Collaborations between CpG sites in DNA methylation
NASA Astrophysics Data System (ADS)
Song, You; Ren, Honglei; Lei, Jinzhi
2017-08-01
DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.
CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study
Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.
2014-01-01
Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585
Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.
Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won
2018-05-01
DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.
Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh
2017-03-09
It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.
GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.
Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi
2017-05-24
As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.
Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.
Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J
2016-08-01
Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.
Epigenetic Transgenerational Inheritance of Altered Sperm Histone Retention Sites.
Ben Maamar, Millissia; Sadler-Riggleman, Ingrid; Beck, Daniel; Skinner, Michael K
2018-03-28
A variety of environmental toxicants and factors have been shown to induce the epigenetic transgenerational inheritance of disease and phenotypic variation. Epigenetic alterations in the germline (sperm or egg) are required to transmit transgenerational phenotypes. The current study was designed to investigate the potential role of histones in sperm to help mediate the epigenetic transgenerational inheritance. The agricultural fungicide vinclozolin and the pesticide DDT (dichlorodiphenyltrichloroethane) were independently used to promote the epigenetic transgenerational inheritance of disease. Purified cauda epididymal sperm were collected from the transgenerational F3 generation control and exposure lineage male rats for histone analysis. A reproducible core of histone H3 retention sites was observed using an H3 chromatin immunoprecipitation (ChIP-Seq) analysis in control lineage sperm. Interestingly, the same core group of H3 retention sites plus additional differential histone retention sites (DHRs) were observed in the F3 generation exposure lineage sperm. Although new histone H3 retention sites were observed, negligible change in histone modification (methylation of H3K27me3) was observed between the control and exposure lineages. Observations demonstrate that in addition to alterations in sperm DNA methylation and ncRNA previously identified, the induction of differential histone retention sites (DHRs) also appear to be involved in environmentally induced epigenetic transgenerational inheritance.
The CpG island searcher: a new WWW resource.
Takai, Daiya; Jones, Peter A
2003-01-01
Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.
CpG Distribution and Methylation Pattern in Porcine Parvovirus
Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán
2013-01-01
Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033
Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela
2016-01-01
Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.
Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R
2015-08-01
Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.
Nucleosome dynamics and maintenance of epigenetic states of CpG islands
NASA Astrophysics Data System (ADS)
Sneppen, Kim; Dodd, Ian B.
2016-06-01
Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.
Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela
2016-01-01
Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681
Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali
2012-06-06
First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.
Qiao, Huan; May, James M.
2013-01-01
SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893
Assisted reproduction treatment and epigenetic inheritance
van Montfoort, A.P.A.; Hanssen, L.L.P.; de Sutter, P.; Viville, S.; Geraedts, J.P.M.; de Boer, P.
2012-01-01
BACKGROUND The subject of epigenetic risk of assisted reproduction treatment (ART), initiated by reports on an increase of children with the Beckwith–Wiedemann imprinting disorder, is very topical. Hence, there is a growing literature, including mouse studies. METHODS In order to gain information on transgenerational epigenetic inheritance and epigenetic effects induced by ART, literature databases were searched for papers on this topic using relevant keywords. RESULTS At the level of genomic imprinting involving CpG methylation, ART-induced epigenetic defects are convincingly observed in mice, especially for placenta, and seem more frequent than in humans. Data generally provide a warning as to the use of ovulation induction and in vitro culture. In human sperm from compromised spermatogenesis, sequence-specific DNA hypomethylation is observed repeatedly. Transmittance of sperm and oocyte DNA methylation defects is possible but, as deduced from the limited data available, largely prevented by selection of gametes for ART and/or non-viability of the resulting embryos. Some evidence indicates that subfertility itself is a risk factor for imprinting diseases. As in mouse, physiological effects from ART are observed in humans. In the human, indications for a broader target for changes in CpG methylation than imprinted DNA sequences alone have been found. In the mouse, a broader range of CpG sequences has not yet been studied. Also, a multigeneration study of systematic ART on epigenetic parameters is lacking. CONCLUSIONS The field of epigenetic inheritance within the lifespan of an individual and between generations (via mitosis and meiosis, respectively) is growing, driven by the expansion of chromatin research. ART can induce epigenetic variation that might be transmitted to the next generation. PMID:22267841
dbCPG: A web resource for cancer predisposition genes.
Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng
2016-06-21
Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.
dbCPG: A web resource for cancer predisposition genes
Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng
2016-01-01
Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119
Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.
Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng
2017-08-07
Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant
Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias
Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.
2013-01-01
Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644
Unique DNA methylome profiles in CpG island methylator phenotype colon cancers
Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.
2012-01-01
A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380
Length of paternal lifespan is manifested in the DNA methylome of their nonagenarian progeny
Marttila, Saara; Kananen, Laura; Jylhävä, Juulia; Nevalainen, Tapio; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko
2015-01-01
The heritability of lifespan is 20-30%, but only a few genes associated with longevity have been identified. To explain this discrepancy, the inheritance of epigenetic features, such as DNA methylation, have been proposed to contribute to the heritability of lifespan. We investigated whether parental lifespan is associated with DNA methylation profile in nonagenarians. A regression model, adjusted for differences in blood cell proportions, identified 659 CpG sites where the level of methylation was associated with paternal lifespan. However, no association was observed between maternal lifespan and DNA methylation. The 659 CpG sites associated with paternal lifespan were enriched outside of CpG islands and were located in genes associated with development and morphogenesis, as well as cell signaling. The largest difference in the level of methylation between the progeny of the shortest-lived and longest-lived fathers was identified for CpG sites mapping to CXXC5. In addition, the level of methylation in three Notch-genes (NOTCH1, NOTCH3 and NOTCH4) was also associated with paternal lifespan. There are implications for the inheritance of acquired traits via epigenetic mechanisms in mammals. Here we describe DNA methylation features that are associated with paternal lifespan, and we speculate that the identified CpG sites may represent intergenerational epigenetic inheritance. PMID:26436701
The evolution of CpG density and lifespan in conserved primate and mammalian promoters
McLain, Adam T.
2018-01-01
Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983
Haque, M Muksitul; Holder, Lawrence B; Skinner, Michael K
2015-01-01
Environmentally induced epigenetic transgenerational inheritance of disease and phenotypic variation involves germline transmitted epimutations. The primary epimutations identified involve altered differential DNA methylation regions (DMRs). Different environmental toxicants have been shown to promote exposure (i.e., toxicant) specific signatures of germline epimutations. Analysis of genomic features associated with these epimutations identified low-density CpG regions (<3 CpG / 100bp) termed CpG deserts and a number of unique DNA sequence motifs. The rat genome was annotated for these and additional relevant features. The objective of the current study was to use a machine learning computational approach to predict all potential epimutations in the genome. A number of previously identified sperm epimutations were used as training sets. A novel machine learning approach using a sequential combination of Active Learning and Imbalance Class Learner analysis was developed. The transgenerational sperm epimutation analysis identified approximately 50K individual sites with a 1 kb mean size and 3,233 regions that had a minimum of three adjacent sites with a mean size of 3.5 kb. A select number of the most relevant genomic features were identified with the low density CpG deserts being a critical genomic feature of the features selected. A similar independent analysis with transgenerational somatic cell epimutation training sets identified a smaller number of 1,503 regions of genome-wide predicted sites and differences in genomic feature contributions. The predicted genome-wide germline (sperm) epimutations were found to be distinct from the predicted somatic cell epimutations. Validation of the genome-wide germline predicted sites used two recently identified transgenerational sperm epimutation signature sets from the pesticides dichlorodiphenyltrichloroethane (DDT) and methoxychlor (MXC) exposure lineage F3 generation. Analysis of this positive validation data set
Predicting aberrant CpG island methylation
Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.
2003-01-01
Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846
Predicting aberrant CpG island methylation.
Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M
2003-10-14
Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.
CpG island mapping by epigenome prediction.
Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas
2007-06-01
CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic
Formulation of vaccines containing CpG oligonucleotides and alum
Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.
2007-01-01
CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533
2013-01-01
Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769
Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts
Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.
2000-01-01
Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792
Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration.
Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu
2015-01-01
Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn't affect Egf mRNA expression during the re-organization phase.
Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration
Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu
2015-01-01
Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832
DNA containing CpG motifs induces angiogenesis
NASA Astrophysics Data System (ADS)
Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.
2002-06-01
New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.
DNA mutation motifs in the genes associated with inherited diseases.
Růžička, Michal; Kulhánek, Petr; Radová, Lenka; Čechová, Andrea; Špačková, Naďa; Fajkusová, Lenka; Réblová, Kamila
2017-01-01
Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs) rarely associated with mutations (coldspots) and frequently associated with mutations (hotspots) exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.
Prediction of CpG-island function: CpG clustering vs. sliding-window methods
2010-01-01
Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903
Leakey, Tatiana I; Zielinski, Jerzy; Siegfried, Rachel N; Siegel, Eric R; Fan, Chun-Yang; Cooney, Craig A
2008-06-01
DNA methylation at cytosines is a widely studied epigenetic modification. Methylation is commonly detected using bisulfite modification of DNA followed by PCR and additional techniques such as restriction digestion or sequencing. These additional techniques are either laborious, require specialized equipment, or are not quantitative. Here we describe a simple algorithm that yields quantitative results from analysis of conventional four-dye-trace sequencing. We call this method Mquant and we compare it with the established laboratory method of combined bisulfite restriction assay (COBRA). This analysis of sequencing electropherograms provides a simple, easily applied method to quantify DNA methylation at specific CpG sites.
Martin, Elizabeth M.; Fry, Rebecca C.
2016-01-01
Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266
Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C
2007-09-01
The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG Pattern
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man
Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine
Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA
2005-09-01
tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such
CpG DNA in the prevention and treatment of infections.
Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus
2002-01-01
Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.
Polycomb-like proteins link the PRC2 complex to CpG islands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Haojie; Liefke, Robert; Jiang, Junyi
The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less
Guntrum, Megan; Vlasova, Ekaterina; Davis, Tamara L
2017-01-01
Differential DNA methylation plays a critical role in the regulation of imprinted genes. The differentially methylated state of the imprinting control region is inherited via the gametes at fertilization, and is stably maintained in somatic cells throughout development, influencing the expression of genes across the imprinting cluster. In contrast, DNA methylation patterns are more labile at secondary differentially methylated regions which are established at imprinted loci during post-implantation development. To investigate the nature of these more variably methylated secondary differentially methylated regions, we adopted a hairpin linker bisulfite mutagenesis approach to examine CpG dyad methylation at differentially methylated regions associated with the murine Dlk1/Gtl2 imprinting cluster on both complementary strands. We observed homomethylation at greater than 90% of the methylated CpG dyads at the IG-DMR, which serves as the imprinting control element. In contrast, homomethylation was only observed at 67-78% of the methylated CpG dyads at the secondary differentially methylated regions; the remaining 22-33% of methylated CpG dyads exhibited hemimethylation. We propose that this high degree of hemimethylation could explain the variability in DNA methylation patterns at secondary differentially methylated regions associated with imprinted loci. We further suggest that the presence of 5-hydroxymethylation at secondary differentially methylated regions may result in hemimethylation and methylation variability as a result of passive and/or active demethylation mechanisms.
László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József
2016-08-01
The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.
Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.
Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam
2011-02-15
Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.
DNA motifs associated with aberrant CpG island methylation.
Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M
2006-05-01
Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.
CpG island methylator phenotype in colorectal cancer
Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.
1999-01-01
Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935
CpG island methylator phenotype (CIMP) in cancer: causes and implications.
Teodoridis, Jens M; Hardie, Catriona; Brown, Robert
2008-09-18
Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.
Couldrey, Christine; Wells, David N
2013-01-01
Incomplete epigenetic reprogramming is postulated to contribute to the low developmental success following somatic cell nuclear transfer (SCNT). Here, we describe the epigenetic reprogramming of DNA methylation at an alpha satellite I CpG site (αsatI-5) during development of cattle generated either by artificial insemination (AI) or in vitro fertilization (IVF) and SCNT. Quantitative methylation analysis identified that SCNT donor cells were highly methylated at αsatI-5 and resulting SCNT blastocysts showed significantly more methylation than IVF blastocysts. At implantation, no difference in methylation was observed between SCNT and AI in trophoblast tissue at αsatI-5, however, SCNT embryos were significantly hyper-methylated compared to AI controls at this time point. Following implantation, DNA methylation at αsatI-5 decreased in AI but not SCNT placental tissues. In contrast to placenta, the proportion of methylation at αsatI-5 remained high in adrenal, kidney and muscle tissues during development. Differences in the average proportion of methylation were smaller in somatic tissues than placental tissues but, on average, SCNT somatic tissues were hyper-methylated at αsatI-5. Although sperm from all bulls was less methylated than somatic tissues at αsatI-5, on average this site remained hyper-methylated in sperm from cloned bulls compared with control bulls. This developmental time course confirms that epigenetic reprogramming does occur, at least to some extent, following SCNT. However, the elevated methylation levels observed in SCNT blastocysts and cellular derivatives implies that there is either insufficient time or abundance of appropriate reprogramming factors in oocytes to ensure complete reprogramming. Incomplete reprogramming at this CpG site may be a contributing factor to low SCNT success rates, but more likely represents the tip of the iceberg in terms of incompletely reprogramming. Until protocols ensure the epigenetic signature of a
Couldrey, Christine; Wells, David N.
2013-01-01
Incomplete epigenetic reprogramming is postulated to contribute to the low developmental success following somatic cell nuclear transfer (SCNT). Here, we describe the epigenetic reprogramming of DNA methylation at an alpha satellite I CpG site (αsatI-5) during development of cattle generated either by artificial insemination (AI) or in vitro fertilization (IVF) and SCNT. Quantitative methylation analysis identified that SCNT donor cells were highly methylated at αsatI-5 and resulting SCNT blastocysts showed significantly more methylation than IVF blastocysts. At implantation, no difference in methylation was observed between SCNT and AI in trophoblast tissue at αsatI-5, however, SCNT embryos were significantly hyper-methylated compared to AI controls at this time point. Following implantation, DNA methylation at αsatI-5 decreased in AI but not SCNT placental tissues. In contrast to placenta, the proportion of methylation at αsatI-5 remained high in adrenal, kidney and muscle tissues during development. Differences in the average proportion of methylation were smaller in somatic tissues than placental tissues but, on average, SCNT somatic tissues were hyper-methylated at αsatI-5. Although sperm from all bulls was less methylated than somatic tissues at αsatI-5, on average this site remained hyper-methylated in sperm from cloned bulls compared with control bulls. This developmental time course confirms that epigenetic reprogramming does occur, at least to some extent, following SCNT. However, the elevated methylation levels observed in SCNT blastocysts and cellular derivatives implies that there is either insufficient time or abundance of appropriate reprogramming factors in oocytes to ensure complete reprogramming. Incomplete reprogramming at this CpG site may be a contributing factor to low SCNT success rates, but more likely represents the tip of the iceberg in terms of incompletely reprogramming. Until protocols ensure the epigenetic signature of a
Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery
NASA Astrophysics Data System (ADS)
Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka
2015-08-01
In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.
Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji
2015-07-08
The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*
Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.
2014-01-01
Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738
Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly
2013-01-01
A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017
Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P
2014-11-01
Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.
Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.
Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar
2013-10-01
Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.
Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity
Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam
2010-01-01
Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258
Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T
2004-09-01
Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.
Comprehensive analysis of CpG islands in human chromosomes 21 and 22
NASA Astrophysics Data System (ADS)
Takai, Daiya; Jones, Peter A.
2002-03-01
CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.
A Hybrid Approach for CpG Island Detection in the Human Genome.
Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh
2016-01-01
CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.
Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae
2014-10-20
The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.
Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt
2017-03-22
Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.
Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E
2016-01-01
Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in
Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P
2014-01-01
Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058
NASA Astrophysics Data System (ADS)
Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka
2012-09-01
CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7
Upadhyay, Mohita; Vivekanandan, Perumal
2015-01-01
Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our
Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka
2013-01-01
Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the
Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K
2016-07-01
Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.
Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James
2013-01-01
Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231
Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal
2013-12-01
Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.
Valenzuela, Luciano O; Sironi, Mariano; Rowntree, Victoria J; Seger, Jon
2009-03-01
Ocean warming will undoubtedly affect the migratory patterns of many marine species, but specific changes can be predicted only where behavioural mechanisms guiding migration are understood. Southern right whales show maternally inherited site fidelity to near-shore winter nursery grounds, but exactly where they feed in summer (collectively and individually) remains mysterious. They consume huge quantities of copepods and krill, and their reproductive rates respond to fluctuations in krill abundance linked to El Niño Southern Oscillation (ENSO). Here we show that genetic and isotopic signatures, analysed together, indicate maternally directed site fidelity to diverse summer feeding grounds for female right whales calving at Península Valdés, Argentina. Isotopic values from 131 skin samples span a broad range (-23.1 to -17.2‰ δ¹³C, 6.0 to 13.8‰ δ¹⁵N) and are more similar than expected among individuals sharing the same mitochondrial haplotype. This pattern indicates that calves learn summer feeding locations from their mothers, and that the timescale of culturally inherited site fidelity to feeding grounds is at least several generations. Such conservatism would be expected to limit the exploration of new feeding opportunities, and may explain why this population shows increased rates of reproductive failure in years following elevated sea-surface temperature anomalies off South Georgia, the richest known feeding ground for baleen whales in the South Atlantic.
Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran
2014-07-01
We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.
Long Oskar Controls Mitochondrial Inheritance in Drosophila melanogaster.
Hurd, Thomas Ryan; Herrmann, Beate; Sauerwald, Julia; Sanny, Justina; Grosch, Markus; Lehmann, Ruth
2016-12-05
Inherited mtDNA mutations cause severe human disease. In most species, mitochondria are inherited maternally through mechanisms that are poorly understood. Genes that specifically control the inheritance of mitochondria in the germline are unknown. Here, we show that the long isoform of the protein Oskar regulates the maternal inheritance of mitochondria in Drosophila melanogaster. We show that, during oogenesis, mitochondria accumulate at the oocyte posterior, concurrent with the bulk streaming and churning of the oocyte cytoplasm. Long Oskar traps and maintains mitochondria at the posterior at the site of primordial germ cell (PGC) formation through an actin-dependent mechanism. Mutating long oskar strongly reduces the number of mtDNA molecules inherited by PGCs. Therefore, Long Oskar ensures germline transmission of mitochondria to the next generation. These results provide molecular insight into how mitochondria are passed from mother to offspring, as well as how they are positioned and asymmetrically partitioned within polarized cells. Copyright © 2016 Elsevier Inc. All rights reserved.
Topical CpG enhances the response of murine malignant melanoma to dacarbazine.
Najar, Hossain M; Dutz, Jan P
2008-09-01
Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.
Behringer, Megan G.; Hall, David W.
2015-01-01
We accumulated mutations for 1952 generations in 79 initially identical, haploid lines of the fission yeast Schizosaccharomyces pombe, and then performed whole-genome sequencing to determine the mutation rates and spectrum. We captured 696 spontaneous mutations across the 79 mutation accumulation (MA) lines. We compared the mutation spectrum and rate to a recently published equivalent experiment on the same species, and to another model ascomycetous yeast, the budding yeast Saccharomyces cerevisiae. While the two species are approximately 600 million years diverged from each other, they share similar life histories, genome size and genomic G/C content. We found that Sc. pombe and S. cerevisiae have similar mutation rates, but Sc. pombe exhibits a stronger insertion bias. Intriguingly, we observed an increased mutation rate at cytosine nucleotides, specifically CpG nucleotides, which is also seen in S. cerevisiae. However, the absence of methylation in Sc. pombe and the pattern of mutation at these sites, primarily C → A as opposed to C → T, strongly suggest that the increased mutation rate is not caused by deamination of methylated cytosines. This result implies that the high mutability of CpG dinucleotides in other species may be caused in part by a methylation-independent mechanism. Many of our findings mirror those seen in the recent study, despite the use of different passaging conditions, indicating that MA is a reliable method for estimating mutation rates and spectra. PMID:26564949
DNA activates human immune cells through a CpG sequence-dependent manner
Bauer, M; Heeg, K; Wagner, H; Lipford, G B
1999-01-01
While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226
Wang, Tingting; Chen, Man; Liu, Lian; Cheng, Huaiyan; Yan, You-E; Feng, Ying-Hong; Wang, Hui
2011-01-01
Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a single site CpG methylation at nt −377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. PMID:21971485
Hanagata, Nobutaka
2017-01-01
Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.
CpG islands: algorithms and applications in methylation studies.
Zhao, Zhongming; Han, Leng
2009-05-15
Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.
Compositional searching of CpG islands in the human genome
NASA Astrophysics Data System (ADS)
Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón
2005-06-01
We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.
Reinforcement learning for a biped robot based on a CPG-actor-critic method.
Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin
2007-08-01
Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
Avramidou, Evangelia V; Doulis, Andreas G; Aravanopoulos, Filippos A
2015-05-15
Genetic inheritance and epigenetic inheritance are significant determinants of plant evolution, adaptation and plasticity. We studied inheritance of restriction site polymorphisms by the f-AFLP method and epigenetic DNA cytosine methylation inheritance by the f-MSAP technique. The study involved parents and 190 progeny of a Cupressus sempervirens L. full-sib family. Results from AFLP genetic data revealed that 71.8% of the fragments studied are under Mendelian genetic control, whereas faithful Mendelian inheritance for the MSAP fragments was low (4.29%). Further, MSAP fragment analysis showed that total methylation presented a mean of 28.2%, which was higher than the midparent value, while maternal inheritance was higher (5.65%) than paternal (3.01%). Interestingly de novo methylation in the progeny was high (19.65%) compared to parental methylation. Genetic and epigenetic distances for parents and offspring were not correlated (R(2)=0.0005). Furthermore, we studied correlation of total relative methylation and CG methylation with growth (height, diameter). We found CG/CNG methylation (N: A, C, T) to be positively correlated with height and diameter, while total relative methylation and CG methylation were positively correlated with height. Results are discussed in light of further research needed and of their potential application in breeding. Copyright © 2015 Elsevier B.V. All rights reserved.
Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka
2015-01-01
CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655
Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka
2015-01-01
CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.
Zhang, Qiang; Guo, Xiaohong; Tian, Tian; Wang, Teng; Li, Qiaoli; Wang, Lei; Liu, Yun; Xing, Qinghe; He, Lin; Zhao, Xinzhi
2017-05-01
Early diagnosis of Turner syndrome (TS) may improve preventive measures and treatment. X-chromosome inactivation specific differentially methylated CpG sites (XIDMSs) that are high methylated in inactive X chromosomes (Xi) and unmethylated in active X chromosomes (Xa) may be potential makers for TS detection. The candidate XIDMSs were screened from 9 male and 12 female DNA samples with normal karyotypes using the Illumina 450k array and validated by bisulfite sequencing PCR and pyrosequencing assay. X chromosome dosage was calculated according to the methylation level of multiple XIDMSs. Overall, 108 candidate XIDMSs were screened by the 450k array. Validations indicated that XIDMSs gathered and formed the X-chromosome inactivation specific differentially methylated regions (XIDMRs). Using 3 XIDMRs at SAT1, UXT and UTP14A loci, 36 TS, 22 normal female and 6 male samples were analyzed. Methylation levels of the 20 XIDMSs in the XIDMRs could distinguish between TS and normal female DNA samples, the X chromosome dosage was consistent with karyotyping data. Analyzing samples of 2 triple X syndrome and 3 Klinefelter syndrome patients suggested that this method could be used to detect X chromosome aneuploids other than TS. XIDMSs are widely spread along the X chromosome and might be effective markers for detection of TS and other X chromosome aneuploids. Copyright © 2017 Elsevier B.V. All rights reserved.
CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.
Kava, Hieronimus W; Murray, Vincent
2016-10-01
This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.
1997-09-01
Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.
[Inherited thrombocytopenias].
Leverger, G; Petit, A; Fasola, S; Landman-Parker, J; Favier, R
2010-08-01
Secondary causes of thrombocytopenia as immunologic thrombopenia purpura, or ITP, are far more common than inherited causes, which even as a group, are rare. Nevertheless, diagnosis is important and progress made in uncovering the molecular basis of these disorders has contributed greatly to our knowledge of these diseases. Inherited thrombocytopenias are a heterogeneous group of disorders. Different criteria have been suggested to classify the forms, such as the inheritance mechanism and the platelet volume as well as the associated platelet dysfunctions or clinical abnormality. This paper describes the clinical and biological data, and current knowledge of the molecular findings of inherited thrombocytopenia, allowing a diagnostic approach to these diseases. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.
Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre
2012-01-01
The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146
The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative
NASA Technical Reports Server (NTRS)
Nillen, Jeannie L.; Smith, Scott M.
2003-01-01
A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.
Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...
2015-09-21
An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less
Prtenjaca, Anita; Tarnowski, Heather E; Marr, Alison M; Heney, Melanie A; Creamer, Laura; Sathiamoorthy, Sarmitha; Hill, Kathleen A
2014-01-01
With few exceptions, spontaneous mutation frequency and pattern are similar across tissue types and relatively constant in young to middle adulthood in wild type mice. Underrepresented in surveys of spontaneous mutations across murine tissues is the diversity of epithelial tissues. For the first time, spontaneous mutations were detected in pancreas and submaxillary gland and compared with kidney, lung, and male germ cells from five adult male Big Blue® mice. Mutation load was assessed quantitatively through measurement of mutant and mutation frequency and qualitatively through identification of mutations and characterization of recurrent mutations, multiple mutations, mutation pattern, and mutation spectrum. A total of 9.6 million plaque forming units were screened, 226 mutants were collected, and 196 independent mutations were identified. Four novel mutations were discovered. Spontaneous mutation frequency was low in pancreas and high in the submaxillary gland. The submaxillary gland had multiple recurrent mutations in each of the mice and one mutant had two independent mutations. Mutation patterns for epithelial tissues differed from that observed in male germ cells with a striking bias for G:C to A:T transitions at CpG sites. A comprehensive review of lacI spontaneous mutation patterns in young adult mice and rats identified additional examples of this mutational bias. An overarching observation about spontaneous mutation frequency in adult tissues of the mouse remains one of stability. A repeated observation in certain epithelial tissues is a higher rate of G:C to A:T transitions at CpG sites and the underlying mechanisms for this bias are not known. Copyright © 2013 Wiley Periodicals, Inc.
Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism
Maguire, S. M.; Phelps, S. M.
2017-01-01
DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564
Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression
Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio
2012-01-01
CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013
Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.
Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M
2018-05-16
Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.
Inherited Retinal Degenerative Disease Clinical Trial Network. Addendum
2010-10-01
by retinitis pigmentosa (RP) and other forms of rare inherited retinal degenerative diseases is estimated at approximately 200,000 individuals. RP... Retinitis Pigmentosa ). NNRI is awaiting final protocol review and HRPO approval for NNRI and the three enrolling clinical sites- the CTEC site at...acid) in individuals with autosomal dominant retinitis pigmentosa , with the ability to expand the enrollment to individuals with autosomal recessive
Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages
Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.
2015-01-01
Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245
Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.
Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L
2015-08-01
Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.
Hopkins, Robert J; Daczkowski, Nancy F; Kaptur, Paulina E; Muse, Derek; Sheldon, Eric; LaForce, Craig; Sari, Suha; Rudge, Thomas L; Bernton, Edward
2013-06-26
A new anthrax vaccine that could accelerate the immune response and possibly reduce the number of injections needed for protection would be desirable in a post-exposure setting. This Phase 1 study compared the safety and immunogenicity of 2 IM doses (Days 0 and 14) of 4 formulations of AV7909 (AVA plus CPG 7909) with 2 IM doses of BioThrax(®) (Anthrax Vaccine Adsorbed) and 2 IM doses of saline placebo administered on Days 0 and 14. A total of 105 healthy adults 18-50 years of age were randomized to 1 of 6 study groups: BioThrax (0.5 mL), AV7909 Formulation 1 (0.5 mL AVA+0.5mg CPG 7909), AV7909 Formulation 2 (0.5 mL AVA+0.25mg CPG 7909), AV7909 Formulation 3 (0.25 mL AVA+0.5mg CPG 7909), AV7909 Formulation 4 (0.25 mL AVA+0.25mg CPG 7909), or saline placebo (0.5 mL). All randomized subjects received at least 1 vaccination, and 100 subjects completed the trial. After 2 doses, mean peak normalized toxin neutralizing antibody responses (TNA NF50) in the AV7909 groups were higher than in the BioThrax group. Differences among the 4 AV7909 groups were not statistically significant. Subjects who received AV7909 reached peak titers on Day 28 vs. Day 35 in the BioThrax group. The most common adverse events (AEs) in the BioThrax and AV7909 groups assessed as related to vaccination were injection site reactions. Transient lymphopenia was observed after the first dose in each AV7909 group. Frequencies of injection site and systemic reactions recorded by subjects in diaries for 7 days after each injection were highest with AV7909 Formulation 1. No AEs of special interest (autoimmune events) were observed in the study. Further studies of doses and dosing regimens are planned to assess the immunogenicity and reactogenicity of AV7909. Copyright © 2013 Elsevier Ltd. All rights reserved.
A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei
Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.
2006-01-01
Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571
A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.
Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M
2006-03-01
Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.
TET1 Depletion Induces Aberrant CpG Methylation in Colorectal Cancer Cells
Yamamoto, Eiichiro; Harada, Taku; Aoki, Hironori; Maruyama, Reo; Toyota, Mutsumi; Sasaki, Yasushi; Sugai, Tamotsu; Tokino, Takashi; Nakase, Hiroshi
2016-01-01
Aberrant DNA methylation is commonly observed in colorectal cancer (CRC), but the underlying mechanism is not fully understood. 5-hydroxymethylcytosine levels and TET1 expression are both reduced in CRC, while epigenetic silencing of TET1 is reportedly associated with the CpG island methylator phenotype. In the present study, we aimed to clarify the relationship between loss of TET1 and aberrant DNA methylation in CRC. Stable TET1 knockdown clones were established using Colo320DM cells, which express high levels of TET1, and HCT116 cells, which express TET1 at a level similar to that in normal colonic tissue. Infinium HumanMethylation450 BeadChip assays revealed increased levels of 5-methylcytosine at more than 10,000 CpG sites in TET1-depleted Colo320DM cells. Changes in DNA methylation were observed at various positions within the genome, including promoters, gene bodies and intergenic regions, and the altered methylation affected expression of a subset of genes. By contrast, TET1 knockdown did not significantly affect DNA methylation in HCT116 cells. However, TET1 depletion was associated with attenuated effects of 5-aza-2’-deoxycytidine on gene expression profiles in both cell lines. These results suggest that loss of TET1 may induce aberrant DNA methylation and may attenuate the effect of 5-aza-2’-deoxycytidine in CRC cells. PMID:27977763
Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells
Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.
2005-01-01
Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623
CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.
Liu, Chengju; Chen, Qijun; Wang, Danwei
2011-06-01
This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.
The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.
Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J
2017-02-14
The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.
Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji
2008-03-01
The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.
Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih
2014-01-01
Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.
Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih
2014-01-01
Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578
CpG DNA: A pathogenic factor in systemic lupus erythematosus?
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krieg, A.M.
1995-11-01
Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less
Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert
2009-01-01
Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344
Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju
2017-06-27
Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J
2003-08-15
The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.
Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.
2014-01-01
Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136
Smoking-Associated Site-Specific Differential Methylation in Buccal Mucosa in the COPDGene Study
Qiu, Weiliang; Carey, Vincent J.; Morrow, Jarrett; Bacherman, Helene; Foreman, Marilyn G.; Hokanson, John E.; Bowler, Russell P.; Crapo, James D.; DeMeo, Dawn L.
2015-01-01
DNA methylation is a complex, tissue-specific phenomenon that can reflect both endogenous factors and exogenous exposures. Buccal brushings represent an easily accessible source of DNA, which may be an appropriate surrogate tissue in the study of environmental exposures and chronic respiratory diseases. Buccal brushings were obtained from a subset of current and former smokers from the COPDGene study. Genome-wide DNA methylation data were obtained in the discovery cohort (n = 82) using the Illumina HumanMethylation450K array. Empirical Bayes methods were used to test for differential methylation by current smoking status at 468,219 autosomal CpG sites using linear models adjusted for age, sex, and race. Pyrosequencing was performed in a nonoverlapping replication cohort (n = 130). Current smokers were significantly younger than former smokers in both the discovery and replication cohorts. Seven CpG sites were associated with current smoking at a false discovery rate less than 0.05 in the discovery cohort. Six of the seven significant sites were pyrosequenced in the replication cohort; five CpG sites, including sites annotated to CYP1B1 and PARVA, were replicated. Correlations between cumulative smoke exposure and time since smoking cessation were observed in a subset of the significantly associated CpG sites. A significant correlation between reduced lung function and increased radiographic emphysema with methylation at cg02162897 (CYP1B1) was observed among female subjects. Site-specific methylation of DNA isolated from buccal mucosa is associated with exposure to cigarette smoke, and may provide insights into the mechanisms underlying differential susceptibility toward the development of smoking-related chronic respiratory diseases. PMID:25517428
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-22
...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...
On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion
Amrollah, Elmira; Henaff, Patrick
2010-01-01
This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.
Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki
2008-10-01
While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.
Heravi Shargh, Vahid; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jalali, Seyed Amir; Firouzmand, Hengameh; Abbasi, Azam; Badiee, Ali
2012-07-01
Development of an effective vaccine against leishmaniasis is possible due to the fact that individuals cured from cutaneous leishmaniasis (CL) are protected from further infection. First generation Leishmania vaccines consisting of whole killed parasites reached to phase 3 clinical trials but failed to show enough efficacies mainly due to the lack of an appropriate adjuvant. In this study, an efficient liposomal protein-based vaccine against Leishmania major infection was developed using soluble Leishmania antigens (SLA) as a first generation vaccine and cytidine phosphate guanosine oligodeoxynucleotides (CpG ODNs) as an immunostimulatory adjuvant. 1, 2-Dioleoyl-3-trimethylammonium-propane was used as a cationic lipid to prepare the liposomes due to its intrinsic adjuvanticity. BALB/c mice were immunized subcutaneously (SC), three times in 2-week intervals, with Lip-SLA-CpG, Lip-SLA, SLA + CpG, SLA, or HEPES buffer. As criteria for protection, footpad swelling at the site of challenge and spleen parasite loads were assessed, and the immune responses were evaluated by determination of IFN-γ and IL-4 levels of cultured splenocytes, and IgG subtypes. The group of mice that received Lip-SLA-CpG showed a significantly smaller footpad swelling, lower spleen parasite burden, higher IgG2a antibody, and lower IL-4 level compared to the control groups. It is concluded that cationic liposomes containing SLA and CpG ODNs are appropriate to induce Th1 type of immune response and protection against leishmaniasis.
Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J
2010-02-05
Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.
Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture.
Li, Cai; Lowe, Robert; Ziemke, Tom
2013-01-01
The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value.
Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture
Li, Cai; Lowe, Robert; Ziemke, Tom
2013-01-01
The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value. PMID:23675345
Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei
2015-08-01
DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.
Scheiermann, Julia; Klinman, Dennis M.
2014-01-01
Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812
Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan
2016-06-01
Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.
Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen
2011-01-01
The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612
Ngô, V; Gourdji, D; Laverrière, J N
1996-01-01
The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139
2010-01-01
Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102
Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko
2018-01-01
CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150
Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.
2016-01-01
Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841
Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L
Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.
Martos, Suzanne N; Tang, Wan-Yee; Wang, Zhibin
2015-07-01
Epigenetic mechanisms involving DNA methylation, histone modification, histone variants and nucleosome positioning, and noncoding RNAs regulate cell-, tissue-, and developmental stage-specific gene expression by influencing chromatin structure and modulating interactions between proteins and DNA. Epigenetic marks are mitotically inherited in somatic cells and may be altered in response to internal and external stimuli. The idea that environment-induced epigenetic changes in mammals could be inherited through the germline, independent of genetic mechanisms, has stimulated much debate. Many experimental models have been designed to interrogate the possibility of transgenerational epigenetic inheritance and provide insight into how environmental exposures influence phenotypes over multiple generations in the absence of any apparent genetic mutation. Unexpected molecular evidence has forced us to reevaluate not only our understanding of the plasticity and heritability of epigenetic factors, but of the stability of the genome as well. Recent reviews have described the difference between transgenerational and intergenerational effects; the two major epigenetic reprogramming events in the mammalian lifecycle; these two events making transgenerational epigenetic inheritance of environment-induced perturbations rare, if at all possible, in mammals; and mechanisms of transgenerational epigenetic inheritance in non-mammalian eukaryotic organisms. This paper briefly introduces these topics and mainly focuses on (1) transgenerational phenotypes and epigenetic effects in mammals, (2) environment-induced intergenerational epigenetic effects, and (3) the inherent difficulties in establishing a role for epigenetic inheritance in human environmental disease. Copyright © 2015 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Diver, R.B.; Moss, T.A.; Goldberg, V.
Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less
Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.
2004-01-01
Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use
Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland
2014-01-23
Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.
Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong
2016-01-01
Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306
Lee, Seung-Tae; Wiemels, Joseph L
2016-02-18
The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as 'backbone', largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois
2017-04-04
Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.
Molano, Monica; Tabrizi, Sepehr N.; Garland, Suzanne M.; Roberts, Jennifer M.; Machalek, Dorothy A.; Phillips, Samuel; Chandler, David; Hillman, Richard J.; Grulich, Andrew E.; Jin, Fengyi; Poynten, I. Mary; Templeton, David J.; Cornall, Alyssa M.
2016-01-01
Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL. PMID:27529629
Molano, Monica; Tabrizi, Sepehr N; Garland, Suzanne M; Roberts, Jennifer M; Machalek, Dorothy A; Phillips, Samuel; Chandler, David; Hillman, Richard J; Grulich, Andrew E; Jin, Fengyi; Poynten, I Mary; Templeton, David J; Cornall, Alyssa M
2016-01-01
Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL.
Lee, Wei-Chung Allen; Nedivi, Elly
2011-01-01
cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509
Woo, Hye Ryun; Dittmer, Travis A.; Richards, Eric J.
2008-01-01
Methylcytosine-binding proteins decipher the epigenetic information encoded by DNA methylation and provide a link between DNA methylation, modification of chromatin structure, and gene silencing. VARIANT IN METHYLATION 1 (VIM1) encodes an SRA (SET- and RING-associated) domain methylcytosine-binding protein in Arabidopsis thaliana, and loss of VIM1 function causes centromere DNA hypomethylation and centromeric heterochromatin decondensation in interphase. In the Arabidopsis genome, there are five VIM genes that share very high sequence similarity and encode proteins containing a PHD domain, two RING domains, and an SRA domain. To gain further insight into the function and potential redundancy among the VIM proteins, we investigated strains combining different vim mutations and transgenic vim knock-down lines that down-regulate multiple VIM family genes. The vim1 vim3 double mutant and the transgenic vim knock-down lines showed decreased DNA methylation primarily at CpG sites in genic regions, as well as repeated sequences in heterochromatic regions. In addition, transcriptional silencing was released in these plants at most heterochromatin regions examined. Interestingly, the vim1 vim3 mutant and vim knock-down lines gained ectopic CpHpH methylation in the 5S rRNA genes against a background of CpG hypomethylation. The vim1 vim2 vim3 triple mutant displayed abnormal morphological phenotypes including late flowering, which is associated with DNA hypomethylation of the 5′ region of FWA and release of FWA gene silencing. Our findings demonstrate that VIM1, VIM2, and VIM3 have overlapping functions in maintenance of global CpG methylation and epigenetic transcriptional silencing. PMID:18704160
Atypical mitochondrial inheritance patterns in eukaryotes.
Breton, Sophie; Stewart, Donald T
2015-10-01
Mitochondrial DNA (mtDNA) is predominantly maternally inherited in eukaryotes. Diverse molecular mechanisms underlying the phenomenon of strict maternal inheritance (SMI) of mtDNA have been described, but the evolutionary forces responsible for its predominance in eukaryotes remain to be elucidated. Exceptions to SMI have been reported in diverse eukaryotic taxa, leading to the prediction that several distinct molecular mechanisms controlling mtDNA transmission are present among the eukaryotes. We propose that these mechanisms will be better understood by studying the deviations from the predominating pattern of SMI. This minireview summarizes studies on eukaryote species with unusual or rare mitochondrial inheritance patterns, i.e., other than the predominant SMI pattern, such as maternal inheritance of stable heteroplasmy, paternal leakage of mtDNA, biparental and strictly paternal inheritance, and doubly uniparental inheritance of mtDNA. The potential genes and mechanisms involved in controlling mitochondrial inheritance in these organisms are discussed. The linkage between mitochondrial inheritance and sex determination is also discussed, given that the atypical systems of mtDNA inheritance examined in this minireview are frequently found in organisms with uncommon sexual systems such as gynodioecy, monoecy, or andromonoecy. The potential of deviations from SMI for facilitating a better understanding of a number of fundamental questions in biology, such as the evolution of mtDNA inheritance, the coevolution of nuclear and mitochondrial genomes, and, perhaps, the role of mitochondria in sex determination, is considerable.
Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D
2011-01-01
Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804
The RNAi Inheritance Machinery of Caenorhabditis elegans.
Spracklin, George; Fields, Brandon; Wan, Gang; Becker, Diveena; Wallig, Ashley; Shukla, Aditi; Kennedy, Scott
2017-07-01
Gene silencing mediated by dsRNA (RNAi) can persist for multiple generations in Caenorhabditis elegans (termed RNAi inheritance). Here we describe the results of a forward genetic screen in C. elegans that has identified six factors required for RNAi inheritance: GLH-1/VASA, PUP-1/CDE-1, MORC-1, SET-32, and two novel nematode-specific factors that we term here (heritable RNAi defective) HRDE-2 and HRDE-4 The new RNAi inheritance factors exhibit mortal germline (Mrt) phenotypes, which we show is likely caused by epigenetic deregulation in germ cells. We also show that HRDE-2 contributes to RNAi inheritance by facilitating the binding of small RNAs to the inheritance Argonaute (Ago) HRDE-1 Together, our results identify additional components of the RNAi inheritance machinery whose conservation provides insights into the molecular mechanism of RNAi inheritance, further our understanding of how the RNAi inheritance machinery promotes germline immortality, and show that HRDE-2 couples the inheritance Ago HRDE-1 with the small RNAs it needs to direct RNAi inheritance and germline immortality. Copyright © 2017 by the Genetics Society of America.
Immunoregulation of GVHD by triggering the innate immune system with CpG.
Morecki, Shoshana; Slavin, Shimon
2009-08-01
Stimulation of Toll-like receptors by oligodeoxynucleotide sequences containing a CpG motif provides signals capable of triggering the innate and adaptive immune systems, thereby leading either to stimulation or suppression of immunoreactivities. Similar immunoregulatory capabilities are necessary for achieving the fine balance between engraftment and graft-versus-host disease required in the setup of allogeneic cell therapy. Ligation of CpG to its Toll-like receptors can be accomplished by treatment of the host or pretransplant treatment of the donor in vivo. These different strategies are presented in this review, which summarizes the attempts to maximize beneficial alloreactivity against malignant or other undesirable host cells, while controlling graft-versus-host disease.
Shen, Hong; Iwasaki, Akiko
2006-01-01
Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177
A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei
2006-03-01
may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M
Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly
2016-02-08
Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.
Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W
2014-11-28
NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors
Gilbert, Kathleen M.; Blossom, Sarah J.; Reisfeld, Brad; Erickson, Stephen W.; Vyas, Kanan; Maher, Mary; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A.; Bhattacharyya, Sudeepa
2017-01-01
Abstract Exposure to industrial solvent and water pollutant trichloroethylene (TCE) can promote autoimmunity, and expand effector/memory (CD62L) CD4+ T cells. In order to better understand etiology reduced representation bisulfite sequencing was used to study how a 40-week exposure to TCE in drinking water altered methylation of ∼337 770 CpG sites across the entire genome of effector/memory CD4+ T cells from MRL+/+ mice. Regardless of TCE exposure, 62% of CpG sites in autosomal chromosomes were hypomethylated (0–15% methylation), and 25% were hypermethylated (85–100% methylation). In contrast, only 6% of the CpGs on the X chromosome were hypomethylated, and 51% had mid-range methylation levels. In terms of TCE impact, TCE altered (≥ 10%) the methylation of 233 CpG sites in effector/memory CD4+ T cells. Approximately 31.7% of these differentially methylated sites occurred in regions known to bind one or more Polycomb group (PcG) proteins, namely Ezh2, Suz12, Mtf2 or Jarid2. In comparison, only 23.3% of CpG sites not differentially methylated by TCE were found in PcG protein binding regions. Transcriptomics revealed that TCE altered the expression of ∼560 genes in the same effector/memory CD4+ T cells. At least 80% of the immune genes altered by TCE had binding sites for PcG proteins flanking their transcription start site, or were regulated by other transcription factors that were in turn ordered by PcG proteins at their own transcription start site. Thus, PcG proteins, and the differential methylation of their binding sites, may represent a new mechanism by which TCE could alter the function of effector/memory CD4+ T cells. PMID:29129997
INHERITED NEUROPATHIES: CLINICAL OVERVIEW AND UPDATE
KLEIN, CHRISTOPHER J.; DUAN, XIAOHUI; SHY, MICHAEL E.
2014-01-01
Inherited neuropathy is a group of common neurologic disorders with heterogeneous clinical presentations and genetic causes. Detailed neuromuscular evaluations, including nerve conduction studies, laboratory testing, and histopathologic examination, can assist in identification of the inherited component beyond family history. Genetic testing increasingly enables definitive diagnosis of specific inherited neuropathies. Diagnosis, however, is often complex, and neurologic disability may have both genetic and acquired components in individual patients. The decision of which genetic test to order or whether to order genetic tests is often complicated, and the strategies to maximize the value of testing are evolving. Apart from rare inherited metabolic neuropathies, treatment approaches remain largely supportive. We provide a clinical update of the various types of inherited neuropathies, their differential diagnoses, and distinguishing clinical features (where available). A framework is provided for clinical evaluations, including the inheritance assessment, electrophysiologic examinations, and specific genetic tests. PMID:23801417
Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J
2002-04-01
Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.
Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu
2016-12-01
For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo
2018-03-01
-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.
Inherited trombophilic states and pulmonary embolism
Konecny, Filip
2009-01-01
Pulmonary embolism (PE) and deep vein thrombosis (DVT) are associated with considerable morbidity and mortality, mostly, in case of PE for its lack of sensitivity of its early detection. For as much as twenty-five percent of PE patients the primary clinical appearance is unexpected death. While PE is one of the most avertable causes of hospital associated deaths, its diagnostics can be extremely difficult. Newly increased interest in an inherited thrombophilic states has been provoked by the discovery of several common inherited abnormalities, i.e. the prothrombin (PT) gene G20210A, Factor V Leiden (FVL) mutation (Arg506Gln), hyperhomocystenemia and homocysteiuria, Wein-Penzing defect, Sticky Platelet Syndrome (SPS), Quebec platelet disorder (QPD) and Sickle Cell Disease (SCD). PE incidence rates increase exponentially with age for both men and women, as they might harbor more than one thrombophilic state. Although the impact of genetic factors on PE is to some extent documented with lacking taxonomy, its genetic testing as its prevention strategy fall short. In this review thrombophilic states are divided into inherited or acquired, and only the inherited and newly documented are more closely followed. Factors are further grouped based on its thrombophilic taxonomy into; inherited defects of coagulation, inherited defects of fibrinolysis, inherited defects of enzymatic pathway in relation to development of VTE and PE and inherited defects of platelets in relation to PE. It was beyond the scope of this review to follow all inherited and newly recognized factors and its association to VTE and PE; however the overall taxonomy makes this review clinically valuable i.e. in relation to genetic testing as PE prevention. PMID:21772860
Inherited trombophilic states and pulmonary embolism.
Konecny, Filip
2009-01-01
Pulmonary embolism (PE) and deep vein thrombosis (DVT) are associated with considerable morbidity and mortality, mostly, in case of PE for its lack of sensitivity of its early detection. For as much as twenty-five percent of PE patients the primary clinical appearance is unexpected death. While PE is one of the most avertable causes of hospital associated deaths, its diagnostics can be extremely difficult. Newly increased interest in an inherited thrombophilic states has been provoked by the discovery of several common inherited abnormalities, i.e. the prothrombin (PT) gene G20210A, Factor V Leiden (FVL) mutation (Arg506Gln), hyperhomocystenemia and homocysteiuria, Wein-Penzing defect, Sticky Platelet Syndrome (SPS), Quebec platelet disorder (QPD) and Sickle Cell Disease (SCD). PE incidence rates increase exponentially with age for both men and women, as they might harbor more than one thrombophilic state. Although the impact of genetic factors on PE is to some extent documented with lacking taxonomy, its genetic testing as its prevention strategy fall short.In this review thrombophilic states are divided into inherited or acquired, and only the inherited and newly documented are more closely followed. Factors are further grouped based on its thrombophilic taxonomy into; inherited defects of coagulation, inherited defects of fibrinolysis, inherited defects of enzymatic pathway in relation to development of VTE and PE and inherited defects of platelets in relation to PE. It was beyond the scope of this review to follow all inherited and newly recognized factors and its association to VTE and PE; however the overall taxonomy makes this review clinically valuable i.e. in relation to genetic testing as PE prevention.
Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen
2010-11-23
Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.
Nygren, G H; Nylin, S; Stefanescu, C
2006-11-01
Comma butterflies (Nymphalidae: Polygonia c-album L.) from one Belgian site and three Spanish sites were crossed with butterflies from a Swedish population in order to investigate inheritance of female host plant choice, egg mass and larval growth rate. We found three different modes of inheritance for the three investigated traits. In line with earlier results from crosses between Swedish and English populations, the results regarding female oviposition preference (choice between Urtica dioica and Salix caprea) showed X-linked inheritance to be of importance for the variation between Sweden and the other sites. Egg mass and growth rate did not show any sex-linked inheritance. Egg mass differences between populations seem to be controlled mainly by additive autosomal genes, as hybrids showed intermediate values. The growth rates of both hybrid types following reciprocal crossings were similar to each other but consistently higher than for the two source populations, suggesting a nonadditive mode of inheritance which is not sex-linked. The different modes of inheritance for host plant preference vs. important life history traits are likely to result in hybrids with unfit combinations of traits. This type of potential reproductive barrier based on multiple ecologically important traits deserves more attention, as it should be a common situation for instance in the early stages of population divergence in host plant usage, facilitating ecological speciation.
Inner-shell chemical shift of DNA/RNA bases and inheritance from their parent purine and pyrimidine.
Wang, Feng; Zhu, Quan; Ivanova, Elena
2008-11-01
Inner-shell electronic structures, properties and ionization spectra of DNA/RNA bases are studied with respect to their parent pyrimidine and purine species. Density functional theory B3LYP/aug-cc-pVTZ has been employed to produce the geometries of the bases, whereas LB94/et-pVQZ//B3LYP/aug-cc-pVTZ is used to calculate site-related Hirshfeld charges and core (vertical) ionization energies, as well as inner-shell spectra of C1s, N1s and O1s for DNA/RNA bases and their parent pyrimidine and purine species. The site-dependent variations of properties indicate the changes and inheritance of chemical environment when pyrimidine and purine become substituted. In general, although the changes are site-dependent, they are also ring-dependent. Pyrimidine bases change less significantly with respect to their parent pyrimidine than the purine bases with respect to their parent purine. Pyrimidine bases such as uracil, thymine and cytosine inherit certain properties from their parent pyrimidine, such as the Hirshfeld charge distributions and the order of core ionization energy level etc. No particular sites in the pyrimidine derivatives are engaged with a dramatic chemical shift nor with energy crossings to other sites. For the core shell spectra, the purine bases inherit very little from their parent purine, and guanine exhibits the least similarities to the parent among all the DNA/RNA bases.
Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo
2017-10-01
Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.
Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye
2017-01-01
Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654
Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J
2009-04-06
The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).
Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi
2010-01-01
Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.
Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi
2010-01-01
Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193
The evolutionary implications of epigenetic inheritance.
Jablonka, Eva
2017-10-06
The Modern Evolutionary Synthesis (MS) forged in the mid-twentieth century was built on a notion of heredity that excluded soft inheritance, the inheritance of the effects of developmental modifications. However, the discovery of molecular mechanisms that generate random and developmentally induced epigenetic variations is leading to a broadening of the notion of biological heredity that has consequences for ideas about evolution. After presenting some old challenges to the MS that were raised, among others, by Karl Popper, I discuss recent research on epigenetic inheritance, which provides experimental and theoretical support for these challenges. There is now good evidence that epigenetic inheritance is ubiquitous and is involved in adaptive evolution and macroevolution. I argue that the many evolutionary consequences of epigenetic inheritance open up new research areas and require the extension of the evolutionary synthesis beyond the current neo-Darwinian model.
Sepulveda, Antonia R.; Jones, Dan; Ogino, Shuji; Samowitz, Wade; Gulley, Margaret L.; Edwards, Robin; Levenson, Victor; Pratt, Victoria M.; Yang, Bin; Nafa, Khedoudja; Yan, Liying; Vitazka, Patrick
2009-01-01
Methylation of CpG islands in gene promoter regions is a major molecular mechanism of gene silencing and underlies both cancer development and progression. In molecular oncology, testing for the CpG methylation of tissue DNA has emerged as a clinically useful tool for tumor detection, outcome prediction, and treatment selection, as well as for assessing the efficacy of treatment with the use of demethylating agents and monitoring for tumor recurrence. In addition, because CpG methylation occurs early in pre-neoplastic tissues, methylation tests may be useful as markers of cancer risk in patients with either infectious or inflammatory conditions. The Methylation Working Group of the Clinical Practice Committee of the Association of Molecular Pathology has reviewed the current state of clinical testing in this area. We report here our summary of both the advantages and disadvantages of various methods, as well as the needs for standardization and reporting. We then conclude by summarizing the most promising areas for future clinical testing in cancer molecular diagnostics. PMID:19541921
Inherited Retinal Degenerative Clinical Trial Network
2009-10-01
ending in blindness. In the United States, the total number of individuals affected by retinitis pigmentosa (RP) and other forms of rare inherited...AD_________________ AWARD NUMBER: W81XWH-07-1-0720 TITLE: Inherited Retinal Degenerative...Final 3. DATES COVERED 27 Sep 2007 – 29 Sep 2009 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Inherited Retinal Degenerative Clinical Trial Network
Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao
2012-05-01
Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.
In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases
Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn
2012-01-01
The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581
PGD for inherited cardiac diseases.
Kuliev, Anver; Pomerantseva, Ekaterina; Polling, Dana; Verlinsky, Oleg; Rechitsky, Svetlana
2012-04-01
Preimplantation genetic diagnosis (PGD) has been applied for more than 200 different inherited conditions, with expanding application to common disorders with genetic predisposition. One of the recent indications for PGD has been inherited cardiac disease, for which no preclinical diagnosis and preventive management may exist and which may lead to premature or sudden death. This paper presents the first, as far as is known, cumulative experience of PGD for inherited cardiac diseases, including familial hypertrophic and dilated cardiomyopathy, cardioencephalomyopathy and Emery-Dreifuss muscular dystrophy. A total of 18 PGD cycles were performed, resulting in transfer in 15 of them, which yielded nine unaffected pregnancies and the births of seven disease- or disease predisposition-free children. The data open the prospect of PGD for inherited cardiac diseases, allowing couples carrying cardiac disease predisposing genes to reproduce without much fear of having offspring with these genes, which are at risk for premature or sudden death. Preimplantation genetic diagnosis (PGD) is currently an established clinical procedure in assisted reproduction and genetic practices. Its application has been expanding beyond traditional indications of prenatal diagnosis and currently includes common disorders with genetic predisposition, such as inherited forms of cancer. This applies also to the diseases with no current prospect of treatment, which may manifest despite presymptomatic diagnosis and follow up, when PGD may provide the only relief for the at-risk couples to reproduce. One of the recent indications for PGD has been inherited cardiac disease, for which no preclinical diagnosis and preventive management may exist and which may lead to premature or sudden death. We present here our first cumulative experience of PGD for inherited cardiac diseases, including familial hypertrophic and dilated cardiomyopathy, cardioencephalomyopathy and Emery-Dreifuss muscular dystrophy. A
Primer in Genetics and Genomics, Article 4-Inheritance Patterns.
Aiello, Lisa B; Chiatti, Beth Desaretz
2017-07-01
Since the completion of the Human Genome Project, much has been uncovered about inheritance of various illnesses and disorders. There are two main types of inheritance: Mendelian and non-Mendelian. Mendelian inheritance includes autosomal dominant, autosomal recessive, X-linked, and Y-linked inheritance. Non-Mendelian inheritance includes mitochondrial and multifactorial inheritance. Nurses must understand the types of inheritance in order to identify red flags that may indicate the possibility of a hereditary disorder in a patient or family.
Shaw, Richard J; Hall, Gillian L; Lowe, Derek; Bowers, Naomi L; Liloglou, Triantafillos; Field, John K; Woolgar, Julia A; Risk, Janet M
2007-10-01
Studies in several tumour sites highlight the significance of the CpG island methylation phenotype (CIMP), with distinct features of histology, biological aggression and outcome. We utilise pyrosequencing techniques of quantitative methylation analysis to investigate the presence of CIMP in oral squamous cell carcinoma (OSCC) for the first time, and evaluate its correlation with allelic imbalance, pathology and clinical behaviour. Tumour tissue, control tissue and PBLs were obtained from 74 patients with oral squamous cell carcinoma. Pyrosequencing was used to analyse methylation patterns in 75-200 bp regions of the CpG rich gene promoters of 10 genes with a broad range of cellular functions. Allelic imbalance was investigated using a multiplexed panel of 11 microsatellite markers. Corresponding variables, histopathological staging and grading were correlated with these genetic and epigenetic aberrations. A cluster of tumours with a greater degree of promoter methylation than would be predicted by chance alone (P=0.001) were designated CIMP+ve. This group had less aggressive tumour biology in terms of tumour thickness (p=0.015) and nodal metastasis (P=0.012), this being apparently independent of tumour diameter. Further, it seems that these CIMP+ve tumours excited a greater host inflammatory response (P=0.019). The exact mechanisms underlying CIMP remain obscure but the association with a greater inflammatory host response supports existing theories relating these features in other tumour sites. As CIMP has significant associations with other well documented prognostic indicators, it may prove beneficial to include methylation analyses in molecular risk modelling of tumours.
Zhao, Yongzhong; Epstein, Richard J
2013-01-01
Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.
Wan, Emily S.; Qiu, Weiliang; Morrow, Jarrett; Beaty, Terri H.; Hetmanski, Jacqueline; Make, Barry J.; Lomas, David A.; Silverman, Edwin K.; DeMeo, Dawn L.
2015-01-01
Klinefelter syndrome (KS) (47 XXY) is a common sex-chromosome aneuploidy with an estimated prevalence of 1 in every 660 male births. Investigations into the associations between DNA methylation and the highly variable clinical manifestations of KS have largely focused on the supernumerary X chromosome; systematic investigations of the epigenome have been limited. We obtained genome-wide DNA methylation data from peripheral blood using the Illumina HumanMethylation450K platform in 5 KS (47 XXY), 102 male (46 XY), and 113 female (46 XX) control subjects participating in the chronic obstructive pulmonary disease (COPD) Gene Study. Empirical Bayes-mediated models were used to test for differential methylation by KS status. CpG sites with a false-discovery rate <0.05 from the first-generation HumanMethylation27K platform were further examined in an independent replication cohort of 2 KS subjects, 590 male, and 495 female controls drawn from the International COPD Genetics Network (ICGN). Differential methylation at sites throughout the genome were identified, including 86 CpG sites that were differentially methylated in KS subjects relative to both male and female controls. CpG sites annotated to the HEN1 methyltransferase homolog 1 (HENMT1), calcyclin-binding protein (CACYBP), and GTPase-activating protein (SH3 domain)-binding protein 1 (G3BP1) genes were among the “KS-specific” loci that were replicated in ICGN. We therefore conclude that site-specific differential methylation exists throughout the genome in KS. The functional impact and clinical relevance of these differentially methylated loci should be explored in future studies. PMID:25988574
Developmental origins of epigenetic transgenerational inheritance
Hanson, Mark A.; Skinner, Michael K.
2016-01-01
Abstract Environmental factors can induce epigenetic alterations in the germ cells that can potentially be transmitted transgenerationally. This non-genetic form of inheritance is termed epigenetic transgenerational inheritance and has been shown in a variety of species including plants, flies, worms, fish, rodents, pigs, and humans. This phenomenon operates during specific critical windows of exposure, linked to the developmental biology of the germ cells (sperm and eggs). Therefore, concepts of the developmental origins of transgenerational inheritance of phenotypic variation and subsequent disease risk need to include epigenetic processes affecting the developmental biology of the germ cell. These developmental impacts on epigenetic transgenerational inheritance, in contrast to multigenerational exposures, are the focus of this Perspective. PMID:27390622
Epigenetic Inheritance: A Contributor to Species Differentiation?
Boffelli, Dario
2012-01-01
Multiple epigenetic states can be associated with the same genome, and transmitted through the germline for generations, to create the phenomenon of epigenetic inheritance. This form of inheritance is mediated by complex and highly diverse components of the chromosome that associate with DNA, control its transcription, and are inherited alongside it. But, how extensive, and how stable, is the information carried in the germline by the epigenome? Several known examples of epigenetic inheritance demonstrate that it has the ability to create selectable traits, and thus to mediate Darwinian evolution. Here we discuss the possibility that epigenetic inheritance is responsible for some stable characteristics of species, focusing on a recent comparison of the human and chimpanzee methylomes which reveals that somatic methylation states are related to methylation states in the germline. Interpretation of this finding highlights the potential significance of germline epigenetic states, as well as the challenge of investigating a form of inheritance with complex and unfamiliar rules. PMID:22966965
Inhalation of diesel exhaust and allergen alters human bronchial epithelium DNA methylation.
Clifford, Rachel L; Jones, Meaghan J; MacIsaac, Julia L; McEwen, Lisa M; Goodman, Sarah J; Mostafavi, Sara; Kobor, Michael S; Carlsten, Chris
2017-01-01
Allergic disease affects 30% to 40% of the world's population, and its development is determined by the interplay between environmental and inherited factors. Air pollution, primarily consisting of diesel exhaust emissions, has increased at a similar rate to allergic disease. Exposure to diesel exhaust may play a role in the development and progression of allergic disease, in particular allergic respiratory disease. One potential mechanism underlying the connection between air pollution and increased allergic disease incidence is DNA methylation, an epigenetic process with the capacity to integrate gene-environment interactions. We sought to investigate the effect of allergen and diesel exhaust exposure on bronchial epithelial DNA methylation. We performed a randomized crossover-controlled exposure study to allergen and diesel exhaust in humans, and measured single-site (CpG) resolution global DNA methylation in bronchial epithelial cells. Exposure to allergen alone, diesel exhaust alone, or allergen and diesel exhaust together (coexposure) led to significant changes in 7 CpG sites at 48 hours. However, when the same lung was exposed to allergen and diesel exhaust but separated by approximately 4 weeks, significant changes in more than 500 sites were observed. Furthermore, sites of differential methylation differed depending on which exposure was experienced first. Functional analysis of differentially methylated CpG sites found genes involved in transcription factor activity, protein metabolism, cell adhesion, and vascular development, among others. These findings suggest that specific exposures can prime the lung for changes in DNA methylation induced by a subsequent insult. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
FPGA implementation of a configurable neuromorphic CPG-based locomotion controller.
Barron-Zambrano, Jose Hugo; Torres-Huitzil, Cesar
2013-09-01
Neuromorphic engineering is a discipline devoted to the design and development of computational hardware that mimics the characteristics and capabilities of neuro-biological systems. In recent years, neuromorphic hardware systems have been implemented using a hybrid approach incorporating digital hardware so as to provide flexibility and scalability at the cost of power efficiency and some biological realism. This paper proposes an FPGA-based neuromorphic-like embedded system on a chip to generate locomotion patterns of periodic rhythmic movements inspired by Central Pattern Generators (CPGs). The proposed implementation follows a top-down approach where modularity and hierarchy are two desirable features. The locomotion controller is based on CPG models to produce rhythmic locomotion patterns or gaits for legged robots such as quadrupeds and hexapods. The architecture is configurable and scalable for robots with either different morphologies or different degrees of freedom (DOFs). Experiments performed on a real robot are presented and discussed. The obtained results demonstrate that the CPG-based controller provides the necessary flexibility to generate different rhythmic patterns at run-time suitable for adaptable locomotion. Copyright © 2013 Elsevier Ltd. All rights reserved.
Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua
2015-06-01
Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.
Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin
2010-08-01
Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.
25 CFR 91.9 - Inheritance of improvements.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Inheritance of improvements. 91.9 Section 91.9 Indians..., OSAGE RESERVATION, OKLAHOMA § 91.9 Inheritance of improvements. (a) Upon the death of the owner of... of the county courts, State of Oklahoma, and shall be subject to inheritance or bequest in accordance...
Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko
2015-08-01
The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Biparental chloroplast inheritance leads to rescue from cytonuclear incompatibility.
Barnard-Kubow, Karen B; McCoy, Morgan A; Galloway, Laura F
2017-02-01
Although organelle inheritance is predominantly maternal across animals and plants, biparental chloroplast inheritance has arisen multiple times in the angiosperms. Biparental inheritance has the potential to impact the evolutionary dynamics of cytonuclear incompatibility, interactions between nuclear and organelle genomes that are proposed to be among the earliest types of genetic incompatibility to arise in speciation. We examine the interplay between biparental inheritance and cytonuclear incompatibility in Campanulastrum americanum, a plant species exhibiting both traits. We first determine patterns of chloroplast inheritance in genetically similar and divergent crosses, and then associate inheritance with hybrid survival across multiple generations. There is substantial biparental inheritance in C. americanum. The frequency of biparental inheritance is greater in divergent crosses and in the presence of cytonuclear incompatibility. Biparental inheritance helps to mitigate cytonuclear incompatibility, leading to increased fitness of F 1 hybrids and recovery in the F 2 generation. This study demonstrates the potential for biparental chloroplast inheritance to rescue cytonuclear compatibility, reducing cytonuclear incompatibility's contribution to reproductive isolation and potentially slowing speciation. The efficacy of rescue depended upon the strength of incompatibility, with a greater persistence of weak incompatibilities in later generations. These findings suggest that incompatible plastids may lead to selection for biparental inheritance. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Pregnancy complications in women with inherited thrombophilia.
Weintraub, Adi Y; Sheiner, Eyal; Levy, Amalia; Yerushalmi, Ronit; Mazor, Moshe
2006-06-01
The purpose of this study was to examine whether women with inherited thrombophilia have an increased risk of developing pregnancy complications. All singleton pregnancies with known inherited thrombophilia were compared to those without inherited thrombophilia for deliveries during the years 2000-2002 in a tertiary medical center. Data regarding inherited thrombophilia (International Classification of Disease 9th revision, Clinical Modification code 286.3) were available from the perinatal database in our center. Women lacking prenatal care were excluded from the analysis. Stratified analysis, using a multiple logistic regression model, was performed to control for confounders. Out of 32,763 singleton deliveries that occurred during the study period, 0.2% (n=57) of the women were diagnosed with inherited thrombophilia. Using a multivariate analysis, with backward elimination, the following conditions were significantly associated with inherited thrombophilia: previous fetal losses [odds ratio (OR)=5.5; 95% confidence interval (CI) 2.9-10.3; P<0.001], recurrent abortions (OR=9.5; 95% CI 5.5-16.3; P<0.001), fertility treatments (OR=3.7; 95% CI 1.3-10.6; P=0.014), and intrauterine growth restriction (OR=7.2; 95% CI 3.4-15; P<0.001). Perinatal mortality was significantly higher in women with inherited thrombophilia than in those without known thrombophilia 5.3% (3/57) versus 0.6% (477/32,763) P=0.017. However, inherited thrombophilia was not found to be an independent risk factor for perinatal mortality (OR=3.05; 95% CI 0.90-10.3; P<0.073) in a multivariate analysis with perinatal mortality as the outcome variable, controlling for recurrent abortions, IUGR, and gestational age. Inherited thrombophilia, associated with previous fetal losses, recurrent abortions, fertility treatments, and intrauterine growth restriction, was not an independent risk factor for perinatal mortality.
Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong
2005-10-01
Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.
Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.
McCluskie, M J; Krieg, A M
2006-01-01
The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.
Genetics Home Reference: inherited thyroxine-binding globulin deficiency
... Health Conditions Inherited thyroxine-binding globulin deficiency Inherited thyroxine-binding globulin deficiency Printable PDF Open All Close ... to view the expand/collapse boxes. Description Inherited thyroxine-binding globulin deficiency is a genetic condition that ...
Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.
Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A
2004-09-01
Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.
Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J
2011-08-26
Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.
Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.
Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui
2011-02-28
To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.
Scala, Giovanni; Affinito, Ornella; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Chiariotti, Lorenzo; Cocozza, Sergio
2016-11-25
CpG sites in an individual molecule may exist in a binary state (methylated or unmethylated) and each individual DNA molecule, containing a certain number of CpGs, is a combination of these states defining an epihaplotype. Classic quantification based approaches to study DNA methylation are intrinsically unable to fully represent the complexity of the underlying methylation substrate. Epihaplotype based approaches, on the other hand, allow methylation profiles of cell populations to be studied at the single molecule level. For such investigations, next-generation sequencing techniques can be used, both for quantitative and for epihaplotype analysis. Currently available tools for methylation analysis lack output formats that explicitly report CpG methylation profiles at the single molecule level and that have suited statistical tools for their interpretation. Here we present ampliMethProfiler, a python-based pipeline for the extraction and statistical epihaplotype analysis of amplicons from targeted deep bisulfite sequencing of multiple DNA regions. ampliMethProfiler tool provides an easy and user friendly way to extract and analyze the epihaplotype composition of reads from targeted bisulfite sequencing experiments. ampliMethProfiler is written in python language and requires a local installation of BLAST and (optionally) QIIME tools. It can be run on Linux and OS X platforms. The software is open source and freely available at http://amplimethprofiler.sourceforge.net .
Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats
López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl
2017-01-01
ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046
Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun
2005-02-01
CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.
Inheritance of tristyly in Oxalis tuberosa (Oxalidaceae).
Trognitz, B R; Hermann, M
2001-05-01
Frequencies of floral morphs in progenies obtained from a complete set of diallelic crosses among three accessions of tristylous, octoploid oca (Oxalis tuberosa) were used for a Mendelian analysis of floral morph inheritance. The frequencies observed had the best fit to a model of tetrasomic inheritance with two diallelic factors, S, s and M, m, with S being epistatic over M. No explanation could be found for the unexpected formation of a small percentage of short-styled individuals in crosses between the mid-styled and the long-styled parent. For the acceptance of models of disomic and octosomic inheritance several additional assumptions would have to be made and therefore these modes of inheritance are less likely. Dosage-dependent inheritance of floral morph was rejected. Only a small frequency (36%) of the cross progenies flowered, in contrast to the greater propensity for flowering of O. tuberosa accessions held at gene banks.
Suli, Zailiza; Singh Gill, Balvinder; Rudra Deva, Shanti; Abdullah Sani, Ana Fizalinda; Romli, Erni Zurina; Mohamed Ghazali, Izzuna Mudla; Mohd. Yusof, Mohd. Aminuddin; Ahmad Lutfi, Nafisah; Shuib, Shahril Effendi; Mohd Darus, Noormah; Bakri, Rugayah
2017-01-01
The Malaysian Dengue Clinical Practice Guidelines (CPG) have been developed to provide evidence-based guidance in the management of dengue infections. The use of these guidelines is essential to ensure its recommendations are being practiced. However, the adherence to the guidelines for management of dengue (revised 2nd edition) by healthcare providers still remains unknown. Therefore, the aim of this study was to evaluate the proportion among healthcare providers that adhere to this Dengue CPG. A retrospective cohort study of dengue cases registered from 1 January 2014 to 1 June 2015 was conducted in public hospitals and health clinics in Selangor, Putrajaya and Kuala Lumpur. Adherence to the CPG recommendations were recorded by reviewing patients’ case notes. Overall proportion of adherence in clinical components of the recommendation were (7.1 to 100.0% versus 7.7 to 73.8%) in history taking, (6.7 to 100.0% versus 12.3 to 60.0%) in physical examinations, (18.4 to 100.0% versus 23.1 to 83.2%) in assessment of warning signs, (0.6 to 100.0% versus 12.3 to 87.7%) in assessment of haemodynamic status, (60.0 to 100.0% versus 27.7 to 40.0%) in diagnosis, (46.6 to 80.0% versus 52.3%) in case notifications, (73.2 to 100.0% versus 89.2 to 96.9%) in performing specific laboratory investigations and (7.9 to 100.0% versus 21.5%) in monitoring, for outpatient versus inpatient, respectively. Adherence trends were demonstrated to be higher in hospital settings compared to outpatient settings. Adherence to this Dengue CPG varies widely with overall good clinical outcomes observed. PMID:29095822
Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua
2013-01-01
Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433
77 FR 14700 - Streamlining Inherited Regulations
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-13
... contains notices to the public of #0;the proposed issuance of rules and regulations. The purpose of these... X [Docket No. CFPB-2011-0039] Streamlining Inherited Regulations AGENCY: Bureau of Consumer... the public for streamlining regulations it recently inherited from other Federal agencies (the...
Xing, Jinyi; Kang, Li; Jiang, Yunliang
2011-03-01
Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.
Langevin, Scott M; Eliot, Melissa; Butler, Rondi A; Cheong, Agnes; Zhang, Xiang; McClean, Michael D; Koestler, Devin C; Kelsey, Karl T
2015-01-01
There are currently no screening tests in routine use for oral and pharyngeal cancer beyond visual inspection and palpation, which are provided on an opportunistic basis, indicating a need for development of novel methods for early detection, particularly in high-risk populations. We sought to address this need through comprehensive interrogation of CpG island methylation in oral rinse samples. We used the Infinium HumanMethylation450 BeadArray to interrogate DNA methylation in oral rinse samples collected from 154 patients with incident oral or pharyngeal carcinoma prior to treatment and 72 cancer-free control subjects. Subjects were randomly allocated to either a training or a testing set. For each subject, average methylation was calculated for each CpG island represented on the array. We applied a semi-supervised recursively partitioned mixture model to the CpG island methylation data to identify a classifier for prediction of case status in the training set. We then applied the resultant classifier to the testing set for validation and to assess the predictive accuracy. We identified a methylation classifier comprised of 22 CpG islands, which predicted oral and pharyngeal carcinoma with a high degree of accuracy (AUC = 0.92, 95 % CI 0.86, 0.98). This novel methylation panel is a strong predictor of oral and pharyngeal carcinoma case status in oral rinse samples and may have utility in early detection and post-treatment follow-up.
Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal
2018-01-01
Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.
Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved
Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.
2016-01-01
DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945
Oliveira, Maxwel C.; Gaines, Todd A.; Jhala, Amit J.; Knezevic, Stevan Z.
2018-01-01
A population of Amaranthus tuberculatus (var. rudis) evolved resistance to 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitor herbicides (mesotrione, tembotrione, and topramezone) in Nebraska. The level of resistance was the highest to mesotrione, and the mechanism of resistance in this population is metabolism-based likely via cytochrome P450 enzymes. The increasing number of weeds resistant to herbicides warrants studies on the ecology and evolutionary factors contributing for resistance evolution, including inheritance of resistance traits. In this study, we investigated the genetic control of mesotrione resistance in an A. tuberculatus population from Nebraska, USA. Results showed that reciprocal crosses in the F1 families exhibited nuclear inheritance, which allows pollen movement carrying herbicide resistance alleles. The mode of inheritance varied from incomplete recessive to incomplete dominance depending upon the F1 family. Observed segregation patterns for the majority of the F2 and back-cross susceptible (BC/S) families did not fit to a single major gene model. Therefore, multiple genes are likely to confer metabolism-based mesotrione resistance in this A. tuberculatus population from Nebraska. The results of this study aid to understand the genetics and inheritance of a non-target-site based mesotrione resistant A. tuberculatus population from Nebraska, USA. PMID:29456544
Uniparental Inheritance Promotes Adaptive Evolution in Cytoplasmic Genomes.
Christie, Joshua R; Beekman, Madeleine
2017-03-01
Eukaryotes carry numerous asexual cytoplasmic genomes (mitochondria and plastids). Lacking recombination, asexual genomes should theoretically suffer from impaired adaptive evolution. Yet, empirical evidence indicates that cytoplasmic genomes experience higher levels of adaptive evolution than predicted by theory. In this study, we use a computational model to show that the unique biology of cytoplasmic genomes-specifically their organization into host cells and their uniparental (maternal) inheritance-enable them to undergo effective adaptive evolution. Uniparental inheritance of cytoplasmic genomes decreases competition between different beneficial substitutions (clonal interference), promoting the accumulation of beneficial substitutions. Uniparental inheritance also facilitates selection against deleterious cytoplasmic substitutions, slowing Muller's ratchet. In addition, uniparental inheritance generally reduces genetic hitchhiking of deleterious substitutions during selective sweeps. Overall, uniparental inheritance promotes adaptive evolution by increasing the level of beneficial substitutions relative to deleterious substitutions. When we assume that cytoplasmic genome inheritance is biparental, decreasing the number of genomes transmitted during gametogenesis (bottleneck) aids adaptive evolution. Nevertheless, adaptive evolution is always more efficient when inheritance is uniparental. Our findings explain empirical observations that cytoplasmic genomes-despite their asexual mode of reproduction-can readily undergo adaptive evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Emulating multiple inheritance in Fortran 2003/2008
Morris, Karla
2015-01-24
Although the high-performance computing (HPC) community increasingly embraces object-oriented programming (OOP), most HPC OOP projects employ the C++ programming language. Until recently, Fortran programmers interested in mining the benefits of OOP had to emulate OOP in Fortran 90/95. The advent of widespread compiler support for Fortran 2003 now facilitates explicitly constructing object-oriented class hierarchies via inheritance and leveraging related class behaviors such as dynamic polymorphism. Although C++ allows a class to inherit from multiple parent classes, Fortran and several other OOP languages restrict or prohibit explicit multiple inheritance relationships in order to circumvent several pitfalls associated with them. Nonetheless, whatmore » appears as an intrinsic feature in one language can be modeled as a user-constructed design pattern in another language. The present paper demonstrates how to apply the facade structural design pattern to support a multiple inheritance class relationship in Fortran 2003. As a result, the design unleashes the power of the associated class relationships for modeling complicated data structures yet avoids the ambiguities that plague some multiple inheritance scenarios.« less
Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A
2015-01-01
Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.
Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P
1988-01-01
Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118
[Gene therapy for inherited retinal dystrophies].
Côco, Monique; Han, Sang Won; Sallum, Juliana Maria Ferraz
2009-01-01
The inherited retinal dystrophies comprise a large number of disorders characterized by a slow and progressive retinal degeneration. They are the result of mutations in genes that express in either the photoreceptor cells or the retinal pigment epithelium. The mode of inheritance can be autosomal dominant, autosomal recessive, X linked recessive, digenic or mitochondrial DNA inherited. At the moment, there is no treatment for these conditions and the patients can expect a progressive loss of vision. Accurate genetic counseling and support for rehabilitation are indicated. Research into the molecular and genetic basis of disease is continually expanding and improving the prospects for rational treatments. In this way, gene therapy, defined as the introduction of exogenous genetic material into human cells for therapeutic purposes, may ultimately offer the greatest treatment for the inherited retinal dystrophies. The eye is an attractive target for gene therapy because of its accessibility, immune privilege and translucent media. A number of retinal diseases affecting the eye have known gene defects. Besides, there is a well characterized animal model for many of these conditions. Proposals for clinical trials of gene therapy for inherited retinal degenerations owing to defects in the gene RPE65, have recently received ethical approval and the obtained preliminary results brought large prospects in the improvement on patient's quality of life.
Immunogenicity of porcine circovirus type 2 nucleic acid vaccine containing CpG motif for mice.
Li, Jun; Yu, Jiang; Xu, Shaojian; Shi, Jianli; Xu, Shengnan; Wu, Xiaoyan; Fu, Fang; Peng, Zhe; Zhang, Lingling; Zheng, Shuxuan; Yuan, Xiaoyuan; Cong, Xiaoyan; Sun, Wenbo; Cheng, Kaihui; Du, Yijun; Wu, Jiaqiang; Wang, Jinbao
2016-11-14
This study aimed at reseaching the immune effect of porcine circovirus type 2 (PCV2) DNA vaccine containing CpG motif on mice. A total of 40 6-week-old female BALB/c mice were randomly divided into four groups which were immunized by 18CpG-pVAX1-ORF2, pVAX1-ORF2, pVAX1 and PBS, respectively, and immunized again 2 weeks later. All mice were challenged with 0.2 mL PCV2 cells virulent strain SD (10 6.0 TCID 50 /mL) after 4 weeks. Average daily gain, blood antibody levels, microscopic changes and viremia were detected to estimate the effect of DNA vaccine. The results showed that compared to those of the control mice, groups immunized with pVAX1-ORF2 and 18CpG-pVAX1-ORF2 could induce PCV2-specific antibodies. The PCV2-specific antibodies level of 18 CpG-pVAX1-ORF2 groups was higher significantly than other groups and decreased slowly along with time. There was no distinct pathological damage and viremia occurring in mice that inoculated with CpG motif DNA vaccines. The results demonstrated that the DNA vaccine containing 18 CpG could build up resistibility immunity and reduce immune organ damage on mice.
Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype
Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.
2000-01-01
Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144
Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James
2003-01-01
Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069
26 CFR 1.102-1 - Gifts and inheritances.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Gifts and inheritances. 1.102-1 Section 1.102-1...) INCOME TAXES (CONTINUED) Items Specifically Excluded from Gross Income § 1.102-1 Gifts and inheritances... inheritances. The income from any property received as a gift, or under a will or statute of descent and...
Jung, Myung-Hwa; Jung, Sung-Ju
2017-10-01
Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.
Bae, J M; Kim, J H; Cho, N-Y; Kim, T-Y; Kang, G H
2013-01-01
Background: Colorectal cancer (CRC) is usually categorised as proximal or distal CRC. Recently, many researchers have tried to determine the molecular heterogeneity of CRCs along bowel subsites. However, the differential effects of the CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) on the clinical outcome according to tumour location are not well-known. Methods: We analysed clinicopathologic and molecular characteristics, including CIMP, MSI, KRAS and BRAF mutations, in 734 CRCs according to bowel subsites. And the prognostic value of CIMP and MSI was analysed according to tumour location. Results: We found a linear increase of female predominance, T, N category, stage, differentiation, absence of luminal necrosis, tumour -infiltrating lymphocytes, Crohn's-like lymphoid reaction, serration and mucin production from the rectum to caecum. CpG island methylator phenotype -high and MSI-high gradually increased from the rectum to caecum. CpG island methylator phenotype is a poor prognostic factor of overall survival (hazard ratio (HR): 4.13, 95% confidence interval (CI): 1.27–13.46) and disease-free survival (HR: 2.90, 95% CI: 1.04–8.08) in rectal cancers. Conclusion: Clinicopathologic and molecular profiles of CRCs gradually change along bowel subsites, and the prognostic implication of CIMP is different according to tumour location. PMID:23900220
Tao, Wenqian; Ziemer, Katherine S; Gill, Harvinder S
2014-01-01
Aim: This study aimed to develop a novel influenza A vaccine by conjugating the highly conserved extracellular region of the matrix 2 protein (M2e) of influenza A virus to gold nanoparticles (AuNPs) and to test the vaccine in a mouse influenza challenge model. Materials & methods: Citrate-reduced AuNPs (diameter: 12 nm) were synthesized, and characterized by transmission electron microscopy and dynamic light scattering. M2e was conjugated to AuNPs through thiol–gold interactions to form M2e–AuNP conjugates. Particle stability was confirmed by UV–visible spectra, and M2e conjugation was further characterized by x-ray photoelectron spectroscopy. Mice were immunized with M2e–AuNPs with or without CpG (cytosine-guanine rich oligonucleotide) as an adjuvant with appropriate control groups. Sera was collected and M2e-specific immunoglobulin (IgG) was measured, and immunized mice were challenged with PR8-H1N1 influenza virus. Results: M2e-capped AuNPs could be lyophilized and stably resuspended in water. Intranasal vaccination of mice with M2e–AuNP conjugates induced M2e-specific IgG serum antibodies, which significantly increased upon addition of soluble CpG as adjuvant. Upon challenge with lethal PR8, mice vaccinated with M2e-AuNP conjugates were only partially protected, while mice that received soluble CpG as adjuvant in addition to M2e–AuNP were fully protected. Conclusion: Overall, this study demonstrates the potential of using the M2e–AuNP conjugates with CpG as an adjuvant as a platform for developing an influenza A vaccine. PMID:23829488
Inherited Bone Marrow Failure Syndromes (IBMFS)
The NCI IBMFS Cohort Study consists of affected individuals and their immediate families in North America who have an inherited bone marrow failure syndrome (IBMFS)-either one that has been specifically identified and defined, or bone marrow failure that appears to be inherited but has not yet been clearly identified as having a genetic basis.
Bauer, Mario; Linsel, Gunter; Fink, Beate; Offenberg, Kirsten; Hahn, Anne Maria; Sack, Ulrich; Knaack, Heike; Eszlinger, Markus; Herberth, Gunda
2015-01-01
Many recent epigenetic studies report that cigarette smoking reduces DNA methylation in whole blood at the single CpG site cg19859270 within the GPR15 gene. Within two independent cohorts, we confirmed the differentially expression of the GPR15 gene when smokers and non-smokers subjects are compared. By validating the GPR15 protein expression at the cellular level, we found that the observed decreased methylation at this site in white blood cells (WBC) of smokers is mainly caused by the high proportion of CD3+GPR15+ expressing T cells in peripheral blood. In current smokers, the percentage of GPR15+ cells among CD3+ T cells in peripheral blood is significantly higher (15.5 ± 7.2 %, mean ± standard deviation) compared to non-smokers (3.7 ± 1.6 %). Treatment of peripheral blood mononuclear cell (PBMC) cultures with aqueous cigarette smoke extract did not induce a higher proportion of this T cell subtype. Our results underline that DNA hypomethylation at cg19859270 site, observed in WBCs of smokers, did not arise by direct effect of tobacco smoking compounds on methylation of DNA but rather by the enrichment of a tobacco-smoking-induced lymphocyte population in the peripheral blood.
Legal Portion in Russian Inheritance Law
ERIC Educational Resources Information Center
Inshina, Roza; Murzalimova, Lyudmila
2013-01-01
In this paper the authors describe the right to inherit as one of the basic human rights guaranteed by the Constitution of the Russian Federation. The state has set rules according to which after a person's death, his or her property is inherited by other persons. The Russian civil legislation establishes the institution of legal portions that is…
The role of inheritance in structuring hyperextended rift systems
NASA Astrophysics Data System (ADS)
Manatschal, Gianreto; Lavier, Luc; Chenin, Pauline
2015-04-01
A long-standing question in Earth Sciences is related to the importance of inheritance in controlling tectonic processes. In contrast to physical processes that are generally applicable, assessing the role of inheritance suffers from two major problems: firstly, it is difficult to appraise without having insights into the history of a geological system; and secondly all inherited features are not reactivated during subsequent deformation phases. Therefore, the aim of our presentation is to give some conceptual framework about how inheritance may control the architecture and evolution of hyperextended rift systems. We use the term inheritance to refer to the difference between an "ideal" layer-cake type lithosphere and a "real" lithosphere containing heterogeneities and we define 3 types of inheritance, namely structural, compositional and thermal inheritance. Moreover, we assume that the evolution of hyperextended rift systems reflects the interplay between their inheritance (innate/"genetic code") and the physical processes at play (acquired/external factors). Thus, by observing the architecture and evolution of hyperextended rift systems and integrating the physical processes, one my get hints on what may have been the original inheritance of a system. Using this approach, we focus on 3 well-studied rift systems that are the Alpine Tethys, Pyrenean-Bay of Biscay and Iberia-Newfoundland rift systems. For the studied examples we can show that: 1) strain localization on a local scale and during early stages of rifting is controlled by inherited structures and weaknesses 2) the architecture of the necking zone seems to be influenced by the distribution and importance of ductile layers during decoupled deformation and is consequently controlled by the thermal structure and/or the inherited composition of the curst 3) the location of breakup in the 3 examples is not significantly controlled by the inherited structures 4) inherited mantle composition and rift
Uniparental Inheritance Promotes Adaptive Evolution in Cytoplasmic Genomes
Christie, Joshua R.; Beekman, Madeleine
2017-01-01
Eukaryotes carry numerous asexual cytoplasmic genomes (mitochondria and plastids). Lacking recombination, asexual genomes should theoretically suffer from impaired adaptive evolution. Yet, empirical evidence indicates that cytoplasmic genomes experience higher levels of adaptive evolution than predicted by theory. In this study, we use a computational model to show that the unique biology of cytoplasmic genomes—specifically their organization into host cells and their uniparental (maternal) inheritance—enable them to undergo effective adaptive evolution. Uniparental inheritance of cytoplasmic genomes decreases competition between different beneficial substitutions (clonal interference), promoting the accumulation of beneficial substitutions. Uniparental inheritance also facilitates selection against deleterious cytoplasmic substitutions, slowing Muller’s ratchet. In addition, uniparental inheritance generally reduces genetic hitchhiking of deleterious substitutions during selective sweeps. Overall, uniparental inheritance promotes adaptive evolution by increasing the level of beneficial substitutions relative to deleterious substitutions. When we assume that cytoplasmic genome inheritance is biparental, decreasing the number of genomes transmitted during gametogenesis (bottleneck) aids adaptive evolution. Nevertheless, adaptive evolution is always more efficient when inheritance is uniparental. Our findings explain empirical observations that cytoplasmic genomes—despite their asexual mode of reproduction—can readily undergo adaptive evolution. PMID:28025277
Mitochondrial DNA inheritance in the human fungal pathogen Cryptococcus gattii.
Wang, Zixuan; Wilson, Amanda; Xu, Jianping
2015-02-01
The inheritance of mitochondrial DNA (mtDNA) is predominantly uniparental in most sexual eukaryotes. In this study, we examined the mitochondrial inheritance pattern of Cryptococcus gattii, a basidiomycetous yeast responsible for the recent and ongoing outbreak of cryptococcal infections in the US Pacific Northwest and British Columbia (especially Vancouver Island) in Canada. Using molecular markers, we analyzed the inheritance of mtDNA in 14 crosses between strains within and between divergent lineages in C. gattii. Consistent with results from recent studies, our analyses identified significant variations in mtDNA inheritance patterns among strains and crosses, ranging from strictly uniparental to biparental. For two of the crosses that showed uniparental mitochondrial inheritance in standard laboratory conditions, we further investigated the effects of the following environmental variables on mtDNA inheritance: UV exposure, temperature, and treatments with the methylation inhibitor 5-aza-2'-deoxycytidine and with the ubiquitination inhibitor ammonium chloride. Interestingly, one of these crosses showed no response to these environmental variables while the other exhibited diverse patterns ranging from complete uniparental inheritance of the MATa parent mtDNA, to biparental inheritance, and to a significant bias toward inheritance of the MATα parental mtDNA. Our results indicate that mtDNA inheritance in C. gattii differs from that in its closely related species Cryptococcus neoformans. Copyright © 2015 Elsevier Inc. All rights reserved.
Hu, Yingchun; Zhang, Quan; Rao, Guangyuan; Sodmergen
2008-06-01
It is widely held that organelles inherit from the maternal lineage. However, the plastid genome in quite a few angiosperms appears to be biparentally transmitted. It is unclear how and why biparental inheritance of the genome became activated. Here, we detected widespread occurrence of plastids in the sperm cells (a cellular prerequisite for biparental inheritance) of traditional Caprifoliaceae. Of the 12 genera sampled, the sperm cells of Abelia, Dipelta, Heptacodium, Kolkwitzia, Leycesteria, Linnaea, Lonicera, Symphoricarpos, Triosteum and Weigela possessed inheritable plastids. The other genera, Sambucus and Viburnum, lacked plastids in sperm cells. Interestingly, such exclusion of plastids in the sperm cells of some Caprifoliaceae appeared to be associated with the divergence of Dipsacales phylogeny. Closer examination of Weigela florida revealed that both plastids and plastid DNA were highly duplicated in the generative cells. This implies that the appearance of plastids in sperm cells involved cellular mechanisms. Because such mechanisms must enhance the strength of plastid transmission through the paternal lineage and appear ubiquitous in species exhibiting biparental or potential biparental plastid inheritance, we presume that biparental plastid genetics may be a derived trait in angiosperms. This is consistent with our extended phylogenetic analysis using species with recently discovered modes of potential plastid inheritance. The results show that basal and early angiosperms have maternal plastid transmission, whereas all potential biparental transmission occurs at terminal branches of the tree. Thus, unlike previous studies, we suggest that biparental plastid inheritance in angiosperms was unilaterally converted from the maternal transmission mode during late angiosperm evolution.
Spencer, Gaynor E; Kazmi, Mustapha H; Syed, Naweed I; Lukowiak, Ken
2002-10-01
We have previously shown that the aerial respiratory behavior of the mollusk Lymnaea stagnalis can be operantly conditioned, and the central pattern generating (CPG) neurons underlying this behavior have been identified. As neural correlates of operant conditioning remain poorly defined in both vertebrates and invertebrates, we have used the Lymnaea respiratory CPG to investigate neuronal changes associated with the change in behavior after conditioning. After operant conditioning of the intact animals, semi-intact preparations were dissected, so that changes in the respiratory behavior (pneumostome openings) and underlying activity of the identified CPG neuron, right pedal dorsal 1 (RPeD1), could be monitored simultaneously. RPeD1 was studied because it initiates the rhythmic activity of the CPG and receives chemo-sensory input from the pneumostome area. Pneumostome openings and RPeD1 activity were monitored both before and after a reinforcing training stimulus applied to the open pneumostome of operantly conditioned and yoked control preparations. After presentation of the reinforcing stimulus, there was a significant reduction in both breathing behavior and RPeD1 activity in operant preparations but not in yoked and naïve controls. Furthermore these changes were only significant in the subgroup of operantly conditioned animals described as good learners and not in poor learners. These data strongly suggest that changes in RPeD1 activity may underlie the behavioral changes associated with the reinforcement of operant conditioning of the respiratory behavior.
Phenotype-specific CpG island methylation events in a murine model of prostate cancer.
Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J
2008-06-01
Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.
Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.
Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J
2016-08-19
DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Selection against Heteroplasmy Explains the Evolution of Uniparental Inheritance of Mitochondria
Christie, Joshua R.; Schaerf, Timothy M.; Beekman, Madeleine
2015-01-01
Why are mitochondria almost always inherited from one parent during sexual reproduction? Current explanations for this evolutionary mystery include conflict avoidance between the nuclear and mitochondrial genomes, clearing of deleterious mutations, and optimization of mitochondrial-nuclear coadaptation. Mathematical models, however, fail to show that uniparental inheritance can replace biparental inheritance under any existing hypothesis. Recent empirical evidence indicates that mixing two different but normal mitochondrial haplotypes within a cell (heteroplasmy) can cause cell and organism dysfunction. Using a mathematical model, we test if selection against heteroplasmy can lead to the evolution of uniparental inheritance. When we assume selection against heteroplasmy and mutations are neither advantageous nor deleterious (neutral mutations), uniparental inheritance replaces biparental inheritance for all tested parameter values. When heteroplasmy involves mutations that are advantageous or deleterious (non-neutral mutations), uniparental inheritance can still replace biparental inheritance. We show that uniparental inheritance can evolve with or without pre-existing mating types. Finally, we show that selection against heteroplasmy can explain why some organisms deviate from strict uniparental inheritance. Thus, we suggest that selection against heteroplasmy explains the evolution of uniparental inheritance. PMID:25880558
Inherited cardiomyopathies and sports participation.
Zorzi, A; Pelliccia, A; Corrado, D
2018-03-01
Competitive sports activity is associated with an increased risk of sudden cardiovascular death in adolescents and young adults with inherited cardiomyopathies. Many young subjects aspire to continue competitive sport after a diagnosis of cardiomyopathy and the clinician is frequently confronted with the problem of eligibility and the request of designing specific exercise programs. Since inherited cardiomyopathies are the leading cause of sudden cardiovascular death during sports performance, a conservative approach implying disqualification of affected athletes from most competitive athletic disciplines is recommended by all the available international guidelines. On the other hand, we know that the health benefits of practicing recreational sports activity can overcome the potential arrhythmic risk in these patients, provided that the type and level of exercise are tailored on the basis of the specific risk profile of the underlying cardiomyopathy. This article will review the available evidence on the sports-related risk of sudden cardiac death and the recommendations regarding eligibility of individuals affected by inherited cardiomyopathies for sports activities.
Environmental stress and epigenetic transgenerational inheritance.
