Science.gov

Sample records for intron-flanking pcr primer

  1. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  2. Multiplexed Primer Prediction for PCR

    Energy Science and Technology Software Center (ESTSC)

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequencesmore » used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.« less

  3. In silico PCR primer designing and validation.

    PubMed

    Kumar, Anil; Chordia, Nikita

    2015-01-01

    Polymerase chain reaction (PCR) is an enzymatic reaction whose efficiency and sensitivity largely depend on the efficiency of the primers that are used for the amplification of a concerned gene/DNA fragment. Selective amplification of nucleic acid molecules initially present in minute quantities provides a powerful tool for analyzing nucleic acids. In silico method helps in designing primers. There are various programs available for PCR primer design. Here we described designing of primers using web-based tools like "Primer3" and "Web Primer". For designing the primer, DNA template sequence is required that can be taken from any of the available sequence databases, e.g., RefSeq database. The in silico validation can be carried out using BLAST tool and Gene Runner software, which check their efficiency and specificity. Thereafter, the primers designed in silico can be validated in the wet lab. After that, these validated primers can be synthesized for use in the amplification of concerned gene/DNA fragment. PMID:25697657

  4. Chemically modified primers for improved multiplex PCR

    PubMed Central

    Shum, Jonathan; Paul, Natasha

    2009-01-01

    Multiplexed PCR, the amplification of multiple targets in a single reaction, presents a new set of challenges that further complicate more traditional PCR set-ups. These complications include a greater probability for non-specific amplicon formation and for imbalanced amplification of different targets, each of which can compromise quantification and detection of multiple targets. Despite these difficulties, multiplex PCR is frequently used in such applications as pathogen detection, RNA quantification, mutation analysis and now, next generation DNA sequencing. Herein, we investigate the utility of primers with one or two thermolabile 4-oxo-1-pentyl phosphotriester modifications in improving multiplex PCR performance. Initial endpoint and real-time analyses reveal a decrease in off-target amplification and subsequent increase in amplicon yield. Furthermore, the use of modified primers in multiplex set-ups revealed a greater limit of detection and more uniform amplification of each target as compared to unmodified primers. Overall, the thermolabile modified primers present a novel and exciting avenue in improving multiplex PCR performance. PMID:19258004

  5. MPprimer: a program for reliable multiplex PCR primer design

    PubMed Central

    2010-01-01

    Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs) for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy), which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays. PMID:20298595

  6. Partially overlapping primer-based PCR for genome walking.

    PubMed

    Li, Haixing; Ding, Dongqin; Cao, Yusheng; Yu, Bo; Guo, Liang; Liu, Xiaohua

    2015-01-01

    Current genome walking methods are cumbersome to perform and can result in non-specific products. Here, we demonstrate the use of partially overlapping primer-based PCR (POP-PCR), a direct genome walking technique for the isolation of unknown flanking regions. This method exploits the partially overlapping characteristic at the 3' ends of a set of POP primers (walking primers), which guarantees that the POP primer only anneals to the POP site of the preceding PCR product at relatively low temperatures. POP primer adaptation priming at the genomic DNA/POP site occurs only once due to one low-/reduced-stringency cycle in each nested PCR, resulting in the synthesis of a pool of single-stranded DNA molecules. Of this pool, the target single-stranded DNA is replicated to the double-stranded form bound by the specific primer and the POP primer in the subsequent high-stringency cycle due to the presence of the specific primer-binding site. The non-target single stranded DNA does not become double stranded due to the absence of a binding site for any of the primers. Therefore, the POP-PCR enriches target DNA while suppressing non-target products. We successfully used POP-PCR to retrieve flanking regions bordering the gadA locus in Lactobacillus brevis NCL912, malQ in Pichia pastoris GS115, the human aldolase A gene, and hyg in rice. PMID:25811779

  7. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  8. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  9. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  10. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  11. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    Energy Science and Technology Software Center (ESTSC)

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether theremore » are also TaqMan/Luminex probe matches within predicted amplicons.« less

  12. Selecting optimal oligonucleotide primers for multiplex PCR.

    PubMed

    Nicodème, P; Steyaert, J M

    1997-01-01

    We investigate the problem of designing efficient multiplex PCR for medical applications. We show that the problem is NP-complete by transformation to the Multiple Choice Matching problem and give an efficient approximation algorithm. We developed this algorithm in a computer program that predicts which genomic regions may be simultaneously amplified by PCR. Practical use of the software shows that the method can treat 250 non-polymorphic loci with less than 5 simultaneous experiments. PMID:9322038

  13. Real-time PCR (qPCR) primer design using free online software.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. PMID:21445907

  14. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  15. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricte...

  16. Primer Extension Reactions for the PCR- based α- complementation Assay

    PubMed Central

    Achuthan, Vasudevan; DeStefano, Jeffrey J.

    2016-01-01

    The PCR- based- α- complementation assay is an effective technique to measure the fidelity of polymerases, especially RNA-dependent RNA polymerases (RDRP) and Reverse Transcriptases (RT). It has been successfully employed to determine the fidelity of the poliovirus polymerase 3D-pol (DeStefano, 2010) as well as the human immunodeficiency virus Reverse Transcriptase (HIV RT) (Achuthan et al., 2014). A major advantage of the assay is that since the PCR step is involved, even the low yield of products obtained after two rounds of low yield of RNA synthesis (for RDRP) or reverse transcription (for RT) can be measured using the assay. The assay also mimics the reverse transcription process, since both RNA- and DNA- directed RT synthesis steps are performed. We recently used this assay to show that the HIV RT, at physiologically relevant magnesium concentration, has accuracy in the same range as other reverse transcriptases (Achuthan et al., 2014). Here, we describe in detail how to prepare the inserts using the primer extension reactions. The prepared inserts are then processed further in the PCR- based- α- complementation assay.

  17. The PCR-SSP Manager computer program: a tool for maintaining sequence alignments and automatically updating the specificities of PCR-SSP primers and primer mixes.

    PubMed

    Bunce, M; Barnardo, M C; Welsh, K I

    1998-08-01

    An emerging problem of molecular typing methods such as PCR amplification using sequence-specific primers (PCR-SSP) is that they frequently require updating as new alleles are constantly being described which potentially affect the specificity of every PCR-SSP reaction. PCR-SSP uses pairs of primers to detect cis-linked polymorphisms and thus each new allele described must be compared to each individual primer pair. Furthermore, sequence homology between the various loci for class I and class II means that, for example, new HLA-A sequences have to be compared with HLA-B and HLA-C primer mixes to rule out cross-locus amplification. We have developed a computer program known as SSP Manager which is capable of aligning HLA class I and class II sequences obtained from Internet-accessible databases such as GenBank. The program then updates all individual primer specificities held in its database before updating the specificities of all primer mixes. Sets of primer mixes can then be combined from the primer mix directory to create PCR-SSP typing trays which are subsequently analysed by the program. A report is generated which stipulates whether all known sequences are amplified and the reason for apparent failure to test for individual alleles, e.g. a lack of relevant sequence information. SSP Manager has the flexibility to cope with unusual sequences (deletions and insertions), primers with internal mismatches and primers with a deliberate mismatch. The program also has many tools for developing new primer mixes, such as the facility to search for novel reactions using Boolean operators. The organisation and operational use of the SSP Manager program is described and its uses are illustrated with an updated allele list for our previously described Phototyping PCR-SSP class I and class II typing set. The SSP Manager is available on request from the authors. PMID:9756405

  18. FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  19. 3-Nitropyrrole and 5-nitroindole as universal bases in primers for DNA sequencing and PCR.

    PubMed Central

    Loakes, D; Brown, D M; Linde, S; Hill, F

    1995-01-01

    3-Nitropyrrole and 5-nitroindole have been assessed as universal bases in primers for dideoxy DNA sequencing and in the polymerase chain reaction (PCR). In contrast to a previous report, we have found that the introduction of more than one 3-nitropyrrole residue at dispersed positions into primers significantly reduced their efficiency in PCR and sequencing reactions. Primers containing 5-nitroindole at multiple dispersed positions were similarly affected; for both bases only a small number of substitutions were tolerated. In PCR experiments neither base, when incorporated into primers in codon third positions, was as effective as hypoxanthine, which was incorporated in six codon third positions in a 20mer oligomer. However, primers containing up to four consecutive 5-nitroindole substitutions performed well in both PCR and sequencing reactions. Consecutive 3-nitropyrrole substitutions were tolerated, but less well in comparable reactions. Images PMID:7630712

  20. Guidelines for the tetra-primer ARMS-PCR technique development.

    PubMed

    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa

    2014-07-01

    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way. PMID:24519268

  1. Improved PCR primers to amplify 16S rRNA genes from NC10 bacteria.

    PubMed

    He, Zhanfei; Wang, Jiaqi; Hu, Jiajie; Zhang, Hao; Cai, Chaoyang; Shen, Jiaxian; Xu, Xinhua; Zheng, Ping; Hu, Baolan

    2016-06-01

    Anaerobic oxidation of methane (AOM) coupled to nitrite reduction (AOM-NIR) is ecologically significant for mitigating the methane-induced greenhouse effect. The microbes responsible for this reaction, NC10 bacteria, have been widely detected in diverse ecosystems. However, some defects were discovered in the commonly used NC10-specific primers, 202F and qP1F. In the present work, the primers were redesigned and improved to overcome the defects found in the previous primers. A new nested PCR method was developed using the improved primers to amplify 16S ribosomal RNA (rRNA) genes from NC10 bacteria. In the new nested PCR method, the qP1mF/1492R and 1051F/qP2R primer sets were used in the first and second rounds, respectively. The PCR products were sequenced, and more operational taxonomic units (OTUs) of the NC10 phylum were obtained using the new primers compared to the previous primers. The sensitivity of the new nested PCR was tested by the serial dilution method, and the limit of detection was approximately 10(3) copies g(-1) dry sed. for the environmental samples compared to approximately 10(5) copies g(-1) dry sed. by the previous method. Finally, the improved primer, qP1mF, was used in quantitative PCR (qPCR) to determine the abundance of NC10 bacteria, and the results agreed well with the activity of AOM-NIR measured by isotope tracer experiments. The improved primers are able to amplify NC10 16S rRNA genes more efficiently than the previous primers and useful to explore the microbial community of the NC10 phylum in different systems. PMID:27020287

  2. Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

    PubMed Central

    Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

    2006-01-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

  3. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.

