouse mammary carcinoma cells. The ability of MGd to alter radiosensitivity and to inhibit DNA damage repair after X-ray irradiation was also evaluated. Methods and Materials: Reactive oxygen species and GSH levels were assessed by 2,7-dichlorofluorescein fluorescence flow cytometry and the Tietze method, respectively. Cellular radiosensitivity was assessed by clonogenic assays. Deoxyribonucleic acid damage and DNA damage repair were assessed in plateau-phase EMT6 cells by the Comet assay and clonogenic assays. Results: Cells treated with 100 {mu}mol/L MGd plus equimolar ascorbic acid (AA) had significantly increased levels of ROS and a 58.9% {+-} 3.4% decrease in GSH levels, relative to controls. Motexafin gadolinium plus AA treatment increased the hypoxic, but not the aerobic, radiosensitivity of EMT6 cells. There were increased levels of single-strand breaks in cells treated with 100 {mu}mol/L MGd plus equimolar AA, as evidenced by changes in the alkaline tail moment (MGd + AA, 6 h: 14.7 {+-} 1.8; control: 2.8 {+-} 0.9). The level of single-strand breaks was dependent on the length of treatment. Motexafin gadolinium plus AA did not increase double-strand breaks. The repair of single-strand breaks at 2 h, but not at 4 h and 6 h, after irradiation was altered significantly in cells treated with MGd plus AA (MGd + AA, 2 h: 15.8 {+-} 3.4; control: 5.8 {+-} 0.6). Motexafin gadolinium did not alter the repair of double-strand breaks at any time after irradiation with 10 Gy. Conclusions: Motexafin gadolinium plus AA generated ROS, which in turn altered GSH homeostasis and induced DNA strand breaks. The MGd plus AA-mediated alteration of GSH levels increased the hypoxic, but not aerobic, radiosensitivity of EMT6 cells. Motexafin gadolinium altered the kinetics of single-strand break repair soon after irradiation but

  20. Role of AtMSH7 in UV-B-induced DNA damage recognition and recombination.

    PubMed

    Lario, Luciana Daniela; Botta, Pablo; Casati, Paula; Spampinato, Claudia Patricia

    2015-06-01

    The mismatch repair (MMR) system maintains genome integrity by correcting replication-associated errors and inhibiting recombination between divergent DNA sequences. The basic features of the pathway have been highly conserved throughout evolution, although the nature and number of the proteins involved in this DNA repair system vary among organisms. Plants have an extra mismatch recognition protein, MutSγ, which is a heterodimer: MSH2-MSH7. To further understand the role of MSH7 in vivo, we present data from this protein in Arabidopsis thaliana. First, we generated transgenic plants that express β-glucuronidase (GUS) under the control of the MSH7 promoter. Histochemical staining of the transgenic plants indicated that MSH7 is preferentially expressed in proliferating tissues. Then, we identified msh7 T-DNA insertion mutants. Plants deficient in MSH7 show increased levels of UV-B-induced cyclobutane pyrimidine dimers relative to wild-type (WT) plants. Consistent with the patterns of MSH7 expression, we next analysed the role of the protein during somatic and meiotic recombination. The frequency of somatic recombination between homologous or homeologous repeats (divergence level of 1.6%) was monitored using a previously described GUS recombination reporter assay. Disruption of MSH7 has no effect on the rates of somatic homologous or homeologous recombination under control conditions or after UV-B exposure. However, the rate of meiotic recombination between two genetically linked seed-specific fluorescent markers was 97% higher in msh7 than in WT plants. Taken together, these results suggest that MSH7 is involved in UV-B-induced DNA damage recognition and in controlling meiotic recombination. PMID:25465032

  1. NF-κB inhibition delays DNA damage-induced senescence and aging in mice.

    PubMed

    Tilstra, Jeremy S; Robinson, Andria R; Wang, Jin; Gregg, Siobhán Q; Clauson, Cheryl L; Reay, Daniel P; Nasto, Luigi A; St Croix, Claudette M; Usas, Arvydas; Vo, Nam; Huard, Johnny; Clemens, Paula R; Stolz, Donna B; Guttridge, Denis C; Watkins, Simon C; Garinis, George A; Wang, Yinsheng; Niedernhofer, Laura J; Robbins, Paul D

    2012-07-01

    The accumulation of cellular damage, including DNA damage, is thought to contribute to aging-related degenerative changes, but how damage drives aging is unknown. XFE progeroid syndrome is a disease of accelerated aging caused by a defect in DNA repair. NF-κB, a transcription factor activated by cellular damage and stress, has increased activity with aging and aging-related chronic diseases. To determine whether NF-κB drives aging in response to the accumulation of spontaneous, endogenous DNA damage, we measured the activation of NF-κB in WT and progeroid model mice. As both WT and progeroid mice aged, NF-κB was activated stochastically in a variety of cell types. Genetic depletion of one allele of the p65 subunit of NF-κB or treatment with a pharmacological inhibitor of the NF-κB-activating kinase, IKK, delayed the age-related symptoms and pathologies of progeroid mice. Additionally, inhibition of NF-κB reduced oxidative DNA damage and stress and delayed cellular senescence. These results indicate that the mechanism by which DNA damage drives aging is due in part to NF-κB activation. IKK/NF-κB inhibitors are sufficient to attenuate this damage and could provide clinical benefit for degenerative changes associated with accelerated aging disorders and normal aging. PMID:22706308

  2. DNA damage in oral cancer and normal cells induced by nitrogen atmospheric pressure plasma jets

    NASA Astrophysics Data System (ADS)

    Han, Xu; Kapaldo, James; Liu, Yueying; Stack, M. Sharon; Ptasinska, Sylwia

    2015-09-01

    Nitrogen atmospheric pressure plasma jets (APPJs) have been shown to effectively induce DNA double strand breaks in SCC25 oral cancer cells. The APPJ source constructed in our laboratory operates based on dielectric barrier discharge. It consists of two copper electrodes alternatively wrapping around a fused silica tube with nitrogen as a feed gas. It is generally more challenging to ignite plasma in N2 atmosphere than in noble gases. However, N2 provides additional advantages such as lower costs compared to noble gases, thus this design can be beneficial for the future long-term clinical use. To compare the effects of plasma on cancer cells (SCC25) and normal cells (OKF), the cells from both types were treated at the same experimental condition for various treatment times. The effective area with different damage levels after the treatment was visualized as 3D maps. The delayed damage effects were also explored by varying the incubation times after the treatment. All of these studies are critical for a better understanding of the damage responses of cellular systems exposed to the plasma radiation, thus are useful for the development of the advanced plasma cancer therapy. The research described herein was supported by the Division of Chemical Sciences, Geosciences and Biosciences, Basic Energy Sciences, Office of Science, United States Department of Energy through Grant No. DE-FC02-04ER15533.

  3. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    PubMed Central

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Background. Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis. PMID:26273425

  4. Repairing of N-mustard derivative BO-1055 induced DNA damage requires NER, HR, and MGMT-dependent DNA repair mechanisms.

    PubMed

    Kuo, Ching-Ying; Chou, Wen-Cheng; Wu, Chin-Chung; Wong, Teng-Song; Kakadiya, Rajesh; Lee, Te-Chang; Su, Tsann-Long; Wang, Hui-Chun

    2015-09-22

    Alkylating agents are frequently used as first-line chemotherapeutics for various newly diagnosed cancers. Disruption of genome integrity by such agents can lead to cell lethality if DNA lesions are not removed. Several DNA repair mechanisms participate in the recovery of mono- or bi-functional DNA alkylation. Thus, DNA repair capacity is correlated with the therapeutic response. Here, we assessed the function of novel water-soluble N-mustard BO-1055 (ureidomustin) in DNA damage response and repair mechanisms. As expected, BO-1055 induces ATM and ATR-mediated DNA damage response cascades, including downstream Chk1/Chk2 phosphorylation, S/G2 cell-cycle arrest, and cell death. Further investigation revealed that cell survival sensitivity to BO-1055 is comparable to that of mitomycin C. Both compounds require nucleotide excision repair and homologous recombination, but not non-homologous end-joining, to repair conventional cross-linking DNA damage. Interestingly and unlike mitomycin C and melphalan, MGMT activity was also observed in BO-1055 damage repair systems, which reflects the occurrence of O-alkyl DNA lesions. Combined treatment with ATM/ATR kinase inhibitors significantly increases BO-1055 sensitivity. Our study pinpoints that BO-1055 can be used for treating tumors that with deficient NER, HR, and MGMT DNA repair genes, or for synergistic therapy in tumors that DNA damage response have been suppressed. PMID:26208482

  5. Repairing of N-mustard derivative BO-1055 induced DNA damage requires NER, HR, and MGMT-dependent DNA repair mechanisms

    PubMed Central

    Wu, Chin-Chung; Wong, Teng-Song; Kakadiya, Rajesh; Lee, Te-Chang; Su, Tsann-Long; Wang, Hui-Chun

    2015-01-01

    Alkylating agents are frequently used as first-line chemotherapeutics for various newly diagnosed cancers. Disruption of genome integrity by such agents can lead to cell lethality if DNA lesions are not removed. Several DNA repair mechanisms participate in the recovery of mono- or bi-functional DNA alkylation. Thus, DNA repair capacity is correlated with the therapeutic response. Here, we assessed the function of novel water-soluble N-mustard BO-1055 (ureidomustin) in DNA damage response and repair mechanisms. As expected, BO-1055 induces ATM and ATR-mediated DNA damage response cascades, including downstream Chk1/Chk2 phosphorylation, S/G2 cell-cycle arrest, and cell death. Further investigation revealed that cell survival sensitivity to BO-1055 is comparable to that of mitomycin C. Both compounds require nucleotide excision repair and homologous recombination, but not non-homologous end-joining, to repair conventional cross-linking DNA damage. Interestingly and unlike mitomycin C and melphalan, MGMT activity was also observed in BO-1055 damage repair systems, which reflects the occurrence of O-alkyl DNA lesions. Combined treatment with ATM/ATR kinase inhibitors significantly increases BO-1055 sensitivity. Our study pinpoints that BO-1055 can be used for treating tumors that with deficient NER, HR, and MGMT DNA repair genes, or for synergistic therapy in tumors that DNA damage response have been suppressed. PMID:26208482

  6. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    NASA Astrophysics Data System (ADS)

    Han, Xu; Klas, Matej; Liu, Yueying; Stack, M. Sharon; Ptasinska, Sylwia

    2013-09-01

    The nitrogen atmospheric pressure plasma jet (APPJ) has been shown to effectively induce DNA double strand breaks in SCC-25 oral cancer cells. The APPJ source constructed in our laboratory consists of two external electrodes wrapping around a quartz tube and nitrogen as a feed gas and operates based on dielectric barrier gas discharge. Generally, it is more challenging to ignite plasma in N2 atmosphere than in noble gases. However, this design provides additional advantages such as lower costs compared to the noble gases for future clinical operation. Different parameters of the APPJ configuration were tested in order to determine radiation dosage. To explore the effects of delayed damage and cell self-repairing, various incubation times of cells after plasma treatment were also performed. Reactive species generated in plasma jet and in liquid environment are essential to be identified and quantified, with the aim of unfolding the mystery of detailed mechanisms for plasma-induced cell apoptosis. Moreover, from the comparison of plasma treatment effect on normal oral cells OKF6T, an insight to the selectivity for cancer treatment by APPJ can be explored. All of these studies are critical to better understand the damage responses of normal and abnormal cellular systems to plasma radiation, which are useful for the development of advanced plasma therapy for cancer treatment at a later stage.

  7. Protection against radiation-induced DNA damage by amino acids: a DFT study.

    PubMed

    Jena, N R; Mishra, P C; Suhai, S

    2009-04-23

    Direct and indirect radiation-induced DNA damage is associated with the formation of radical cations (G(+)) and radical anions (G(-)) of guanine, respectively. Deprotonation of G(+) and dehydrogenation of G(-) generate guanine neutral radical [G(-H)] and guanine anion [G(-H)(-)], respectively. These products are of worrisome concern, as they are involved in reactions that are related to certain lethal diseases. It has been observed that guanyl radicals can be repaired by amino acids having strong reducing properties that are believed to be the residues of DNA-bound proteins such as histones. As a result, repair of G(-H) and G(-H)(-) by the amino acids cysteine and tyrosine has been studied here in detail by density functional theory in both the gas phase and aqueous medium using the polarized continuum and Onsager solvation models of self-consistent reaction field theory. Solvation in aqueous medium using three explicit water molecules was also studied. Four equivalent tautomers of each the above radical and anion that will be formed through proton and hydrogen loss from all of the nitrogen centers of guanine radical cation and guanine radical anion, respectively, were considered in the present study. It was found that in both the gas phase and aqueous medium, normal guanine can be retrieved from its radical-damaged form by a hydrogen-atom-transfer (HT) mechanism. Normal guanine can also be retrieved from its anionic damaged form in both the gas phase and aqueous medium through a two-electron-coupled proton-transfer (TECPT) mechanism or a one-step hydrogen-atom- and electron-transfer (OSHET) mechanism. The present results are discussed in light of the experimental findings. PMID:19334703

  8. Growth Arrest and DNA-Damage-Inducible, Beta (GADD45b)-Mediated DNA Demethylation in Major Psychosis

    PubMed Central

    Gavin, David P; Sharma, Rajiv P; Chase, Kayla A; Matrisciano, Francesco; Dong, Erbo; Guidotti, Alessandro

    2012-01-01

    Aberrant neocortical DNA methylation has been suggested to be a pathophysiological contributor to psychotic disorders. Recently, a growth arrest and DNA-damage-inducible, beta (GADD45b) protein-coordinated DNA demethylation pathway, utilizing cytidine deaminases and thymidine glycosylases, has been identified in the brain. We measured expression of several members of this pathway in parietal cortical samples from the Stanley Foundation Neuropathology Consortium (SFNC) cohort. We find an increase in GADD45b mRNA and protein in patients with psychosis. In immunohistochemistry experiments using samples from the Harvard Brain Tissue Resource Center, we report an increased number of GADD45b-stained cells in prefrontal cortical layers II, III, and V in psychotic patients. Brain-derived neurotrophic factor IX (BDNF IXabcd) was selected as a readout gene to determine the effects of GADD45b expression and promoter binding. We find that there is less GADD45b binding to the BDNF IXabcd promoter in psychotic subjects. Further, there is reduced BDNF IXabcd mRNA expression, and an increase in 5-methylcytosine and 5-hydroxymethylcytosine at its promoter. On the basis of these results, we conclude that GADD45b may be increased in psychosis compensatory to its inability to access gene promoter regions. PMID:22048458

  9. A novel cis-acting element required for DNA damage-inducible expression of yeast DIN7

    SciTech Connect

    Yoshitani, Ayako; Yoshida, Minoru; Ling Feng

    2008-01-04

    Din7 is a DNA damage-inducible mitochondrial nuclease that modulates the stability of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae. How DIN7 gene expression is regulated, however, has remained largely unclear. Using promoter sequence alignment, we found a highly conserved 19-bp sequence in the promoter regions of DIN7 and NTG1, which encodes an oxidative stress-inducible base-excision-repair enzyme. Deletion of the 19-bp sequence markedly reduced the hydroxyurea (HU)-enhanced DIN7 promoter activity. In addition, nuclear fractions prepared from HU-treated cells were used in in vitro band shift assays to reveal the presence of currently unidentified trans-acting factor(s) that preferentially bound to the 19-bp region. These results suggest that the 19-bp sequence is a novel cis-acting element that is required for the regulation of DIN7 expression in response to HU-induced DNA damage.

  10. Growth factor independence-1 antagonizes a p53-induced DNA damage response pathway in lymphoblastic leukemia

    PubMed Central

    Khandanpour, Cyrus; Phelan, James D.; Vassen, Lothar; Schütte, Judith; Chen, Riyan; Horman, Shane R.; Gaudreau, Marie-Claude; Krongold, Joseph; Zhu, Jinfang; Paul, William E.; Dührsen, Ulrich; Göttgens, Bertie; Grimes, H. Leighton; Möröy, Tarik

    2013-01-01

    Summary Most patients with acute lymphoblastic leukemia (ALL) fail current treatments highlighting the need for better therapies. Since oncogenic signaling activates a p53-dependent DNA-damage response and apoptosis, leukemic cells must devise appropriate countermeasures. We show here that growth factor independence 1 (Gfi1) can serve such a function, since Gfi1 ablation exacerbates p53 responses, and lowers the threshold for p53-induced cell death. Specifically, Gfi1 restricts p53 activity and expression of pro-apoptotic p53 targets such as Bax, Noxa (Pmaip1) and Puma (Bbc3). Subsequently, Gfi1 ablation cures mice from leukemia and limits the expansion of primary human T-ALL xenografts in mice. This suggests that targeting Gfi1 could improve the prognosis of patients with T-ALL or other lymphoid leukemias. PMID:23410974

  11. Paricalcitol may improve oxidative DNA damage on experimental amikacin-induced nephrotoxicity model.

    PubMed

    Bulut, Gulay; Basbugan, Yildiray; Ari, Elif; Erten, Remzi; Bektas, Havva; Alp, Hamit Hakan; Bayram, Irfan

    2016-06-01

    This study aimed to investigate the possible protective effect of paricalcitol on experimental amikacin-induced nephrotoxicity model in rats. Wistar albino rats (n = 32) were allocated into four equal groups of eight each, the control (Group C), paricalcitol (Group P), amikacin-induced nephrotoxicity (Group A), and paricalcitol-treated amikacin-induced nephrotoxicity (Group A + P) groups. Paricalcitol was given intra-peritoneally at a dose of 0.4 μg/kg/d for 5 consecutive days prior to induction of amikacin-induced nephrotoxicity. Intra-peritoneal amikacin (1.2 g/kg) was used to induce nephrotoxicity at day 4. Renal function parameters, oxidative stress biomarkers, oxidative DNA damage (8-hydroxy-2'-deoxyguanosine/deoxyguanosine ratio), kidney histology, and vascular endothelial growth factor (VEGF) immunoexpression were determined. Group A + P had lower mean fractional sodium excretion (p < 0.001) as well as higher creatinine clearance (p = 0.026) than the amikacin group (Group A). Renal tissue malondialdehyde levels (p = 0.035) and serum 8-hydroxy-2'-deoxyguanosine/deoxyguanosine ratio (8-OHdG/dG ratio) (p < 0.001) were significantly lower; superoxide dismutase (p = 0.024) and glutathione peroxidase (p = 0.007) activities of renal tissue were significantly higher in group A + P than in group A. The mean scores of tubular necrosis (p = 0.024), proteinaceous casts (p = 0.038), medullary congestion (p = 0.035), and VEGF immunoexpression (p = 0.018) were also lower in group A + P when compared with group A. This study demonstrates the protective effect of paricalcitol in the prevention of amikacin-induced nephrotoxicity in an experimental model. Furthermore, it is the first study to demonstrate that paricalcitol improves oxidative DNA damage in an experimental acute kidney injury model. PMID:26983906

  12. Metallothionein blocks oxidative DNA damage induced by acute inorganic arsenic exposure

    SciTech Connect

    Qu, Wei Waalkes, Michael P.

    2015-02-01

    We studied how protein metallothionein (MT) impacts arsenic-induced oxidative DNA damage (ODD) using cells that poorly express MT (MT-I/II double knockout embryonic cells; called MT-null cells) and wild-type (WT) MT competent cells. Arsenic (as NaAsO{sub 2}) was less cytolethal over 24 h in WT cells (LC{sub 50} = 11.0 ± 1.3 μM; mean ± SEM) than in MT-null cells (LC{sub 50} = 5.6 ± 1.2 μM). ODD was measured by the immuno-spin trapping method. Arsenic (1 or 5 μM; 24 h) induced much less ODD in WT cells (121% and 141% of control, respectively) than in MT-null cells (202% and 260%). In WT cells arsenic caused concentration-dependent increases in MT expression (transcript and protein), and in the metal-responsive transcription factor-1 (MTF-1), which is required to induce the MT gene. In contrast, basal MT levels were not detectable in MT-null cells and unaltered by arsenic exposure. Transfection of MT-I gene into the MT-null cells markedly reduced arsenic-induced ODD levels. The transport genes, Abcc1 and Abcc2 were increased by arsenic in WT cells but either showed no or very limited increases in MT-null cells. Arsenic caused increases in oxidant stress defense genes HO-1 and GSTα2 in both WT and MT-null cells, but to much higher levels in WT cells. WT cells appear more adept at activating metal transport systems and oxidant response genes, although the role of MT in these responses is unclear. Overall, MT protects against arsenic-induced ODD in MT competent cells by potential sequestration of scavenging oxidant radicals and/or arsenic. - Highlights: • Metallothionein blocks arsenic toxicity. • Metallothionein reduces arsenic-induced DNA damage. • Metallothionein may bind arsenic or radicals produced by arsenic.

  13. Aluminium-induced DNA damage and adaptive response to genotoxic stress in plant cells are mediated through reactive oxygen intermediates.

    PubMed

    Murali Achary, V Mohan; Panda, Brahma B

    2010-03-01

    Experiments employing growing root cells of Allium cepa were conducted with a view to elucidate the role of reactive oxygen intermediates (ROI) in aluminium (Al)-induced DNA damage, cell death and adaptive response to genotoxic challenge imposed by ethyl methanesulphonate (EMS) or methyl mercuric chloride (MMCl). In a first set of experiments, root cells in planta were treated with Al at high concentrations (200-800 microM) for 3 h without or with pre-treatments of dihydroxybenzene disulphonic acid (Tiron) and dimethylthiourea (DMTU) for 2 h that trap O(2)(.-)and hydrogen peroxide (H(2)O(2)), respectively. At the end of treatments, generation of O(2)(.-) and H(2)O(2), cell death and DNA damage were determined. In a second set of experiments, root cells in planta were conditioned by Al at low concentrations (5 or 10 microM) for 2 h and after a 2 h intertreatment interval challenged by MMCl or EMS for 3 h without or with a pre-treatment of Tiron or DMTU. Conditioning treatments, in addition, included two oxidative agents viz rose bengal and H(2)O(2) for comparison. Following treatments, root cells in planta were allowed to recover in tap water. Genotoxicity and DNA damage were evaluated by micronucleus (MN), chromosome aberration (CA) or spindle aberration (SA) and comet assays at different hours (0-30 h) of recovery. The results demonstrated that whereas Al at high concentrations induced DNA damage and cell death, in low concentrations induced adaptive response conferring genomic protection from genotoxic challenge imposed by MMCl, EMS and Al. Pre-treatments of Tiron and DMTU prevented Al-induced DNA damage, cell death, as well as genotoxic adaptation to MMCl and EMS, significantly. The findings underscored the biphasic (hormetic) mode of action of Al that at high doses induced DNA damage and at low non-toxic doses conferred genomic protection, both of which were mediated through ROI but perhaps involving different networks. PMID:19955331

  14. Electromagnetic noise inhibits radiofrequency radiation-induced DNA damage and reactive oxygen species increase in human lens epithelial cells

    PubMed Central

    Wu, Wei; Wang, KaiJun; Ni, Shuang; Ye, PanPan; Yu, YiBo; Ye, Juan; Sun, LiXia

    2008-01-01

    Purpose The goal of this study was to investigate whether superposing of electromagnetic noise could block or attenuate DNA damage and intracellular reactive oxygen species (ROS) increase of cultured human lens epithelial cells (HLECs) induced by acute exposure to 1.8 GHz radiofrequency field (RF) of the Global System for Mobile Communications (GSM). Methods An sXc-1800 RF exposure system was used to produce a GSM signal at 1.8 GHz (217 Hz amplitude-modulated) with the specific absorption rate (SAR) of 1, 2, 3, and 4 W/kg. After 2 h of intermittent exposure, the ROS level was assessed by the fluorescent probe, 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). DNA damage to HLECs was examined by alkaline comet assay and the phosphorylated form of histone variant H2AX (γH2AX) foci formation assay. Results After exposure to 1.8 GHz RF for 2 h, HLECs exhibited significant intracellular ROS increase in the 2, 3, and 4 W/kg groups. RF radiation at the SAR of 3 W/kg and 4 W/kg could induce significant DNA damage, examined by alkaline comet assay, which was used to detect mainly single strand breaks (SSBs), while no statistical difference in double strand breaks (DSBs), evaluated by γH2AX foci, was found between RF exposure (SAR: 3 and 4 W/kg) and sham exposure groups. When RF was superposed with 2 μT electromagnetic noise could block RF-induced ROS increase and DNA damage. Conclusions DNA damage induced by 1.8 GHz radiofrequency field for 2 h, which was mainly SSBs, may be associated with the increased ROS production. Electromagnetic noise could block RF-induced ROS formation and DNA damage. PMID:18509546

  15. Damage proneness induced by genomic DNA demethylation in mammalian cells cultivated in vitro.

    PubMed

    Perticone, P; Gensabella, G; Cozzi, R

    1997-07-01

    Variations in the genomic DNA methylation level have been shown to be an epigenetic inheritable modification affecting, among other targets, the sister chromatid exchange (SCE) rate in mammalian cells in vitro. The inheritable increase in SCE rate in affected cell populations appears as a puzzling phenomenon in view of the well established relation between SCE and both mutagenesis and carcinogenesis. In the present work we demonstrate that, in a treated cell population, demethylation could be responsible for the inheritable induction of damage proneness affecting both damage induction and repair. Normal and ethionine or azacytidine treated Chinese hamster ovary cells, subclone K1 (CHO-K1), were challenged with UV light (UV) or mitomycin-C (MMC) at different times from the demethylating treatment. The SCE rate was measured with two main objects in view: (i) the induction of synergism or additivity in combined treatments, where mutagen (UV or MMC) pulse is supplied from 0 to 48 h after the end of the demethylating treatment; and (ii) the pattern of damage extinction, for the duration of up to six cell cycles after the end of the combined (demethylating agent + mutagen) treatment. Results indicate both a synergism in SCE induction by mutagens in demethylated cells even if supplied up to four cell cycles after the end of the demethylation treatment and a delay in recovery of induced damage, compared with normally methylated cells. These data are discussed in the light of the supposed mechanism of SCE increase and of the possible biological significance in terms of mutagenesis and carcinogenesis. PMID:9237771

  16. DNA damage-inducible genes as biomarkers for exposures to environmental agents.

    PubMed Central

    Johnson, N F; Carpenter, T R; Jaramillo, R J; Liberati, T A

    1997-01-01

    A biodosimetric approach to determine alpha-particle dose to the respiratory tract epithelium from known exposures to radon has been developed in the rat. Cytotoxicity assays have been used to obtain dose-conversion factors for cumulative exposures typical of those encountered by underground uranium miners. However, this approach is not sensitive enough to derive dose-conversion factors for indoor radon exposures. The expression of DNA damage-inducible genes is being investigated as a biomarker of exposure to radon progeny. Exposure of cultures of A549 cells to alpha particles resulted in an increase in the protein levels of the DNA damage-inducible genes, p53, Cip1, and Gadd45. These protein changes were associated with a transient arrest of cells passing through the cell cycle. This arrest was typified by an increase in the number of cells in the G1 and G2 phases and a decrease in the number of cells in the S phase. The effect of inhaled alpha particles (radon progeny) in rats was examined in the epithelial cells of the lateral well of the anterior nasal cavity. Exposures to radon progeny resulted in a significant increase in the number of cells in the G1 phase and a decrease in the number of cells in the S phase. These cell-cycle changes were concomitant with an increase in the number of cells containing DNA strand breaks. These results suggest a commonality between cell-cycle events in vitro and in vivo following exposure to ionizing radiation. In addition to ionizing radiation, A549 cells were exposed to 4-nitroquinoline-1-oxide, methyl methanesulphonate, crocidolite asbestos, and glass microfiber. These studies showed that physical and chemical agents induce different expression patterns of p53, Cip1, and Gadd153 proteins and they could be used to discriminate between toxic and nontoxic materials such as asbestos and glass microfiber. The measurement of gene expression in A549 cells may provide a means to identify a broad spectrum of physical and chemical

  17. Induction of innate immune gene expression following methyl methanesulfonate-induced DNA damage in sea urchins.

    PubMed

    Reinardy, H C; Chapman, J; Bodnar, A G

    2016-02-01

    Sea urchins are noted for the absence of neoplastic disease and represent a novel model to investigate cellular and systemic cancer protection mechanisms. Following intracoelomic injection of the DNA alkylating agent methyl methanesulfonate, DNA damage was detected in sea urchin cells and tissues (coelomocytes, muscle, oesophagus, ampullae and gonad) by the alkaline unwinding, fast micromethod. Gene expression analyses of the coelomocytes indicated upregulation of innate immune markers, including genes involved in NF-κB signalling. Results suggest that activation of the innate immune system following DNA damage may contribute to the naturally occurring resistance to neoplastic disease observed in sea urchins. PMID:26911343

  18. Nucleotide Excision Repair Factor XPC Enhances DNA Damage-Induced Apoptosis by Downregulating the Antiapoptotic Short Isoform of Caspase-2

    PubMed Central

    Wang, Qi-En; Han, Chunhua; Zhang, Bo; Sabapathy, Kanaga; Wani, Altaf A.