Skinner, Michael K
2014-09-05
Previous studies have shown a wide variety of environmental toxicants and abnormal nutrition can promote the epigenetic transgenerational inheritance of disease. More recently a number of studies have indicated environmental stress can also promote epigenetic alterations that are transmitted to subsequent generations to induce pathologies. A recent study by Yao and colleagues demonstrated gestational exposure to restraint stress and forced swimming promoted preterm birth risk and adverse newborn outcomes generationally. This ancestral stress promoted the epigenetic transgenerational inheritance of abnormalities in the great-grand offspring of the exposed gestating female. Several studies now support the role of environmental stress in promoting the epigenetic transgenerational inheritance of disease. Observations suggest ancestral environmental stress may be a component of disease etiology in the current population.
Extended inheritance from an organizational point of view.
Pontarotti, Gaëlle
2015-12-01
In this paper, I argue that the increasing data about non-genetic inheritance requires the construction of a new conceptual framework that should complement the inclusive approaches already discussed in the literature. More precisely, I hold that this framework should be epistemologically relevant for evolutionary biologists in capturing the limits of extended inheritance and in reassessing the boundaries of biological systems that transmit traits to their offspring. I outline the first elements of an organizational account of extended inheritance. In this account, the category of inherited factors is neither restricted to genes nor extended to stable resources related to trans-generational similarities. Instead, it includes persisting constitutive elements appearing as difference makers for heterogeneous organizational constraints, namely for heterogeneous constitutive parts whose specific role is to harness flows of matter and energy across generations of clearly delimited extended organized systems. This both inclusive and restrictive framework opens an additional way to apprehend how extended inheritance may affect evolutionary trajectories.
Why does biparental plastid inheritance revive in angiosperms?
Zhang, Quan; Sodmergen
2010-03-01
It is widely believed that plastid and mitochondrial genomes are inherited through the maternal parent. In plants, however, paternal transmission of these genomes is frequently observed, especially for the plastid genome. A male gametic trait, called potential biparental plastid inheritance (PBPI), occurs in up to 20% of angiosperm genera, implying a strong tendency for plastid transmission from the male lineage. Why do plants receive organelles from the male parents? Are there clues in plastids that will help to elucidate the evolution of plants? Reconstruction of the ancestral state of plastid inheritance patterns in a phylogenetic context provides insights into these questions. In particular, a recent report demonstrated the unilateral occurrence of PBPI in angiosperms. This result implies that nuclear cytoplasmic conflicts, a basic driving force for altering the mode of organelle inheritance, might have arisen specifically in angiosperms. Based on existing evidence, it is likely that biparental inheritance may have occurred to rescue angiosperm species with defective plastids.
Widow inheritance and HIV/AIDS in rural Uganda.
Mabumba, E D; Mugyenyi, P; Batwala, V; Mulogo, E M; Mirembe, J; Khan, F A; Liljestrand, J
2007-10-01
Despite current efforts to combat HIV/AIDS through behavioural change, ingrained socio-cultural practices such as widow inheritance in south-western Uganda has not changed. Low education, unemployment, dowry, widows' socioeconomic demands and the inheritor's greed for the deceased's wealth, influence widow inheritance. Voluntary counselling and testing is needed for the widows and their inheritors; formal dowry should be removed from marriage and widow inheritance stripped of its sexual component.
NASA Astrophysics Data System (ADS)
Son, Yurak; Kamano, Takuya; Yasuno, Takashi; Suzuki, Takayuki; Harada, Hironobu
This paper describes the generation of adaptive gait patterns using new Central Pattern Generators (CPGs) including motor dynamic models for a quadruped robot under various environment. The CPGs act as the flexible oscillators of the joints and make the desired angle of the joints. The CPGs are mutually connected each other, and the sets of their coupling parameters are adjusted by genetic algorithm so that the quadruped robot can realize the stable and adequate gait patterns. As a result of generation, the suitable CPG networks for not only a walking straight gait pattern but also rotation gait patterns are obtained. Experimental results demonstrate that the proposed CPG networks are effective to automatically adjust the adaptive gait patterns for the tested quadruped robot under various environment. Furthermore, the target tracking control based on image processing is achieved by combining the generated gait patterns.
Law & psychiatry: Murder, inheritance, and mental illness.
Gold, Azgad; Appelbaum, Paul S
2011-07-01
Should a murderer be allowed to inherit the victim's estate? The question dates from biblical times, but most jurisdictions today have statutes in place that bar inheritance by convicted murderers. However, a special problem arises when the killer has a severe mental illness and has been found not guilty by reason of insanity. Should such people, who have not been convicted of a crime, be permitted to collect their inheritance? Jurisdictions vary in their responses, with the rules reflecting a mix of practical and moral considerations influenced by different perspectives about what determines the behavior of persons with mental illness.
Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D
2006-01-16
Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine
Claus, Rainer; Lucas, David M.; Stilgenbauer, Stephan; Ruppert, Amy S.; Yu, Lianbo; Zucknick, Manuela; Mertens, Daniel; Bühler, Andreas; Oakes, Christopher C.; Larson, Richard A.; Kay, Neil E.; Jelinek, Diane F.; Kipps, Thomas J.; Rassenti, Laura Z.; Gribben, John G.; Döhner, Hartmut; Heerema, Nyla A.; Marcucci, Guido; Plass, Christoph; Byrd, John C.
2012-01-01
Purpose Increased ZAP-70 expression predicts poor prognosis in chronic lymphocytic leukemia (CLL). Current methods for accurately measuring ZAP-70 expression are problematic, preventing widespread application of these tests in clinical decision making. We therefore used comprehensive DNA methylation profiling of the ZAP-70 regulatory region to identify sites important for transcriptional control. Patients and Methods High-resolution quantitative DNA methylation analysis of the entire ZAP-70 gene regulatory regions was conducted on 247 samples from patients with CLL from four independent clinical studies. Results Through this comprehensive analysis, we identified a small area in the 5′ regulatory region of ZAP-70 that showed large variability in methylation in CLL samples but was universally methylated in normal B cells. High correlation with mRNA and protein expression, as well as activity in promoter reporter assays, revealed that within this differentially methylated region, a single CpG dinucleotide and neighboring nucleotides are particularly important in ZAP-70 transcriptional regulation. Furthermore, by using clustering approaches, we identified a prognostic role for this site in four independent data sets of patients with CLL using time to treatment, progression-free survival, and overall survival as clinical end points. Conclusion Comprehensive quantitative DNA methylation analysis of the ZAP-70 gene in CLL identified important regions responsible for transcriptional regulation. In addition, loss of methylation at a specific single CpG dinucleotide in the ZAP-70 5′ regulatory sequence is a highly predictive and reproducible biomarker of poor prognosis in this disease. This work demonstrates the feasibility of using quantitative specific ZAP-70 methylation analysis as a relevant clinically applicable prognostic test in CLL. PMID:22564988
Metabolism and insulin signaling in common metabolic disorders and inherited insulin resistance.
Højlund, Kurt
2014-07-01
Type 2 diabetes, obesity and polycystic ovary syndrome (PCOS) are common metabolic disorders which are observed with increasing prevalences, and which are caused by a complex interplay between genetic and environmental factors, including increased calorie intake and physical inactivity. These metabolic disorders are all characterized by reduced plasma adiponectin and insulin resistance in peripheral tissues. Quantitatively skeletal muscle is the major site of insulin resistance. Both low plasma adiponectin and insulin resistance contribute to an increased risk of type 2 diabetes and cardiovascular disease. In several studies, we have investigated insulin action on glucose and lipid metabolism, and at the molecular level, insulin signaling to glucose transport and glycogen synthesis in skeletal muscle from healthy individuals and in obesity, PCOS and type 2 diabetes. Moreover, we have described a novel syndrome characterized by postprandial hyperinsulinemic hypoglycemia and insulin resistance. This syndrome is caused by a mutation in the tyrosine kinase domain of the insulin receptor gene (INSR). We have studied individuals with this mutation as a model of inherited insulin resistance. Type 2 diabetes, obesity and PCOS are characterized by pronounced defects in the insulin-stimulated glucose uptake, in particular glycogen synthesis and to a lesser extent glucose oxidation, and the ability of insulin to suppress lipid oxidation. In inherited insulin resistance, however, only insulin action on glucose uptake and glycogen synthesis is impaired. This suggests that the defects in glucose and lipid oxidation in the common metabolic disorders are secondary to other factors. In young women with PCOS, the degree of insulin resistance was similar to that seen in middle-aged patients with type 2 diabetes. This supports the hypothesis of an unique pathogenesis of insulin resistance in PCOS. Insulin in physiological concentrations stimulates glucose uptake in human skeletal
Epigenetic Inheritance across the Landscape.
Whipple, Amy V; Holeski, Liza M
2016-01-01
The study of epigenomic variation at the landscape-level in plants may add important insight to studies of adaptive variation. A major goal of landscape genomic studies is to identify genomic regions contributing to adaptive variation across the landscape. Heritable variation in epigenetic marks, resulting in transgenerational plasticity, can influence fitness-related traits. Epigenetic marks are influenced by the genome, the environment, and their interaction, and can be inherited independently of the genome. Thus, epigenomic variation likely influences the heritability of many adaptive traits, but the extent of this influence remains largely unknown. Here, we summarize the relevance of epigenetic inheritance to ecological and evolutionary processes, and review the literature on landscape-level patterns of epigenetic variation. Landscape-level patterns of epigenomic variation in plants generally show greater levels of isolation by distance and isolation by environment then is found for the genome, but the causes of these patterns are not yet clear. Linkage between the environment and epigenomic variation has been clearly shown within a single generation, but demonstrating transgenerational inheritance requires more complex breeding and/or experimental designs. Transgenerational epigenetic variation may alter the interpretation of landscape genomic studies that rely upon phenotypic analyses, but should have less influence on landscape genomic approaches that rely upon outlier analyses or genome-environment associations. We suggest that multi-generation common garden experiments conducted across multiple environments will allow researchers to understand which parts of the epigenome are inherited, as well as to parse out the relative contribution of heritable epigenetic variation to the phenotype.
Epigenetic Inheritance across the Landscape
Whipple, Amy V.; Holeski, Liza M.
2016-01-01
The study of epigenomic variation at the landscape-level in plants may add important insight to studies of adaptive variation. A major goal of landscape genomic studies is to identify genomic regions contributing to adaptive variation across the landscape. Heritable variation in epigenetic marks, resulting in transgenerational plasticity, can influence fitness-related traits. Epigenetic marks are influenced by the genome, the environment, and their interaction, and can be inherited independently of the genome. Thus, epigenomic variation likely influences the heritability of many adaptive traits, but the extent of this influence remains largely unknown. Here, we summarize the relevance of epigenetic inheritance to ecological and evolutionary processes, and review the literature on landscape-level patterns of epigenetic variation. Landscape-level patterns of epigenomic variation in plants generally show greater levels of isolation by distance and isolation by environment then is found for the genome, but the causes of these patterns are not yet clear. Linkage between the environment and epigenomic variation has been clearly shown within a single generation, but demonstrating transgenerational inheritance requires more complex breeding and/or experimental designs. Transgenerational epigenetic variation may alter the interpretation of landscape genomic studies that rely upon phenotypic analyses, but should have less influence on landscape genomic approaches that rely upon outlier analyses or genome–environment associations. We suggest that multi-generation common garden experiments conducted across multiple environments will allow researchers to understand which parts of the epigenome are inherited, as well as to parse out the relative contribution of heritable epigenetic variation to the phenotype. PMID:27826318
MPT-51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis.
Silva, Bruna Daniella de Souza; da Silva, Ediane Batista; do Nascimento, Ivan Pereira; Dos Reis, Michelle Cristina Guerreiro; Kipnis, André; Junqueira-Kipnis, Ana Paula
2009-07-16
Tuberculosis (TB) is a severe infectious disease that kills approximately two million people worldwide every year. Because BCG protection is variable and does not protects adults, there is a great need for a new vaccine against TB that does not represent a risk for immunocompromised patients and that is also capable of protecting adult individuals. MPT-51 is a protein found in the genome of mycobacteria and binds to the fibronectin of the extracellular matrix, which may have a role in host tissue attachment and virulence. In order to test the usefulness of MPT-51 as a subunit vaccine, BALB/c were vaccinated and challenged with Mycobacterium tuberculosis. The infection of BALB/c with M. tuberculosis increased the number of IFN-gamma(+) T lymphocytes specific to MPT-51 in the spleen and lungs. Inoculation with rMPT-51/FIA and with rMPT-51/CpG DNA in non-infected BALB/c increased the amounts of IFN-gamma(+) T lymphocytes. Inoculation with rMPT-51/FIA also induced a humoral response specific to MPT-51. CFU counts of lung tissues done 60 days after infection showed a reduction of about 2 log in the bacteria load in the group of animals inoculated with rMPT-51/CpG DNA. These results make MPT-51 a valuable component to be further evaluated in the development of other subunit vaccines.
[Inherited primitive and secondary polycythemia].
Barba, T; Boileau, J-C; Pasquet, F; Hot, A; Pavic, M
2016-07-01
Myeloproliferative disorders and secondary polycythemia cover most of the polycythemia cases encountered in daily practice. Inherited polycythemias are rare entities that have to be suspected when the classical causes of acquired polycythemia have been ruled out. Recent advances were made in the understanding of these pathologies, which are still little known to the physicians. This review reports the state of knowledge and proposes an algorithm to follow when confronted to a possible case of inherited polycythemia. Copyright © 2015 Société Nationale Française de Médecine Interne (SNFMI). Published by Elsevier SAS. All rights reserved.
Jain, Surbhi; Boldbaatar, Batbold; Hamilton, James P.; Lin, Selena Y.; Chang, Ting-Tsung; Chen, Shun-Hua; Song, Wei; Meltzer, Stephen J.; Block, Timothy M.; Su, Ying-Hsiu
2012-01-01
Hypermethylation of the glutathione S-transferase π 1 (GSTP1) gene promoter region has been reported to be a potential biomarker to distinguish hepatocellular carcinoma (HCC) from other liver diseases. However, reports regarding how specific a marker it is have ranged from 100% to 0%. We hypothesized that, to a large extent, the variation of specificity depends on the location of the CpG sites analyzed. To test this hypothesis, we compared the methylation status of the GSTP1 promoter region of the DNA isolated from HCC, cirrhosis, hepatitis, and normal liver tissues by bisulfite–PCR sequencing. We found that the 5′ region of the position −48 nt from the transcription start site of the GSTP1 gene is selectively methylated in HCC, whereas the 3′ region is methylated in all liver tissues examined, including normal liver and the HCC tissue. Interestingly, when DNA derived from fetal liver and 11 nonhepatic normal tissue was also examined by bisulfite-PCR sequencing, we found that methylation of the 3′ region of the promoter appeared to be liver-specific. A methylation-specific PCR assay targeting the 5′ region of the promoter was developed and used to quantify the methylated GSTP1 gene in various diseased liver tissues including HCC. When we used an assay targeting the 3′ region, we found that the methylation of the 5′-end of the GSTP1 promoter was significantly more specific than that of the 3′-end (97.1% vs. 60%, p<0.0001 by Fisher's exact test) for distinguishing HCC (n = 120) from hepatitis (n = 35) and cirrhosis (n = 35). Encouragingly, 33.8% of the AFP-negative HCC contained the methylated GSTP1 gene. This study clearly demonstrates the importance of the location of CpG site methylation for HCC specificity and how liver-specific DNA methylation should be considered when an epigenetic DNA marker is studied for detection of HCC. PMID:22536438
Selective sweeps of mitochondrial DNA can drive the evolution of uniparental inheritance.
Christie, Joshua R; Beekman, Madeleine
2017-08-01
Although the uniparental (or maternal) inheritance of mitochondrial DNA (mtDNA) is widespread, the reasons for its evolution remain unclear. Two main hypotheses have been proposed: selection against individuals containing different mtDNAs (heteroplasmy) and selection against "selfish" mtDNA mutations. Recently, uniparental inheritance was shown to promote adaptive evolution in mtDNA, potentially providing a third hypothesis for its evolution. Here, we explore this hypothesis theoretically and ask if the accumulation of beneficial mutations provides a sufficient fitness advantage for uniparental inheritance to invade a population in which mtDNA is inherited biparentally. In a deterministic model, uniparental inheritance increases in frequency but cannot replace biparental inheritance if only a single beneficial mtDNA mutation sweeps through the population. When we allow successive selective sweeps of mtDNA, however, uniparental inheritance can replace biparental inheritance. Using a stochastic model, we show that a combination of selection and drift facilitates the fixation of uniparental inheritance (compared to a neutral trait) when there is only a single selective mtDNA sweep. When we consider multiple mtDNA sweeps in a stochastic model, uniparental inheritance becomes even more likely to replace biparental inheritance. Our findings thus suggest that selective sweeps of beneficial mtDNA haplotypes can drive the evolution of uniparental inheritance. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.
Molecular mechanisms for protein-encoded inheritance
Wiltzius, Jed J. W.; Landau, Meytal; Nelson, Rebecca; Sawaya, Michael R.; Apostol, Marcin I.; Goldschmidt, Lukasz; Soriaga, Angela B.; Cascio, Duilio; Rajashankar, Kanagalaghatta; Eisenberg, David
2013-01-01
Strains are phenotypic variants, encoded by nucleic acid sequences in chromosomal inheritance and by protein “conformations” in prion inheritance and transmission. But how is a protein “conformation” stable enough to endure transmission between cells or organisms? Here new polymorphic crystal structures of segments of prion and other amyloid proteins offer structural mechanisms for prion strains. In packing polymorphism, prion strains are encoded by alternative packings (polymorphs) of β-sheets formed by the same segment of a protein; in a second mechanism, segmental polymorphism, prion strains are encoded by distinct β-sheets built from different segments of a protein. Both forms of polymorphism can produce enduring “conformations,” capable of encoding strains. These molecular mechanisms for transfer of information into prion strains share features with the familiar mechanism for transfer of information by nucleic acid inheritance, including sequence specificity and recognition by non-covalent bonds. PMID:19684598
Long, Tiffany I.; Buchanan, Daniel D.; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D.; Stern, Mariana C.; LeMarchand, Loic; Lindor, Noralane M.; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A.; Campbell, Peter T.; Casey, Graham; Ahnen, Dennis J.; Baron, John A.; Haile, Robert W.; Hopper, John L.; Young, Joanne P.; Laird, Peter W.; Siegmund, Kimberly D.
2015-01-01
Background The CpG Island Methylator Phenotype (CIMP) represents a subset of colorectal cancers (CRCs) characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. Methods We measured the CIMP status of 3,119 primary population-based CRC tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of CRC cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). Results We found associations between tumor CIMP status and MSI-H (ccOR=7.6), BRAF V600E mutation (ccOR=59.8), proximal tumor site (ccOR=9) (all p<0.0001), female sex (ccOR=1.8; 95% CI=1.5-2.1), older age (ccOR=4.0 comparing over 70 years vs under 50; 95% CI=3.0-5.5) and family history of CRC (ccOR=0.6, 95% CI=0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (p=0.0001 and p=0.02, respectively), use of multi-vitamin or calcium supplements did not. Only for female CRCs was CIMP status associated with increased pack-years of smoking (trend p < 0.001) and body mass index (BMI) (trend p = 0.03). Conclusions The frequency of several CRC risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Impact Differences in the associations of a unique DNA methylation-based subgroup of CRC with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of CRCs. PMID:25587051
Iliev, Dimitar B; Hansen, Tom; Jørgensen, Sven Martin; Krasnov, Aleksei; Jørgensen, Jorunn B
2013-10-01
The Mitogen-activated protein kinases (MAPK) are involved in transmitting intracellular signals downstream of diverse cell surface receptors and mediate the response to ligands such as growth factors, hormones and cytokines. In addition, MAPK are critically involved in the innate immune response to pathogen-derived substances, commonly referred to as pathogen-associated molecular patterns (PAMPs), such as bacterial lipopolysaccharide (LPS) and bacterial DNA rich in CpG dinucleotides. Currently, a great deal of knowledge is available about the involvement of MAPK in the innate immune response to PAMPs in mammals; however, little is known about the role of the different MAPK classes in the immune response to PAMPs in lower vertebrates. In the current study, p38 phosphorylation was induced by CpG oligonucleotides (ODNs) and LPS in primary salmon mononuclear phagocytes. Pre-treatment of the cells with a p38 inhibitor (SB203580) blocked the PAMP-induced p38 activity and suppressed the upregulation of most of the CpG- and LPS-induced transcripts highlighting the role of this kinase in the salmon innate immune response to PAMPs. In contrast to p38, the phosphorylation of extracellular signal-regulated kinase (ERK), a MAPK involved primarily in response to mitogens, was high in resting cells and, surprisingly, incubation with both CpG and control ODNs downregulated the phospho-ERK levels independently of p38 activation. The basal phospho-ERK level and the CpG-inducible p38 phosphorylation were greatly influenced by the length of in vitro incubation. The basal phospho-ERK level increased gradually throughout a 5-day culture period and was PI3K-dependent as demonstrated by its sensitivity to Wortmannin suggesting it is influenced by growth factors. Overall these data indicate that both basal and PAMP-induced activity of MAPKs might be greatly influenced by the differentiation status of salmon mononuclear phagocytes. Copyright © 2013. Published by Elsevier Ltd.
Epigenetic Inheritance and the Intergenerational Transfer of Experience
ERIC Educational Resources Information Center
Harper, Lawrence
2005-01-01
Currently, behavioral development is thought to result from the interplay among genetic inheritance, congenital characteristics, cultural contexts, and parental practices as they directly impact the individual. Evolutionary ecology points to another contributor, epigenetic inheritance, the transmission to offspring of parental phenotypic responses…
Constitutional delay of puberty: presentation and inheritance pattern in 48 familial cases.
Winter, Sarah; Ousidhoum, Aldjia; McElreavey, Kenneth; Brauner, Raja
2016-03-12
The mechanism that initiates the onset of puberty is largely unknown but the age of onset is mainly under genetic control and influenced by environmental factors including nutrition. Familial forms of constitutional delay of puberty (CDP) suggest the involvement of genetic factors. The purpose of this study is to describe the presentation and the mode of inheritance of CDP in a series of familial cases. A retrospective, single center study was carried out over 10 years on 48 probands (14 girls and 34 boys) from 48 families seen for CDP with a familial component. Of the 48 probands, 46 (96 %) had at least one affected 1(st) degree relatives and 2 (4 %, 2 boys) had only 2(nd) degree relatives affected. In girls, 11 families (79 %) exhibited exclusive maternal inheritance, 1 (7 %) paternal inheritance and 2 (14 %) both maternal and paternal inheritance. In boys, 14 families (41 %) exhibited exclusive maternal inheritance, 12 (35 %) paternal inheritance and 8 (24 %) both maternal and paternal inheritance. In the boys with bilineal inheritance, the ages at onset of puberty (16 ± 1.41 years) and at evaluation (16.05 ± 2.47 years) were higher than in those with unilineal inheritance (15.25 ± 0.35 and 15.1 ± 0.42 years respectively), but the difference was not significant. In girls exclusive maternal inheritance seems to be the major mode of inheritance whereas for boys the mode of inheritance was almost equally maternal, paternal or bilineal. Clinical phenotype of boys with bilineal inheritance seems to be more severe, but the difference did not reach statistical significance, perhaps because of the small sample size. This greater severity of the phenotype in boys with bilineal inheritance is likely due to inheriting different puberty timing genes from each parent. Future research should be directed at identifying such genes.
Sanders, G D; Nease, R F; Owens, D K
2000-01-01
Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.
22 CFR 71.3 - American claimants to foreign estates and inheritances.
Code of Federal Regulations, 2010 CFR
2010-04-01
... inheritances. 71.3 Section 71.3 Foreign Relations DEPARTMENT OF STATE PROTECTION AND WELFARE OF AMERICANS....3 American claimants to foreign estates and inheritances. Where treaty provisions, local laws, or... foreign estates and inheritances. ...
Inherited Thrombophilia and Pregnancy Complications: Should We Test?
Arachchillage, Deepa R J; Makris, Mike
2018-06-04
Recurrent miscarriages and pregnancy-related complications cause significant stress to couples looking for successful pregnancy outcome as well as to health care professionals. There is conflicting evidence with respect to the presence and the strength of associations between inherited thrombophilia and these complications. A complete thrombophilia screen is expensive, and no proven effective treatment for women with recurrent miscarriage and inherited thrombophilia is currently available. Based on the concept of microvascular thrombosis of the placenta, women with recurrent miscarriage and placenta-related complications frequently get treated with antithrombotic therapy. In this narrative review, the authors explore the evolving understanding and evidence of inherited thrombophilia in recurrent miscarriages and other pregnancy complications, and whether antithrombotic treatment would modify pregnancy outcome in women with inherited thrombophilia. Finally, they provide some personal recommendations based on available evidence for clinical practice. In summary, inherited thrombophilia testing is not required outside a clinical trial for women with recurrent pregnancy losses or late pregnancy complications. The presence of thrombophilia markers does not generally indicate additional therapy during pregnancy, even if a heritable thrombophilic defect is found in women with recurrent miscarriages or late pregnancy complications. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Depleting tumor-specific Tregs at a single site eradicates disseminated tumors
Marabelle, Aurélien; Kohrt, Holbrook; Sagiv-Barfi, Idit; Ajami, Bahareh; Axtell, Robert C.; Zhou, Gang; Rajapaksa, Ranjani; Green, Michael R.; Torchia, James; Brody, Joshua; Luong, Richard; Rosenblum, Michael D.; Steinman, Lawrence; Levitsky, Hyam I.; Tse, Victor; Levy, Ronald
2013-01-01
Activation of TLR9 by direct injection of unmethylated CpG nucleotides into a tumor can induce a therapeutic immune response; however, Tregs eventually inhibit the antitumor immune response and thereby limit the power of cancer immunotherapies. In tumor-bearing mice, we found that Tregs within the tumor preferentially express the cell surface markers CTLA-4 and OX40. We show that intratumoral coinjection of anti–CTLA-4 and anti-OX40 together with CpG depleted tumor-infiltrating Tregs. This in situ immunomodulation, which was performed with low doses of antibodies in a single tumor, generated a systemic antitumor immune response that eradicated disseminated disease in mice. Further, this treatment modality was effective against established CNS lymphoma with leptomeningeal metastases, sites that are usually considered to be tumor cell sanctuaries in the context of conventional systemic therapy. These results demonstrate that antitumor immune effectors elicited by local immunomodulation can eradicate tumor cells at distant sites. We propose that, rather than using mAbs to target cancer cells systemically, mAbs could be used to target the tumor infiltrative immune cells locally, thereby eliciting a systemic immune response. PMID:23728179
Whitworth, James; Smith, Philip S; Martin, Jose-Ezequiel; West, Hannah; Luchetti, Andrea; Rodger, Faye; Clark, Graeme; Carss, Keren; Stephens, Jonathan; Stirrups, Kathleen; Penkett, Chris; Mapeta, Rutendo; Ashford, Sofie; Megy, Karyn; Shakeel, Hassan; Ahmed, Munaza; Adlard, Julian; Barwell, Julian; Brewer, Carole; Casey, Ruth T; Armstrong, Ruth; Cole, Trevor; Evans, Dafydd Gareth; Fostira, Florentia; Greenhalgh, Lynn; Hanson, Helen; Henderson, Alex; Hoffman, Jonathan; Izatt, Louise; Kumar, Ajith; Kwong, Ava; Lalloo, Fiona; Ong, Kai Ren; Paterson, Joan; Park, Soo-Mi; Chen-Shtoyerman, Rakefet; Searle, Claire; Side, Lucy; Skytte, Anne-Bine; Snape, Katie; Woodward, Emma R; Tischkowitz, Marc D; Maher, Eamonn R
2018-06-12
Multiple primary tumors (MPTs) affect a substantial proportion of cancer survivors and can result from various causes, including inherited predisposition. Currently, germline genetic testing of MPT-affected individuals for variants in cancer-predisposition genes (CPGs) is mostly targeted by tumor type. We ascertained pre-assessed MPT individuals (with at least two primary tumors by age 60 years or at least three by 70 years) from genetics centers and performed whole-genome sequencing (WGS) on 460 individuals from 440 families. Despite previous negative genetic assessment and molecular investigations, pathogenic variants in moderate- and high-risk CPGs were detected in 67/440 (15.2%) probands. WGS detected variants that would not be (or were not) detected by targeted resequencing strategies, including low-frequency structural variants (6/440 [1.4%] probands). In most individuals with a germline variant assessed as pathogenic or likely pathogenic (P/LP), at least one of their tumor types was characteristic of variants in the relevant CPG. However, in 29 probands (42.2% of those with a P/LP variant), the tumor phenotype appeared discordant. The frequency of individuals with truncating or splice-site CPG variants and at least one discordant tumor type was significantly higher than in a control population (χ 2 = 43.642; p ≤ 0.0001). 2/67 (3%) probands with P/LP variants had evidence of multiple inherited neoplasia allele syndrome (MINAS) with deleterious variants in two CPGs. Together with variant detection rates from a previous series of similarly ascertained MPT-affected individuals, the present results suggest that first-line comprehensive CPG analysis in an MPT cohort referred to clinical genetics services would detect a deleterious variant in about a third of individuals. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Regulation, cell differentiation and protein-based inheritance.
Malagnac, Fabienne; Silar, Philippe
2006-11-01
Recent research using fungi as models provide new insight into the ability of regulatory networks to generate cellular states that are sufficiently stable to be faithfully transmitted to daughter cells, thereby generating epigenetic inheritance. Such protein-based inheritance is driven by infectious factors endowed with properties usually displayed by prions. We emphasize the contribution of regulatory networks to the emerging properties displayed by cells.
Inheritance on processes, exemplified on distributed termination detection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thomsen, K.S.
1987-02-01
A multiple inheritance mechanism on processes is designed and presented within the framework of a small object oriented language. Processes are described in classes, and the different action parts of a process inherited from different classes are executed in a coroutine-like style called alternation. The inheritance mechanism is a useful tool for factorizing the description of common aspects of processes. This is demonstrated within the domain of distributed programming by using the inheritance mechanism to factorize the description of distributed termination detection algorithms from the description of the distributed main computations for which termination is to be detected. A clearmore » separation of concerns is obtained, and arbitrary combinations of terminations detection algorithms and main computations can be formed. The same termination detection classes can also be used for more general purposes within distributed programming, such as detecting termination of each phase in a multi-phase main computation.« less
RNA interference-based therapeutics for inherited long QT syndrome.
Li, Guoliang; Ma, Shuting; Sun, Chaofeng
2015-08-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.
RNA interference-based therapeutics for inherited long QT syndrome
LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG
2015-01-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327
Neocentromeres and epigenetically inherited features of centromeres
Burrack, Laura S.; Berman, Judith
2012-01-01
Neocentromeres are ectopic sites where new functional kinetochores assemble and permit chromosome segregation. Neocentromeres usually form following genomic alterations that remove or disrupt centromere function. The ability to form neocentromeres is conserved in eukaryotes ranging from fungi to mammals. Neocentromeres that rescue chromosome fragments in cells with gross chromosomal rearrangements are found in several types of human cancers, and in patients with developmental disabilities. In this review, we discuss the importance of neocentromeres to human health and evaluate recently developed model systems to study neocentromere formation, maintenance, and function in chromosome segregation. Additionally, studies of neocentromeres provide insight into native centromeres; analysis of neocentromeres found in human clinical samples and induced in model organisms distinguishes features of centromeres that are dependent on centromere DNA from features that are epigenetically inherited together with the formation of a functional kinetochore. PMID:22723125
Skinner, Michael K; Ben Maamar, Millissia; Sadler-Riggleman, Ingrid; Beck, Daniel; Nilsson, Eric; McBirney, Margaux; Klukovich, Rachel; Xie, Yeming; Tang, Chong; Yan, Wei
2018-02-27
Environmental toxicants such as DDT have been shown to induce the epigenetic transgenerational inheritance of disease (e.g., obesity) through the germline. The current study was designed to investigate the DDT-induced concurrent alterations of a number of different epigenetic processes including DNA methylation, non-coding RNA (ncRNA) and histone retention in sperm. Gestating females were exposed transiently to DDT during fetal gonadal development, and then, the directly exposed F1 generation, the directly exposed germline F2 generation and the transgenerational F3 generation sperm were investigated. DNA methylation and ncRNA were altered in each generation sperm with the direct exposure F1 and F2 generations being predominantly distinct from the F3 generation epimutations. The piRNA and small tRNA were the most predominant classes of ncRNA altered. A highly conserved set of histone retention sites were found in the control lineage generations which was not significantly altered between generations, but a large number of new histone retention sites were found only in the transgenerational generation DDT lineage sperm. Therefore, all three different epigenetic processes were concurrently altered as DDT induced the epigenetic transgenerational inheritance of sperm epimutations. The direct exposure generations sperm epigenetic alterations were distinct from the transgenerational sperm epimutations. The genomic features and gene associations with the epimutations were investigated to help elucidate the integration of these different epigenetic processes. Observations demonstrate all three epigenetic processes are involved in transgenerational inheritance. The different epigenetic processes appear to be integrated in mediating the epigenetic transgenerational inheritance phenomenon.
Occupational Inheritance in Service Academy Cadets and Midshipmen
ERIC Educational Resources Information Center
Roller, Brain; Doerries, Lee E.
2008-01-01
Occupational inheritance refers to the phenomenon where sons and daughters follow in the career paths of their parents. Historically this has been documented in the areas of engineering, medicine and education. This study investigated the phenomenon of occupational inheritance as it pertains to military service. Archival data provided by the…
MMASS: an optimized array-based method for assessing CpG island methylation.
Ibrahim, Ashraf E K; Thorne, Natalie P; Baird, Katie; Barbosa-Morais, Nuno L; Tavaré, Simon; Collins, V Peter; Wyllie, Andrew H; Arends, Mark J; Brenton, James D
2006-01-01
We describe an optimized microarray method for identifying genome-wide CpG island methylation called microarray-based methylation assessment of single samples (MMASS) which directly compares methylated to unmethylated sequences within a single sample. To improve previous methods we used bioinformatic analysis to predict an optimized combination of methylation-sensitive enzymes that had the highest utility for CpG-island probes and different methods to produce unmethylated representations of test DNA for more sensitive detection of differential methylation by hybridization. Subtraction or methylation-dependent digestion with McrBC was used with optimized (MMASS-v2) or previously described (MMASS-v1, MMASS-sub) methylation-sensitive enzyme combinations and compared with a published McrBC method. Comparison was performed using DNA from the cell line HCT116. We show that the distribution of methylation microarray data is inherently skewed and requires exogenous spiked controls for normalization and that analysis of digestion of methylated and unmethylated control sequences together with linear fit models of replicate data showed superior statistical power for the MMASS-v2 method. Comparison with previous methylation data for HCT116 and validation of CpG islands from PXMP4, SFRP2, DCC, RARB and TSEN2 confirmed the accuracy of MMASS-v2 results. The MMASS-v2 method offers improved sensitivity and statistical power for high-throughput microarray identification of differential methylation.
Environmental Factors Can Influence Mitochondrial Inheritance in the Saccharomyces Yeast Hybrids.
Hsu, Yu-Yi; Chou, Jui-Yu
2017-01-01
Mitochondria play a critical role in the generation of metabolic energy and are crucial for eukaryotic cell survival and proliferation. In most sexual eukaryotes, mitochondrial DNA (mtDNA) is inherited from only one parent in non-Mendelian inheritance in contrast to the inheritance of nuclear DNA. The model organism Saccharomyces cerevisiae is commonly used to study mitochondrial biology. It has two mating types: MATa and MATα. Previous studies have suggested that the mtDNA inheritance patterns in hybrid diploid cells depend on the genetic background of parental strains. However, the underlying mechanisms remain unclear. To elucidate the mechanisms, we examined the effects of environmental factors on the mtDNA inheritance patterns in hybrids obtained by crossing S. cerevisiae with its close relative S. paradoxus. The results demonstrated that environmental factors can influence mtDNA transmission in hybrid diploids, and that the inheritance patterns are strain dependent. The fitness competition assay results showed that the fitness differences can explain the mtDNA inheritance patterns under specific conditions. However, in this study, we found that fitness differences cannot fully be explained by mitochondrial activity in hybrids under stress conditions.
Environmental Factors Can Influence Mitochondrial Inheritance in the Saccharomyces Yeast Hybrids
Hsu, Yu-Yi; Chou, Jui-Yu
2017-01-01
Mitochondria play a critical role in the generation of metabolic energy and are crucial for eukaryotic cell survival and proliferation. In most sexual eukaryotes, mitochondrial DNA (mtDNA) is inherited from only one parent in non-Mendelian inheritance in contrast to the inheritance of nuclear DNA. The model organism Saccharomyces cerevisiae is commonly used to study mitochondrial biology. It has two mating types: MATa and MATα. Previous studies have suggested that the mtDNA inheritance patterns in hybrid diploid cells depend on the genetic background of parental strains. However, the underlying mechanisms remain unclear. To elucidate the mechanisms, we examined the effects of environmental factors on the mtDNA inheritance patterns in hybrids obtained by crossing S. cerevisiae with its close relative S. paradoxus. The results demonstrated that environmental factors can influence mtDNA transmission in hybrid diploids, and that the inheritance patterns are strain dependent. The fitness competition assay results showed that the fitness differences can explain the mtDNA inheritance patterns under specific conditions. However, in this study, we found that fitness differences cannot fully be explained by mitochondrial activity in hybrids under stress conditions. PMID:28081193
Inheritance for software reuse: The good, the bad, and the ugly
NASA Technical Reports Server (NTRS)
Sitaraman, Murali; Eichmann, David A.
1992-01-01
Inheritance is a powerful mechanism supported by object-oriented programming languages to facilitate modifications and extensions of reusable software components. This paper presents a taxonomy of the various purposes for which an inheritance mechanism can be used. While some uses of inheritance significantly enhance software reuse, some others are not as useful and in fact, may even be detrimental to reuse. The paper discusses several examples, and argues for a programming language design that is selective in its support for inheritance.
CZ: Multimethods and Multiple Inheritance Without Diamonds
2009-12-01
Language. Digital Press, second edition , 1990. 31 [48] C. Szyperski, S. Omohundro, and S. Murer. Engineering a programming language: The type and class...CZ:Multimethods andMultiple Inheritance Without Diamonds 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT...Expressiveness is retained through two features: a “requires” construct that provides a form of subtyping without inheritance (in- spired by Scala [39]), and a
Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B
2016-09-06
The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance.
Alport syndrome: impact of digenic inheritance in patients management.
Fallerini, C; Baldassarri, M; Trevisson, E; Morbidoni, V; La Manna, A; Lazzarin, R; Pasini, A; Barbano, G; Pinciaroli, A R; Garosi, G; Frullanti, E; Pinto, A M; Mencarelli, M A; Mari, F; Renieri, A; Ariani, F
2017-07-01
Alport syndrome (ATS) is a genetically heterogeneous nephropathy with considerable phenotypic variability and different transmission patterns, including monogenic (X-linked/autosomal) and digenic inheritance (DI). Here we present a new series of families with DI and we discuss the consequences for genetic counseling and risk assessment. Out of five families harboring variants in more than one COL4 gene detected by next generation sequencing (NGS), minigene-splicing assay allowed us to identify four as true digenic. Two families showed COL4A3/A4 mutations in cis, mimicking an autosomal dominant inheritance with a more severe phenotype and one showed COL4A3/A4 mutations in trans, mimicking an autosomal recessive inheritance with a less severe phenotype. In a fourth family, a de novo mutation (COL4A5) combined with an inherited mutation (COL4A3) triggered a more severe phenotype. A fifth family, predicted digenic on the basis of silico tools, rather showed monogenic X-linked inheritance due to a hypomorphic mutation, in accordance with a milder phenotype. In conclusion, this study highlights the impact of DI in ATS and explains the associated atypical presentations. More complex inheritance should be therefore considered when reviewing prognosis and recurrence risks. On the other side, these findings emphasize the importance to accompany NGS with splicing assays in order to avoid erroneous identification of at risk members. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Familial epilepsy in Algeria: Clinical features and inheritance profiles.
Chentouf, Amina; Dahdouh, Aïcha; Guipponi, Michel; Oubaiche, Mohand Laïd; Chaouch, Malika; Hamamy, Hanan; Antonarakis, Stylianos E
2015-09-01
To document the clinical characteristics and inheritance pattern of epilepsy in multigeneration Algerian families. Affected members from extended families with familial epilepsy were assessed at the University Hospital of Oran in Algeria. Available medical records, neurological examination, electroencephalography and imaging data were reviewed. The epilepsy type was classified according to the criteria of the International League Against Epilepsy and modes of inheritance were deduced from pedigree analysis. The study population included 40 probands; 23 male (57.5%) and 17 female subjects (42.5%). The mean age of seizure onset was 9.5 ± 6.1 years. According to seizure onset, 16 patients (40%) had focal seizures and 20 (50%) had generalized seizures. Seizure control was achieved for two patients (5%) for 10 years, while 28 (70%) were seizure-free for 3 months. Eleven patients (27.5%) had prior febrile seizures, 12 were diagnosed with psychiatric disorders and four families had syndromic epilepsy. The consanguinity rate among parents of affected was 50% with phenotypic concordance observed in 25 families (62.5%). Pedigree analysis suggested autosomal dominant (AD) inheritance with or without reduced penetrance in 18 families (45%), probable autosomal recessive (AR) inheritance in 14 families (35%), and an X-linked recessive inheritance in one family. This study reveals large Algerian families with multigenerational inheritance of epilepsy. Molecular testing such as exome sequencing would clarify the genetic basis of epilepsy in some of our families. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.
Like mother, like daughter: inheritance of nest-site location in snakes.
Brown, Gregory P; Shine, Richard
2007-04-22
A trait can be passed from parents to offspring even if it has no genetic basis. For example, if daughters return to reproduce at the same sites where they were hatched themselves, nest-site location is consistent within matrilineages. Most cases of natal homing (nest-site philopatry) across generations have been inferred from molecular evidence rather than directly demonstrated, and involve species with low dispersal abilities. However, some animals disperse long distances but then return to their own place of birth to reproduce, based on cues imprinted early in their own development. Our field studies on tropical natricine snakes (Tropidonophis mairii, Colubridae) show that when they are ready to nest, females return to the sites where their mothers were captured pre-nesting, and where they themselves were released as hatchlings.
Territory inheritance in clownfish.
Buston, Peter M
2004-05-07
Animal societies composed of breeders and non-breeders present a challenge to evolutionary theory because it is not immediately apparent how natural selection can preserve the genes that underlie non-breeding strategies. The clownfish Amphiprion percula forms groups composed of a breeding pair and 0-4 non-breeders. Non-breeders gain neither present direct, nor present indirect benefits from the association. To determine whether non-breeders obtain future direct benefits, I investigated the pattern of territory inheritance. I show that non-breeders stand to inherit the territory within which they reside. Moreover, they form a perfect queue for breeding positions; a queue from which nobody disperses and within which nobody contests. I suggest that queuing might be favoured by selection because it confers a higher probability of attaining breeding status than either dispersing or contesting. This study illustrates that, within animal societies, individuals may tolerate non-breeding positions solely because of their potential to realize benefits in the future.
Territory inheritance in clownfish.
Buston, Peter M
2004-01-01
Animal societies composed of breeders and non-breeders present a challenge to evolutionary theory because it is not immediately apparent how natural selection can preserve the genes that underlie non-breeding strategies. The clownfish Amphiprion percula forms groups composed of a breeding pair and 0-4 non-breeders. Non-breeders gain neither present direct, nor present indirect benefits from the association. To determine whether non-breeders obtain future direct benefits, I investigated the pattern of territory inheritance. I show that non-breeders stand to inherit the territory within which they reside. Moreover, they form a perfect queue for breeding positions; a queue from which nobody disperses and within which nobody contests. I suggest that queuing might be favoured by selection because it confers a higher probability of attaining breeding status than either dispersing or contesting. This study illustrates that, within animal societies, individuals may tolerate non-breeding positions solely because of their potential to realize benefits in the future. PMID:15252999
Maternal telomere length inheritance in the king penguin.
Reichert, S; Rojas, E R; Zahn, S; Robin, J-P; Criscuolo, F; Massemin, S
2015-01-01
Telomeres are emerging as a biomarker for ageing and survival, and are likely important in shaping life-history trade-offs. In particular, telomere length with which one starts in life has been linked to lifelong survival, suggesting that early telomere dynamics are somehow related to life-history trajectories. This result highlights the importance of determining the extent to which telomere length is inherited, as a crucial factor determining early life telomere length. Given the scarcity of species for which telomere length inheritance has been studied, it is pressing to assess the generality of telomere length inheritance patterns. Further, information on how this pattern changes over the course of growth in individuals living under natural conditions should provide some insight on the extent to which environmental constraints also shape telomere dynamics. To fill this gap partly, we followed telomere inheritance in a population of king penguins (Aptenodytes patagonicus). We tested for paternal and maternal influence on chick initial telomere length (10 days old after hatching), and how these relationships changed with chick age (at 70, 200 and 300 days old). Based on a correlative approach, offspring telomere length was positively associated with maternal telomere length early in life (at 10 days old). However, this relationship was not significant at older ages. These data suggest that telomere length in birds is maternally inherited. Nonetheless, the influence of environmental conditions during growth remained an important factor shaping telomere length, as the maternal link disappeared with chicks' age.
Gene panel testing for inherited cancer risk.
Hall, Michael J; Forman, Andrea D; Pilarski, Robert; Wiesner, Georgia; Giri, Veda N
2014-09-01
Next-generation sequencing technologies have ushered in the capability to assess multiple genes in parallel for genetic alterations that may contribute to inherited risk for cancers in families. Thus, gene panel testing is now an option in the setting of genetic counseling and testing for cancer risk. This article describes the many gene panel testing options clinically available to assess inherited cancer susceptibility, the potential advantages and challenges associated with various types of panels, clinical scenarios in which gene panels may be particularly useful in cancer risk assessment, and testing and counseling considerations. Given the potential issues for patients and their families, gene panel testing for inherited cancer risk is recommended to be offered in conjunction or consultation with an experienced cancer genetic specialist, such as a certified genetic counselor or geneticist, as an integral part of the testing process. Copyright © 2014 by the National Comprehensive Cancer Network.
Moarii, Matahi; Reyal, Fabien; Vert, Jean-Philippe
2015-10-13
The CpG island methylator phenotype (CIMP) was first characterized in colorectal cancer but since has been extensively studied in several other tumor types such as breast, bladder, lung, and gastric. CIMP is of clinical importance as it has been reported to be associated with prognosis or response to treatment. However, the identification of a universal molecular basis to define CIMP across tumors has remained elusive. We perform a genome-wide methylation analysis of over 2000 tumor samples from 5 cancer sites to assess the existence of a CIMP with common molecular basis across cancers. We then show that the CIMP phenotype is associated with specific gene expression variations. However, we do not find a common genetic signature in all tissues associated with CIMP. Our results suggest the existence of a universal epigenetic and transcriptomic signature that defines the CIMP across several tumor types but does not indicate the existence of a common genetic signature of CIMP.
Inheritable copper tolerance in the chlorophyte macroalga Enteromorpha intestinalis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lewis, S.; Williams, P.; Donkin, M.
1995-12-31
A study was carried out to determine if a population of Enteromorpha intestinalis, from a metal polluted site, exhibited copper tolerance. This work was in preparation for investigating stress protein patterns in copper tolerant and sensitive populations. The effects of copper on growth of E. intestinalis from three clean and one metal polluted site were compared. Growth was assessed by incubating thallus sections in a range of copper solutions and measuring increase in length. Offspring were cultured from clean and polluted sites and the effects of copper on their growth assessed, to determine if any tolerance was inheritable. Concentrations ofmore » the trace metals; copper, zinc and manganese in the populations were also determined. Over the range of copper concentrations tested (0--150 {micro}g/i), growth of the polluted site populations was not significantly affected (P > 0.05). However growth of the clean site populations was significantly depressed by exposure to 50 {micro}g/l. This pattern of response was also exhibited by the offspring. Trace metal concentrations in the clean site populations were very similar, however the polluted site population contained {sup {minus}}10 times the control site values of manganese and {approximately}35 times the values of zinc and copper. The results suggest that the polluted site population of E. intestinalis has developed a degree of copper tolerance which appears to have a genetic basis. This investigation is consistent with previous work into copper tolerance in ship-fouling populations of E. intestinalis var. compressa. A commercially available HSP70 antibody with a high degree of cross-reactivity to E. intestinalis has been identified and used to screen samples of the seaweed from the aforementioned populations.« less
Inherited metabolic disorders in Thailand.