    PubMed

    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter

    2014-09-01

    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow. PMID:25017792

  4. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    PubMed

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. PMID:24875331

  5. Rapid Identification of the Genus Fonsecaea by PCR with Specific Oligonucleotide Primers

    PubMed Central

    Abliz, Paride; Fukushima, Kazutaka; Takizawa, Kayoko; Nieda, Norikazu; Miyaji, Makoto; Nishimura, Kazuko

    2003-01-01

    An oligonucleotide primer set based on internal transcribed spacer regions of ribosomal DNA for PCR which gives the amplicon for only the DNA from Fonsecaea species was designed. This set yielded an amplicon with 333 bp for all strains of Fonsecaea pedrosoi and Fonsecaea compacta examined but no amplicons for related dematiaceous fungi and pathogenic yeasts. PCR using this primer set was considered to be a useful method for the rapid identification of the genus Fonsecaea. PMID:12574304

  6. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. PMID:24829457

  7. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    PubMed Central

    Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals. PMID:18316812

  8. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    ERIC Educational Resources Information Center

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  9. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats

    PubMed Central

    Camacho, H.; Tuero, A. D.; Bacardí, D.; Palenzuela, D. O.; Aguilera, A.; Silva, J. A.; Estrada, R.; Gell, O.; Suárez, J.; Ancizar, J.; Brown, E.; Colarte, A. B.; Castro, J.; Novoa, L. I.

    2016-01-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies. PMID:27382362

  10. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  11. A Comprehensive Evaluation of PCR Primers to Amplify the nifH Gene of Nitrogenase

    PubMed Central

    Gaby, John Christian; Buckley, Daniel H.

    2012-01-01

    The nifH gene is the most widely sequenced marker gene used to identify nitrogen-fixing Bacteria and Archaea. Numerous PCR primers have been designed to amplify nifH, but a comprehensive evaluation of nifH PCR primers has not been performed. We performed an in silico analysis of the specificity and coverage of 51 universal and 35 group-specific nifH primers by using an aligned database of 23,847 nifH sequences. We found that there are 15 universal nifH primers that target 90% or more of nitrogen fixers, but that there are also 23 nifH primers that target less than 50% of nifH sequences. The nifH primers we evaluated vary in their phylogenetic bias and their ability to recover sequences from commonly sampled environments. In addition, many of these primers will amplify genes that do not mediate nitrogen fixation, and thus it would be advisable for researchers to screen their sequencing results for the presence of non-target genes before analysis. Universal primers that performed well in silico were tested empirically with soil samples and with genomic DNA from a phylogenetically diverse set of nitrogen-fixing strains. This analysis will be of great utility to those engaged in molecular analysis of nifH genes from isolates and environmental samples. PMID:22848735

  12. Indexed PCR Primers Induce Template-Specific Bias in Large-Scale DNA Sequencing Studies

    PubMed Central

    O’Donnell, James L.; Kelly, Ryan P.; Lowell, Natalie C.; Port, Jesse A.

    2016-01-01

    Massively parallel sequencing is rapidly emerging as an efficient way to quantify biodiversity at all levels, from genetic variation and expression to ecological community assemblage. However, the number of reads produced per sequencing run far exceeds the number required per sample for many applications, compelling researchers to sequence multiple samples per run in order to maximize efficiency. For studies that include a PCR step, this can be accomplished using primers that include an index sequence allowing sample origin to be determined after sequencing. The use of indexed primers assumes they behave no differently than standard primers; however, we found that indexed primers cause substantial template sequence-specific bias, resulting in radically different profiles of the same environmental sample. Likely the outcome of differential amplification efficiency due to primer-template mismatch, two indexed primer sets spuriously change the inferred sequence abundance from the same DNA extraction by up to 77.1%. We demonstrate that a double PCR approach alleviates these effects in applications where indexed primers are necessary. PMID:26950069

  13. Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.

    PubMed

    Winn-Deen

    1998-12-01

    Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe. PMID:10089280

  14. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    ERIC Educational Resources Information Center

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  15. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    PubMed Central

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods. PMID:27408580

  16. Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

  17. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  18. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

    PubMed

    Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

    2008-08-01

    A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups. PMID:18631176

  19. Revealing the Diversity and Quantity of Peritrich Ciliates in Environmental Samples Using Specific Primer-based PCR and Quantitative PCR

    PubMed Central

    Liu, Xihan; Gong, Jun

    2012-01-01

    Peritrichs are a diverse, ecologically important ciliate group usually with a complex life cycle. To date, the community of the peritrichs has been investigated by using morphology-based methods such as living observation and silver staining. Here we show a molecular approach for characterizing the diversity and quantity of free-living peritrichs in environmental samples. We newly designed four peritrich-specific primers targeting 18S rRNA genes that allow clone library construction, screening and analysis. A quantitative real-time PCR (qPCR) assay was developed to quantify peritrichs in environmental samples by using rDNA copy number as an indicator. DNA extracted from four water samples of contrasting environmental gradients was analysed. The results showed that the peritrich community was differentiated among these samples, and that the diversity decreased with the increase of water salinity. The qPCR results are consistent with the library sequence analysis in terms of quantity variations from sample to sample. The development of peritrich-specific primers, for the first time, for conventional PCR and qPCR assays, provides useful molecular tools for revealing the diversity and quantity of peritrich ciliates in environmental samples. Also, our study illustrates the potential of these molecular tools to ecological studies of other ciliate groups in diverse environments. PMID:23100023

  20. Primer Evaluation for PCR and its Application for Detection of Carbapenemases in Enterobacteriaceae

    PubMed Central

    Mlynarcik, Patrik; Roderova, Magdalena; Kolar, Milan

    2016-01-01

    Background: During the last decade, the prevalence of carbapenem-resistant Enterobacteriaceae in human patients has increased. Carbapenemase-producing bacteria are usually multidrug resistant. Therefore, early recognition of carbapenemase producers is critical to prevent their spread. Objectives: The objective of this study was to develop the primers for single and/or multiplex PCR amplification assays for simultaneous identification of class A, class B, and class D carbapenem hydrolyzing β-lactamases in Enterobacteriaceae and then to evaluate their efficiency. Materials and Methods: The reference sequences of all genes encoding carbapenemases were downloaded from GenBank. Primers were designed to amplify the following 11 genes: blaKPC, blaOXA, blaVIM, blaNDM, blaIMP, blaSME, blaIMI, blaGES, blaGIM, blaDIM and blaCMY. PCR conditions were tested to amplify fragments of different sizes. Two multiplex PCR sets were created for the detection of clinically important carbapenemases. The third set of primers was included for detection of all known carbapenemases in Enterobacteriaceae. They were evaluated using six reference strains and nine clinical isolates. Results: Using optimized conditions, all carbapenemase-positive controls yielded predicted amplicon sizes and confirmed the specificity of the primers in single and multiplex PCR. Conclusions: We have reported here a reliable method, composed of single and multiplex PCR assays, for screening all clinically known carbapenemases. Primers tested in silico and in vitro may distinguish carbapenem-resistant Enterobacteriaceae and could assist in combating the spread of carbapenem resistance in Enterobacteriaceae. PMID:27099689

  1. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

    PubMed Central

    Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

  2. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  3. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata

    PubMed Central

    Martín, M. T.; Cuesta, M. J.; Martín, L.