    2012-01-01

    XPC protein is a critical DNA damage recognition factor in nucleotide excision repair (NER) for which genetic deficiency confers a predisposition to cancer. In this study we demonstrate that XPC has a function that is independent of its canonical function in DNA repair, potentially altering the interpretation of how XPC deficiency leads to heightened cancer susceptibility. XPC enhances apoptosis induced by DNA damage in a p53 nullizygous background, acting downstream of mitochondrial permeabilization and upstream of caspase-9 activation in the DNA damage-induced apoptosis cascade. We found that deficiency in XPC upregulated production of the short isoform of caspase-2 (casp-2S). This upregulation occurred at both protein and mRNA levels through repression of the caspase-2 promoter by XPC protein. Targeted RNAi-mediated downregulation of casp-2S enhanced UV-induced apoptosis as well as activation of caspase-9 and caspase-6 in XPC-deficient cells, but not in XPC-proficient cells. In addition, XPC overexpression in various p53-deficient cancer cells resistant to cisplatin improved their sensitivity to cisplatin-induced apoptosis. Given that casp-2S functions as an anti-apoptotic protein, our findings suggest that XPC enhances DNA damage-induced apoptosis through inhibition of casp-2S transcription. Together, these findings offer a mechanistic foundation to overcome the resistance of highly prevalent p53-deficient tumors to cell death induced by DNA-damaging therapeutic agents, by targeting strategies that inhibit the expression or function of casp-2S. PMID:22174370

  19. Induction and persistence of radiation-induced DNA damage is more pronounced in young animals than in old animals

    PubMed Central

    Hudson, Darryl; Kovalchuk, Igor; Koturbash, Igor; Kolb, Bryan; Martin, Olga A.; Kovalchuk, Olga

    2011-01-01

    Younger individuals are more prone to develop cancer upon ionizing radiation (IR) exposure. Radiation-induced tumors are associated with inefficient repair of IR-induced DNA damage and genome instability. Phosphorylation of histone H2AX (γ-H2AX) is the initial event in repair of IR-induced DNA damage on the chromatin flanking the DNA strand breaks. This step is crucially important for the repair of DNA strand breaks and for the maintenance of genome stability. We studied the molecular underpinnings of the age-related IR effects using an animal model. By assaying for IR-induced γ-H2AX foci we analyzed the induction and repair of the DNA strand breaks in spleen, thymus, liver, lung, kidney, cerebellum, hippocampus, frontal cortex and olfactory bulb of 7, 14, 24, 30 and 45 days old male and female mice as a function of age. We demonstrate that tissues of younger animals are much more susceptible to IR-induced DNA damage. Younger animals exhibited higher levels of γ-H2AX formation which partially correlated with cellular proliferation and expression of DNA repair proteins. Induction and persistence of γ-H2AX foci was the highest in lymphoid organs (thymus and spleen) of 7 and 14 day old mice. The lowest focal induction was seen in lung and brain of young animals. The mechanisms of cell and tissue-specificity of in vivo IR responses need to be further dissected. This study provides a roadmap for the future analyses of DNA damage and repair induction in young individuals. PMID:21685513

  20. Base excision repair of ionizing radiation-induced DNA damage in G1 and G2 cell cycle phases

    PubMed Central

    Chaudhry, M Ahmad

    2007-01-01

    Background Major genomic surveillance mechanisms regulated in response to DNA damage exist at the G1/S and G2/M checkpoints. It is presumed that these delays provide time for the repair of damaged DNA. Cells have developed multiple DNA repair pathways to protect themselves from different types of DNA damage. Oxidative DNA damage is processed by the base excision repair (BER) pathway. Little is known about the BER of ionizing radiation-induced DNA damage and putative heterogeneity of BER in the cell cycle context. We measured the activities of three BER enzymes throughout the cell cycle to investigate the cell cycle-specific repair of ionizing radiation-induced DNA damage. We further examined BER activities in G2 arrested human cells after exposure to ionizing radiation. Results Using an in vitro incision assay involving radiolabeled oligonucleotides with specific DNA lesions, we examined the activities of several BER enzymes in the whole cell extracts prepared from synchronized human HeLa cells irradiated in G1 and G2 phase of the cell cycle. The activities of human endonuclease III (hNTH1), a glycosylase/lyase that removes several damaged bases from DNA including dihydrouracil (DHU), 8-oxoguanine-DNA glycosylase (hOGG1) that recognizes 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxoG) lesion and apurinic/apyrimidinic endonuclease (hAPE1) that acts on abasic sites including synthetic analog furan were examined. Conclusion Overall the repair activities of hNTH1 and hAPE1 were higher in the G1 compared to G2 phase of the cell cycle. The percent cleavages of oligonucleotide substrate with furan were greater than substrate with DHU in both G1 and G2 phases. The irradiation of cells enhanced the cleavage of substrates with furan and DHU only in G1 phase. The activity of hOGG1 was much lower and did not vary within the cell cycle. These results demonstrate the cell cycle phase dependence on the BER of ionizing radiation-induced DNA damage. Interestingly no evidence of

  1. Antiapoptotic effects of roscovitine on camptothecin-induced DNA damage in neuroblastoma cells.

    PubMed

    Pizarro, Javier G; Folch, Jaume; Junyent, Felix; Verdaguer, Ester; Auladell, Carme; Beas-Zarate, Carlos; Pallàs, Mercè; Camins, Antoni

    2011-05-01

    In the present study dopaminergic neuroblastoma B65 cells were exposed to Camptothecin (CPT) (0.5-10 μM), either alone or in the presence of roscovitine (ROSC). The results show that CPT induces apoptosis through the activation of ataxia telangiectasia mutated (ATM)-induced cell-cycle alteration in neuroblastoma B65 cells. The apoptotic process is mediated through the activation of cystein proteases, namely calpain/caspases. However, whereas a pan-caspase inhibitor, zVADfmk, inhibited CPT-mediated apoptosis, a calpain inhibitor, calpeptin, did not prevent cell death. Interestingly, CPT also induces CDK5 activation and ROSC (25 μM) blocked CDK5, ATM activation and apoptosis (as measured by caspase-3 activation). By contrast, selective inhibition of ATM, by KU55933, and non-selective inhibition, by caffeine, did not prevent CPT-mediated apoptosis. Thus, we conclude that CDK5 is activated in response to DNA damage and that CDK5 inhibition prevents ATM and p53ser15 activation. However, pharmacological inhibition of ATM using KU55933 and caffeine suggests that ATM inhibition by ROSC is not the only mechanism that might explain the anti-apoptotic effects of this drug in this apoptosis model. Our findings have a potential clinical implication, suggesting that combinatory drugs in the treatment of cancer activation should be administered with caution. PMID:21424556

  2. Mechanistic Modelling of DNA Repair and Cellular Survival Following Radiation-Induced DNA Damage.

    PubMed

    McMahon, Stephen J; Schuemann, Jan; Paganetti, Harald; Prise, Kevin M

    2016-01-01

    Characterising and predicting the effects of ionising radiation on cells remains challenging, with the lack of robust models of the underlying mechanism of radiation responses providing a significant limitation to the development of personalised radiotherapy. In this paper we present a mechanistic model of cellular response to radiation that incorporates the kinetics of different DNA repair processes, the spatial distribution of double strand breaks and the resulting probability and severity of misrepair. This model enables predictions to be made of a range of key biological endpoints (DNA repair kinetics, chromosome aberration and mutation formation, survival) across a range of cell types based on a set of 11 mechanistic fitting parameters that are common across all cells. Applying this model to cellular survival showed its capacity to stratify the radiosensitivity of cells based on aspects of their phenotype and experimental conditions such as cell cycle phase and plating delay (correlation between modelled and observed Mean Inactivation Doses R(2) > 0.9). By explicitly incorporating underlying mechanistic factors, this model can integrate knowledge from a wide range of biological studies to provide robust predictions and may act as a foundation for future calculations of individualised radiosensitivity. PMID:27624453

  3. DNA damage tolerance.

    PubMed

    Branzei, Dana; Psakhye, Ivan

    2016-06-01

    Accurate chromosomal DNA replication is fundamental for optimal cellular function and genome integrity. Replication perturbations activate DNA damage tolerance pathways, which are crucial to complete genome duplication as well as to prevent formation of deleterious double strand breaks. Cells use two general strategies to tolerate lesions: recombination to a homologous template, and trans-lesion synthesis with specialized polymerases. While key players of these processes have been outlined, much less is known on their choreography and regulation. Recent advances have uncovered principles by which DNA damage tolerance is regulated locally and temporally - in relation to replication timing and cell cycle stage -, and are beginning to elucidate the DNA dynamics that mediate lesion tolerance and influence chromosome structure during replication. PMID:27060551

  4. Selenite induces DNA damage and specific mitochondrial degeneration in human bladder cancer cells.

    PubMed

    Řezáčová, K; Čáňová, K; Bezrouk, A; Rudolf, E

    2016-04-01

    We have investigated the cytotoxicity and specific effects of selenite in human bladder cancer cell line RT-112 and its clonogenic variant RT-112 HB. Selenite inhibited cell growth and proliferation in both cell lines. Treated cells developed extensive vacuolization which was dose independent but occurring in differing time frames. Ultrastructure analysis revealed that the observed vacuoles are damaged mitochondria and potentially other subcellular compartments. Selenite-specific effects on mitochondria were further confirmed by mitochondrial membrane potential analysis, changes in ATP production and generation of superoxide. Simultaneously, selenite induced DNA damage in treated cells with activation of p53, PARP-1 and JNK and suppressed autophagy. Cells ultimately died via a combination of apoptosis, necrosis and a distinct type of cell death featuring "vacuolar shrinkage", loss of adherence and absence of secondary necrosis as well as other classical markers of either apoptosis or autophagy. The significant presence of so called necroptosis was also not confirmed as the specific inhibitor necrostatin-1 could not prevent cell death. These results thus confirm the toxicity of selenite in bladder cancer cells while pointing at potentially new mechanism of action of this compound in this model. PMID:26718266

  5. Protective effects of antioxidants against UVA-induced DNA damage in human skin fibroblasts in culture.

    PubMed

    Emonet-Piccardi, N; Richard, M J; Ravanat, J L; Signorini, N; Cadet, J; Béani, J C

    1998-10-01

    Ultraviolet A radiation (UVA, 320-400 nm) is mutagenic and induces genomic damage to skin cells. N-acetyl-cysteine (NAC), selenium and zinc have been shown to have antioxidant properties and to exhibit protective effects against UVA cytotoxicity. The present work attempts to delineate the effect of these compounds on genomic integrity of human skin fibroblasts exposed to UVA radiation using the single cell gel electrophoresis (SCGE) or Comet assay. The cells were incubated with NAC (5 mM), sodium selenite (0.6 microM) or zinc chloride (100 microM). Then cells were embedded in low melting point agarose, and immediately submitted to UVA fluences ranging from 1 to 6J/cm2. In the Comet assay, the tail moment increased by 45% (1 J/cm2) to 89% (6J/cm2) in non-supplemented cells (p)<0.01). DNA damage was significantly prevented by NAC, Se and Zn, with a similar efficiency from 1 to 4J/cm2 (p < 0.05). For the highest UVA dose (6J/cm2), Se and Zn were more effective than NAC (p < 0.01). PMID:9860045

  6. Oxidative stress-induced DNA damage in the synovial cells of the temporomandibular joint in the rat.

    PubMed

    Yamaza, T; Masuda, K F; Atsuta, I; Nishijima, K; Kido, M A; Tanaka, T

    2004-08-01

    Synovial hyperplasia is a feature of degenerative temporomandibular joint (TMJ) disease. However, the mechanism by which hyperplasia progresses in the TMJ is unknown. Based on the hypothesis that the oxidative stress generated by mechanical loading causes degenerative changes in the TMJ synovium, we investigated the generation of the highly reactive species, peroxynitrite, and the occurrence of DNA damage in the synovium. After condylar hypermobility of rat TMJs, a marker of peroxynitrite, nitrotyrosine, was localized to the nuclei and cytoplasm of the synovial lining cells and fibroblasts in synovitis-induced TMJ. DNA single-strand breaks were found in the nuclei of the synovial cells only after enzyme treatment, whereas DNA double-strand breaks were not detected. These findings indicate that condylar hypermovement induces the proliferation of synovial cells, and suggest that oxidative stress leads to the progression of synovial hyperplasia via DNA damage of the synovial cells in TMJs after mechanical loading. PMID:15271970

  7. Use of molecular beacons for the rapid analysis of DNA damage induced by exposure to an atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Kurita, Hirofumi; Miyachika, Saki; Yasuda, Hachiro; Takashima, Kazunori; Mizuno, Akira

    2015-12-01

    A rapid method for evaluating the damage caused to DNA molecules upon exposure to plasma is demonstrated. Here, we propose the use of a molecular beacon for rapid detection of DNA strand breaks induced by atmospheric pressure plasma jet (APPJ) irradiation. Scission of the molecular beacon by APPJ irradiation leads to separation of the fluorophore-quencher pair, resulting in an increase in fluorescence that directly correlates with the DNA strand breaks. The results show that the increase in fluorescence intensity is proportional to the exposure time and the rate of fluorescence increase is proportional to the discharge power. This simple and rapid method allows the estimation of DNA damage induced by exposure to a non-thermal plasma.

  8. Use of molecular beacons for the rapid analysis of DNA damage induced by exposure to an atmospheric pressure plasma jet

    SciTech Connect

    Kurita, Hirofumi E-mail: mizuno@ens.tut.ac.jp; Miyachika, Saki; Yasuda, Hachiro; Takashima, Kazunori; Mizuno, Akira E-mail: mizuno@ens.tut.ac.jp

    2015-12-28

    A rapid method for evaluating the damage caused to DNA molecules upon exposure to plasma is demonstrated. Here, we propose the use of a molecular beacon for rapid detection of DNA strand breaks induced by atmospheric pressure plasma jet (APPJ) irradiation. Scission of the molecular beacon by APPJ irradiation leads to separation of the fluorophore-quencher pair, resulting in an increase in fluorescence that directly correlates with the DNA strand breaks. The results show that the increase in fluorescence intensity is proportional to the exposure time and the rate of fluorescence increase is proportional to the discharge power. This simple and rapid method allows the estimation of DNA damage induced by exposure to a non-thermal plasma.

  9. Modulating effects of pycnogenol® on oxidative stress and DNA damage induced by sepsis in rats.

    PubMed

    Taner, Gökçe; Aydın, Sevtap; Bacanlı, Merve; Sarıgöl, Zehra; Sahin, Tolga; Başaran, A Ahmet; Başaran, Nurşen

    2014-11-01

    The aim of this study was to evaluate the protective effects of Pycnogenol® (Pyc), a complex plant extract from the bark of French maritime pine, on oxidative stress parameters (superoxide dismutase (SOD), and glutathione peroxidase (GPx) activities and total glutathione (GSH) and malondialdehyde (MDA) levels), an inflammatory cytokine (tumor necrosis factor alpha (TNF-α) level) and also DNA damage in Wistar albino rats. Rats were treated with 100 mg/kg intraperitonally Pyc following the induction of sepsis by cecal ligation and puncture. The decreases in MDA levels and increases in GSH levels, and SOD and GPx activities were observed in the livers and kidneys of Pyc-treated septic rats. Plasma TNF-α level was found to be decreased in the Pyc-treated septic rats. In the lymphocytes, kidney, and liver tissue cells of the sepsis-induced rats, Pyc treatment significantly decreased the DNA damage and oxidative base damage using standard alkaline assay and formamidopyrimidine DNA glycosylase-modified comet assay, respectively. In conclusion, Pyc treatment might have a role in the prevention of sepsis-induced oxidative damage not only by decreasing DNA damage but also increasing the antioxidant status and DNA repair capacity in rats. PMID:24919414

  10. Effects of Antidepressants on DSP4/CPT-Induced DNA Damage Response in Neuroblastoma SH-SY5Y Cells.

    PubMed

    Wang, Yan; Hilton, Benjamin A; Cui, Kui; Zhu, Meng-Yang

    2015-08-01

    DNA damage is a form of cell stress and injury. Increased systemic DNA damage is related to the pathogenic development of neurodegenerative diseases. Depression occurs in a relatively high percentage of patients suffering from degenerative diseases, for whom antidepressants are often used to relieve depressive symptoms. However, few studies have attempted to elucidate why different groups of antidepressants have similar effects on relieving symptoms of depression. Previously, we demonstrated that neurotoxins N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine (DSP4)- and camptothecin (CPT) induced the DNA damage response in SH-SY5Y cells, and DSP4 caused cell cycle arrest which was predominately in the S-phase. The present study shows that CPT treatment also resulted in similar cell cycle arrest. Some classic antidepressants could reduce the DNA damage response induced by DSP4 or CPT in SH-SY5Y cells. Cell viability examination demonstrated that both DSP4 and CPT caused cell death, which was prevented by spontaneous administration of some tested antidepressants. Flow cytometric analysis demonstrated that a majority of the tested antidepressants protect cells from being arrested in S-phase. These results suggest that blocking the DNA damage response may be an important pharmacologic characteristic of antidepressants. Exploring the underlying mechanisms may allow for advances in the effort to improve therapeutic strategies for depression appearing in degenerative and psychiatric diseases. PMID:26038195

  11. VRK1 chromatin kinase phosphorylates H2AX and is required for foci formation induced by DNA damage.

    PubMed

    Salzano, Marcella; Sanz-García, Marta; Monsalve, Diana M; Moura, David S; Lazo, Pedro A

    2015-01-01

    All types of DNA damage cause a local alteration and relaxation of chromatin structure. Sensing and reacting to this initial chromatin alteration is a necessary trigger for any type of DNA damage response (DDR). In this context, chromatin kinases are likely candidates to participate in detection and reaction to a locally altered chromatin as a consequence of DNA damage and, thus, initiate the appropriate cellular response. In this work, we demonstrate that VRK1 is a nucleosomal chromatin kinase and that its depletion causes loss of histones H3 and H4 acetylation, which are required for chromatin relaxation, both in basal conditions and after DNA damage, independently of ATM. Moreover, VRK1 directly and stably interacts with histones H2AX and H3 in basal conditions. In response to DNA damage induced by ionizing radiation, histone H2AX is phosphorylated in Ser139 by VRK1. The phosphorylation of H2AX and the formation of γH2AX foci induced by ionizing radiation (IR), are prevented by VRK1 depletion and are rescued by kinase-active, but not kinase-dead, VRK1. In conclusion, we found that VRK1 is a novel chromatin component that reacts to its alterations and participates very early in DDR, functioning by itself or in cooperation with ATM. PMID:25923214

  12. Ionizing Radiation-Induced DNA Damage and Its Repair in Human Cells

    SciTech Connect

    Dizdaroglu, Miral

    1999-05-12

    DNA damage in mammalian chromatin in vitro and in cultured mammalian cells including human cells was studied. In the first phase of these studies, a cell culture laboratory was established. Necessary equipment including an incubator, a sterile laminar flow hood and several centrifuges was purchased. We have successfully grown several cell lines such as murine hybridoma cells, V79 cells and human K562 leukemia cells. This was followed by the establishment of a methodology for the isolation of chromatin from cells. This was a very important step, because a routine and successful isolation of chromatin was a prerequisite for the success of the further studies in this project, the aim of which was the measurement of DNA darnage in mammalian chromatin in vitro and in cultured cells. Chromatin isolation was accomplished using a slightly modified procedure of the one described by Mee & Adelstein (1981). For identification and quantitation of DNA damage in cells, analysis of chromatin was preferred over the analysis of "naked DNA" for the following reasons: i. DNA may not be extracted efficiently from nucleoprotein in exposed cells, due to formation of DNA-protein cross-links, ii. the extractability of DNA is well known to decrease with increasing doses of radiation, iii. portions of DNA may not be extracted due to fragmentation, iv. unextracted DNA may contain a significant portion of damaged DNA bases and DNA-protein cross-links. The technique of gas chromatography/mass spectrometry (GC/MS), which was used in the present project, permits the identification and quantitation of modified DNA bases in chromatin in the presence of proteins without the necessity of first isolating DNA from chromatin. This has been demonstrated previously by the results from our laboratory and by the results obtained during the course of the present project. The quality of isolated chromatin was tested by measurement of its content of DNA, proteins, and RNA, by analysis of its protein

  13. Telomere-related functions of yeast KU in the repair of bleomycin-induced DNA damage.

    PubMed

    Tam, Angela T Y; Pike, Brietta L; Hammet, Andrew; Heierhorst, Jörg

    2007-06-01

    Bleomycins are small glycopeptide cancer chemotherapeutics that give rise to 3'-modified DNA double-strand breaks (DSBs). In Saccharomyces cerevisiae, DSBs are predominantly repaired by RAD52-dependent homologous recombination (HR) with some support by Yku70/Yku80 (KU)-dependent pathways. The main DSB repair function of KU is believed to be as part of the non-homologous end-joining (NHEJ) pathway, but KU also functions in a "chromosome healing" pathway that seals DSBs by de novo telomere addition. We report here that rad52Deltayku70Delta double mutants are considerably more bleomycin hypersensitive than rad52Deltalig4Delta cells that lack the NHEJ-specific DNA ligase 4. Moreover, the telomere-specific KU mutation yku80-135i also dramatically increases rad52Delta bleomycin hypersensitivity, almost to the level of rad52Deltayku80Delta. The results indicate that telomere-specific functions of KU play a more prominent role in the repair of bleomycin-induced damage than its NHEJ functions, which could have important clinical implications for bleomycin-based combination chemotherapies. PMID:17442269

  14. Combined metformin and resveratrol confers protection against UVC-induced DNA damage in A549 lung cancer cells via modulation of cell cycle checkpoints and DNA repair.

    PubMed

    Lee, Yong-Syu; Doonan, Barbara B; Wu, Joseph M; Hsieh, Tze-Chen

    2016-06-01

    Aging in humans is a multi-factorial cellular process that is associated with an increase in the risk of numerous diseases including diabetes, coronary heart disease and cancer. Aging is linked to DNA damage, and a persistent source of DNA damage is exposure to ultraviolet (UV) radiation. As such, identifying agents that confer protection against DNA damage is an approach that could reduce the public health burden of age-related disorders. Metformin and resveratrol have both shown effectiveness in preventing several age-related diseases; using human A549 cells, we investigated whether metformin or resveratrol, alone or combined, prevent UVC-induced DNA damage. We found that metformin inhibited UVC-induced upregulation of p53, as well as downregulated the expression of two DNA damage markers: γH2AX and p-chk2. Metformin also upregulated DNA repair as evidenced by the increase in expression of p53R2. Treatment with metformin also induced cell cycle arrest in UVC-induced cells, in correlation with a reduction in the levels of cyclin E/cdk2/Rb and cyclin B1/cdk1. Compared to metformin, resveratrol as a single agent showed less effectiveness in counteracting UVC-elicited cellular responses. However, resveratrol displayed synergism when combined with metformin as shown by the downregulation of p53/γH2AX/p-chk2. In conclusion, the results of the present study validate the effectiveness of metformin, alone or with the addition of resveratrol, in reducing the risk of aging by conferring protection against UV-induced DNA damage. PMID:27109601

  15. The role of dietary nucleotides in reduction of DNA damage induced by T-2 toxin and deoxynivalenol in chicken leukocytes.

    PubMed

    Frankic, T; Pajk, T; Rezar, V; Levart, A; Salobir, J

    2006-11-01

    The objective of present study was to determine the effect of T-2 toxin and deoxynivalenol (DON) on DNA fragmentation in spleen leukocytes and oxidative stress in chickens, and furthermore, to evaluate the potential of dietary nucleotides in reduction of toxin-induced DNA damage. Male broiler chickens were exposed to 10mg/kg feed of either T-2 toxin or DON with or without addition of dietary nucleotides. After 17 days of treatment DNA damage of spleen leukocytes was measured by Comet assay, lipid peroxidation was studied by malondialdehyde (MDA), total antioxidant status (TAS) of plasma and glutathione peroxidase (GPx) assays, and the hepatotoxicity was studied by measuring plasma liver enzyme levels (ALT, AST and GGT) levels. T-2 toxin and DON induced DNA fragmentation in chicken spleen leukocytes and supplementation with nucleotides reduced the amount of damage only when added to T-2 toxin. In comparison to control group, values of TAS and AST decreased significantly in the groups fed T-2 toxin with or without nucleotide supplementation. Plasma and liver MDA content in groups fed T-2 toxin and DON did not differ significantly from the control. Dietary nucleotides did not affect MDA formation when added to the diets with mycotoxins. The results obtained suggest that dietary nucleotides have the potency to reduce the extent of DNA damage induced by the action of T-2 toxin in immune cells. This underlines their possible beneficial effect on the immune system in mycotoxin intoxication. PMID:16875771

  16. Poly(ADP-ribosyl)ation of Apoptosis Antagonizing Transcription Factor Involved in Hydroquinone-Induced DNA Damage Response.

    PubMed

    Ling, Xiao Xuan; Liu, Jia Xian; Yun, Lin; DU, Yu Jun; Chen, Shao Qian; Chen, Jia Long; Tang, Huan Wen; Liu, Lin Hua

    2016-01-01

    The molecular mechanism of DNA damage induced by hydroquinone (HQ) remains unclear. Poly(ADP-ribose) polymerase-1 (PARP-1) usually works as a DNA damage sensor, and hence, it is possible that PARP-1 is involved in the DNA damage response induced by HQ. In TK6 cells treated with HQ, PARP activity as well as the expression of apoptosis antagonizing transcription factor (AATF), PARP-1, and phosphorylated H2AX (γ-H2AX) were maximum at 0.5 h, 6 h, 3 h, and 3 h, respectively. To explore the detailed mechanisms underlying the prompt DNA repair reaction, the above indicators were investigated in PARP-1-silenced cells. PARP activity and expression of AATF and PARP-1 decreased to 36%, 32%, and 33%, respectively, in the cells; however, γ-H2AX expression increased to 265%. Co-immunoprecipitation (co-IP) assays were employed to determine whether PARP-1 and AATF formed protein complexes. The interaction between these proteins together with the results from IP assays and confocal microscopy indicated that poly(ADP-ribosyl)ation (PARylation) regulated AATF expression. In conclusion, PARP-1 was involved in the DNA damage repair induced by HQ via increasing the accumulation of AATF through PARylation. PMID:26822515

  17. Effects of Spaceflight on Molecular and Cellular Responses to Bleomycin-induced DNA Damages in Confluent Human Fibroblasts

    NASA Astrophysics Data System (ADS)

    Lu, Tao; Wu, Honglu; Karouia, Fathi; Stodieck, Louis; Zhang, Ye; Wong, Michael

    2016-07-01

    Spaceflights expose human beings to various risk factors. Among them are microgravity related physiological stresses in immune, cytoskeletal, and cardiovascular systems, and space radiation related elevation of cancer risk. Cosmic radiation consists of energetic protons and other heavier charged particles that induce DNA damages. Effective DNA damage response and repair mechanism is important to maintain genomic integrity and reduce cancer risk. There were studies on effects of spaceflight and microgravity on DNA damage response in cell and animal models, but the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on molecular and cellular responses to DNA damages, bleomycin, an anti-cancer drug and radiomimetic reagent, was used to induce DNA damages in confluent human fibroblasts flown to the International Space Station (ISS) and on ground. After exposure to 1.0 mg/ml bleomycin for 3 hours, cells were fixed for immunofluorescence assays and for RNA preparation. Extents of DNA damages were quantified by focus pattern and focus number counting of phosphorylated histone protein H2AX (γg-H2AX). The cells on the ISS showed modestly increased average focus counts per nucleus while the distribution of patterns was similar to that on the ground. PCR array analysis showed that expressions of several genes, including CDKN1A and PCNA, were significantly changed in response to DNA damages induced by bleomycin in both flight and ground control cells. However, there were no significant differences in the overall expression profiles of DNA damage response genes between the flight and ground samples. Analysis of cellular proliferation status with Ki-67 staining showed a slightly higher proliferating population in cells on the ISS than those on ground. Our results suggested that the difference in γg-H2AX focus counts between flight and ground was due to the higher percentage of proliferating cells in space, but spaceflight did not

  18. Transgenic overexpression of neuroglobin attenuates formation of smoke-inhalation-induced oxidative DNA damage, in vivo, in the mouse brain.

    PubMed

    Lee, Heung Man; Greeley, George H; Englander, Ella W

    2011-12-15

    Acute inhalation of combustion smoke causes neurological deficits in survivors. Inhaled smoke includes carbon monoxide, noxious gases, and a hypoxic environment, which disrupt oxygenation and generate free radicals. To replicate a smoke-inhalation scenario, we developed an experimental model of acute exposure to smoke for the awake mouse/rat and detected induction of biomarkers of oxidative stress. These include inhibition of mitochondrial respiratory complexes and formation of oxidative DNA damage in the brain. DNA damage is likely to contribute to neuronal dysfunction and progression of brain injury. In the search for strategies to attenuate the smoke-initiated brain injury, we produced a transgenic mouse overexpressing the neuronal globin protein neuroglobin. Neuroglobin was neuroprotective in diverse models of ischemic/hypoxic/toxic brain injuries. Here, we report lesser inhibition of respiratory complex I and reduced formation of smoke-induced DNA damage in neuroglobin transgenic compared to wild-type mouse brain. DNA damage was assessed using the standard comet assay, as well as a modified comet assay done in conjunction with an enzyme that excises oxidized guanines that form readily under conditions of oxidative stress. Both comet assays revealed that overexpressed neuroglobin attenuates the formation of oxidative DNA damage, in vivo, in the brain. These findings suggest that elevated neuroglobin exerts neuroprotection, in part, by decreasing the impact of acute smoke inhalation on the integrity of neuronal DNA. PMID:22001746

  19. Autophagy and senescence, stress responses induced by the DNA-damaging mycotoxin alternariol.

    PubMed

    Solhaug, A; Torgersen, M L; Holme, J A; Lagadic-Gossmann, D; Eriksen, G S

    2014-12-01

    The mycotoxin alternariol (AOH), a frequent contaminant in fruit and grain, is known to induce cellular stress responses such as reactive oxygen production, DNA damage and cell cycle arrest. Cellular stress is often connected to autophagy, and we employed the RAW264.7 macrophage model to test the hypothesis that AOH induces autophagy. Indeed, AOH treatment led to a massive increase in acidic vacuoles often observed upon autophagy induction. Moreover, expression of the autophagy marker LC3 was markedly increased and there was a strong accumulation of LC3-positive puncta. Increased autophagic activity was verified biochemically by measuring the degradation rate of long-lived proteins. Furthermore, AOH induced expression of Sestrin2 and phosphorylation of AMPK as well as reduced phosphorylation of mTOR and S6 kinase, common mediators of signaling pathways involved in autophagy. Transmission electron microscopy analyzes of AOH treated cells not only clearly displayed structures associated with autophagy such as autophagosomes and autolysosomes, but also the appearance of lamellar bodies. Prolonged AOH treatment resulted in changed cell morphology from round into more star-shaped as well as increased β-galactosidase activity. This suggests that the cells eventually entered senescence. In conclusion, our data identify here AOH as an inducer of both autophagy and senescence. These effects are suggested to be to be linked to AOH-induced DSB (via a reported effect on topoisomerase activity), resulting in an activation of p53 and the Sestrin2-AMPK-mTOR-S6K signaling pathway. PMID:25456271

  20. Protection of radiation induced DNA and membrane damages by total triterpenes isolated from Ganoderma lucidum (Fr.) P. Karst.

    PubMed

    Smina, T P; Maurya, D K; Devasagayam, T P A; Janardhanan, K K

    2015-05-25

    The total triterpenes isolated from the fruiting bodies of Ganoderma lucidum was examined for its potential to prevent γ-radiation induced membrane damage in rat liver mitochondria and microsomes. The effects of total triterpenes on γ-radiation-induced DNA strand breaks in pBR 322 plasmid DNA in vitro and human peripheral blood lymphocytes ex vivo were evaluated. The protective effect of total triterpenes against γ-radiation-induced micronuclei formations in mice bone marrow cells in vivo were also evaluated. The results indicated the significant effectiveness of Ganoderma triterpenes in protecting the DNA and membrane damages consequent to the hazardous effects of radiation. The findings suggest the potential use of Ganoderma triterpenes in radio therapy. PMID:25824410

  1. Pulsewidth-dependent nature of laser-induced DNA damage in RPE cells

    NASA Astrophysics Data System (ADS)

    Hall, Rebecca M.; Glickman, Randolph D.; Rockwell, Benjamin A.; Kumar, Neeru; Noojin, Gary D.

    2001-07-01

    Ultrashort pulse laser radiation may produce cellular damage through unique mechanisms. Primary cultures of bovine retinal pigment epithelial (RPE) cells were exposed to the out put of a Ti:Sapphire laser producing 30 fs (mode-locked) pulses, 44 amplified fs pulses, or continuous wave exposures at 800 nm. Laser exposures at and below the damage threshold were studied. DNA damage was detected using single cell gel electrophoresis (comet assay). Unexposed (control) cells produced short tails with low tail moments. In contrast, all laser-exposed cells showed some degree of DNA fragmentation, but the size and shape of the resulting comets differed among the various modalities. CW-exposed cells produced generally light and relatively compact tails, suggesting fewer and larger DNA fragments, while mode-locked laser exposures (30 fs pulses) resulted in large and diffuse comets, indicating the DNA was fragmented into many very small pieces. Work is continuing to define the relationship of laser pulsewidth and intensity with the degree of DNA fragmentation. These results suggest that DNA damage may result from multiple mechanisms of laser-cell interaction, including multiphoton absorption.

  2. Inactivation of ATM/ATR DNA Damage Checkpoint Promotes Androgen Induced Chromosomal Instability in Prostate Epithelial Cells

    PubMed Central

    Chiu, Yung-Tuen; Liu, Ji; Tang, Kaidun; Wong, Yong-Chuan; Khanna, Kum Kum; Ling, Ming-Tat

    2012-01-01

    The ATM/ATR DNA damage checkpoint functions in the maintenance of genetic stability and some missense variants of the ATM gene have been shown to confer a moderate increased risk of prostate cancer. However, whether inactivation of this checkpoint contributes directly to prostate specific cancer predisposition is still unknown. Here, we show that exposure of non-malignant prostate epithelial cells (HPr-1AR) to androgen led to activation of the ATM/ATR DNA damage response and induction of cellular senescence. Notably, knockdown of the ATM gene expression in HPr-1AR cells can promote androgen-induced TMPRSS2: ERG rearrangement, a prostate-specific chromosome translocation frequently found in prostate cancer cells. Intriguingly, unlike the non-malignant prostate epithelial cells, the ATM/ATR DNA damage checkpoint appears to be defective in prostate cancer cells, since androgen treatment only induced a partial activation of the DNA damage response. This mechanism appears to preserve androgen induced autophosphorylation of ATM and phosphorylation of H2AX, lesion processing and repair pathway yet restrain ATM/CHK1/CHK2 and p53 signaling pathway. Our findings demonstrate that ATM/ATR inactivation is a crucial step in promoting androgen-induced genomic instability and prostate carcinogenesis. PMID:23272087

  3. Homocysteine thiolactone induces apoptotic DNA damage mediated by increased intracellular hydrogen peroxide and caspase 3 activation in HL-60 cells.