Wasant, Pornswan; Svasti, Jisnuson; Srisomsap, Chantragan; Liammongkolkul, Somporn
2002-08-01
The study of inborn errors of metabolism (IEM) in Thailand is in its infancy. The majority are clinically diagnosed since there are only a handful of clinicians and scientists with expertise in inherited metabolic disorders, shortage of well-equipped laboratory facilities and lack of governmental financial support. Genetic metabolic disorders are usually not considered a priority due to prevalence of infectious diseases and congenital infections. From a retrospective study at the Medical Genetics Unit, Department of Pediatrics, Siriraj Hospital; estimated pediatrics patients with suspected IEM were approximately 2-3 per cent of the total pediatric admissions of over 5,000 annually. After more than 10 years of research and accumulated clinical experiences, a genetic metabolic center is being established in collaboration with expert laboratories both in Bangkok (Chulabhorn Research Institute) and abroad (Japan and the United States). Numerous inherited metabolic disorders were identified--carbohydrate, amino acids, organic acids, mitochondrial fatty acid oxidation, peroxisomal, mucopolysaccharidoses etc. This report includes the establishment of genetic metabolic center in Thailand, research and pilot studies in newborn screening in Thailand and a multicenter study from 5 institutions (Children's National Center, King Chulalongkorn Memorial Hospital, Pramongkutklao Hospital, Ramathibodi and Siriraj Hospitals). Inherited metabolic disorders reported are fructose-1,6-bisphosphatase deficiency, phenylketonuria, homocystinuria, nonketotic hyperglycinemia, urea cycle defect (arginino succinate lyase deficiency, argininosuccinate synthetase deficiency), Menkes disease, propionic acidemia and mucopolysaccharidoses (Hurler, Hurler-Scheie).
Cropley, Jennifer E; Suter, Catherine M; Beckman, Kenneth B; Martin, David I K
2010-02-04
The viable yellow allele of agouti (A(vy)) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the A(vy) allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between A(vy) mice indicates that the epigenetic state of the IAP is unstable in the germline. We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of A(vy) phenotypes, does not increase the density of CpG methylation in the silent LTR. Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence A(vy). The incomplete cytosine methylation we observe at the somatically silent A(vy) allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation.
Cropley, Jennifer E.; Suter, Catherine M.; Beckman, Kenneth B.; Martin, David I. K.
2010-01-01
Background The viable yellow allele of agouti (Avy) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the Avy allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between Avy mice indicates that the epigenetic state of the IAP is unstable in the germline. Principal Findings We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of Avy phenotypes, does not increase the density of CpG methylation in the silent LTR. Conclusions Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence Avy. The incomplete cytosine methylation we observe at the somatically silent Avy allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation. PMID:20140227
Fouché, Simone; Plissonneau, Clémence; McDonald, Bruce A; Croll, Daniel
2018-06-01
Meiosis is one of the most conserved molecular processes in eukaryotes. The fidelity of pairing and segregation of homologous chromosomes has a major impact on the proper transmission of genetic information. Aberrant chromosomal transmission can have major phenotypic consequences, yet the mechanisms are poorly understood. Fungi are excellent models to investigate processes of chromosomal transmission, because many species have highly polymorphic genomes that include accessory chromosomes. Inheritance of accessory chromosomes is often unstable and chromosomal losses have little impact on fitness. We analyzed chromosomal inheritance in 477 progeny coming from two crosses of the fungal wheat pathogen Zymoseptoria tritici. For this, we developed a high-throughput screening method based on restriction site-associated DNA sequencing that generated dense coverage of genetic markers along each chromosome. We identified rare instances of chromosomal duplications (disomy) in core chromosomes. Accessory chromosomes showed high overall frequencies of disomy. Chromosomal rearrangements were found exclusively on accessory chromosomes and were more frequent than disomy. Accessory chromosomes present in only one of the parents in an analyzed cross were inherited at significantly higher rates than the expected 1:1 segregation ratio. Both the chromosome and the parental background had significant impacts on the rates of disomy, losses, rearrangements, and distorted inheritance. We found that chromosomes with higher sequence similarity and lower repeat content were inherited more faithfully. The large number of rearranged progeny chromosomes identified in this species will enable detailed analyses of the mechanisms underlying chromosomal rearrangement.
Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.
Peng, Liu; Wei, He; Liren, Li
2014-01-01
To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.
Use/disuse paradigms are ubiquitous concepts in characterizing the process of inheritance.
Veigl, Sophie Juliane
2017-12-02
In recent years, a Lamarckian theme has found its way back into academic discourse on evolution and inheritance. Especially the emerging field of transgenerational small RNAs has provided at least a proof of concept for the inheritance of acquired traits. Yet it remains unclear whether the Lamarckian concept of inheritance will in fact have its rennaisance or whether it will remain the rallying cry for the outlaws, heretics and enfants terribles of molecular biology. As unclear as the future of Lamarckian theory is its content and reference. Since the formulation of the Philosophie Zoologique, Lamarckian thought has been de- and reconfiguring in and out of the scientific literature and become an umbrella-term for all kinds of unconventional modes of inheritance. This essay will argue that heritable small RNAs might in fact provide a case of genuine Lamarckian inheritance. Moreover, it will be claimed that not only the very broad concept of "inheritance of acquired traits" applies, but also that Lamarck's mechanistic insight into a use/disuse relation might help to explain a specific mode of transgenerational inheritance.
Fractional populations in multiple gene inheritance.
Chung, Myung-Hoon; Kim, Chul Koo; Nahm, Kyun
2003-01-22
With complete knowledge of the human genome sequence, one of the most interesting tasks remaining is to understand the functions of individual genes and how they communicate. Using the information about genes (locus, allele, mutation rate, fitness, etc.), we attempt to explain population demographic data. This population evolution study could complement and enhance biologists' understanding about genes. We present a general approach to study population genetics in complex situations. In the present approach, multiple allele inheritance, multiple loci inheritance, natural selection and mutations are allowed simultaneously in order to consider a more realistic situation. A simulation program is presented so that readers can readily carry out studies with their own parameters. It is shown that the multiplicity of the loci greatly affects the demographic results of fractional population ratios. Furthermore, the study indicates that some high infant mortality rates due to congenital anomalies can be attributed to multiple loci inheritance. The simulation program can be downloaded from http://won.hongik.ac.kr/~mhchung/index_files/yapop.htm. In order to run this program, one needs Visual Studio.NET platform, which can be downloaded from http://msdn.microsoft.com/netframework/downloads/default.asp.
Effect of heterogeneity and assumed mode of inheritance on lod scores.
Durner, M; Greenberg, D A
1992-02-01
Heterogeneity is a major factor in many common, complex diseases and can confound linkage analysis. Using computer-simulated heterogeneous data we tested what effect unlinked families have on a linkage analysis when heterogeneity is not taken into account. We created 60 data sets of 40 nuclear families each with different proportions of linked and unlinked families and with different modes of inheritance. The ascertainment probability was 0.05, the disease had a penetrance of 0.6, and the recombination fraction for the linked families was zero. For the analysis we used a variety of assumed modes of inheritance and penetrances. Under these conditions we looked at the effect of the unlinked families on the lod score, the evaluation of the mode of inheritance, and the estimate of penetrance and of the recombination fraction in the linked families. 1. When the analysis was done under the correct mode of inheritance for the linked families, we found that the mode of inheritance of the unlinked families had minimal influence on the highest maximum lod score (MMLS) (i.e., we maximized the maximum lod score with respect to penetrance). Adding sporadic families decreased the MMLS less than adding recessive or dominant unlinked families. 2. The mixtures of dominant linked families with unlinked families always led to a higher MMLS when analyzed under the correct (dominant) mode of inheritance than when analyzed under the incorrect mode of inheritance. In the mixtures with recessive linked families, assuming the correct mode of inheritance generally led to a higher MMLS, but we observed broad variation.(ABSTRACT TRUNCATED AT 250 WORDS)
Endocrine disruptor induction of epigenetic transgenerational inheritance of disease.
Skinner, Michael K
2014-12-01
Environmental exposures such as toxicants, nutrition and stress have been shown to promote the epigenetic transgenerational inheritance of disease susceptibility. Endocrine disruptors are one of the largest groups of specific toxicants shown to promote this form of epigenetic inheritance. These environmental compounds that interfere with normal endocrine signaling are one of the largest classes of toxicants we are exposed to on a daily level. The ability of ancestral exposures to promote disease susceptibility significantly increases the potential biohazards of these toxicants. Therefore, what your great-grandmother was exposed to during pregnancy may influence your disease development, even in the absence of any exposure, and you are going to pass this on to your grandchildren. This non-genetic form of inheritance significantly impacts our understanding of biology from the origins of disease to evolutionary biology. The current review will describe the previous studies and endocrine disruptors shown to promote the epigenetic transgenerational inheritance of disease. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Endocrine Disruptor Induction of Epigenetic Transgenerational Inheritance of Disease
Skinner, Michael K.
2014-01-01
Environmental exposures such as toxicants, nutrition and stress have been shown to promote the epigenetic transgenerational inheritance of disease susceptibility. Endocrine disruptors are one of the largest groups of specific toxicants shown to promote this form of epigenetic inheritance. These environmental compounds that interfere with normal endocrine signaling are one of the largest classes of toxicants we are exposed to on a daily level. The ability of ancestral exposures to promote disease susceptibility significantly increases the potential biohazards of these toxicants. Therefore, what your great-grandmother was exposed to during pregnancy may influence your disease development, even in the absence of any exposure, and you are going to pass this on to your grandchildren. This non-genetic form of inheritance significantly impacts our understanding of biology from the origins of disease to evolutionary biology. The current review will describe the previous studies and endocrine disruptors shown to promote the epigenetic transgenerational inheritance of disease. PMID:25088466
Weisenberger, Daniel J; Levine, A Joan; Long, Tiffany I; Buchanan, Daniel D; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D; Stern, Mariana C; LeMarchand, Loic; Lindor, Noralane M; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A; Campbell, Peter T; Casey, Graham; Ahnen, Dennis J; Baron, John A; Haile, Robert W; Hopper, John L; Young, Joanne P; Laird, Peter W; Siegmund, Kimberly D
2015-03-01
The CpG island methylator phenotype (CIMP) represents a subset of colorectal cancers characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. We measured the CIMP status of 3,119 primary population-based colorectal cancer tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of colorectal cancer cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). We found associations between tumor CIMP status and MSI-H (ccOR = 7.6), BRAF V600E mutation (ccOR = 59.8), proximal tumor site (ccOR = 9; all P < 0.0001), female sex [ccOR = 1.8; 95% confidence interval (CI), 1.5-2.1], older age (ccOR = 4.0 comparing over 70 years vs. under 50; 95% CI, 3.0-5.5), and family history of CRC (ccOR = 0.6; 95% CI, 0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (P = 0.0001 and P = 0.02, respectively), use of multivitamin or calcium supplements did not. Only for female colorectal cancer was CIMP status associated with increased pack-years of smoking (Ptrend < 0.001) and body mass index (BMI; Ptrend = 0.03). The frequency of several colorectal cancer risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Differences in the associations of a unique DNA methylation-based subgroup of colorectal cancer with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of colorectal cancer. Cancer Epidemiol Biomarkers Prev; 24(3); 512-9. ©2015 AACR. ©2015 American Association for Cancer Research.
Taha-Abdelaziz, Khaled; Alkie, Tamiru Negash; Hodgins, Douglas C; Yitbarek, Alexander; Shojadoost, Bahram; Sharif, Shayan
2017-12-01
Campylobacter jejuni (C. jejuni) is a leading bacterial cause of food-borne illness in humans. Contaminated chicken meat is an important source of infection for humans. Chickens are not clinically affected by colonization, and immune responses following natural infection have limited effects on bacterial load in the gut. Induction of intestinal immune responses may possibly lead to a breakdown of the commensal relationship of chickens with Campylobacter. We have recently shown that soluble and poly D, L-lactic-co-glycolic acid (PLGA)-encapsulated CpG oligodeoxynucleotide (ODN) as well as C. jejuni lysate, are effective in reducing the intestinal burden of C. jejuni in chickens; however, the mechanisms behind this protection have yet to be determined. The present study was undertaken to investigate the mechanisms of host responses conferred by these treatments. Chickens were treated orally with soluble CpG ODN, or PLGA-encapsulated CpG ODN, or C. jejuni lysate, and expression of cytokines and antimicrobial peptides was evaluated in cecal tonsils and ileum using quantitative RT-PCR. Oral administration of soluble CpG ODN upregulated the expression of interferon (IFN)-γ, interleukin (IL)-1β, CXCLi2, transforming growth factor (TGF)-β4/1, IL-10 and IL-13, while treatment with PLGA-encapsulated CpG ODN upregulated the expression of IL-1β, CXCLi2, TGF-β4/1, IL-13, avian β-defensin (AvBD) 1, AvBD2 and cathelicidin 3 (CATHL-3). C. jejuni lysate upregulated the expression of IFN-γ, IL-1β, TGF-β4/1, IL-13, AvBD1, and CATHL-3. In conclusion, induction of cytokine and antimicrobial peptides expression in intestinal microenvironments may provide a means of reducing C. jejuni colonization in broiler chickens, a key step in reducing the incidence of campylobacteriosis in humans. Copyright © 2017 Elsevier B.V. All rights reserved.
Utilizing inheritance in requirements engineering
NASA Technical Reports Server (NTRS)
Kaindl, Hermann
1994-01-01
The scope of this paper is the utilization of inheritance for requirements specification, i.e., the tasks of analyzing and modeling the domain, as well as forming and defining requirements. Our approach and the tool supporting it are named RETH (Requirements Engineering Through Hypertext). Actually, RETH uses a combination of various technologies, including object-oriented approaches and artificial intelligence (in particular frames). We do not attempt to exclude or replace formal representations, but try to complement and provide means for gradually developing them. Among others, RETH has been applied in the CERN (Conseil Europeen pour la Rechereche Nucleaire) Cortex project. While it would be impossible to explain this project in detail here, it should be sufficient to know that it deals with a generic distributed control system. Since this project is not finished yet, it is difficult to state its size precisely. In order to give an idea, its final goal is to substitute the many existing similar control systems at CERN by this generic approach. Currently, RETH is also tested using real-world requirements for the Pastel Mission Planning System at ESOC in Darmstadt. First, we outline how hypertext is integrated into a frame system in our approach. Moreover, the usefulness of inheritance is demonstrated as performed by the tool RETH. We then summarize our experiences of utilizing inheritance in the Cortex project. Lastly, RETH will be related to existing work.
Genetic instability in inherited and sporadic leukemias.
Popp, Henning D; Bohlander, Stefan K
2010-12-01
Genetic instability due to increased DNA damage and altered DNA repair is of central significance in the initiation and progression of inherited and sporadic human leukemias. Although very rare, some inherited DNA repair insufficiency syndromes (e.g., Fanconi anemia, Bloom's syndrome) have added substantially to our understanding of crucial mechanisms of leukemogenesis in recent years. Conversely, sporadic leukemias account for the main proportion of leukemias and here DNA damaging reactive oxygen species (ROS) play a central role. Although the exact mechanisms of increased ROS production remain largely unknown and no single pathway has been detected thus far, some oncogenic proteins (e.g., the activated tyrosine kinases BCR-ABL1 and FLT3-ITD) seem to play a key role in driving genetic instability by increased ROS generation which influences the disease course (e.g., blast crisis in chronic myeloid leukemia or relapse in FLT3-ITD positive acute myeloid leukemia). Of course other mechanisms, which promote genetic instability in leukemia also exist. A newly emerging mechanism is the genome-wide alteration of epigenetic marks (e.g., hypomethylation of histone H3K79), which promotes chromosomal instability. Taken together genetic instability plays a critical role both in inherited and sporadic leukemias and emerges as a common theme in both inherited and sporadic leukemias. Beyond its theoretical impact, the analysis of genetic instability may lead the way to the development of innovative therapy strategies. © 2010 Wiley-Liss, Inc.
Frequency Modulation and Spatiotemporal Stability of the sCPG in Preterm Infants with RDS
Barlow, Steven M.; Burch, Mimi; Venkatesan, Lalit; Harold, Meredith; Zimmerman, Emily
2012-01-01
The nonnutritive suck (NNS) is an observable and accessible motor behavior which is often used to make inference about brain development and pre-feeding skill in preterm and term infants. The purpose of this study was to model NNS burst compression pressure dynamics in the frequency and time domain among two groups of preterm infants, including those with respiratory distress syndrome (RDS, N = 15) and 17 healthy controls. Digitized samples of NNS compression pressure waveforms recorded at a 1-week interval were collected 15 minutes prior to a scheduled feed. Regression analysis and ANOVA revealed that healthy preterm infants produced longer NNS bursts and the mean burst initiation cycle frequencies were higher when compared to the RDS group. Moreover, the initial 5 cycles of the NNS burst manifest a frequency modulated (FM) segment which is a significant feature of the suck central pattern generator (sCPG), and differentially expressed in healthy and RDS infants. The NNS burst structure revealed significantly lower spatiotemporal index values for control versus RDS preterm infants during FM, and provides additional information on the microstructure of the sCPG which may be used to gauge the developmental status and progression of oromotor control systems among these fragile infants. PMID:22888359
Savio, Andrea J.; Lemire, Mathieu; Mrkonjic, Miralem; Gallinger, Steven; Zanke, Brent W.; Hudson, Thomas J.; Bapat, Bharati
2012-01-01
Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation. We previously demonstrated that SNPs (rs1800734, rs749072, and rs13098279) in the MLH1 gene region are associated with MLH1 promoter island methylation, loss of MLH1 protein expression, and microsatellite instability (MSI) in colorectal cancer (CRC) patients. Recent studies have identified less CpG-dense “shore” regions flanking many CpG islands. These shores often exhibit distinct methylation profiles between different tissues and matched normal versus tumor cells of patients. To date, most epigenetic studies have focused on somatic methylation events occurring within solid tumors; less is known of the contributions of peripheral blood cell (PBC) methylation to processes such as aging and tumorigenesis. To address whether MLH1 methylation in PBCs is correlated with tumorigenesis we utilized the Illumina 450 K microarrays to measure methylation in PBC DNA of 846 healthy controls and 252 CRC patients from Ontario, Canada. Analysis of a region of chromosome 3p21 spanning the MLH1 locus in healthy controls revealed that a CpG island shore 1 kb upstream of the MLH1 gene exhibits different methylation profiles when stratified by SNP genotypes (rs1800734, rs749072, and rs13098279). Individuals with wild-type genotypes incur significantly higher PBC shore methylation than heterozygous or homozygous variant carriers (p<1.1×10−6; ANOVA). This trend is also seen in CRC cases (p<0.096; ANOVA). Shore methylation also decreases significantly with increasing age in cases and controls. This is the first study of its kind to integrate PBC methylation at a CpG island shore with SNP genotype status in CRC cases and controls. These results indicate that CpG island shore methylation in PBCs may be influenced by genotype as well as the normal aging process. PMID:23240038
Transgenerational epigenetic inheritance: how important is it?
Grossniklaus, Ueli; Kelly, William G.; Ferguson-Smith, Anne C.; Pembrey, Marcus; Lindquist, Susan
2014-01-01
Much attention has been given to the idea of transgenerational epigenetic inheritance, but fundamental questions remain regarding how much takes place and the impact that this might have on organisms. We asked five leading researchers in this area — working on a range of model organisms and in human disease — for their views on these topics. Their responses highlight the mixture of excitement and caution that surrounds transgenerational epigenetic inheritance and the wide gulf between species in terms of our knowledge of the mechanisms that may be involved. PMID:23416892
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo
2017-01-01
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo
2008-10-09
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.
Veenstra, Jesse J; Gibson, Heather M; Littrup, Peter J; Reyes, Joyce D; Cher, Michael L; Takashima, Akira; Wei, Wei-Zen
2014-10-01
Percutaneous cryoablation is a minimally invasive procedure for tumor destruction, which can potentially initiate or amplify antitumor immunity through the release of tumor-associated antigens. However, clinically efficacious immunity is lacking and regional recurrences are a limiting factor relative to surgical excision. To understand the mechanism of immune activation by cryoablation, comprehensive analyses of innate immunity and HER2/neu humoral and cellular immunity following cryoablation with or without peritumoral CpG injection were conducted using two HER2/neu(+) tumor systems in wild-type (WT), neu-tolerant, and SCID mice. Cryoablation of neu(+) TUBO tumor in BALB/c mice resulted in systemic immune priming, but not in neu-tolerant BALB NeuT mice. Cryoablation of human HER2(+) D2F2/E2 tumor enabled the functionality of tumor-induced immunity, but secondary tumors were refractory to antitumor immunity if rechallenge occurred during the resolution phase of the cryoablated tumor. A step-wise increase in local recurrence was observed in WT, neu-tolerant, and SCID mice, indicating a role of adaptive immunity in controlling residual tumor foci. Importantly, local recurrences were eliminated or greatly reduced in WT, neu tolerant, and SCID mice when CpG was incorporated in the cryoablation regimen, showing significant local control by innate immunity. For long-term protection, however, adaptive immunity was required because most SCID mice eventually succumbed to local tumor recurrence even with combined cryoablation and CpG treatment. This improved understanding of the mechanisms by which cryoablation affects innate and adaptive immunity will help guide appropriate combination of therapeutic interventions to improve treatment outcomes. ©2014 American Association for Cancer Research.
Francis, R J; Mather, S J; Chester, K; Sharma, S K; Bhatia, J; Pedley, R B; Waibel, R; Green, A J; Begent, R H J
2004-08-01
MFECP1 is a glycosylated recombinant fusion protein composed of MFE-23, a high-affinity anti-carcinoembryonic antigen (CEA) single chain Fv (scFv), fused to the enzyme carboxypeptidase G2 (CPG2), and has been constructed for use in antibody-directed enzyme pro-drug therapy (ADEPT). Radiolabelling of glycosylated MFECP1 with technetium-99m was developed for the purpose of determining tumour localisation of MFECP1 in a phase I ADEPT clinical study. The method used was 99mTc-carbonyl [99mTc(H2O)3(CO)3]+ (abbreviated to TcCO) mediated labelling of 99mTc to the hexahistidine (His) tag of MFECP1. MFECP1 fusion protein was labelled with TcCO under a variety of conditions, and this was shown to be a relatively simple and robust method. Tissue biodistribution was assessed in a CEA-expressing LS174T (human colon carcinoma) nude mouse xenograft model. Tissues were taken at 1, 4 and 6 h for assessment of distribution of radioactivity and for measurement of CPG2 enzyme levels. The amount of radioactivity retained by the tumour proved to be an accurate estimation of actual measured enzyme activity, indicating that this radiolabelling method does not appear to damage the antibody-antigen binding or the enzyme activity of MFECP1. However, correlation between CPG2 enzyme activity and measured radioactivity in liver, spleen and kidney was poor, indicating retention of radioactivity in non-tumour sites but loss of enzyme activity. The high retention of technetium radioisotope in normal tissues may limit the clinical applicability of this radiolabelling method for MFECP1; however, these results suggest that this technique does have applicability for measuring the biodistribution of His-tagged recombinant proteins.
Recent Progress in Genome Editing Approaches for Inherited Cardiovascular Diseases.
Kaur, Balpreet; Perea-Gil, Isaac; Karakikes, Ioannis
2018-06-02
This review describes the recent progress in nuclease-based therapeutic applications for inherited heart diseases in vitro, highlights the development of the most recent genome editing technologies and discusses the associated challenges for clinical translation. Inherited cardiovascular disorders are passed from generation to generation. Over the past decade, considerable progress has been made in understanding the genetic basis of inherited heart diseases. The timely emergence of genome editing technologies using engineered programmable nucleases has revolutionized the basic research of inherited cardiovascular diseases and holds great promise for the development of targeted therapies. The genome editing toolbox is rapidly expanding, and new tools have been recently added that significantly expand the capabilities of engineered nucleases. Newer classes of versatile engineered nucleases, such as the "base editors," have been recently developed, offering the potential for efficient and precise therapeutic manipulation of the human genome.
Inheritance of microsatellite loci in the polyploid lake sturgeon (Acipenser fulvescens)
Pyatskowit, J.D.; Krueger, C.C.; Kincaid, H.L.; May, B.
2001-01-01
Inheritance in the expression of amplicons for four microsatellite primer pairs was determined using 10 families created from gametes of wild lake sturgeon (Acipenser fulvescens). Loci Afu34 and Afu68 expressed a maximum of two even-intensity bands per individual and had progeny genotype ratios that fit disomic inheritance (P > 0.05). Some variation exhibited at Afu34 and Afu68 was attributable to a null allele. Genotype expression at both loci also indicated that one female parent had transmitted unreduced gametes. Primer Afu39 amplified products that exhibited four gene doses, where genotype counts fit expected ratios for disomic inheritance (P > 0.05) indicating amplification of products from two disomic loci that share alleles. Meiotic drive was evident at the Afu39 loci based on a test for random segregation (P < 0.05). Only the expression of Afu19 gave evidence of tetrasomic inheritance based on a single progeny potentially produced by a double reduction gamete. No evidence for proposed octoploid inheritance was observed.
Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.
Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin
2016-10-15
Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author
Chan, K. C. Allen; Jiang, Peiyong; Sun, Kun; Cheng, Yvonne K. Y.; Tong, Yu K.; Cheng, Suk Hang; Wong, Ada I. C.; Hudecova, Irena; Leung, Tak Y.; Chiu, Rossa W. K.; Lo, Yuk Ming Dennis
2016-01-01
Plasma DNA obtained from a pregnant woman was sequenced to a depth of 270× haploid genome coverage. Comparing the maternal plasma DNA sequencing data with the parental genomic DNA data and using a series of bioinformatics filters, fetal de novo mutations were detected at a sensitivity of 85% and a positive predictive value of 74%. These results represent a 169-fold improvement in the positive predictive value over previous attempts. Improvements in the interpretation of the sequence information of every base position in the genome allowed us to interrogate the maternal inheritance of the fetus for 618,271 of 656,676 (94.2%) heterozygous SNPs within the maternal genome. The fetal genotype at each of these sites was deduced individually, unlike previously, where the inheritance was determined for a collection of sites within a haplotype. These results represent a 90-fold enhancement in the resolution in determining the fetus’s maternal inheritance. Selected genomic locations were more likely to be found at the ends of plasma DNA molecules. We found that a subset of such preferred ends exhibited selectivity for fetal- or maternal-derived DNA in maternal plasma. The ratio of the number of maternal plasma DNA molecules with fetal preferred ends to those with maternal preferred ends showed a correlation with the fetal DNA fraction. Finally, this second generation approach for noninvasive fetal whole-genome analysis was validated in a pregnancy diagnosed with cardiofaciocutaneous syndrome with maternal plasma DNA sequenced to 195× coverage. The causative de novo BRAF mutation was successfully detected through the maternal plasma DNA analysis. PMID:27799561
"You're saying something by giving things to them:" communication and family inheritance.
de Witt, Lorna; Campbell, Lori; Ploeg, Jenny; Kemp, Candace L; Rosenthal, Carolyn
2013-09-01
The study purpose was to contribute to a more complete understanding of the experience and meaning of family inheritance. The aim of this article is to describe and discuss the meaning of communication in inheritance experiences among Canadian families. A constructivist/interpretive methodological approach guided this research. Participants were recruited through purposive, convenience sampling from two cities and one town in southern and southwestern Ontario, Canada. Fifty face-to-face, semi-structured, audio-taped, in-depth interviews were conducted between June 2006 and April 2007. NVivo software was used to organize and analyze the data. A content analysis method guided data analysis. Participants interpreted the meaning of family structure, relationships, feelings, and past inheritance experiences to construct their family inheritance communication. Analysis of the findings revealed four themes regarding the role of communication in family inheritance including: (a) avoiding conflict and preserving biological ties , (b) resisting conversations about possessions , (c) achieving confidence with possession communication , and (d) lasting effects. Participants from non-blended and blended families experienced similar inheritance communication challenges related to past experience with their parents' wills and distribution of their own possessions. Participants with past positive inheritance experiences with parents adopted similar strategies when communicating their own inheritance wishes. Negative messages conveyed to participants by their parent's wills inspired participants to communicate in opposite ways in their own inheritance planning. The study findings are useful for gerontologists, lawyers, family counselors, and estate planners.
Day, Troy
2016-04-01
Epigenetic inheritance is the transmission of nongenetic material such as gene expression levels, RNA and other biomolecules from parents to offspring. There is a growing realization that such forms of inheritance can play an important role in evolution. Bacteria represent a prime example of epigenetic inheritance because a large array of cellular components is transmitted to offspring, in addition to genetic material. Interestingly, there is an extensive and growing empirical literature showing that many bacteria can form 'persister' cells that are phenotypically resistant or tolerant to antibiotics, but most of these results are not interpreted within the context of epigenetic inheritance. Instead, persister cells are usually viewed as a genetically encoded bet-hedging strategy that has evolved in response to a fluctuating environment. Here I show, using a relatively simple model, that many of these empirical findings can be more simply understood as arising from a combination of epigenetic inheritance and cellular noise. I therefore suggest that phenotypic drug tolerance in bacteria might represent one of the best-studied examples of evolution under epigenetic inheritance. © 2016 John Wiley & Sons Ltd.
Zhang, Chunlin; Deng, Zeyi; Pan, Xiaoli; Uehara, Takayuki; Suzuki, Mikio; Xie, Minqiang
2015-01-01
To map comprehensively the methylation status of the CpG sites within the HPV16 long control region (LCR) in HPV-positive cancer cells, and to explore further the effects of methylation status of HPV16 LCR on cell bioactivity and E6 and E7 expression. In addition, to analyze the methylation status of the LCR in HPV-positive oropharyngeal squamous cell carcinoma (OPSCC) patients. Methylation patterns of HPV16 LCR in UM-SCC47, CaSki, and SiHa cells and HPV16-positiive OPSCC specimens were detected by bisulfite-sequencing PCR and TA cloning. For cells treated with 5-aza-2'-deoxycytidine and E6 and E7 knockdown, MTS and trypan blue staining, annexin-V and 7-AAD staining, and prodidium iodide were used to evaluate cell growth and cell proliferation, cell apoptosis, and cell cycle arrest, respectively. E6 and E7 mRNA and protein expression were analyzed by quantitative real-time PCR and immunocytochemistry, respectively. Hypermethylation status of the LCR in UM-SCC47 (79.8%) and CaSki cells (90.0%) and unmethylation status of the LCR in SiHa cells (0%) were observed. Upon demethylation, the cells with different methylation levels responded differently during growth, apoptosis, and cell cycle arrest, as well as in terms of their E6 and E7 expression. In HPV16-positive OPSCC patients, the methylation rates were 9.5% in the entire LCR region, 13.9% in the 5'-LCR, 6.0% in the E6 enhancer, and 9.5% in the p97 promoter, and hypermethylation of p97 promoter was found in a subset of cases (20.0%, 2/10). Our study revealed two different methylation levels of the LCR in HPV16-positive cancer cells and OPSCC patients, which may represent different carcinogenesis mechanisms of HPV-positive cancers cells. Demethylating the meCpGs in HPV16 LCR might be a potential target for a subgroup of HPV16-positive patients with head and neck squamous cell carcinoma.
Malhotra, Sanandan; Justice, James; Morgan, Robin
2017-01-01
Avian leukosis virus (ALV) is a simple retrovirus that causes a wide range of tumors in chickens, the most common of which are B-cell lymphomas. The viral genome integrates into the host genome and uses its strong promoter and enhancer sequences to alter the expression of nearby genes, frequently inducing tumors. In this study, we compare the preferences for ALV integration sites in cultured cells and in tumors, by analysis of over 87,000 unique integration sites. In tissue culture we observed integration was relatively random with slight preferences for genes, transcription start sites and CpG islands. We also observed a preference for integrations in or near expressed and spliced genes. The integration pattern in cultured cells changed over the course of selection for oncogenic characteristics in tumors. In comparison to tissue culture, ALV integrations are more highly selected for proximity to transcription start sites in tumors. There is also a significant selection of ALV integrations away from CpG islands in the highly clonally expanded cells in tumors. Additionally, we utilized a high throughput method to quantify the magnitude of clonality in different stages of tumorigenesis. An ALV-induced tumor carries between 700 and 3000 unique integrations, with an average of 2.3 to 4 copies of proviral DNA per infected cell. We observed increasing tumor clonality during progression of B-cell lymphomas and identified gene players (especially TERT and MYB) and biological processes involved in tumor progression. PMID:29099869
A differential diagnosis of inherited endocrine tumors and their tumor counterparts
Toledo, Sergio P. A.; Lourenço, Delmar M.; Toledo, Rodrigo A.
2013-01-01
Inherited endocrine tumors have been increasingly recognized in clinical practice, although some difficulties still exist in differentiating these conditions from their sporadic endocrine tumor counterparts. Here, we list the 12 main topics that could add helpful information and clues for performing an early differential diagnosis to distinguish between these conditions. The early diagnosis of patients with inherited endocrine tumors may be performed either clinically or by mutation analysis in at-risk individuals. Early detection usually has a large impact in tumor management, allowing preventive clinical or surgical therapy in most cases. Advice for the clinical and surgical management of inherited endocrine tumors is also discussed. In addition, recent clinical and genetic advances for 17 different forms of inherited endocrine tumors are briefly reviewed. PMID:23917672
Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun
2017-01-01
There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.
Cross, Alan S; Greenberg, Nancy; Billington, Melissa; Zhang, Lei; DeFilippi, Christopher; May, Ryan C; Bajwa, Kanwaldeep K
2015-11-27
Gram-negative bacteria (GNB) are a leading cause of nosocomial infection and sepsis. Increasing multi-antibiotic resistance has left clinicians with fewer therapeutic options. Antibodies to GNB lipopolysaccharide (LPS, or endotoxin) have reduced morbidity and mortality as a result of infection and are not subject to the resistance mechanisms deployed by bacteria against antibiotics. In this phase 1 study, we administered a vaccine that elicits antibodies against a highly conserved portion of LPS with and without a CpG oligodeoxynucleotide (ODN) TLR9 agonist as adjuvant. A vaccine composed of the detoxified LPS (dLPS) from E. coli O111:B4 (J5 mutant) non-covalently complexed to group B meningococcal outer membrane protein (OMP). Twenty healthy adult subjects received three doses at 0, 29 and 59 days of antigen (10 μg dLPS) with or without CPG 7909 (250 or 500 μg). Subjects were evaluated for local and systemic adverse effects and laboratory findings. Anti-J5 LPS IgG and IgM antibody levels were measured by electrochemiluminesence. Due to premature study termination, not all subjects received all three doses. All vaccine formulations were well-tolerated with no local or systemic events of greater than moderate severity. The vaccine alone group achieved a ≥ 4-fold "responder" response in IgG and IgM antibody in only one of 6 subjects. In contrast, the vaccine plus CPG 7909 groups appeared to have earlier and more sustained (to 180 days) responses, greater mean-fold increases, and a higher proportion of "responders" achieving ≥ 4-fold increases over baseline. Although the study was halted before all enrolled subjects received all three doses, the J5dLPS/OMP vaccine, with or without CpG adjuvant, was safe and well-tolerated. The inclusion of CpG increased the number of subjects with a ≥ 4-fold antibody response, evident even after the second of three planned doses. A vaccine comprising J5dLPS/OMP antigen with CpG adjuvant merits further investigation. Clinical
Inheritance of evolved clethodim resistance in Lolium rigidum populations from Australia.
Saini, Rupinder Kaur; Malone, Jenna; Gill, Gurjeet; Preston, Christopher
2017-08-01
In Australia, the extensive use of clethodim for the control of Lolium rigidum has resulted in the evolution of many clethodim-resistant L. rigidum populations. Five clethodim-resistant populations of L. rigidum were analysed for the inheritance of clethodim resistance. Reciprocal crosses were made between resistant (R) and susceptible (S) populations. Within crosses, dose-responses of reciprocal F 1 families of all populations except A61 were similar to each other, indicating that clethodim resistance in these populations is encoded on the nuclear genome. The level of dominance observed in the dose-response experiments ranged from partial to complete within the herbicide rate used. In the A61 population, within each cross, the response of F 1 from the maternal and paternal parent was different, indicating that resistance is inherited through the female parent. All backcross populations segregated in a different manner. Only one population, FP, fitted a single-gene model (1:1). Two populations fitted two-gene models: a 3:1 inheritance model for F4 and a 1:3 inheritance model for A91. For population E2, no clear pattern of inheritance was determined, suggesting more complex inheritance. The results of this study indicate that different patterns of clethodim resistance in L. rigidum exist. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Center for Inherited Disease Research (CIDR)
The Center for Inherited Disease Research (CIDR) Program at The Johns Hopkins University provides high-quality next generation sequencing and genotyping services to investigators working to discover genes that contribute to common diseases.
The Tasmantid Seamounts: A window into the structural inheritance of ocean floor fabric
NASA Astrophysics Data System (ADS)
Richards, F. D.; Kalnins, L. M.; Watts, A. B.; Cohen, B. E.; Beaman, R. J.
2015-12-01
The extinct Tasman Sea spreading centre, active from 84--53 Ma, is intersected at a number of locations by the Tasmantid Seamount Chain. The chain, which extends for over 2000 km off the east coast of Australia, progressively increases in age from south to north with ages ranging between 6 Ma and ˜50 Ma. While thick sediment (˜1 km) obscures much of the northern Tasman Sea basement, detailed morphological and geophysical analyses of the seamounts reveal a strong correlation between tectonic setting, seamount orientation, and volcanic structure, despite the ≥20 Ma offset between spreading cessation and initial seamount emplacement. Morphologically, structural inheritance is evidenced by the contrast between two volcanic styles: 1) the rugged, predominantly fissure-fed, fabrics characterizing seamounts emplaced at inside corners of spreading segment-transform intersections; and 2) the conical seamounts with summit craters and isolated dyke-fed flank cones that develop off-axis. Furthermore, volcanic fabrics align closely with the principal stress directions expected for a spreading ridge system in which strong mechanical coupling occurs across transform faults. This suggests that the lithosphere is dissected by numerous deep faults, allowing magma to be channelled away from the site of melting along pre-existing structural trends. The generally low effective elastic thickness, TeT_e, (≤15 km) and lack of a plate age-TeT_e relationship along the chain indicate that structural inheritance is also the major control on lithospheric strength near the extinct spreading centre. While the importance of structural inheritance in controlling magmatic behaviour is commonly acknowledged in continental settings, these results clearly demonstrate the need to also consider it in the oceanic realm.The extinct Tasman Sea spreading centre, active from 84--53 Ma, is intersected at a number of locations by the Tasmantid Seamount Chain. The chain, which extends for over 2000 km off
Inherited secondary nephrogenic diabetes insipidus: concentrating on humans.
Bockenhauer, D; Bichet, D G
2013-04-15
The study of human physiology is paramount to understanding disease and developing rational and targeted treatments. Conversely, the study of human disease can teach us a lot about physiology. Investigations into primary inherited nephrogenic diabetes insipidus (NDI) have contributed enormously to our understanding of the mechanisms of urinary concentration and identified the vasopressin receptor AVPR2, as well as the water channel aquaporin-2 (AQP2), as key players in water reabsorption in the collecting duct. Yet, there are also secondary forms of NDI, for instance as a complication of lithium treatment. The focus of this review is secondary NDI associated with inherited human diseases, such as Bartter syndrome or apparent mineralocorticoid excess. Currently, the underlying pathophysiology of this inherited secondary NDI is unclear, but there appears to be true AQP2 deficiency. To better understand the underlying mechanism(s), collaboration between clinical and experimental physiologists is essential to further investigate these observations in appropriate experimental models.
Social and Experiential Influences on the Development of Inheritance Concepts
ERIC Educational Resources Information Center
Williams, Joanne M.; Smith, Lesley A.
2006-01-01
This study explored social and experiential differences in children's (aged 4 to 14 years) concepts of inheritance. The study utilized semi-structured interviews including four tasks that were designed to elicit judgements and explanations about different aspects of inheritance understanding. A variety of social and experiential factors were…
"That's not how we do it": managing the inherited medical practice team.
Hills, Laura
2013-01-01
Most medical practice managers who take a new job will inherit an existing team. Those first few days on the job are critical because they can determine whether or not the new manager will succeed. This article provides a game plan for new medical practice managers so they get off on the right foot with their inherited teams. It suggests strategies for learning about the team's culture and for demonstrating visibly that there is a new manager in the job. It offers guidelines about introducing the new manager to the inherited team, discussing past experiences, and establishing new expectations. This article further provides practical tips for serving as a role model, gaining allies, and dealing with troublemakers quickly and effectively. It suggests strategies for speaking about the previous practice manager and for creating excitement with the inherited team. Finally, this article offers a set of 15 questions a new manager can ask members of the inherited team to get to know them, an additional 25-point team assessment instrument, and a step-by-step strategy for raising the bar for mediocre, lackluster, or dysfunctional inherited teams.
Genetic Testing for Inherited Heart Disease
... are also inherited heart conditions that affect the electric system of the heart, causing abnormal heart rhythms ... mistakenly labeled as a heart attack, drowning, or car accident. The sudden death of a previously healthy ...
Emeny, Rebecca T; Baumert, Jens; Zannas, Anthony S; Kunze, Sonja; Wahl, Simone; Iurato, Stella; Arloth, Janine; Erhardt, Angelika; Balsevich, Georgia; Schmidt, Mathias V; Weber, Peter; Kretschmer, Anja; Pfeiffer, Liliane; Kruse, Johannes; Strauch, Konstantin; Roden, Michael; Herder, Christian; Koenig, Wolfgang; Gieger, Christian; Waldenberger, Melanie; Peters, Annette; Binder, Elisabeth B; Ladwig, Karl-Heinz
2018-01-01
Epigenetic regulation in anxiety is suggested, but evidence from large studies is needed. We conducted an epigenome-wide association study (EWAS) on anxiety in a population-based cohort and validated our finding in a clinical cohort as well as a murine model. In the KORA cohort, participants (n=1522, age 32-72 years) were administered the Generalized Anxiety Disorder (GAD-7) instrument, whole blood DNA methylation was measured (Illumina 450K BeadChip), and circulating levels of hs-CRP and IL-18 were assessed in the association between anxiety and methylation. DNA methylation was measured using the same instrument in a study of patients with anxiety disorders recruited at the Max Planck Institute of Psychiatry (MPIP, 131 non-medicated cases and 169 controls). To expand our mechanistic understanding, these findings were reverse translated in a mouse model of acute social defeat stress. In the KORA study, participants were classified according to mild, moderate, or severe levels of anxiety (29.4%/6.0%/1.5%, respectively). Severe anxiety was associated with 48.5% increased methylation at a single CpG site (cg12701571) located in the promoter of the gene encoding Asb1 (β-coefficient=0.56 standard error (SE)=0.10, p (Bonferroni)=0.005), a protein hypothetically involved in regulation of cytokine signaling. An interaction between IL-18 and severe anxiety with methylation of this CpG cite showed a tendency towards significance in the total population (p=0.083) and a significant interaction among women (p=0.014). Methylation of the same CpG was positively associated with Panic and Agoraphobia scale (PAS) scores (β=0.005, SE=0.002, p=0.021, n=131) among cases in the MPIP study. In a murine model of acute social defeat stress, Asb1 gene expression was significantly upregulated in a tissue-specific manner (p=0.006), which correlated with upregulation of the neuroimmunomodulating cytokine interleukin 1 beta. Our findings suggest epigenetic regulation of the stress
Emeny, Rebecca T; Baumert, Jens; Zannas, Anthony S; Kunze, Sonja; Wahl, Simone; Iurato, Stella; Arloth, Janine; Erhardt, Angelika; Balsevich, Georgia; Schmidt, Mathias V; Weber, Peter; Kretschmer, Anja; Pfeiffer, Liliane; Kruse, Johannes; Strauch, Konstantin; Roden, Michael; Herder, Christian; Koenig, Wolfgang; Gieger, Christian; Waldenberger, Melanie; Peters, Annette; Binder, Elisabeth B; Ladwig, Karl-Heinz
2018-01-01
Epigenetic regulation in anxiety is suggested, but evidence from large studies is needed. We conducted an epigenome-wide association study (EWAS) on anxiety in a population-based cohort and validated our finding in a clinical cohort as well as a murine model. In the KORA cohort, participants (n=1522, age 32–72 years) were administered the Generalized Anxiety Disorder (GAD-7) instrument, whole blood DNA methylation was measured (Illumina 450K BeadChip), and circulating levels of hs-CRP and IL-18 were assessed in the association between anxiety and methylation. DNA methylation was measured using the same instrument in a study of patients with anxiety disorders recruited at the Max Planck Institute of Psychiatry (MPIP, 131 non-medicated cases and 169 controls). To expand our mechanistic understanding, these findings were reverse translated in a mouse model of acute social defeat stress. In the KORA study, participants were classified according to mild, moderate, or severe levels of anxiety (29.4%/6.0%/1.5%, respectively). Severe anxiety was associated with 48.5% increased methylation at a single CpG site (cg12701571) located in the promoter of the gene encoding Asb1 (β-coefficient=0.56 standard error (SE)=0.10, p (Bonferroni)=0.005), a protein hypothetically involved in regulation of cytokine signaling. An interaction between IL-18 and severe anxiety with methylation of this CpG cite showed a tendency towards significance in the total population (p=0.083) and a significant interaction among women (p=0.014). Methylation of the same CpG was positively associated with Panic and Agoraphobia scale (PAS) scores (β=0.005, SE=0.002, p=0.021, n=131) among cases in the MPIP study. In a murine model of acute social defeat stress, Asb1 gene expression was significantly upregulated in a tissue-specific manner (p=0.006), which correlated with upregulation of the neuroimmunomodulating cytokine interleukin 1 beta. Our findings suggest epigenetic regulation of the stress
Harandi, Ali M
2004-07-01
Herpes simplex virus type 2 (HSV-2) invades human genital tract mucosa and following local replications can be rapidly transmitted via peripheral nerve axons to the sacral ganglia where it can establish latency. Reactivation of the latent viral reservoir results in recurrent ulcers in the genital region. Innate immunity, the first line of defence during both primary and recurrent genital herpes infections, is crucial during the period of acute infection to limit early virus replication and to facilitate the development of an appropriate specific acquired immunity. Recent developments in immunology reveal that the mammalian innate immune systems use Toll-like receptor (TLR) to specifically sense evolutionary conserved molecules such as bacterial DNA in pathogens. Recently, local-vaginal delivery of CpG containing oligodeoxynucleotide (ODN), a synthetic mimic of bacterial DNA, holds substantial promise as a strong inducer of innate immunity against genital herpes infections in the animal models of the disease. These preclinical observations provide a scientific ground work for introduction of this novel intervention strategy to clinic. This review aims to highlight recent developments and future challenges in use of immunostimulatory CpG ODN for inducing immunity against genital herpes infection and disease.
Sánchez-Vega, Francisco; Gotea, Valer; Chen, Yun-Ching; Elnitski, Laura
2017-01-01
Over the last two decades, cancer-related alterations in DNA methylation that regulate transcription have been reported for a variety of tumors of the gastrointestinal tract. Due to its relevance for translational research, great emphasis has been placed on the analysis and molecular characterization of the CpG island methylator phenotype (CIMP), defined as widespread hypermethylation of CpG islands in clinically distinct subsets of cancer patients. Here, we present an overview of previous work in this field and also explore some open questions using cross-platform data for esophageal, gastric, and colorectal adenocarcinomas from The Cancer Genome Atlas. We provide a data-driven, pan-gastrointestinal stratification of individual samples based on CIMP status and we investigate correlations with oncogenic alterations, including somatic mutations and epigenetic silencing of tumor suppressor genes. Besides known events in CIMP such as BRAF V600E mutation, CDKN2A silencing or MLH1 inactivation, we discuss the potential role of emerging actors such as Wnt pathway deregulation through truncating mutations in RNF43 and epigenetic silencing of WIF1. Our results highlight the existence of molecular similarities that are superimposed over a larger backbone of tissue-specific features and can be exploited to reduce heterogeneity of response in clinical trials. PMID:28344746
Guiametabolica.org: empowerment through internet tools in inherited metabolic diseases.