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes. PMID:27437468

  4. Detection and analysis of diverse herpesviral species by consensus primer PCR.

    PubMed Central

    VanDevanter, D R; Warrener, P; Bennett, L; Schultz, E R; Coulter, S; Garber, R L; Rose, T M

    1996-01-01

    A consensus primer PCR method which amplifies a region of herpesviral DNA-directed DNA polymerase (EC 2.7.7.7) and which uses degenerate primers in a nested format was developed. Primers were designed to target sequences coding for highly conserved amino acid motifs covering a region of approximately 800 bp. The assay was applied to 22 species of herpesviruses (8 human and 14 animal viruses), with PCR products obtained for 21 of 22 viruses. In the process, 14 previously unreported amino acid-coding sequences from herpesviral DNA polymerases were obtained, including regions of human herpesviruses 7 and 8. The 50 to 60 amino acid-coding sequences recovered in the present study were determined to be unique to each viral species studied, with very little sequence variation between strains of a single species when studied. Template dilution studies in the presence of human carrier DNA demonstrated that six human herpesviruses (herpesviruses 1, 2, 3, 4, 5, and 6B) could be detected at levels at or below 100 genome equivalents per 100 ng of carrier DNA. These data suggest that consensus primer PCR targeted to herpesviral DNA polymerase may prove to be useful in the detection and identification of known herpesviruses in clinical samples and the initial characterization of new herpesviral genomes. PMID:8784566

  5. Multiplexing with three-primer PCR for rapid and economical microsatellite validation.

    PubMed

    Vartia, Salla; Collins, Patrick C; Cross, Thomas F; Fitzgerald, Richard D; Gauthier, David T; McGinnity, Philip; Mirimin, Luca; Carlsson, Jens

    2014-06-01

    The next generation sequencing revolution has enabled rapid discovery of genetic markers, however, development of fully functioning new markers still requires a long and costly process of marker validation. This study reports a rapid and economical approach for the validation and deployment of polymorphic microsatellite markers obtained from a 454 pyrosequencing library of Atlantic cod, Gadus morhua, Linnaeus 1758. Primers were designed from raw reads to amplify specific amplicon size ranges, allowing effective PCR multiplexing. Multiplexing was combined with a three-primer PCR approach using four universal tails to label amplicons with separate fluorochromes. A total of 192 primer pairs were tested, resulting in 73 polymorphic markers. Of these, 55 loci were combined in six multiplex panels each containing between six and eleven markers. Variability of the loci was assessed on G. morhua from the Celtic Sea (n = 46) and the Scotian Shelf (n = 46), two locations that have shown genetic differentiation in previous studies. Multilocus F(ST) between the two samples was estimated at 0.067 (P = 0.001). After three loci potentially under selection were excluded, the global F(ST) was estimated at 0.043 (P = 0.001). Our technique combines three-primer and multiplex PCR techniques, allowing simultaneous screening and validation of relatively large numbers of microsatellite loci. PMID:25041267

  6. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    PubMed

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes. PMID:21570489

  7. Removal of PCR Error Products and Unincorporated Primers by Metal-Chelate Affinity Chromatography

    PubMed Central

    Kanakaraj, Indhu; Jewell, David L.; Murphy, Jason C.; Fox, George E.; Willson, Richard C.

    2011-01-01

    Immobilized Metal Affinity Chromatography (IMAC) has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and “histidine tags” genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu2+-iminodiacetic acid (IDA) agarose spin column, 94–99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu2+-IDA agarose) can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs. PMID:21264292

  8. Low-stringency PCR with diagnostically useful primers for identification of Leptospira serovars.

    PubMed Central

    de Caballero, O L; Dias Neto, E; Koury, M C; Romanha, A J; Simpson, A J

    1994-01-01

    Primers proposed for the diagnosis of the pathogenic spirochete Leptospira spp. (C. Gravekamp, H. V. D. Kemp, M. Franzen, D. Carrington, G.J. Schoone, G.J.J.M. Van Eys, C. O. R. Everard, R.A. Hartskeel, and W.J. Terpstra, J. Gen. Microbiol. 139:1691-1700, 1993) have been found to produce complex serovar-specific patterns under low-stringency PCR conditions. Such patterns obtained by low-stringency PCR, which maintain the specific band as an internal control, offer, an approach to the standardized identification of Leptospira serovars in clinical laboratories. Images PMID:8051272

  9. PCR primers to amplify 16S rRNA genes from cyanobacteria.

    PubMed Central

    Nübel, U; Garcia-Pichel, F; Muyzer, G

    1997-01-01

    We developed and tested a set of oligonucleotide primers for the specific amplification of 16S rRNA gene segments from cyanobacteria and plastids by PCR. PCR products were recovered from all cultures of cyanobacteria and diatoms that were checked but not from other bacteria and archaea. Gene segments selectively retrieved from cyanobacteria and diatoms in unialgal but nonaxenic cultures and from cyanobionts in lichens could be directly sequenced. In the context of growing sequence databases, this procedure allows rapid and phylogenetically meaningful identification without pure cultures or molecular cloning. We demonstrate the use of this specific PCR in combination with denaturing gradient gel electrophoresis to probe the diversity of oxygenic phototrophic microorganisms in cultures, lichens, and complex microbial communities. PMID:9251225

  10. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    PubMed

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens. PMID:21332639

  11. Degenerate PCR primers for detecting putative priming glycosyltransferase genes in Bifidobacterium strains.

    PubMed

    Hidalgo-Cantabrana, C; Ordoñez, I; Ruas-Madiedo, P; Margolles, A

    2015-01-01

    A new PCR-based method to detect putative exopolysaccharide (EPS) producers from the genus Bifidobacterium was developed based on the detection of two priming glycosyltransferase genes: rfbP (undecaprenyl-phosphate sugar phospho-transferase) and cpsD (galactosyl-transferase). An in silico analysis of the genomes of 28 bifidobacterial strains, belonging to 8 different species, allowed us to detect rfbP, cpsD, or both, in the large majority of the genomes. Based on DNA sequence homology studies, 24 degenerated primers were synthesised in order to select the primer pairs with the broadest capacity to detect the presence of these genes. Four primer pairs targeting internal regions of rfbP and cpsD were selected, allowing the detection of at least one of the two genes in 63 out of 99 bifidobacterial strains analysed, whereas control strains from other genera yielded negative results, suggesting that these genes are widely spread in this genus. The use of these primers is recommended to screen for the potential of Bifidobacterium strains to produce EPS. PMID:25653152

  12. Universal primer PCR with DGGE for rapid detection of bacterial pathogens.

    PubMed

    Ji, Niannian; Peng, Bo; Wang, Guizhong; Wang, Sanying; Peng, Xuanxian

    2004-06-01

    A universal primer PCR (UPPCR) combined with denaturing gradient gel electrophoresis (DGGE) was evaluated as a method permitting the rapid detection of pathogens. The results show that this method is efficient at amplifying the conserved regions of bacterial 16S rRNA genes with universal primers and can detect causative bacterial pathogens rapidly. Six species of bacteria from fisheries (Pseudomonas fluorescens, Vibrio anguillarum, Aeromonas hydrophila, Vibrio fluvialis, Providencia rettgeri and Aeromonas sobria) were examined. Our results indicate that the approach we undertook can be adopted not only for axenic bacterial populations but also for mixed communities as well. Furthermore, we were able to achieve the rapid detection of multiple bacteria a single in sample. In addition, UPPCR-DGGE was shown to be better than previously reported UPPCR-single-stranded conformation polymorphism (SSCP)-based methods for the rapid detection of bacterial pathogens. PMID:15134888

  13. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    SciTech Connect

    Jothikumar, N. Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  14. Development of universal primers for detection of potato carlaviruses by RT-PCR.

    PubMed

    Nie, Xianzhou; Bai, Yanju; Molen, Teresa A; Desjardins, David C

    2008-05-01

    To facilitate efficient and accurate detection of potato-infecting carlaviruses, degenerated universal primers were designed based on conserved amino acid and nucleotide sequences. Two sense primers, Car-F1 and Car-F2, were based on the amino acid sequences "SNNMA" and "GLGVPTE", respectively, in the coat protein. The reverse primer, Car-R, which was located at the border of the nucleic acid binding protein gene and the 3' untranslated region, and dT-B, which was derived from the oligo-dT targeting the poly(A) tail, were selected. Successful application of fragments within the predicted size range of carlaviruses was obtained using Car-F1 paired with either Car-R or dT-B from tested carlaviruses (Potato virus S, M and latent) by RT-PCR. The Car-F2 failed to yield clear-cut fragments within the predicted size range when paired with either Car-R or dT-B in RT-PCR. However, a less degenerated version of the primer, Car-F2b, resulted in amplicons within the predicted size range when paired with either Car-R or dT-B. Sequencing of the tentative carlavirus-fragments resulting from Car-F1/Car-R and Car-F2b/dT-B proved their carlavirus-origin, thus indicating the high specificity of these primers. The sensitivity of Car-F1/Car-R or Car-F2b/Car-R mediated RT-PCR for the detection of carlavirus-infected potato tubers were assessed using composite samples containing one carlavirus-infected-potato-tuber RNA sample with up to 49 virus-free-potato-tuber RNA samples under the optimal annealing temperature. The target carlaviruses were detected readily from all composites, demonstrating a high sensitivity. The method was further evaluated using presumed virus-free or carlavirus-infected potatoes of several cultivars, and reliable results were obtained. PMID:18353450