    PubMed

    Huang, R F; Huang, S M; Lin, B S; Wei, J S; Liu, T Z

    2001-05-11

    The cytotoxicity of homocysteine derivatives on chromosomal damage in somatic cells is not well established. The present study used reactive homocysteine derivative of homocysteine thiolactone (Hcy) to investigate its causal effect on apoptotic DNA injury in human promyeloid HL-60 cells. Our results demonstrated that Hcy induced cell death and features of apoptosis including increased phosphotidylserine exposure on the membrane surface, increased apoptotic cells with hypoploid DNA contents, and internucleosomal DNA fragmentation, all of which occurred in a time- and concentration-dependent manner. Hcy treatment also significantly increased intracellular reactive oxygen species H2O2, which coincided with the elimination of caspase 3 proenzyme levels and increased caspase 3 activity at the time of the appearance of apoptotic DNA fragmentation. Preincubation of Hcy-treated HL-60 cells with catalase completely scavenged intracellular H2O2, thus inhibiting caspase 3 activity and protecting cells from apoptotic DNA damage. In contrast, superoxide dismutase failed to inhibit Hcy-induced DNA damage. Taken together, these results demonstrate that Hcy exerted its genotoxic effects on HL-60 cells through an apoptotic pathway, which is mediated by the activation of caspase 3 activity induced by an increase in intracellular hydrogen peroxide. PMID:11432446

  4. Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo

    PubMed Central

    Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

    2014-01-01

    Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein. PMID:24583641

  5. Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.

    PubMed

    Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

    2014-06-01

    Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein. PMID:24583641

  6. Cantharidin induces DNA damage and inhibits DNA repair-associated protein levels in NCI-H460 human lung cancer cells.

    PubMed

    Hsia, Te-Chun; Lin, Ju-Hwa; Hsu, Shu-Chun; Tang, Nou-Ying; Lu, Hsu-Feng; Wu, Shin-Hwar; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-09-01

    Cantharidin is one of the major compounds from mylabris and it has cytotoxic effects in many different types of human cancer cells. Previously, we found that cantharidin induced cell death through cell cycle arrest and apoptosis induction in human lung cancer NCI-H460 cells. However, cantharidin-affected DNA damage, repair, and associated protein levels in NCI-H460 cells have not been examined. In this study, we determined whether cantharidin induced DNA damage and condensation and altered levels of proteins in NCI-H460 cells in vitro. Incubation of NCI-H460 cells with 0, 2.5, 5, 10, and 15 μM of cantharidin caused a longer DNA migration smear (comet tail). Cantharidin also increased DNA condensation. These effects were dose-dependent. Cantharidin (5, 10, and 15 μM) treatment of NCI-H460 cells reduced protein levels of ataxia telangiectasia mutated (ATM), breast cancer 1, early onset (BRCA-1), 14-3-3 proteins sigma (14-3-3σ), DNA-dependent serine/threonine protein kinase (DNA-PK), O(6) -methylguanine-DNA methyltransferase (MGMT), and mediator of DNA damage checkpoint protein 1 (MDC1). Protein translocation of p-p53, p-H2A.X (S140), and MDC1 from cytoplasm to nucleus was induced by cantharidin in NCI-H460 cells. Taken together, this study showed that cantharidin caused DNA damage and inhibited levels of DNA repair-associated proteins. These effects may contribute to cantharidin-induced cell death in vitro. PMID:24639390

  7. DNA damage induced by industrial solid waste leachates in Drosophila melanogaster: a mechanistic approach.

    PubMed

    Siddique, Hifzur R; Sharma, Anurag; Gupta, Subash C; Murthy, Ramesh C; Dhawan, Alok; Saxena, Daya K; Chowdhuri, Debapratim K

    2008-04-01

    Genomic stability requires that error-free genetic information be transmitted from generation to generation, a process that is dependent upon efficient DNA repair. Industrial leachates which contain mixtures of diverse chemicals are a major environmental concern. The interaction between these chemicals may have synergistic, antagonistic, or simply additive effects on biological systems. In the present study, the Comet assay was used to measure the DNA damage produced by leachates of solid wastes from flashlight battery, pigment, and tanning factories in the midgut cells and brain ganglia of Drosophila melanogaster mutants deficient in DNA repair proteins. Larvae were allowed to feed for 48 or 72 hr on diets containing 0.1, 0.5, and 2.0% (v/v) of the leachates. Physicochemical analysis run on the solid wastes, leachates, and treated larvae detected elevated levels of heavy metals. Leachates produced significantly greater levels of DNA damage in mutant strains mei41 (deficient in cell cycle check point protein), mus201 (deficient in excision repair protein), mus308 (deficient in postreplication repair protein), and rad54 (deficient in double strand break repair protein) than in the OregonR(+) wild-type strain. Larvae of the ligaseIV mutant (deficient in double strand break repair protein) were hypersensitive only to the pigment plant waste leachate. Conversely, the dnase2 mutant (deficient in protein responsible for degrading fragmented DNA) was more sensitive to DNA damage induction from the flashlight battery and tannery waste leachates. Our data demonstrate that repair of DNA damage in organisms exposed to leachates is dependent upon several DNA repair proteins, indicative of the involvement of multiple overlapping repair pathways. The study further suggests the usefulness of the Comet assay for studying the mechanisms of DNA repair in Drosophila. PMID:18240159

  8. Growth control switch by a DNA-damage-inducible toxin-antitoxin system in Caulobacter crescentus.

    PubMed

    Kirkpatrick, Clare L; Martins, Daniel; Redder, Peter; Frandi, Antonio; Mignolet, Johann; Chapalay, Julien Bortoli; Chambon, Marc; Turcatti, Gerardo; Viollier, Patrick H

    2016-01-01

    Bacterial toxin-antitoxin systems (TASs) are thought to respond to various stresses, often inducing growth-arrested (persistent) sub-populations of cells whose housekeeping functions are inhibited. Many such TASs induce this effect through the translation-dependent RNA cleavage (RNase) activity of their toxins, which are held in check by their cognate antitoxins in the absence of stress. However, it is not always clear whether specific mRNA targets of orthologous RNase toxins are responsible for their phenotypic effect, which has made it difficult to accurately place the multitude of TASs within cellular and adaptive regulatory networks. Here, we show that the TAS HigBA of Caulobacter crescentus can promote and inhibit bacterial growth dependent on the dosage of HigB, a toxin regulated by the DNA damage (SOS) repressor LexA in addition to its antitoxin HigA, and the target selectivity of HigB's mRNA cleavage activity. HigB reduced the expression of an efflux pump that is toxic to a polarity control mutant, cripples the growth of cells lacking LexA, and targets the cell cycle circuitry. Thus, TASs can have outcome switching activity in bacterial adaptive (stress) and systemic (cell cycle) networks. PMID:27572440

  9. Exposure to 50Hz-sinusoidal electromagnetic field induces DNA damage-independent autophagy.

    PubMed

    Shen, Yunyun; Xia, Ruohong; Jiang, Hengjun; Chen, Yanfeng; Hong, Ling; Yu, Yunxian; Xu, Zhengping; Zeng, Qunli

    2016-08-01

    As electromagnetic field (EMF) is commonly encountered within our daily lives, the biological effects of EMF are of great concern. Autophagy is a key process for maintaining cellular homeostasis, and it can also reveal cellular responses to environmental stimuli. In this study, we aim to investigate the biological effects of a 50Hz-sinusoidal electromagnetic field on autophagy and we identified its mechanism of action in Chinese Hamster Lung (CHL) cells. CHL cells were exposed to a 50Hz sinusoidal EMF at 0.4mT for 30min or 24h. In this study, we found that a 0.4mT EMF resulted in: (i) an increase in LC3-II expression and increased autophagosome formation; (ii) no significant difference in the incidence of γH2AX foci between the sham and exposure groups; (iii) reorganized actin filaments and increased pseudopodial extensions without promoting cell migration; and (iv) enhanced cell apoptosis when autophagy was blocked by Bafilomycin A1. These results implied that DNA damage was not directly involved in the autophagy induced by a 0.4mT 50Hz EMF. In addition, an EMF induced autophagy balanced the cellular homeostasis to protect the cells from severe adverse biological consequences. PMID:27177844

  10. Effect of aspirin on chromosome aberration and DNA damage induced by X-rays in mice

    NASA Astrophysics Data System (ADS)

    Niikawa, M.; Chuuriki, K.; Shibuya, K.; Seo, M.; Nagase, H.

    In order to reveal the anticlastogenic potency of aspirin, we evaluated the suppressive ability of aspirin on chromosome aberrations induced by X-ray. Aspirin at doses of 0.5, 5 and 50 mg/kg was administrated intraperitoneally or orally at 0.5 h after or before the X-ray irradiation. The anticlastogenic activity of aspirin on chromosome aberrations induced by X-ray was determined in the mouse micronucleus test and alkaline single cell gel electrophoresis (SCG) assay in vivo. The frequency by polychromatic erythrocytes with micronuclei (MNPCEs) was decreased by about 19-61% at 0.5 h after and about 23-62% at 0.5 h before the X-ray irradiation. DNA damage by X-ray was significantly decreased by oral administration of aspirin at 0.5 h after or before the X-ray irradiation for the SCG assay. We consider aspirin can be used as preventive agents against exposure of X-ray.

  11. Inhibition of autophagy enhances DNA damage-induced apoptosis by disrupting CHK1-dependent S phase arrest

    SciTech Connect

    Liou, Jong-Shian; Wu, Yi-Chen; Yen, Wen-Yen; Tang, Yu-Shuan; Kakadiya, Rajesh B.; Su, Tsann-Long; Yih, Ling-Huei

    2014-08-01

    DNA damage has been shown to induce autophagy, but the role of autophagy in the DNA damage response and cell fate is not fully understood. BO-1012, a bifunctional alkylating derivative of 3a-aza-cyclopenta[a]indene, is a potent DNA interstrand cross-linking agent with anticancer activity. In this study, BO-1012 was found to reduce DNA synthesis, inhibit S phase progression, and induce phosphorylation of histone H2AX on serine 139 (γH2AX) exclusively in S phase cells. Both CHK1 and CHK2 were phosphorylated in response to BO-1012 treatment, but only depletion of CHK1, but not CHK2, impaired BO-1012-induced S phase arrest and facilitated the entry of γH2AX-positive cells into G2 phase. CHK1 depletion also significantly enhanced BO-1012-induced cell death and apoptosis. These results indicate that BO-1012-induced S phase arrest is a CHK1-dependent pro-survival response. BO-1012 also resulted in marked induction of acidic vesicular organelle (AVO) formation and microtubule-associated protein 1 light chain 3 (LC3) processing and redistribution, features characteristic of autophagy. Depletion of ATG7 or co-treatment of cells with BO-1012 and either 3-methyladenine or bafilomycin A1, two inhibitors of autophagy, not only reduced CHK1 phosphorylation and disrupted S phase arrest, but also increased cleavage of caspase-9 and PARP, and cell death. These results suggest that cells initiate S phase arrest and autophagy as pro-survival responses to BO-1012-induced DNA damage, and that suppression of autophagy enhances BO-1012-induced apoptosis via disruption of CHK1-dependent S phase arrest. - Highlights: • Autophagy inhibitors enhanced the cytotoxicity of a DNA alkylating agent, BO-1012. • BO-1012-induced S phase arrest was a CHK1-dependent pro-survival response. • Autophagy inhibition enhanced BO-1012 cytotoxicity via disrupting the S phase arrest.

  12. DNA repair efficiency in germ cells and early mouse embryos and consequences for radiation-induced transgenerational genomic damage

    SciTech Connect

    Marchetti, Francesco; Wyrobek, Andrew J.

    2009-01-18

    Exposure to ionizing radiation and other environmental agents can affect the genomic integrity of germ cells and induce adverse health effects in the progeny. Efficient DNA repair during gametogenesis and the early embryonic cycles after fertilization is critical for preventing transmission of DNA damage to the progeny and relies on maternal factors stored in the egg before fertilization. The ability of the maternal repair machinery to repair DNA damage in both parental genomes in the fertilizing egg is especially crucial for the fertilizing male genome that has not experienced a DNA repair-competent cellular environment for several weeks prior to fertilization. During the DNA repair-deficient period of spermatogenesis, DNA lesions may accumulate in sperm and be carried into the egg where, if not properly repaired, could result in the formation of heritable chromosomal aberrations or mutations and associated birth defects. Studies with female mice deficient in specific DNA repair genes have shown that: (i) cell cycle checkpoints are activated in the fertilized egg by DNA damage carried by the sperm; and (ii) the maternal genotype plays a major role in determining the efficiency of repairing genomic lesions in the fertilizing sperm and directly affect the risk for abnormal reproductive outcomes. There is also growing evidence that implicates DNA damage carried by the fertilizing gamete as a mediator of postfertilization processes that contribute to genomic instability in subsequent generations. Transgenerational genomic instability most likely involves epigenetic mechanisms or error-prone DNA repair processes in the early embryo. Maternal and embryonic DNA repair processes during the early phases of mammalian embryonic development can have far reaching consequences for the genomic integrity and health of subsequent generations.

  13. L-tyrosine induces DNA damage in brain and blood of rats.

    PubMed

    De Prá, Samira D T; Ferreira, Gabriela K; Carvalho-Silva, Milena; Vieira, Júlia S; Scaini, Giselli; Leffa, Daniela D; Fagundes, Gabriela E; Bristot, Bruno N; Borges, Gabriela D; Ferreira, Gustavo C; Schuck, Patrícia F; Andrade, Vanessa M; Streck, Emilio L

    2014-01-01

    Mutations in the tyrosine aminotransferase gene have been identified to cause tyrosinemia type II which is inherited in an autosomal recessive manner. Studies have demonstrated that an excessive production of ROS can lead to reactions with macromolecules, such as DNA, lipids, and proteins. Considering that the L-tyrosine may promote oxidative stress, the main objective of this study was to investigate the in vivo effects of L-tyrosine on DNA damage determined by the alkaline comet assay, in brain and blood of rats. In our acute protocol, Wistar rats (30 days old) were killed 1 h after a single intraperitoneal L-tyrosine injection (500 mg/kg) or saline. For chronic administration, the animals received two subcutaneous injections of L-tyrosine (500 mg/kg, 12-h intervals) or saline administered for 24 days starting at postnatal day (PD) 7 (last injection at PD 31), 12 h after the last injection, the animals were killed by decapitation. We observed that acute administration of L-tyrosine increased DNA damage frequency and damage index in cerebral cortex and blood when compared to control group. Moreover, we observed that chronic administration of L-tyrosine increased DNA damage frequency and damage index in hippocampus, striatum, cerebral cortex and blood when compared to control group. In conclusion, the present work demonstrated that DNA damage can be encountered in brain from animal models of hypertyrosinemia, DNA alterations may represent a further means to explain neurological dysfunction in this inherited metabolic disorder and to reinforce the role of oxidative stress in the pathophysiology of tyrosinemia type II. PMID:24297753

  14. Sequence-specific DNA damage induced by ultraviolet A-irradiated folic acid via its photolysis product.

    PubMed

    Hirakawa, Kazutaka; Suzuki, Hiroyuki; Oikawa, Shinji; Kawanishi, Shosuke

    2003-02-15

    DNA damage mediated by photosensitizers participates in solar carcinogenesis. Fluorescence measurement and high-performance liquid chromatography analysis demonstrated that photoirradiated folic acid, one of the photosensitizers in cells, generates pterine-6-carboxylic acid (PCA). Experiments using 32P-labeled DNA fragments obtained from a human gene showed that ultraviolet A-irradiated folic acid or PCA caused DNA cleavage specifically at consecutive G residues in double-stranded DNA after Escherichia coli formamidopyrimidine-DNA glycosylase or piperidine treatment. The amount of 8-oxo-7,8-dihydro-2(')-deoxyguanosine formed through this DNA photoreaction in double-stranded DNA exceeded that in single-stranded DNA. Kinetic studies suggested that DNA damage is caused mainly by photoexcited PCA generated from folic acid rather than by folic acid itself. In conclusion, photoirradiated folic acid generates PCA, which induces DNA photooxidation specifically at consecutive G residues through electron transfer. Excess intake of folic acid supplements may increase a risk of skin cancer by solar ultraviolet light. PMID:12573286

  15. Manufactured silver nanoparticles of different sizes induced DNA strand breaks and oxidative DNA damage in hepatoma and leukaemia cells and in dermal and pulmonary fibroblasts.

    PubMed

    Ávalos, A; Haza, A I; Morales, P

    2015-01-01

    Many classes of silver nanoparticles (AgNPs) have been synthesized and widely applied, but no conclusive information on their potential cytotoxicity and genotoxicity mechanisms is available. Therefore, the purpose of this study was to compare the potential genotoxic effects (DNA strand breaks and oxidative DNA damage) of 4.7 nm coated and 42 nm uncoated AgNPs, using the comet assay, in four relevant human cell lines (hepatoma, leukaemia, and dermal and pulmonary fibroblasts) in order to understand the impact of such nanomaterials on cellular DNA. The results indicated that in all cell lines tested, 4.7 nm coated (0.1-1.6 μg ml⁻¹) and 42 nm uncoated (0.1-6.7 μg ml⁻¹) AgNPs increased DNA strand breaks in a dose- and size-dependent manner following 24 h treatment, the smaller AgNPs being more genotoxic. Human pulmonary fibroblasts showed the highest sensitivity to the AgNPs. A modified comet assay using endonuclease III and formamidopyrimidine- DNA glycosylase restriction enzymes showed that in tumoral and normal human dermal fibroblasts, pyrimidines and purines were oxidatively damaged by both AgNPs, but the damage was not size-dependent. However, in human pulmonary fibroblasts, no oxidative damage was observed after treatment with 42 nm AgNPs. In conclusion, both AgNP sizes induced DNA damage in human cells, and this damage could be related to oxidative stress. PMID:25958309

  16. The impact of lymphocyte isolation on induced DNA damage in human blood samples measured by the comet assay.

    PubMed

    Bausinger, Julia; Speit, Günter

    2016-09-01

    The comet assay is frequently used in human biomonitoring for the detection of exposure to genotoxic agents. Peripheral blood samples are most frequently used and tested either as whole blood or after isolation of lymphocytes (i.e. peripheral blood mononuclear cells, PBMC). To investigate a potential impact of lymphocyte isolation on induced DNA damage in human blood samples, we exposed blood ex vivo to mutagens with different modes of genotoxic action. The comet assay was performed either directly with whole blood at the end of the exposure period or with lymphocytes isolated directly after exposure. In addition to the recommended standard protocol for lymphocyte isolation, a shortened protocol was established to optimise the isolation procedure. The results indicate that the effects of induced DNA strand breaks and alkali-labile sites induced by ionising radiation and alkylants, respectively, are significantly reduced in isolated lymphocytes. In contrast, oxidative DNA base damage (induced by potassium bromate) and stable bulky adducts (induced by benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide; BPDE) seem to be less affected. Our findings suggest that in vivo-induced DNA damage might also be reduced in isolated lymphocytes in comparison with the whole blood depending of the types of DNA damage induced. Because only small genotoxic effects can generally be expected in human biomonitoring studies with the comet assay after occupational and environmental exposure to genotoxic agents, any loss might be relevant and should be avoided. The possibility of such effects and their potential impact on variability of comet assay results in human biomonitoring should be considered when performing or evaluating such kind of studies. PMID:27154923

  17. Analogs of the novel phytohormone, strigolactone, trigger apoptosis and synergize with PARP inhibitors by inducing DNA damage and inhibiting DNA repair

    PubMed Central

    Ryan, Colin P.; Wang, Victor S.; Lapier, Jennifer; Schlarbaum, Jamie P.; Dayani, Yaron; Artuso, Emma; Prandi, Cristina; Koltai, Hinanit; Agama, Keli; Pommier, Yves; Chen, Yu; Tricoli, Lucas; LaRocque, Jeannine R.; Albanese, Christopher; Yarden, Ronit I.

    2016-01-01

    Strigolactones are a novel class of plant hormones produced in roots that regulate shoot and root development. We previously reported that strigolactone analogs (SLs) induce G2/M cell cycle arrest and apoptosis in a variety of human cancer cells and inhibit tumor growth of human breast cancer xenografts in mice. SLs had no significant influences on non-transformed cells. Here we report for the first time that SLs induce DNA damage in the form of DNA double-strand breaks (DSBs) and activate the DNA damage response signaling by inducing phosphorylation of ATM, ATR and DNA-PKcs and co-localization of the DNA damage signaling protein, 53BP1, with γH2AX nuclear foci. We further report that in addition to DSBs induction, SLs simultaneously impair DSBs repair, mostly homology-directed repair (HDR) and to a lesser extent non-homologous end joining (NHEJ). In response to SLs, RAD51, the homologous DSB repair protein, is ubiquitinated and targeted for proteasomal degradation and it fails to co-localize with γH2AX foci. Interestingly, SLs synergize with DNA damaging agents-based therapeutics. The combination of PARP inhibitors and SLs showed an especially potent synergy, but only in BRCA1-proficient cells. No synergy was observed between SLs and PARP inhibitors in BRCA1-deficient cells, supporting a role for SLs in HDR impairment. Together, our data suggest that SLs increase genome instability and cell death by a unique mechanism of inducing DNA damage and inhibiting DNA repair. PMID:26910887

  18. Analogs of the novel phytohormone, strigolactone, trigger apoptosis and synergize with PARP inhibitors by inducing DNA damage and inhibiting DNA repair.

    PubMed

    Croglio, Michael P; Haake, Jefferson M; Ryan, Colin P; Wang, Victor S; Lapier, Jennifer; Schlarbaum, Jamie P; Dayani, Yaron; Artuso, Emma; Prandi, Cristina; Koltai, Hinanit; Agama, Keli; Pommier, Yves; Chen, Yu; Tricoli, Lucas; LaRocque, Jeannine R; Albanese, Christopher; Yarden, Ronit I

    2016-03-22

    Strigolactones are a novel class of plant hormones produced in roots that regulate shoot and root development. We previously reported that strigolactone analogs (SLs) induce G2/M cell cycle arrest and apoptosis in a variety of human cancer cells and inhibit tumor growth of human breast cancer xenografts in mice. SLs had no significant influences on non-transformed cells. Here we report for the first time that SLs induce DNA damage in the form of DNA double-strand breaks (DSBs) and activate the DNA damage response signaling by inducing phosphorylation of ATM, ATR and DNA-PKcs and co-localization of the DNA damage signaling protein, 53BP1, with γH2AX nuclear foci. We further report that in addition to DSBs induction, SLs simultaneously impair DSBs repair, mostly homology-directed repair (HDR) and to a lesser extent non-homologous end joining (NHEJ). In response to SLs, RAD51, the homologous DSB repair protein, is ubiquitinated and targeted for proteasomal degradation and it fails to co-localize with γH2AX foci. Interestingly, SLs synergize with DNA damaging agents-based therapeutics. The combination of PARP inhibitors and SLs showed an especially potent synergy, but only in BRCA1-proficient cells. No synergy was observed between SLs and PARP inhibitors in BRCA1-deficient cells, supporting a role for SLs in HDR impairment. Together, our data suggest that SLs increase genome instability and cell death by a unique mechanism of inducing DNA damage and inhibiting DNA repair. PMID:26910887

  19. ShaPINg Cell Fate Upon DNA Damage: Role of Pin1 Isomerase in DNA Damage-Induced Cell Death and Repair.

    PubMed

    Polonio-Vallon, Tilman; Krüger, Daniel; Hofmann, Thomas G

    2014-01-01

    The peptidyl-prolyl cis/trans isomerase Pin1 acts as a molecular timer in proline-directed Ser/Thr kinase signaling and shapes cellular responses based on recognition of phosphorylation marks and implementing conformational changes in its substrates. Accordingly, Pin1 has been linked to numerous phosphorylation-controlled signaling pathways and cellular processes such as cell cycle progression, proliferation, and differentiation. In addition, Pin1 plays a pivotal role in DNA damage-triggered cell fate decisions. Whereas moderate DNA damage is balanced by DNA repair, cells confronted with massive genotoxic stress are eliminated by the induction of programed cell death or cellular senescence. In this review, we summarize and discuss the current knowledge on how Pin1 specifies cell fate through regulating key players of the apoptotic and the repair branch of the DNA-damage response. PMID:24982848

  20. Gene 33/Mig6 inhibits hexavalent chromium-induced DNA damage and cell transformation in human lung epithelial cells

    PubMed Central

    Park, Soyoung; Li, Cen; Zhao, Hong; Darzynkiewicz, Zbigniew; Xu, Dazhong

    2016-01-01

    Hexavalent Chromium [Cr(VI)] compounds are human lung carcinogens and environmental/occupational hazards. The molecular mechanisms of Cr(VI) carcinogenesis appear to be complex and are poorly defined. In this study, we investigated the potential role of Gene 33 (ERRFI1, Mig6), a multifunctional adaptor protein, in Cr(VI)-mediated lung carcinogenesis. We show that the level of Gene 33 protein is suppressed by both acute and chronic Cr(VI) treatments in a dose- and time-dependent fashion in BEAS-2B lung epithelial cells. The inhibition also occurs in A549 lung bronchial carcinoma cells. Cr(VI) suppresses Gene 33 expression mainly through post-transcriptional mechanisms, although the mRNA level of gene 33 also tends to be lower upon Cr(VI) treatments. Cr(VI)-induced DNA damage appears primarily in the S phases of the cell cycle despite the high basal DNA damage signals at the G2M phase. Knockdown of Gene 33 with siRNA significantly elevates Cr(VI)-induced DNA damage in both BEAS-2B and A549 cells. Depletion of Gene 33 also promotes Cr(VI)-induced micronucleus (MN) formation and cell transformation in BEAS-2B cells. Our results reveal a novel function of Gene 33 in Cr(VI)-induced DNA damage and lung epithelial cell transformation. We propose that in addition to its role in the canonical EGFR signaling pathway and other signaling pathways, Gene 33 may also inhibit Cr(VI)-induced lung carcinogenesis by reducing DNA damage triggered by Cr(VI). PMID:26760771

  1. Assessment of gamma ray-induced DNA damage in Lasioderma serricorne using the comet assay

    NASA Astrophysics Data System (ADS)

    Kameya, Hiromi; Miyanoshita, Akihiro; Imamura, Taro; Todoriki, Setsuko

    2012-03-01

    We attempted a DNA comet assay under alkaline conditions to verify the irradiation treatment of pests. Lasioderma serricorne (Fabricius) were chosen as test insects and irradiated with gamma rays from a 60Co source at 1 kGy. We conducted the comet assay immediately after irradiation and over time for 7 day. Severe DNA fragmentation in L. serricorne cells was observed just after irradiation and the damage was repaired during the post-irradiation period in a time-dependent manner. The parameters of the comet image analysis were calculated, and the degree of DNA damage and repair were evaluated. Values for the Ratio (a percentage determined by fluorescence in the damaged area to overall luminance, including intact DNA and the damaged area of a comet image) of individual cells showed that no cells in the irradiated group were included in the Ratio<0.1 category, the lowest grade. This finding was observed consistently throughout the 7-day post-irradiation period. We suggest that the Ratio values of individual cells can be used as an index of irradiation history and conclude that the DNA comet assay under alkaline conditions, combined with comet image analysis, can be used to identify irradiation history.

  2. Discrepancies in the measurement of UVC-induced 8-oxo-2'-deoxyguanosine: implications for the analysis of oxidative DNA damage.

    PubMed

    Evans, M D; Cooke, M S; Podmore, I D; Zheng, Q; Herbert, K E; Lunec, J

    1999-06-01

    Ultraviolet (UV) light-induced indirect, oxidative damage to DNA has received increasing attention with respect to the mutagenic and carcinogenic effects of solar radiation. An oxidative lesion that has raised particular interest because of its qualitative and quantitative importance is 8-oxo-2'-deoxyguanosine. This deoxynucleoside lesion is most frequently measured by high performance liquid chromatography with electrochemical detection (HPLC-EC) following enzymatic hydrolysis of DNA or as the base equivalent, 8-oxoguanine, by gas chromatography-mass spectrometry (GC-MS) following acid hydrolysis of DNA. We have noted a discrepancy in the literature whereby the levels of 8-oxo-2'-deoxyguanosine measured by HPLC-EC in UVC-irradiated DNA are significantly higher than when 8-oxoguanine is measured by GC-MS. By making use of the availability of both HPLC-EC and stable-isotope dilution GC-MS methodologies in our laboratory we have confirmed the discrepancy noted in the literature by parallel analysis of the same UVC-irradiated calf thymus DNA samples. Furthermore, analysis of the UVC-induced product by UV-visible spectrophotometry, voltammetry and its detection by a monoclonal antibody which recognises 8-oxo-2'-deoxyguanosine strongly suggests that the product is indeed 8-oxo-2'-deoxyguanosine. Partial explanation for this discrepancy could be an inordinate resistance of UVC-irradiated DNA to formic acid hydrolysis. However, we cannot completely exclude the possibility that there is a formic acid-labile species which co-elutes with 8-oxo-2'-deoxyguanosine in enzymatically digested UVC-irradiated DNA. Whether this phenomenon is unique to UV-irradiation damage or occurs with other systems that cause oxidative damage to DNA awaits further investigation. Irrespective of the exact mechanism, there will be significant implications for the analysis of oxidative DNA damage. PMID:10362517

  3. Exposure to Ultrafine Particles from Ambient Air and Oxidative Stress–Induced DNA Damage

    PubMed Central

    Bräuner, Elvira Vaclavik; Forchhammer, Lykke; Møller, Peter; Simonsen, Jacob; Glasius, Marianne; Wåhlin, Peter; Raaschou-Nielsen, Ole; Loft, Steffen

    2007-01-01

    Background Particulate matter, especially ultrafine particles (UFPs), may cause health effects through generation of oxidative stress, with resulting damage to DNA and other macromolecules. Objective We investigated oxidative damage to DNA and related repair capacity in peripheral blood mononuclear cells (PBMCs) during controlled exposure to urban air particles with assignment of number concentration (NC) to four size modes with average diameters of 12, 23, 57, and 212 nm. Design Twenty-nine healthy adults participated in a randomized, two-factor cross-over study with or without biking exercise for 180 min and with exposure to particles (NC 6169-15362/cm3) or filtered air (NC 91-542/cm3) for 24 hr. Methods The levels of DNA strand breaks (SBs), oxidized purines as formamidopyrimidine DNA glycolase (FPG) sites, and activity of 7,8-dihydro-8-oxoguanine-DNA glycosylase (OGG1) in PBMCs were measured by the Comet assay. mRNA levels of OGG1, nucleoside diphosphate linked moiety X-type motif 1 (NUDT1), and heme oxygenase-1 (HO1) were determined by real-time reverse transcriptase–polymerase chain reaction. Results Exposure to UFPs for 6 and 24 hr significantly increased the levels of SBs and FPG sites, with a further insignificant increase after physical exercise. The OGG1 activity and expression of OGG1, NUDT1, and HO1 were unaltered. There was a significant dose–response relationship between NC and DNA damage, with the 57-nm mode as the major contributor to effects. Concomitant exposure to ozone, nitrogen oxides, and carbon monoxide had no influence. Conclusion Our results indicate that UFPs, especially the 57-nm soot fraction from vehicle emissions, causes systemic oxidative stress with damage to DNA and no apparent compensatory up-regulation of DNA repair within 24 hr. PMID:17687444

  4. Silymarin Protects Epidermal Keratinocytes from Ultraviolet Radiation-Induced Apoptosis and DNA Damage by Nucleotide Excision Repair Mechanism

    PubMed Central

    Katiyar, Santosh K.; Mantena, Sudheer K.; Meeran, Syed M.