Armayones, Manuel; Vilaseca, M Antònia; Cutillas, Júlia; Fàbrega, Jordi; Fernández, Jorge Juan; García, Mei; Egea, Natàlia; Pousada, Modesta; Gómez-Zuñiga, Beni; Pérez-Payarols, Jaume; Artuch, Rafael; Palau, Francesc; Serrano, Mercedes
2012-08-21
Web-based interventions are effective on the patient empowerment. Guiametabolica.org constitutes an interface for people involved in inherited metabolic diseases, trying to facilitate access to information and contact with professionals and other patients, offering a platform to develop support groups. Guiametabolica.org is widely considered for Spanish-speaking patients and caregivers with inherited metabolic diseases. Preliminary evaluations show changes in their habits, decrease in their senses of isolation and improvement regarding self-efficacy. Specific inherited metabolic diseases websites, especially participative websites, should be considered as a complement to more traditional clinical approaches. Their contribution lies in patient's general well-being, without interfering with traditional care.
Mitochondrial inheritance in budding yeasts: towards an integrated understanding.
Solieri, Lisa
2010-11-01
Recent advances in yeast mitogenomics have significantly contributed to our understanding of the diversity of organization, structure and topology in the mitochondrial genome of budding yeasts. In parallel, new insights on mitochondrial DNA (mtDNA) inheritance in the model organism Saccharomyces cerevisiae highlighted an integrated scenario where recombination, replication and segregation of mtDNA are intricately linked to mitochondrial nucleoid (mt-nucleoid) structure and organelle sorting. In addition to this, recent discoveries of bifunctional roles of some mitochondrial proteins have interesting implications on mito-nuclear genome interactions and the relationship between mtDNA inheritance, yeast fitness and speciation. This review summarizes the current knowledge on yeast mitogenomics, mtDNA inheritance with regard to mt-nucleoid structure and organelle dynamics, and mito-nuclear genome interactions. Copyright © 2010 Elsevier Ltd. All rights reserved.
Chloroplast and mitochondrial DNA are paternally inherited in Sequoia sempervirens D. Don Endl
Neale, David B.; Marshall, Kimberly A.; Sederoff, Ronald R.
1989-01-01
Restriction fragment length polymorphisms in controlled crosses were used to infer the mode of inheritance of chloroplast DNA and mitochondrial DNA in coast redwood (Sequoia sempervirens D. Don Endl.). Chloroplast DNA was paternally inherited, as is true for all other conifers studied thus far. Surprisingly, a restriction fragment length polymorphism detected by a mitochondrial probe was paternally inherited as well. This polymorphism could not be detected in hybridizations with chloroplast probes covering the entire chloroplast genome, thus providing evidence that the mitochondrial probe had not hybridized to chloroplast DNA on the blot. We conclude that mitochondrial DNA is paternally inherited in coast redwood. To our knowledge, paternal inheritance of mitochondrial DNA in sexual crosses of a multicellular eukaryotic organism has not been previously reported. Images PMID:16594091
Middelton, L A; Peters, K F
2001-10-01
The information gained from the Human Genome Project and related genetic research will undoubtedly create significant changes in healthcare practice. It is becoming increasingly clear that nurses in all areas of clinical practice will require a fundamental understanding of basic genetics. This article provides the oncology nurse with an overview of basic genetic concepts, including inheritance patterns of single gene conditions, pedigree construction, chromosome aberrations, and the multifactorial basis underlying the common diseases of adulthood. Normal gene structure and function are introduced and the biochemistry of genetic errors is described.
USDA-ARS?s Scientific Manuscript database
The potential of using a QCDCR (quilA:cholesterol:dimethyl dioctadecyl ammonium bromide:carbopol:R1005 glycolipid) formulated CpG oligodeoxynucleotide (ODN), ODN 2007, to confer protection in Nile tilapia against Streptococcus iniae infection was evaluated in this study. At two days post treatment, ...
Radzvilavicius, Arunas L; Lane, Nick; Pomiankowski, Andrew
2017-10-26
Mitochondria are predominantly inherited from the maternal gamete, even in unicellular organisms. Yet an extraordinary array of mechanisms enforce uniparental inheritance, which implies shifting selection pressures and multiple origins. We consider how this high turnover in mechanisms controlling uniparental inheritance arises using a novel evolutionary model in which control of mitochondrial transmission occurs either during spermatogenesis (by paternal nuclear genes) or at/after fertilization (by maternal nuclear genes). The model treats paternal leakage as an evolvable trait. Our evolutionary analysis shows that maternal control consistently favours strict uniparental inheritance with complete exclusion of sperm mitochondria, whereas some degree of paternal leakage of mitochondria is an expected outcome under paternal control. This difference arises because mito-nuclear linkage builds up with maternal control, allowing the greater variance created by asymmetric inheritance to boost the efficiency of purifying selection and bring benefits in the long term. In contrast, under paternal control, mito-nuclear linkage tends to be much weaker, giving greater advantage to the mixing of cytotypes, which improves mean fitness in the short term, even though it imposes a fitness cost to both mating types in the long term. Sexual conflict is an inevitable outcome when there is competition between maternal and paternal control of mitochondrial inheritance. If evolution has led to complete uniparental inheritance through maternal control, it creates selective pressure on the paternal nucleus in favour of subversion through paternal leakage, and vice versa. This selective divergence provides a reason for the repeated evolution of novel mechanisms that regulate the transmission of paternal mitochondria, both in the fertilized egg and spermatogenesis. Our analysis suggests that the widespread occurrence of paternal leakage and prevalence of heteroplasmy are natural outcomes of
Inheritance of the 8.1 ancestral haplotype in recurrent pregnancy loss
Kolte, Astrid M.; Nielsen, Henriette S.; Steffensen, Rudi; Crespi, Bernard; Christiansen, Ole B.
2015-01-01
Background and objectives: The 8.1 ancestral haplotype (AH) (HLA-A1, C7, B8, C4AQ0, C4B1, DR3, DQ2) is a remarkably long and conserved haplotype in the human major histocompatibility complex. It has been associated with both beneficial and detrimental effects, consistent with antagonistic pleiotropy. It has also been proposed that the survival of long, conserved haplotypes may be due to gestational drive, i.e. selective miscarriage of fetuses who have not inherited the haplotype from a heterozygous mother. Recurrent pregnancy loss (RPL) is defined as three or more consecutive pregnancy losses. The objective was to test the gestational drive theory for the 8.1AH in women with RPL and their live born children. Methodology: We investigated the inheritance of the 8.1AH from 82 heterozygous RPL women to 110 live born children. All participants were genotyped for HLA-A, -B and -DRB1 in DNA from EDTA-treated blood or buccal swaps. Inheritance was compared with a Mendelian inheritance of 50% using a two-sided exact binomial test. Results: We found that 55% of the live born children had inherited the 8.1AH, which was not significantly higher than the expected 50% (P = 0.29). Interestingly, we found a non-significant trend toward a higher inheritance of the 8.1AH in girls, 63%, P = 0.11 as opposed to boys, 50%, P = 1.00. Conclusions and implications: We did not find that the 8.1AH was significantly more often inherited by live born children of 8.1AH heterozygous RPL women. However our data suggest that there may be a sex-specific effect which would be interesting to explore further, both in RPL and in a background population. PMID:26675299
Women's Inheritance Rights and Intergenerational Transmission of Resources in India
ERIC Educational Resources Information Center
Deininger, Klaus; Goyal, Aparajita; Nagarajan, Hari
2013-01-01
We use inheritance patterns over three generations of individuals to assess the impact of changes in the Hindu Succession Act that grant daughters equal coparcenary birth rights in joint family property that were denied to daughters in the past. We show that the amendment significantly increased daughters' likelihood to inherit land, but that…
Shirokawa, Yuka; Shimada, Masakazu
2016-11-16
In cytoplasmic inheritance, structural states of a parent cell could be transmitted to offspring cells via two mechanisms. The first is referred to as the hangover of parent structure, where the structure itself remains and faithfully transmits within offspring cells; the second is structural inheritance, wherein the parent structure functions as a template for development of new offspring structure. We estimated to what extent the parent structure affects the development of offspring structure by structural inheritance, using a clone of the diatom Cyclotella meneghiniana The cell has two siliceous valves (a cell wall part at both cell poles): one is inherited from the parent and the other is newly formed. We estimated cytoplasmic heritability by comparing valve traits (central fultoportulae (CTFP), striae, central area, and cell diameter) of parent and new offspring valves, using single-cell isolation and valve labelling. Parent-offspring valve trait regressions showed that all traits, except CTFP, were significantly correlated. We formulated a quantitative genetic model considering the diatom inheritance system and revealed short-term rapid evolution compared with other inheritance systems. Diatom structural inheritance will have evolved to enable clonal populations to rapidly acquire and maintain suitable structures for temporal changes in environments and life-cycle stages. © 2016 The Author(s).
Fernández, Olga L.; Rodriguez-Pinto, Daniel; Castilho, Tiago M.; Corral Caridad, Maria J.; Goldsmith-Pestana, Karen; Saravia, Nancy Gore; McMahon-Pratt, Diane
2017-01-01
ABSTRACT Infection by Leishmania (Viannia) panamensis, the predominant etiologic agent for cutaneous leishmaniasis in Colombia, is characterized by a chronic mixed inflammatory response. Current treatment options are plagued by toxicity, lengthy treatment regimens, and growing evidence of drug resistance. Immunotherapy, modulating the immune system to mount a protective response, may provide an alternate therapeutic approach. We investigated the ability of the Toll-like receptor 9 (TLR9) ligand CpG to modulate established disease in the L. (V.) panamensis mouse model. Treatment of established infection with a high dose (50 μg) of CpG ameliorated disease and lowered parasite burden. Interestingly, immediately after treatment there was a significant increase in transforming growth factor β (TGF-β) and concomitantly an increase in T regulatory cell (Treg) function. Although a general reduction in cell-mediated immune cytokine and chemokine (gamma interferon [IFN-γ], interleukin 10 [IL-10], IL-13, IL-6, granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-4, and MIP-1α) responses of the treated mice was observed, certain chemokines (RANTES, monocyte chemoattractant protein 1[MCP-1], and IP-10) were increased. Further, in peripheral blood mononuclear cells (PBMCs) from patients with cutaneous leishmaniasis, CpG treatment similarly exhibited a dose-response effect on the production of IFN-γ, IL-17, IL-10, and IL-13, with reductions observed at higher doses. To further understand the underlying mechanisms and cell populations driving the CpG mediated response, we examined the ex vivo dose effects mediated by the TLR9+ cell populations (dendritic cells, macrophages, and B cells) found to accumulate labeled CpG in vivo. Notably, B cells altered the production of IL-17, IL-13, and IFN-γ, supporting a role for B cells functioning as antigen-presenting cells (APCs) and/or regulatory cells during infection. Interestingly, B cells have been previously
DNA Methylation as a Biomarker for Preeclampsia
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Cindy M.; Ralph, Jody L.; Wright, Michelle L.
Background: Preeclampsia contributes significantly to pregnancy-associated morbidity and mortality as well as future risk of cardiovascular disease in mother and offspring, and preeclampsia in offspring. The lack of reliable methods for early detection limits the opportunities for prevention, diagnosis, and timely treatment. Purpose: The purpose of this study was to explore distinct DNA methylation patterns associated with preeclampsia in both maternal cells and fetal-derived tissue that represent potential biomarkers to predict future preeclampsia and inheritance in children. Method: A convenience sample of nulliparous women (N = 55) in the first trimester of pregnancy was recruited for this prospective study. Genome-widemore » DNA methylation was quantified in first-trimester maternal peripheral white blood cells and placental chorionic tissue from normotensive women and those with preeclampsia (n = 6/group). Results: Late-onset preeclampsia developed in 12.7% of women. Significant differences in DNA methylation were identified in 207 individual linked cytosine and guanine (CpG) sites in maternal white blood cells collected in the first trimester (132 sites with gain and 75 sites with loss of methylation), which were common to approximately 75% of the differentially methylated CpG sites identified in chorionic tissue of fetal origin. Conclusion: This study is the first to identify maternal epigenetic targets and common targets in fetal-derived tissue that represent putative biomarkers for early detection and heritable risk of preeclampsia. Findings may pave the way for diagnosis of preeclampsia prior to its clinical presentation and acute damaging effects, and the potential for prevention of the detrimental long-term sequelae.« less
Agreement Between Aging Parent’s Bequest Intention and Middle-Aged Child’s Inheritance Expectation
Kim, Kyungmin
2013-01-01
Purpose: This study investigated discrepancies in expectations of aging parents and their middle-aged offspring regarding future inheritances. Methods: Data from 327 older parent–adult child dyads were analyzed. Using multilevel models, we examined factors (e.g., economic resources, family characteristics, current support exchanges, and beliefs about family obligation) associated with expectations of inheritance. We also explored patterns of correspondence in expectations over inheritance within dyads and what factors are associated with these patterns. Results: We found a significant generational difference in expectations of inheritance, with children less likely to expect inheritances than parents expected to give. Parent’s income, number of siblings, and support currently given to children were significantly associated with both parents’ and children’s positive expectations of inheritance. The effects of child’s income, support given to parent, and parent’s gender on inheritance expectations differed between parents and children. Compared with discordant dyads (parents intended to leave a bequest, but their child did not expect an inheritance), correspondent dyads (both parents and children expected a bequest) showed higher income of parents and children, more support given to the child, and lower levels of child’s filial obligation. Implications: Although bequest decisions are circumscribed by parent’s financial resources, our findings suggest that they are also a continuation of established patterns of exchanges. Parents and children form their intention or expectation about inheritance based on different factors, leaving open the possibility of misunderstandings between the generations. PMID:23197395
Savio, Andrea J.; Bapat, Bharati
2017-01-01
ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185
Savio, Andrea J; Bapat, Bharati
2017-06-03
The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.
Osteosarcoma inheritance in two families of Scottish deerhounds.
Dillberger, John E; McAtee, Sara Ann
2017-01-01
Osteosarcoma is the most common neoplastic disease in Scottish Deerhounds. For Deerhounds, a 2007 population-based study concluded that a single dominant genetic factor largely governed disease risk. For Greyhounds, Rottweilers, and Irish Wolfhounds, a 2013 genome-wide association study found multiple genetic markers in each breed, with each marker only weakly associated with the disease. We obtained from two breeders the pedigrees, age (if alive) or age at death, and osteosarcoma status for two families of Scottish Deerhounds, designated Cohorts K and T. A dog was considered unaffected only if it was osteosarcoma-free and at least 8.5 years old. We analyzed the data in two ways, by assuming either a single recessive genetic factor or a single dominant genetic factor with high penetrance. Cohort K contained 54 evaluable dogs representing 12 litters. Cohort T contained 56 evaluable dogs representing eight litters. Osteosarcoma seemed clearly heritable in both cohorts; however, having a parent with osteosarcoma raised a pup's risk of developing osteosarcoma to 38% for Cohort K but 78% for Cohort T, suggesting the possibility of different genetic risk factors in each cohort. In Cohort K, osteosarcoma inheritance fit well with a single, recessive, autosomal risk factor, although we could not rule out the possibility of a single dominant risk factor with incomplete penetrance. In Cohort T, inheritance could be explained well by a single, dominant, autosomal risk factor but was inconsistent with recessive expression. Inheritance of osteosarcoma in two Scottish Deerhound families could be explained well by a single genetic risk factor residing on an autosome, consistent with a 2007 report. In one family, inheritance was consistent with dominant expression, as previously reported. In the other family, inheritance fit better with recessive expression, although the possibility of a dominant genetic factor influenced by one or more other genetic factors could not be ruled
KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands
Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J
2012-01-01
CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043
Plate tectonics, damage and inheritance.
Bercovici, David; Ricard, Yanick
2014-04-24
The initiation of plate tectonics on Earth is a critical event in our planet's history. The time lag between the first proto-subduction (about 4 billion years ago) and global tectonics (approximately 3 billion years ago) suggests that plates and plate boundaries became widespread over a period of 1 billion years. The reason for this time lag is unknown but fundamental to understanding the origin of plate tectonics. Here we suggest that when sufficient lithospheric damage (which promotes shear localization and long-lived weak zones) combines with transient mantle flow and migrating proto-subduction, it leads to the accumulation of weak plate boundaries and eventually to fully formed tectonic plates driven by subduction alone. We simulate this process using a grain evolution and damage mechanism with a composite rheology (which is compatible with field and laboratory observations of polycrystalline rocks), coupled to an idealized model of pressure-driven lithospheric flow in which a low-pressure zone is equivalent to the suction of convective downwellings. In the simplest case, for Earth-like conditions, a few successive rotations of the driving pressure field yield relic damaged weak zones that are inherited by the lithospheric flow to form a nearly perfect plate, with passive spreading and strike-slip margins that persist and localize further, even though flow is driven only by subduction. But for hotter surface conditions, such as those on Venus, accumulation and inheritance of damage is negligible; hence only subduction zones survive and plate tectonics does not spread, which corresponds to observations. After plates have developed, continued changes in driving forces, combined with inherited damage and weak zones, promote increased tectonic complexity, such as oblique subduction, strike-slip boundaries that are subparallel to plate motion, and spalling of minor plates.
The CpG island methylator phenotype (CIMP) in colorectal cancer.
Nazemalhosseini Mojarad, Ehsan; Kuppen, Peter Jk; Aghdaei, Hamid Asadzadeh; Zali, Mohammad Reza
2013-01-01
It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer.
Neo-sex chromosome inheritance across species in Silene hybrids.
Weingartner, L A; Delph, L F
2014-07-01
Neo-sex chromosomes, which form through the major restructuring of ancestral sex chromosome systems, have evolved in various taxa. Such restructuring often consists of the fusion of an autosome to an existing sex chromosome, resulting in novel sex chromosome formations (e.g. X1X2Y or XY1Y2.). Comparative studies are often made between restructured sex chromosome systems of closely related species, and here we evaluate the consequences of variable sex chromosome systems to hybrids. If neo-sex chromosomes are improperly inherited across species, this could lead to aberrant development and reproductive isolation. In this study, we examine the fate of neo-sex chromosomes in hybrids of the flowering plants Silene diclinis and Silene latifolia. Silene diclinis has a neo-sex chromosome system (XY1Y2) that is thought to have evolved from an ancestral XY system that is still present in S. latifolia. These species do not hybridize naturally, and improper sex chromosome inheritance could contribute to reproductive isolation. We investigated whether this major restructuring of sex chromosomes prevents their proper inheritance in a variety of hybrid crosses, including some F2 - and later-generation hybrids, with sex chromosome-linked, species-specific, polymorphic markers and chromosome squashes. We discovered that despite the differences in sex chromosomes that exist between these two species, proper segregation had occurred in hybrids that made it to flowering, including later-generation hybrids, indicating that neo-sex chromosome formation alone does not result in complete reproductive isolation between these two species. Additionally, hybrids with aberrant sex expression (e.g. neuter, hermaphrodite) also inherited the restructured sex chromosomes properly, highlighting that issues with sexual development in hybrids can be caused by intrinsic genetic incompatibility rather than improper sex chromosome inheritance. © 2014 The Authors. Journal of Evolutionary Biology © 2014
Ye, Christine J; Regan, Sarah; Liu, Guo; Alemara, Sarah; Heng, Henry H
2018-01-01
In the past 15 years, impressive progress has been made to understand the molecular mechanism behind aneuploidy, largely due to the effort of using various -omics approaches to study model systems (e.g. yeast and mouse models) and patient samples, as well as the new realization that chromosome alteration-mediated genome instability plays the key role in cancer. As the molecular characterization of the causes and effects of aneuploidy progresses, the search for the general mechanism of how aneuploidy contributes to cancer becomes increasingly challenging: since aneuploidy can be linked to diverse molecular pathways (in regards to both cause and effect), the chances of it being cancerous is highly context-dependent, making it more difficult to study than individual molecular mechanisms. When so many genomic and environmental factors can be linked to aneuploidy, and most of them not commonly shared among patients, the practical value of characterizing additional genetic/epigenetic factors contributing to aneuploidy decreases. Based on the fact that cancer typically represents a complex adaptive system, where there is no linear relationship between lower-level agents (such as each individual gene mutation) and emergent properties (such as cancer phenotypes), we call for a new strategy based on the evolutionary mechanism of aneuploidy in cancer, rather than continuous analysis of various individual molecular mechanisms. To illustrate our viewpoint, we have briefly reviewed both the progress and challenges in this field, suggesting the incorporation of an evolutionary-based mechanism to unify diverse molecular mechanisms. To further clarify this rationale, we will discuss some key concepts of the genome theory of cancer evolution, including system inheritance, fuzzy inheritance, and cancer as a newly emergent cellular system. Illustrating how aneuploidy impacts system inheritance, fuzzy inheritance and the emergence of new systems is of great importance. Such synthesis
Fractional populations in sex-linked inheritance
NASA Astrophysics Data System (ADS)
Pyo Lee, Seung; Chung, Myung-Hoon; Koo Kim, Chul; Nahm, Kyun
2001-03-01
We study the fractional populations in chromosome inherited diseases. The governing equations for the fractional populations are found and solved in the presence of mutation and selection. The physical fixed points obtained are used to discuss the cases of color blindness and hemophilia.
Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior
2011-09-23
Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.
Inherited Congenital Cataract: A Guide to Suspect the Genetic Etiology in the Cataract Genesis
Messina-Baas, Olga; Cuevas-Covarrubias, Sergio A.
2017-01-01
Cataracts are the principal cause of treatable blindness worldwide. Inherited congenital cataract (CC) shows all types of inheritance patterns in a syndromic and nonsyndromic form. There are more than 100 genes associated with cataract with a predominance of autosomal dominant inheritance. A cataract is defined as an opacity of the lens producing a variation of the refractive index of the lens. This variation derives from modifications in the lens structure resulting in light scattering, frequently a consequence of a significant concentration of high-molecular-weight protein aggregates. The aim of this review is to introduce a guide to identify the gene involved in inherited CC. Due to the manifold clinical and genetic heterogeneity, we discarded the cataract phenotype as a cardinal sign; a 4-group classification with the genes implicated in inherited CC is proposed. We consider that this classification will assist in identifying the probable gene involved in inherited CC. PMID:28611546
Inherited Mitochondrial Diseases of DNA Replication
Copeland, William C.
2007-01-01
Mitochondrial genetic diseases can result from defects in mitochondrial DNA (mtDNA) in the form of deletions, point mutations, or depletion, which ultimately cause loss of oxidative phosphorylation. These mutations may be spontaneous, maternally inherited, or a result of inherited nuclear defects in genes that maintain mtDNA. This review focuses on our current understanding of nuclear gene mutations that produce mtDNA alterations and cause mitochondrial depletion syndrome (MDS), progressive external ophthalmoplegia (PEO), ataxia-neuropathy, or mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). To date, all of these etiologic nuclear genes fall into one of two categories: genes whose products function directly at the mtDNA replication fork, such as POLG, POLG2, and TWINKLE, or genes whose products supply the mitochondria with deoxynucleotide triphosphate pools needed for DNA replication, such as TK2, DGUOK, TP, SUCLA2, ANT1, and possibly the newly identified MPV17. PMID:17892433
Polydactyly in Development, Inheritance, and Evolution.
Lange, Axel; Müller, Gerd B
2017-03-01
The occurrence of supernumerary digits or toes in humans and other tetrapods has attracted general interest since antiquity and later influenced scientific theories of development, inheritance, and evolution. Seventeenth-century genealogical studies of polydactyly were at the beginning of an understanding of the rules of inheritance. Features of polydactyly were also part of the classical disputes on the nature of development, including the preformation-versus-epigenesis and the atavism-versus-malformation debates. In the evolutionary domain, polydactyly was used in the criticism of the gradualist account of variation underlying Darwin’s theory. Today, extra digit formation plays a role in the conceptualization of gene regulation and pattern formation in vertebrate limb evolution. Recent genetic, experimental, and modeling accounts of extra digit formation highlight the existence of nongradual transitions in phenotypic states, suggesting a distinction between continuous and discontinuous variation in evolution. Unless otherwise noted, all translations are our own.
Prélaud, Ana Rostaher; Fuchs, Sebastian; Weber, Karin; Winter, Gerhard; Coester, Conrad; Mueller, Ralf S
2013-10-01
Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides offer a novel promising immunotherapeutic approach for atopic dermatitis (AD) both in humans and animals. Gelatin nanoparticles (GNP) enhance and prolong CpG-associated immunomodulatory effects and minimize adverse effects both in vitro and in vivo. Information about the effects of this combination in dogs is lacking. The aim of this study was to evaluate immunological effects of CpG coupled to GNP on canine peripheral blood mononuclear cells (PBMCs) in vitro. Eight dogs with AD, diagnosed by standard criteria and with a concurrent immediate hypersensitivity to house dust mites were included. Control samples were taken from eight healthy, age-matched control dogs without history or evidence of cutaneous or systemic illness. Peripheral blood mononuclear cells of healthy and allergic dogs were incubated with CpG-GNP and the uptake of CpG-GNP was demonstrated using confocal laser scanning microscopy. Cell culture supernatant concentrations of interferon gamma (IFN-γ), interleukin (IL)-4, IL-6 and IL-10 were measured by Canine Cytokine Milliplex. No significant changes in IFN-γ and IL-4 were found when comparing PBMCs incubated with CpG and CpG-GNP with the negative controls in atopic and healthy dogs. Interleukin-6 was not detected in any of the groups. However, a statistically significant increase in IL-10 concentration was found after 24 h stimulation with CpG-GNP compared with CpG alone both in atopic and healthy dogs. As IL-10 is considered an immunosuppressive cytokine playing a key role in peripheral tolerance; the reported CpG-GNP formulation could be a new approach in allergy treatment. © 2013 ESVD and ACVD.
A second inheritance system: the extension of biology through culture.
Whiten, Andrew
2017-10-06
By the mid-twentieth century (thus following the 'Modern Synthesis' in evolutionary biology), the behavioural sciences offered only the sketchy beginnings of a scientific literature documenting evidence for cultural inheritance in animals-the transmission of traditional behaviours via learning from others (social learning). By contrast, recent decades have seen a massive growth in the documentation of such cultural phenomena, driven by long-term field studies and complementary laboratory experiments. Here, I review the burgeoning scope of discoveries in this field, which increasingly suggest that this 'second inheritance system', built on the shoulders of the primary genetic inheritance system, occurs widely among vertebrates and possibly in invertebrates too. Its novel characteristics suggest significant implications for our understanding of evolutionary biology. I assess the extent to which this second system extends the scope of evolution, both by echoing principal properties of the primary, organic evolutionary system, and going beyond it in significant ways. This is well established in human cultural evolution; here, I address animal cultures more generally. The further major, and related, question concerns the extent to which the consequences of widespread animal cultural transmission interact with the primary, genetically based inheritance systems, shaping organic evolution.
Inheritance of Febrile Seizures in Sudden Unexplained Death in Toddlers
Holm, Ingrid A.; Poduri, Annapurna; Crandall, Laura; Haas, Elisabeth; Grafe, Marjorie R.; Kinney, Hannah C.; Krous, Henry F.
2014-01-01
Sudden unexplained death in toddlers has been associated with febrile seizures, family history of febrile seizures, and hippocampal anomalies. We investigated the mode of inheritance for febrile seizures in these families. A three-generation pedigree was obtained from families enrolled in the San Diego Sudden Unexplained Death in Childhood Research Project, involving toddlers with sudden unexplained death, febrile seizures, and family history of febrile seizures. In our six cases, death was unwitnessed and related to sleep. The interval from last witnessed febrile seizure to death ranged from 3 weeks to 6 months. Hippocampal abnormalities were identified in one of three cases with available autopsy sections. Autosomal dominant inheritance of febrile seizures was observed in three families. A fourth demonstrated autosomal dominant inheritance with incomplete penetrance or variable expressivity. In two families, the maternal and paternal sides manifested febrile seizures. In this series, the major pattern of inheritance in toddlers with sudden unexplained death and febrile seizures was autosomal dominant. Future studies should develop markers (including genetic) to identify which patients with febrile seizures are at risk for sudden unexplained death in childhood, and to provide guidance for families and physicians. PMID:22490769
Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt
2014-11-07
We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.
Ekenstedt, Kari J; Oberbauer, Anita M
2013-05-01
Epilepsy is the most common neurologic disease in dogs and many forms are considered to have a genetic basis. In contrast, some seizure disorders are also heritable, but are not technically defined as epilepsy. Investigation of true canine epilepsies has uncovered genetic associations in some cases, however, many remain unexplained. Gene mutations have been described for 2 forms of canine epilepsy: primary epilepsy (PE) and progressive myoclonic epilepsies. To date, 9 genes have been described to underlie progressive myoclonic epilepsies in several dog breeds. Investigations into genetic PE have been less successful, with only 1 causative gene described. Genetic testing as an aid to diagnosis, prognosis, and breeding decisions is available for these 10 forms. Additional studies utilizing genome-wide tools have identified PE loci of interest; however, specific genetic tests are not yet developed. Many studies of dog breeds with PE have failed to identify genes or loci of interest, suggesting that, similar to what is seen in many human genetic epilepsies, inheritance is likely complex, involving several or many genes, and reflective of environmental interactions. An individual dog's response to therapeutic intervention for epilepsy may also be genetically complex. Although the field of inherited epilepsy has faced challenges, particularly with PE, newer technologies contribute to further advances. © 2013 Elsevier Inc. All rights reserved.
Ancient origin and maternal inheritance of blue cuckoo eggs.
Fossøy, Frode; Sorenson, Michael D; Liang, Wei; Ekrem, Torbjørn; Moksnes, Arne; Møller, Anders P; Rutila, Jarkko; Røskaft, Eivin; Takasu, Fugo; Yang, Canchao; Stokke, Bård G
2016-01-12
Maternal inheritance via the female-specific W chromosome was long ago proposed as a potential solution to the evolutionary enigma of co-existing host-specific races (or 'gentes') in avian brood parasites. Here we report the first unambiguous evidence for maternal inheritance of egg colouration in the brood-parasitic common cuckoo Cuculus canorus. Females laying blue eggs belong to an ancient (∼2.6 Myr) maternal lineage, as evidenced by both mitochondrial and W-linked DNA, but are indistinguishable at nuclear DNA from other common cuckoos. Hence, cuckoo host races with blue eggs are distinguished only by maternally inherited components of the genome, which maintain host-specific adaptation despite interbreeding among males and females reared by different hosts. A mitochondrial phylogeny suggests that blue eggs originated in Asia and then expanded westwards as female cuckoos laying blue eggs interbred with the existing European population, introducing an adaptive trait that expanded the range of potential hosts.
Clinical Characteristics and Current Therapies for Inherited Retinal Degenerations
Sahel, José-Alain; Marazova, Katia; Audo, Isabelle
2015-01-01
Inherited retinal degenerations (IRDs) encompass a large group of clinically and genetically heterogeneous diseases that affect approximately 1 in 3000 people (>2 million people worldwide) (Bessant DA, Ali RR, Bhattacharya SS. 2001. Molecular genetics and prospects for therapy of the inherited retinal dystrophies. Curr Opin Genet Dev 11: 307–316.). IRDs may be inherited as Mendelian traits or through mitochondrial DNA, and may affect the entire retina (e.g., rod–cone dystrophy, also known as retinitis pigmentosa, cone dystrophy, cone–rod dystrophy, choroideremia, Usher syndrome, and Bardet-Bidel syndrome) or be restricted to the macula (e.g., Stargardt disease, Best disease, and Sorsby fundus dystrophy), ultimately leading to blindness. IRDs are a major cause of severe vision loss, with profound impact on patients and society. Although IRDs remain untreatable today, significant progress toward therapeutic strategies for IRDs has marked the past two decades. This progress has been based on better understanding of the pathophysiological pathways of these diseases and on technological advances. PMID:25324231
Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua; Yan, Liying; Meyer, Ann; Oler, Andrew J; Chung, Charles C; Wang, Zhaoming; Yeager, Meredith; Amundadottir, Laufey; Berndt, Sonja I
2014-12-01
Chromosome 8q24 has emerged as an important region for genetic susceptibility to various cancers, but little is known about the contribution of DNA methylation at 8q24. To evaluate variability in DNA methylation levels at 8q24 and the relationship with cancer susceptibility single nucleotide polymorphisms (SNPs) in this region, we quantified DNA methylation levels in peripheral blood at 145 CpG sites nearby 8q24 cancer susceptibility SNPs or MYC using pyrosequencing among 80 Caucasian men in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. For the 60 CpG sites meeting quality control, which also demonstrated temporal stability over a 5-year period, we calculated pairwise Spearman correlations for DNA methylation levels at each CpG site with 42 8q24 cancer susceptibility SNPs. To account for multiple testing, we adjusted P values into q values reflecting the false discovery rate (FDR). In contrast to the MYC CpG sites, most sites nearby the SNPs demonstrated good reproducibility, high methylation levels, and moderate-high between-individual variation. We observed 10 statistically significant (FDR < 0.05) CpG site-SNP correlations. These included correlations between an intergenic CpG site at Chr8:128393157 and the prostate cancer SNP rs16902094 (ρ = -0.54; P = 9.7 × 10(-7); q = 0.002), a PRNCR1 CpG site at Chr8:128167809 and the prostate cancer SNP rs1456315 (ρ = 0.52; P = 1.4 × 10(-6); q = 0.002), and two POU5F1B CpG sites and several prostate/colorectal cancer SNPs (for Chr8:128498051 and rs6983267, ρ = 0.46; P = 2.0 × 10(-5); q = 0.01). This is the first report of correlations between blood DNA methylation levels and cancer susceptibility SNPs at 8q24, suggesting that DNA methylation at this important susceptibility locus may contribute to cancer risk. ©2014 American Association for Cancer Research.
17 CFR 240.16b-5 - Bona fide gifts and inheritance.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Bona fide gifts and inheritance. 240.16b-5 Section 240.16b-5 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... gifts and inheritance. Both the acquisition and the disposition of equity securities shall be exempt...
MET-2-Dependent H3K9 Methylation Suppresses Transgenerational Small RNA Inheritance.
Lev, Itamar; Seroussi, Uri; Gingold, Hila; Bril, Roberta; Anava, Sarit; Rechavi, Oded
2017-04-24
In C. elegans, alterations to chromatin produce transgenerational effects, such as inherited increase in lifespan and gradual loss of fertility. Inheritance of histone modifications can be induced by double-stranded RNA-derived heritable small RNAs. Here, we show that the mortal germline phenotype, which is typical of met-2 mutants, defective in H3K9 methylation, depends on HRDE-1, an argonaute that carries small RNAs across generations, and is accompanied by accumulated transgenerational misexpression of heritable small RNAs. We discovered that MET-2 inhibits small RNA inheritance, and, as a consequence, induction of RNAi in met-2 mutants leads to permanent RNAi responses that do not terminate even after more than 30 generations. We found that potentiation of heritable RNAi in met-2 animals results from global hyperactivation of the small RNA inheritance machinery. Thus, changes in histone modifications can give rise to drastic transgenerational epigenetic effects, by controlling the overall potency of small RNA inheritance. Copyright © 2017 Elsevier Ltd. All rights reserved.
Network-based analysis of genotype-phenotype correlations between different inheritance modes.
Hao, Dapeng; Li, Chuanxing; Zhang, Shaojun; Lu, Jianping; Jiang, Yongshuai; Wang, Shiyuan; Zhou, Meng
2014-11-15
Recent studies on human disease have revealed that aberrant interaction between proteins probably underlies a substantial number of human genetic diseases. This suggests a need to investigate disease inheritance mode using interaction, and based on which to refresh our conceptual understanding of a series of properties regarding inheritance mode of human disease. We observed a strong correlation between the number of protein interactions and the likelihood of a gene causing any dominant diseases or multiple dominant diseases, whereas no correlation was observed between protein interaction and the likelihood of a gene causing recessive diseases. We found that dominant diseases are more likely to be associated with disruption of important interactions. These suggest inheritance mode should be understood using protein interaction. We therefore reviewed the previous studies and refined an interaction model of inheritance mode, and then confirmed that this model is largely reasonable using new evidences. With these findings, we found that the inheritance mode of human genetic diseases can be predicted using protein interaction. By integrating the systems biology perspectives with the classical disease genetics paradigm, our study provides some new insights into genotype-phenotype correlations. haodapeng@ems.hrbmu.edu.cn or biofomeng@hotmail.com Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Orogenic structural inheritance and rifted passive margin formation
NASA Astrophysics Data System (ADS)
Salazar Mora, Claudio A.; Huismans, Ritske S.
2016-04-01
Structural inheritance is related to mechanical weaknesses in the lithosphere due to previous tectonic events, e.g. rifting, subduction and collision. The North and South Atlantic rifted passive margins that formed during the breakup of Western Gondwana, are parallel to the older Caledonide and the Brasiliano-Pan-African orogenic belts. In the South Atlantic, 'old' mantle lithospheric fabric resulting from crystallographic preferred orientation of olivine is suggested to play a role during rifted margin formation (Tommasi and Vauchez, 2001). Magnetometric and gravimetric mapping of onshore structures in the Camamu and Almada basins suggest that extensional faults are controlled by two different directions of inherited older Brasiliano structures in the upper lithosphere (Ferreira et al., 2009). In the South Atlantic Campos Basin, 3D seismic data indicate that inherited basement structures provide a first order control on basin structure (Fetter, 2009). Here we investigate the role of structural inheritance on the formation of rifted passive margins with high-resolution 2D thermo-mechanical numerical experiments. The numerical domain is 1200 km long and 600 km deep and represents the lithosphere and the sublithospheric mantle. Model experiments were carried out by creating self-consistent orogenic inheritance where a first phase of orogen formation is followed by extension. We focus in particular on the role of varying amount of orogenic shortening, crustal rheology, contrasting styles of orogen formation on rifted margin style, and the time delay between orogeny and subsequent rifted passive formation. Model results are compared to contrasting structural styles of rifted passive margin formation as observed in the South Atlantic. Ferreira, T.S., Caixeta, J.M., Lima, F.D., 2009. Basement control in Camamu and Almada rift basins. Boletim de Geociências da Petrobrás 17, 69-88. Fetter, M., 2009. The role of basement tectonic reactivation on the structural evolution
CpG Island Methylation in Colorectal Cancer: Past, Present and Future
Curtin, Karen; Slattery, Martha L.; Samowitz, Wade S.
2011-01-01
The concept of a CpG island methylator phenotype, or CIMP, quickly became the focus of several colorectal cancer studies describing its clinical and pathological features after its introduction in 1999 by Toyota and colleagues. Further characterization of CIMP in tumors lead to widespread acceptance of the concept, as expressed by Shen and Issa in their 2005 editorial, “CIMP, at last.” Since that time, extensive research efforts have brought great insights into the epidemiology and prognosis of CIMP+ tumors and other epigenetic mechanisms underlying tumorigenesis. With the advances in technology and subsequent cataloging of the human methylome in cancer and normal tissue, new directions in research to understand CIMP and its role in complex biological systems yield hope for future epigenetically based diagnostics and treatments. PMID:21559209
The CpG island methylator phenotype (CIMP) in colorectal cancer
Mojarad, Ehsan Nazemalhosseini; Kuppen, Peter JK; Aghdaei, Hamid Asadzadeh
2013-01-01
It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer. PMID:24834258
Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C
2015-01-01
Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Analysis of Rules for Islamic Inheritance Law in Indonesia Using Hybrid Rule Based Learning
NASA Astrophysics Data System (ADS)
Khosyi'ah, S.; Irfan, M.; Maylawati, D. S.; Mukhlas, O. S.
2018-01-01
Along with the development of human civilization in Indonesia, the changes and reform of Islamic inheritance law so as to conform to the conditions and culture cannot be denied. The distribution of inheritance in Indonesia can be done automatically by storing the rule of Islamic inheritance law in the expert system. In this study, we analyze the knowledge of experts in Islamic inheritance in Indonesia and represent it in the form of rules using rule-based Forward Chaining (FC) and Davis-Putman-Logemann-Loveland (DPLL) algorithms. By hybridizing FC and DPLL algorithms, the rules of Islamic inheritance law in Indonesia are clearly defined and measured. The rules were conceptually validated by some experts in Islamic laws and informatics. The results revealed that generally all rules were ready for use in an expert system.
Association between folate levels and CpG island hypermethylation in normal colorectal mucosa
Wallace, Kristin; Grau, Maria V.; Levine, Joan A.; Shen, Lanlan; Hamdan, Randala; Chen, Xinli; Gui, Jiang; Haile, Robert W.; Barry, Elizabeth L.; Ahnen, Dennis; McKeown-Eyssen, Gail; Baron, John A.; Issa, Jean Pierre J.
2010-01-01
Background Gene-specific promoter methylation of several genes occurs in aging normal tissues and may predispose to tumorigenesis. In the present study, we investigate the association among blood folate levels, and dietary and lifestyle factors with CpG island methylation in normal colorectal mucosa. Methods Subjects were enrolled in a multi-center chemoprevention trial of aspirin or folic acid for the prevention of large bowel adenomas. We collected 1000 biopsies from 389 patients, 501 samples from the right colon and 499 from the rectum at the follow-up colonoscopy. We measured DNA methylation of estrogen receptor alpha (ERα) and secreted frizzled related protein-1 (SFRP1) using bisulfite pyrosequencing. We used Generalized Estimating Equations regression analysis to examine the association between methylation and selected variables. Results For both ERα and SFRP1, percent methylation was significantly higher in the rectum compared to the right colon (p = 0.001). For each 10 years of age, we observed a 1.7 % increase in methylation level for ERα and a 2.9 % increase for SFRP1 (P < 0.0001). African Americans had a significantly lower level of ERα and SFRP1 methylation compared to Caucasians and Hispanics. Higher RBC folate levels were associated with higher levels of both ERα (p=0.03) and SFRP1 methylation (p=0.01). Conclusions Our results suggest that CpG island methylation in normal colorectal mucosa is related to advancing age, race, rectal location, and RBC folate levels. These data have important implications regarding the safety of supplementary folate administration in healthy adults given the hypothesis that methylation in normal mucosa may predispose to colorectal neoplasia. PMID:21149331
Ouko, Lillian A; Shantikumar, Katpaham; Knezovich, Jaysen; Haycock, Philip; Schnugh, Desmond J; Ramsay, Michèle
2009-09-01
Exposure to alcohol in utero is the main attributable cause of fetal alcohol spectrum disorders (FASD) which in its most severe form is characterized by irreversible behavioral and cognitive disability. Paternal preconception drinking is not considered to be a significant risk factor, even though animal studies have demonstrated that chronic paternal alcohol consumption has a detrimental effect on the physical and mental development of offspring even in the absence of in utero alcohol exposure. It has been documented that alcohol can reduce the levels and activity of DNA methyltransferases resulting in DNA hypomethylation and that reduced methyltransferase activity can cause activation of normally silenced genes. The aim of this study was to establish a link between alcohol use in men and hypomethylation of paternally imprinted loci in sperm DNA in genomic regions critical for embryonic development, thus providing a mechanism for paternal effects in the aetiology of FASD. Sperm DNA from male volunteers was bisulfite treated and the methylation patterns of 2 differentially methylated regions (DMRs), H19 and IG-DMR, analyzed following sequencing of individual clones. The methylation patterns were correlated with the alcohol consumption levels of the volunteer males. There was a pattern of increased demethylation with alcohol consumption at the 2 imprinted loci with a significant difference observed at the IG-DMR between the nondrinking and heavy alcohol consuming groups. Greater inter-individual variation in average methylation was observed at the H19 DMR and individual clones were more extensively demethylated than those of the IG-DMR. CpG site #4 in the IG-DMR was preferentially demethylated among all individuals and along with the H19 DMR CpG site #7 located within the CTCF binding site 6 showed significant demethylation in the alcohol consuming groups compared with the control group. This study demonstrates a correlation between chronic alcohol use and
Inheritable and sporadic non-autoimmune hyperthyroidism.
Ferraz, Carolina; Paschke, Ralf
2017-03-01
Hyperthyroidism is a clinical state that results from high thyroid hormone levels which has multiple etiologies, manifestations, and potential therapies. Excluding the autoimmune Graves disease, autonomic adenomas account for the most import cause of non-autoimmune hyperthyroidism. Activating germline mutations of the TSH receptor are rare etiologies for hyperthyroidism. They can be inherited in an autosomal dominant manner (familial or hereditary, FNAH), or may occur sporadically as a de novo condition, also called: persistent sporadic congenital non-autoimmune hyperthyroidism (PSNAH). These three conditions: autonomic adenoma, FNAH and PSNAH constitute the inheritable and sporadic non-autoimmune hyperthyroidism. Particularities in epidemiology, etiology, molecular and clinical aspects of these three entities will be discussed in this review in order to guide to an accurate diagnosis allowing among others genetic counseling and presymptomatic diagnosis for the affected families. The optimal treatment based on the right diagnosis will avoid consequences of a persistent or relapsing hyperthyroidism. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.
Online Mendelian Inheritance in Man (OMIM).
Hamosh, A; Scott, A F; Amberger, J; Valle, D; McKusick, V A
2000-01-01
Online Mendelian Inheritance In Man (OMIM) is a public database of bibliographic information about human genes and genetic disorders. Begun by Dr. Victor McKusick as the authoritative reference Mendelian Inheritance in Man, it is now distributed electronically by the National Center for Biotechnology Information (NCBI). Material in OMIM is derived from the biomedical literature and is written by Dr. McKusick and his colleagues at Johns Hopkins University and elsewhere. Each OMIM entry has a full text summary of a genetic phenotype and/or gene and has copious links to other genetic resources such as DNA and protein sequence, PubMed references, mutation databases, approved gene nomenclature, and more. In addition, NCBI's neighboring feature allows users to identify related articles from PubMed selected on the basis of key words in the OMIM entry. Through its many features, OMIM is increasingly becoming a major gateway for clinicians, students, and basic researchers to the ever-growing literature and resources of human genetics. Copyright 2000 Wiley-Liss, Inc.
Environmentally Induced Epigenetic Transgenerational Inheritance of Disease Susceptibility
Nilsson, Eric E.; Skinner, Michael K.
2014-01-01
Environmental insults, such as exposure to toxicants or nutritional abnormalities, can lead to epigenetic changes that are in turn related to increased susceptibility to disease. The focus of this review is on the transgenerational inheritance of such epigenetic abnormalities (epimutations), and how it is that these inherited epigenetic abnormalities can lead to increased disease susceptibility, even in the absence of continued environmental insult. Observations of environmental toxicant specificity and exposure specific disease susceptibility are discussed. How epimutations are transmitted across generations and how epigenetic changes in the germline are translated into an increased disease susceptibility in the adult is reviewed in regards to disease etiology. PMID:24657180
Kandimalla, Ekambar R; Bhagat, Lakshmi; Zhu, Fu-Gang; Yu, Dong; Cong, Yan-Ping; Wang, Daqing; Tang, Jimmy X; Tang, Jin-Yan; Knetter, Cathrine F; Lien, Egil; Agrawal, Sudhir
2003-11-25
Bacterial and synthetic DNAs containing CpG dinucleotides in specific sequence contexts activate the vertebrate immune system through Toll-like receptor 9 (TLR9). In the present study, we used a synthetic nucleoside with a bicyclic heterobase [1-(2'-deoxy-beta-d-ribofuranosyl)-2-oxo-7-deaza-8-methyl-purine; R] to replace the C in CpG, resulting in an RpG dinucleotide. The RpG dinucleotide was incorporated in mouse- and human-specific motifs in oligodeoxynucleotides (oligos) and 3'-3-linked oligos, referred to as immunomers. Oligos containing the RpG motif induced cytokine secretion in mouse spleen-cell cultures. Immunomers containing RpG dinucleotides showed activity in transfected-HEK293 cells stably expressing mouse TLR9, suggesting direct involvement of TLR9 in the recognition of RpG motif. In J774 macrophages, RpG motifs activated NF-kappa B and mitogen-activated protein kinase pathways. Immunomers containing the RpG dinucleotide induced high levels of IL-12 and IFN-gamma, but lower IL-6 in time- and concentration-dependent fashion in mouse spleen-cell cultures costimulated with IL-2. Importantly, immunomers containing GTRGTT and GARGTT motifs were recognized to a similar extent by both mouse and human immune systems. Additionally, both mouse- and human-specific RpG immunomers potently stimulated proliferation of peripheral blood mononuclear cells obtained from diverse vertebrate species, including monkey, pig, horse, sheep, goat, rat, and chicken. An immunomer containing GTRGTT motif prevented conalbumin-induced and ragweed allergen-induced allergic inflammation in mice. We show that a synthetic bicyclic nucleotide is recognized in the C position of a CpG dinucleotide by immune cells from diverse vertebrate species without bias for flanking sequences, suggesting a divergent nucleotide motif recognition pattern of TLR9.