  15. Partial molecular cloning of the JHK retrovirus using gammaretrovirus consensus PCR primers

    PubMed Central

    Halligan, Brian D; Sun, Hai-Yuan; Kushnaryov, Vladimir M; Grossberg, Sidney E

    2013-01-01

    The JHK virus (JHKV) was previously described as a type C retrovirus that has some distinctive ultrastructural features and replicates constitutively in a human B-lymphoblastoid cell line, JHK-3. In order to facilitate the cloning of sequences from JHKV, a series of partially degenerate consensus retroviral PCR primers were created by a data-driven design approach based on an alignment of 14 diverse gammaretroviral genomes. These primers were used in the PCR amplification of purified JHK virion cDNA, and ana lysis of the resulting amplified sequence indicates that the JHKV is in the murine leukemia virus (MLV) family. The JHK sequence is nearly identical to the corresponding region of the Bxv-1 endogenous mouse retrovirus (GenBank accession AC115959) and distinct from XMRV. JHKV gag-specific amplification was demonstrated with nucleic acids from uncultivated, frozen, peripheral blood mononuclear cells (PBMCs) of the index patient, but not in PBMCs from nine healthy blood donors. Unlike earlier reports, in which MLV-like sequences were identified in human source material, which may have been due to murine contamination, budding retrovirions were demonstrated repeatedly by electron microscopy in uncultivated lymphocytes of the index patient that were morphologically identical in their development to the virions in the JHK-3 cells, and immunological evidence was obtained that the index patient produced IgG antibodies that bound to the budding viral particles in patient PBMCs and in the JHK-3 cells. These data indicate that the patient had been infected by JHKV, lending significance to the demonstration of JHKV amplicons in nucleic acids of the patient’s PBMCs. In future studies, the PCR primer sets described herein may expand the detection of an amplifiable subset of viruses related to MLV. PMID:24159361

  16. Tetra Primer ARMS PCR Optimization to Detect Single Nucleotide Polymorphisms of the CYP2E1 Gene.

    PubMed

    Suhda, Saihas; Paramita, Dewi Kartikawati; Fachiroh, Jajah

    2016-01-01

    Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP). PMID:27509930

  17. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    PubMed

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding. PMID:26084789

  18. Genotyping single nucleotide polymorphisms in barley by tetra-primer ARMS-PCR.

    PubMed

    Chiapparino, E; Lee, D; Donini, P

    2004-04-01

    Single nucleotide polymorphisms (SNPs) are the most abundant form of DNA polymorphism. These polymorphisms can be used in plants as simple genetic markers for many breeding applications, for population studies, and for germplasm fingerprinting. The great increase in the available DNA sequences in the databases has made it possible to identify SNPs by "database mining", and the single most important factor preventing their widespread use appears to be the genotyping cost. Many genotyping platforms rely on the use of sophisticated, automated equipment coupled to costly chemistry and detection systems. A simple and economical method involving a single PCR is reported here for barley SNP genotyping. Using the tetra-primer ARMS-PCR procedure, we have been able to assay unambiguously five SNPs in a set of 132 varieties of cultivated barley. The results show the reliability of this technique and its potential for use in low- to moderate-throughput situations; the association of agronomically important traits is discussed. PMID:15060595

  19. PCR differentiation of commercial yeast strains using intron splice site primers.

    PubMed Central

    de Barros Lopes, M; Soden, A; Henschke, P A; Langridge, P

    1996-01-01

    The increased use of pure starter cultures in the wine industry has made it necessary to develop a rapid and simple identification system for yeast strains. A method based upon the PCR using oligonucleotide primers that are complementary to intron splice sites has been developed. Since most introns are not essential for gene function, introns have evolved with minimal constraint. By targeting these highly variable sequences, the PCR has proved to be very effective in uncovering polymorphisms in commercial yeast strains. The speed of the method and the ability to analyze many samples in a single day permit the monitoring of specific yeast strains during fermentations. Furthermore, the simplicity of the technique, which does not require the isolation of DNA, makes it accessible to industrial laboratories that have limited molecular expertise and resources. PMID:8953723

  20. Development of primers and probes for detection of citrus "Candidatus Liberibacter species" by real-time PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Citrus huanglongbing (HLB) or citrus greening is the most threatening bacterial disease of Citrus spp. Three uncultured Candidatus Liberibacter spp. are usually detected by conventional PCR or real-time PCR using species specific primers and probes based on the 16S rRNA gene. Recent molecular analy...

  1. Identification of Mycobacterium bovis in bovine clinical samples by PCR species-specific primers.

    PubMed Central

    Romero, R E; Garzón, D L; Mejía, G A; Monroy, W; Patarroyo, M E; Murillo, L A

    1999-01-01

    Tuberculosis, caused by Mycobacterium bovis is emerging as the most important disease affecting cattle. Furthermore, it results in a major public health problem when transmitted to humans. Due to its difficult and non-specific diagnosis, M. bovis has been declared to be one of the etiologic agents causing significant economic loss in the cattle industry. Our group evaluated a more rapid and specific method, based on a new polymerase chain reaction species-specific primers, which amplifies a 470-base pair fragment of the M. bovis genome. A total of 275 milk-producing cows were studied by intradermal tuberculin test (ITT) which gave 184 positive and 91 negative cases. From them, 50 animals were taken from a cattle ranch free of tuberculosis. Three different samples were collected from each animal (blood, nasal mucus, and milk). Positive results were obtained from 26 animals by PCR (11.4%), 1 by bacteriological culturing (0.4%) and 1 by bacilloscopy (0.4%). This finding suggests, as in previous reports, that ITT, normally used for bovine tuberculosis detection, has the inconvenience of having a broad range of specificity and sensitivity, and the PCR technique is a more specific and sensitive test to detect infection associated with M. bovis. Therefore, we propose this PCR assay as a useful tool in the epidemiological characterization of infected animals in areas considered to be at high risk of transmission. Images Figure 1. PMID:10369566

  2. GenoFrag: software to design primers optimized for whole genome scanning by long-range PCR amplification

    PubMed Central

    Ben Zakour, Nouri; Gautier, Michel; Andonov, Rumen; Lavenier, Dominique; Cochet, Marie-Françoise; Veber, Philippe; Sorokin, Alexei; Le Loir, Yves

    2004-01-01

    Genome sequence data can be used to analyze genome plasticity by whole genome PCR scanning. Small sized chromosomes can indeed be fully amplified by long-range PCR with a set of primers designed using a reference strain and applied to several other strains. Analysis of the resulting patterns can reveal the genome plasticity. To facilitate such analysis, we have developed GenoFrag, a software package for the design of primers optimized for whole genome scanning by long-range PCR. GenoFrag was developed for the analysis of Staphylococcus aureus genome plasticity by whole genome amplification in ∼10 kb-long fragments. A set of primers was generated from the genome sequence of S.aureus N315, employed here as a reference strain. Two subsets of primers were successfully used to amplify two portions of the N315 chromosome. This experimental validation demonstrates that GenoFrag is a robust and reliable tool for primer design and that whole genome PCR scanning can be envisaged for the analysis of genome diversity in S.aureus, one of the major public health concerns worldwide. PMID:14704339

  3. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers.

    PubMed

    Kotik, Michael; Faměrová, Veronika

    2012-02-01

    Haloalkane dehalogenases (HLDs) are hydrolytic enzymes that cleave carbon-halogen bonds in various halogenated compounds. Interest initially grew in HLDs as biocatalysts for bioremediation and later for biotransformation applications; each specific HLD within the HLD family has its own substrate specificity, enantioselectivity and product inhibition characteristics. We developed degenerate oligonucleotide primers for HLD-encoding genes and used these to PCR-amplify large hld gene fragments using genomic DNA from the microbial community of a chlorinated-solvent-contaminated aquifer as a template. An analysis of small subunit ribosomal RNA genes revealed a high complexity in the eubacterial population, dominated by α-, β- and γ-Proteobacteria, and Acidobacteria. Using HLD-family-specific primers, we also retrieved transcribed hld homologues from the microbial consortium of this contaminated site. The DNA-derived hld sequences were phylogenetically broadly distributed over both HLD subclasses I and II. Most hld sequences of the environmental RNA data set clustered in three groups within both HLD subclasses, indicating that a considerable proportion of the microbial consortium carrying hld genes was actively involved in haloalkane dehalogenation. The small sequence variation in hld genes and transcripts within each HLD cluster inferred the presence of a substantial pool of highly related HLD genes. The sequence variability appeared to be unevenly distributed over the HLD genes, however, with no apparent preference for a particular protein segment or domain. PMID:22155739

  4. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    PubMed Central

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-01-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  5. Nested PCR and New Primers for Analysis of Sulfate-Reducing Bacteria in Low-Cell-Biomass Environments▿ †

    PubMed Central

    Giloteaux, Ludovic; Goñi-Urriza, Marisol; Duran, Robert

    2010-01-01

    New primers were designed for the amplification of dsrAB genes by nested PCR to investigate the diversity of sulfate-reducing prokaryotes (SRP) in environments with low bacterial cell density. The success of the nested PCR for the determination of SRP diversity was estimated by terminal-restriction fragment length polymorphism analysis in the Reigous, a small creek at an inactive mine (Carnoulès, France), which constitutes an extreme acidic arsenic-rich environment. Nested PCR limits were evaluated in dsrAB-rich sediments, and this technique was compared to direct PCR using either known primers (DSR1F/DSR4R) or new primers (dsr619AF/dsr1905BR). The comparison of clone libraries revealed that, even if the levels of diversity observed were not identical, nested PCR did not reduce the diversity compared to that of direct DSR1F/DSR4R PCR. Clone sequences were affiliated mainly with the Desulfobacteraceae and Desulfohalobiaceae families. Many sequences (∼30%) were related to a deeply branching lineage unaffiliated with any cultured SRP. Although this dsrAB cluster was found in all libraries, the new primers better amplified this lineage, providing more information on this unknown bacterial group. Thanks to these new primers in nested PCR, the SRP community from Carnoulès could be characterized. Specific SRP populations were obtained according to environmental characteristics. Desulfomicrobiaceae-related sequences were recovered in samples with low pH, low levels of dissolved oxygen, and high As content, while sequences belonging to the deeply branching group were found in a less extreme sample. Furthermore, for the first time, dsrAB sequences related to the latter group were recovered from freshwater. PMID:20228118

  6. Multiplex detection and genotyping of pathogenic bacteria on paper-based biosensor with a novel universal primer mediated asymmetric PCR.