    2011-01-01

    Solar ultraviolet (UV) radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum), inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK) with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs) and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER) genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells. PMID:21731736

  5. Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism.

    PubMed

    Katiyar, Santosh K; Mantena, Sudheer K; Meeran, Syed M

    2011-01-01

    Solar ultraviolet (UV) radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum), inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK) with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs) and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER) genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells. PMID:21731736

  6. Troglitazone, but not rosiglitazone, damages mitochondrial DNA and induces mitochondrial dysfunction and cell death in human hepatocytes

    SciTech Connect

    Rachek, Lyudmila I.; Yuzefovych, Larysa V.; LeDoux, Susan P.; Julie, Neil L.; Wilson, Glenn L.

    2009-11-01

    Thiazolidinediones (TZDs), such as troglitazone (TRO) and rosiglitazone (ROSI), improve insulin resistance by acting as ligands for the nuclear receptor peroxisome proliferator-activated receptor-gamma (PPARgamma). TRO was withdrawn from the market because of reports of serious hepatotoxicity. A growing body of evidence suggests that TRO caused mitochondrial dysfunction and induction of apoptosis in human hepatocytes but its mechanisms of action remain unclear. We hypothesized that damage to mitochondrial DNA (mtDNA) is an initiating event involved in TRO-induced mitochondrial dysfunction and hepatotoxicity. Primary human hepatocytes were exposed to TRO and ROSI. The results obtained revealed that TRO, but not ROSI at equimolar concentrations, caused a substantial increase in mtDNA damage and decreased ATP production and cellular viability. The reactive oxygen species (ROS) scavenger, N-acetyl cystein (NAC), significantly diminished the TRO-induced cytotoxicity, suggesting involvement of ROS in TRO-induced hepatocyte cytotoxicity. The PPARgamma antagonist (GW9662) did not block the TRO-induced decrease in cell viability, indicating that the TRO-induced hepatotoxicity is PPARgamma-independent. Furthermore, TRO induced hepatocyte apoptosis, caspase-3 cleavage and cytochrome c release. Targeting of a DNA repair protein to mitochondria by protein transduction using a fusion protein containing the DNA repair enzyme Endonuclease III (EndoIII) from Escherichia coli, a mitochondrial translocation sequence (MTS) and the protein transduction domain (PTD) from HIV-1 TAT protein protected hepatocytes against TRO-induced toxicity. Overall, our results indicate that significant mtDNA damage caused by TRO is a prime initiator of the hepatoxicity caused by this drug.

  7. Reversal of DNA damage induced Topoisomerase 2 DNA–protein crosslinks by Tdp2

    PubMed Central

    Schellenberg, Matthew J.; Perera, Lalith; Strom, Christina N.; Waters, Crystal A.; Monian, Brinda; Appel, C. Denise; Vilas, Caroline K.; Williams, Jason G.; Ramsden, Dale A.; Williams, R. Scott

    2016-01-01

    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA–protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg2+-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg2+ binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons. PMID:27060144

  8. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes.

    PubMed

    Hasegawa, Tatsuya; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-08-26

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE2. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. PMID:27343554

  9. Reduction of DNA damage induced by titanium dioxide nanoparticles through Nrf2 in vitro and in vivo.

    PubMed

    Shi, Zhiqin; Niu, Yujie; Wang, Qian; Shi, Lei; Guo, Huicai; Liu, Yi; Zhu, Yue; Liu, Shufeng; Liu, Chao; Chen, Xin; Zhang, Rong

    2015-11-15

    Titanium dioxide nanoparticles (Nano-TiO2) are widely used to additives in cosmetics, pharmaceutical, paints and foods. Recent studies have demonstrated that Nano-TiO2 induces DNA damage and increased the risk of cancer and the mechanism might relate with oxidative stress. The aim of this study was to evaluate the effects of Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), an anti-oxidative mediator, on DNA damage induced by Nano-TiO2. Wildtype, Nrf2 knockout (Nrf2(-/-)) and tert-butylhydroquinone (tBHQ) pre-treated HepG2 cells and mice were treated with Nano-TiO2. And then the oxidative stress and DNA damage were evaluated. Our data showed that DNA damage, reactive oxygen species (ROS) generation and MDA content in Nano-TiO2 exposed cells were significantly increased than those of control in dose dependent manners. Nrf2/ARE droved the downstream genes including NAD(P)H dehydrogenase [quinine] 1(NQO1), heme oxygenase 1 (HO-1) and glutamate-cysteine ligase catalytic subunit (GCLC) expression were significantly higher in wildtype HepG2 cells after Nano-TiO2 treatment. After treatment with Nano-TiO2, the DNA damages were significantly increased in Nrf(-/-) cells and mice whereas significantly decreased in tBHQ pre-treatment cells and mice, compared with the wildtype HepG2 cells and mice, respectively. Our results indicated that the acquired of Nrf2 leads to a decreased susceptibility to DNA damages induction by Nano-TiO2 and decreasing of risk of cancer which would provide a strategy for a more efficacious sensitization of against of Nano-TiO2 toxication. PMID:26091733

  10. Enhanced susceptibility of ovaries from obese mice to 7,12-dimethylbenz[a]anthracene-induced DNA damage

    PubMed Central

    Ganesan, Shanthi; Nteeba, Jackson; Keating, Aileen F.

    2014-01-01

    7,12-dimethylbenz[a]anthracene (DMBA) depletes ovarian follicles and induces DNA damage in extra-ovarian tissues, thus, we investigated ovarian DMBA-induced DNA damage. Additionally, since obesity is associated with increased offspring birth defect incidence, we hypothesized that a DMBA-induced DNA damage response (DDR) is compromised in ovaries from obese females. Wild type (lean) non agouti (a/a) and KK.Cg-Ay/J heterozygote (obese) mice were dosed with sesame oil or DMBA (1mg/kg; intraperitoneal injection) at 18 wks of age, for 14 days. Total ovarian RNA and protein were isolated and abundance of Ataxia telangiectasia mutated (Atm), X-ray repair complementing defective repair in chinese hamster cells 6 (Xrcc6), Breast cancer type 1 (Brca1), Rad 51 homolog (Rad51), Poly [ADP-ribose] polymerase 1 (Parp1) and Protein kinase, DNA-activated, catalytic polypeptide (Prkdc) were quantified by RT-PCR or Western blot. Phosphorylated histone H2AX (γH2AX) level was determined by Western blotting. Obesity decreased (P < 0.05) basal protein abundance of PRKDC and BRCA1 proteins but increased (P < 0.05) γH2AX and PARP1 proteins. Ovarian ATM, XRCC6, PRKDC, RAD51 and PARP1 proteins were increased (P < 0.05) by DMBA exposure in lean mice. A blunted DMBA-induced increase (P < 0.05) in XRCC6, PRKDC, RAD51 and BRCA1 was observed in ovaries from obese mice, relative to lean counterparts. Taken together, DMBA exposure induced γH2AX as well as the ovarian DDR, supporting that DMBA causes ovarian DNA damage. Additionally, ovarian DDR was partially attenuated in obese females raising concern that obesity may be an additive factor during chemical-induced ovotoxicity. PMID:25448685

  11. Effect of ATM and HDAC Inhibition on Etoposide-Induced DNA Damage in Porcine Early Preimplantation Embryos

    PubMed Central

    Wang, HaiYang; Luo, YiBo; Lin, ZiLi; Lee, In-Won; Kwon, Jeongwoo; Cui, Xiang-Shun; Kim, Nam-Hyung

    2015-01-01

    Oocyte maturation and embryonic development are sensitive to DNA damage. Compared with somatic cells or oocytes, little is known about the response to DNA damage in early preimplantation embryos. In this study, we examined DNA damage checkpoints and DNA repair mechanisms in parthenogenetic preimplantation porcine embryos. We found that most of the etoposide-treated embryos showed delay in cleavage and ceased development before the blastocyst stage. In DNA-damaged embryos, the earliest positive TUNEL signals were detected on Day 5 of in vitro culture. Caffeine, which is an ATM (ataxia telangiectasia mutated) and ATR (ataxia telangiectasia and Rad3-related protein) kinase inhibitor, and KU55933, which is an ATM kinase inhibitor, were equally effective in rescuing the etoposide-induced cell-cycle blocks. This indicates that ATM plays a central role in the regulation of the checkpoint mechanisms. Treating the embryos with histone deacetylase inhibitors (HDACi) increased embryonic development and reduced etoposide-induced double-strand breaks (DSBs). The mRNA expression of genes involved in non-homologous end-joining (NHEJ) or homologous recombination (HR) pathways for DSB repair was reduced upon HDACi treatment in 5-day-old embryos. Furthermore, HDACi treatment increased the expression levels of pluripotency-related genes (OCT4, SOX2 and NANOG) and decreased the expression levels of apoptosis-related genes (CASP3 and BAX). These results indicate that early embryonic cleavage and development are disturbed by etoposide-induced DNA damage. ATMi (caffeine or KU55933) treatment bypasses the checkpoint while HDACi treatment improves the efficiency of DSB repair to increase the cleavage and blastocyst rate in porcine early preimplantation embryos. PMID:26556501

  12. Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival.

    PubMed

    Hain, Karolina O; Colin, Didier J; Rastogi, Shubhra; Allan, Lindsey A; Clarke, Paul R

    2016-01-01

    A delay in the completion of metaphase induces a stress response that inhibits further cell proliferation or induces apoptosis. This response is thought to protect against genomic instability and is important for the effects of anti-mitotic cancer drugs. Here, we show that mitotic arrest induces a caspase-dependent DNA damage response (DDR) at telomeres in non-apoptotic cells. This pathway is under the control of Mcl-1 and other Bcl-2 family proteins and requires caspase-9, caspase-3/7 and the endonuclease CAD/DFF40. The gradual caspase-dependent loss of the shelterin complex protein TRF2 from telomeres promotes a DDR that involves DNA-dependent protein kinase (DNA-PK). Suppression of mitotic telomere damage by enhanced expression of TRF2, or the inhibition of either caspase-3/7 or DNA-PK during mitotic arrest, promotes subsequent cell survival. Thus, we demonstrate that mitotic stress is characterised by the sub-apoptotic activation of a classical caspase pathway, which promotes telomere deprotection, activates DNA damage signalling, and determines cell fate in response to a prolonged delay in mitosis. PMID:27230693

  13. Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival

    PubMed Central

    Hain, Karolina O.; Colin, Didier J.; Rastogi, Shubhra; Allan, Lindsey A.; Clarke, Paul R.

    2016-01-01

    A delay in the completion of metaphase induces a stress response that inhibits further cell proliferation or induces apoptosis. This response is thought to protect against genomic instability and is important for the effects of anti-mitotic cancer drugs. Here, we show that mitotic arrest induces a caspase-dependent DNA damage response (DDR) at telomeres in non-apoptotic cells. This pathway is under the control of Mcl-1 and other Bcl-2 family proteins and requires caspase-9, caspase-3/7 and the endonuclease CAD/DFF40. The gradual caspase-dependent loss of the shelterin complex protein TRF2 from telomeres promotes a DDR that involves DNA-dependent protein kinase (DNA-PK). Suppression of mitotic telomere damage by enhanced expression of TRF2, or the inhibition of either caspase-3/7 or DNA-PK during mitotic arrest, promotes subsequent cell survival. Thus, we demonstrate that mitotic stress is characterised by the sub-apoptotic activation of a classical caspase pathway, which promotes telomere deprotection, activates DNA damage signalling, and determines cell fate in response to a prolonged delay in mitosis. PMID:27230693

  14. Albendazole induces oxidative stress and DNA damage in the parasitic protozoan Giardia duodenalis

    PubMed Central

    Martínez-Espinosa, Rodrigo; Argüello-García, Raúl; Saavedra, Emma; Ortega-Pierres, Guadalupe

    2015-01-01

    The control of Giardia duodenalis infections is carried out mainly by drugs, among these albendazole (ABZ) is commonly used. Although the cytotoxic effect of ABZ usually involves binding to β-tubulin, it has been suggested that oxidative stress may also play a role in its parasiticidal mechanism. In this work the effect of ABZ in Giardia clones that are susceptible or resistant to different concentrations (1.35, 8, and 250 μM) of this drug was analyzed. Reactive oxygen species (ROS) were induced by ABZ in susceptible clones and this was associated with a decrease in growth that was alleviated by cysteine supplementation. Remarkably, ABZ-resistant clones exhibited partial cross-resistance to H2O2, whereas a Giardia H2O2-resistant strain can grow in the presence of ABZ. Lipid oxidation and protein carbonylation in ABZ-treated parasites did not show significant differences as compared to untreated parasites; however, ABZ induced the formation of 8OHdG adducts and DNA degradation, indicating nucleic acid oxidative damage. This was supported by observations of histone H2AX phosphorylation in ABZ-susceptible trophozoites treated with 250 μM ABZ. Flow cytometry analysis showed that ABZ partially arrested cell cycle in drug-susceptible clones at G2/M phase at the expense of cells in G1 phase. Also, ABZ treatment resulted in phosphatidylserine exposure on the parasite surface, an event related to apoptosis. All together these data suggest that ROS induced by ABZ affect Giardia genetic material through oxidative stress mechanisms and subsequent induction of apoptotic-like events. PMID:26300866

  15. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair

    PubMed Central

    Sterpone, Silvia; Cozzi, Renata

    2010-01-01

    It is well known that ionizing radiation (IR) can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs) of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER). In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer. PMID:20798883

  16. NDR1 modulates the UV-induced DNA-damage checkpoint and nucleotide excision repair

    SciTech Connect

    Park, Jeong-Min; Choi, Ji Ye; Yi, Joo Mi; Chung, Jin Woong; Leem, Sun-Hee; Koh, Sang Seok; Kang, Tae-Hong

    2015-06-05

    Nucleotide excision repair (NER) is the sole mechanism of UV-induced DNA lesion repair in mammals. A single round of NER requires multiple components including seven core NER factors, xeroderma pigmentosum A–G (XPA–XPG), and many auxiliary effector proteins including ATR serine/threonine kinase. The XPA protein helps to verify DNA damage and thus plays a rate-limiting role in NER. Hence, the regulation of XPA is important for the entire NER kinetic. We found that NDR1, a novel XPA-interacting protein, modulates NER by modulating the UV-induced DNA-damage checkpoint. In quiescent cells, NDR1 localized mainly in the cytoplasm. After UV irradiation, NDR1 accumulated in the nucleus. The siRNA knockdown of NDR1 delayed the repair of UV-induced cyclobutane pyrimidine dimers in both normal cells and cancer cells. It did not, however, alter the expression levels or the chromatin association levels of the core NER factors following UV irradiation. Instead, the NDR1-depleted cells displayed reduced activity of ATR for some set of its substrates including CHK1 and p53, suggesting that NDR1 modulates NER indirectly via the ATR pathway. - Highlights: • NDR1 is a novel XPA-interacting protein. • NDR1 accumulates in the nucleus in response to UV irradiation. • NDR1 modulates NER (nucleotide excision repair) by modulating the UV-induced DNA-damage checkpoint response.

  17. High-throughput genotoxicity assay identifies antioxidants as inducers of DNA damage response and cell death

    EPA Science Inventory

    Human ATAD5 is an excellent biomarker for identifying genotoxic compounds because ATADS protein levels increase post-transcriptionally following exposure to a variety of DNA damaging agents. Here we report a novel quantitative high-throughput ATAD5-Iuciferase assay that can moni...

  18. The mycotoxin alternariol induces DNA damage and modify macrophage phenotype and inflammatory responses.

    PubMed

    Solhaug, A; Wisbech, C; Christoffersen, T E; Hult, L O; Lea, T; Eriksen, G S; Holme, J A

    2015-11-19

    Alternariol (AOH), a mycotoxin produced by Alternaria fungi, is frequently found as a contaminant in fruit and grain products. Here we examined if AOH could modify macrophage phenotype and inflammatory responses. In RAW 264.7 mouse macrophages AOH changed the cell morphology of from round to star-shaped cells, with increased levels of CD83, CD86, CD11b, MHCII and endocytic activity. TNFα and IL-6 were enhanced at mRNA-level, but only TNFα showed increased secretion. No changes were found in IL-10 or IL-12p40 expression. Primary human macrophages changed the cell morphology from round into elongated shapes with dendrite-like protrusions in response to AOH. The levels of CD83 and CD86 were increased, HLA-DR and CD68 were down-regulated and CD80, CD200R and CD163 remained unchanged. Increased secretion of TNFα and IL-6 were found after AOH exposure, while IL-8, IL-10 and IL-12p70 were not changed. Furthermore, AOH reduced macrophage endocytic activity and autophagosomes. AOH was also found to induce DNA damage, which is suggested to be linked to the morphological and phenotypical changes. Thus, AOH was found to change the morphology and phenotype of the two cell models, but either of them could be characterized as typical M1/M2 macrophages or as dendritic cells (DC). PMID:26341179

  19. X-ray induced damage in DNA monitored by X-ray photoelectron spectroscopy

    SciTech Connect

    Ptasinska, Sylwia; Stypczynska, Agnieszka; Nixon, Tony; Mason, Nigel J.; Klyachko, Dimitri V.; Sanche, Leon

    2008-08-14

    In this work, the chemical changes in calf thymus DNA samples were analyzed by X-ray photoelectron spectroscopy (XPS). The DNA samples were irradiated for over 5 h and spectra were taken repeatedly every 30 min. In this approach the X-ray beam both damages and probes the samples. In most cases, XPS spectra have complex shapes due to contributions of C, N, and O atoms bonded at several different sites. We show that from a comparative analysis of the modification in XPS line shapes of the C 1s, O 1s, N 1s, and P 2p peaks, one can gain insight into a number of reaction pathways leading to radiation damage to DNA.

  20. Repair of gamma-ray-induced DNA base damage in xeroderma pigmentosum cells

    SciTech Connect

    Fornace, A.J. Jr.; Dobson, P.P.; Kinsella, T.J.

    1986-04-01

    The repair of DNA damage produced by /sup 137/Cs gamma irradiation was measured with a preparation from Micrococcus luteus containing DNA damage-specific endonucleases in combination with alkaline elution. The frequency of these endonuclease sensitive sites (ESS) was determined after 54 or 110 Gy of oxic irradiation in normal and xeroderma pigmentosum (XP) fibroblasts from complementation groups A, C, D, and G. Repair was rapid in all cell strains with greater than 50% repair after 1.5 h of repair incubation. At later repair times, 12-17 h, more ESS remained in XP than in normal cells. The frequency of excess ESS in XP cells was approximately 0.04 per 10(9) Da of DNA per Gy which was equivalent to 10% of the initial ESS produced. The removal of ESS was comparable in XP cells with normal radiosensitivity and XP3BR cells which have been reported to be moderately radiosensitive.

  1. Effects of temperature on baseline and genotoxicant-induced DNA damage in haemocytes of Dreissena polymorpha.

    PubMed

    Buschini, Annamaria; Carboni, Pamela; Martino, Anna; Poli, Paola; Rossi, Carlo

    2003-05-01

    The potential application of the Comet assay for monitoring genotoxicity in the freshwater mussel Dreissena polymorpha was explored and a preliminary investigation was undertaken of the baseline levels of DNA damage in mussel haemocytes of animals kept at different temperatures. In addition, in vitro cell sensitivity against genotoxicants was assessed in relation to increasing temperatures. The mussels were kept at four different constant temperatures (4, 18, 28 and 37 degrees C) for 15 h. The haemocytes withdrawn were treated in vitro with melphalan, as a model genotoxic compound, or sodium hypochlorite, a common water disinfectant capable of producing mutagenic/carcinogenic by-products, at the established temperatures for 1h. The data obtained in vivo, in cells directly withdrawn from the mussels showed a significant (P<0.001, Student's t test) inter-individual variability, probably due to genetic and epigenetic factors and an increasing amount of DNA damage at increasing temperature. Mussel haemocytes showed a clear dose-response effect after in vitro melphalan treatment. Hypochlorite treatment also significantly increased DNA migration: the damage was temperature dependent, with a similar increase at 4 and 28 degrees C and a minimum level at 18 degrees C. This study demonstrates the potential application of the Comet assay to haemocytes of D. polymorpha. However, these findings suggest that temperature could alter both DNA damage baseline levels in untreated animals and cell sensitivity towards environmental pollutants in in vitro conditions. Therefore, more information is needed about seasonal variations and the natural background levels of DNA damage in mussels living in the wild, before they are used for the monitoring of genotoxic effects in aquatic environments. PMID:12742509

  2. An automated alkaline elution system: DNA damage induced by 1,2-dibromo-3-chloropropane in vivo and in vitro.

    PubMed

    Brunborg, G; Holme, J A; Søderlund, E J; Omichinski, J G; Dybing, E

    1988-11-01

    An automated alkaline elution system for the detection of DNA damage has been developed. After manual application of samples, which is completed within 5 min, the subsequent supply of liquids, changes in flow rates, and temperature are controlled automatically. The system operates 16 filters and may easily be expanded. The sensitivity of the fluorometric DNA determinations with the Hoechst 33258 dye is increased by using an elution buffer (20 mM Na2EDTA, pH 12.50) with low background fluorescence. DNA is determined using an automated setup similar to the one recently presented by Sterzel et al. (1985, Anal. Biochem. 147, 462-467). The most significant modification is the use of a neutralization buffer which allows variations in the pH of eluted fractions. This change increases the sensitivity of the DNA measurements. The automated alkaline elution system was evaluated using the nematocide 1,2-dibromo-3-chloropropane (DBCP) in a study of its genotoxic effects in the testes and the kidneys. Significant DNA damage was induced in testicular cells by 2.5 microM DBCP (1 h) in vitro and 85 mumol/kg DBCP ip (3 h) in vivo. The damage appeared after short treatment times (10 min in vivo). Variations in the observed DBCP response in vivo were largely due to interanimal variations. The automated alkaline elution system proved to be a sensitive assay also for the detection of DNA damage in kidney nuclei prepared from rats exposed to DBCP. Provided that kidney nuclei from untreated rats, mice, or hamster were kept ice-cold until lysing, 85-100% of their DNA was retained after 16 h of elution, indicating highly intact DNA. Under the same conditions, guinea pig DNA was rapidly degraded unless the nuclei were prepared in a buffer with a higher concentration of Na2EDTA (20 mM). PMID:3239754

  3. Telomerase activation as a repair response to radiation-induced DNA damage in Y79 retinoblastoma cells.

    PubMed

    Akiyama, Masaharu; Ozaki, Kohji; Kawano, Takeshi; Yamada, Osamu; Kawauchi, Kiyotaka; Ida, Hiroyuki; Yamada, Hisashi

    2013-10-28

    The molecular mechanism of telomerase activation induced by ionizing radiation (IR) remains poorly understood. We demonstrate that DNA damage induced by IR at doses of 2-5 Gy triggers activation of Akt, predominant to that of protein phosphatase 2A (PP2A), resulting in human telomerase reverse transcriptase (hTERT) phosphorylation and increased telomerase activity in Y79 cells. DNA damage induced by IR at doses greater than 10 Gy might trigger PP2A activation, predominant to that of Akt, resulting in hTERT dephosphorylation and decreased telomerase activity. Our results suggest that differential activation of Akt and PP2A may be responsible for telomerase regulation. PMID:23850566

  4. MDM2-regulated degradation of HIPK2 prevents p53Ser46 phosphorylation and DNA damage-induced apoptosis.

    PubMed

    Rinaldo, Cinzia; Prodosmo, Andrea; Mancini, Francesca; Iacovelli, Stefano; Sacchi, Ada; Moretti, Fabiola; Soddu, Silvia

    2007-03-01

    In response to DNA damage, p53 induces either cell-cycle arrest or apoptosis by differential transcription of several target genes and through transcription-independent apoptotic functions. p53 phosphorylation at Ser46 by HIPK2 is one determinant of the outcome because it takes place only upon severe, nonrepairable DNA damage that irreversibly drives cells to apoptosis. Here, we show that p53 represses its proapoptotic activator HIPK2 via MDM2-mediated degradation, whereas a degradation-resistant HIPK2 mutant has increased apoptotic activity. Upon cytostatic, nonsevere DNA damage, inhibition of HIPK2 degradation is sufficient to induce p53Ser46 phosphorylation and apoptosis, converting growth-arresting stimuli to apoptotic ones. These findings establish HIPK2 as an MDM2 target and support a model in which, upon nonsevere DNA damage, p53 represses its own phosphorylation at Ser46 due to HIPK2 degradation, supporting the notion that the cell-cycle-arresting functions of p53 include active inhibition of the apoptotic ones. PMID:17349959

  5. Evaluating the effects of galbanic acid on hydrogen peroxide-induced oxidative DNA damage in human lymphocytes

    PubMed Central

    Shirani, Kobra; Behravan, Javad; Mosaffa, Fatemeh; Iranshahi, Mehrdad; Mehmankhah, Babak; Razavi-Azarkhiavi, Kamal; Karimi, Gholamreza

    2014-01-01

    Objective: Ferula szowitsiana has been widely used for medicinal purposes around the world. The anti-oxidant effect of F. szowitsiana had been proved. The current study aims to determine the protective effects of galbanic acid, a sesquiterpene coumarin from F. szowitsiana, against hydrogen peroxide (H2O2) - induced oxidative DNA damage in human lymphocytes. Materials and Methods: Human lymphocytes were incubated with H2O2 (0, 25, 50, 100, and 200 µM), galbanic acid (200 and 400 µM) and a combination of galbanic acid (200 and 400 µM) and H2O2 (25 µM) at 4 C for 30 minutes. Solvents of galbanic acid without H2O2 were used as negative controls. Results: The findings of this study demonstrated that H2O2 exposure leads to a significant concentration-dependent increase in DNA damage. Galbanic acid did not cause DNA damage compared with the control cells. Data showed that galbanic acid does not have a protective effect against H2O2-induced oxidative DNA damage in human lymphocytes. Conclusion: According to the results, it is concluded that the capability of F. szowitsiana in reducing reactive oxygen species and the anti-inflammatory property of its methanolic extract may be due to its other ingredients. PMID:25386396

  6. Hinokitiol Induces DNA Damage and Autophagy followed by Cell Cycle Arrest and Senescence in Gefitinib-Resistant Lung Adenocarcinoma Cells

    PubMed Central

    Li, Lan-Hui; Wu, Ping; Lee, Jen-Yi; Li, Pei-Rong; Hsieh, Wan-Yu; Ho, Chao-Chi; Ho, Chen-Lung; Chen, Wan-Jiun; Wang, Chien-Chun; Yen, Muh-Yong; Yang, Shun-Min; Chen, Huei-Wen

    2014-01-01

    Despite good initial responses, drug resistance and disease recurrence remain major issues for lung adenocarcinoma patients with epidermal growth factor receptor (EGFR) mutations taking EGFR-tyrosine kinase inhibitors (TKI). To discover new strategies to overcome this issue, we investigated 40 essential oils from plants indigenous to Taiwan as alternative treatments for a wide range of illnesses. Here, we found that hinokitiol, a natural monoterpenoid from the heartwood of Calocedrus formosana, exhibited potent anticancer effects. In this study, we demonstrated that hinokitiol inhibited the proliferation and colony formation ability of lung adenocarcinoma cells as well as the EGFR-TKI-resistant lines PC9-IR and H1975. Transcriptomic analysis and pathway prediction algorithms indicated that the main implicated pathways included DNA damage, autophagy, and cell cycle. Further investigations confirmed that in lung cancer cells, hinokitiol inhibited cell proliferation by inducing the p53-independent DNA damage response, autophagy (not apoptosis), S-phase cell cycle arrest, and senescence. Furthermore, hinokitiol inhibited the growth of xenograft tumors in association with DNA damage and autophagy but exhibited fewer effects on lung stromal fibroblasts. In summary, we demonstrated novel mechanisms by which hinokitiol, an essential oil extract, acted as a promising anticancer agent to overcome EGFR-TKI resistance in lung cancer cells via inducing DNA damage, autophagy, cell cycle arrest, and senescence in vitro and in vivo. PMID:25105411

  7. RESCUE OF HIPPO CO-ACTIVATOR YAP1 TRIGGERS DNA DAMAGE-INDUCED APOPTOSIS IN HEMATOLOGICAL CANCERS

    PubMed Central

    Cottini, Francesca; Hideshima, Teru; Xu, Chunxiao; Sattler, Martin; Dori, Martina; Agnelli, Luca; Hacken, Elisa ten; Bertilaccio, Maria Teresa; Antonini, Elena; Neri, Antonino; Ponzoni, Maurilio; Marcatti, Magda; Richardson, Paul G.; Carrasco, Ruben; Kimmelman, Alec C.; Wong, Kwok-Kin; Caligaris-Cappio, Federico; Blandino, Giovanni; Kuehl, W. Michael; Anderson, Kenneth C.; Tonon, Giovanni

    2014-01-01

    Oncogene–induced DNA damage elicits genomic instability in epithelial cancer cells, but apoptosis is blocked through inactivation of the tumor suppressor p53. In hematological cancers, the relevance of ongoing DNA damage and mechanisms by which apoptosis is suppressed are largely unknown. We found pervasive DNA damage in hematologic malignancies including multiple myeloma, lymphoma and leukemia, which leads to activation of a p53–independent, pro-apoptotic network centered on nuclear relocalization of ABL1 kinase. Although nuclear ABL1 triggers cell death through its interaction with the Hippo pathway co–activator YAP1 in normal cells, we show that low YAP1 levels prevent nuclear ABL1–induced apoptosis in these hematologic malignancies. YAP1 is under the control of a serine–threonine kinase, STK4. Importantly, genetic inactivation of STK4 restores YAP1 levels, triggering cell death in vitro and in vivo. Our data therefore identify a novel synthetic–lethal strategy to selectively target cancer cells presenting with endogenous DNA damage and low YAP1 levels. PMID:24813251

  8. Protective activity of butyrate on hydrogen peroxide-induced DNA damage in isolated human colonocytes and HT29 tumour cells.