Qi, Xu-Feng; Zheng, Li; Kim, Cheol-Su; Lee, Kyu-Jae; Kim, Dong-Heui; Cai, Dong-Qing; Qin, Jun-Wen; Yu, Yan-Hong; Wu, Zheng; Kim, Soo-Ki
2013-07-01
Recent studies have suggested that the anti-cancer activity of CpG-oligodeoxynucleotides (CpG-ODNs) is owing to their immunomodulatory effects in tumor-bearing host. The purpose of this study is to investigate the directly cytotoxic activity of KSK-CpG, a novel CpG-ODN with an alternative CpG motif, against A20 and EL4 lymphoma cells in comparison with previously used murine CpG motif (1826-CpG). To evaluate the potential cytotoxic effects of KSK-CpG on lymphoma cells, cell viability assay, confocal microscopy, flow cytometry, DNA fragmentation, Western blotting, and reverse transcription-polymerase chain reaction (RT-PCR) analysis were used. We found that KSK-CpG induced direct cytotoxicity in A20 lymphoma cells, but not in EL4 lymphoma cells, at least in part via TLR9-mediated pathways. Apoptotic cell death was demonstrated to play an important role in CpG-ODNs-induced cytotoxicity. In addition, both mitochondrial membrane potential decrease and G1-phase arrest were involved in KSK-CpG-induced apoptosis in A20 cells. The activities of apoptotic molecules such as caspase-3, PARP, and Bax were increased, but the activation of p27 Kip1 and ERK were decreased in KSK-CpG-treated A20 cells. Furthermore, autocrine IFN-γ partially contributed to apoptotic cell death in KSK-CpG-treated A20 cells. Collectively, our findings suggest that KSK-CpG induces apoptotic cell death in A20 lymphoma cells at least in part by inducing G1-phase arrest and autocrine IFN-γ via increasing TLR9 expression, without the need for immune system of tumor-bearing host. This new understanding supports the development of TLR9-targeted therapy with CpG-ODN as a direct therapeutic agent for treating B lymphoma. Copyright © 2013 Elsevier Ltd. All rights reserved.
Shin, Junha; Lee, Insuk
2015-01-01
Phylogenetic profiling, a network inference method based on gene inheritance profiles, has been widely used to construct functional gene networks in microbes. However, its utility for network inference in higher eukaryotes has been limited. An improved algorithm with an in-depth understanding of pathway evolution may overcome this limitation. In this study, we investigated the effects of taxonomic structures on co-inheritance analysis using 2,144 reference species in four query species: Escherichia coli, Saccharomyces cerevisiae, Arabidopsis thaliana, and Homo sapiens. We observed three clusters of reference species based on a principal component analysis of the phylogenetic profiles, which correspond to the three domains of life—Archaea, Bacteria, and Eukaryota—suggesting that pathways inherit primarily within specific domains or lower-ranked taxonomic groups during speciation. Hence, the co-inheritance pattern within a taxonomic group may be eroded by confounding inheritance patterns from irrelevant taxonomic groups. We demonstrated that co-inheritance analysis within domains substantially improved network inference not only in microbe species but also in the higher eukaryotes, including humans. Although we observed two sub-domain clusters of reference species within Eukaryota, co-inheritance analysis within these sub-domain taxonomic groups only marginally improved network inference. Therefore, we conclude that co-inheritance analysis within domains is the optimal approach to network inference with the given reference species. The construction of a series of human gene networks with increasing sample sizes of the reference species for each domain revealed that the size of the high-accuracy networks increased as additional reference species genomes were included, suggesting that within-domain co-inheritance analysis will continue to expand human gene networks as genomes of additional species are sequenced. Taken together, we propose that co-inheritance
Diede, Scott J; Yao, Zizhen; Keyes, C Chip; Tyler, Ashlee E; Dey, Joyoti; Hackett, Christopher S; Elsaesser, Katrina; Kemp, Christopher J; Neiman, Paul E; Weiss, William A; Olson, James M; Tapscott, Stephen J
2013-12-01
Genetic and epigenetic alterations are essential for the initiation and progression of human cancer. We previously reported that primary human medulloblastomas showed extensive cancer-specific CpG island DNA hypermethylation in critical developmental pathways. To determine whether genetically engineered mouse models (GEMMs) of medulloblastoma have comparable epigenetic changes, we assessed genome-wide DNA methylation in three mouse models of medulloblastoma. In contrast to human samples, very few loci with cancer-specific DNA hypermethylation were detected, and in almost all cases the degree of methylation was relatively modest compared with the dense hypermethylation in the human cancers. To determine if this finding was common to other GEMMs, we examined a Burkitt lymphoma and breast cancer model and did not detect promoter CpG island DNA hypermethylation, suggesting that human cancers and at least some GEMMs are fundamentally different with respect to this epigenetic modification. These findings provide an opportunity to both better understand the mechanism of aberrant DNA methylation in human cancer and construct better GEMMs to serve as preclinical platforms for therapy development.
Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon
2017-01-01
The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway. PMID:27885175
Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon
2017-01-15
The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway.
Muscular MRI-based algorithm to differentiate inherited myopathies presenting with spinal rigidity.
Tordjman, Mickael; Dabaj, Ivana; Laforet, Pascal; Felter, Adrien; Ferreiro, Ana; Biyoukar, Moustafa; Law-Ye, Bruno; Zanoteli, Edmar; Castiglioni, Claudia; Rendu, John; Beroud, Christophe; Chamouni, Alexandre; Richard, Pascale; Mompoint, Dominique; Quijano-Roy, Susana; Carlier, Robert-Yves
2018-05-25
Inherited myopathies are major causes of muscle atrophy and are often characterized by rigid spine syndrome, a clinical feature designating patients with early spinal contractures. We aim to present a decision algorithm based on muscular whole body magnetic resonance imaging (mWB-MRI) as a unique tool to orientate the diagnosis of each inherited myopathy long before the genetically confirmed diagnosis. This multicentre retrospective study enrolled 79 patients from referral centres in France, Brazil and Chile. The patients underwent 1.5-T or 3-T mWB-MRI. The protocol comprised STIR and T1 sequences in axial and coronal planes, from head to toe. All images were analyzed manually by multiple raters. Fatty muscle replacement was evaluated on mWB-MRI using both the Mercuri scale and statistical comparison based on the percentage of affected muscle. Between February 2005 and December 2015, 76 patients with genetically confirmed inherited myopathy were included. They were affected by Pompe disease or harbored mutations in RYR1, Collagen VI, LMNA, SEPN1, LAMA2 and MYH7 genes. Each myopathy had a specific pattern of affected muscles recognizable on mWB-MRI. This allowed us to create a novel decision algorithm for patients with rigid spine syndrome by segregating these signs. This algorithm was validated by five external evaluators on a cohort of seven patients with a diagnostic accuracy of 94.3% compared with the genetic diagnosis. We provide a novel decision algorithm based on muscle fat replacement graded on mWB-MRI that allows diagnosis and differentiation of inherited myopathies presenting with spinal rigidity. • Inherited myopathies are rare, diagnosis is challenging and genetic tests require specialized centres and often take years. • Inherited myopathies are often characterized by spinal rigidity. • Whole body magnetic resonance imaging is a unique tool to orientate the diagnosis of each inherited myopathy presenting with spinal rigidity. • Each inherited
Matrilineal inheritance of a key mediator of prenatal maternal effects
Ziegler, Ann-Kathrin; Pick, Joel L.; Okuliarová, Monika; Zeman, Michal
2016-01-01
Sex-linkage is predicted to evolve in response to sex-specific or sexually antagonistic selection. In line with this prediction, most sex-linked genes are associated with reproduction in the respective sex. In addition to traits directly involved in fertility and fecundity, mediators of maternal effects may be predisposed to evolve sex-linkage, because they indirectly affect female fitness through their effect on offspring phenotype. Here, we test for sex-linked inheritance of a key mediator of prenatal maternal effects in oviparous species, the transfer of maternally derived testosterone to the eggs. Consistent with maternal inheritance, we found that in Japanese quail (Coturnix japonica) granddaughters resemble their maternal (but not their paternal) grandmother in yolk testosterone deposition. This pattern of resemblance was not due to non-genetic priming effects of testosterone exposure during prenatal development, as an experimental manipulation of yolk testosterone levels did not affect the females' testosterone transfer to their own eggs later in life. Instead, W chromosome and/or mitochondrial variation may underlie the observed matrilineal inheritance pattern. Ultimately, the inheritance of mediators of maternal effects along the maternal line will allow for a fast and direct response to female-specific selection, thereby affecting the dynamics of evolutionary processes mediated by maternal effects. PMID:27629040
[Discussion on inheritance,innovation and belongingness of acupuncture-moxibustion research].
Cai, Ronglin; Hu, Ling
2016-08-12
Three points on the inheritance,innovation and belongingness of acupuncture-moxibustion research are discussed in the paper,including the inheritance of acupuncture-moxibustion culture showing the soul of the development of acupuncture,the improvement of acupuncture-moxibustion presenting the close relationship with the innovation and its development belonging to the origin. It is considered that the inheritance of acupuncture-moxibustion culture takes the priority of its development. Innovation must be realized in order to exist better in the future medicine. The study of acupuncture-moxibustion can not be limited to the traditional acupuncture-moxibustion theory,but need to be in line with it. Explore actively the value of traditional acupuncture-moxibustion culture and its theory. The research and education of acupuncture-moxibustion must belong to TCM. With all the above condition,the innovation and development of acupuncture-moxibustion could be better achieved.
VIPER: a visualisation tool for exploring inheritance inconsistencies in genotyped pedigrees
2012-01-01
Background Pedigree genotype datasets are used for analysing genetic inheritance and to map genetic markers and traits. Such datasets consist of hundreds of related animals genotyped for thousands of genetic markers and invariably contain multiple errors in both the pedigree structure and in the associated individual genotype data. These errors manifest as apparent inheritance inconsistencies in the pedigree, and invalidate analyses of marker inheritance patterns across the dataset. Cleaning raw datasets of bad data points (incorrect pedigree relationships, unreliable marker assays, suspect samples, bad genotype results etc.) requires expert exploration of the patterns of exposed inconsistencies in the context of the inheritance pedigree. In order to assist this process we are developing VIPER (Visual Pedigree Explorer), a software tool that integrates an inheritance-checking algorithm with a novel space-efficient pedigree visualisation, so that reported inheritance inconsistencies are overlaid on an interactive, navigable representation of the pedigree structure. Methods and results This paper describes an evaluation of how VIPER displays the different scales and types of dataset that occur experimentally, with a description of how VIPER's display interface and functionality meet the challenges presented by such data. We examine a range of possible error types found in real and simulated pedigree genotype datasets, demonstrating how these errors are exposed and explored using the VIPER interface and we evaluate the utility and usability of the interface to the domain expert. Evaluation was performed as a two stage process with the assistance of domain experts (geneticists). The initial evaluation drove the iterative implementation of further features in the software prototype, as required by the users, prior to a final functional evaluation of the pedigree display for exploring the various error types, data scales and structures. Conclusions The VIPER display was
Lauria, Massimiliano; Piccinini, Sara; Pirona, Raul; Lund, Gertrud; Viotti, Angelo; Motto, Mario
2014-03-01
Pure epigenetic variation, or epigenetic variation that is independent of genetic context, may provide a mechanism for phenotypic variation in the absence of DNA mutations. To estimate the extent of pure epigenetic variation within and across generations and to identify the DNA regions targeted, a group of eight plants derived from a highly inbred line of maize (Zea mays) was analyzed by the methylation-sensitive amplified polymorphism (MSAP) technique. We found that cytosine methylation (mC) differences among individuals accounted for up to 7.4% of CCGG sites investigated by MSAP. Of the differentially methylated fragments (DMFs) identified in the S0 generation, ∼12% were meiotically inherited for at least six generations. We show that meiotically heritable mC variation was consistently generated for an average of 0.5% CCGG sites per generation and that it largely occurred somatically. We provide evidence that mC variation can be established and inherited in a parent-of-origin manner, given that the paternal lineage is more prone to both forward and reverse mC changes. The molecular characterization of selected DMFs revealed that the variation was largely determined by CG methylation changes that map within gene regions. The expression analysis of genes overlapping with DMFs did not reveal an obvious correlation between mC variation and transcription, reinforcing the idea that the primary function of gene-body methylation is not to control gene expression. Because this study focuses on epigenetic variation in field-grown plants, the data presented herein pertain to spontaneous epigenetic changes of the maize genome in a natural context.
Lauria, Massimiliano; Piccinini, Sara; Pirona, Raul; Lund, Gertrud; Viotti, Angelo; Motto, Mario
2014-01-01
Pure epigenetic variation, or epigenetic variation that is independent of genetic context, may provide a mechanism for phenotypic variation in the absence of DNA mutations. To estimate the extent of pure epigenetic variation within and across generations and to identify the DNA regions targeted, a group of eight plants derived from a highly inbred line of maize (Zea mays) was analyzed by the methylation-sensitive amplified polymorphism (MSAP) technique. We found that cytosine methylation (mC) differences among individuals accounted for up to 7.4% of CCGG sites investigated by MSAP. Of the differentially methylated fragments (DMFs) identified in the S0 generation, ∼12% were meiotically inherited for at least six generations. We show that meiotically heritable mC variation was consistently generated for an average of 0.5% CCGG sites per generation and that it largely occurred somatically. We provide evidence that mC variation can be established and inherited in a parent-of-origin manner, given that the paternal lineage is more prone to both forward and reverse mC changes. The molecular characterization of selected DMFs revealed that the variation was largely determined by CG methylation changes that map within gene regions. The expression analysis of genes overlapping with DMFs did not reveal an obvious correlation between mC variation and transcription, reinforcing the idea that the primary function of gene-body methylation is not to control gene expression. Because this study focuses on epigenetic variation in field-grown plants, the data presented herein pertain to spontaneous epigenetic changes of the maize genome in a natural context. PMID:24374354
Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M; Michor, Franziska; Fan, Rong; Pan, Xinghua
2017-06-02
Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L.; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M.
2017-01-01
Abstract Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. PMID:28126923
Paternal inheritance in mealybugs (Hemiptera: Coccoidea: Pseudococcidae)
NASA Astrophysics Data System (ADS)
Kol-Maimon, Hofit; Mendel, Zvi; Franco, José Carlos; Ghanim, Murad
2014-10-01
Mealybugs have a haplodiploid reproduction system, with paternal genome elimination (PGE); the males are diploid soon after fertilization, but during embryogenesis, the male paternal set of chromosomes becomes heterochromatic (HC) and therefore inactive. Previous studies have suggested that paternal genes can be passed on from mealybug males to their sons, but not necessarily by any son, to the next generation. We employed crosses between two mealybug species— Planococcus ficus (Signoret) and Planococcus citri (Risso)—and between two populations of P. ficus, which differ in their mode of pheromone attraction, in order to demonstrate paternal inheritance from males to F2 through F1 male hybrids. Two traits were monitored through three generations: mode of male pheromone attraction (pherotype) and sequences of the internal transcribed spacer 2 (ITS2) gene segment (genotype). Our results demonstrate that paternal inheritance in mealybugs can occur from males to their F2 offspring, through F1 males (paternal line). F2 backcrossed hybrid males expressed paternal pherotypes and ITS2 genotypes although their mother originated through a maternal population. Further results revealed other, hitherto unknown, aspects of inheritance in mealybugs, such as that hybridization between the two species caused absence of paternal traits in F2 hybrid females produced by F1 hybrid females. Furthermore, hybridization between the two species raised the question of whether unattracted males have any role in the interactions between P. ficus and P. citri.
Environmentally induced epigenetic transgenerational inheritance of disease susceptibility.
Nilsson, Eric E; Skinner, Michael K
2015-01-01
Environmental insults, such as exposure to toxicants or nutritional abnormalities, can lead to epigenetic changes that are in turn related to increased susceptibility to disease. The focus of this review is on the transgenerational inheritance of such epigenetic abnormalities (epimutations), and how it is that these inherited epigenetic abnormalities can lead to increased disease susceptibility, even in the absence of continued environmental insult. Observations of environmental toxicant specificity and exposure-specific disease susceptibility are discussed. How epimutations are transmitted across generations and how epigenetic changes in the germline are translated into an increased disease susceptibility in the adult is reviewed with regard to disease etiology. Copyright © 2015 Elsevier Inc. All rights reserved.
Clinical characteristics and current therapies for inherited retinal degenerations.
Sahel, José-Alain; Marazova, Katia; Audo, Isabelle
2014-10-16
Inherited retinal degenerations (IRDs) encompass a large group of clinically and genetically heterogeneous diseases that affect approximately 1 in 3000 people (>2 million people worldwide) (Bessant DA, Ali RR, Bhattacharya SS. 2001. Molecular genetics and prospects for therapy of the inherited retinal dystrophies. Curr Opin Genet Dev 11: 307-316.). IRDs may be inherited as Mendelian traits or through mitochondrial DNA, and may affect the entire retina (e.g., rod-cone dystrophy, also known as retinitis pigmentosa, cone dystrophy, cone-rod dystrophy, choroideremia, Usher syndrome, and Bardet-Bidel syndrome) or be restricted to the macula (e.g., Stargardt disease, Best disease, and Sorsby fundus dystrophy), ultimately leading to blindness. IRDs are a major cause of severe vision loss, with profound impact on patients and society. Although IRDs remain untreatable today, significant progress toward therapeutic strategies for IRDs has marked the past two decades. This progress has been based on better understanding of the pathophysiological pathways of these diseases and on technological advances. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.
Phylogenetics Exercise Using Inherited Human Traits
ERIC Educational Resources Information Center
Tuimala, Jarno
2006-01-01
A bioinformatics laboratory exercise based on inherited human morphological traits is presented. It teaches how morphological characters can be used to study the evolutionary history of humans using parsimony. The exercise can easily be used in a pen-and-paper laboratory, but if computers are available, a more versatile analysis can be carried…
Promoter methylation assay of SASH1 gene in breast cancer.
Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He
2013-01-01
To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.
NASA Astrophysics Data System (ADS)
Garapati, N.; Randolph, J.; Saar, M. O.
2013-12-01
CO2-Plume Geothermal (CPG) involves injection of CO2 as a working fluid to extract heat from naturally high permeable sedimentary basins. The injected CO2 forms a large subsurface CO2 plume that absorbs heat from the geothermal reservoir and eventually buoyantly rises to the surface. The heat density of sedimentary basins is typically relatively low.However, this drawback is likely counteracted by the large accessible volume of natural reservoirs compared to artificial, hydrofractured, and thus small-scale, reservoirs. Furthermore, supercritical CO2has a large mobility (inverse kinematic viscosity) and expansibility compared to water resulting in the formation of a strong thermosiphon which eliminates the need for parasitic pumping power requirements and significantly increasing electricity production efficiency. Simultaneously, the life span of the geothermal power plant can be increased by operating the CPG system such that it depletes the geothermal reservoir heat slowly. Because the produced CO2 is reinjected into the ground with the main CO2 sequestration stream coming from a CO2 emitter, all of the CO2 is ultimately geologically sequestered resulting in a CO2 sequestering geothermal power plant with a negative carbon footprint. Conventional geothermal process requires pumping of huge amount of water for the propagation of the fractures in the reservoir, but CPG process eliminates this requirement and conserves water resources. Here, we present results for performance of a CPG system as a function of various geologic properties of multilayered systemsincludingpermeability anisotropy, rock thermal conductivity, geothermal gradient, reservoir depth and initial native brine salinity as well as spacing between the injection and production wells. The model consists of a 50 m thick, radially symmetric grid with a semi-analytic heat exchange and no fluid flow at the top and bottom boundaries and no fluid and heat flow at the lateral boundaries. We design Plackett
Gentil, Coline A; Gammill, Hilary S; Luu, Christine T; Mayes, Maureen D; Furst, Dan E; Nelson, J Lee
2017-03-07
Specific HLA class II alleles are associated with systemic sclerosis (SSc) risk, clinical characteristics, and autoantibodies. HLA nomenclature initially developed with antibodies as typing reagents defining DRB1 allele groups. However, alleles from different DRB1 allele groups encode the same third hypervariable region (3rd HVR) sequence, the primary T-cell recognition site, and 3rd HVR charge differences can affect interactions with T cells. We considered 3rd HVR sequences (amino acids 67-74) irrespective of the allele group and analyzed parental inheritance considered according to the 3rd HVR charge, comparing SSc patients with controls. In total, 306 families (121 SSc and 185 controls) were HLA genotyped and parental HLA-haplotype origin was determined. Analysis was conducted according to DRβ1 3rd HVR sequence, charge, and parental inheritance. The distribution of 3rd HVR sequences differed in SSc patients versus controls (p = 0.007), primarily due to an increase of specific DRB1*11 alleles, in accord with previous observations. The 3rd HVR sequences were next analyzed according to charge and parental inheritance. Paternal transmission of DRB1 alleles encoding a +2 charge 3rd HVR was significantly reduced in SSc patients compared with maternal transmission (p = 0.0003, corrected for analysis of four charge categories p = 0.001). To a lesser extent, paternal transmission was increased when charge was 0 (p = 0.021, corrected for multiple comparisons p = 0.084). In contrast, paternal versus maternal inheritance was similar in controls. SSc patients differed from controls when DRB1 alleles were categorized according to 3rd HVR sequences. Skewed parental inheritance was observed in SSc patients but not in controls when the DRβ1 3rd HVR was considered according to charge. These observations suggest that epigenetic modulation of HLA merits investigation in SSc.
Identifying mantle lithosphere inheritance in controlling intraplate orogenesis
NASA Astrophysics Data System (ADS)
Heron, Philip J.; Pysklywec, Russell N.; Stephenson, Randell
2016-09-01
Crustal inheritance is often considered important in the tectonic evolution of the Wilson Cycle. However, the role of the mantle lithosphere is usually overlooked due to its difficulty to image and uncertainty in rheological makeup. Recently, increased resolution in lithosphere imaging has shown potential scarring in continental mantle lithosphere to be ubiquitous. In our study, we analyze intraplate deformation driven by mantle lithosphere heterogeneities from ancient Wilson Cycle processes and compare this to crustal inheritance deformation. We present 2-D numerical experiments of continental convergence to generate intraplate deformation, exploring the limits of continental rheology to understand the dominant lithosphere layer across a broad range of geological settings. By implementing a "jelly sandwich" rheology, common in stable continental lithosphere, we find that during compression the strength of the mantle lithosphere is integral in generating deformation from a structural anomaly. We posit that if the continental mantle is the strongest layer within the lithosphere, then such inheritance may have important implications for the Wilson Cycle. Furthermore, our models show that deformation driven by mantle lithosphere scarring can produce tectonic patterns related to intraplate orogenesis originating from crustal sources, highlighting the need for a more formal discussion of the role of the mantle lithosphere in plate tectonics.
Does cross-generational epigenetic inheritance contribute to cultural continuity?
Pembrey, Marcus E
2018-04-01
Human studies of cross-generational epigenetic inheritance have to consider confounding by social patterning down the generations, often referred to as 'cultural inheritance'. This raises the question to what extent is 'cultural inheritance' itself epigenetically mediated rather than just learnt. Human studies of non-genetic inheritance have demonstrated that, beyond foetal life, experiences occurring in mid-childhood before puberty are the most likely to be associated with cross-generational responses in the next generation(s). It is proposed that cultural continuity is played out along the axis, or 'payoff', between responsiveness and stability. During the formative years of childhood a stable family and/or home permits small children to explore and thereby learn. To counter disruptions to this family home ideal, cultural institutions such as local schools, religious centres and market places emerged to provide ongoing stability, holding the received wisdom of the past in an accessible state. This cultural support allows the growing child to freely indulge their responsiveness. Some of these prepubertal experiences induce epigenetic responses that also transfer molecular signals to the gametes through which they contribute to the conception of future offspring. In parallel co-evolution with growing cultural support for increasing responsiveness, 'runaway' responsiveness is countered by the positive selection of genetic variants that dampen responsiveness. Testing these ideas within longitudinal multigenerational cohorts will need information on ancestors/parents' own communities and experiences (Exposome scans) linked to ongoing Phenome scans on grandchildren; coupled with epigenome analysis, metastable epialleles and DNA methylation age. Interactions with genetic variants affecting responsiveness should help inform the broad hypothesis.
Glucocorticoid receptor gene expression and promoter CpG modifications throughout the human brain.
Cao-Lei, Lei; Suwansirikul, Songkiet; Jutavijittum, Prapan; Mériaux, Sophie B; Turner, Jonathan D; Muller, Claude P
2013-11-01
Glucocorticoids and the glucocorticoid (GR) and mineralocorticoid (MR) receptors have been implicated in many processes, particularly in negative feedback regulation of the hypothalamic-pituitary-adrenal axis. Epigenetically programmed GR alternative promoter usage underlies transcriptional control of GR levels, generation of GR 3' splice variants, and the overall GC response in the brain. No detailed analysis of GR first exons or GR transcript variants throughout the human brain has been reported. Therefore we investigated post mortem tissues from 28 brain regions of 5 individuals. GR first exons were expressed throughout the healthy human brain with no region-specific usage patterns. First exon levels were highly inter-correlated suggesting that they are co-regulated. GR 3' splice variants (GRα and GR-P) were equally distributed in all regions, and GRβ expression was always low. GR/MR ratios showed significant differences between the 28 tissues with the highest ratio in the pituitary gland. Modification levels of individual CpG dinucleotides, including 5-mC and 5-hmC, in promoters 1D, 1E, 1F, and 1H were low, and diffusely clustered; despite significant heterogeneity between the donors. In agreement with this clustering, sum modification levels rather than individual CpG modifications correlated with GR expression. Two-way ANOVA showed that this sum modification was both promoter and brain region specific, but that there was however no promoter*tissue interaction. The heterogeneity between donors may however hide such an interaction. In both promoters 1F and 1H modification levels correlated with GRα expression suggesting that 5-mC and 5-hmC play an important role in fine tuning GR expression levels throughout the brain. Copyright © 2013 Elsevier Ltd. All rights reserved.
M.A. Keena
2016-01-01
Mode of inheritance of hatch traits in Lymantria dispar L. was determined by crossing populations nearly fixed for the phenotypic extremes. The nondiapausing phenotype was inherited via a single recessive gene and the phenotype with reduced low temperature exposure requirements before hatch was inherited via a single dominant gene. There was no...
Maternally-inherited diabetes with deafness (MIDD) and hyporeninemic hypoaldosteronism.
Mory, Patricia B; Santos, Marcia C dos; Kater, Claudio E; Moisés, Regina S
2012-11-01
Maternally-inherited diabetes with deafness (MIDD) is a rare form of monogenic diabetes that results, in most cases, from an A-to-G transition at position 3243 of mitochondrial DNA (m.3243A>G) in the mitochondrial-encoded tRNA leucine (UUA/G) gene. As the name suggests, this condition is characterized by maternally-inherited diabetes and bilateral neurosensory hearing impairment. A characteristic of mitochondrial cytopathies is the progressive multisystemic involvement with the development of more symptoms during the course of the disease. We report here the case of a patient with MIDD who developed hyporeninemic hypoaldosteronism.
Replication stress affects the fidelity of nucleosome-mediated epigenetic inheritance
Li, Wenzhu; Yi, Jia; Agbu, Pamela; Zhou, Zheng; Kelley, Richard L.; Jia, Songtao
2017-01-01
The fidelity of epigenetic inheritance or, the precision by which epigenetic information is passed along, is an essential parameter for measuring the effectiveness of the process. How the precision of the process is achieved or modulated, however, remains largely elusive. We have performed quantitative measurement of epigenetic fidelity, using position effect variegation (PEV) in Schizosaccharomyces pombe as readout, to explore whether replication perturbation affects nucleosome-mediated epigenetic inheritance. We show that replication stresses, due to either hydroxyurea treatment or various forms of genetic lesions of the replication machinery, reduce the inheritance accuracy of CENP-A/Cnp1 nucleosome positioning within centromere. Mechanistically, we demonstrate that excessive formation of single-stranded DNA, a common molecular abnormality under these conditions, might have correlation with the reduction in fidelity of centromeric chromatin duplication. Furthermore, we show that replication stress broadly changes chromatin structure at various loci in the genome, such as telomere heterochromatin expanding and mating type locus heterochromatin spreading out of the boundaries. Interestingly, the levels of inheritable expanding at sub-telomeric heterochromatin regions are highly variable among independent cell populations. Finally, we show that HU treatment of the multi-cellular organisms C. elegans and D. melanogaster affects epigenetically programmed development and PEV, illustrating the evolutionary conservation of the phenomenon. Replication stress, in addition to its demonstrated role in genetic instability, promotes variable epigenetic instability throughout the epigenome. PMID:28749973
The intriguing complexity of parthenogenesis inheritance in Pilosella rubra (Asteraceae, Lactuceae).
Rosenbaumová, Radka; Krahulcová, Anna; Krahulec, František
2012-09-01
Neither the genetic basis nor the inheritance of apomixis is fully understood in plants. The present study is focused on the inheritance of parthenogenesis, one of the basic elements of apomixis, in Pilosella (Asteraceae). A complex pattern of inheritance was recorded in the segregating F(1) progeny recovered from reciprocal crosses between the facultatively apomictic hexaploid P. rubra and the sexual tetraploid P. officinarum. Although both female and male reduced gametes of P. rubra transmitted parthenogenesis at the same rate in the reciprocal crosses, the resulting segregating F(1) progeny inherited parthenogenesis at different rates. The actual transmission rates of parthenogenesis were significantly correlated with the mode of origin of the respective F(1) progeny class. The inheritance of parthenogenesis was significantly reduced in F(1) n + n hybrid progeny from the cross where parthenogenesis was transmitted by female gametes. In F(1) n + 0 polyhaploid progeny from the same cross, however, the transmission rate of parthenogenesis was high; all fertile polyhaploids were parthenogenetic. It appeared that reduced female gametes transmitting parthenogenesis preferentially developed parthenogenetically and only rarely were fertilized in P. rubra. The fact that the determinant for parthenogenesis acts gametophytically in Pilosella and the precocious embryogenesis in parthenogenesis-transmitting megagametophytes was suggested as the most probable explanations for this observation. Furthermore, we observed the different expression of complete apomixis in the non-segregating F(1) 2n + n hybrids as compared to their apomictic maternal parent P. rubra. We suggest that this difference is a result of unspecified interactions between the parental genomes.
Epigenetically-inherited centromere and neocentromere DNA replicates earliest in S-phase.
Koren, Amnon; Tsai, Hung-Ji; Tirosh, Itay; Burrack, Laura S; Barkai, Naama; Berman, Judith
2010-08-19
Eukaryotic centromeres are maintained at specific chromosomal sites over many generations. In the budding yeast Saccharomyces cerevisiae, centromeres are genetic elements defined by a DNA sequence that is both necessary and sufficient for function; whereas, in most other eukaryotes, centromeres are maintained by poorly characterized epigenetic mechanisms in which DNA has a less definitive role. Here we use the pathogenic yeast Candida albicans as a model organism to study the DNA replication properties of centromeric DNA. By determining the genome-wide replication timing program of the C. albicans genome, we discovered that each centromere is associated with a replication origin that is the first to fire on its respective chromosome. Importantly, epigenetic formation of new ectopic centromeres (neocentromeres) was accompanied by shifts in replication timing, such that a neocentromere became the first to replicate and became associated with origin recognition complex (ORC) components. Furthermore, changing the level of the centromere-specific histone H3 isoform led to a concomitant change in levels of ORC association with centromere regions, further supporting the idea that centromere proteins determine origin activity. Finally, analysis of centromere-associated DNA revealed a replication-dependent sequence pattern characteristic of constitutively active replication origins. This strand-biased pattern is conserved, together with centromere position, among related strains and species, in a manner independent of primary DNA sequence. Thus, inheritance of centromere position is correlated with a constitutively active origin of replication that fires at a distinct early time. We suggest a model in which the distinct timing of DNA replication serves as an epigenetic mechanism for the inheritance of centromere position.
Obstetric outcomes of recurrent pregnancy loss patients diagnosed wıth inherited thrombophilia.
Karadağ, C; Yoldemir, T; Karadağ, S D; İnan, C; Dolgun, Z N; Aslanova, L
2017-08-01
Recurrent pregnancy loss (RPL) is defined by two or more failed pregnancies. The relation between RPL and inherited thrombophilia requires anticoagulant therapy during pregnancy. However the obstetric outcomes have not been well defined in these RPL patients diagnosed with inherited thrombophilia, who have been given anticoagulant therapy. To investigate the obstetric outcomes in pregnant women with RPL who are given low molecular weight heparin (LMWH) and low-dose aspirin due to diagnosis of inherited thrombophilia. A hundred and eight RPL women were diagnosed with inherited thrombophilia, and 98 women were diagnosed with unexplained RPL. The patients with inherited thrombophilia were given LMWH and low-dose aspirin. Unexplained RPL patients were not given any medicine. The obstetric outcomes of participants were noted. In thrombophilic group, the live-birth levels were significantly higher [90 (83%) vs 67 (68%) p < 0.05], and the miscarriage levels were significantly lower than that in the control group [14 (13%) vs 27 (28%) p < 0.01]. The number of patients with preeclampsia was significantly higher in the thrombophilic group [16 (15%) vs 6 (6%) p < 0.05]. The number of preterm births was significantly higher than that of the controls [25 (23%) vs 10 (10%) p < 0.05]. The median gestation age of delivery was 35 weeks for thrombophilic patients and 38 weeks for controls (p < 0.05). The RPL patients diagnosed with inherited thrombophilia and who were given LMWH with low-dose aspirin had higher live-birth rates and lower miscarriage rates than those in the unexplained RPL patients. Increased risk of preeclampsia is seen in RPL patients with inherited thrombophilia despite thrombophilia prophylaxis.
Inheritance of proportionate dwarfism in Angus cattle.
Latter, M R; Latter, B D H; Wilkins, J F; Windsor, P A
2006-04-01
To determine the mode of inheritance of congenital proportionate dwarfism in Angus and Angus crossbred cattle, initially detected in two commercial beef herds in northern New South Wales. Matings of normal carrier sires to unrelated cows of diverse breeds, and of one carrier sire to his unaffected daughters. An unrelated Piedmontese bull was also mated to unaffected daughters of the carrier sires. Two carrier Angus bulls and nine unaffected daughters, all of whom were completely indistinguishable from normal animals, were purchased for controlled breeding studies under known nutritional and disease conditions. Affected and carrier individuals were examined for the presence of obvious chromosomal abnormalities. Angus dwarfism has been successfully reproduced under controlled experimental conditions over successive years using unrelated dams and is undoubtedly heritable. The high frequency of occurrence of affected individuals (23/61 = 0.38 +/- .06) among the progeny of matings of the Angus sires to unrelated females of diverse breeding is not compatible with recessive inheritance, because of the negligible frequency of proportionate dwarfism in the breeds of the dams. Both paternal and maternal transmission of the defect was demonstrated, so that imprinting in the strict sense of a gene that is only expressed when received from the male parent appears not to be involved. Tested individuals showed no evidence of gross chromosomal abnormality. Dominant autosomal inheritance with incomplete penetrance was indicated by the lack of expression of the defective gene in the two Angus sires and in three unaffected daughters who produced dwarf calves from matings to the Piedmontese bull. The mode of inheritance is that of a single autosomal dominant gene with a penetrance coefficient of 0.75 +/- 0.12, estimated from the observed incidence of 23/61 affected offspring of the two carrier Angus bulls mated to unrelated dams. Simple genetic models involving either (i) an unstable
Tamary, Hannah; Nishri, Daniella; Yacobovich, Joanne; Zilber, Rama; Dgany, Orly; Krasnov, Tanya; Aviner, Shraga; Stepensky, Polina; Ravel-Vilk, Shoshana; Bitan, Menachem; Kaplinsky, Chaim; Ben Barak, Ayelet; Elhasid, Ronit; Kapelusnik, Joseph; Koren, Ariel; Levin, Carina; Attias, Dina; Laor, Ruth; Yaniv, Isaac; Rosenberg, Philip S; Alter, Blanche P
2010-08-01
Inherited bone marrow failure syndromes are rare genetic disorders characterized by bone marrow failure, congenital anomalies, and cancer predisposition. Available single disease registries provide reliable information regarding natural history, efficacy and side effects of treatments, and contribute to the discovery of the causative genes. However, these registries could not shed light on the true incidence of the various syndromes. We, therefore, established an Israeli national registry in order to investigate the relative frequency of each of these syndromes and their complications. Patients were registered by their hematologists in all 16 medical centers in Israel. We included patients with Fanconi anemia, severe congenital neutropenia, Diamond-Blackfan anemia, congenital amegakaryocytic thrombocytopenia, dyskeratosis congenita, Shwachman-Diamond syndrome, and thrombocytopenia with absent radii. One hundred and twenty-seven patients diagnosed between 1966 and 2007 were registered. Fifty-two percent were found to have Fanconi anemia, 17% severe congenital neutropenia, 14% Diamond-Blackfan anemia, 6% congenital amegakaryocytic thrombocytopenia, 5% dyskeratosis congenita, 2% Shwachman-Diamond syndrome, and 2% thrombocytopenia with absent radii. No specific diagnosis was made in only 2 patients. Of the thirty patients (24%) developing severe bone marrow failure, 80% had Fanconi anemia. Seven of 9 patients with leukemia had Fanconi anemia, as did all 6 with solid tumors. Thirty-four patients died from their disease; 25 (74%) had Fanconi anemia and 6 (17%) had severe congenital neutropenia. This is the first comprehensive population-based study evaluating the incidence and complications of the different inherited bone marrow failure syndromes. By far the most common disease was Fanconi anemia, followed by severe congenital neutropenia and Diamond-Blackfan anemia. Fanconi anemia carried the worst prognosis, with severe bone marrow failure and cancer susceptibility
Difficulties in Learning Inheritance and Polymorphism
ERIC Educational Resources Information Center
Liberman, Neomi; Beeri, Catriel; Kolikant, Yifat Ben-David
2011-01-01
This article reports on difficulties related to the concepts of inheritance and polymorphism, expressed by a group of 22 in-service CS teachers with an experience with the procedural paradigm, as they coped with a course on OOP. Our findings are based on the analysis of tests, questionnaires that the teachers completed in the course, as well as on…
Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal
2014-01-01
Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts.
Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal
2014-01-01
Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts. PMID:25369195
Micronucleus formation causes perpetual unilateral chromosome inheritance in mouse embryos
Vázquez-Diez, Cayetana; Yamagata, Kazuo; Trivedi, Shardul; Haverfield, Jenna; FitzHarris, Greg
2016-01-01
Chromosome segregation defects in cancer cells lead to encapsulation of chromosomes in micronuclei (MN), small nucleus-like structures within which dangerous DNA rearrangements termed chromothripsis can occur. Here we uncover a strikingly different consequence of MN formation in preimplantation development. We find that chromosomes from within MN become damaged and fail to support a functional kinetochore. MN are therefore not segregated, but are instead inherited by one of the two daughter cells. We find that the same MN can be inherited several times without rejoining the principal nucleus and without altering the kinetics of cell divisions. MN motion is passive, resulting in an even distribution of MN across the first two cell lineages. We propose that perpetual unilateral MN inheritance constitutes an unexpected mode of chromosome missegregation, which could contribute to the high frequency of aneuploid cells in mammalian embryos, but simultaneously may serve to insulate the early embryonic genome from chromothripsis. PMID:26729872
Micronucleus formation causes perpetual unilateral chromosome inheritance in mouse embryos.
Vázquez-Diez, Cayetana; Yamagata, Kazuo; Trivedi, Shardul; Haverfield, Jenna; FitzHarris, Greg
2016-01-19
Chromosome segregation defects in cancer cells lead to encapsulation of chromosomes in micronuclei (MN), small nucleus-like structures within which dangerous DNA rearrangements termed chromothripsis can occur. Here we uncover a strikingly different consequence of MN formation in preimplantation development. We find that chromosomes from within MN become damaged and fail to support a functional kinetochore. MN are therefore not segregated, but are instead inherited by one of the two daughter cells. We find that the same MN can be inherited several times without rejoining the principal nucleus and without altering the kinetics of cell divisions. MN motion is passive, resulting in an even distribution of MN across the first two cell lineages. We propose that perpetual unilateral MN inheritance constitutes an unexpected mode of chromosome missegregation, which could contribute to the high frequency of aneuploid cells in mammalian embryos, but simultaneously may serve to insulate the early embryonic genome from chromothripsis.
Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.
Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei
2017-08-16
Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.
CRISPR-Cas9 genome engineering: Treating inherited retinal degeneration.
Burnight, Erin R; Giacalone, Joseph C; Cooke, Jessica A; Thompson, Jessica R; Bohrer, Laura R; Chirco, Kathleen R; Drack, Arlene V; Fingert, John H; Worthington, Kristan S; Wiley, Luke A; Mullins, Robert F; Stone, Edwin M; Tucker, Budd A
2018-03-22
Gene correction is a valuable strategy for treating inherited retinal degenerative diseases, a major cause of irreversible blindness worldwide. Single gene defects cause the majority of these retinal dystrophies. Gene augmentation holds great promise if delivered early in the course of the disease, however, many patients carry mutations in genes too large to be packaged into adeno-associated viral vectors and some, when overexpressed via heterologous promoters, induce retinal toxicity. In addition to the aforementioned challenges, some patients have sustained significant photoreceptor cell loss at the time of diagnosis, rendering gene replacement therapy insufficient to treat the disease. These patients will require cell replacement to restore useful vision. Fortunately, the advent of induced pluripotent stem cell and CRISPR-Cas9 gene editing technologies affords researchers and clinicians a powerful means by which to develop strategies to treat patients with inherited retinal dystrophies. In this review we will discuss the current developments in CRISPR-Cas9 gene editing in vivo in animal models and in vitro in patient-derived cells to study and treat inherited retinal degenerative diseases. Copyright © 2018 Elsevier Ltd. All rights reserved.
MSH6 G39E Polymorphism and CpG Island Methylator Phenotype in Colon Cancer
Curtin, Karen; Samowitz, Wade S.; Wolff, Roger K.; Caan, Bette J.; Ulrich, Cornelia M.; Potter, John D.; Slattery, Martha L.
2010-01-01
The MSH6 G39E germline polymorphism is not associated with an increased risk of either microsatellite stable or unstable sporadic colorectal cancer. Other than microsatellite instability, however, most genetic and epigenetic changes of tumors associated with this common variant have not been studied. The objective of our investigation was to evaluate associations between the MSH6 G39E (116G>A) polymorphism and CpG island methylator phenotype (CIMP) and BRAF V600E mutations in tumors from a sample of 1048 individuals with colon cancer and 1964 controls from Utah, Northern California, and Minnesota. The G39E polymorphism (rs1042821) was determined by the five prime nuclease assay. CIMP was determined by methylation-specific polymerase chain reaction (PCR) of CpG islands in MLH1, methylated in tumors (MINT)1, MINT2, MINT31, and CDKN2A. The BRAF V600E mutation was determined by sequencing exon 15. In microsatellite stable tumors, homozygous carriers of the G39E polymorphism had an increased risk of CIMP+ colon cancer (odds ratio (OR) 2.2, 95% confidence interval (CI) 1.1, 4.2) and BRAF V600E mutation (OR 3.1, 95% CI 1.01, 9.7) in a case–control comparison. This finding was not observed in unstable tumors; however, power may have been low to detect an association. Age at diagnosis, family history, and alcohol use did not interact with MSH6 G39E and CIMP. The MSH6 G39E germline polymorphism may be associated with CIMP+ colon cancer. PMID:19582761
NASA Astrophysics Data System (ADS)
Heron, Philip J.; Pysklywec, Russell N.
2016-05-01
Continents have a rich tectonic history that have left lasting crustal impressions. In analyzing Central Australian intraplate orogenesis, complex continental features make it difficult to identify the controls of inherited structure. Here the tectonics of two types of inherited structures (e.g., a thermally enhanced or a rheologically strengthened region) are compared in numerical simulations of continental compression with and without "glacial buzzsaw" erosion. We find that although both inherited structures produce deformation in the upper crust that is confined to areas where material contrasts, patterns of deformation in the deep lithosphere differ significantly. Furthermore, our models infer that glacial buzzsaw erosion has little impact at depth. This tectonic isolation of the mantle lithosphere from glacial processes may further assist in the identification of a controlling inherited structure in intraplate orogenesis. Our models are interpreted in the context of Central Australian tectonics (specifically the Petermann and Alice Springs orogenies).
Genetic manipulation for inherited neurodegenerative diseases: myth or reality?
Yu-Wai-Man, Patrick
2016-01-01
Rare genetic diseases affect about 7% of the general population and over 7000 distinct clinical syndromes have been described with the majority being due to single gene defects. This review will provide a critical overview of genetic strategies that are being pioneered to halt or reverse disease progression in inherited neurodegenerative diseases. This field of research covers a vast area and only the most promising treatment paradigms will be discussed with a particular focus on inherited eye diseases, which have paved the way for innovative gene therapy paradigms, and mitochondrial diseases, which are currently generating a lot of debate centred on the bioethics of germline manipulation. PMID:27002113
Frisso, Giulia; Detta, Nicola; Coppola, Pamela; Mazzaccara, Cristina; Pricolo, Maria Rosaria; D'Onofrio, Antonio; Limongelli, Giuseppe; Calabrò, Raffaele; Salvatore, Francesco
2016-11-10
Point mutations are the most common cause of inherited diseases. Bioinformatics tools can help to predict the pathogenicity of mutations found during genetic screening, but they may work less well in determining the effect of point mutations in non-coding regions. In silico analysis of intronic variants can reveal their impact on the splicing process, but the consequence of a given substitution is generally not predictable. The aim of this study was to functionally test five intronic variants ( MYBPC3 -c.506-2A>C, MYBPC3 -c.906-7G>T, MYBPC3 -c.2308+3G>C, SCN5A -c.393-5C>A, and ACTC1 -c.617-7T>C) found in five patients affected by inherited cardiomyopathies in the attempt to verify their pathogenic role. Analysis of the MYBPC3 -c.506-2A>C mutation in mRNA from the peripheral blood of one of the patients affected by hypertrophic cardiac myopathy revealed the loss of the canonical splice site and the use of an alternative splicing site, which caused the loss of the first seven nucleotides of exon 5 ( MYBPC3 -G169AfsX14). In the other four patients, we generated minigene constructs and transfected them in HEK-293 cells. This minigene approach showed that MYBPC3 -c.2308+3G>C and SCN5A -c.393-5C>A altered pre-mRNA processing, thus resulting in the skipping of one exon. No alterations were found in either MYBPC3 -c.906-7G>T or ACTC1 -c.617-7T>C. In conclusion, functional in vitro analysis of the effects of potential splicing mutations can confirm or otherwise the putative pathogenicity of non-coding mutations, and thus help to guide the patient's clinical management and improve genetic counseling in affected families.
Insurance coverage of medical foods for treatment of inherited metabolic disorders
Berry, Susan A.; Kenney, Mary Kay; Harris, Katharine B.; Singh, Rani H.; Cameron, Cynthia A.; Kraszewski, Jennifer N.; Levy-Fisch, Jill; Shuger, Jill F.; Greene, Carol L.; Lloyd-Puryear, Michele A.; Boyle, Coleen A.
2015-01-01
Purpose Treatment of inherited metabolic disorders is accomplished by use of specialized diets employing medical foods and medically necessary supplements. Families seeking insurance coverage for these products express concern that coverage is often limited; the extent of this challenge is not well defined. Methods To learn about limitations in insurance coverage, parents of 305 children with inherited metabolic disorders completed a paper survey providing information about their use of medical foods, modified low-protein foods, prescribed dietary supplements, and medical feeding equipment and supplies for treatment of their child's disorder as well as details about payment sources for these products. Results Although nearly all children with inherited metabolic dis orders had medical coverage of some type, families paid “out of pocket” for all types of products. Uncovered spending was reported for 11% of families purchasing medical foods, 26% purchasing supplements, 33% of those needing medical feeding supplies, and 59% of families requiring modified low-protein foods. Forty-two percent of families using modified low-protein foods and 21% of families using medical foods reported additional treatment-related expenses of $100 or more per month for these products. Conclusion Costs of medical foods used to treat inherited metabolic disorders are not completely covered by insurance or other resources. PMID:23598714
Zhang, Xiao Xia; Wong, Sing Wai; Han, Dong; Feng, Hai Lan
2015-01-01
To describe the simultaneous occurence of an autosomal dominant inherited MSX1 mutation and an X-linked recessive inherited EDA mutation in one Chinese family with nonsyndromic oligodontia. Clinical data of characteristics of tooth agenesis were collected. MSX1 and EDA gene mutations were detected in a Chinese family of non-syndromic oligodontia. Mild hypodontia in the parents and severe oligodontia in the son was recorded. A novel missense heterozygous mutation c.517C>A (p.Arg173Ser) was detected in the MSX1 gene in the boy and the father. A homozygous missense mutation c.1001G>A (p.Arg334His) was detected in the EDA gene in the boy and the same mutant occurred heterozygously in the mother. Simultaneous occurence of two different gene mutations with different inheritence patterns, which both caused oligodontia, which occurred in one subject and in one family, was reported.