    PubMed

    Liu, Fang; Liu, Hongxing; Liao, Yuhui; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2015-12-15

    Traditionary multiplex asymmetric polymerase chain reaction (PCR) can be applied to detect multiplex target organisms simultaneously, but complex optimizations of primer concentrations and staggered additions of primers are required to achieve equal amplification of multiplex genes. To overcome this shortcoming, we propose a novel method based on multiplex asymmetric PCR and paper-based nucleic acid diagnostics (PBNAD). In the asymmetric PCR, a universal primer was introduced to break the bottlenecks of low sensitivity and self-inhibition among different sets of primers. Amplification using the novel multiplex asymmetric PCR boosted the quantity of single-stranded amplicons, and the amplified products contained the same sequence at the 5' end. Therefore, only one gold nanoparticle-based signal probe was needed for the simultaneous detection of three genes using the PBNAD platform, and the detection signals could be observed with the naked eye. With this highly efficient, novel multiplex asymmetric PCR, as little as 1 pg/μL genomic DNA can be detected. This method can also be applied to genotyping for reliable epidemiological investigations. This proof-of-concept study highlights the potential of the PBNAD platform for cost- and labor-effective applications in the detection of pathogenic bacteria. PMID:26226347

  7. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    PubMed Central

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C.; Chorianopoulos, Nikos

    2015-01-01

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry. PMID:26506345

  8. Nested Allele-Specific PCR Primers Distinguish Genetic Groups of Uncinula necator

    PubMed Central

    Délye, Christophe; Ronchi, Valérie; Laigret, Frédéric; Corio-Costet, Marie-France

    1999-01-01

    Isolates of the obligately biotrophic fungus Uncinula necator cluster in three distinct genetic groups (groups I, II, and III). We designed PCR primers specific for these groups in order to monitor field populations of U. necator. We used the nucleotide sequences of the gene that encodes eburicol 14α-demethylase (CYP51) and of the ribosomal DNA internal transcribed spacer 1 (ITS1), ITS2, and 5.8S regions. We identified four point mutations (three in CYP51 and one in ITS1) that distinguished groups I and II from group III based on a sample of 132 single-spore isolates originating from Europe, Tunisia, Israel, India, and Australia. We developed a nested allele-specific PCR assay in which the CYP51 point mutations were used to detect and distinguish groups I and II from group III in crude mildewed samples from vineyards. In a preliminary study performed with samples from French vineyards in which isolates belonging to genetic groups I and III were present, we found that a shift from a population composed primarily of group I isolates to a population composed primarily of group III isolates occurred during the grapevine growing season. PMID:10473400

  9. Influence of primer & probe chemistry and amplification target on reverse transcription digital PCR quantification of viral RNA.

    PubMed

    Van Heuverswyn, Fran; Karczmarczyk, Maria; Schimmel, Heinz; Trapmann, Stefanie; Emons, Hendrik

    2016-09-01

    Compared to other PCR technologies, digital PCR is a potentially highly accurate approach for the quantification of nucleic acid fragments. This study describes the impact of four experimental factors, namely primer and probe chemistry, PCR amplification target, duplexing, and template type, on the measurement results obtained by reverse transcription digital PCR (RT-dPCR) of viral RNA using influenza A virus as a model. Along conventional dual labelled probes (DLP), alternative primer and probe chemistries, including Zip Nucleic Acids (ZNAs), Locked Nucleic Acids (LNAs), and Scorpions(®), were compared with two RNA template types: i) total genomic RNA extracted from cell cultured influenza A and ii) a synthetically prepared RNA transcript (In vitro transcribed RNA). While apparently duplexing or a different PCR target choice did not have a significant influence on the estimated RNA copy numbers, the impact of the choice of primer and probe chemistry and template type differed significantly for some methods. The combined standard uncertainty of the dPCR analysis results has been assessed, taking into account both the repeatability and the intermediate precision of the procedure. Our data highlight the importance of dPCR method optimisation and the advantage of using a more sophisticated primer and probe chemistry, which turned out to be dependent on the template type. Considerations are provided with respect to the molecular diagnostics of viral RNA pathogens, and more specifically, for precise quantification of RNA, which is of tremendous importance for the development of RNA calibration materials and the qualification of these calibrants as certified reference materials. PMID:27617229

  10. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree. PMID:19778057

  11. DegePrime, a program for degenerate primer design for broad-taxonomic-range PCR in microbial ecology studies.

    PubMed

    Hugerth, Luisa W; Wefer, Hugo A; Lundin, Sverker; Jakobsson, Hedvig E; Lindberg, Mathilda; Rodin, Sandra; Engstrand, Lars; Andersson, Anders F

    2014-08-01

    The taxonomic composition of a microbial community can be deduced by analyzing its rRNA gene content by, e.g., high-throughput DNA sequencing or DNA chips. Such methods typically are based on PCR amplification of rRNA gene sequences using broad-taxonomic-range PCR primers. In these analyses, the use of optimal primers is crucial for achieving an unbiased representation of community composition. Here, we present the computer program DegePrime that, for each position of a multiple sequence alignment, finds a degenerate oligomer of as high coverage as possible and outputs its coverage among taxonomic divisions. We show that our novel heuristic, which we call weighted randomized combination, performs better than previously described algorithms for solving the maximum coverage degenerate primer design problem. We previously used DegePrime to design a broad-taxonomic-range primer pair that targets the bacterial V3-V4 region (341F-805R) (D. P. Herlemann, M. Labrenz, K. Jurgens, S. Bertilsson, J. J. Waniek, and A. F. Andersson, ISME J. 5:1571-1579, 2011, http://dx.doi.org/10.1038/ismej.2011.41), and here we use the program to significantly increase the coverage of a primer pair (515F-806R) widely used for Illumina-based surveys of bacterial and archaeal diversity. By comparison with shotgun metagenomics, we show that the primers give an accurate representation of microbial diversity in natural samples. PMID:24928874

  12. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    PubMed Central

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  13. Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

    PubMed

    Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

    2015-08-01

    Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. PMID:26074237

  14. Evaluation of multiplex PCR using MPB64 and IS6110 primers for rapid diagnosis of tuberculous meningitis.

    PubMed

    Lekhak, Sunil Prasad; Sharma, Laxmi; Rajbhandari, Reema; Rajbhandari, Pravesh; Shrestha, Resha; Pant, Basant

    2016-09-01

    Tuberculous meningitis (TBM) is one of those most serious manifestations of extra-pulmonary tuberculosis and prompt diagnosis and treatment is required for better clinical outcome. It is difficult to diagnose due to lack of rapid, sensitive, and specific tests. Newer methods, which are easy and reliable, are required to diagnose TBM at an early stage. Thus our aim was to evaluate the Multiplex polymerase chain reaction (PCR) technique, using primers directed against the insertion sequence IS6110 and MPB64 gene for the detection of Mycobacterium tuberculosis in Cerebrospinal fluid (CSF), for rapid diagnosis of TBM patients. 102 CSF samples were analyzed from patients suspected with TBM along with a control group of 10 patients having other neurological disorders. CSF sediments were analyzed individually for M. tuberculosis DNA by Multiplex PCR using two set of primers targeting insertion sequence IS6110 and gene MBp64, which is very specific for MTBC. Out of 37 patients diagnosed with TBM clinically, MPB64 PCR was positive in 22, IS6110 PCR was positive in 28, both PCR using Multiplex were positive in 34 and Microscopy was positive in one. Thus Sensitivity of MPB64 PCR, IS6110 PCR, Multiplex PCR and Microscopy were found to be 62.3%, 75.4%, 91.8% and 2.7% respectively. In non TBM group PCR was negative in all cases hence, the specificity was 100%. Multiplex PCR system using primers targeting IS6110 and MPB64, for the detection of M. tuberculosis DNA in CSF samples, has high sensitivity than any one of them alone, and could be used for the early detection of TBM in CSF samples. PMID:27553404

  15. A Unique Primer with an Inosine Chain at the 5′-Terminus Improves the Reliability of SNP Analysis Using the PCR-Amplified Product Length Polymorphism Method

    PubMed Central

    Shojo, Hideki; Tanaka, Mayumi; Takahashi, Ryohei; Kakuda, Tsuneo; Adachi, Noboru

    2015-01-01

    Polymerase chain reaction-amplified product length polymorphism (PCR-APLP) is one of the most convenient and reliable methods for single nucleotide polymorphism (SNP) analysis. This method is based on PCR, but uses allele-specific primers containing SNP sites at the 3′-terminus of each primer. To use this method at least two allele-specific primers and one “counter-primer”, which serves as a common forward or reverse primer of the allele-specific primers, are required. The allele-specific primers have SNP sites at the 3′-terminus, and another primer should have a few non-complementary flaps at the 5′-terminus to detect SNPs by determining the difference of amplicon length by PCR and subsequent electrophoresis. A major disadvantage of the addition of a non-complementary flap is the non-specific annealing of the primer with non-complementary flaps. However, a design principle for avoiding this undesired annealing has not been fully established, therefore, it is often difficult to design effective APLP primers. Here, we report allele-specific primers with an inosine chain at the 5′-terminus for PCR-APLP analysis. This unique design improves the competitiveness of allele-specific primers and the reliability of SNP analysis when using the PCR-APLP method. PMID:26381262

  16. Evaluation of primer and probe mismatches in sensitivity of select RRT-PCR tests for avian influenza

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The recent outbreak of pH1N1 in animals highlighted an imperfection of the matrix real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) that has become the primary screening test for avian and swine influenza viruses. Four mismatches in one primer resulted in an important loss of sens...