    PubMed

    Rosignoli, P; Fabiani, R; De Bartolomeo, A; Spinozzi, F; Agea, E; Pelli, M A; Morozzi, G

    2001-10-01

    Epidemiological studies support the involvement of short-chain fatty acids (SCFA) in colon physiology and the protective role of butyrate on colon carcinogenesis. Among the possible mechanisms by which butyrate may exert its anti-carcinogenicity an antioxidant activity has been recently suggested. We investigated the effects of butyrate and mixtures of SCFA (butyrate, propionate and acetate) on DNA damage induced by H(2)O(2) in isolated human colonocytes and in two human colon tumour cell lines (HT29 and HT29 19A). Human colonocytes were isolated from endoscopically obtained samples and the DNA damage was assessed by the comet assay. H(2)O(2) induced DNA damage in normal colonocytes in a dose-dependent manner which was statistically significant at concentrations over 10 microM. At 15 microM H(2)O(2) DNA damage in HT29 and HT29 19A cells was significantly lower than that observed in normal colonocytes (P < 0.01). Pre-incubation of the cells with physiological concentrations of butyrate (6.25 and 12.5 mM) reduced H(2)O(2) (15 microM) induced damage by 33 and 51% in human colonocytes, 45 and 75% in HT29 and 30 and 80% in HT29 19A, respectively. Treatment of cells with a mixture of 25 mM acetate + 10.4 mM propionate + 6.25 mM butyrate did not induce DNA damage, while a mixture of 50 mM acetate + 20.8 mM propionate + 12.5 mM butyrate was weakly genotoxic only towards normal colonocytes. However, both mixtures were able to reduce the H(2)O(2)-induced DNA damage by about 50% in all cell types. The reported protective effect of butyrate might be important in pathogenetic mechanisms mediated by reactive oxygen species, and aids understanding of the apparent protection toward colorectal cancer exerted by dietary fibres, which enhance the butyrate bioavailability in the colonic mucosa. PMID:11577008

  9. Implications of caspase-dependent proteolytic cleavage of cyclin A1 in DNA damage-induced cell death

    SciTech Connect

    Woo, Sang Hyeok; Seo, Sung-Keum; An, Sungkwan; Choe, Tae-Boo; Hong, Seok-Il; Lee, Yun-Han; Park, In-Chul

    2014-10-24

    Highlights: • Caspase-1 mediates doxorubicin-induced downregulation of cyclin A1. • Active caspase-1 effectively cleaved cyclin A1 at D165. • Cyclin A1 expression is involved in DNA damage-induced cell death. - Abstract: Cyclin A1 is an A-type cyclin that directly binds to CDK2 to regulate cell-cycle progression. In the present study, we found that doxorubicin decreased the expression of cyclin A1 at the protein level in A549 lung cancer cells, while markedly downregulating its mRNA levels. Interestingly, doxorubicin upregulated caspase-1 in a concentration-dependent manner, and z-YAVD-fmk, a specific inhibitor of caspase-1, reversed the doxorubicin-induced decrease in cyclin A1 in A549 lung cancer and MCF7 breast cancer cells. Active caspase-1 effectively cleaved cyclin A1 at D165 into two fragments, which in vitro cleavage assays showed were further cleaved by caspase-3. Finally, we found that overexpression of cyclin A1 significantly reduced the cytotoxicity of doxorubicin, and knockdown of cyclin A1 by RNA interference enhanced the sensitivity of cells to ionizing radiation. Our data suggest a new mechanism for the downregulation of cyclin A1 by DNA-damaging stimuli that could be intimately involved in the cell death induced by DNA damage-inducing stimuli, including doxorubicin and ionizing radiation.

  10. Repression of BIRC5/Survivin by FOXO3/FKHRL1 Sensitizes Human Neuroblastoma Cells to DNA Damage-induced Apoptosis

    PubMed Central

    Hagenbuchner, Judith; Unterkircher, Thomas; Sachsenmaier, Nora; Seifarth, Christoph; Böck, Günther; Porto, Verena; Geiger, Kathrin; Ausserlechner, Michael

    2009-01-01

    The phosphatidylinositol 3-kinase (PI3K)–protein kinase B (PKB) pathway regulates survival and chemotherapy resistance of neuronal cells, and its deregulation in neuroblastoma (NB) tumors predicts an adverse clinical outcome. Here, we show that inhibition of PI3K-PKB signaling in human NB cells induces nuclear translocation of FOXO3/FKHRL1, represses the prosurvival protein BIRC5/Survivin, and sensitizes to DNA-damaging agents. To specifically address whether FKHRL1 contributes to Survivin regulation, we introduced a 4-hydroxy-tamoxifen-regulated FKHRL1(A3)ERtm allele into NB cells. Conditional FKHRL1 activation repressed Survivin transcription and protein expression. Transgenic Survivin exerted a significant antiapoptotic effect and prevented the accumulation of Bim and Bax at mitochondria, the loss of mitochondrial membrane potential as well as the release of cytochrome c during FKHRL1-induced apoptosis. In concordance, Survivin knockdown by retroviral short hairpin RNA technology accelerated FKHRL1-induced apoptosis. Low-dose activation of FKHRL1 sensitized to the DNA-damaging agents doxorubicin and etoposide, whereas the overexpression of Survivin diminished FKHRL1 sensitization to these drugs. These results suggest that repression of Survivin by FKHRL1 facilitates FKHRL1-induced apoptosis and sensitizes to cell death induced by DNA-damaging agents, which supports the central role of PI3K-PKB-FKHRL1 signaling in drug resistance of human NB. PMID:19211844

  11. Jumonji domain-containing protein 2B silencing induces DNA damage response via STAT3 pathway in colorectal cancer

    PubMed Central

    Chen, L; Fu, L; Kong, X; Xu, J; Wang, Z; Ma, X; Akiyama, Y; Chen, Y; Fang, J

    2014-01-01

    Background: Jumonji domain-containing protein 2B (JMJD2B), directly targeted by hypoxia-inducible factor 1α, maintains the histone methylation balance important for the transcriptional activation of many oncogenes. Jumonji domain-containing protein 2B has been implicated in colorectal cancer (CRC) progression; however, the mechanism remains unclear. Methods: Immunofluorescence and western blotting detected phosphorylated histone H2AX, characteristic of double-strand breaks, and comet assay was used to investigate DNA damage, in CRC cells after JMJD2B small interfering RNA (siRNA) transfection. We assessed the resulting in vitro responses, that is, cell cycle progression, apoptosis, and senescence coupled with JMJD2B silencing-induced DNA damage, studying the regulatory role of signal transducers and activators of transcription 3 (STAT3). The JMJD2B silencing anti-cancer effect was determined using an in vivo CRC xenograft model. Results: Jumonji domain-containing protein 2B knockdown induced DNA damage via ataxia telangiectasia-mutated (ATM) and ATM and Rad3-related pathway activation, resulting in cell cycle arrest, apoptosis, and senescence in both normoxia and hypoxia. Signal transducers and activators of transcription 3 suppression by JMJD2B silencing enhanced DNA damage. Intratumoural injection of JMJD2B siRNA suppressed tumour growth in vivo and activated the DNA damage response (DDR). Conclusions: Jumonji domain-containing protein 2B has an essential role in cancer cell survival and tumour growth via DDR mediation, which STAT3 partially regulates, suggesting that JMJD2B is a potential anti-cancer target. PMID:24473398

  12. Remote limb preconditioning protects against ischemia-induced neuronal death through ameliorating neuronal oxidative DNA damage and parthanatos.

    PubMed

    Jin, Wei; Xu, Wei; Chen, Jing; Zhang, Xiaoxiao; Shi, Lei; Ren, Chuancheng

    2016-07-15

    Remote limb preconditioning (RPC) ameliorates ischemia-induced cerebral infarction and promotes neurological function recovery; however, the mechanism of RPC hasn't been fully understood, which limits its clinical application. The present study aimed at exploring the underlying mechanism of RPC through testing its effects on neuronal oxidative DNA damage and parthanatos in a rat focal cerebral ischemia model. Infarct volume was investigated by 2, 3, 5-triphenyltetrazolium chloride (TTC) staining, and neuronal survival was evaluated by Nissl staining. Oxidative DNA damage was investigated via analyzing the expression of 8-hydroxy-2'-deoxyguanosine (8-OHdG). Besides, terminal deoxynucleotidyl transferase-mediated biotinylated-dUTP nick-end labeling (TUNEL) and DNA laddering were utilized to evaluate neuronal DNA fragmentation. Moreover, we tested whether RPC regulated poly(ADP-ribose) polymer (PAR) and apoptosis inducing factor (AIF) pathway; thus, PAR expression, AIF translocation and AIF/histone H2AX (H2AX) interaction were investigated. The results showed that RPC exerted neuroprotective effects by ameliorating oxidative DNA damage and neuronal parthanatos; additionally, RPC suppressed PAR/AIF pathway through reducing AIF translocation and AIF/H2AX interaction. The present study further exposed neuroprotective mechanism of RPC, and provided new evidence for the research on RPC and ICS. PMID:27288768

  13. Ribonucleotide triggered DNA damage and RNA-DNA damage responses

    PubMed Central

    Wallace, Bret D; Williams, R Scott

    2014-01-01

    Research indicates that the transient contamination of DNA with ribonucleotides exceeds all other known types of DNA damage combined. The consequences of ribose incorporation into DNA, and the identity of protein factors operating in this RNA-DNA realm to protect genomic integrity from RNA-triggered events are emerging. Left unrepaired, the presence of ribonucleotides in genomic DNA impacts cellular proliferation and is associated with chromosome instability, gross chromosomal rearrangements, mutagenesis, and production of previously unrecognized forms of ribonucleotide-triggered DNA damage. Here, we highlight recent findings on the nature and structure of DNA damage arising from ribonucleotides in DNA, and the identification of cellular factors acting in an RNA-DNA damage response (RDDR) to counter RNA-triggered DNA damage. PMID:25692233

  14. REC-2006-A Fractionated Extract of Podophyllum hexandrum Protects Cellular DNA from Radiation-Induced Damage by Reducing the Initial Damage and Enhancing Its Repair In Vivo.

    PubMed

    Chaudhary, Pankaj; Shukla, Sandeep Kumar; Sharma, Rakesh Kumar

    2011-01-01

    Podophyllum hexandrum, a perennial herb commonly known as the Himalayan May Apple, is well known in Indian and Chinese traditional systems of medicine. P. hexandrum has been widely used for the treatment of venereal warts, skin infections, bacterial and viral infections, and different cancers of the brain, lung and bladder. This study aimed at elucidating the effect of REC-2006, a bioactive fractionated extract from the rhizome of P. hexandrum, on the kinetics of induction and repair of radiation-induced DNA damage in murine thymocytes in vivo. We evaluated its effect on non-specific radiation-induced DNA damage by the alkaline halo assay in terms of relative nuclear spreading factor (RNSF) and gene-specific radiation-induced DNA damage via semi-quantitative polymerase chain reaction. Whole body exposure of animals with gamma rays (10 Gy) caused a significant amount of DNA damage in thymocytes (RNSF values 17.7 ± 0.47, 12.96 ± 1.64 and 3.3 ± 0.014) and a reduction in the amplification of β-globin gene to 0, 28 and 43% at 0, 15 and 60 min, respectively. Administrating REC-2006 at a radioprotective concentration (15 mg kg(-1) body weight) 1 h before irradiation resulted in time-dependent reduction of DNA damage evident as a decrease in RNSF values 6.156 ± 0.576, 1.647 ± 0.534 and 0.496 ± 0.012, and an increase in β-globin gene amplification 36, 95 and 99%, at 0, 15 and 60 min, respectively. REC-2006 scavenged radiation-induced hydroxyl radicals in a dose-dependent manner stabilized DPPH free radicals and also inhibited superoxide anions. Various polyphenols and flavonoides present in REC-2006 might contribute to scavenging of radiation-induced free radicals, thereby preventing DNA damage and stimulating its repair. PMID:20008078

  15. Aryl Hydrocarbon Receptor Ligand 5F 203 Induces Oxidative Stress That Triggers DNA Damage in Human Breast Cancer Cells

    PubMed Central

    McLean, Lancelot S.; Watkins, Cheri N.; Campbell, Petreena; Zylstra, Dain; Rowland, Leah; Amis, Louisa H.; Scott, Lia; Babb, Crystal E.; Livingston, W. Joel; Darwanto, Agus; Davis, Willie L.; Senthil, Maheswari; Sowers, Lawrence C.; Brantley, Eileen

    2015-01-01

    Breast tumors often show profound sensitivity to exogenous oxidative stress. Investigational agent 2-(4-amino-3-methylphenyl)-5-fluorobenzothiazole (5F 203) induces aryl hydrocarbon receptor (AhR)-mediated DNA damage in certain breast cancer cells. Since AhR agonists often elevate intracellular oxidative stress, we hypothesize that 5F 203 increases reactive oxygen species (ROS) to induce DNA damage, which thwarts breast cancer cell growth. We found that 5F 203 induced single-strand break formation. 5F 203 enhanced oxidative DNA damage that was specific to breast cancer cells sensitive to its cytotoxic actions, as it did not increase oxidative DNA damage or ROS formation in nontumorigenic MCF-10A breast epithelial cells. In contrast, AhR agonist and procarcinogen benzo[a]pyrene and its metabolite, 1,6-benzo[a]pyrene quinone, induced oxidative DNA damage and ROS formation, respectively, in MCF-10A cells. In sensitive breast cancer cells, 5F 203 activated ROS-responsive kinases: c-Jun-N-terminal kinase (JNK) and p38 mitogen activated protein kinase (p38). AhR antagonists (alpha-naphthoflavone, CH223191) or antioxidants (N-acetyl-l-cysteine, EUK-134) attenuated 5F 203-mediated JNK and p38 activation, depending on the cell type. Pharmacological inhibition of AhR, JNK, or p38 attenuated 5F 203-mediated increases in intracellular ROS, apoptosis, and single-strand break formation. 5F 203 induced the expression of cytoglobin, an oxidative stress-responsive gene and a putative tumor suppressor, which was diminished with AhR, JNK, or p38 inhibition. Additionally, 5F 203-mediated increases in ROS production and cytoglobin were suppressed in AHR100 cells (AhR ligand-unresponsive MCF-7 breast cancer cells). Our data demonstrate 5F 203 induces ROS-mediated DNA damage at least in part via AhR, JNK, or p38 activation and modulates the expression of oxidative stress-responsive genes such as cytoglobin to confer its anticancer action. PMID:25781201

  16. Laser phototherapy triggers the production of reactive oxygen species in oral epithelial cells without inducing DNA damage.

    PubMed

    Dillenburg, Caroline Siviero; Almeida, Luciana Oliveira; Martins, Manoela Domingues; Squarize, Cristiane Helena; Castilho, Rogerio Moraes

    2014-04-01

    Laser phototherapy (LPT) is widely used in clinical practice to accelerate healing. Although the use of LPT has advantages, the molecular mechanisms involved in the process of accelerated healing and the safety concerns associated with LPT are still poorly understood. We investigated the physiological effects of LPT irradiation on the production and accumulation of reactive oxygen species (ROS), genomic instability, and deoxyribose nucleic acid (DNA) damage in human epithelial cells. In contrast to a high energy density (20  J/cm²), laser administered at a low energy density (4  J/cm²) resulted in the accumulation of ROS. Interestingly, 4  J/cm² of LPT did not induce DNA damage, genomic instability, or nuclear influx of the BRCA1 DNA damage repair protein, a known genome protective molecule that actively participates in DNA repair. Our results suggest that administration of low energy densities of LPT induces the accumulation of safe levels of ROS, which may explain the accelerated healing results observed in patients. These findings indicate that epithelial cells have an endowed molecular circuitry that responds to LPT by physiologically inducing accumulation of ROS, which triggers accelerated healing. Importantly, our results suggest that low energy densities of LPT can serve as a safe therapy to accelerate epithelial healing. PMID:24781593

  17. Optical control of filamentation-induced damage to DNA by intense, ultrashort, near-infrared laser pulses

    NASA Astrophysics Data System (ADS)

    Dharmadhikari, J. A.; Dharmadhikari, A. K.; Kasuba, K. C.; Bharambe, H.; D’Souza, J. S.; Rathod, K. D.; Mathur, D.

    2016-06-01

    We report on damage to DNA in an aqueous medium induced by ultrashort pulses of intense laser light of 800 nm wavelength. Focusing of such pulses, using lenses of various focal lengths, induces plasma formation within the aqueous medium. Such plasma can have a spatial extent that is far in excess of the Rayleigh range. In the case of water, the resulting ionization and dissociation gives rise to in situ generation of low-energy electrons and OH-radicals. Interactions of these with plasmid DNA produce nicks in the DNA backbone: single strand breaks (SSBs) are induced as are, at higher laser intensities, double strand breaks (DSBs). Under physiological conditions, the latter are not readily amenable to repair. Systematic quantification of SSBs and DSBs at different values of incident laser energy and under different external focusing conditions reveals that damage occurs in two distinct regimes. Numerical aperture is the experimental handle that delineates the two regimes, permitting simple optical control over the extent of DNA damage.

  18. Optical control of filamentation-induced damage to DNA by intense, ultrashort, near-infrared laser pulses.

    PubMed

    Dharmadhikari, J A; Dharmadhikari, A K; Kasuba, K C; Bharambe, H; D'Souza, J S; Rathod, K D; Mathur, D

    2016-01-01

    We report on damage to DNA in an aqueous medium induced by ultrashort pulses of intense laser light of 800 nm wavelength. Focusing of such pulses, using lenses of various focal lengths, induces plasma formation within the aqueous medium. Such plasma can have a spatial extent that is far in excess of the Rayleigh range. In the case of water, the resulting ionization and dissociation gives rise to in situ generation of low-energy electrons and OH-radicals. Interactions of these with plasmid DNA produce nicks in the DNA backbone: single strand breaks (SSBs) are induced as are, at higher laser intensities, double strand breaks (DSBs). Under physiological conditions, the latter are not readily amenable to repair. Systematic quantification of SSBs and DSBs at different values of incident laser energy and under different external focusing conditions reveals that damage occurs in two distinct regimes. Numerical aperture is the experimental handle that delineates the two regimes, permitting simple optical control over the extent of DNA damage. PMID:27279565

  19. Optical control of filamentation-induced damage to DNA by intense, ultrashort, near-infrared laser pulses

    PubMed Central

    Dharmadhikari, J. A.; Dharmadhikari, A. K.; Kasuba, K. C.; Bharambe, H.; D’Souza, J. S.; Rathod, K. D.; Mathur, D.

    2016-01-01

    We report on damage to DNA in an aqueous medium induced by ultrashort pulses of intense laser light of 800 nm wavelength. Focusing of such pulses, using lenses of various focal lengths, induces plasma formation within the aqueous medium. Such plasma can have a spatial extent that is far in excess of the Rayleigh range. In the case of water, the resulting ionization and dissociation gives rise to in situ generation of low-energy electrons and OH-radicals. Interactions of these with plasmid DNA produce nicks in the DNA backbone: single strand breaks (SSBs) are induced as are, at higher laser intensities, double strand breaks (DSBs). Under physiological conditions, the latter are not readily amenable to repair. Systematic quantification of SSBs and DSBs at different values of incident laser energy and under different external focusing conditions reveals that damage occurs in two distinct regimes. Numerical aperture is the experimental handle that delineates the two regimes, permitting simple optical control over the extent of DNA damage. PMID:27279565

  20. Pteridium aquilinum and its ptaquiloside toxin induce DNA damage response in gastric epithelial cells, a link with gastric carcinogenesis.

    PubMed

    Gomes, Joana; Magalhães, Ana; Michel, Valérie; Amado, Inês F; Aranha, Paulo; Ovesen, Rikke G; Hansen, Hans C B; Gärtner, Fátima; Reis, Celso A; Touati, Eliette

    2012-03-01

    The multifactorial origin of gastric cancer encompasses environmental factors mainly associated with diet. Pteridium aquilinum-bracken fern-is the only higher plant known to cause cancer in animals. Its carcinogenic toxin, ptaquiloside, has been identified in milk of cows and groundwater. Humans can be directly exposed by consumption of the plant, contaminated water or milk, and spore inhalation. Epidemiological studies have shown an association between bracken exposure and gastric cancer. In the present work, the genotoxicity of P. aquilinum and ptaquiloside, including DNA damaging effects and DNA damage response, was characterized in human gastric epithelial cells and in a mouse model. In vitro, the highest doses of P. aquilinum extracts (40 mg/ml) and ptaquiloside (60 μg/ml) decreased cell viability and induced apoptosis. γH2AX and P53-binding protein 1 analysis indicated induction of DNA strand breaks in treated cells. P53 level also increased after exposure, associated with ATR-Chk1 signaling pathway activation. The involvement of ptaquiloside in the DNA damage activity of P. aquilinum was confirmed by deregulation of the expression of a panel of genes related to DNA damage signaling pathways and DNA repair, in response to purified ptaquiloside. Oral administration of P. aquilinum extracts to mice increased gastric cell proliferation and led to frameshift events in intron 2 of the P53 gene. Our data demonstrate the direct DNA damaging and mutagenic effects of P. aquilinum. These results are in agreement with the carcinogenic properties attributed to this fern and its ptaquiloside toxin and support their role in promoting gastric carcinogenesis. PMID:22143989

  1. Profiling DNA damage-induced phosphorylation in budding yeast reveals diverse signaling networks.

    PubMed

    Zhou, Chunshui; Elia, Andrew E H; Naylor, Maria L; Dephoure, Noah; Ballif, Bryan A; Goel, Gautam; Xu, Qikai; Ng, Aylwin; Chou, Danny M; Xavier, Ramnik J; Gygi, Steven P; Elledge, Stephen J

    2016-06-28

    The DNA damage response (DDR) is regulated by a protein kinase signaling cascade that orchestrates DNA repair and other processes. Identifying the substrate effectors of these kinases is critical for understanding the underlying physiology and mechanism of the response. We have used quantitative mass spectrometry to profile DDR-dependent phosphorylation in budding yeast and genetically explored the dependency of these phosphorylation events on the DDR kinases MEC1, RAD53, CHK1, and DUN1. Based on these screens, a database containing many novel DDR-regulated phosphorylation events has been established. Phosphorylation of many of these proteins has been validated by quantitative peptide phospho-immunoprecipitation and examined for functional relevance to the DDR through large-scale analysis of sensitivity to DNA damage in yeast deletion strains. We reveal a link between DDR signaling and the metabolic pathways of inositol phosphate and phosphatidyl inositol synthesis, which are required for resistance to DNA damage. We also uncover links between the DDR and TOR signaling as well as translation regulation. Taken together, these data shed new light on the organization of DDR signaling in budding yeast. PMID:27298372

  2. DNA fragmentation induced by fe ions in human cells: shielding influence on spatially correlated damage

    SciTech Connect

    Antonelli, F.; Belli, M.; Campa, A.; Chatterjee, A.; Dini, V.; Esposito, G.; Rydberg, B.; Simone, G.; Tabocchini, M.A.

    2003-11-19

    Outside the magnetic field of the Earth, high energy heavy ions constitute a relevant part of the biologically significant dose to astronauts during the very long travels through space. The typical pattern of energy deposition in the matter by heavy ions on the microscopic scale is believed to produce spatially correlated damage in the DNA which is critical for radiobiological effects. We have investigated the influence of a lucite shielding on the initial production of very small DNA fragments in human fibroblasts irradiated with 1 GeV/u iron (Fe) ions. We also used small gamma, Greek-rays as reference radiation. Our results show: (1) a lower effect per incident ion when the shielding is used; (2) an higher DNA Double Strand Breaks (DSB) induction by Fe ions than by small gamma, Greek-rays in the size range 123 kbp; (3) a non-random DNA DSB induction by Fe ions.

  3. DNA fragmentation induced by Fe ions in human cells: shielding influence on spatially correlated damage

    NASA Technical Reports Server (NTRS)

    Antonelli, F.; Belli, M.; Campa, A.; Chatterjee, A.; Dini, V.; Esposito, G.; Rydberg, B.; Simone, G.; Tabocchini, M. A.

    2004-01-01

    Outside the magnetic field of the Earth, high energy heavy ions constitute a relevant part of the biologically significant dose to astronauts during the very long travels through space. The typical pattern of energy deposition in the matter by heavy ions on the microscopic scale is believed to produce spatially correlated damage in the DNA which is critical for radiobiological effects. We have investigated the influence of a lucite shielding on the initial production of very small DNA fragments in human fibroblasts irradiated with 1 GeV/u iron (Fe) ions. We also used gamma rays as reference radiation. Our results show: (1) a lower effect per incident ion when the shielding is used; (2) an higher DNA Double Strand Breaks (DSB) induction by Fe ions than by gamma rays in the size range 1-23 kbp; (3) a non-random DNA DSB induction by Fe ions. c2004 COSPAR. Published by Elsevier Ltd. All rights reserved.

  4. Ionizing radiation-induced DNA injury and damage detection in patients with breast cancer

    PubMed Central

    Borrego-Soto, Gissela; Ortiz-López, Rocío; Rojas-Martínez, Augusto

    2015-01-01

    Abstract Breast cancer is the most common malignancy in women. Radiotherapy is frequently used in patients with breast cancer, but some patients may be more susceptible to ionizing radiation, and increased exposure to radiation sources may be associated to radiation adverse events. This susceptibility may be related to deficiencies in DNA repair mechanisms that are activated after cell-radiation, which causes DNA damage, particularly DNA double strand breaks. Some of these genetic susceptibilities in DNA-repair mechanisms are implicated in the etiology of hereditary breast/ovarian cancer (pathologic mutations in the BRCA 1 and 2 genes), but other less penetrant variants in genes involved in sporadic breast cancer have been described. These same genetic susceptibilities may be involved in negative radiotherapeutic outcomes. For these reasons, it is necessary to implement methods for detecting patients who are susceptible to radiotherapy-related adverse events. This review discusses mechanisms of DNA damage and repair, genes related to these functions, and the diagnosis methods designed and under research for detection of breast cancer patients with increased radiosensitivity. PMID:26692152

  5. Selective anticancer activity of hirsutine against HER2‑positive breast cancer cells by inducing DNA damage.

    PubMed

    Lou, Chenghua; Yokoyama, Satoru; Saiki, Ikuo; Hayakawa, Yoshihiro

    2015-04-01

    Hirsutine is one of the major alkaloids isolated from plants of the Uncaria genus and is known for its cardioprotective, anti‑hypertensive and anti-arrhythmic activities. We recently reported that hirsutine is an anti-metastatic phytochemical by targeting NF-κB activation in a murine breast cancer model. In the present study, we further examined the clinical utility of hirsutine against human breast cancer. Among six distinct human breast cancer cell lines, hirsutine showed strong cytotoxicity against HER2-positive/p53-mutated MDA-MB‑453 and BT474 cell lines. Conversely, HER2-negative/p53 wild‑type MCF-7 and ZR-75-1 cell lines showed resistance against hirsutine-induced cytotoxicity. Hirsutine induced apoptotic cell death in the MDA-MB-453 cells, but not in the MCF-7 cells, through activation of caspases. Furthermore, hirsutine induced the DNA damage response in the MDA-MB-453 cells, but not in the MCF-7 cells, as highlighted by the upregulation of γH2AX expression. Along with the induction of the DNA damage response, the suppression of HER2, NF-κB and Akt pathways and the activation of the p38 MAPK pathway in the MDA-MB-453 cells were observed. Considering that there was no difference between MDA-MB-453 and MCF-7 cells in regards to irinotecan‑induced DNA damage response, our present results indicate the selective anticancer activity of hirsutine in HER2-positive breast cancer by inducing a DNA damage response. PMID:25672479

  6. DNA-damage response gene GADD45A induces differentiation in hematopoietic stem cells without inhibiting cell cycle or survival.

    PubMed

    Wingert, Susanne; Thalheimer, Frederic B; Haetscher, Nadine; Rehage, Maike; Schroeder, Timm; Rieger, Michael A

    2016-03-01

    Hematopoietic stem cells (HSCs) maintain blood cell production life-long by their unique abilities of self-renewal and differentiation into all blood cell lineages. Growth arrest and DNA-damage-inducible 45 alpha (GADD45A) is induced by genotoxic stress in HSCs. GADD45A has been implicated in cell cycle control, cell death and senescence, as well as in DNA-damage repair. In general, GADD45A provides cellular stability by either arresting the cell cycle progression until DNA damage is repaired or, in cases of fatal damage, by inducing apoptosis. However, the function of GADD45A in hematopoiesis remains controversial. We revealed the changes in murine HSC fate control orchestrated by the expression of GADD45A at single cell resolution. In contrast to other cellular systems, GADD45A expression did not cause a cell cycle arrest or an alteration in the decision between cell survival and apoptosis in HSCs. Strikingly, GADD45A strongly induced and accelerated the differentiation program in HSCs. Continuous tracking of individual HSCs and their progeny via time-lapse microscopy elucidated that once GADD45A was expressed, HSCs differentiate into committed progenitors within 29 hours. GADD45A-expressing HSCs failed to long-term reconstitute the blood of recipients by inducing multilineage differentiation in vivo. Importantly, γ-irradiation of HSCs induced their differentiation by upregulating endogenous GADD45A. The differentiation induction by GADD45A was transmitted by activating p38 Mitogen-activated protein kinase (MAPK) signaling and allowed the generation of megakaryocytic-erythroid, myeloid, and lymphoid lineages. These data indicate that genotoxic stress-induced GADD45A expression in HSCs prevents their fatal transformation by directing them into differentiation and thereby clearing them from the system. Stem Cells 2016;34:699-710. PMID:26731607

  7. MicroRNA response to DNA damage

    PubMed Central

    Wan, Guohui; Mathur, Rohit; Hu, Xiaoxiao; Zhang, Xinna; Lu, Xiongbin

    2011-01-01

    Faithful transmission of genetic material in eukaryotic cells requires not only accurate DNA replication and chromosome distribution, but also the ability to sense and repair spontaneous and induced DNA damage. To maintain genomic integrity, cells undergo a DNA damage response using a complex network of signaling pathways, composed of coordinate sensors, transducers and effectors in cell cycle arrest, apoptosis and DNA repair. Emerging evidence has suggested that microRNAs (miRNAs) play a critical role in regulation of DNA damage response. Here, we discuss the recent findings on how miRNAs interact with the canonical DNA damage response and how miRNA expression is regulated after DNA damage. PMID:21741842

  8. A new arylbenzofuran derivative functions as an anti-tumour agent by inducing DNA damage and inhibiting PARP activity

    PubMed Central

    Chen, Hongbo; Zeng, Xiaobin; Gao, Chunmei; Ming, Pinghong; Zhang, Jianping; Guo, Caiping; Zhou, Lanzhen; Lu, Yin; Wang, Lijun; Huang, Laiqiang; He, Xiangjiu; Mei, Lin

    2015-01-01

    We previously reported that 7-hydroxy-5, 4’-dimethoxy-2-arylbenzofuran (HDAB) purified from Livistona chinensis is a key active agent. The present study investigated the function and molecular mechanism of HDAB. HDAB treatment of cervical cancer cells resulted in S phase arrest and apoptosis, together with cyclin A2 and CDK2 upregulation. Cyclin A2 siRNA and a CDK inhibitor efficiently relieved S phase arrest but increased the apoptosis rate. Mechanistic studies revealed that HDAB treatment significantly increased DNA strand breaks in an alkaline comet assay and induced ATM, CHK1, CHK2 and H2A.X phosphorylation. Wortmannin (a broad inhibitor of PIKKs) and CGK733 (a specific ATM inhibitor), but not LY294002 (a phosphatidylinositol 3-kinase inhibitor) or NU7026 (a DNA-PK specific inhibitor), prevented H2A.X phosphorylation and γH2A.X-positive foci formation in the nuclei, reversed S phase arrest and promoted the HDAB-induced apoptosis, suggesting that HDAB is a DNA damaging agent that can activate the ATM-dependent DNA repair response, thereby contributing to cell cycle arrest. In addition, molecular docking and in vitro activity assays revealed that HDAB can correctly dock into the hydrophobic pocket of PARP-1 and suppress PARP-1 ADP-ribosylation activity. Thus, the results indicated that HDAB can function as an anti-cancer agent by inducing DNA damage and inhibiting PARP activity. PMID:26041102

  9. Polyploid cells rewire DNA damage response networks to overcome replication stress-induced barriers for tumour progression

    PubMed Central

    Zheng, Li; Dai, Huifang; Zhou, Mian; Li, Xiaojin; Liu, Changwei; Guo, Zhigang; Wu, Xiwei; Wu, Jun; Wang, Charles; Zhong, John; Huang, Qin; Garcia-Aguilar, Julio; Pfeifer, Gerd P.; Shen, Binghui

    2012-01-01

    Mutations in genes involved in DNA replication such as FEN1, can cause single-stranded DNA breaks (SSBs) and subsequent collapse of DNA replication forks leading to DNA replication stresses. Persistent replication stresses normally induce p53-mediated senescence or apoptosis to prevent tumor progression. It is unclear how some mutant cells can overcome persistent replication stresses and bypass the p53-mediated pathways to develop malignancy. Here we show that formation of polyploidy, which is often observed in human cancers, leads to overexpression of BRCA1, p19arf and other DNA repair genes in FEN1 mutant cells. This overexpression triggers SSB repair and non-homologous end joining pathways to increase DNA repair activity, but at the cost of frequent chromosomal translocations. Meanwhile, DNA methylation silences p53 target genes, to bypass the p53-mediated senescence and apoptosis. These molecular changes rewire DNA damage response and repair gene networks in polyploid tumor cells, enabling them to escape replication stress-induced senescence barriers. PMID:22569363

  10. HIPK2: A tumour suppressor that controls DNA damage-induced cell fate and cytokinesis.

    PubMed

    Hofmann, Thomas G; Glas, Carolina; Bitomsky, Nadja

    2013-01-01

    In response to DNA-damage, cells have to decide between different cell fate programmes. Activation of the tumour suppressor HIPK2 specifies the DNA damage response (DDR) and tips the cell fate balance towards an apoptotic response. HIPK2 is activated by the checkpoint kinase ATM, and triggers apoptosis through regulatory phosphorylation of a set of cellular key molecules including the tumour suppressor p53 and the anti-apoptotic corepressor CtBP. Recent work has identified HIPK2 as a regulator of the ultimate step in cytokinesis: the abscission of the mother and daughter cells. Since proper cytokinesis is essential for genome stability and maintenance of correct ploidy, this finding sheds new light on the tumour suppressor function of HIPK2. Here we highlight the molecular mechanisms coordinating HIPK2 function and discuss its emerging role as a tumour suppressor. PMID:23169233

  11. Anthracyclines Induce DNA Damage Response-Mediated Protection against Severe Sepsis

    PubMed Central

    Figueiredo, Nuno; Chora, Angelo; Raquel, Helena; Pejanovic, Nadja; Pereira, Pedro; Hartleben, Björn; Neves-Costa, Ana; Moita, Catarina; Pedroso, Dora; Pinto, Andreia; Marques, Sofia; Faridi, Hafeez; Costa, Paulo; Gozzelino, Raffaella; Zhao, Jimmy L.; Soares, Miguel P.; Gama-Carvalho, Margarida; Martinez, Jennifer; Zhang, Qingshuo; Döring, Gerd; Grompe, Markus; Simas, J. Pedro; Huber, Tobias B.; Baltimore, David; Gupta, Vineet; Green, Douglas R.; Ferreira, João A.; Moita, Luis F.