Ergene, Boğaç A; Berker, Ali
2009-01-01
This article investigates the relationship between inheritance and wealth in the context of eighteenth-century Ottoman Kastamonu. Based on the estate inventories of the deceased (sing. tereke) as recorded in Kastamonu court records (sicils), the article introduces a variety of quantitative techniques to measure the impact of Islamic inheritance practices on wealth accumulation across subsequent generations and to understand how it influenced wealth mobility among various socioeconomic groups. The estimations provided in this article suggest that while the inheritance practice in Kastamonu caused wealth fragmentation, the process also contributed to the durability of economic divisions within the provincial Ottoman society.
The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern
Bellizzi, Dina; D'Aquila, Patrizia; Scafone, Teresa; Giordano, Marco; Riso, Vincenzo; Riccio, Andrea; Passarino, Giuseppe
2013-01-01
DNA methylation is a common epigenetic modification of the mammalian genome. Conflicting data regarding the possible presence of methylated cytosines within mitochondrial DNA (mtDNA) have been reported. To clarify this point, we analysed the methylation status of mtDNA control region (D-loop) on human and murine DNA samples from blood and cultured cells by bisulphite sequencing and methylated/hydroxymethylated DNA immunoprecipitation assays. We found methylated and hydroxymethylated cytosines in the L-strand of all samples analysed. MtDNA methylation particularly occurs within non-C-phosphate-G (non-CpG) nucleotides, mainly in the promoter region of the heavy strand and in conserved sequence blocks, suggesting its involvement in regulating mtDNA replication and/or transcription. We observed DNA methyltransferases within the mitochondria, but the inactivation of Dnmt1, Dnmt3a, and Dnmt3b in mouse embryonic stem (ES) cells results in a reduction of the CpG methylation, while the non-CpG methylation shows to be not affected. This suggests that D-loop epigenetic modification is only partially established by these enzymes. Our data show that DNA methylation occurs in the mtDNA control region of mammals, not only at symmetrical CpG dinucleotides, typical of nuclear genome, but in a peculiar non-CpG pattern previously reported for plants and fungi. The molecular mechanisms responsible for this pattern remain an open question. PMID:23804556
Marasco, Emiliano; Farroni, Chiara; Cascioli, Simona; Marcellini, Valentina; Scarsella, Marco; Giorda, Ezio; Piano Mortari, Eva; Leonardi, Lucia; Scarselli, Alessia; Valentini, Diletta; Cancrini, Caterina; Duse, Marzia; Grimsholm, Ola; Carsetti, Rita
2017-01-01
Around 65% of primary immunodeficiencies are antibody deficiencies. Functional tests are useful tools to study B-cell functions in vitro. However, no accepted guidelines for performing and evaluating functional tests have been issued yet. Here, we report our experience on the study of B-cell functions in infancy and throughout childhood. We show that T-independent stimulation with CpG measures proliferation and differentiation potential of memory B cells. Switched memory B cells respond better than IgM memory B cells. On the other hand, CD40L, a T-dependent stimulus, does not induce plasma cell differentiation, but causes proliferation of naïve and memory B cells. During childhood, the production of plasmablasts in response to CpG increases with age mirroring the development of memory B cells. The response to CD40L does not change with age. In patients with selective IgA deficiency (SIgAD), we observed that switched memory B cells are reduced due to the absence of IgA memory B cells. In agreement, IgA plasma cells are not generated in response to CpG. Unexpectedly, B cells from SIgAD patients show a reduced proliferative response to CD40L. Our results demonstrate that functional tests are an important tool to assess the functions of the humoral immune system. © 2016 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas
Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle
2009-01-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763
Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle
2009-08-01
The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.
Fu, J; Su, Y; Liu, Y; Zhang, X Y
2018-04-09
Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.
Role of structural inheritance on present-day deformation in intraplate domains
NASA Astrophysics Data System (ADS)
Tarayoun, A.; Mazzotti, S.; Gueydan, F.
2017-12-01
Understanding the role of structural inheritance on present day surface deformation is a key element for better characterizing the dynamism of intraplate earthquakes. Current deformation and seismicity are poorly understood phenomenon in intra-continental domains. A commonly used hypothesis, based on observations, suggests that intraplate deformation is related to the reactivation of large tectonic paleo-structures, which can act as locally weakened domains. The objective of our study is to quantify the impact of these weakened areas on present-day strain localizations and rates. We combine GPS observations and numerical modeling to analyze the role of structural inheritance on strain rates, with specific observations along the St. Lawrence Valley of eastern Canada. We processed 143 GPS stations from five different networks, in particular one dense campaign network situated along a recognized major normal faults system of the Iapetus paleo-rift, in order to accurately determine the GPS velocities and strain rates. Results of strain rates show magnitude varying from 1.5x10-10 to 6.8x10-9 yr-1 in the St Lawrence valley. Weakened area strain rates are up to one order of magnitude higher than surrounding areas. We compare strain rates inferred from GPS and the new postglacial rebound model. We found that GPS signal is one order of magnitude higher in the weakened zone, which is likely due to structural inheritance. The numerical modeling investigates the steady-state deformation of the continental lithosphere with presence of a weak area. Our new approach integrates ductile structural inheritance using a weakening coefficient that decreases the lithosphere strength at different depths. This allows studying crustal strain rates mainly as a function of rheological contrast and geometry of the weakened domains. Comparison between model predictions and observed GPS strain rates will allow us to investigate the respective role of crustal and mantle tectonic inheritance.
Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun
2018-05-01
We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.
Fan, Haitao; Zhang, Ian; Chen, Xuebo; Zhang, Leying; Wang, Huaqing; Fonseca, Anna Da; Manuel, Edwin R.; Diamond, Don J.; Raubitschek, Andrew; Badie, Behnam
2012-01-01
Purpose Recently, we showed that intratumoral delivery of low-dose, immunostimulatory CpG oligodeoxynucleotides conjugated with carbon nanotubes (CNT-CpG) was more effective than free CpG and not only eradicated intracranial (i.c.) gliomas, but also induced antitumor immunity that protected mice from subsequent i.c. or systemic tumor rechallenge. Here, we examined if the same “intracerebral immunotherapy” strategy could be applied to the treatment of metastatic brain tumors. Experimental Design Mice with both i.c. and subcutaneous (s.c.) melanomas were injected intratumorally with CNT-CpG into either location. Antitumor responses were assessed by flow cytometry, bioluminescent imaging, and animal survival. Results When given s.c., CNT-CpG response was mostly local, and it only modestly inhibited the growth of i.c. melanomas. However, i.c. CNT-CpG abrogated the growth of not only brain, but also s.c. tumors. Furthermore, compared to s.c. injections, i.c. CNT-CpG elicited a stronger inflammatory response that resulted in more potent antitumor cytotoxicity and improved in vivo trafficking of effector cells into both i.c. and s.c. tumors. To investigate factors that accounted for these observations, CNT-CpG biodistribution and cellular inflammatory responses were examined in both tumor locations. Intracranial melanomas retained the CNT-CpG particles longer and were infiltrated by TLR-9-positive microglia. In contrast, myeloid-derived suppressive cells were more abundant in s.c. tumors. Although depletion of these cells prior to s.c. CNT-CpG therapy enhanced its cytotoxic responses, antitumor responses to brain melanomas were unchanged. Conclusions These findings suggest that intracerebral CNT-CpG immunotherapy is more effective than systemic therapy in generating antitumor responses that target both brain and systemic melanomas. PMID:22904105
Fan, Haitao; Zhang, Ian; Chen, Xuebo; Zhang, Leying; Wang, Huaqing; Da Fonseca, Anna; Manuel, Edwin R; Diamond, Don J; Raubitschek, Andrew; Badie, Behnam
2012-10-15
Recently, we showed that intratumoral delivery of low-dose, immunostimulatory CpG oligodeoxynucleotides conjugated with carbon nanotubes (CNT-CpG) was more effective than free CpG and not only eradicated intracranial (i.c.) gliomas but also induced antitumor immunity that protected mice from subsequent i.c. or systemic tumor rechallenge. Here, we examined whether the same "intracerebral immunotherapy" strategy could be applied to the treatment of metastatic brain tumors. Mice with both i.c. and s.c. melanomas were injected intratumorally with CNT-CpG into either location. Antitumor responses were assessed by flow cytometry, bioluminescent imaging, and animal survival. When given s.c., CNT-CpG response was mostly local, and it only modestly inhibited the growth of i.c. melanomas. However, i.c. CNT-CpG abrogated the growth of not only brain but also s.c. tumors. Furthermore, compared with s.c. injections, i.c. CNT-CpG elicited a stronger inflammatory response that resulted in more potent antitumor cytotoxicity and improved in vivo trafficking of effector cells into both i.c. and s.c. tumors. To investigate factors that accounted for these observations, CNT-CpG biodistribution and cellular inflammatory responses were examined in both tumor locations. Intracranial melanomas retained the CNT-CpG particles longer and were infiltrated by Toll-like receptor (TLR-9)-positive microglia. In contrast, myeloid-derived suppressive cells were more abundant in s.c. tumors. Although depletion of these cells before s.c. CNT-CpG therapy enhanced its cytotoxic responses, antitumor responses to brain melanomas were unchanged. These findings suggest that intracerebral CNT-CpG immunotherapy is more effective than systemic therapy in generating antitumor responses that target both brain and systemic melanomas. ©2012 AACR
Nakayama, Masashi; Bennett, Christina J.; Hicks, Jessica L.; Epstein, Jonathan I.; Platz, Elizabeth A.; Nelson, William G.; De Marzo, Angelo M.
2003-01-01
Somatic inactivation of the glutathione S-transferase-π gene (GSTP1) via CpG island hypermethylation occurs early during prostate carcinogenesis, present in ∼70% of high-grade prostatic intraepithelial neoplasia (high-grade PIN) lesions and more than 90% of adenocarcinomas. Recently, there has been a resurgence of the concept that foci of prostatic atrophy (referred to as proliferative inflammatory atrophy or PIA) may be precursor lesions for the development of prostate cancer and/or high-grade PIN. Many of the cells within PIA lesions contain elevated levels of GSTP1, glutathione S-transferase-α (GSTA1), and cyclooxygenase-II proteins, suggesting a stress response. Because not all PIA cells are positive for GSTP1 protein, we hypothesized that some of the cells within these regions acquire GSTP1 CpG island hypermethylation, increasing the chance of progression to high-grade PIN and/or adenocarcinoma. Separate regions (n =199) from 27 formalin-fixed paraffin-embedded prostates were microdissected by laser-capture microdissection (Arcturus PixCell II). These regions included normal epithelium (n = 48), hyperplasticepithelium from benign prostatic hyperplasia nodules (n = 22), PIA (n = 64), high-grade PIN (n = 32), and adenocarcinoma (n = 33). Genomic DNA was isolated and assessed for GSTP1 CpG island hypermethylation by methylation-specific polymerase chain reaction. GSTP1 CpG island hypermethylation was not detected in normal epithelium (0 of 48) or in hyperplastic epithelium (0 of 22), but was found in 4 of 64 (6.3%) PIA lesions. The difference in the frequency of GSTP1 CpG island hypermethylation between normal or hyperplastic epithelium and PIA was statistically significant (P = 0.049). Similar to studies using nonmicrodissected cases, hypermethylation was found in 22 of 32 (68.8%) high-grade PIN lesions and in 30 of 33 (90.9%) adenocarcinoma lesions. Unlike normal or hyperplastic epithelium, GSTP1 CpG island hypermethylation can be detected in some PIA
Sato, Ken; Sato, Miyuki
2017-10-01
Mitochondria contain their own DNA (mtDNA). In most sexually reproducing organisms, mtDNA is inherited maternally (uniparentally); this type of inheritance is thus referred to as 'maternal (uniparental) inheritance'. Recent studies have revealed various mechanisms to prevent the transmission of sperm-derived paternal mtDNA to the offspring, thereby ensuring maternal inheritance of mtDNA. In the nematode Caenorhabditis elegans, paternal mitochondria and their mtDNA degenerate almost immediately after fertilization and are selectively degraded by autophagy, which is referred to as 'allophagy' (allogeneic [non-self] organelle autophagy). In the fruit fly Drosophila melanogaster, paternal mtDNA is largely eliminated by an endonuclease G-mediated mechanism. Paternal mitochondria are subsequently removed by endocytic and autophagic pathways after fertilization. In many mammals, including humans, paternal mitochondria enter fertilized eggs. However, the fate of paternal mitochondria and their mtDNA in mammals is still a matter of debate. In this review, we will summarize recent knowledge on the molecular mechanisms underlying the prevention of paternal mtDNA transmission, which ensures maternal mtDNA inheritance in animals. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
Luo, Jing; Fu, Chang-geng; Xu, Hao
2015-04-01
The inheritance of famous old traditional Chinese medicine (TCM) doctors plays an essential role in the fields of TCM research. Qualitative interviews allow for subjectivity and individuality within clinical experience as well as academic ideas of doctors, making it a potential appropriate research method for inheritance of famous old TCM doctors. We summarized current situations of inheritance research on famous old TCM doctors, and then discussed the feasibility of applying qualitative interviews in inheritance of famous old TCM doctors. By combining our experience in research on inheritance of famous old TCM doctors, we gave some advice on study design, interview implementation, data transcription and analyses , and report writing, providing a reference for further relevant research.
Countering the New Media: The Resurgence of Inheritance Effects in Primetime Network Television.
ERIC Educational Resources Information Center
Davis, Donald M.; Walker, James R.
A study examined the impact of remote control devices, videocassette recorders, and cable television on inheritance effects (the tendency for viewers to continue watching a channel at the conclusion of a program). Inheritance effects were measured by calculating the correlation between program share and lead-in program share for all primetime…
Vector platforms for gene therapy of inherited retinopathies
Trapani, Ivana; Puppo, Agostina; Auricchio, Alberto
2014-01-01
Inherited retinopathies (IR) are common untreatable blinding conditions. Most of them are inherited as monogenic disorders, due to mutations in genes expressed in retinal photoreceptors (PR) and in retinal pigment epithelium (RPE). The retina’s compatibility with gene transfer has made transduction of different retinal cell layers in small and large animal models via viral and non-viral vectors possible. The ongoing identification of novel viruses as well as modifications of existing ones based either on rational design or directed evolution have generated vector variants with improved transduction properties. Dozens of promising proofs of concept have been obtained in IR animal models with both viral and non-viral vectors, and some of them have been relayed to clinical trials. To date, recombinant vectors based on the adeno-associated virus (AAV) represent the most promising tool for retinal gene therapy, given their ability to efficiently deliver therapeutic genes to both PR and RPE and their excellent safety and efficacy profiles in humans. However, AAVs’ limited cargo capacity has prevented application of the viral vector to treatments requiring transfer of genes with a coding sequence larger than 5 kb. Vectors with larger capacity, i.e. nanoparticles, adenoviral and lentiviral vectors are being exploited for gene transfer to the retina in animal models and, more recently, in humans. This review focuses on the available platforms for retinal gene therapy to fight inherited blindness, highlights their main strengths and examines the efforts to overcome some of their limitations. PMID:25124745
Links between DNA methylation and nucleosome occupancy in the human genome.
Collings, Clayton K; Anderson, John N
2017-01-01
DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.
Fitness and inheritance of metaflumizone resistance in Plutella xylostella.
Shen, Jun; Li, Dongyang; Zhang, Shuzhen; Zhu, Xun; Wan, Hu; Li, Jianhong
2017-06-01
The diamondback moth, Plutella xylostella (L.) has developed resistance to many types of insecticides in the field. To study inheritance and fitness cost of metaflumizone resistance, a susceptible strain of diamondback moth was continuously selected with metaflumizone during 37 generations under laboratory conditions. The resistance to metaflumizone was at a high level (resistance ratios from 250.37 to 1450.47-fold). We investigated a metaflumizone resistance strain (G 27 ) and a susceptible strain of P. xylostella, using the age-stage, two-sex life table approach. Compared to the susceptible strain, egg duration, the developmental time of the first and second instar larvae, pupae duration, adult preoviposition period (APOP), total preoviposition period (TPOP), egg hatchability, the survival rate of second instar larva and the mean generation time (T) were significantly differences in the resistant strain. The resistant strain had a relative fitness of 0.78. The inheritance of metaflumizone resistance was also studied by crossing the metaflumizone resistant and susceptible populations. Results revealed an autosomal and incompletely recessive mode of inheritance for metaflumizone resistance in the resistant population of P. xylostella. The present study provided useful information for planning potential management strategies to delay development of metaflumizone resistance in P. xylostella. Copyright © 2017 Elsevier Inc. All rights reserved.
Harrison, T.M.; Aleinikoff, J.N.; Compston, W.
1987-01-01
U-Pb analyses of zircons separated from two Concord-type plutons near Sunapee and Dixville Notch, New Hampshire, reveal differences in the pattern and magnitude of zircon inheritance which are related to differences in melt chemistry. The Sunapee pluton contains only slightly more Zr than required to saturate the melt at the peak temperature of 700 ?? 30??C. Traces of inherited zircon in this separate are inferred to be present as small, largely resorbed grains. In contrast, the Long Mountain pluton, near Dixville Notch, contains about 240% more Zr than required to saturate the melt. Thus, more than half of the Zr existed as stable, inherited zircon crystals during the partial fusion event, consistent with the observation of substantial inheritance in all grain size fractions. Ion probe intra-grain analyses of zircon from the Long Mountain pluton indicate a complex pattern of inheritance with contributions from at least two Proterozoic terrenes and caution against simple interpretations of upper and lower intercepts of chords containing an inherited component. Ion probe analyses of zircons from the Sunapee pluton reveal clear evidence of U loss which results in incorrect apparent conventional U-Pb ages. Ages of crystallization for the Long Mountain and Sunapee pluton are ~350 and 354 ?? 5 Ma, respectively. A Sm/Nd measurement for the Long Mountain pluton yields a depleted mantle model age of 1.5 Ga, consistent with the observed inheritance pattern. In contrast, a Sm/Nd model age for the Sunapee pluton is improbably old due to minor monazite fractionation. ?? 1987.
Mutational analysis of the RB1 gene and the inheritance patterns of retinoblastoma in Jordan.
Yousef, Yacoub A; Tbakhi, Abdelghani; Al-Hussaini, Maysa; AlNawaiseh, Ibrahim; Saab, Ala; Afifi, Amal; Naji, Maysa; Mohammad, Mona; Deebajah, Rasha; Jaradat, Imad; Sultan, Iyad; Mehyar, Mustafa
2018-04-01
Retinoblastoma (RB) is a childhood cancer developing in the retina due to RB1 pathologic variant. Herein we are evaluating the oncogenic mutations in the RB1 gene and the inheritance patterns of RB in the Jordanian patients. In this prospective study, the peripheral blood of 50 retinoblastoma patients was collected, genomic DNA was extracted, mutations were identified using Quantitative multiplex PCR (QM-PCR), Allele-specific PCR, Next Generation Sequencing analysis, and Sanger sequencing. In this cohort of 50 patients, 20(40%) patients had unilateral RB and 30(60%) were males. Overall, 36(72%) patients had germline disease, 17(47%) of whom had the same RB1 pathologic variant detected in one of the parents (inherited disease). In the bilateral group, all (100%) patients had germline disease; 13(43%) of them had inherited mutation. In the unilateral group, 6(30%) had germline disease, 4(20%) of them had inherited mutation. Nonsense mutation generating a stop codon and producing a truncated non-functional protein was the most frequent detected type of mutations (n = 15/36, 42%). Only one (2%) of the patients had mosaic mutation, and of the 17 inherited cases, 16(94%) had an unaffected carrier parent. In conclusion, in addition to all bilateral RB patients in our cohort, 30% of unilateral cases showed germline mutation. Almost half (47%) of germline cases had inherited disease from affected (6%) parent or unaffected carrier (94%). Therefore molecular screening is critical for the genetic counseling regarding the risk for inherited RB in both unilateral and bilateral cases including those with no family history.
Familial mesial temporal lobe epilepsy: a benign epilepsy syndrome showing complex inheritance.
Crompton, Douglas E; Scheffer, Ingrid E; Taylor, Isabella; Cook, Mark J; McKelvie, Penelope A; Vears, Danya F; Lawrence, Kate M; McMahon, Jacinta M; Grinton, Bronwyn E; McIntosh, Anne M; Berkovic, Samuel F
2010-11-01
Temporal lobe epilepsy is the commonest partial epilepsy of adulthood. Although generally perceived as an acquired disorder, several forms of familial temporal lobe epilepsy, with mesial or lateral seizure semiology, have been described. Descriptions of familial mesial temporal lobe epilepsy have varied widely from a benign epilepsy syndrome with prominent déjà vu and without antecedent febrile seizures or magnetic resonance imaging abnormalities, to heterogeneous, but generally more refractory epilepsies, often with a history of febrile seizures and with frequent hippocampal atrophy and high T₂ signal on magnetic resonance imaging. Compelling evidence of a genetic aetiology (rather than chance aggregation) in familial mesial temporal lobe epilepsy has come from twin studies. Dominant inheritance has been reported in two large families, though the usual mode of inheritance is not known. Here, we describe clinical and neurophysiological features of 20 new mesial temporal lobe epilepsy families including 51 affected individuals. The epilepsies in these families were generally benign, and febrile seizure history was infrequent (9.8%). No evidence of hippocampal sclerosis or dysplasia was present on brain imaging. A single individual underwent anterior temporal lobectomy, with subsequent seizure freedom and histopathological evidence of hippocampal sclerosis was not found. Inheritance patterns in probands' relatives were analysed in these families, together with 19 other temporal lobe epilepsy families previously reported by us. Observed frequencies of epilepsies in relatives were lower than predicted by dominant Mendelian models, while only a minority (8/39) of families could be compatible with recessive inheritance. These findings strongly suggest that complex inheritance, similar to that widely accepted in the idiopathic generalized epilepsies, is the usual mode of inheritance in familial mesial temporal lobe epilepsy. This disorder, which appears to be
Dominant inheritance of cerebral gigantism.
Zonana, J; Sotos, J F; Romshe, C A; Fisher, D A; Elders, M J; Rimoin, D L
1977-08-01
Cerebral gigantism is a syndrome consisting of characteristic dysmorphic features, accelerated growth in early childhood, and variable degrees of mental retardation. Its etiology and pathogenesis have not been defined. Three families are presented with multiple affected members. The vertical transmission of the trait and equal expression in both sexes in these families indicates a genetic etiology with a dominant pattern of inheritance, probably autosomal. As in previously reported cases, extensive endocrine evaluation failed to define the pathogenesis of the accelerated growth present in this disorder.
Understanding Genetics and Inheritance in Rural Schools
ERIC Educational Resources Information Center
Kibuka-Sebitosi, Esther
2007-01-01
Conducted in urban and rural schools in two provinces of South Africa, the present study reports biology learners' understanding of concepts about genetics and inheritance. Participants were Grade 11 and 12 learners, aged 15-16 years. The tools included a written questionnaire, interviews, pre- and post-paper and pencil tests and focus group…
Quisumbing, A R
1994-04-01
The author presents findings from a study of education, land, and nonland asset transfers from parents to children in 344 households in five rice villages in the Philippines. A model with family fixed effects is developed which explains transfers better than either individual heterogeneity or observed parent and child characteristics without family fixed effects. Analysis revealed that families facing different land constraints exhibit significantly different patterns of educational investment in children. In a subsample with completed inheritance, daughters receive less education, land, and total inheritance, but are compensated with nonland assets. Parents also exhibit preferential behavior toward children of the same gender such that daughters of better educated mothers receive more land, nonland assets, and total inheritance. Better educated fathers, however, give land preferentially to sons, but favor daughters in education.
Combined prevalence of inherited skeletal disorders in dog breeds in Belgium.
Coopman, F; Broeckx, B; Verelst, E; Deforce, D; Saunders, J; Duchateau, L; Verhoeven, G
2014-01-01
Canine hip dysplasia (CHD), canine elbow dysplasia (CED), and humeral head osteochondrosis (HHOC) are inherited traits with uneven incidence in dog breeds. Knowledge of the combined prevalence of these three disorders is necessary to estimate the effect of the currently applied breeding strategies, in order to improve the genetic health of the population. Official screening results of the Belgian National Committee for Inherited Skeletal Disorders (NCSID) revealed that an average of 31.8% (CHD, CED, or both; n = 1273 dogs) and 47.2% (CHD, CED, HHOC, or a combination of these three diseases; n = 250 dogs) of dogs are mildly to severely affected by at least one skeletal disorder. According to the current breeding recommendations in some dog breeds in Belgium, these animals should be restricted (mild signs) or excluded (moderate to severe signs) from breeding. The introduction of genetic parameters, such as estimated breeding values, might create a better approach to gradually reduce the incidence of these complex inherited joint disorders, without compromising genetic population health.
Zhang, Jinling; Zhu, Xuebin; Li, Yuhong; Zhu, Lingyan; Li, Shiming; Zheng, Guoying; Ren, Qi; Xiao, Yonghong; Feng, Fumin
2016-08-01
This study investigated the role of CpG island methylation of the CYP2E1 and CYP2D6 genes in liver injury induced by anti-TB drugs from an epigenetic perspective in a Chinese cohort. A 1:1 matched nested case-control study design was applied. Pulmonary tuberculosis (TB) patients, who underwent standard anti-TB therapy and developed liver injury were defined as cases, while those who did not develop liver injury were defined as control. The two groups were matched in terms of sex, treatment regimen, and age. In 114 pairs of cases, CpG island methylation levels of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of anti-TB drug-induced liver injury (ADLI), with odds ratio (OR) values of 2.429 and 3.500, respectively (p < 0.01). Moreover, through multivariate logistic regression analysis, CpG island methylation of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of ADLI, with adjusted OR values of 4.390 (95% confidence interval (CI): 1.982-9.724) and 9.193 (95% CI: 3.624-25.888), respectively (p < 0.001). These results suggest that aberrantly elevated methylation of CpG islands of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA may increase the risk of ADLI in Chinese TB patients.
Chung, Sharon A; Nititham, Joanne; Elboudwarej, Emon; Quach, Hong L; Taylor, Kimberly E; Barcellos, Lisa F; Criswell, Lindsey A
2015-01-01
Systemic lupus erythematosus (SLE) is characterized by the development of autoantibodies associated with specific clinical manifestations. Previous studies have shown an association between differential DNA methylation and SLE susceptibility, but have not investigated SLE-related autoantibodies. Our goal was to determine whether DNA methylation is associated with production of clinically relevant SLE-related autoantibodies, with an emphasis on the anti-dsDNA autoantibody. In this study, we characterized the methylation status of 467,314 CpG sites in 326 women with SLE. Using a discovery and replication study design, we identified and replicated significant associations between anti-dsDNA autoantibody production and the methylation status of 16 CpG sites (pdiscovery<1.07E-07 and preplication<0.0029) in 11 genes. Associations were further investigated using multivariable regression to adjust for estimated leukocyte cell proportions and population substructure. The adjusted mean DNA methylation difference between anti-dsDNA positive and negative cases ranged from 1.2% to 19%, and the adjusted odds ratio for anti-dsDNA autoantibody production comparing the lowest and highest methylation tertiles ranged from 6.8 to 18.2. Differential methylation for these CpG sites was also associated with anti-SSA, anti-Sm, and anti-RNP autoantibody production. Overall, associated CpG sites were hypomethylated in autoantibody positive compared to autoantibody negative cases. Differential methylation of CpG sites within the major histocompatibility region was not strongly associated with autoantibody production. Genes with differentially methylated CpG sites represent multiple biologic pathways, and have not been associated with autoantibody production in genetic association studies. In conclusion, hypomethylation of CpG sites within genes from different pathways is associated with anti-dsDNA, anti-SSA, anti-Sm, and anti-RNP production in SLE, and these associations are not explained by
Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns
NASA Astrophysics Data System (ADS)
Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong
2003-04-01
A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.
Inherited Disorders of Bilirubin Clearance
Memon, Naureen; Weinberger, Barry I; Hegyi, Thomas; Aleksunes, Lauren M
2016-01-01
Inherited disorders of hyperbilirubinemia may be caused by increased bilirubin production or decreased bilirubin clearance. Reduced hepatic bilirubin clearance can be due to defective 1) unconjugated bilirubin uptake and intrahepatic storage, 2) conjugation of glucuronic acid to bilirubin (e.g. Gilbert syndrome, Crigler-Najjar syndrome, Lucey-Driscoll syndrome, breast milk jaundice), 3) bilirubin excretion into bile (Dubin-Johnson syndrome), or 4) conjugated bilirubin re-uptake (Rotor syndrome). In this review, the molecular mechanisms and clinical manifestations of these conditions are described, as well as current approaches to diagnosis and therapy. PMID:26595536
Neuromuscular imaging in inherited muscle diseases
Kley, Rudolf A.; Fischer, Dirk
2010-01-01
Driven by increasing numbers of newly identified genetic defects and new insights into the field of inherited muscle diseases, neuromuscular imaging in general and magnetic resonance imaging (MRI) in particular are increasingly being used to characterise the severity and pattern of muscle involvement. Although muscle biopsy is still the gold standard for the establishment of the definitive diagnosis, muscular imaging is an important diagnostic tool for the detection and quantification of dystrophic changes during the clinical workup of patients with hereditary muscle diseases. MRI is frequently used to describe muscle involvement patterns, which aids in narrowing of the differential diagnosis and distinguishing between dystrophic and non-dystrophic diseases. Recent work has demonstrated the usefulness of muscle imaging for the detection of specific congenital myopathies, mainly for the identification of the underlying genetic defect in core and centronuclear myopathies. Muscle imaging demonstrates characteristic patterns, which can be helpful for the differentiation of individual limb girdle muscular dystrophies. The aim of this review is to give a comprehensive overview of current methods and applications as well as future perspectives in the field of neuromuscular imaging in inherited muscle diseases. We also provide diagnostic algorithms that might guide us through the differential diagnosis in hereditary myopathies. PMID:20422195
[Mitochondria inheritance in yeast saccharomyces cerevisiae].
Fizikova, A Iu
2011-01-01
The review is devoted to the main mechanisms of mitochondria inheritance in yeast Saccharonmyces cerevisiae. The genetic mechanisms of functionally active mitochondria inheritance in eukaryotic cells is one of the most relevant in modem researches. A great number of genetic diseases are associated with mitochondria dysfunction. Plasticity of eukaryotic cell metabolism according to the environmental changes is ensured by adequate mitochondria functioning by means of ATP synthesis coordination, reactive oxygen species accumulation, apoptosis regulation and is an important factor of cell adaptation to stress. Mitochondria participation in important for cell vitality processes masters the presence of accurate mechanisms of mitochondria functions regulation according to environment fluctuations. The mechanisms of mitochondria division and distribution are highly conserved. Baker yeast S. cerevisiae is an ideal model object for mitochondria researches due to energetic metabolism lability, ability to switch over respiration to fermentation, and petite-positive phenotype. Correction of metabolism according to the environmental changes is necessary for cell vitality. The influence of respiratory, carbon, amino acid and phosphate metabolism on mitochondria functions was shown. As far as the mechanisms that stabilize functions of mitochondria and mtDNA are highly conserve, we can project yeast regularities on higher eukaryotes systems. This makes it possible to approximate understanding the etiology and pathogenesis of a great number of human diseases.
Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan
2012-01-01
Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110
Paternal inheritance of classic X-linked bilateral periventricular nodular heterotopia.
Kasper, Burkhard S; Kurzbuch, Katrin; Chang, Bernard S; Pauli, Elisabeth; Hamer, Hajo M; Winkler, Jürgen; Hehr, Ute
2013-06-01
Periventricular nodular heterotopia (PNH) is a developmental disorder of the central nervous system, characterized by heterotopic nodules of gray matter resulting from disturbed neuronal migration. The most common form of bilateral PNH is X-linked dominant inherited, caused by mutations in the Filamin A gene (FLNA) and associated with a wide variety of other clinical findings including congenital heart disease. The typical patient with FLNA-associated PNH is female and presents with difficult to treat seizures. In contrast, hemizygous FLNA loss of function mutations in males are reported to be perinatally lethal. In X-linked dominant traits like FLNA-associated PNH the causal mutation is commonly inherited from the mother. Here, we present an exceptional family with paternal transmission of classic bilateral FLNA-associated PNH from a mildly affected father with somatic and germline mosaicism for a c.5686G>A FLNA splice mutation to both daughters with strikingly variable clinical manifestation and PNH extent in cerebral MR imaging. Our observations emphasize the importance to consider in genetic counseling and risk assessment the rare genetic constellation of paternal transmission for families with X-linked dominant inherited FLNA-associated PNH. Copyright © 2013 Wiley Periodicals, Inc.
Comprehensive analysis of Arabidopsis expression level polymorphisms with simple inheritance
Plantegenet, Stephanie; Weber, Johann; Goldstein, Darlene R; Zeller, Georg; Nussbaumer, Cindy; Thomas, Jérôme; Weigel, Detlef; Harshman, Keith; Hardtke, Christian S
2009-01-01
In Arabidopsis thaliana, gene expression level polymorphisms (ELPs) between natural accessions that exhibit simple, single locus inheritance are promising quantitative trait locus (QTL) candidates to explain phenotypic variability. It is assumed that such ELPs overwhelmingly represent regulatory element polymorphisms. However, comprehensive genome-wide analyses linking expression level, regulatory sequence and gene structure variation are missing, preventing definite verification of this assumption. Here, we analyzed ELPs observed between the Eil-0 and Lc-0 accessions. Compared with non-variable controls, 5′ regulatory sequence variation in the corresponding genes is indeed increased. However, ∼42% of all the ELP genes also carry major transcription unit deletions in one parent as revealed by genome tiling arrays, representing a >4-fold enrichment over controls. Within the subset of ELPs with simple inheritance, this proportion is even higher and deletions are generally more severe. Similar results were obtained from analyses of the Bay-0 and Sha accessions, using alternative technical approaches. Collectively, our results suggest that drastic structural changes are a major cause for ELPs with simple inheritance, corroborating experimentally observed indel preponderance in cloned Arabidopsis QTL. PMID:19225455
Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.
Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya
2014-03-20
Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity
Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei
2017-01-01
Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025
Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele
2011-05-26
The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.
2011-01-01
Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918
Radio-induced inherited sterility in Heliothis zea (Boddie)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carpenter, J.E.
1985-01-01
Heliothis zea (Boddie) (Lepidoptera: Noctuidae) males and females were irradiated with substerilizing doses of radiation. These moths were inbred and outcrossed and observed for their ability to reproduce. The inherited deleterious effects resulting from the irradiated P/sub 1/ males were recorded for several generations. Larvae from both irradiated (10 krad) and normal parents were compared for their ability to survive under field conditions on whole-stage sweet corn and these results were compared with those from a laboratory study using meridic diet. Irradiated males and females and F/sub 1/ males from an irradiated (10 krad) male x normal female cross weremore » released in the field and in field cages and observed for their ability to search/attract and secure a mate. Females that had mated with normal and irradiated (10 krad) males were studied to determine the effect of different mating histories on the subsequent mating propensity of the females. A 10-krad dose of radiation induced deleterious effects which were inherited through the F/sub 2/ generation. These radiation-induced deleterious effects were similar to those reported in other species of Lepidoptera. The relationship between the survival of normal larvae and larvae from irradiated parents was similar under laboratory and field rearing conditions. Females mated to normal males and males irradiated with 10 krad had the same mating propensity and experienced the same intermating interval. These effects of substerilizing doses of radiation and inherited sterility on the reproductive ability and behavior of H. zea suggest that a great potential exists for population suppression.« less
Song, Guanli; Wang, Yinghui; Zhang, Runshun; Liu, Baoyan; Zhou, Xuezhong; Zhou, Xiaji; Zhang, Hong; Guo, Yufeng; Xue, Yanxing; Xu, Lili
2014-09-01
The current modes of experience inheritance from famous specialists in traditional Chinese medicine (TCM) include master and disciple, literature review, clinical-epidemiology-based clinical research observation, and analysis and data mining via computer and database technologies. Each mode has its advantages and disadvantages. However, a scientific and instructive experience inheritance mode has not been developed. The advent of the big data era as well as the formation and practice accumulation of the TCM clinical research paradigm in the real world have provided new perspectives, techniques, and methods for inheriting experience from famous TCM specialists. Through continuous exploration and practice, the research group proposes the innovation research mode based on the real-world TCM clinical research paradigm, which involves the inheritance and innovation of the existing modes. This mode is formulated in line with its own development regularity of TCM and is expected to become the main mode of experience inheritance in the clinical field.
Inheritance of astigmatism: evidence for a major autosomal dominant locus.
Clementi, M; Angi, M; Forabosco, P; Di Gianantonio, E; Tenconi, R
1998-01-01
Although astigmatism is a frequent refractive error, its mode of inheritance remains uncertain. Complex segregation analysis was performed, by the POINTER and COMDS programs, with data from a geographically well-defined sample of 125 nuclear families of individuals affected by astigmatism. POINTER could not distinguish between alternative genetic models, and only the hypothesis of no familial transmission could be rejected. After inclusion of the severity parameter, COMDS results defined a genetic model for corneal astigmatism and provided evidence for single-major-locus inheritance. These results suggest that genetic linkage studies could be implemented and that they should be limited to multiplex families with severely affected individuals. PMID:9718344
Dai, Wei; Siddiq, Afshan; Walley, Andrew J; Limpaiboon, Temduang; Brown, Robert
2013-01-01
Genetic abnormalities of cholangiocarcinoma have been widely studied; however, epigenomic changes related to cholangiocarcinogenesis have been less well characterised. We have profiled the DNA methylomes of 28 primary cholangiocarcinoma and six matched adjacent normal tissues using Infinium’s HumanMethylation27 BeadChips with the aim of identifying gene sets aberrantly epigenetically regulated in this tumour type. Using a linear model for microarray data we identified 1610 differentially methylated autosomal CpG sites with 809 CpG sites (representing 603 genes) being hypermethylated and 801 CpG sites (representing 712 genes) being hypomethylated in cholangiocarcinoma versus adjacent normal tissues (false discovery rate ≤ 0.05). Gene ontology and gene set enrichment analyses identified gene sets significantly associated with hypermethylation at linked CpG sites in cholangiocarcinoma including homeobox genes and target genes of PRC2, EED, SUZ12 and histone H3 trimethylation at lysine 27. We confirmed frequent hypermethylation at the homeobox genes HOXA9 and HOXD9 by bisulfite pyrosequencing in a larger cohort of cholangiocarcinoma (n = 102). Our findings indicate a key role for hypermethylation of multiple CpG sites at genes associated with a stem cell-like phenotype as a common molecular aberration in cholangiocarcinoma. These data have implications for cholangiocarcinogenesis, as well as possible novel treatment options using histone methyltransferase inhibitors. PMID:24089088
Kim, Youl-Ri; Kim, Jeong-Hyun; Kim, Mi Jeong; Treasure, Janet
2014-01-01
Recent studies in patients with anorexia nervosa suggest that oxytocin may be involved in the pathophysiology of anorexia nervosa. We examined whether there was evidence of variation in methylation status of the oxytocin receptor (OXTR) gene in patients with anorexia nervosa that might account for these findings. We analyzed the methylation status of the CpG sites in a region from the exon 1 to the MT2 regions of the OXTR gene in buccal cells from 15 patients and 36 healthy women using bisulfite sequencing. We further examined whether methylation status was associated with markers of illness severity or form. We identified six CpG sites with significant differences in average methylation levels between the patient and control groups. Among the six differentially methylated CpG sites, five showed higher than average methylation levels in patients than those in the control group (64.9-88.8% vs. 6.6-45.0%). The methylation levels of these five CpG sites were negatively associated with body mass index (BMI). BMI, eating disorders psychopathology, and anxiety were identified in a regression analysis as factors affecting the methylation levels of these CpG sites with more variation accounted for by BMI. Epigenetic misregulation of the OXTR gene may be implicated in anorexia nervosa, which may either be a mechanism linking environmental adversity to risk or may be a secondary consequence of the illness.
RAPD inheritance and diversity in pawpaw (Asimina triloba)
Hongwen Huang; Desmond R. Layne; Thomas L. Kubisiak
2000-01-01
Twelve, 10-base primers amplified a total of 20 intense and easily scorable polymorphic bands in an interspecific cross of PPFl-5 pawpaw (Asimina triloba (L.) Dunal.) x RET (Asimina reticulata Shuttlew.). In this cross, all bands scored were present in, and inherited from, the A. triloba ...
Dominantly inherited syndrome of microcephaly and cleft palate.
Halal, F
1983-05-01
Two sisters and their mother had a syndrome of microcephaly, cleft palate, and variable anomalies such as unusual facial appearance, hypotelorism, abnormal retinal pigmentation, maxillary hypoplasia, goiter, camptodactyly, mild mental retardation, and abnormal dermatoglyphics. This is an evidently dominantly inherited trait, either autosomal or X-linked.
Navigating the current landscape of clinical genetic testing for inherited retinal dystrophies.
Lee, Kristy; Garg, Seema
2015-04-01
Inherited eye disorders are a significant cause of vision loss. Genetic testing can be particularly helpful for patients with inherited retinal dystrophies because of genetic heterogeneity and overlapping phenotypes. The need to identify a molecular diagnosis for retinal dystrophies is particularly important in the era of developing novel gene therapy-based treatments, such as the RPE65 gene-based clinical trials and others on the horizon, as well as recent advances in reproductive options. The introduction of massively parallel sequencing technologies has significantly advanced the identification of novel gene candidates and has expanded the landscape of genetic testing. In a relatively short time clinical medicine has progressed from limited testing options to a plethora of choices ranging from single-gene testing to whole-exome sequencing. This article outlines currently available genetic testing and factors to consider when selecting appropriate testing for patients with inherited retinal dystrophies.
Lamarck, Evolution, and the Inheritance of Acquired Characters
Burkhardt, Richard W.
2013-01-01
Scientists are not always remembered for the ideas they cherished most. In the case of the French biologist Jean-Baptiste Lamarck, his name since the end of the nineteenth century has been tightly linked to the idea of the inheritance of acquired characters. This was indeed an idea that he endorsed, but he did not claim it as his own nor did he give it much thought. He took pride instead in advancing the ideas that (1) nature produced successively all the different forms of life on earth, and (2) environmentally induced behavioral changes lead the way in species change. This article surveys Lamarck’s ideas about organic change, identifies several ironies with respect to how his name is commonly remembered, and suggests that some historical justice might be done by using the adjective “Lamarckian” to denote something more (or other) than a belief in the inheritance of acquired characters. PMID:23908372
Environmentally Induced Epigenetic Transgenerational Inheritance of Ovarian Disease
Nilsson, Eric; Larsen, Ginger; Manikkam, Mohan; Guerrero-Bosagna, Carlos; Savenkova, Marina I.; Skinner, Michael K.
2012-01-01
The actions of environmental toxicants and relevant mixtures in promoting the epigenetic transgenerational inheritance of ovarian disease was investigated with the use of a fungicide, a pesticide mixture, a plastic mixture, dioxin and a hydrocarbon mixture. After transient exposure of an F0 gestating female rat during embryonic gonadal sex determination, the F1 and F3 generation progeny adult onset ovarian disease was assessed. Transgenerational disease phenotypes observed included an increase in cysts resembling human polycystic ovarian disease (PCO) and a decrease in the ovarian primordial follicle pool size resembling primary ovarian insufficiency (POI). The F3 generation granulosa cells were isolated and found to have a transgenerational effect on the transcriptome and epigenome (differential DNA methylation). Epigenetic biomarkers for environmental exposure and associated gene networks were identified. Epigenetic transgenerational inheritance of ovarian disease states was induced by all the different classes of environmental compounds, suggesting a role of environmental epigenetics in ovarian disease etiology. PMID:22570695
From rifting to subduction: the role of inheritance in the Wilson Cycle
NASA Astrophysics Data System (ADS)
Beaussier, Stéphane; Gerya, Taras; Burg, Jean-Pierre
2017-04-01
The Wilson Cycle entails that oceans close and reopen. This cycle is a fundamental principle in plate tectonics, inferring continuity from divergence to convergence and that continental rifting takes place along former suture zones. This view questions the role of inherited structures at each stage of the Wilson Cycle. Using the 3D thermo-mechanical code, I3ELVIS (Gerya and Yuen 2007) we present a high-resolution continuous model of the Wilson cycle from continental rifting, breakup and oceanic spreading to convergence and spontaneous subduction initiation. Therefore, all lateral and longitudinal structures of the lithospheres are generated self-consistently and are consequences of the initial continental structure, tectono-magmatic inheritance and material rheology. In the models, subduction systematically initiates off-ridge and is controlled by the convergence-induced swelling of the ridge. Geometry and dynamics of the developing off-ridge subduction is controlled by four main factors: (1) the obliquity of the ridge with respect to the convergence direction; (2) fluid-induced weakening of the oceanic crust; (3) irregularity of ridge and margins inherited from rifting and spreading; (4) strain localization at transform faults formed during ocean floor spreading. Further convergence can lead to obduction of the oceanic crust and segments of ridge after the oceanic lithosphere is entrained into subduction. We show that the main parameters controlling the occurrence and geometry of obducted ophiolite are the convergence rate and the inherited structure of the passive margins and ridge. Our numerical experiments results show the essential role played by inheritance during the Wilson Cycle and are consistent with nature observations such as the tectonic history of the Oman subduction-obduction system. REFERENCES Gerya, T. V., and D. A. Yuen. 2007: "Robust Characteristics Method for Modelling Multiphase Visco-Elasto-Plastic Thermo-Mechanical Problems, Physics of the
Induction of anti-glioma NK cell response following multiple low-dose intracerebral CpG therapy
Alizadeh, Darya; Zhang, Leying; Brown, Christine E.; Farrukh, Omar; Jensen, Michael C.; Badie, Behnam
2010-01-01
Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG-ODN) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. These studies, however, have used high doses of CpG-ODN which can induce toxicity in a clinical setting. The goal of this study was to evaluate the anti-tumor efficacy of multiple low-dose intratumoral CpG- ODN in a glioma model. Experimental Design Mice bearing four-day old intracranial GL261 gliomas received a single or multiple (two or four) intratumoral injections of CpG-ODN (3 μg) every 4 days. Tumor growth was measured by bioluminescent imaging, brain histology, and animal survival. Flow cytometry and cytotoxicity assays were used to assess anti-glioma immune response. Results Two and four intracranial injections of low-dose CpG-ODN, but not a single injection, eradicated gliomas in 70% of mice. Moreover, surviving animals exhibited durable tumor free remission (> 3 months), and were protected from intracranial rechallenge with GL21 gliomas, demonstrating the capacity for long-term anti-tumor immunity. Although most inflammatory cells appeared to increase, activated NK cells (i.e. NK+CD107a+) were more frequent than CD8+CD107a+ in the brains of rechallenged CpG-ODN-treated animals and demonstrated a stronger in vitro cytotoxicity against GL261 target cells. Leukocyte depletion studies confirmed that NK cells played an important role in the initial CpG-ODN anti-tumor response, but both CD8 and NK cells were equally important in long-term immunity against gliomas. Conclusions These findings suggest that multiple low-dose intratumoral injections of CpG-ODN can eradicate intracranial gliomas possibly through mechanisms involving NK mediated effector function. PMID:20570924
Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael
2016-11-22
Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72-1.40 for overall survival; HR=0.96; 95% CI=0.65-1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27-0.90) and BRAF mutation (HR=1.78; 95% CI=1.10-2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations.
Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael
2016-01-01
Background: Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. Methods: The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. Results: The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72–1.40 for overall survival; HR=0.96; 95% CI=0.65–1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27–0.90) and BRAF mutation (HR=1.78; 95% CI=1.10–2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. Conclusions: CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations. PMID:27811854
[Study on the mode of inheritance for familial polycystic ovary syndrome].
Mao, W; Li, M; Chen, Y; Lu, C; Wang, Y; Zhang, X; Qiao, J; Wang, A
2001-02-01
To investigate the mode of inheritance of polycystic ovary syndrome(PCOS). The first female relatives with irregular cycle and the first male relatives with premature balding in each nuclear family were designated the affected. Their prevalence rates in families were respectively calculated. Analyses of segregation ratio were carried out among 139 nuclear families with PCOS by the methods of simple segregation and complex segregation of genetic epidemiology, respectively. The prevalence rates of irregular cycle among mothers and sisters with PCOS were 37.4% and 33.1% respectively, and the prevalence rates of premature balding among fathers and brothers of patients were 19.4% and 6.5%, respectively. The simple segregation analysis indicated that the segregation ratio of PCOS trait in siblings was 0.3023, the complex segregation analysis indicated that it fitted in with the inheritance model of co-dominant disorder with full penetrance and sporadic cases. The frequency of homozygote of disease gene in population was 0.046. PCOS presents the mode of co-dominant inheritance with complete penetrance.
Willis, T A; Potrata, B; Ahmed, M; Hewison, J; Gale, R; Downey, L; McKibbin, M
2013-09-01
The views of people with inherited retinal disease are important to help develop health policy and plan services. This study aimed to record levels of understanding of and attitudes to genetic testing for inherited retinal disease, and views on the availability of testing. Telephone questionnaires comprising quantitative and qualitative items were completed with adults with inherited retinal disease. Participants were recruited via postal invitation (response rate 48%), approach at clinic or newsletters of relevant charitable organisations. Questionnaires were completed with 200 participants. Responses indicated that participants' perceived understanding of genetic testing for inherited retinal disease was variable. The majority (90%) considered testing to be good/very good and would be likely to undergo genetic testing (90%) if offered. Most supported the provision of diagnostic (97%) and predictive (92%) testing, but support was less strong for testing as part of reproductive planning. Most (87%) agreed with the statement that testing should be offered only after the individual has received genetic counselling from a professional. Subgroup analyses revealed differences associated with participant age, gender, education level and ethnicity (p<0.02). Participants reported a range of perceived benefits (eg, family planning, access to treatment) and risks (eg, impact upon family relationships, emotional consequences). Adults with inherited retinal disease strongly support the provision of publicly funded genetic testing. Support was stronger for diagnostic and predictive testing than for testing as part of reproductive planning.
Pengon, Jutharat; Svasti, Saovaros; Kamchonwongpaisan, Sumalee; Vattanaviboon, Phantip
2018-03-01
Glucose-6-phosphate dehydrogenase (G-6-PD) deficiency and thalassemia are genetically independent hemolytic disorders. Co-inheritance of both disorders may affect red blood cell pathology to a greater extent than normally seen in either disorder alone. This study determines the prevalence and evaluates hematological changes of G-6-PD deficiency and thalassemia co-inheritance. G-6-PD deficiency was screened from 200 male thalassemia blood samples using a fluorescent spot test. Hematological parameters and red blood cell morphology were evaluated among G-6-PD deficiency/thalassemia co-inheritance, G-6-PD deficiency alone, thalassemia alone, and normal individuals. G-6-PD deficiency was detected together with hemoglobin (Hb) E heterozygote, Hb E homozygote, β-thalassemia trait, and β-thalassemia/Hb E, α-thalassemia-2 trait, and Hb H disease. Hb level, hematocrit, mean cell volume, and mean cell Hb of G-6-PD deficiency co-inherited with asymptomatic thalassemia carriers show significantly lower mean values compared to carriers with only the same thalassemia genotypes. Higher mean red blood cell distribution width was observed in G-6-PD deficiency co-inherited with Hb E heterozygote, as with numbers of hemighost cells in G-6-PD deficiency/thalassemia co-inheritance compared to those with either disorder. Apart from Hb level, hematological parameters of co-inheritance disorders were not different from individuals with a single thalassemia disease. G-6-PD deficiency co-inherited with thalassemia in males was present in 10% of the participants, resulting in worsening of red blood cell pathology compared with inheritance of thalassemia alone. Copyright © 2017 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.
Jackson, I M
1976-03-01
Familial hypothyroidism results from both thyroidal and extrathyroidal dysfunction. Specific intrathyroidal abnormalities in thyroid hormone synthesis causing goitrous hypothyroidism are iodide trap defect, organification defect, "coupling" defect, iodoprotein defect, and dehalogenase defect. The diagnostic studies for each are outlined utilizing radioiodine(131I) studies. Other causes of cretinism include failure of the thyroid gland to respond to TSH and lack of pituitary TSH (or hypothalamic TRH). The syndrome of peripheral resistance to thyroid hormone is discussed. The diagnosis of inherited hypothyrodism rests on an adequate family history and measurement of both T4 and TSH levels which can be determined in cord blood or peripheral blood from the infant. The importance of early treatment of hypothyroidism in the neonatal period to prevent brain damage is emphasized. The rec:nt discovery of the importance of reverse T3 (RT3) in fetal thyroid metabolism is described, and the possibility of amniocentesis as an aid in prenatal diagnosis is considered. The place of intrauterine administration of thyroid hormone to the fetus at risk from hypothyroidism is uncertain at this time and requires carefully controlled studies and long-term follow-up.
Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing
2017-01-01
ABSTRACT Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8+ lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe
Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing; Zeng, Ruihong; Wei, Lin
2017-05-15
Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8 + lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and
Koh, Young Wha; Chun, Sung-Min; Park, Young-Soo; Song, Joon Seon; Lee, Geon Kook; Khang, Shin Kwang; Jang, Se Jin
2016-08-01
Aberrant methylation of promoter CpG islands is one of the most important inactivation mechanisms for tumor suppressor and tumor-related genes. Previous studies using genome-wide DNA methylation microarray analysis have suggested the existence of a CpG island methylator phenotype (CIMP) in lung adenocarcinomas. Although the biological behavior of these tumors varies according to tumor stage, no large-scale study has examined the CIMP in lung adenocarcinoma patients according to tumor stage. Furthermore, there have been no reported results regarding the clinical significance of each of the six CIMP markers. To examine the CIMP in patients with pulmonary adenocarcinoma after a surgical resection, we performed methylation analysis of six genes (CCNA1, ACAN, GFRA1, EDARADD, MGC45800, and p16 (INK4A)) in 230 pulmonary adenocarcinoma cases using the SEQUENOM MassARRAY platform. Fifty-four patients (28 %, 54/191) were in the CIMP-high (CIMP-H) group associated with high nodal stage (P = 0.007), the presence of micropapillary or solid histology (P = 0.003), and the absence of an epidermal growth factor receptor (EGFR) mutation (P = 0.002). By multivariate analysis, CIMP was an independent prognostic marker for overall survival (OS) and disease-specific survival (P = 0.03 and P = 0.43, respectively). In the stage I subgroups alone, CIMP-H patients had lower OS rates than the CIMP-low (CIMP-L) group (P = 0.041). Of the six CIMP markers, ACAN alone was significantly associated with patient survival. CIMP predicted the risk of progression independently of clinicopathological variables and enables the stratification of pulmonary adenocarcinoma patients, particularly among stage I cases.
Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung
2014-09-01
BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Majewska-Szczepanik, Monika; Askenase, Philip W.; Lobo, Francis M.; Marcińska, Katarzyna; Wen, Li; Szczepanik, Marian
2017-01-01
Background Subcutaneous allergen-specific immunotherapy is a standard route for the immunotherapy of allergic diseases. It modulates the course of allergy and can generate long-term remission. However, subcutaneous allergen-specific immunotherapy can also induce anaphylaxis in some patients, and therefore additional routes of administration should be investigated to improve the safety and tolerability of immunotherapy. Objective We sought to determine whether epicutaneous treatment with antigen in the presence of a Toll-like receptor 9 agonist can suppress TH2-mediated responses in an antigen-specific manner. Methods Epicutaneous immunization was performed by applying a skin patch soaked with ovalbumin (OVA) plus CpG, and its suppressor activity was determined by using the mouse model of atopic dermatitis. Finally, adoptive cell transfers were implemented to characterize the regulatory cells that are induced by epicutaneous immunization. Results Epicutaneous immunization with OVA and CpG reduces the production of OVA-specific IgE and increases the synthesis of OVA-specific IgG2a antibodies in an antigen-specific manner. Moreover, eosinophil peroxidase activity in the skin and production of IL-4, IL-5, IL-10, and IL-13 are suppressed. The observed reduction of IgE synthesis is transferable with T-cell receptor (TCR) αβ+CD4+CD25− cells, whereas IgG2a production is dependent on both TCRαβ+ and TCRγδ+ T cells. Further experiments show that the described phenomenon is myeloid differentiation primary response 88, IFN-γ, and IL-17A dependent. Finally, the results suggest that epicutaneous immunization with OVA and CpG decreases the synthesis of OVA-specific IgE and skin eosinophil peroxidase activity in mice with ongoing skin allergy. Conclusion Epicutaneous application of protein antigen in the presence of adjuvant could be an attractive needle-free and self-administered immunotherapy for allergic diseases. PMID:26810716
Inherited selective intestinal cobalamin malabsorption and cobalamin deficiency in dogs.
Fyfe, J C; Giger, U; Hall, C A; Jezyk, P F; Klumpp, S A; Levine, J S; Patterson, D F
1991-01-01
Inherited selective intestinal malabsorption of cobalamin (Cbl) was observed in a family of giant schnauzer dogs. Family studies and breeding experiments demonstrated simple autosomal recessive inheritance of this disease. Affected puppies exhibited chronic inappetence and failure to thrive beginning between 6 and 12 wk of age. Neutropenia with hypersegmentation, anemia with anisocytosis and poikilocytosis, and megaloblastic changes of the bone marrow were present. Serum Cbl concentrations were low, and methylmalonic aciduria and homocysteinemia were present. Parenteral, but not oral, cyanocobalamin administration rapidly eliminated all signs of Cbl deficiency except for low serum Cbl concentrations. Cbl malabsorption in affected dogs was documented by oral administration of [57Co]cyanocobalamin with or without simultaneous oral administration of intrinsic factor or normal dog gastric juice. Quantitation and function studies of intrinsic factor and transcobalamin-II from affected dogs revealed no abnormality. Other gastrointestinal functions and ileal morphology were normal, indicating a selective defect of Cbl absorption at the level of the ileal enterocyte. Immunoelectron microscopy of ileal biopsies showed that the receptor for intrinsic factor-Cbl complex was absent from the apical brush border microvillus pits of affected dogs. This canine disorder resembles inherited selective intestinal Cbl malabsorption (Imerslund-Gräsbeck syndrome) in humans, and is a spontaneously occurring animal model of early onset Cbl deficiency.
Smith, Thomas; Ho, Gladys; Christodoulou, John; Price, Elizabeth Ann; Onadim, Zerrin; Gauthier-Villars, Marion; Dehainault, Catherine; Houdayer, Claude; Parfait, Beatrice; van Minkelen, Rick; Lohman, Dietmar; Eyre-Walker, Adam
2016-05-01
We have investigated whether the mutation rate varies between genes and sites using de novo mutations (DNMs) from three genes associated with Mendelian diseases (RB1, NF1, and MECP2). We show that the relative frequency of mutations at CpG dinucleotides relative to non-CpG sites varies between genes and relative to the genomic average. In particular we show that the rate of transition mutation at CpG sites relative to the rate of non-CpG transversion is substantially higher in our disease genes than amongst DNMs in general; the rate of CpG transition can be several hundred-fold greater than the rate of non-CpG transversion. We also show that the mutation rate varies significantly between sites of a particular mutational type, such as non-CpG transversion, within a gene. We estimate that for all categories of sites, except CpG transitions, there is at least a 30-fold difference in the mutation rate between the 10% of sites with the highest and lowest mutation rates. However, our best estimate is that the mutation rate varies by several hundred-fold variation. We suggest that the presence of hypermutable sites may be one reason certain genes are associated with disease. © 2016 WILEY PERIODICALS, INC.
Alsøe, Lene; Sarno, Antonio; Carracedo, Sergio; ...
2017-08-03
Both a DNA lesion and an intermediate for antibody maturation, uracil is primarily processed by base excision repair (BER), either initiated by uracil-DNA glycosylase (UNG) or by single-strand selective monofunctional uracil DNA glycosylase (SMUG1). The relative in vivo contributions of each glycosylase remain elusive. To assess the impact of SMUG1 deficiency, we measured uracil and 5-hydroxymethyluracil, another SMUG1 substrate, in Smug1 -/ - mice. Here, we found that 5-hydroxymethyluracil accumulated in Smug1 -/ - tissues and correlated with 5-hydroxymethylcytosine levels. The highest increase was found in brain, which contained about 26-fold higher genomic 5-hydroxymethyluracil levels than the wild type. Smug1more » -/ - mice did not accumulate uracil in their genome and Ung -/ - mice showed slightly elevated uracil levels. Contrastingly, Ung -/ -Smug1 -/ - mice showed a synergistic increase in uracil levels with up to 25-fold higher uracil levels than wild type. Whole genome sequencing of UNG/SMUG1-deficient tumours revealed that combined UNG and SMUG1 deficiency leads to the accumulation of mutations, primarily C to T transitions within CpG sequences. This unexpected sequence bias suggests that CpG dinucleotides are intrinsically more mutation prone. In conclusion, we showed that SMUG1 efficiently prevent genomic uracil accumulation, even in the presence of UNG, and identified mutational signatures associated with combined UNG and SMUG1 deficiency.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alsøe, Lene; Sarno, Antonio; Carracedo, Sergio
Both a DNA lesion and an intermediate for antibody maturation, uracil is primarily processed by base excision repair (BER), either initiated by uracil-DNA glycosylase (UNG) or by single-strand selective monofunctional uracil DNA glycosylase (SMUG1). The relative in vivo contributions of each glycosylase remain elusive. To assess the impact of SMUG1 deficiency, we measured uracil and 5-hydroxymethyluracil, another SMUG1 substrate, in Smug1 -/ - mice. Here, we found that 5-hydroxymethyluracil accumulated in Smug1 -/ - tissues and correlated with 5-hydroxymethylcytosine levels. The highest increase was found in brain, which contained about 26-fold higher genomic 5-hydroxymethyluracil levels than the wild type. Smug1more » -/ - mice did not accumulate uracil in their genome and Ung -/ - mice showed slightly elevated uracil levels. Contrastingly, Ung -/ -Smug1 -/ - mice showed a synergistic increase in uracil levels with up to 25-fold higher uracil levels than wild type. Whole genome sequencing of UNG/SMUG1-deficient tumours revealed that combined UNG and SMUG1 deficiency leads to the accumulation of mutations, primarily C to T transitions within CpG sequences. This unexpected sequence bias suggests that CpG dinucleotides are intrinsically more mutation prone. In conclusion, we showed that SMUG1 efficiently prevent genomic uracil accumulation, even in the presence of UNG, and identified mutational signatures associated with combined UNG and SMUG1 deficiency.« less
Patankar, Sumant; Gautam, Siddharth; Rother, Gernot; ...
2016-02-10
It was found that ethane is confined to mineral and organic pores in certain shale formations. Effects of confinement on structural and dynamic properties of ethane in mesoporous controlled pore glass (CPG) were studied by gravimetric adsorption and quasi-elastic neutron scattering (QENS) measurements. The obtained isotherms and scattering data complement each other by quantifying the relative strength of the solid–fluid interactions and the transport properties of the fluid under confinement, respectively. We used a magnetic suspension balance to measure the adsorption isotherms at two temperatures and over a range of pressures corresponding to a bulk density range of 0.01–0.35 g/cmmore » 3. Key confinement effects were highlighted through differences between isotherms for the two pore sizes. A comparison was made with previously published isotherms for CO 2 on the same CPG materials. Behavior of ethane in the smaller pore size was probed further using quasi-elastic neutron scattering. By extracting the self-diffusivity and residence time, we were able to study the effect of pressure and transition from gaseous to supercritical densities on the dynamics of confined ethane. Moreover, a temperature variation QENS study was also completed with pure ethane and a CO 2–ethane mixture. Activation energies extracted from the Arrhenius plots show the effects of CO 2 addition on ethane mobility.« less
Hafler, Brian P
2017-03-01
Inherited retinal dystrophies are a significant cause of vision loss and are characterized by the loss of photoreceptors and the retinal pigment epithelium (RPE). Mutations in approximately 250 genes cause inherited retinal degenerations with a high degree of genetic heterogeneity. New techniques in next-generation sequencing are allowing the comprehensive analysis of all retinal disease genes thus changing the approach to the molecular diagnosis of inherited retinal dystrophies. This review serves to analyze clinical progress in genetic diagnostic testing and implications for retinal gene therapy. A literature search of PubMed and OMIM was conducted to relevant articles in inherited retinal dystrophies. Next-generation genetic sequencing allows the simultaneous analysis of all the approximately 250 genes that cause inherited retinal dystrophies. Reported diagnostic rates range are high and range from 51% to 57%. These new sequencing tools are highly accurate with sensitivities of 97.9% and specificities of 100%. Retinal gene therapy clinical trials are underway for multiple genes including RPE65, ABCA4, CHM, RS1, MYO7A, CNGA3, CNGB3, ND4, and MERTK for which a molecular diagnosis may be beneficial for patients. Comprehensive next-generation genetic sequencing of all retinal dystrophy genes is changing the paradigm for how retinal specialists perform genetic testing for inherited retinal degenerations. Not only are high diagnostic yields obtained, but mutations in genes with novel clinical phenotypes are also identified. In the era of retinal gene therapy clinical trials, identifying specific genetic defects will increasingly be of use to identify patients who may enroll in clinical studies and benefit from novel therapies.
Mummichogs (Fundulus heteroclitus) indigenous to an urban estuarine Superfund site in New Bedford Harbor (NBH, MA, USA) contain extremely high concentrations of the local contaminants, polychlorinated biphenyls (PCBs). These fish populations apparently persist due to an inherited...
Maternal inheritance of the chloroplast genome in Eucalyptus globulus and interspecific hybrids.
Mckinnon, A E; Vaillancourt, R E; Tilyard, P A; Potts, B M
2001-10-01
The utility of chloroplast DNA (cpDNA) in Eucalyptus, either as a molecular marker for genetic studies or as a potential vehicle for genetic manipulation, is based on knowledge of its mode of inheritance. Chloroplast inheritance in angiosperms can vary among and within species, and anomalous inheritance has been reported in some interspecific-hybrid combinations. In Eucalyptus, abnormalities of pollen-tube growth occur in a number of interspecific-hybrid combinations, and this might increase the likelihood of anomalous chloroplast transmission. We used a rapid PCR technique to determine chloroplast heritability in 425 progeny of Eucalyptus, comprising 194 progeny of the premier pulpwood species E. globulus and 231 interspecific hybrids between E. globulus and E. nitens (F1, F2, and backcrosses). At this sampling intensity, no pollen-mediated transmission of cpDNA was found in any of the 40 families tested. The results are discussed with reference to chloroplast engineering and the use of cpDNA as a seed-specific marker in phylogeographic studies of Eucalyptus.
Genetic manipulation for inherited neurodegenerative diseases: myth or reality?
Yu-Wai-Man, Patrick
2016-10-01
Rare genetic diseases affect about 7% of the general population and over 7000 distinct clinical syndromes have been described with the majority being due to single gene defects. This review will provide a critical overview of genetic strategies that are being pioneered to halt or reverse disease progression in inherited neurodegenerative diseases. This field of research covers a vast area and only the most promising treatment paradigms will be discussed with a particular focus on inherited eye diseases, which have paved the way for innovative gene therapy paradigms, and mitochondrial diseases, which are currently generating a lot of debate centred on the bioethics of germline manipulation. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Berg, Marianne; Hagland, Hanne R; Søreide, Kjetil
2014-01-01
In colorectal cancer a distinct subgroup of tumours demonstrate the CpG island methylator phenotype (CIMP). However, a consensus of how to score CIMP is not reached, and variation in definition may influence the reported CIMP prevalence in tumours. Thus, we sought to compare currently suggested definitions and cut-offs for methylation markers and how they influence CIMP classification in colon cancer. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA), with subsequent fragment analysis, was used to investigate methylation of tumour samples. In total, 31 CpG sites, located in 8 different genes (RUNX3, MLH1, NEUROG1, CDKN2A, IGF2, CRABP1, SOCS1 and CACNA1G) were investigated in 64 distinct colon cancers and 2 colon cancer cell lines. The Ogino gene panel includes all 8 genes, in addition to the Weisenberger panel of which only 5 of the 8 genes included were investigated. In total, 18 alternative combinations of scoring of CIMP positivity on probe-, gene-, and panel-level were analysed and compared. For 47 samples (71%), the CIMP status was constant and independent of criteria used for scoring; 34 samples were constantly scored as CIMP negative, and 13 (20%) consistently scored as CIMP positive. Only four of 31 probes (13%) investigated showed no difference in the numbers of positive samples using the different cut-offs. Within the panels a trend was observed that increasing the gene-level stringency resulted in a larger difference in CIMP positive samples than increasing the probe-level stringency. A significant difference between positive samples using 'the most stringent' as compared to 'the least stringent' criteria (20% vs 46%, respectively; p<0.005) was demonstrated. A statistical significant variation in the frequency of CIMP depending on the cut-offs and genes included in a panel was found, with twice as many positives samples by least compared to most stringent definition used.
Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin
2015-01-01
Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular
Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin
2015-12-01
Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic
Nur, I; Pascale, E; Furano, A V
1988-01-01
Here we report that the 600 bp promoter-like region at the left end of a newly isolated and characterized rat L1 DNA element can activate the prokaryotic chloramphenicol acyltransferase gene in a rat cell line. Activation only occurs when the promoter region is oriented to the transferase gene as it is to the L1 protein encoding sequences and is 75% inhibited by methylation of just 5 of the 22 CpGs present in the promoter. The G + C rich promoter contains enough CpGs to qualify it as a CpG island, but in contrast to other CpG islands, genomic L1 promoters are fully methylated in both somatic cell and sperm DNA as judged by restriction enzyme analysis. Partial demethylation of the genomic promoters by treatment with 5-azacytidine failed to produce discrete L1 transcripts. The relationship of methylation to the evolutionary history and fate of the rat L1 promoter is discussed. Images PMID:2459662
Draht, Muriel X G; Smits, Kim M; Jooste, Valérie; Tournier, Benjamin; Vervoort, Martijn; Ramaekers, Chantal; Chapusot, Caroline; Weijenberg, Matty P; van Engeland, Manon; Melotte, Veerle
2016-01-01
Already since the 1990s, promoter CpG island methylation markers have been considered promising diagnostic, prognostic, and predictive cancer biomarkers. However, so far, only a limited number of DNA methylation markers have been introduced into clinical practice. One reason why the vast majority of methylation markers do not translate into clinical applications is lack of independent validation of methylation markers, often caused by differences in methylation analysis techniques. We recently described RET promoter CpG island methylation as a potential prognostic marker in stage II colorectal cancer (CRC) patients of two independent series. In the current study, we analyzed the RET promoter CpG island methylation of 241 stage II colon cancer patients by direct methylation-specific PCR (MSP), nested-MSP, pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM). All primers were designed as close as possible to the same genomic region. In order to investigate the effect of different DNA methylation assays on patient outcome, we assessed the clinical sensitivity and specificity as well as the association of RET methylation with overall survival for three and five years of follow-up. Using direct-MSP and nested-MSP, 12.0 % (25/209) and 29.6 % (71/240) of the patients showed RET promoter CpG island methylation. Methylation frequencies detected by pyrosequencing were related to the threshold for positivity that defined RET methylation. Methylation frequencies obtained by pyrosequencing (threshold for positivity at 20 %) and MS-HRM were 13.3 % (32/240) and 13.8 % (33/239), respectively. The pyrosequencing threshold for positivity of 20 % showed the best correlation with MS-HRM and direct-MSP results. Nested-MSP detected RET promoter CpG island methylation in deceased patients with a higher sensitivity (33.1 %) compared to direct-MSP (10.7 %), pyrosequencing (14.4 %), and MS-HRM (15.4 %). While RET methylation frequencies detected by nested
Willis, T A; Potrata, B; Ahmed, M; Hewison, J; Gale, R; Downey, L; McKibbin, M
2013-01-01
Background/aims The views of people with inherited retinal disease are important to help develop health policy and plan services. This study aimed to record levels of understanding of and attitudes to genetic testing for inherited retinal disease, and views on the availability of testing. Methods Telephone questionnaires comprising quantitative and qualitative items were completed with adults with inherited retinal disease. Participants were recruited via postal invitation (response rate 48%), approach at clinic or newsletters of relevant charitable organisations. Results Questionnaires were completed with 200 participants. Responses indicated that participants’ perceived understanding of genetic testing for inherited retinal disease was variable. The majority (90%) considered testing to be good/very good and would be likely to undergo genetic testing (90%) if offered. Most supported the provision of diagnostic (97%) and predictive (92%) testing, but support was less strong for testing as part of reproductive planning. Most (87%) agreed with the statement that testing should be offered only after the individual has received genetic counselling from a professional. Subgroup analyses revealed differences associated with participant age, gender, education level and ethnicity (p<0.02). Participants reported a range of perceived benefits (eg, family planning, access to treatment) and risks (eg, impact upon family relationships, emotional consequences). Conclusions Adults with inherited retinal disease strongly support the provision of publicly funded genetic testing. Support was stronger for diagnostic and predictive testing than for testing as part of reproductive planning. PMID:23813418
Establishment and evolution of the Australian Inherited Retinal Disease Register and DNA Bank.
De Roach, John N; McLaren, Terri L; Paterson, Rachel L; O'Brien, Emily C; Hoffmann, Ling; Mackey, David A; Hewitt, Alex W; Lamey, Tina M
2013-07-01
Inherited retinal disease represents a significant cause of blindness and visual morbidity worldwide. With the development of emerging molecular technologies, accessible and well-governed repositories of data characterising inherited retinal disease patients is becoming increasingly important. This manuscript introduces such a repository. Participants were recruited from the Retina Australia membership, through the Royal Australian and New Zealand College of Ophthalmologists, and by recruitment of suitable patients attending the Sir Charles Gairdner Hospital visual electrophysiology clinic. Four thousand one hundred ninety-three participants were recruited. All participants were members of families in which the proband was diagnosed with an inherited retinal disease (excluding age-related macular degeneration). Clinical and family information was collected by interview with the participant and by examination of medical records. In 2001, we began collecting DNA from Western Australian participants. In 2009 this activity was extended Australia-wide. Genetic analysis results were stored in the register as they were obtained. The main outcome measurement was the number of DNA samples (with associated phenotypic information) collected from Australian inherited retinal disease-affected families. DNA was obtained from 2873 participants. Retinitis pigmentosa, Stargardt disease and Usher syndrome participants comprised 61.0%, 9.9% and 6.4% of the register, respectively. This resource is a valuable tool for investigating the aetiology of inherited retinal diseases. As new molecular technologies are translated into clinical applications, this well-governed repository of clinical and genetic information will become increasingly relevant for tasks such as identifying candidates for gene-specific clinical trials. © 2012 The Authors. Clinical and Experimental Ophthalmology © 2012 Royal Australian and New Zealand College of Ophthalmologists.
A test of the transcription model for biased inheritance of yeast mitochondrial DNA.
Lorimer, H E; Brewer, B J; Fangman, W L
1995-09-01
Two strand-specific origins of replication appear to be required for mammalian mitochondrial DNA (mtDNA) replication. Structural equivalents of these origins are found in the rep sequences of Saccharomyces cerevisiae mtDNA. These striking similarities have contributed to a universal model for the initiation of mtDNA replication in which a primer is created by cleavage of an origin region transcript. Consistent with this model are the properties of deletion mutants of yeast mtDNA ([rho-]) with a high density of reps (HS [rho-]). These mutant mtDNAs are preferentially inherited by the progeny resulting from the mating of HS [rho-] cells with cells containing wild-type mtDNA ([rho+]). This bias is presumed to result from a replication advantage conferred on HS [rho-] mtDNA by the high density of rep sequences acting as origins. To test whether transcription is indeed required for the preferential inheritance of HS [rho-] mtDNA, we deleted the nuclear gene (RPO41) for the mitochondrial RNA polymerase, reducing transcripts by at least 1000-fold. Since [rho-] genomes, but not [rho+] genomes, are stable when RPO41 is deleted, we examined matings between HS [rho-] and neutral [rho-] cells. Neutral [rho-] mtDNAs lack rep sequences and are not preferentially inherited in [rho-] x [rho+] crosses. In HS [rho-] x neutral [rho-] matings, the HS [rho-] mtDNA was preferentially inherited whether both parents were wild type or both were deleted for RPO41. Thus, transcription from the rep promoter does not appear to be necessary for biased inheritance. Our results, and analysis of the literature, suggest that priming by transcription is not a universal mechanism for mtDNA replication initiation.
Epigenetic Inheritance and Its Role in Evolutionary Biology: Re-Evaluation and New Perspectives
Burggren, Warren
2016-01-01
Epigenetics increasingly occupies a pivotal position in our understanding of inheritance, natural selection and, perhaps, even evolution. A survey of the PubMed database, however, reveals that the great majority (>93%) of epigenetic papers have an intra-, rather than an inter-generational focus, primarily on mechanisms and disease. Approximately ~1% of epigenetic papers even mention the nexus of epigenetics, natural selection and evolution. Yet, when environments are dynamic (e.g., climate change effects), there may be an “epigenetic advantage” to phenotypic switching by epigenetic inheritance, rather than by gene mutation. An epigenetically-inherited trait can arise simultaneously in many individuals, as opposed to a single individual with a gene mutation. Moreover, a transient epigenetically-modified phenotype can be quickly “sunsetted”, with individuals reverting to the original phenotype. Thus, epigenetic phenotype switching is dynamic and temporary and can help bridge periods of environmental stress. Epigenetic inheritance likely contributes to evolution both directly and indirectly. While there is as yet incomplete evidence of direct permanent incorporation of a complex epigenetic phenotype into the genome, doubtlessly, the presence of epigenetic markers and the phenotypes they create (which may sort quite separately from the genotype within a population) will influence natural selection and, so, drive the collective genotype of a population. PMID:27231949
Ogrodnik, Mikołaj; Salmonowicz, Hanna; Brown, Rachel; Turkowska, Joanna; Średniawa, Władysław; Pattabiraman, Sundararaghavan; Amen, Triana; Abraham, Ayelet-chen; Eichler, Noam; Lyakhovetsky, Roman; Kaganovich, Daniel
2014-06-03
Aging is associated with the accumulation of several types of damage: in particular, damage to the proteome. Recent work points to a conserved replicative rejuvenation mechanism that works by preventing the inheritance of damaged and misfolded proteins by specific cells during division. Asymmetric inheritance of misfolded and aggregated proteins has been shown in bacteria and yeast, but relatively little evidence exists for a similar mechanism in mammalian cells. Here, we demonstrate, using long-term 4D imaging, that the vimentin intermediate filament establishes mitotic polarity in mammalian cell lines and mediates the asymmetric partitioning of damaged proteins. We show that mammalian JUNQ inclusion bodies containing soluble misfolded proteins are inherited asymmetrically, similarly to JUNQ quality-control inclusions observed in yeast. Mammalian IPOD-like inclusion bodies, meanwhile, are not always inherited by the same cell as the JUNQ. Our study suggests that the mammalian cytoskeleton and intermediate filaments provide the physical scaffold for asymmetric inheritance of dynamic quality-control JUNQ inclusions. Mammalian IPOD inclusions containing amyloidogenic proteins are not partitioned as effectively during mitosis as their counterparts in yeast. These findings provide a valuable mechanistic basis for studying the process of asymmetric inheritance in mammalian cells, including cells potentially undergoing polar divisions, such as differentiating stem cells and cancer cells.
Inheritance rules for Hierarchical Metadata Based on ISO 19115
NASA Astrophysics Data System (ADS)
Zabala, A.; Masó, J.; Pons, X.
2012-04-01
Mainly, ISO19115 has been used to describe metadata for datasets and services. Furthermore, ISO19115 standard (as well as the new draft ISO19115-1) includes a conceptual model that allows to describe metadata at different levels of granularity structured in hierarchical levels, both in aggregated resources such as particularly series, datasets, and also in more disaggregated resources such as types of entities (feature type), types of attributes (attribute type), entities (feature instances) and attributes (attribute instances). In theory, to apply a complete metadata structure to all hierarchical levels of metadata, from the whole series to an individual feature attributes, is possible, but to store all metadata at all levels is completely impractical. An inheritance mechanism is needed to store each metadata and quality information at the optimum hierarchical level and to allow an ease and efficient documentation of metadata in both an Earth observation scenario such as a multi-satellite mission multiband imagery, as well as in a complex vector topographical map that includes several feature types separated in layers (e.g. administrative limits, contour lines, edification polygons, road lines, etc). Moreover, and due to the traditional split of maps in tiles due to map handling at detailed scales or due to the satellite characteristics, each of the previous thematic layers (e.g. 1:5000 roads for a country) or band (Landsat-5 TM cover of the Earth) are tiled on several parts (sheets or scenes respectively). According to hierarchy in ISO 19115, the definition of general metadata can be supplemented by spatially specific metadata that, when required, either inherits or overrides the general case (G.1.3). Annex H of this standard states that only metadata exceptions are defined at lower levels, so it is not necessary to generate the full registry of metadata for each level but to link particular values to the general value that they inherit. Conceptually the metadata
Arm-Gal4 inheritance influences development and lifespan in Drosophila melanogaster.
Slade, F A; Staveley, B E
2015-10-19
The UAS-Gal4 ectopic expression system is a widely used and highly valued tool that allows specific gene expression in Drosophila melanogaster. Yeast transcription factor Gal4 can be directed using D. melanogaster transcriptional control elements, and is often assumed to have little effect on the organism. By evaluation of the consequences of maternal and paternal inheritance of a Gal4 transgene under the transcriptional regulation of armadillo control elements (arm-Gal4), we demonstrated that Gal4 expression could be detrimental to development and longevity. Male progeny expressing arm-Gal4 in the presence of UAS-lacZ transgene had reduced numbers and size of ommatidia, compared to flies expressing UAS-lacZ transgene under the control of other Gal4 transgenes. Aged at 25°C, the median life span of male flies with maternally inherited elav-Gal4 was 70 days, without a responding transgene or with UAS-lacZ. The median life span of maternally inherited arm-Gal4 male flies without a responding transgene was 48 days, and 40 days with the UAS-lacZ transgene. A partial rescue of this phenotype was observed with the expression of UAS-lacZ under paternal arm-Gal4 control, having an average median lifespan of 60 days. This data suggests that arm-Gal4 has detrimental effects on Drosophila development and lifespan that are directly dependent upon parental inheritance, and that the benign responder and reporter gene UAS-lacZ may influence D. melanogaster development. These findings should be taken into consideration during the design and execution of UAS-Gal4 expression experiments.
Grahn, Bruce H; Storey, Eric S; McMillan, Catherine
2004-01-01
The objectives of this study were to define the clinical syndrome of retinal dysplasia and persistent primary vitreous in Miniature Schnauzer dogs and determine the etiology. We examined 106 Miniature Schnauzers using a biomicroscope and indirect ophthalmoscope. The anterior and posterior segments of affected dogs were photographed. Four enucleated eyes were examined using routine light microscopy and scanning electron microscopy. A pedigree was constructed and related dogs were test-bred to define the mode of inheritance of this syndrome. Congenital retinal dysplasia was confirmed in 24 of 106 related Miniature Schnauzer dogs. Physical and postmortem examinations revealed that congenital abnormalities were limited to the eyes. Biomicroscopic, indirect ophthalmoscopic, and neuro-ophthalmic examinations confirmed that some of these dogs were blind secondary to bilateral retinal dysplasia and detachment (nonattachment) (n = 13), and the remainder had generalized retinal dysplasia (n = 11). Fifteen of these dogs were also diagnosed with unilateral (n = 9) or bilateral (n = 6) persistent hyperplastic primary vitreous. Nutritional, infectious, or toxic etiologies were not evident on physical, postmortem, light microscopic, or transmitting and scanning electron microscopic examination of four affected Miniature Schnauzers. We examined the pedigree and determined that an autosomal recessive mode of inheritance was most likely. Three test-bred litters including those from affected parents, carrier and affected parents, and carrier parents confirmed this mode of inheritance. This study confirms that retinal dysplasia and persistent hyperplastic primary vitreous is a congenital abnormality that is inherited as an autosomal recessive condition in Miniature Schnauzers.
NASA Astrophysics Data System (ADS)
Buttinelli, M.; Improta, L.; Bagh, S.; Chiarabba, C.
2016-11-01
Since 2006 wastewater has been injected below the Val d’Agri Quaternary basin, the largest on-land oilfield in Europe, inducing micro-seismicity in the proximity of a high-rate injection well. In this study, we have the rare opportunity to revise a massive set of 2D/3D seismic and deep borehole data in order to investigate the relationship between the active faults that bound the basin and the induced earthquakes. Below the injection site we identify a Pliocene thrusts and back-thrusts system inherited by the Apennines compression, with no relation with faults bounding the basin. The induced seismicity is mostly confined within the injection reservoir, and aligns coherently with a NE-dipping back-thrust favorably oriented within the current extensional stress field. Earthquakes spread upwards from the back-thrust deep portion activating a 2.5-km wide patch. Focal mechanisms show a predominant extensional kinematic testifying to an on-going inversion of the back-thrust, while a minor strike-slip compound suggests a control exerted by a high angle inherited transverse fault developed within the compressional system, possibly at the intersection between the two fault sets. We stress that where wastewater injection is active, understanding the complex interaction between injection-linked seismicity and pre-existing faults is a strong requisite for safe oilfield exploitation.
Spatial vs. individual variability with inheritance in a stochastic Lotka-Volterra system
NASA Astrophysics Data System (ADS)
Dobramysl, Ulrich; Tauber, Uwe C.
2012-02-01
We investigate a stochastic spatial Lotka-Volterra predator-prey model with randomized interaction rates that are either affixed to the lattice sites and quenched, and / or specific to individuals in either population. In the latter situation, we include rate inheritance with mutations from the particles' progenitors. Thus we arrive at a simple model for competitive evolution with environmental variability and selection pressure. We employ Monte Carlo simulations in zero and two dimensions to study the time evolution of both species' densities and their interaction rate distributions. The predator and prey concentrations in the ensuing steady states depend crucially on the environmental variability, whereas the temporal evolution of the individualized rate distributions leads to largely neutral optimization. Contrary to, e.g., linear gene expression models, this system does not experience fixation at extreme values. An approximate description of the resulting data is achieved by means of an effective master equation approach for the interaction rate distribution.
Rare Inherited and De Novo CNVs Reveal Complex Contributions to ASD Risk in Multiplex Families.
Leppa, Virpi M; Kravitz, Stephanie N; Martin, Christa Lese; Andrieux, Joris; Le Caignec, Cedric; Martin-Coignard, Dominique; DyBuncio, Christina; Sanders, Stephan J; Lowe, Jennifer K; Cantor, Rita M; Geschwind, Daniel H
2016-09-01
Rare mutations, including copy-number variants (CNVs), contribute significantly to autism spectrum disorder (ASD) risk. Although their importance has been established in families with only one affected child (simplex families), the contribution of both de novo and inherited CNVs to ASD in families with multiple affected individuals (multiplex families) is less well understood. We analyzed 1,532 families from the Autism Genetic Resource Exchange (AGRE) to assess the impact of de novo and rare CNVs on ASD risk in multiplex families. We observed a higher burden of large, rare CNVs, including inherited events, in individuals with ASD than in their unaffected siblings (odds ratio [OR] = 1.7), but the rate of de novo events was significantly lower than in simplex families. In previously characterized ASD risk loci, we identified 49 CNVs, comprising 24 inherited events, 19 de novo events, and 6 events of unknown inheritance, a significant enrichment in affected versus control individuals (OR = 3.3). In 21 of the 30 families (71%) in whom at least one affected sibling harbored an established ASD major risk CNV, including five families harboring inherited CNVs, the CNV was not shared by all affected siblings, indicating that other risk factors are contributing. We also identified a rare risk locus for ASD and language delay at chromosomal region 2q24 (implicating NR4A2) and another lower-penetrance locus involving inherited deletions and duplications of WWOX. The genetic architecture in multiplex families differs from that in simplex families and is complex, warranting more complete genetic characterization of larger multiplex ASD cohorts. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
HAFLER, BRIAN P.
2017-01-01
Purpose Inherited retinal dystrophies are a significant cause of vision loss and are characterized by the loss of photoreceptors and the retinal pigment epithelium (RPE). Mutations in approximately 250 genes cause inherited retinal degenerations with a high degree of genetic heterogeneity. New techniques in next-generation sequencing are allowing the comprehensive analysis of all retinal disease genes thus changing the approach to the molecular diagnosis of inherited retinal dystrophies. This review serves to analyze clinical progress in genetic diagnostic testing and implications for retinal gene therapy. Methods A literature search of PubMed and OMIM was conducted to relevant articles in inherited retinal dystrophies. Results Next-generation genetic sequencing allows the simultaneous analysis of all the approximately 250 genes that cause inherited retinal dystrophies. Reported diagnostic rates range are high and range from 51% to 57%. These new sequencing tools are highly accurate with sensitivities of 97.9% and specificities of 100%. Retinal gene therapy clinical trials are underway for multiple genes including RPE65, ABCA4, CHM, RS1, MYO7A, CNGA3, CNGB3, ND4, and MERTK for which a molecular diagnosis may be beneficial for patients. Conclusion Comprehensive next-generation genetic sequencing of all retinal dystrophy genes is changing the paradigm for how retinal specialists perform genetic testing for inherited retinal degenerations. Not only are high diagnostic yields obtained, but mutations in genes with novel clinical phenotypes are also identified. In the era of retinal gene therapy clinical trials, identifying specific genetic defects will increasingly be of use to identify patients who may enroll in clinical studies and benefit from novel therapies. PMID:27753762
Data-driven models of dominantly-inherited Alzheimer's disease progression.
Oxtoby, Neil P; Young, Alexandra L; Cash, David M; Benzinger, Tammie L S; Fagan, Anne M; Morris, John C; Bateman, Randall J; Fox, Nick C; Schott, Jonathan M; Alexander, Daniel C
2018-05-01
See Li and Donohue (doi:10.1093/brain/awy089) for a scientific commentary on this article.Dominantly-inherited Alzheimer's disease is widely hoped to hold the key to developing interventions for sporadic late onset Alzheimer's disease. We use emerging techniques in generative data-driven disease progression modelling to characterize dominantly-inherited Alzheimer's disease progression with unprecedented resolution, and without relying upon familial estimates of years until symptom onset. We retrospectively analysed biomarker data from the sixth data freeze of the Dominantly Inherited Alzheimer Network observational study, including measures of amyloid proteins and neurofibrillary tangles in the brain, regional brain volumes and cortical thicknesses, brain glucose hypometabolism, and cognitive performance from the Mini-Mental State Examination (all adjusted for age, years of education, sex, and head size, as appropriate). Data included 338 participants with known mutation status (211 mutation carriers in three subtypes: 163 PSEN1, 17 PSEN2, and 31 APP) and a baseline visit (age 19-66; up to four visits each, 1.1 ± 1.9 years in duration; spanning 30 years before, to 21 years after, parental age of symptom onset). We used an event-based model to estimate sequences of biomarker changes from baseline data across disease subtypes (mutation groups), and a differential equation model to estimate biomarker trajectories from longitudinal data (up to 66 mutation carriers, all subtypes combined). The two models concur that biomarker abnormality proceeds as follows: amyloid deposition in cortical then subcortical regions (∼24 ± 11 years before onset); phosphorylated tau (17 ± 8 years), tau and amyloid-β changes in cerebrospinal fluid; neurodegeneration first in the putamen and nucleus accumbens (up to 6 ± 2 years); then cognitive decline (7 ± 6 years), cerebral hypometabolism (4 ± 4 years), and further regional neurodegeneration. Our models predicted symptom onset more
[Preimplantation genetic diagnosis and monogenic inherited eye diseases].
Hlavatá, L; Ďuďáková, Ľ; Trková, M; Soldátová, I; Skalická, P; Kousal, B; Lišková, P
Preimplantation genetic diagnosis (PGD) is an established application of genetic testing in the context of in vitro fertilization. PGD is an alternative method to prenatal diagnosis which aims to prevent the transmission of an inherited disorder to the progeny by implanting only embryos that do not carry genetic predisposition for a particular disease. The aim of this study is to provide an overview of eye disorders for which PGD has been carried out. The European literature search focused on best practices, ethical issues, risks and results of PGD for inherited eye disorders. PGD is performed for a number of ocular disorders; a prerequisite for its application is however, the knowledge of a disease-causing mutation(s). The main advantage of this method is that the couple is not exposed to a decision of whether or not to undergo an abortion. Qualified counselling must be provided prior to the PGD in order to completely understand the risk of disability in any child conceived, consequences of disease manifestation, and advantages as well as limitations of this method. In the group of non-syndromic eye diseases and diseases in which ocular findings dominate, PGD has been performed in European countries for aniridia, choroideremia, congenital fibrosis of extraocular muscles, Leber congenital amaurosis, ocular albinism, retinitis pigmentosa, X-linked retinoschisis, Stargardt disease, blepharophimosis-ptosis-inverse epicanthus syndrome and retinoblastoma. Sexing for X-linked or mitochondrial diseases has been carried out for blue cone monochromatism, choroideremia, familial exudative vitreoretinopathy, Leber hereditary optic neuropathy, macular dystrophy (not further specified), Norrie disease, X-linked congenital stationary night blindness, X-linked retinoschisis and nystagmus (not further specified). In recent years, there has been an increase in potential to use PGD. The spectrum of diseases for this method has widened to include severe inherited eye diseases
Jiang, WenZhi; Yang, Bing; Weeks, Donald P
2014-01-01
The newly developed CRISPR/Cas9 system for targeted gene knockout or editing has recently been shown to function in plants in both transient expression systems as well as in primary T1 transgenic plants. However, stable transmission of genes modified by the Cas9/single guide RNA (sgRNA) system to the T2 generation and beyond has not been demonstrated. Here we provide extensive data demonstrating the efficiency of Cas9/sgRNA in causing modification of a chromosomally integrated target reporter gene during early development of transgenic Arabidopsis plants and inheritance of the modified gene in T2 and T3 progeny. Efficient conversion of a nonfunctional, out-of-frame GFP gene to a functional GFP gene was confirmed in T1 plants by the observation of green fluorescent signals in leaf tissues as well as the presence of mutagenized DNA sequences at the sgRNA target site within the GFP gene. All GFP-positive T1 transgenic plants and nearly all GFP-negative plants examined contained mutagenized GFP genes. Analyses of 42 individual T2 generation plants derived from 6 different T1 progenitor plants showed that 50% of T2 plants inherited a single T-DNA insert. The efficiency of the Cas9/sgRNA system and stable inheritance of edited genes point to the promise of this system for facile editing of plant genes.
Dog models for blinding inherited retinal dystrophies.
Petersen-Jones, Simon M; Komáromy, András M
2015-03-01
Spontaneous canine models exist for several inherited retinal dystrophies. This review will summarize the models and indicate where they have been used in translational gene therapy trials. The RPE65 gene therapy trials to treat childhood blindness are a good example of how studies in dogs have contributed to therapy development. Outcomes in human clinical trials are compared and contrasted with the result of the preclinical dog trials.
Dog Models for Blinding Inherited Retinal Dystrophies
Komáromy, András M.
2015-01-01
Abstract Spontaneous canine models exist for several inherited retinal dystrophies. This review will summarize the models and indicate where they have been used in translational gene therapy trials. The RPE65 gene therapy trials to treat childhood blindness are a good example of how studies in dogs have contributed to therapy development. Outcomes in human clinical trials are compared and contrasted with the result of the preclinical dog trials. PMID:25671556
Darwin's Invention: Inheritance & the "Mad Dream" of Pangenesis
ERIC Educational Resources Information Center
McComas, William F.
2012-01-01
This article recounts the story of the development of pangenesis, a principle proposed by Charles Darwin to describe the rules of inheritance and the source of new variation, two concepts vital to his proposal of evolution by natural selection. Historical accounts such as this are infrequently included in texts and classroom discussions but can…