  17. Development of PCR primers from internal transcribed spacer region 2 for detection of Phytophthora species infecting potatoes.

    PubMed Central

    Tooley, P W; Bunyard, B A; Carras, M M; Hatziloukas, E

    1997-01-01

    We developed PCR primers and assay methods to detect and differentiate three Phytophthora species which infect potatoes and cause late blight (Phytophthora infestans) and pink rot (P. erythroseptica and P. nicotianae) diseases. Primers based on sequence analysis of internal transcribed spacer region 2 of ribosomal DNA produced PCR products of 456 bp (P. infestans), 136 bp (P. erythroseptica), and 455 bp (P. nicotianae) and were used to detect the pathogens in potato leaf (P. infestans) and tuber (P. infestans, P. erythroseptica, and P. nicotianae) tissue with a sensitivity of 1 to 10 pg of DNA. Leaf and tuber tissue were processed for PCR by a rapid NaOH method as well as a method based on the use of commercially available ion-exchange columns of P. infestans primers and the rapid NaOH extraction method were used to detect late blight in artificially and naturally infected tubers of potato cultivar Red LaSoda. In sampling studies, P. infestans was detected by PCR from artificially infected tubers at 4 days postinoculation, before any visible symptoms were present. The PCR assay and direct tissue extraction methods provide tools which may be used to detect Phytophthora pathogens in potato seedlots and storages and thus limit the transmission and spread of new, aggressive strains of P. infestans in U.S. potato-growing regions. PMID:9097445

  18. Methods for detection and differentiation of existing and new crinivirus species through multiplex and degenerate primer RT-PCR.

    PubMed

    Wintermantel, William M; Hladky, Laura L

    2010-12-01

    A method was developed for rapid identification and differentiation of both known and novel crinivirus species involving both multiplex and degenerate reverse transcription-polymerase chain reaction (RT-PCR). The multiplex method can discriminate among known criniviruses infecting vegetable and small fruit crops, and rapidly identify viruses associated with disease symptoms, as well as identification of mixed crinivirus infections. Four host groups for multiplex detection of criniviruses were selected based on the types of crops where specific criniviruses would be expected to occur. Each detection group contained three to four crop-specific primers designed to the same region of the gene encoding the highly conserved RNA-dependent RNA polymerase gene (RdRp) of criniviruses for rapid, single-reaction determination of which crinivirus(es) may be infecting a plant. Degenerate reverse primers used for RT and in PCR were designed to amplify all members of each host group, and were coupled with species-specific forward primers resulting in four separate single-reaction cocktails for detection of most criniviruses sequenced to date, whether present in single or mixed virus infections. Additional viruses can be added to multiplex detection by adjustment of primer concentration for balanced detection of target viruses. In order to identify unknown putative criniviruses or those for which sequence information is not yet available, a genus-wide, universal degenerate primer set was developed. These primers also targeted the crinivirus RdRp gene, and amplify a wide range of crinivirus sequences. Both detection systems can be used with most RNA extraction methods, and with RT-PCR reagents common in most laboratories. PMID:20833203

  19. Data in support of qPCR primer design and verification in a Pink1 -/- rat model of Parkinson disease.

    PubMed

    Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R

    2016-09-01

    Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1]. PMID:27331115

  20. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.

    PubMed

    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P

    2004-03-15

    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity. PMID:14738987

  1. Single-Step PCR Using (GACA)4 Primer: Utility for Rapid Identification of Dermatophyte Species and Strains▿

    PubMed Central

    Shehata, Atef S.; Mukherjee, Pranab K.; Aboulatta, Hassan N.; El Akhras, Atef I.; Abbadi, Said H.; Ghannoum, Mahmoud A.

    2008-01-01

    Dermatophytes are fungi that belong to three genera: Epidermophyton, Microsporum, and Trichophyton. Identification of dermatophyte species is essential for appropriate diagnosis and treatment of dermatophytosis. Routine identification depends on macroscopic and microscopic morphology, which is time-consuming and does not identify dermatophyte strains. In this study, two PCR-based methods were compared for their abilities to identify 21 dermatophyte isolates obtained from Egyptian patients to the species and strain levels. The first method employed a two-step method: PCR amplification, using ITS1 and ITS4 as primers, followed by restriction enzyme digestion using the endonuclease MvaI. The second method employed a one-step approach employing the repetitive oligonucleotide (GACA)4 as a primer. Dermatophyte strains were also identified using a conventional culture method. Our results showed that the conventional culture method identified four species: Microsporum canis, Trichophyton mentagrophytes, Trichophyton rubrum, and Trichophyton violaceum. Moreover, both PCR methods agreed with the diagnosis made using the conventional approach. Furthermore, ITS1/ITS4-based PCR provided no strain differentiation, while (GACA)4-based PCR identified different varieties among the T. mentagrophytes isolates. Taken together, our results suggest that (GACA)4-based PCR has utility as a simple and rapid method for identification of dermatophyte species as well as utility for differentiation of T. mentagrophytes variants. PMID:18579714

  2. Strain-Specific Identification of Probiotic Lactobacillus rhamnosus with Randomly Amplified Polymorphic DNA-Derived PCR Primers

    PubMed Central

    Tilsala-Timisjärvi, Anu; Alatossava, Tapani

    1998-01-01

    In the present work, strain-specific PCR primers for Lactobacillus rhamnosus Lc 1/3 are described. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. They were screened for specificity by hybridization with DNA from 11 L. rhamnosus strains. A 613-bp RAPD marker found to be strain-specific was sequenced, and a primer pair specific to L. rhamnosus Lc 1/3 was constructed based on the sequence. The primer pair was tested with 11 Lactobacillus species and 11 L. rhamnosus strains and was found to be strain specific. The nucleotide sequence of the specific RAPD marker was found to contain part of a protein encoding region which showed significant similarity to several transposases for insertion sequence elements of various bacteria, including other lactic acid bacterium species. PMID:9835567

  3. PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high-throughput sequencing.

    PubMed

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the

  4. PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

    PubMed Central

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the

  5. Reassessment of PCR primers targeting 16S rRNA genes of the organohalide-respiring genus Dehalogenimonas.

    PubMed

    Chen, Jie; Bowman, Kimberly S; Rainey, Fred A; Moe, William M

    2014-09-01

    Representatives from the genus Dehalogenimonas have the metabolic capacity to anaerobically transform a variety of environmentally important polychlorinated aliphatic compounds. In light of the recent isolation of additional strains, description of a new species, and an expanded number of uncultured DNA sequences, PCR primers and protocols intended to uniquely target members of this organohalide-respiring genus were reevaluated. Nine of fourteen primer combinations reported previously as genus-specific failed to amplify 16S rRNA genes of recently isolated Dehalogenimonas strains. Use of alternative combinations or modified genus-specific primers, however, allowed detection of all presently known Dehalogenimonas strains. Use of a modified primer set in qPCR revealed an approximately two-order of magnitude increase in concentration of Dehalogenimonas 16S rRNA gene copies following subsurface injection of electron donors at a Louisiana Superfund site, demonstrating the utility of the newly developed protocol and suggesting that the genus Dehalogenimonas can respond to biostimulation remediation strategies in a manner similar to that previously reported for other dechlorinating genera such as Dehalococcoides. PMID:24989478

  6. A novel PCR technique using Alu-specific primers to identify unknown flanking sequences from the human genome

    SciTech Connect

    Minami, M.; Poussin, K.; Brechot, C.; Paterlini, P.

    1995-09-20

    The rapid and reproducible identification of new cellular DNA sequences is difficult to achieve with the currently available procedures. Here we describe a novel approach based on the polymerase chain reaction (PCR) using a primer specific to the known sequence and another directed to a human Alu repeat. To avoid undesirable amplifications between Alu sequences, primers are constructed with dUTPs and destroyed by uracil DNA glycosylase treatment after 10 initial cycles of amplification. Only desirable fragments are then further amplified with specific primers to the known region and to a tag sequence introduced in the Alu-specific primer. Using this protocol, we have successfully indentified cellular sequences flanking integrated hepatitis B virus DNA from the human genome of three hepatoma tissues. The method enables a direct specific amplification without any ligation or nonspecific annealing steps as required by previous PCR-based protocols. This rapid and straightforward approach will be a powerful tool for the study of viral integration sites, but is also widely applicable to other studies of the human genome. 39 refs., 4 figs.