    2014-01-01

    Summary Severe sepsis remains a poorly understood systemic inflammatory condition with high mortality rates and limited therapeutic options in addition to organ support measures. Here we show that the clinically approved group of anthracyclines acts therapeutically at a low dose regimen to confer robust protection against severe sepsis in mice. This salutary effect is strictly dependent on the activation of DNA damage response and autophagy pathways in the lung, as demonstrated by deletion of the ataxia telangiectasia mutated (Atm) or the autophagy-related protein 7 (Atg7) specifically in this organ. The protective effect of anthracyclines occurs irrespectively of pathogen burden, conferring disease tolerance to severe sepsis. These findings demonstrate that DNA damage responses, including the ATM and Fancony Anemia pathways, are important modulators of immune responses and might be exploited to confer protection to inflammation-driven conditions, including severe sepsis. PMID:24184056

  12. Anthracyclines induce DNA damage response-mediated protection against severe sepsis.

    PubMed

    Figueiredo, Nuno; Chora, Angelo; Raquel, Helena; Pejanovic, Nadja; Pereira, Pedro; Hartleben, Björn; Neves-Costa, Ana; Moita, Catarina; Pedroso, Dora; Pinto, Andreia; Marques, Sofia; Faridi, Hafeez; Costa, Paulo; Gozzelino, Raffaella; Zhao, Jimmy L; Soares, Miguel P; Gama-Carvalho, Margarida; Martinez, Jennifer; Zhang, Qingshuo; Döring, Gerd; Grompe, Markus; Simas, J Pedro; Huber, Tobias B; Baltimore, David; Gupta, Vineet; Green, Douglas R; Ferreira, João A; Moita, Luis F

    2013-11-14

    Severe sepsis remains a poorly understood systemic inflammatory condition with high mortality rates and limited therapeutic options in addition to organ support measures. Here we show that the clinically approved group of anthracyclines acts therapeutically at a low dose regimen to confer robust protection against severe sepsis in mice. This salutary effect is strictly dependent on the activation of DNA damage response and autophagy pathways in the lung, as demonstrated by deletion of the ataxia telangiectasia mutated (Atm) or the autophagy-related protein 7 (Atg7) specifically in this organ. The protective effect of anthracyclines occurs irrespectively of pathogen burden, conferring disease tolerance to severe sepsis. These findings demonstrate that DNA damage responses, including the ATM and Fanconi Anemia pathways, are important modulators of immune responses and might be exploited to confer protection to inflammation-driven conditions, including severe sepsis. PMID:24184056

  13. DNA damage-responsive Drosophila melanogaster gene is also induced by heat shock

    SciTech Connect

    Vivino, A.A.; Smith, M.D.; Minton, K.W.

    1986-12-01

    A gene isolated by screening Drosophila melanogaster tissue culture cells for DNA damage regulation was also found to be regulated by heat shock. After UV irradiation or heat shock, induction is at the transcriptional level and results in the accumulation of a 1.0-kilobase polyadenylated transcript. The restriction map of the clone bears no resemblance to the known heat shock genes, which are shown to be uninduced by UV irradiation.

  14. DNA damage-induced regulatory interplay between DAXX, p53, ATM kinase and Wip1 phosphatase

    PubMed Central

    Brazina, Jan; Svadlenka, Jan; Macurek, Libor; Andera, Ladislav; Hodny, Zdenek; Bartek, Jiri; Hanzlikova, Hana

    2015-01-01

    Death domain-associated protein 6 (DAXX) is a histone chaperone, putative regulator of apoptosis and transcription, and candidate modulator of p53-mediated gene expression following DNA damage. DAXX becomes phosphorylated upon DNA damage, however regulation of this modification, and its relationship to p53 remain unclear. Here we show that in human cells exposed to ionizing radiation or genotoxic drugs etoposide and neocarzinostatin, DAXX became rapidly phosphorylated in an ATM kinase-dependent manner. Our deletion and site-directed mutagenesis experiments identified Serine 564 (S564) as the dominant ATM-targeted site of DAXX, and immunofluorescence experiments revealed localization of S564-phosphorylated DAXX to PML nuclear bodies. Furthermore, using a panel of human cell types, we identified the p53-regulated Wip1 protein phosphatase as a key negative regulator of DAXX phosphorylation at S564, both in vitro and in cells. Consistent with the emerging oncogenic role of Wip1, its DAXX-dephosphorylating impact was most apparent in cancer cell lines harboring gain-of-function mutant and/or overexpressed Wip1. Unexpectedly, while Wip1 depletion increased DAXX phosphorylation both before and after DNA damage and increased p53 stability and transcriptional activity, knock-down of DAXX impacted neither p53 stabilization nor p53-mediated expression of Gadd45a, Noxa, Mdm2, p21, Puma, Sesn2, Tigar or Wip1. Consistently, analyses of cells with genetic, TALEN-mediated DAXX deletion corroborated the notion that neither phosphorylated nor non-phosphorylated DAXX is required for p53-mediated gene expression upon DNA damage. Overall, we identify ATM kinase and Wip1 phosphatase as opposing regulators of DAXX-S564 phosphorylation, and propose that the role of DAXX phosphorylation and DAXX itself are independent of p53-mediated gene expression. PMID:25659035

  15. Gene Expression Profile Changes and Cellular Responses to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Kidane, Yared; Feiveson, Alan; Stodieck, Louis; Karouia, Fathi; Rohde, Larry; Wu, Honglu

    2016-01-01

    Living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. In addition, DNA in space can be damaged by toxic chemicals or reactive oxygen species generated due to increased levels of environmental and psychological stresses. Understanding the impact of spaceflight factors, microgravity in particular, on cellular responses to DNA damage affects the accuracy of the radiation risk assessment for astronauts and the mutation rate in microorganisms. Although possible synergistic effects of space radiation and microgravity have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate the effects of spaceflight on cellular responses to DNA damage, confluent human fibroblast cells (AG1522) flown on the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induced DNA damages including double-strand breaks (DSB). Damages in the DNA were quantified by immunofluorescence staining for ?-H2AX, which showed similar percentages of different types of stained cells between flight and ground. However, there was a slight shift in the distribution of the ?-H2AX foci number in the flown cells with countable foci. Comparison of the cells in confluent and in exponential growth conditions indicated that the proliferation rate between flight and the ground may be responsible for such a shift. A microarray analysis of gene expressions in response to bleomycin treatment was also performed. Comparison of the responsive pathways between the flown and ground cells showed similar responses with the p53 network being the top upstream regulator. Similar responses at the RNA level between different gravity conditions were also observed with a PCR array analysis containing a set of genes involved in DNA damage signaling; with BBC3, CDKN1A, PCNA and PPM1D being significantly

  16. Dasatinib induces DNA damage and activates DNA repair pathways leading to senescence in non-small cell lung cancer cell lines with kinase-inactivating BRAF mutations

    PubMed Central

    Peng, Shaohua; Sen, Banibrata; Mazumdar, Tuhina; Byers, Lauren A.; Diao, Lixia; Wang, Jing; Tong, Pan; Giri, Uma; Heymach, John V.; Kadara, Humam N.; Johnson, Faye M.

    2016-01-01

    Improved therapies are greatly needed for non-small cell lung cancer (NSCLC) that does not harbor targetable kinase mutations or translocations. We previously demonstrated that NSCLC cells that harbor kinase-inactivating BRAF mutations (KIBRAF) undergo senescence when treated with the multitargeted kinase inhibitor dasatinib. Similarly, treatment with dasatinib resulted in a profound and durable response in a patient with KIBRAF NSCLC. However, no canonical pathways explain dasatinib-induced senescence in KIBRAF NSCLC. To investigate the underlying mechanism, we used 2 approaches: gene expression and reverse phase protein arrays. Both approaches showed that DNA repair pathways were differentially modulated between KIBRAF NSCLC cells and those with wild-type (WT) BRAF. Consistent with these findings, dasatinib induced DNA damage and activated DNA repair pathways leading to senescence only in the KIBRAF cells. Moreover, dasatinib-induced senescence was dependent on Chk1 and p21, proteins known to mediate DNA damage-induced senescence. Dasatinib also led to a marked decrease in TAZ but not YAP protein levels. Overexpression of TAZ inhibited dasatinib-induced senescence. To investigate other vulnerabilities in KIBRAF NSCLC cells, we compared the sensitivity of these cells with that of WTBRAF NSCLC cells to 79 drugs and identified a pattern of sensitivity to EGFR and MEK inhibitors in the KIBRAF cells. Clinically approved EGFR and MEK inhibitors, which are better tolerated than dasatinib, could be used to treat KIBRAF NSCLC. Our novel finding that dasatinib induced DNA damage and subsequently activated DNA repair pathways leading to senescence in KIBRAF NSCLC cells represents a unique vulnerability with potential clinical applications. PMID:26623721

  17. Nucleolar disruption and cajal body disassembly are nuclear hallmarks of DNA damage-induced neurodegeneration in purkinje cells.

    PubMed

    Baltanás, Fernando C; Casafont, Iñigo; Weruaga, Eduardo; Alonso, José R; Berciano, María T; Lafarga, Miguel

    2011-07-01

    The Purkinje cell (PC) degeneration (pcd) phenotype results from mutation in nna1 gene and is associated with the degeneration and death of PCs during the postnatal life. Although the pcd mutation is a model of the ataxic mouse, it shares clinical and pathological characteristics of inherited human spinocerebellar ataxias. PC degeneration in pcd mice provides a useful neuronal system to study nuclear mechanisms involved in DNA damage-dependent neurodegeneration, particularly the contribution of nucleoli and Cajal bodies (CBs). Both nuclear structures are engaged in housekeeping functions for neuronal survival, the biogenesis of ribosomes and the maturation of snRNPs and snoRNPs required for pre-mRNA and pre-rRNA processing, respectively. In this study, we use ultrastructural analysis, in situ transcription assay and molecular markers for DNA damage, nucleoli and CB components to demonstrate that PC degeneration involves the progressive accumulation of nuclear DNA damage associated with disruption of nucleoli and CBs, disassembly of polyribosomes into monoribosomes, ribophagy and shut down of nucleolar and extranucleolar transcription. Microarray analysis reveals that four genes encoding repressors of nucleolar rRNA synthesis (p53, Rb, PTEN and SNF2) are upregulated in the cerebellum of pcd mice. Collectively, these data support that nucleolar and CB alterations are hallmarks of DNA damage-induced neurodegeneration. PMID:21054627

  18. Squalene Inhibits ATM-Dependent Signaling in γIR-Induced DNA Damage Response through Induction of Wip1 Phosphatase

    PubMed Central

    Tatewaki, Naoto; Konishi, Tetsuya; Nakajima, Yuki; Nishida, Miyako; Saito, Masafumi; Eitsuka, Takahiro; Sakamaki, Toshiyuki; Ikekawa, Nobuo; Nishida, Hiroshi

    2016-01-01

    Ataxia telangiectasia mutated (ATM) kinase plays a crucial role as a master controller in the cellular DNA damage response. Inhibition of ATM leads to inhibition of the checkpoint signaling pathway. Hence, addition of checkpoint inhibitors to anticancer therapies may be an effective targeting strategy. A recent study reported that Wip1, a protein phosphatase, de-phosphorylates serine 1981 of ATM during the DNA damage response. Squalene has been proposed to complement anticancer therapies such as chemotherapy and radiotherapy; however, there is little mechanistic information supporting this idea. Here, we report the inhibitory effect of squalene on ATM-dependent DNA damage signals. Squalene itself did not affect cell viability and the cell cycle of A549 cells, but it enhanced the cytotoxicity of gamma-irradiation (γIR). The in vitro kinase activity of ATM was not altered by squalene. However, squalene increased Wip1 expression in cells and suppressed ATM activation in γIR-treated cells. Consistent with the potential inhibition of ATM by squalene, IR-induced phosphorylation of ATM effectors such as p53 (Ser15) and Chk1 (Ser317) was inhibited by cell treatment with squalene. Thus, squalene inhibits the ATM-dependent signaling pathway following DNA damage through intracellular induction of Wip1 expression. PMID:26824362

  19. Modulation of DNA-Induced Damage and Repair Capacity in Humans after Dietary Intervention with Lutein-Enriched Fermented Milk

    PubMed Central

    Herrero-Barbudo, Carmen; Soldevilla, Beatriz; Pérez-Sacristán, Belén; Blanco-Navarro, Inmaculada; Herrera, Mercedes; Granado-Lorencio, Fernando; Domínguez, Gemma

    2013-01-01

    Dietary factors provide protection against several forms of DNA damage. Additionally, consumer demand for natural products favours the development of bioactive food ingredients with health benefits. Lutein is a promising biologically active component in the food industry. The EFSA Panel on Dietetic Products, Nutrition and Allergies considers that protection from oxidative damage may be a beneficial physiological effect but that a cause and effect relationship has not been established. Thus, our aim was to evaluate the safety and potential functional effect of a lutein-enriched milk product using the Comet Assay in order to analyze the baseline, the induced DNA-damage and the repair capacity in the lymphocytes of 10 healthy donors before and after the intake of the mentioned product. Our data suggest that the regular consumption of lutein-enriched fermented milk results in a significant increase in serum lutein levels and this change is associated with an improvement in the resistance of DNA to damage and the capacity of DNA repair in lymphocytes. Our results also support the lack of a genotoxic effect at the doses supplied as well as the absence of interactions and side effects on other nutritional and biochemicals markers. PMID:24040187

  20. Modulation of DNA-induced damage and repair capacity in humans after dietary intervention with lutein-enriched fermented milk.

    PubMed

    Herrero-Barbudo, Carmen; Soldevilla, Beatriz; Pérez-Sacristán, Belén; Blanco-Navarro, Inmaculada; Herrera, Mercedes; Granado-Lorencio, Fernando; Domínguez, Gemma

    2013-01-01

    Dietary factors provide protection against several forms of DNA damage. Additionally, consumer demand for natural products favours the development of bioactive food ingredients with health benefits. Lutein is a promising biologically active component in the food industry. The EFSA Panel on Dietetic Products, Nutrition and Allergies considers that protection from oxidative damage may be a beneficial physiological effect but that a cause and effect relationship has not been established. Thus, our aim was to evaluate the safety and potential functional effect of a lutein-enriched milk product using the Comet Assay in order to analyze the baseline, the induced DNA-damage and the repair capacity in the lymphocytes of 10 healthy donors before and after the intake of the mentioned product. Our data suggest that the regular consumption of lutein-enriched fermented milk results in a significant increase in serum lutein levels and this change is associated with an improvement in the resistance of DNA to damage and the capacity of DNA repair in lymphocytes. Our results also support the lack of a genotoxic effect at the doses supplied as well as the absence of interactions and side effects on other nutritional and biochemicals markers. PMID:24040187

  1. Squalene Inhibits ATM-Dependent Signaling in γIR-Induced DNA Damage Response through Induction of Wip1 Phosphatase.

    PubMed

    Tatewaki, Naoto; Konishi, Tetsuya; Nakajima, Yuki; Nishida, Miyako; Saito, Masafumi; Eitsuka, Takahiro; Sakamaki, Toshiyuki; Ikekawa, Nobuo; Nishida, Hiroshi

    2016-01-01

    Ataxia telangiectasia mutated (ATM) kinase plays a crucial role as a master controller in the cellular DNA damage response. Inhibition of ATM leads to inhibition of the checkpoint signaling pathway. Hence, addition of checkpoint inhibitors to anticancer therapies may be an effective targeting strategy. A recent study reported that Wip1, a protein phosphatase, de-phosphorylates serine 1981 of ATM during the DNA damage response. Squalene has been proposed to complement anticancer therapies such as chemotherapy and radiotherapy; however, there is little mechanistic information supporting this idea. Here, we report the inhibitory effect of squalene on ATM-dependent DNA damage signals. Squalene itself did not affect cell viability and the cell cycle of A549 cells, but it enhanced the cytotoxicity of gamma-irradiation (γIR). The in vitro kinase activity of ATM was not altered by squalene. However, squalene increased Wip1 expression in cells and suppressed ATM activation in γIR-treated cells. Consistent with the potential inhibition of ATM by squalene, IR-induced phosphorylation of ATM effectors such as p53 (Ser15) and Chk1 (Ser317) was inhibited by cell treatment with squalene. Thus, squalene inhibits the ATM-dependent signaling pathway following DNA damage through intracellular induction of Wip1 expression. PMID:26824362

  2. The effect of quercetin on oxidative DNA damage and myelosuppression induced by etoposide in bone marrow cells of rats.

    PubMed

    Papież, Monika A

    2014-01-01

    There is increasing evidence for the existence of an association between the presence of etoposide phenoxyl radicals and the development of treatment-related acute myeloid leukemia (t-AML), which occurs in a few percent of patients treated with this chemotherapeutic agent. The most common side effect caused by etoposide is myelosuppression, which limits the use of this effective drug. The goal of the study was to investigate the influence of antioxidant querectin on myelosuppression and oxidative DNA damage caused by etoposide. The influence of quercetin and/or etoposide on oxidative DNA damage was investigated in LT-12 cell line and bone marrow cells of rats via comet assay. The effect of quercetin on myelosuppression induced by etoposide was invetsigated by cytological analysis of bone marrow smears stained with May-Grünwald-Giemsa stain. Etoposide caused a significant increase in oxidative DNA damage in bone marrow cells and LT-12 cell line in comparison to the appropriate controls. Quercetin significantly reduced the oxidative DNA damage caused by etoposide both in vitro and in vivo. Quercetin also significantly protected against a decrease in the percentage of myeloid precursors and erythroid nucleated cells caused by etoposide administration in comparison to the group treated with etoposide alone. The results of the study indicate that quercetin could be considered a protectively acting compound in bone marrow cells during etoposide therapy. PMID:24644549

  3. Protective effect of enzymatic extracts from microalgae against DNA damage induced by H2O2.

    PubMed

    Karawita, Rohan; Senevirathne, Mahinda; Athukorala, Yasantha; Affan, Abu; Lee, Young-Jae; Kim, Se-Kwon; Lee, Joon-Baek; Jeon, You-Jin

    2007-01-01

    The enzymatic extracts from seven species of microalgae (Pediastrum duplex, Dactylococcopsis fascicularis, Halochlorococcum porphyrae, Oltmannsiellopsis unicellularis, Achnanthes longipes, Navicula sp. and Amphora coffeaeformis) collected from three habitats (freshwater, tidal pool, and coastal benthic) at Jeju Island in Korea were investigated for their antioxidant activity. Of the extracts tested, the AMG 300 L (an exo 1, 4-alpha-D-glucosidase) extract of P. duplex, the Viscozyme extract of Navicula sp., and the Celluclast extract of A. longipes provided the most potential as antioxidants. Meanwhile, the Termamyl extract of P. duplex in an H(2)O(2) scavenging assay exhibited an approximate 60% scavenging effect. In this study, we report that the DNA damage inhibitory effects of P. duplex (Termamyl extract) and D. fascicularis (Kojizyme extract) were nearly 80% and 69% respectively at a concentration of 100 microg/ml. Thus, it is suggested that the microalgae tested in this study yield promising DNA damage inhibitory properties on mouse lymphoma L 5178 cells that are treated with H(2)O(2). Therefore, microalgae such as P. duplex may be an excellent source of naturally occurring antioxidant compounds with potent DNA damage inhibition potential. PMID:17520314

  4. Endonuclease IV Is the Main Base Excision Repair Enzyme Involved in DNA Damage Induced by UVA Radiation and Stannous Chloride

    PubMed Central

    Motta, Ellen S.; Souza-Santos, Paulo Thiago; Cassiano, Tuany R.; Dantas, Flávio J. S.; Caldeira-de-Araujo, Adriano; De Mattos, José Carlos P.

    2010-01-01

    Stannous chloride (SnCl2) and UVA induce DNA lesions through ROS. The aim of this work was to study the toxicity induced by UVA preillumination, followed by SnCl2 treatment. E. coli BER mutants were used to identify genes which could play a role in DNA lesion repair generated by these agents. The survival assays showed (i) The nfo mutant was the most sensitive to SnCl2; (ii) lethal synergistic effect was observed after UVA pre-illumination, plus SnCl2 incubation, the nfo mutant being the most sensitive; (iii) wild type and nfo mutants, transformed with pBW21 plasmid (nfo+) had their survival increased following treatments. The alkaline agarose gel electrophoresis assays pointed that (i) UVA induced DNA breaks and fpg mutant was the most sensitive; (ii) SnCl2-induced DNA strand breaks were higher than those from UVA and nfo mutant had the slowest repair kinetics; (iii) UVA + SnCl2 promoted an increase in DNA breaks than SnCl2 and, again, nfo mutant displayed the slowest repair kinetics. In summary, Nfo protects E. coli cells against damage induced by SnCl2 and UVA + SnCl2. PMID:20300433

  5. Subcellular Localization of Proteins Responding to Mitoxantrone-Induced DNA Damage in Leukaemic Cells.

    PubMed

    Ćmielová, J; Lesná, M; Řezáčová, M

    2015-01-01

    The aim of the present study was to investigate the subcellular localization of proteins participating in the double-strand break response pathway - p53, Mdm2, p21 and Chk2. MOLT-4 cells were pre-treated with mitoxantrone in concentrations 1 nmol/l and 5 nmol/l. The trypan blue technique was used to determine cell viability and proliferation. Western blotting was used to evaluate changes in p53, Mdm2 and Chk2 protein expression and sandwich ELISA was used to evaluate changes in the p21 protein amount. After 1 nmol/l mitoxantrone cells did not die, but their ability to proliferate was decreased. The p53 protein was activated and phosphorylated at serines 15 and 392 and accumulated in the nucleus after 24 and 48 h. The Mdm2 protein was present in the cytoplasm with its maximal level after 8 and 16 h. The p21 protein was detected in the nucleus after 24 and 48 h. Increased levels of phosphorylated Chk2 at threonine 68 were observed in the cytoplasmic fraction after 24 and 48 h of mitoxantrone treatment. We used mitoxantrone as an inducer of double-strand breaks to bring new data about the subcellular distribution of proteins responding to DNA damage. In MOLT-4 cells, the p53 protein was activated. p53 was phosphorylated at serines 15 and 392 and accumulated in the nucleus. The Mdm2 protein was activated in advance to p53 and occurred in the cytoplasm. The p21 protein was present in the nucleus. Chk2 kinase was activated by the phosphorylation at threonine 68 and we observed increased levels of this protein in the cytoplasmic fraction. PMID:26333122

  6. Fe65 Is Phosphorylated on Ser289 after UV-Induced DNA Damage

    PubMed Central

    Langlands, Hannah; Blain, Peter G.; Jowsey, Paul A.

    2016-01-01

    Fe65 undergoes a phosphatase-sensitive gel mobility shift after DNA damage, consistent with protein phosphorylation. A recent study identified Ser228 as a specific site of phosphorylation, targeted by the ATM and ATR protein kinases, with phosphorylation inhibiting the Fe65-dependent transcriptional activity of the amyloid precursor protein (APP). The direct binding of Fe65 to APP not only regulates target gene expression, but also contributes to secretase-mediated processing of APP, producing cytoactive proteolytic fragments including the APP intracellular domain (AICD) and cytotoxic amyloid β (Aβ) peptides. Given that the accumulation of Aβ peptides in neural plaques is a pathological feature of Alzheimer’s disease (AD), it is essential to understand the mechanisms controlling Aβ production. This will aid in the development of potential therapeutic agents that act to limit the deleterious production of Aβ peptides. The Fe65-APP complex has transcriptional activity and the complex is regulated by multiple post-translational modifications and other protein binding partners. In the present study, we have identified Ser289 as a novel site of UV-induced phosphorylation. Interestingly, this phosphorylation was mediated by ATM, rather than ATR, and occurred independently of APP. Neither phosphorylation nor mutation of Ser289 affected the Fe65-APP interaction, though this was markedly decreased after UV treatment, with a concomitant decrease in the protein levels of APP in cells. Using mutagenesis, we demonstrated that Fe65 Ser289 phosphorylation did not affect the transcriptional activity of the Fe65-APP complex, in contrast to the previously described Ser228 site. PMID:27176072

  7. Tirapazamine-induced DNA damage measured using the comet assay correlates with cytotoxicity towards hypoxic tumour cells in vitro.

    PubMed Central

    Siim, B. G.; van Zijl, P. L.; Brown, J. M.

    1996-01-01

    Tirapazamine (SR 4233), a bioreductive drug selectively toxic towards hypoxic cells, is presently in phase II clinical trials. Since it would not be expected that all tumours would respond equally to the drug, we are exploring ways of predicting the response of individual tumours. In this study we have tested whether the comet assay, which measures DNA damage in individual cells, can provide a simple, surrogate end point for cell killing by tirapazamine. We examined the relationship between the cytotoxicity of tirapazamine under hypoxic conditions and tirapazamine-induced DNA strand breaks in murine (SCCVII, EMT6, RIF-1) and human (HT1080, A549, HT29) tumour cell lines. These results were compared with the relationship between tirapazamine cytotoxicity and another measure of the ability of cells to metabolise tirapazamine; high-performance liquid chromatography (HPLC) analysis of tirapazamine loss or formation of the two electron reduction product SR 4317. The correlation between the hypoxic cytotoxic potency of tirapazamine and DNA damage was highly significant (r = 0.905, P = 0.013). A similar correlation was observed for hypoxic potency and tirapazamine loss (r = 0.812, P = 0.050), while the correlation between hypoxic potency and SR 4317 formation was not significant (r = 0.634, P = 0.171). The hypoxic cytotoxicity of tirapazamine in vitro can therefore be predicted by measuring tirapazamine-induced DNA damage using the comet assay. This approach holds promise for predicting the response of individual tumours to tirapazamine in the clinic. PMID:8611431

  8. Calcium channel blockers protect against aluminium-induced DNA damage and block adaptive response to genotoxic stress in plant cells.

    PubMed

    Achary, V Mohan M; Parinandi, Narasimham L; Panda, Brahma B

    2013-03-18

    Calcium is an important second messenger in signal transduction pathways. The role of Ca(2+) signalling in Al-induced DNA damage, cell death, and adaptive response to genotoxic stress caused by ethyl methanesulfonate (EMS) or methylmercuric chloride (MMCl) in the root cells of Allium cepa was investigated in the current study. Root cells in planta were treated with Al(3+) (800μM of AlCl(3)) for 3h without or with 2h pre-treatment with the Ca(2+) chelator (EGTA) or Ca(2+) channel blockers (lanthanum chloride, verapamil) or CaM/CDPK antagonist (W7). In addition, root cells in planta were conditioned by treatment with Al(3+) (5 or 10μM of AlCl(3)) for 2h followed by the genotoxic challenge with MMCl (1.25μM) or EMS (2.5 or 5mM) for 3h without or with the pre-treatment of the chosen Ca(2+) chelator/channel blockers/antagonist. Following the treatments, cell death and DNA damage were investigated in the root cells by comet assay. Furthermore, genotoxicity in the root meristems was determined after 18-30h of recovery. These results revealed that Al(3+) (800μM) significantly induced DNA damage and cell death in the root cells of A. cepa. On the other hand, conditioning of the root cells with Al(3+) at low concentrations (5 or 10μM) offered adaptive response leading to the protection against genotoxic stress induced by MMCl and EMS. Pre-treatment of root cells with the Ca(2+) chelator/channel blockers/antagonist not only alleviated Al(3+)-induced DNA damage and cell death induced but also blocked the Al(3+)-mediated adaptive response to genotoxic stress induced by MMCl and EMS. For the first time, the results of the present study highlighted the role of Ca(2+) signalling underlying the biphasic mode of action of Al(3+) that induced DNA damage and cell death at high doses and offered adaptation to genotoxic response in plants at low doses. PMID:23313746

  9. Surface Etching and DNA Damage Induced by Low-Energy Ion Irradiation in Yeast

    NASA Astrophysics Data System (ADS)

    Liu, Xuelan; Xu, An; Dai, Yin; Yuan, Hang; Yu, Zengliang

    2011-06-01

    Bio-effects of survival and etching damage on cell surface and DNA strand breaks were investigated in the yeast saccharomyces cerevisiae after exposure by nitrogen ion with an energy below 40 keV. The result showed that 16% of trehalose provided definite protection for cells against vacuum stress compared with glycerol. In contrast to vacuum control, significant morphological damage and DNA strand breaks were observed, in yeast cells bombarded with low-energy nitrogen, by scanning electron microscopy (SEM) and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) immunofluorescence assays. Moreover, PI (propidium iodide) fluorescent staining indicated that cell integrity could be destroyed by ion irradiation. Cell damage eventually affected cell viability and free radicals were involved in cell damage as shown by DMSO (dimethyl sulfoxide) rescue experiment. Our primary experiments demonstrated that yeast cells can be used as an optional experimental model to study the biological effects of low energy ions and be applied to further investigate the mechanism(s) underlying the bio-effects of eukaryotic cells.

  10. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence.

    PubMed

    McKenna, Elise; Traganos, Frank; Zhao, Hong; Darzynkiewicz, Zbigniew

    2012-08-15

    Mutations of oncogenes and tumor suppressor genes which activate mTOR through several downstream signaling pathways are common to cancer. Activation of mTOR when combined with inhibition of cell cycle progression or DNA replication stress has previously been shown to promote cell senescence. In the present study, we examined the conditions under which human non-small cell lung carcinoma A549 cells can undergo senescence when treated with the DNA alkylating agent mitomycin C (MMC). While exposure of A549 cells to 0.1 or 0.5 µg/ml of MMC led to their arrest in S phase of the cell cycle and subsequent apoptosis, exposure to 0.01 or 0.02 µg/ml for 6 d resulted in induction of cell senescence and near total (0.01 µg/ml) or total (0.02 µg/ml) elimination of their reproductive potential. During exposure to these low concentrations of MMC, the cells demonstrated evidence of DNA replication stress manifested by expression of γH2AX, p21 (WAF1) and a very low level of EdU incorporation into DNA. The data are consistent with the notion that enduring DNA replication stress in cells known to have activated oncogenes leads to their senescence. It is reasonable to expect that tumors having constitutive activation of oncogenes triggering mTOR signaling may be particularly predisposed to undergoing senescence following prolonged treatment with low doses of DNA damaging drugs. PMID:22871735

  11. Functional specialization of Chlamydomonas reinhardtii cytosolic thioredoxin h1 in the response to alkylation-induced DNA damage.