  7. Development of a Dinoflagellate-Oriented PCR Primer Set Leads to Detection of Picoplanktonic Dinoflagellates from Long Island Sound†

    PubMed Central

    Lin, Senjie; Zhang, Huan; Hou, Yubo; Miranda, Lilibeth; Bhattacharya, Debashish

    2006-01-01

    We developed dinoflagellate-specific 18S rRNA gene primers. PCR amplification using these oligonucleotides for a picoplanktonic DNA sample from Long Island Sound yielded 24 clones, and all but one of these clones were dinoflagellates primarily belonging to undescribed and Amoebophrya-like lineages. These results highlight the need for a systematic investigation of picodinoflagellate diversity in both coastal and oceanic ecosystems. PMID:16885319

  8. Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers

    SciTech Connect

    Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A. . E-mail: andrepeinnequin@crssa.net

    2007-03-02

    Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased.

  9. easyPAC: A Tool for Fast Prediction, Testing and Reference Mapping of Degenerate PCR Primers from Alignments or Consensus Sequences

    PubMed Central

    Rosenkranz, David

    2012-01-01

    The PCR-amplification of unknown homologous or paralogous genes generally relies on PCR primers predicted from multi sequence alignments. But increasing sequence divergence can induce the need to use degenerate primers which entails the problem of testing the characteristics, unwanted interactions and potential mispriming of degenerate primers. Here I introduce easyPAC, a new software for the prediction of degenerate primers from multi sequence alignments or single consensus sequences. As a major innovation, easyPAC allows to apply all customary primer test procedures to degenerate primer sequences including fast mapping to reference files. Thus, easyPAC simplifies and expedites the designing of specific degenerate primers enormously. Degenerate primers suggested by easyPAC were used in PCR amplification with subsequent de novo sequencing of TDRD1 exon 11 homologs from several representatives of the haplorrhine primate phylogeny. The results demonstrate the efficient performance of the suggested primers and therefore show that easyPAC can advance upcoming comparative genetic studies.

  10. Comparative in silico analysis of PCR primers suited for diagnostics and cloning of ammonia monooxygenase genes from ammonia-oxidizing bacteria.

    PubMed

    Junier, Pilar; Kim, Ok-Sun; Molina, Verónica; Limburg, Petra; Junier, Thomas; Imhoff, Johannes F; Witzel, Karl-Paul

    2008-04-01

    Over recent years, several PCR primers have been described to amplify genes encoding the structural subunits of ammonia monooxygenase (AMO) from ammonia-oxidizing bacteria (AOB). Most of them target amoA, while amoB and amoC have been neglected so far. This study compared the nucleotide sequence of 33 primers that have been used to amplify different regions of the amoCAB operon with alignments of all available sequences in public databases. The advantages and disadvantages of these primers are discussed based on the original description and the spectrum of matching sequences obtained. Additionally, new primers to amplify the almost complete amoCAB operon of AOB belonging to Betaproteobacteria (betaproteobacterial AOB), a primer pair for DGGE analysis of amoA and specific primers for gammaproteobacterial AOB, are also described. The specificity of these new primers was also evaluated using the databases of the sequences created during this study. PMID:18248438

  11. A New Multiplex-PCR for Urinary Tract Pathogen Detection Using Primer Design Based on an Evolutionary Computation Method.

    PubMed

    García, Liliana Torcoroma; Cristancho, Laura Maritza; Vera, Erika Patricia; Begambre, Oscar

    2015-10-28

    This work describes a new strategy for optimal design of Multiplex-PCR primer sequences. The process is based on the Particle Swarm Optimization-Simplex algorithm (Mult-PSOS). Diverging from previous solutions centered on heuristic tools, the Mult-PSOS is selfconfigured because it does not require the definition of the algorithm's initial search parameters. The successful performance of this method was validated in vitro using Multiplex- PCR assays. For this validation, seven gene sequences of the most prevalent bacteria implicated in urinary tract infections were taken as DNA targets. The in vitro tests confirmed the good performance of the Mult-PSOS, with respect to infectious disease diagnosis, in the rapid and efficient selection of the optimal oligonucleotide sequences for Multiplex-PCRs. The predicted sequences allowed the adequate amplification of all amplicons in a single step (with the correct amount of DNA template and primers), reducing significantly the need for trial and error experiments. In addition, owing to its independence from the initial selection of the heuristic constants, the Mult-PSOS can be employed by non-expert users in computational techniques or in primer design problems. PMID:26059514

  12. Development of species-specific PCR primers and polyphasic characterization of Lactobacillus sanfranciscensis isolated from Korean sourdough.

    PubMed

    Lee, Hyeongrho; Baek, Hyunwook; Lim, Sae Bom; Hur, Jin Soo; Shim, Sangmin; Shin, So-Yeon; Han, Nam Soo; Seo, Jin-Ho

    2015-05-01

    Lactobacillus sanfranciscensis is a bacterium used in sourdough that provides desirable properties such as better flavor and texture to the sourdough bread. Here, the intra-species diversity of L. sanfranciscensis strains isolated from Korean sourdough was studied using genotypic (multiplex-RAPD-PCR: multiplex-Randomly Amplified Polymorphic DNA-polymerase chain reaction) and phenotypic (VITEK2 Compact system) analyses. For this, a novel species-specific set of PCR primers was developed to identify L. sanfranciscensis using the recently published genome database. The primers were able to detect L. sanfranciscensis isolated from Korean sourdough with 100% accuracy. Genotyping and phenotyping analyses at the strain level demonstrated that Korean sourdough possesses various biotypes of L. sanfranciscensis strains. These strains were clustered into 5 subtypes (genotyping) or 7 subtypes (phenotyping). In summary, this strategy to construct novel primers reduced the chance of cross amplification and was able to identify the desired strain. The various strains isolated in this study can be used to develop a sourdough starter after the analysis of their fermentation characteristics. PMID:25702881

  13. Blocking primers to enhance PCR amplification of rare sequences in mixed samples – a case study on prey DNA in Antarctic krill stomachs

    PubMed Central

    Vestheim, Hege; Jarman, Simon N

    2008-01-01

    Background Identification of DNA sequence diversity is a powerful means for assessing the species present in environmental samples. The most common molecular strategies for estimating taxonomic composition depend upon PCR with universal primers that amplify an orthologous DNA region from a range of species. The diversity of sequences within a sample that can be detected by universal primers is often compromised by high concentrations of some DNA templates. If the DNA within the sample contains a small number of sequences in relatively high concentrations, then less concentrated sequences are often not amplified because the PCR favours the dominant DNA types. This is a particular problem in molecular diet studies, where predator DNA is often present in great excess of food-derived DNA. Results We have developed a strategy where a universal PCR simultaneously amplifies DNA from food items present in DNA purified from stomach samples, while the predator's own DNA is blocked from amplification by the addition of a modified predator-specific blocking primer. Three different types of modified primers were tested out; one annealing inhibiting primer overlapping with the 3' end of one of the universal primers, another annealing inhibiting primer also having an internal modification of five dI molecules making it a dual priming oligo, and a third elongation arrest primer located between the two universal primers. All blocking primers were modified with a C3 spacer. In artificial PCR mixtures, annealing inhibiting primers proved to be the most efficient ones and this method reduced predator amplicons to undetectable levels even when predator template was present in 1000 fold excess of the prey template. The prey template then showed strong PCR amplification where none was detectable without the addition of blocking primer. Our method was applied to identifying the winter food of one of the most abundant animals in the world, the Antarctic krill, Euphausia superba. Dietary

  14. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-01-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  15. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    PubMed

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  16. PCR Detection of Salmonella enterica Serotype Montevideo in and on Raw Tomatoes Using Primers Derived from hilA

    PubMed Central

    Guo, Xuan; Chen, Jinru; Beuchat, Larry R.; Brackett, Robert E.