    PubMed

    Sarkar, Nandita; Lemaire, Stéphane; Wu-Scharf, Danxia; Issakidis-Bourguet, Emmanuelle; Cerutti, Heriberto

    2005-02-01

    DNA damage occurs as a by-product of intrinsic cellular processes, like DNA replication, or as a consequence of exposure to genotoxic agents. Organisms have evolved multiple mechanisms to avoid, tolerate, or repair DNA lesions. To gain insight into these processes, we have isolated mutants hypersensitive to DNA-damaging agents in the green alga Chlamydomonas reinhardtii. One mutant, Ble-1, showed decreased survival when it was treated with methyl methanesulfonate (MMS), bleomycin, or hydrogen peroxide (H2O2) but behaved like the wild type when it was exposed to UVC irradiation. Ble-1 carries an extensive chromosomal deletion that includes the gene encoding cytosolic thioredoxin h1 (Trxh1). Transformation of Ble-1 with a wild-type copy of Trxh1 fully corrected the MMS hypersensitivity and partly restored the tolerance to bleomycin. Trxh1 also complemented a defect in the repair of MMS-induced DNA strand breaks and alkali-labile sites. In addition, a Trxh1-beta-glucuronidase fusion protein translocated to the nucleus in response to treatment with MMS. However, somewhat surprisingly, Trxh1 failed to correct the Ble-1 hypersensitivity to H2O2. Moreover, Trxh1 suppression by RNA interference in a wild-type strain resulted in enhanced sensitivity to MMS and DNA repair defects but no increased cytotoxicity to H2O2. Thioredoxins have been implicated in oxidative-stress responses in many organisms. Yet our results indicate a specific role of Chlamydomonas Trxh1 in the repair of MMS-induced DNA damage, whereas it is dispensable for the response to H2O2. These observations also suggest functional specialization among cytosolic thioredoxins since another Chlamydomonas isoform (Trxh2) does not compensate for the lack of Trxh1. PMID:15701788

  12. A novel DNA damage-inducible transcript, gadd7, inhibits cell growth, but lacks a protein product.

    PubMed Central

    Hollander, M C; Alamo, I; Fornace, A J

    1996-01-01

    gadd7 cDNA was isolated from Chinese hamster ovary (CHO) cells on the basis of increased levels of RNA following treatment with UV radiation. The transcript for gadd7, as well as for four other gadd genes, was found to increase rapidly and coordinately following several different types of DNA damage and more slowly following other stresses that elicit growth arrest. Agents that induce gadd7 RNA include alkylating agents, such as methyl methanesulfonate (MMS), N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and mechlorethamine HCl (HN2), oxidizing agents, such as hydrogen peroxide, and growth arrest signals, such as medium depletion (starvation). Since growth arrest is a cellular consequence of many types of DNA damage in normal cells, it was thought that gadd7 may play a role in the cellular response to DNA damage. Indeed, overexpression of gadd7 led to a decrease in cell growth. Interestingly, gadd7 cDNA does not contain an appreciable open reading frame and does not appear to encode a protein product, but instead may function at the RNA level. PMID:8649973

  13. Cellular responses to environmental DNA damage

    SciTech Connect

    Not Available

    1994-08-01

    This volume contains the proceedings of the conference entitled Cellular Responses to Environmental DNA Damage held in Banff,Alberta December 1--6, 1991. The conference addresses various aspects of DNA repair in sessions titled DNA repair; Basic Mechanisms; Lesions; Systems; Inducible Responses; Mutagenesis; Human Population Response Heterogeneity; Intragenomic DNA Repair Heterogeneity; DNA Repair Gene Cloning; Aging; Human Genetic Disease; and Carcinogenesis. Individual papers are represented as abstracts of about one page in length.

  14. Evidence that 3-hydroxy-3-methylglutaric and 3-methylglutaric acids induce DNA damage in rat striatum.

    PubMed

    da Rosa, Mateus Struecker; Scaini, Giselli; Damiani, Adriani Paganini; Longaretti, Luiza Martins; Pereira, Maiara; Seminotti, Bianca; Zapelini, Hugo Galvane; Schuck, Patrícia Fernanda; Streck, Emílio Luiz; de Andrade, Vanessa Moraes; Wajner, Moacir; Leipnitz, Guilhian

    2015-08-01

    3-Hydroxy-3-methylglutaryl-CoA lyase (HL) deficiency is a rare autosomal recessive disorderaffecting the final step of leucine degradation and ketogenesis and biochemically characterized by the predominant accumulation of 3-hydroxy-3-methylglutaric (HMG) and 3-methylglutaric (MGA) acids in biological fluids and tissues of affected patients. Considering that previous studies reported that HMG and MGA have pro oxidant properties, the present study evaluated the ex vivo and in vitro effects of HMG and MGA on frequency and index of DNA damage in cerebral cortex and striatum of young rats. The ex vivo effects of both organic acids on 8-hydroxy-2'-deoxyguanosine (OHdG) levels and their in vitro effects on 2',7'-dichlorofluorescin (DCFH) oxidation and glutathione (GSH) concentrations in rat striatum were also determined. We also investigated the ex vivo effects of both organic acids on 8-hydroxy-2'-deoxyguanosine (OHdG) levels in rat striatum. In the ex vivo experiments, DNA damage was determined in striatum homogenates prepared 30 min after a single intrastriatal administration of HMG or MGA. On the other hand, the in vitro evaluation was performed after an incubation of rat cerebral cortex or striatum homogenates or slices in the presence of HMG or MGA during 1 h at 37 °C. We observed that the intrastriatal administration of HMG and MGA increased the frequency and the index of DNA damage, as well as OHdG staining in rat striatum. We also verified that MGA, but not HMG, increased DNA damage frequency and index in vitro in striatum of rats. In contrast, no alterations were verified in vitro in cerebral cortex. Finally, we found that HMG and MGA increased DCFH oxidation and decreased GSH concentrations in rat striatum. Therefore, it may be presumed that DNA damage provoked by HMG and MGA possibly via reactive species generation is involved, at least in part, in the pathophysiology of brain injury, particularly in the striatum of HL-deficient patients. PMID:25939283

  15. Cigarette smoke-induced DNA damage and repair detected by the comet assay in HPV-transformed cervical cells

    PubMed Central

    Moktar, Afsoon; Ravoori, Srivani; Vadhanam, Manicka V.; Gairola, C. Gary; Gupta, Ramesh C.

    2010-01-01

    Human papillomavirus (HPV) is the causative factor in the development and progression of cervical cancers in >97% of the cases, although insufficient. Epidemiological studies suggest an elevated risk of cervical cancer for cigarette smokers; therefore, we examined cigarette smoke-induced DNA damage and repair in HPV16-transformed human ectocervical cells (ECT1/E6 E7). Cells were treated with cigarette smoke condensate (CSC) for 72 h to assess the formation of single- and double-strand DNA breaks, measured by alkaline and neutral single cell gel electrophoresis assays, respectively. The mean tail length of cells with single-strand breaks was increased by 1.8-, 2.7- and 3.7-fold (p<0.001) after treatment with 4, 8 and 12 µg/ml CSC, respectively. The tail length with double-strand breaks was also increased dose-dependently. These results were further supported by measurement of the mean tail moment: the increase in both single- and double-strand breaks were much more pronounced with increasing concentration of CSC, by up to 23.5-fold (p<0.0001 for both assays). To examine the DNA repair, cells were treated with CSC for 72 h, followed by CSC withdrawal and re-incubation of the cells with fresh medium for 24, 48, or 72 h. Both single- and double-strand DNA breaks were removed during the initial 24 h but no further removal of the damage was observed. Up to 80% of residual single- and double-strand DNA breaks (p<0.05) were found to persist at all CSC concentrations examined. Ellagic acid, a known antioxidant and free-radical scavenger, was found to significantly inhibit DNA breaks induced by CSC. Thus, free radicals may be a plausible source of CSC-induced DNA damage. These data show that CSC-mediated DNA strand breaks are highly persistent, and suggest that persistence of cigarette smoke-associated DNA damage in the presence of HPV infection may lead to increased mutations in cervical cells and ultimately higher cancer risk. PMID:19885552

  16. The study on space-flight induced DNA damage in Arabidopsis thaliana and the protective effect of hydrogen

    NASA Astrophysics Data System (ADS)

    Sun, Qiao; Liu, Min; Zhao, Hui

    2016-07-01

    Ionizing radiation (IR) is a known mutagen responsible for causing DNA strand breaks in all living organisms. Strand breaks thus created can be repaired by different mechanisms, including homologous recombination (HR), one of the key mechanisms maintaining genome stability. Here, we used previously generated Arabidopsis thaliana, transgenic for homologous recombination reporter system, in which homologous recombination frequency(HRF) was used as mutagenic end points. Based on the system, effect of DNA damage by space-flight during the Shenzhou-9 mission was investigated and the results showed that 13 days space-flight exposure of seedlings induced a significant increase in HRF compared with its ground-base three-dimensional clinostat controls and ground 1g controls. We also observed three-dimensional clinostat induced a significant increase in HRF compared with ground 1g controls. Molecular hydrogen (H2) has antioxidant activities by selectively reducing hydroxylradical ( •OH) and peroxynitrite(ONOO-), so we investigated the effect of hydrogen on IR-induced HRF. Treatment with hydrogen-rich water dramatically reduced the HR frequency induced by exposure of seedlings to 0 to 80 Gy 60Co radiation , suggesting that hydrogen represents a potentially novel preventative strategy for radiation-induced DNA damage in plants.

  17. DNA Damage Signaling Is Induced in the Absence of Epstein-Barr Virus (EBV) Lytic DNA Replication and in Response to Expression of ZEBRA.

    PubMed

    Wang'ondu, Ruth; Teal, Stuart; Park, Richard; Heston, Lee; Delecluse, Henri; Miller, George

    2015-01-01

    Epstein Barr virus (EBV), like other oncogenic viruses, modulates the activity of cellular DNA damage responses (DDR) during its life cycle. Our aim was to characterize the role of early lytic proteins and viral lytic DNA replication in activation of DNA damage signaling during the EBV lytic cycle. Our data challenge the prevalent hypothesis that activation of DDR pathways during the EBV lytic cycle occurs solely in response to large amounts of exogenous double stranded DNA products generated during lytic viral DNA replication. In immunofluorescence or immunoblot assays, DDR activation markers, specifically phosphorylated ATM (pATM), H2AX (γH2AX), or 53BP1 (p53BP1), were induced in the presence or absence of viral DNA amplification or replication compartments during the EBV lytic cycle. In assays with an ATM inhibitor and DNA damaging reagents in Burkitt lymphoma cell lines, γH2AX induction was necessary for optimal expression of early EBV genes, but not sufficient for lytic reactivation. Studies in lytically reactivated EBV-positive cells in which early EBV proteins, BGLF4, BGLF5, or BALF2, were not expressed showed that these proteins were not necessary for DDR activation during the EBV lytic cycle. Expression of ZEBRA, a viral protein that is necessary for EBV entry into the lytic phase, induced pATM foci and γH2AX independent of other EBV gene products. ZEBRA mutants deficient in DNA binding, Z(R183E) and Z(S186E), did not induce foci of pATM. ZEBRA co-localized with HP1β, a heterochromatin associated protein involved in DNA damage signaling. We propose a model of DDR activation during the EBV lytic cycle in which ZEBRA induces ATM kinase phosphorylation, in a DNA binding dependent manner, to modulate gene expression. ATM and H2AX phosphorylation induced prior to EBV replication may be critical for creating a microenvironment of viral and cellular gene expression that enables lytic cycle progression. PMID:25950714

  18. Influence of organic ions on DNA damage induced by 1 eV to 60 keV electrons

    NASA Astrophysics Data System (ADS)

    Zheng, Yi; Sanche, Léon

    2010-10-01

    We report the results of a study on the influence of organic salts on the induction of single strand breaks (SSBs) and double strand breaks (DSBs) in DNA by electrons of 1 eV to 60 keV. Plasmid DNA films are prepared with two different concentrations of organic salts, by varying the amount of the TE buffer (Tris-HCl and EDTA) in the films with ratio of 1:1 and 6:1 Tris ions to DNA nucleotide. The films are bombarded with electrons of 1, 10, 100, and 60 000 eV under vacuum. The damage to the 3197 base-pair plasmid is analyzed ex vacuo by agarose gel electrophoresis. The highest yields are reached at 100 eV and the lowest ones at 60 keV. The ratios of SSB to DSB are surprisingly low at 10 eV (˜4.3) at both salt concentrations, and comparable to the ratios measured with 100 eV electrons. At all characteristic electron energies, the yields of SSB and DSB are found to be higher for the DNA having the lowest salt concentration. However, the organic salts are more efficient at protecting DNA against the damage induced by 1 and 10 eV electrons. DNA damage and protection by organic ions are discussed in terms of mechanisms operative at each electron energy. It is suggested that these ions create additional electric fields within the groove of DNA, which modify the resonance parameter of 1 and 10 eV electrons, namely, by reducing the electron capture cross-section of basic DNA units and the lifetime of corresponding transient anions. An interstrand electron transfer mechanism is proposed to explain the low ratios for the yields of SSB to those of DSB produced by 10 eV electrons.

  19. Influence of organic ions on DNA damage induced by 1 eV to 60 keV electrons

    SciTech Connect

    Zheng Yi; Sanche, Leon

    2010-10-21

    We report the results of a study on the influence of organic salts on the induction of single strand breaks (SSBs) and double strand breaks (DSBs) in DNA by electrons of 1 eV to 60 keV. Plasmid DNA films are prepared with two different concentrations of organic salts, by varying the amount of the TE buffer (Tris-HCl and EDTA) in the films with ratio of 1:1 and 6:1 Tris ions to DNA nucleotide. The films are bombarded with electrons of 1, 10, 100, and 60 000 eV under vacuum. The damage to the 3197 base-pair plasmid is analyzed ex vacuo by agarose gel electrophoresis. The highest yields are reached at 100 eV and the lowest ones at 60 keV. The ratios of SSB to DSB are surprisingly low at 10 eV ({approx}4.3) at both salt concentrations, and comparable to the ratios measured with 100 eV electrons. At all characteristic electron energies, the yields of SSB and DSB are found to be higher for the DNA having the lowest salt concentration. However, the organic salts are more efficient at protecting DNA against the damage induced by 1 and 10 eV electrons. DNA damage and protection by organic ions are discussed in terms of mechanisms operative at each electron energy. It is suggested that these ions create additional electric fields within the groove of DNA, which modify the resonance parameter of 1 and 10 eV electrons, namely, by reducing the electron capture cross-section of basic DNA units and the lifetime of corresponding transient anions. An interstrand electron transfer mechanism is proposed to explain the low ratios for the yields of SSB to those of DSB produced by 10 eV electrons.

  20. Acute and chronic watercress supplementation attenuates exercise-induced peripheral mononuclear cell DNA damage and lipid peroxidation.

    PubMed

    Fogarty, Mark C; Hughes, Ciara M; Burke, George; Brown, John C; Davison, Gareth W

    2013-01-28

    Pharmacological antioxidant vitamins have previously been investigated for a prophylactic effect against exercise-induced oxidative stress. However, large doses are often required and may lead to a state of pro-oxidation and oxidative damage. Watercress contains an array of nutritional compounds such as β-carotene and α-tocopherol which may increase protection against exercise-induced oxidative stress. The present randomised controlled investigation was designed to test the hypothesis that acute (consumption 2 h before exercise) and chronic (8 weeks consumption) watercress supplementation can attenuate exercise-induced oxidative stress. A total of ten apparently healthy male subjects (age 23 (SD 4) years, stature 179 (SD 10) cm and body mass 74 (SD 15) kg) were recruited to complete the 8-week chronic watercress intervention period (and then 8 weeks of control, with no ingestion) of the experiment before crossing over in order to compete the single-dose acute phase (with control, no ingestion). Blood samples were taken at baseline (pre-supplementation), at rest (pre-exercise) and following exercise. Each subject completed an incremental exercise test to volitional exhaustion following chronic and acute watercress supplementation or control. The main findings show an exercise-induced increase in DNA damage and lipid peroxidation over both acute and chronic control supplementation phases (P< 0.05 v. supplementation), while acute and chronic watercress attenuated DNA damage and lipid peroxidation and decreased H₂O₂ accumulation following exhaustive exercise (P< 0.05 v. control). A marked increase in the main lipid-soluble antioxidants (α-tocopherol, γ-tocopherol and xanthophyll) was observed following watercress supplementation (P< 0.05 v. control) in both experimental phases. These findings suggest that short- and long-term watercress ingestion has potential antioxidant effects against exercise-induced DNA damage and lipid peroxidation. PMID:22475430

  1. Nitrative DNA damage induced by multi-walled carbon nanotube via endocytosis in human lung epithelial cells

    SciTech Connect

    Guo, Feiye; Ma, Ning; Horibe, Yoshiteru; Kawanishi, Shosuke; Murata, Mariko; Hiraku, Yusuke

    2012-04-15

    Carbon nanotube (CNT) has a promising usage in the field of material science for industrial purposes because of its unique physicochemical property. However, intraperitoneal administration of CNT was reported to cause mesothelioma in experimental animals. Chronic inflammation may contribute to carcinogenesis induced by fibrous materials. 8-Nitroguanine is a mutagenic DNA lesion formed during inflammation and may play a role in CNT-induced carcinogenesis. In this study, we examined 8-nitroguanine formation in A549 human lung alveolar epithelial cells treated with multi-walled CNT (MWCNT) by fluorescent immunocytochemistry. Both MWCNTs with diameter of 20–30 nm (CNT20) and 40–70 nm (CNT40) significantly induced 8-nitroguanine formation at 5 and 10 μg/ml (p < 0.05), which persisted for 24 h, although there was no significant difference in DNA-damaging abilities of these MWCNTs. MWCNTs significantly induced the expression of inducible nitric oxide synthase (iNOS) for 24 h (p < 0.05). MWCNTs also significantly increased the level of nitrite, a hydrolysis product of oxidized NO, in the culture supernatant at 4 and 8 h (p < 0.05). MWCNT-induced 8-nitroguanine formation and iNOS expression were largely suppressed by inhibitors of iNOS (1400 W), nuclear factor-κB (Bay11-7082), actin polymerization (cytochalasin D), caveolae-mediated endocytosis (methyl-β-cyclodextrin, MBCD) and clathrin-mediated endocytosis (monodansylcadaverine, MDC). Electron microscopy revealed that MWCNT was mainly located in vesicular structures in the cytoplasm, and its cellular internalization was reduced by MBCD and MDC. These results suggest that MWCNT is internalized into cells via clathrin- and caveolae-mediated endocytosis, leading to inflammatory reactions including iNOS expression and resulting nitrative DNA damage, which may contribute to carcinogenesis. Highlights: ►Multi-walled carbon nanotube (MWCNT) caused DNA damage in A549 cells. ►MWCNT formed 8-nitroguanine, a DNA lesion

  2. Characterization of a novel DNA glycosylase from S. sahachiroi involved in the reduction and repair of azinomycin B induced DNA damage

    PubMed Central

    Wang, Shan; Liu, Kai; Xiao, Le; Yang, LiYuan; Li, Hong; Zhang, FeiXue; Lei, Lei; Li, ShengQing; Feng, Xu; Li, AiYing; He, Jing

    2016-01-01

    Azinomycin B is a hybrid polyketide/nonribosomal peptide natural product and possesses antitumor activity by interacting covalently with duplex DNA and inducing interstrand crosslinks. In the biosynthetic study of azinomycin B, a gene (orf1) adjacent to the azinomycin B gene cluster was found to be essential for the survival of the producer, Streptomyces sahachiroi ATCC33158. Sequence analyses revealed that Orf1 belongs to the HTH_42 superfamily of conserved bacterial proteins which are widely distributed in pathogenic and antibiotic-producing bacteria with unknown functions. The protein exhibits a protective effect against azinomycin B when heterologously expressed in azinomycin-sensitive strains. EMSA assays showed its sequence nonspecific binding to DNA and structure-specific binding to azinomycin B-adducted sites, and ChIP assays revealed extensive association of Orf1 with chromatin in vivo. Interestingly, Orf1 not only protects target sites by protein–DNA interaction but is also capable of repairing azinomycin B-mediated DNA cross-linking. It possesses the DNA glycosylase-like activity and specifically repairs DNA damage induced by azinomycin B through removal of both adducted nitrogenous bases in the cross-link. This bifunctional protein massively binds to genomic DNA to reduce drug attack risk as a novel DNA binding protein and triggers the base excision repair system as a novel DNA glycosylase. PMID:26400161

  3. Ultraviolet Radiation-Induced Skin Aging: The Role of DNA Damage and Oxidative Stress in Epidermal Stem Cell Damage Mediated Skin Aging

    PubMed Central

    Panich, Uraiwan; Sittithumcharee, Gunya; Rathviboon, Natwarath

    2016-01-01

    Skin is the largest human organ. Skin continually reconstructs itself to ensure its viability, integrity, and ability to provide protection for the body. Some areas of skin are continuously exposed to a variety of environmental stressors that can inflict direct and indirect damage to skin cell DNA. Skin homeostasis is maintained by mesenchymal stem cells in inner layer dermis and epidermal stem cells (ESCs) in the outer layer epidermis. Reduction of skin stem cell number and function has been linked to impaired skin homeostasis (e.g., skin premature aging and skin cancers). Skin stem cells, with self-renewal capability and multipotency, are frequently affected by environment. Ultraviolet radiation (UVR), a major cause of stem cell DNA damage, can contribute to depletion of stem cells (ESCs and mesenchymal stem cells) and damage of stem cell niche, eventually leading to photoinduced skin aging. In this review, we discuss the role of UV-induced DNA damage and oxidative stress in the skin stem cell aging in order to gain insights into the pathogenesis and develop a way to reduce photoaging of skin cells. PMID:27148370

  4. G-quadruplex ligand-induced DNA damage response coupled with telomere dysfunction and replication stress in glioma stem cells.

    PubMed

    Hasegawa, Daiki; Okabe, Sachiko; Okamoto, Keiji; Nakano, Ichiro; Shin-ya, Kazuo; Seimiya, Hiroyuki

    2016-02-26

    Glioblastoma (GBM) is an invariably fatal brain tumor in which a small subpopulation of self-renewable glioma stem cells (GSCs) contributes to tumor propagation and relapse. Targeting GSCs could therefore have a significant clinical impact for GBM. Telomestatin is a naturally-occurring compound that preferentially impairs GSC growth by perturbing transcription and inducing a DNA damage response. Telomestatin stabilizes G-quadruplexes (G4s), which are guanine-rich four-strand nucleic acid structures observed in vitro and in vivo. However, the mechanism underlying the GSC-selective nature of the DNA damage response remains unknown. Here we demonstrate that GSCs are more susceptible to telomestatin-induced telomere dysfunction and replication stress when compared with GSC-derived non-stem glioma cells (NSGCs). Telomestatin induced dissociation of the telomere-capping protein TRF2 from telomeres, leading to telomeric DNA damage in GSCs-but not in NSGCs. BIBR1532, a telomerase catalytic inhibitor, did not preferentially inhibit GSC growth, suggesting that telomestatin promotes telomere dysfunction in a telomerase-independent manner. GSCs and NSGCs had comparable levels of G4s in their nuclei, and both responded to telomestatin with phosphorylation of RPA2 at Ser33-a hallmark of replication stress. However, activation of the checkpoint kinase Chk1, induction of a DNA damage response, and subsequent growth inhibition occurred only in telomestatin-treated GSCs. These observations suggest that telomestatin impairs GSC growth through removal of TRF2 from telomeres and potent activation of the replication stress response pathway. Therefore, a novel G4-directed therapeutic strategy could specifically target cancer stem cells in GBM. PMID:26845351

  5. Textile industrial effluent induces mutagenicity and oxidative DNA damage and exploits oxidative stress biomarkers in rats.

    PubMed

    Akhtar, Muhammad Furqan; Ashraf, Muhammad; Anjum, Aftab Ahmad; Javeed, Aqeel; Sharif, Ali; Saleem, Ammara; Akhtar, Bushra

    2016-01-01

    Exposure to complex mixtures like textile effluent poses risks to animal and human health such as mutations, genotoxicity and oxidative damage. Aim of the present study was to quantify metals in industrial effluent and to determine its mutagenic, genotoxic and cytotoxic potential and effects on oxidative stress biomarkers in effluent exposed rats. Metal analysis revealed presence of high amounts of zinc, copper, chromium, iron, arsenic and mercury in industrial effluent. Ames test with/without enzyme activation and MTT assay showed strong association of industrial effluent with mutagenicity and cytotoxicity respectively. In-vitro comet assay revealed evidence of high oxidative DNA damage. When Wistar rats were exposed to industrial effluent in different dilutions for 60 days, then activities of total superoxide dismutase and catalase and hydrogen peroxide concentration were found to be significantly lower in kidney, liver and blood/plasma of effluent exposed rats than control. Vitamin C in a dose of 50 mg/kg/day significantly reduced oxidative effects of effluent in rats. On the basis of this study it is concluded that industrial effluent may cause mutagenicity, in-vitro oxidative stress-related DNA damage and cytotoxicity and may be associated with oxidative stress in rats. Vitamin C may have ameliorating effect when exposed to effluent. PMID:26710178

  6. DNA damage and S phase arrest induced by Ochratoxin A in human embryonic kidney cells (HEK 293).

    PubMed

    Yang, Qian; He, Xiaoyun; Li, Xiaohong; Xu, Wentao; Luo, Yunbo; Yang, Xuan; Wang, Yan; Li, Yingcong; Huang, Kunlun

    2014-07-01

    Ochratoxin A (OTA) is a ubiquitous mycotoxin with potential nephrotoxic, hepatotoxic and immunotoxic effects. The mechanisms underlying the nephrotoxicity of OTA remain obscure. To investigate DNA damage and the changes of the cell cycle distribution induced by OTA, human embryonic kidney cells (HEK 293 cells) were incubated with various concentrations of OTA for 24h in vitro. The results indicated that OTA treatment led to the production of reactive oxygen species (ROS) and to a decrease of the mitochondrial membrane potential (ΔΨm). OTA-induced DNA damage in HEK 293 cells was evidenced by DNA comet tails formation and increased expression of γ-H2AX. In addition, OTA could induce cell cycle arrest at the S phase in HEK 293 cells. The expression of key cell cycle regulatory factors that were critical to the S phase, including cyclin A2, cyclin E1, and CDK2, were further detected. The expression of cyclin A2, cyclin E1, and CDK2 were significantly decreased by OTA treatment at both the mRNA and protein levels. The apoptosis of HEK 293 cells after OTA treatment was observed using Hoechst 33342 staining. The results confirmed that OTA did induce apoptosis in HEK 293 cells. In conclusion, our results provided new insights into the molecular mechanisms by which OTA might promote nephrotoxicity. PMID:25847125

  7. Cerium Oxide Nanoparticles Induced Toxicity in Human Lung Cells: Role of ROS Mediated DNA Damage and Apoptosis

    PubMed Central

    Pandey, Alok K.

    2014-01-01

    Cerium oxide nanoparticles (CeO2 NPs) have promising industrial and biomedical applications. In spite of their applications, the toxicity of these NPs in biological/physiological environment is a major concern. Present study aimed to understand the molecular mechanism underlying the toxicity of CeO2 NPs on lung adenocarcinoma (A549) cells. After internalization, CeO2 NPs caused significant cytotoxicity and morphological changes in A549 cells. Further, the cell death was found to be apoptotic as shown by loss in mitochondrial membrane potential and increase in annexin-V positive cells and confirmed by immunoblot analysis of BAX, BCl-2, Cyt C, AIF, caspase-3, and caspase-9. A significant increase in oxidative DNA damage was found which was confirmed by phosphorylation of p53 gene and presence of cleaved poly ADP ribose polymerase (PARP). This damage could be attributed to increased production of reactive oxygen species (ROS) with concomitant decrease in antioxidant “glutathione (GSH)” level. DNA damage and cell death were attenuated by the application of ROS and apoptosis inhibitors N-acetyl-L- cysteine (NAC) and Z-DEVD-fmk, respectively. Our study concludes that ROS mediated DNA damage and cell cycle arrest play a major role in CeO2 NPs induced apoptotic cell death in A549 cells. Apart from beneficial applications, these NPs also impart potential harmful effects which should be properly evaluated prior to their use. PMID:24987704

  8. Sulfated polysaccharide isolated from Ulva lactuca attenuates d-galactosamine induced DNA fragmentation and necrosis during liver damage in rats.

    PubMed

    Sathivel, Arumugam; Balavinayagamani; Hanumantha Rao, Balaji Raghavendran; Devaki, Thiruvengadam

    2013-12-13

    Abstract Context: Ulva lactuca Linnaeus (Chlorophyceae), a commonly distributed seaweed, is rich in polysaccharide but has not been studied extensively. Objective: The present study investigated the effects of crude fraction of Ulva lactuca polysaccharide (ULP) on d-galactosamine (d-Gal)-induced DNA damage, hepatic oxidative stress, and necrosis in rats. Materials and methods: The rats were treated with ULP (100 mg/kg, orally) for 4 weeks before a single intraperitoneal injection of d-Gal (500 mg/kg). In addition to liver cell necrosis and DNA damage, antioxidant parameters, such as lipid peroxide (LPO), superoxide dismutase, and catalase, and histopathology of liver tissue were evaluated. Results: ULP pre-treatment significantly attenuated a d-Gal-induced decrease in DNA and RNA levels (3.67 ± 0.38) and (5.42 ± 0.46), respectively. Comet tail length and acridine staining confirmed the number of cells undergoing necrosis were relatively lower in ULP treated rats (30 µm and 8-10% of counted cells) compared to rats treated with d-Gal (60 µm and 16% of counted cells). Biochemical (LPO, SOD and CAT) and histological evaluation (p < 0.01) confirmed the anti-hepatotoxic and antioxidant property of crude polysaccharide against d-Gal-induced elevation of LPO and infiltration of inflammatory cells into liver tissue. Discussion and conclusion: Although our previous studies have reported on the protective role of ULP against liver toxicity, our present findings show that ULP improved the hepatic antioxidant defense system against d-Gal-induced DNA damage and necrosis in rats. PMID:24329421

  9. Aldosterone induces fibrosis, oxidative stress and DNA damage in livers of male rats independent of blood pressure changes

    SciTech Connect

    Queisser, Nina; Happ, Kathrin; Link, Samuel; Jahn, Daniel; Zimnol, Anna; Geier, Andreas; Schupp, Nicole

    2014-11-01

    Mineralocorticoid receptor blockers show antifibrotic potential in hepatic fibrosis. The mechanism of this protective effect is not known yet, although reactive oxygen species seem to play an important role. Here, we investigated the effects of elevated levels of aldosterone (Ald), the primary ligand of the mineralocorticoid receptor, on livers of rats in a hyperaldosteronism model: aldosterone-induced hypertension. Male Sprague–Dawley rats were treated for 4 weeks with aldosterone. To distinguish if damage caused in the liver depended on increased blood pressure or on increased Ald levels, the mineralocorticoid receptor antagonist spironolactone was given in a subtherapeutic dose, not normalizing blood pressure. To investigate the impact of oxidative stress, the antioxidant tempol was administered. Aldosterone induced fibrosis, detected histopathologically, and by expression analysis of the fibrosis marker, α-smooth muscle actin. Further, the mRNA amount of the profibrotic cytokine TGF-β was increased significantly. Fibrosis could be reduced by scavenging reactive oxygen species, and also by blocking the mineralocorticoid receptor. Furthermore, aldosterone treatment caused oxidative stress and DNA double strand breaks in livers, as well as the elevation of DNA repair activity. An increase of the transcription factor Nrf2, the main regulator of the antioxidative response could be observed, and of its target genes heme oxygenase-1 and γ-glutamylcysteine synthetase. All these effects of aldosterone were prevented by spironolactone and tempol. Already after 4 weeks of treatment, aldosteroneinfusion induced fibrosis in the liver. This effect was independent of elevated blood pressure. DNA damage caused by aldosterone might contribute to fibrosis progression when aldosterone is chronically increased. - Highlights: • Aldosterone has direct profibrotic effects on the liver independent of blood pressure. • Fibrosis is mediated by the mineralocorticoid receptor and

  10. Methacryloxylethyl Cetyl Ammonium Chloride Induces DNA Damage and Apoptosis in Human Dental Pulp Cells via Generation of Oxidative Stress

    PubMed Central

    Jiao, Yang; Ma, Sai; Wang, Yirong; Li, Jing; Shan, Lequn; Sun, Jinlong; Chen, Jihua

    2016-01-01

    The polymerizable antibacterial monomer methacryloxylethyl cetyl ammonium chloride (DMAE-CB) has provided an effective strategy to combat dental caries. However, the application of such material raises the question about the biological safety and the question remains open. The mechanism of this toxic action, however, is not yet clearly understood. The present study aims at providing novel insight into the possible causal link between cellular oxidative stress and DNA damage, as well as apoptosis in human dental pulp cells exposed to DMAE-CB. The enhanced formation of reactive oxygen species and depletion of glutathione, as well as differential changes in activities of superoxide dismutase, glutathione peroxidase, and catalase in DMAE-CB-treated cells indicated oxidative stress. By using substances that can alter GSH synthesis, we found that GSH was the key component in the regulation of cell response towards oxidative stress induced by DMAE-CB. The increase in oxidative stress-sensitive 8-Oxo-2'-deoxyguanosine (8-OHdG) content, formation of γ-H2AX and cell cycle G1 phase arrest indicated that DNA damage occurred as a result of the interaction between DNA base and ROS beyond the capacities of antioxidant mechanisms in cells exposed to DMAE-CB. Such oxidative DNA damage thus triggers the activation of ataxia telangiectasia-mutated (ATM) signaling, the intrinsic apoptotic pathway, and destruction of mitochondrial morphology and function. PMID:27143955

  11. Methacryloxylethyl Cetyl Ammonium Chloride Induces DNA Damage and Apoptosis in Human Dental Pulp Cells via Generation of Oxidative Stress.

    PubMed

    Jiao, Yang; Ma, Sai; Wang, Yirong; Li, Jing; Shan, Lequn; Sun, Jinlong; Chen, Jihua

    2016-01-01

    The polymerizable antibacterial monomer methacryloxylethyl cetyl ammonium chloride (DMAE-CB) has provided an effective strategy to combat dental caries. However, the application of such material raises the question about the biological safety and the question remains open. The mechanism of this toxic action, however, is not yet clearly understood. The present study aims at providing novel insight into the possible causal link between cellular oxidative stress and DNA damage, as well as apoptosis in human dental pulp cells exposed to DMAE-CB. The enhanced formation of reactive oxygen species and depletion of glutathione, as well as differential changes in activities of superoxide dismutase, glutathione peroxidase, and catalase in DMAE-CB-treated cells indicated oxidative stress. By using substances that can alter GSH synthesis, we found that GSH was the key component in the regulation of cell response towards oxidative stress induced by DMAE-CB. The increase in oxidative stress-sensitive 8-Oxo-2'-deoxyguanosine (8-OHdG) content, formation of γ-H2AX and cell cycle G1 phase arrest indicated that DNA damage occurred as a result of the interaction between DNA base and ROS beyond the capacities of antioxidant mechanisms in cells exposed to DMAE-CB. Such oxidative DNA damage thus triggers the activation of ataxia telangiectasia-mutated (ATM) signaling, the intrinsic apoptotic pathway, and destruction of mitochondrial morphology and function. PMID:27143955

  12. Protein kinase C{eta} activates NF-{kappa}B in response to camptothecin-induced DNA damage

    SciTech Connect

    Raveh-Amit, Hadas; Hai, Naama; Rotem-Dai, Noa; Shahaf, Galit; Gopas, Jacob; Livneh, Etta

    2011-08-26

    Highlights: {yields} Protein kinase C-eta (PKC{eta}) is an upstream regulator of the NF-{kappa}B signaling pathway. {yields} PKC{eta} activates NF-{kappa}B in non-stressed conditions and in response to DNA damage. {yields} PKC{eta} regulates NF-{kappa}B by activating I{kappa}B kinase (IKK) and inducing I{kappa}B degradation. -- Abstract: The nuclear factor {kappa}B (NF-{kappa}B) family of transcription factors participates in the regulation of genes involved in innate- and adaptive-immune responses, cell death and inflammation. The involvement of the Protein kinase C (PKC) family in the regulation of NF-{kappa}B in inflammation and immune-related signaling has been extensively studied. However, not much is known on the role of PKC in NF-{kappa}B regulation in response to DNA damage. Here we demonstrate for the first time that PKC-eta (PKC{eta}) regulates NF-{kappa}B upstream signaling by activating the I{kappa}B kinase (IKK) and the degradation of I{kappa}B. Furthermore, PKC{eta} enhances the nuclear translocation and transactivation of NF-{kappa}B under non-stressed conditions and in response to the anticancer drug camptothecin. We and others have previously shown that PKC{eta} confers protection against DNA damage-induced apoptosis. Our present study suggests that PKC{eta} is involved in NF-{kappa}B signaling leading to drug resistance.

  13. Overestimation of nanoparticles-induced DNA damage determined by the comet assay.

    PubMed

    Ferraro, Daniela; Anselmi-Tamburini, Umberto; Tredici, Ilenia Giuseppina; Ricci, Vittorio; Sommi, Patrizia

    2016-09-01

    The increasing use of engineered nanoparticles (NPs) in a wide range of commercial products raises concern about the possible risks that NPs pose to human health. Many aspects of the interaction between living cells and NPs are still unclear, and a reliable assessment of NP genotoxicity would be important. One of the most common tests used for genotoxicity is the comet assay, a sensitive method measuring DNA damage in individual cells. The assay was originally developed for soluble molecules, but it is also used in the assessment of genotoxicity of NPs. However, concerns have been raised recently about the reliability of this test in the case of NPs, but no conclusive results have been presented. Using nuclei isolated from human epithelial cells incubated with NPs, we obtained clear evidence of overestimation of NP genotoxicity by the comet assay in the case of CeO2, TiO2, SiO2, and polystyrene NPs. Removal of the NPs in the cytoplasm was effective in eliminating this genotoxicity overestimation (ex post damage) and determining the actual damage produced by the NPs during incubation with the cells (ex ante damage). This method could improve significantly the determination of NP genotoxicity in eukaryotic cells. PMID:26812144

  14. Protective Effect of Thymoquinone against Cyclophosphamide-Induced Hemorrhagic Cystitis through Inhibiting DNA Damage and Upregulation of Nrf2 Expression.

    PubMed

    Gore, Prashant R; Prajapati, Chaitali P; Mahajan, Umesh B; Goyal, Sameer N; Belemkar, Sateesh; Ojha, Shreesh; Patil, Chandragouda R

    2016-01-01

    Cyclophosphamide (CYP) induced hemorrhagic cystitis is a dose-limiting side effect involving increased oxidative stress, inflammatory cytokines and suppressed activity of nuclear factor related erythroid 2-related factor (Nrf2). Thymoquinone (TQ), an active constituent of Nigella sativa seeds, is reported to increase the expression of Nrf2, exert antioxidant action, and anti-inflammatory effects in the experimental animals. The present study was designed to explore the effects of TQ on CYP-induced hemorrhagic cystitis in Balb/c mice. Cystitis was induced by a single intraperitoneal injection of CYP (200 mg/kg). TQ was administered intraperitoneally at 5, 10 and 20 mg/kg doses twice a day, for three days before and three days after the CYP administration. The efficacy of TQ was determined in terms of the protection against the CYP-induced histological perturbations in the bladder tissue, reduction in the oxidative stress, and inhibition of the DNA fragmentation. Immunohistochemistry was performed to examine the expression of Nrf2. TQ protected against CYP-induced oxidative stress was evident from significant reduction in the lipid peroxidation, restoration of the levels of reduced glutathione, catalase and superoxide dismutase activities. TQ treatment significantly reduced the DNA damage evident as reduced DNA fragmentation. A significant decrease in the cellular infiltration, edema, epithelial denudation and hemorrhage were observed in the histological observations. There was restoration and rise in the Nrf2 expression in the bladder tissues of mice treated with TQ. These results confirm that, TQ ameliorates the CYP-induced hemorrhagic cystitis in mice through reduction in the oxidative stress, inhibition of the DNA damage and through increased expression of Nrf2 in the bladder tissues. PMID:27489498

  15. Protective Effect of Thymoquinone against Cyclophosphamide-Induced Hemorrhagic Cystitis through Inhibiting DNA Damage and Upregulation of Nrf2 Expression

    PubMed Central

    Gore, Prashant R.; Prajapati, Chaitali P.; Mahajan, Umesh B.; Goyal, Sameer N.; Belemkar, Sateesh; Ojha, Shreesh; Patil, Chandragouda R.

    2016-01-01

    Cyclophosphamide (CYP) induced hemorrhagic cystitis is a dose-limiting side effect involving increased oxidative stress, inflammatory cytokines and suppressed activity of nuclear factor related erythroid 2-related factor (Nrf2). Thymoquinone (TQ), an active constituent of Nigella sativa seeds, is reported to increase the expression of Nrf2, exert antioxidant action, and anti-inflammatory effects in the experimental animals. The present study was designed to explore the effects of TQ on CYP-induced hemorrhagic cystitis in Balb/c mice. Cystitis was induced by a single intraperitoneal injection of CYP (200 mg/kg). TQ was administered intraperitoneally at 5, 10 and 20 mg/kg doses twice a day, for three days before and three days after the CYP administration. The efficacy of TQ was determined in terms of the protection against the CYP-induced histological perturbations in the bladder tissue, reduction in the oxidative stress, and inhibition of the DNA fragmentation. Immunohistochemistry was performed to examine the expression of Nrf2. TQ protected against CYP-induced oxidative stress was evident from significant reduction in the lipid peroxidation, restoration of the levels of reduced glutathione, catalase and superoxide dismutase activities. TQ treatment significantly reduced the DNA damage evident as reduced DNA fragmentation. A significant decrease in the cellular infiltration, edema, epithelial denudation and hemorrhage were observed in the histological observations. There was restoration and rise in the Nrf2 expression in the bladder tissues of mice treated with TQ. These results confirm that, TQ ameliorates the CYP-induced hemorrhagic cystitis in mice through reduction in the oxidative stress, inhibition of the DNA damage and through increased expression of Nrf2 in the bladder tissues. PMID:27489498

  16. Mushroom-derived preparations in the prevention of H2O2-induced oxidative damage to cellular DNA.

    PubMed

    Shi, Yu-ling; James, Anthony E; Benzie, Iris F F; Buswell, John A

    2002-01-01

    Aqueous extracts of the sporophores of eight mushroom species were assessed for their ability to prevent H2O2-induced oxidative damage to cellular DNA using the single-cell gel electrophoresis ("Comet") assay. The highest genoprotective effects were obtained with cold (20 degrees C) and hot (100 degrees C) water extracts of Agaricus bisporus and Ganoderma lucidum fruit bodies, respectively. No protective effects were observed with Mushroom Derived Preparations (MDPs) from Flammulina velutipes, Auricularia auricula, Hypsizygus marmoreus, Lentinula edodes, Pleurotus sajor-caju, and Volvariella volvacea. These findings indicate that some edible mushrooms represent a valuable source of biologically active compounds with potential for protecting cellular DNA from oxidative damage. PMID:11835288

  17. Nucleobase-Based Barbiturates: Their Protective Effect against DNA Damage Induced by Bleomycin-Iron, Antioxidant, and Lymphocyte Transformation Assay

    PubMed Central

    Dhorajiya, Bhaveshkumar D.; Dholakiya, Bharatkumar Z.; Ibrahim, Ahmed S.; Badria, Farid A.

    2014-01-01

    A number of nucleobase-based barbiturates have been synthesized by combination of nucleic acid bases and heterocyclic amines and barbituric acid derivatives through green and efficient multicomponent route and one pot reaction. This approach was accomplished efficiently using aqueous medium to give the corresponding products in high yield. The newly synthesized compounds were characterized by spectral analysis (FT-IR, 1H NMR, 13C NMR, HMBC, and UV spectroscopy) and elemental analysis. Representative of all synthesized compounds was tested and evaluated for antioxidant, bleomycin-dependent DNA damage, and Lymphocyte Transformation studies. Compounds TBC > TBA > TBG showed highest lymphocyte transformation assay, TBC > TBA > BG showed inhibitory antioxidant activity using ABTS methods, and TBC > BPA > BAMT > TBA > 1, 3-TBA manifested the best protective effect against DNA damage induced by bleomycin. PMID:24900997

  18. SNF2H interacts with XRCC1 and is involved in repair of H2O2-induced DNA damage.

    PubMed

    Kubota, Yoshiko; Shimizu, Shinji; Yasuhira, Shinji; Horiuchi, Saburo

    2016-07-01

    The protein XRCC1 has no inherent enzymatic activity, and is believed to function in base excision repair as a dedicated scaffold component that coordinates other DNA repair factors. Repair foci clearly represent the recruitment and accumulation of DNA repair factors at sites of damage; however, uncertainties remain regarding their organization in the context of nuclear architecture and their biological significance. Here we identified the chromatin remodeling factor SNF2H/SMARCA5 as a novel binding partner of XRCC1, with their interaction dependent on the casein kinase 2-mediated constitutive phosphorylation of XRCC1. The proficiency of repairing H2O2-induced damage was strongly impaired by SNF2H knock-down, and similar impairment was observed with knock-down of both XRCC1 and SNF2H simultaneously, suggesting their role in a common repair pathway. Most SNF2H exists in the nuclear matrix fraction, forming salt extraction-resistant foci-like structures in unchallenged nuclei. Remarkably, damage-induced formation of both PAR and XRCC1 foci depended on SNF2H, and the PAR and XRCC1 foci co-localized with the SNF2H foci. We propose a model in which a base excision repair complex containing damaged chromatin is recruited to specific locations in the nuclear matrix for repair, with this recruitment mediated by XRCC1-SNF2H interaction. PMID:27268481

  19. Assessment of oxidative stress-induced DNA damage by immunoflourescent analysis of 8-oxodG.

    PubMed

    Lee, Soo Fern; Pervaiz, Shazib

    2011-01-01

    Oxidative stress refers to the imbalance between the generation of reactive oxygen species (ROS) and their scavenging by the inherent antioxidant defenses of the cell. The abnormal accumulation of ROS is the underlying pathology in a variety of human diseases such as neurodegenerative phenomena, inflammatory diseases, metabolic disorders, and cancer. The mechanism by which abnormal accumulation of ROS contributes to pathological conditions involves damage or oxidative modification of biomolecules, such as nucleotides, lipids, and proteins. One of the most common targets of ROS is DNA, modifications of which have been associated with cellular transformation and genome instability. There are a number of experimental strategies to assess oxidative modification of DNA bases, such as chromatography-based assays and indirect immunofluorescence. While the former provide quantitative assessment of oxidative modification, the latter is a much simpler assay for qualitative determination of DNA base modification in very small sample sizes. Here, we present a brief background of the various methodologies for the assessment of a specific oxidative DNA modification, 8oxodG, and present a more detailed account of the indirect immunofluorescence assay. PMID:21722801

  20. Oxidative DNA damage is instrumental in hyperreplication stress-induced inviability of Escherichia coli

    PubMed Central

    Charbon, Godefroid; Bjørn, Louise; Mendoza-Chamizo, Belén; Frimodt-Møller, Jakob; Løbner-Olesen, Anders

    2014-01-01

    In Escherichia coli, an increase in the ATP bound form of the DnaA initiator protein results in hyperinitiation and inviability. Here, we show that such replication stress is tolerated during anaerobic growth. In hyperinitiating cells, a shift from anaerobic to aerobic growth resulted in appearance of fragmented chromosomes and a decrease in terminus concentration, leading to a dramatic increase in ori/ter ratio and cessation of cell growth. Aerobic viability was restored by reducing the level of reactive oxygen species (ROS) or by deleting mutM (Fpg glycosylase). The double-strand breaks observed in hyperinitiating cells therefore results from replication forks encountering single-stranded DNA lesions generated while removing oxidized bases, primarily 8-oxoG, from the DNA. We conclude that there is a delicate balance between chromosome replication and ROS inflicted DNA damage so the number of replication forks can only increase when ROS formation is reduced or when the pertinent repair is compromised. PMID:25389264

  1. Disruption of the mevalonate pathway induces dNTP depletion and DNA damage.

    PubMed

    Martín Sánchez, Covadonga; Pérez Martín, José Manuel; Jin, Jong-Sik; Dávalos, Alberto; Zhang, Wei; de la Peña, Gema; Martínez-Botas, Javier; Rodríguez-Acebes, Sara; Suárez, Yajaira; Hazen, María José; Gómez-Coronado, Diego; Busto, Rebeca; Cheng, Yung-Chi; Lasunción, Miguel A

    2015-09-01

    The mevalonate pathway is tightly linked to cell division. Mevalonate derived non-sterol isoprenoids and cholesterol are essential for cell cycle progression and mitosis completion respectively. In the present work, we studied the effects of fluoromevalonate, a competitive inhibitor of mevalonate diphosphate decarboxylase, on cell proliferation and cell cycle progression in both HL-60 and MOLT-4 cells. This enzyme catalyzes the synthesis of isopentenyl diphosphate, the first isoprenoid in the cholesterol biosynthesis pathway, consuming ATP at the same time. Inhibition of mevalonate diphosphate decarboxylase was followed by a rapid accumulation of mevalonate diphosphate and the reduction of ATP concentrations, while the cell content of cholesterol was barely affected. Strikingly, mevalonate diphosphate decarboxylase inhibition also resulted in the depletion of dNTP pools, which has never been reported before. These effects were accompanied by inhibition of cell proliferation and cell cycle arrest at S phase, together with the appearance of γ-H2AX foci and Chk1 activation. Inhibition of Chk1 in cells treated with fluoromevalonate resulted in premature entry into mitosis and massive cell death, indicating that the inhibition of mevalonate diphosphate decarboxylase triggered a DNA damage response. Notably, the supply of exogenously deoxyribonucleosides abolished γ-H2AX formation and prevented the effects of mevalonate diphosphate decarboxylase inhibition on DNA replication and cell growth. The results indicate that dNTP pool depletion caused by mevalonate diphosphate decarboxylase inhibition hampered DNA replication with subsequent DNA damage, which may have important consequences for replication stress and genomic instability. PMID:26055626

  2. INTRANUCLEAR MATRIX METALLOPROTEINASES PROMOTE DNA DAMAGE AND APOPTOSIS INDUCED BY OXYGEN–GLUCOSE DEPRIVATION IN NEURONS

    PubMed Central

    HILL, J. W.; PODDAR, R.; THOMPSON, J. F.; ROSENBERG, G. A.; YANG, Y.

    2016-01-01

    Degradation of the extracellular matrix by elevated matrix metalloproteinase (MMP) activity following ischemia/reperfusion is implicated in blood–brain barrier disruption and neuronal death. In contrast to their characterized extracellular roles, we previously reported that elevated intranuclear MMP-2 and -9 (gelatinase) activity degrades nuclear DNA repair proteins and promotes accumulation of oxidative DNA damage in neurons in rat brain at 3-h reperfusion after ischemic stroke. Here, we report that treatment with a broad-spectrum MMP inhibitor significantly reduced neuronal apoptosis in rat ischemic hemispheres at 48-h reperfusion after a 90-min middle cerebral artery occlusion (MCAO). Since extracellular gelatinases in brain tissue are known to be neurotoxic during acute stroke, the contribution of intranuclear MMP-2 and -9 activities in neurons to neuronal apoptosis has been unclear. To confirm and extend our in vivo observations, oxygen–glucose deprivation (OGD), an in vitro model of ischemia/reperfusion, was employed. Primary cortical neurons were subjected to 2-h OGD with reoxygenation. Increased intranuclear gelatinase activity was detected immediately after reoxygenation onset and was maximal at 24 h, while extracellular gelatinase levels remained unchanged. We detected elevated levels of both MMP-2 and -9 in neuronal nuclear extracts and gelatinase activity in neurons co-localized primarily with MMP-2. We found a marked decrease in PARP1, XRCC1, and OGG1, and decreased PARP1 activity. Pretreatment of neurons with selective MMP-2/9 inhibitor II significantly decreased gelatinase activity and downregulation of DNA repair enzymes, decreased accumulation of oxidative DNA damage, and promoted neuronal survival after OGD. Our results confirm the nuclear localization of gelatinases and their nuclear substrates observed in an animal stroke model, further supporting a novel role for intranuclear gelatinase activity in an intrinsic apoptotic pathway in neurons

  3. Jatropha curcas leaf and bark fractions protect against ultraviolet radiation-B induced DNA damage in human peripheral blood lymphocytes.

    PubMed

    Sundari, J; Selvaraj, R; Rajendra Prasad, N; Elumalai, R

    2013-11-01

    The present study is conducted to investigate the antioxidant potential of Jatropha curcas root bark extract (RB4 fraction) and leaf extract (L1 fraction), and to study their effects on UVB-radiation-induced DNA damage in cultured human blood lymphocytes. In this study, J. curcas showed strong antioxidant property in different free radical scavenging systems. Both the fractions effectively scavenged hydroxyl (OH), superoxide anion (O₂(·-)), 1,1-diphenyl-2-picrylhydrazyl (DPPH·) and 2,2-azino-bis-3-ethylbenzothiazoline-6-sulphonic acid radical cation (ABTS(·+)) in a concentration-dependent manner. The IC₅₀ (Inhibitory Concentration 50) values of J. curcas fractions were compared to standard ascorbic acid used in this study. The antioxidant potential of a compound was directly proportional to the photoprotective effect. In this study, human peripheral blood lymphocytes (HPBL) were exposed to UVB-radiation and there was an increase in comet attributes (% tail DNA, tail length, tail movement and Olive tail moment). Jatropha curcas RB4 fraction and L1 fraction treatment before UVB-irradiation significantly decreased the % tail DNA, tail length, tail moment and Olive tail moment in irradiated HPBL. These results suggested that J. curcas exhibited strong antioxidant property and RB4 and L1 fractions protected UVB-radiation-induced DNA damage in HPBL. PMID:23995553

  4. The MAPK Pathway Signals Telomerase Modulation in Response to Isothiocyanate-Induced DNA Damage of Human Liver Cancer Cells

    PubMed Central

    Lamy, Evelyn; Herz, Corinna; Lutz-Bonengel, Sabine; Hertrampf, Anke; Márton, Melinda-Rita; Mersch-Sundermann, Volker

    2013-01-01

    4-methylthiobutyl isothiocyanate (MTBITC), an aliphatic, sulphuric compound from Brassica vegetables, possesses in vitro and in vivo antitumor activity. Recently we demonstrated the potent growth inhibitory potential of the DNA damaging agent MTBITC in human liver cancer cells. Here we now show that MTBITC down regulates telomerase which sensitizes cells to apoptosis induction. This is mediated by MAPK activation but independent from production of reactive oxygen species (ROS). Within one hour, MTBITC induced DNA damage in cancer cells correlating to a transient increase in hTERT mRNA expression which then turned into telomerase suppression, evident at mRNA as well as enzyme activity level. To clarify the role of MAPK for telomerase regulation, liver cancer cells were pre-treated with MAPK-specific inhibitors prior to MTBITC exposure. This clearly showed that transient elevation of hTERT mRNA expression was predominantly mediated by the MAPK family member JNK. In contrast, activated ERK1/2 and P38, but not JNK, signalled to telomerase abrogation and consequent apoptosis induction. DNA damage by MTBITC was also strongly abolished by MAPK inhibition. Oxidative stress, as analysed by DCF fluorescence assay, electron spin resonance spectroscopy and formation of 4-hydroxynonenal was found as not relevant for this process. Furthermore, N-acetylcysteine pre-treatment did not impact MTBITC-induced telomerase suppression or depolarization of the mitochondrial membrane potential as marker for apoptosis. Our data therefore imply that upon DNA damage by MTBITC, MAPK are essential for telomerase regulation and consequent growth impairment in liver tumor cells and this detail probably plays an important role in understanding the potential chemotherapeutic efficacy of ITC. PMID:23382840

  5. Phorate-induced oxidative stress, DNA damage and transcriptional activation of p53 and caspase genes in male Wistar rats

    SciTech Connect

    Saquib, Quaiser; Attia, Sabry M.; Siddiqui, Maqsood A.; Aboul-Soud, Mourad A.M.; Al-Khedhairy, Abdulaziz A.; Giesy, John P.; Musarrat, Javed

    2012-02-15

    Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G{sub 2}/M arrest and appearance of a distinctive SubG{sub 1} peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced

  6. Analysis of repair and mutagenesis of chromium-induced DNA damage in yeast, mammalian cells, and transgenic mice.

    PubMed Central

    Cheng, L; Liu, S; Dixon, K

    1998-01-01

    Chromium (Cr) is a widespread environmental contaminant and a known human carcinogen. We have used shuttle vector systems in yeast, mammalian cells, and transgenic mice to characterize the mutational specificity and premutational DNA damage induced by Cr(VI) and its reduction intermediates in order to elucidate the mechanism by which Cr induces mutations. In the yeast system, treatment of vector-containing cells with Cr(VI) results in a dose-dependent increase in mutations in the SUP4-o target gene of the vector; mutagenesis is enhanced in an apn-1 yeast mutant, deficient in the capacity to repair oxidative-type DNA damage. In vector-containing mammalian cells, treatment with Cr(VI) also results in a dose-dependent increase in mutations in the vector target gene supF. The Cr-induced mutations in supF occurred mostly at G:C base pairs and were widely distributed across the gene, a pattern similar to those observed with ionizing radiation or hydrogen peroxide. These results support the hypothesis that Cr(VI)-induced oxidative-type DNA damage is responsible for Cr mutagenesis in the cell. Recently these studies were extended into the Big Blue transgenic mouse system in which Cr-induced mutagenesis was observed in the lung, the target organ for Cr carcinogenesis in humans. Analysis of the spectrum of these mutations will test whether Cr mutagenesis occurs by similar mechanisms in the intact animal as in cell culture systems and yeast. Images Figure 2 Figure 3 PMID:9703488

  7. Excision repair of UV radiation-induced DNA damage in Caenorhabditis elegans

    SciTech Connect

    Hartman, P.S.; Hevelone, J.; Dwarakanath, V.; Mitchell, D.L. )

    1989-06-01

    Radioimmunoassays were used to monitor the removal of antibody-binding sites associated with the two major UV radiation-induced DNA photoproducts (cyclobutane dimers and (6-4) photoproducts). Unlike with cultured human cells, where (6-4) photoproducts are removed more rapidly than cyclobutane dimers, the kinetics of repair were similar for both lesions. Repair capacity in wild type diminished throughout development. The radioimmunoassays were also employed to confirm the absence of photoreactivation in C. elegans. In addition, three radiation-sensitive mutants (rad-1, rad-2, rad-7) displayed normal repair capacities. An excision defect was much more pronounced in larvae than embryos in the fourth mutant tested (rad-3). This correlates with the hypersensitivity pattern of this mutant and suggests that DNA repair may be developmentally regulated in C. elegans. The mechanism of DNA repair in C. elegans as well as the relationship between the repair of specific photoproducts and UV radiation sensitivity during development are discussed.

  8. Combinatorial Measurement of CDKN1A/p21 and KIF20A Expression for Discrimination of DNA Damage-Induced Clastogenicity

    PubMed Central

    Sakai, Rina; Morikawa, Yuji; Kondo, Chiaki; Oka, Hiroyuki; Miyajima, Hirofumi; Kubo, Kihei; Uehara, Takeki

    2014-01-01

    In vitro mammalian cytogenetic tests detect chromosomal aberrations and are used for testing the genotoxicity of compounds. This study aimed to identify a supportive genomic biomarker could minimize the risk of misjudgments and aid appropriate decision making in genotoxicity testing. Human lymphoblastoid TK6 cells were treated with each of six DNA damage-inducing genotoxins (clastogens) or two genotoxins that do not cause DNA damage. Cells were exposed to each compound for 4 h, and gene expression was comprehensively examined using Affymetrix U133A microarrays. Toxicogenomic analysis revealed characteristic alterations in the expression of genes included in cyclin-dependent kinase inhibitor 1A (CDKN1A/p21)-centered network. The majority of genes included in this network were upregulated on treatment with DNA damage-inducing clastogens. The network, however, also included kinesin family member 20A (KIF20A) downregulated by treatment with all the DNA damage-inducing clastogens. Downregulation of KIF20A expression was successfully confirmed using additional DNA damage-inducing clastogens. Our analysis also demonstrated that nucleic acid constituents falsely downregulated the expression of KIF20A, possibly via p16 activation, independently of the CDKN1A signaling pathway. Our results indicate the potential of KIF20A as a supportive biomarker for clastogenicity judgment and possible mechanisms involved in KIF20A downregulation in DNA damage and non-DNA damage signaling networks. PMID:25264741

  9. Maximiscin Induces DNA Damage, Activates DNA Damage Response Pathways, and Has Selective Cytotoxic Activity against a Subtype of Triple-Negative Breast Cancer.

    PubMed

    Robles, Andrew J; Du, Lin; Cichewicz, Robert H; Mooberry, Susan L

    2016-07-22

    Triple-negative breast cancers are highly aggressive, and patients with these types of tumors have poor long-term survival. These breast cancers do not express estrogen or progesterone receptors and do not have gene amplification of human epidermal growth factor receptor 2; therefore, they do not respond to available targeted therapies. The lack of targeted therapies for triple-negative breast cancers stems from their heterogeneous nature and lack of a clear definition of driver defects. Studies have recently identified triple-negative breast cancer molecular subtypes based on gene expression profiling and representative cell lines, allowing for the identification of subtype-specific drug leads and molecular targets. We previously reported the identification of a new fungal metabolite named maximiscin (1) identified through a crowdsourcing program. New results show that 1 has selective cytotoxic efficacy against basal-like 1 MDA-MB-468 cells compared to cell lines modeling other triple-negative breast cancer molecular subtypes. This compound also exhibited antitumor efficacy in a xenograft mouse model. The mechanisms of action of 1 in MDA-MB-468 cells were investigated to identify potential molecular targets and affected pathways. Compound 1 caused accumulation of cells in the G1 phase of the cell cycle, suggesting induction of DNA damage. Indeed, treatment with 1 caused DNA double-strand breaks with concomitant activation of the DNA damage response pathways, indicated by phosphorylation of p53, Chk1, and Chk2. Collectively, these results suggest basal-like triple-negative breast cancer may be inherently sensitive to DNA-damaging agents relative to other triple-negative breast cancer subtypes. These results also demonstrate the potential of our citizen crowdsourcing program to identify new lead molecules for treating the subtypes of triple-negative breast cancer. PMID:27310425

  10. Molecular Mechanisms of Ultraviolet Radiation-Induced DNA Damage and Repair

    PubMed Central

    Rastogi, Rajesh P.; Richa; Kumar, Ashok; Tyagi, Madhu B.; Sinha, Rajeshwar P.

    2010-01-01

    DNA is one of the prime molecules, and its stability is of utmost importance for proper functioning and existence of all living systems. Genotoxic chemicals and radiations exert adve