    2000-01-01

    Salmonellae have been some of the most frequently reported etiological agents in fresh-produce-associated outbreaks of human infections in recent years. PCR assays using four innovative pairs of primers derived from hilA and sirA, positive regulators of Salmonella invasive genes, were developed to identify Salmonella enterica serotype Montevideo on and in tomatoes. Based on examination of 83 Salmonella strains and 22 non-Salmonella strains, we concluded that a pair of hilA primers detects Salmonella specifically. The detection limits of the PCR assay were 101 and 100 CFU/ml after enrichment at 37°C for 6 and 9 h, respectively. When the assay was validated by detecting S. enterica serotype Montevideo in and on artificially inoculated tomatoes, 102 and 101 CFU/g were detected, respectively, after enrichment for 6 h at 37°C. Our results suggest that the hilA-based PCR assay is sensitive and specific, and can be used for rapid detection of Salmonellae in or on fresh produce. PMID:11097898

  17. Development of a direct blood-based PCR system to detect BLV provirus using CoCoMo primers.

    PubMed

    Takeshima, Shin-Nosuke; Watanuki, Sonoko; Ishizaki, Hiroshi; Matoba, Kazuhiro; Aida, Yoko

    2016-06-01

    Bovine leukemia virus (BLV), the etiologic agent of enzootic bovine leucosis, has caused pandemic outbreaks worldwide. Because transcription of the BLV is quickly blocked after infection, detecting integrated provirus at host genome is an important method of identifying whether an animal is infected. The aim of the present study was to develop a novel direct blood-based PCR system to detect the BLV provirus with high specificity and at low cost. The assay was based on the BLV-CoCoMo degenerate primers, which amplify all known BLV strains. Cattle blood samples (n = 182) were collected from the same BLV-positive farm and subjected to BLV-CoCoMo-direct-PCR to detect the BLV provirus. The proviral load was then estimated. This novel PCR method showed 100 % specificity. The BLV-CoCoMo-direct-PCR can be used in a variety of laboratory situations because it does not require expensive equipment/reagents, DNA purification, or a second round of PCR. Therefore, the method is extremely cost-effective and the risk of a false-positive result due to DNA contamination is very low. PMID:26997610

  18. Application of PCR amplicon sequencing using a single primer pair in PCR amplification to assess variations in Helicobacter pylori CagA EPIYA tyrosine phosphorylation motifs

    PubMed Central

    2010-01-01

    Background The presence of various EPIYA tyrosine phosphorylation motifs in the CagA protein of Helicobacter pylori has been suggested to contribute to pathogenesis in adults. In this study, a unique PCR assay and sequencing strategy was developed to establish the number and variation of cagA EPIYA motifs. Findings MDA-DNA derived from gastric biopsy specimens from eleven subjects with gastritis was used with M13- and T7-sequence-tagged primers for amplification of the cagA EPIYA motif region. Automated capillary electrophoresis using a high resolution kit and amplicon sequencing confirmed variations in the cagA EPIYA motif region. In nine cases, sequencing revealed the presence of AB, ABC, or ABCC (Western type) cagA EPIYA motif, respectively. In two cases, double cagA EPIYA motifs were detected (ABC/ABCC or ABC/AB), indicating the presence of two H. pylori strains in the same biopsy. Conclusion Automated capillary electrophoresis and Amplicon sequencing using a single, M13- and T7-sequence-tagged primer pair in PCR amplification enabled a rapid molecular typing of cagA EPIYA motifs. Moreover, the techniques described allowed for a rapid detection of mixed H. pylori strains present in the same biopsy specimen. PMID:20181142

  19. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR

    PubMed Central

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-01-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5′ end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays. PMID:26217821

  20. Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

    PubMed Central

    Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.

    2000-01-01

    Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239

  1. Quantitative detection of Aeromonas salmonicida in fish tissue by real-time PCR using self-quenched, fluorogenic primers.

    PubMed

    Balcázar, José Luis; Vendrell, Daniel; de Blas, Ignacio; Ruiz-Zarzuela, Imanol; Gironés, Olivia; Múzquiz, José Luis

    2007-03-01

    In this study a real-time PCR assay using self-quenched primers labelled with a single fluorophore for the detection of Aeromonas salmonicida was developed. Probe specificity was confirmed by amplification of 16 A. salmonicida strain templates and by the lack of a PCR product with 26 non-A. salmonicida strains. With a pure culture of A. salmonicida, the assay was linear over a range of 0.5 pg to 50 ng and was able to detect 16 c.f.u. per reaction. A similar sensitivity was observed in DNA extracted from a mixture of A. salmonicida and fish tissue. Results using artificially inoculated tissues and diseased fish from outbreaks indicated that the assay can provide sensitive species-specific detection and quantification of A. salmonicida in fish tissue. PMID:17314361

  2. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    ERIC Educational Resources Information Center

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel…

  3. New Design Strategy for Development of Specific Primer Sets for PCR-Based Detection of Chlorophyceae and Bacillariophyceae in Environmental Samples▿ †

    PubMed Central

    Valiente Moro, Claire; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-01-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments. PMID:19592531

  4. New design strategy for development of specific primer sets for PCR-based detection of Chlorophyceae and Bacillariophyceae in environmental samples.

    PubMed

    Moro, Claire Valiente; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-09-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments. PMID:19592531

  5. Development of catechol 2,3-dioxygenase-specific primers for monitoring bioremediation by competitive quantitative PCR

    SciTech Connect

    Mesarch, M.B.; Nakatsu, C.H.; Nies, L.

    2000-02-01

    Benzene, toluene, xylenes, phenol, naphthalene, and biphenyl are among a group of compounds that have at least one reported pathway for biodegradation involving catechol 2,3-dioxygenase enzymes. Thus, detection of the corresponding catechol 2,3-dioxygenase genes can serve as a basis for identifying and quantifying bacteria that have these catabolic abilities. Primes that can successfully amplify a 238-bp catechol 2,3-dioxygenase gene fragment from eight different bacteria are described. The identities of the amplicons were confirmed by hybridization with a 238-bp catechol 2,3-dioxygenase probe. The detection limit was 10{sup 2} to 10{sup 3} gene copies, which was lowered to 10{sup 0} to 10{sup 1} gene copies of hybridization. Using the dioxygenase-specific primers, an increase in catechol 2,3-dioxygenase genes was detected in petroleum-amended soils. The dioxygenase genes were enumerated by competitive quantitative PCR and a 163-bp competitor that was amplified using the same primers. Target and competitor sequences had identical amplification kinetics. Potential PCR inhibitors that could coextract with DNA, nonamplifying DNA, soil factors (humics), and soil pollutants (toluene) did not impact enumeration. Therefore, this technique can be used to accurately and reproducibly quantify catechol 2,3-dioxygenase genes in complex environments such as petroleum-contaminated soil. Direct, non-cultivation-based molecular techniques for detecting and enumerating microbial pollutant-biodegrading genes in environmental samples are powerful tools for monitoring bioremediation and developing field evidence in support of natural attenuation.

  6. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics. PMID:25678350

  7. Detection of single-nucleotide polymorphisms in Plasmodium falciparum by PCR primer extension and lateral flow immunoassay.

    PubMed

    Moers, A P H A; Hallett, R L; Burrow, R; Schallig, H D F H; Sutherland, C J; van Amerongen, A

    2015-01-01

    The resistance of Plasmodium falciparum to some antimalarial drugs is linked to single-nucleotide polymorphisms (SNPs). Currently, there are no methods for the identification of resistant parasites that are sufficiently simple, cheap, and fast enough to be performed at point-of-care, i.e., in local hospitals where drugs are prescribed. Primer extension methods (PEXT) were developed to identify 4 SNPs in P. falciparum positioned at amino acids 86, 184, and 1246 of the P. falciparum multidrug resistance 1 gene (pfmdr1) and amino acid 76 of the chloroquine resistance transporter gene (pfcrt). The PEXT products were visualized by a nucleic acid lateral flow immunoassay (NALFIA) with carbon nanoparticles as the detection labels. PCR-PEXT-NALFIAs showed good correlation to the reference methods, quantitative PCR (qPCR) or direct amplicon sequence analysis, in an initial open-label evaluation with 17 field samples. The tests were further evaluated in a blind study design in a set of 150 patient isolates. High specificities of 98 to 100% were found for all 4 PCR-PEXT genotyping assays. The sensitivities ranged from 75% to 100% when all PEXT-positive tests were considered. A number of samples with a low parasite density were successfully characterized by the reference methods but failed to generate a result in the PCR-PEXT-NALFIA, particularly those samples with microscopy-negative subpatent infections. This proof-of principle study validates the use of PCR-PEXT-NALFIA for the detection of resistance-associated mutations in P. falciparum, particularly for microscopy-positive infections. Although it requires a standard thermal cycler, the procedure is cheap and rapid and thus a potentially valuable tool for point-of-care detection in developing countries. PMID:25367901

  8. Hepatitis C Virus RNA Real-Time Quantitative RT-PCR Method Based on a New Primer Design Strategy.

    PubMed

    Chen, Lida; Li, Wenli; Zhang, Kuo; Zhang, Rui; Lu, Tian; Hao, Mingju; Jia, Tingting; Sun, Yu; Lin, Guigao; Wang, Lunan; Li, Jinming

    2016-01-01

    Viral nucleic acids are unstable when improperly collected, handled, and stored, resulting in decreased sensitivity of currently available commercial quantitative nucleic acid testing kits. Using known unstable hepatitis C virus RNA, we developed a quantitative RT-PCR method based on a new primer design strategy to reduce the impact of nucleic acid instability on nucleic acid testing. The performance of the method was evaluated for linearity, limit of detection, precision, specificity, and agreement with commercial hepatitis C virus assays. Its clinical application was compared to that of two commercial kits--Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) and Kehua. The quantitative RT-PCR method delivered a good performance, with a linearity of R(2) = 0.99, a total limit of detection (genotypes 1 to 6) of 42.6 IU/mL (95% CI, 32.84 to 67.76 IU/mL), a CV of 1.06% to 3.34%, a specificity of 100%, and a high concordance with the CAP/CTM assay (R(2) = 0.97), with a means ± SD value of -0.06 ± 1.96 log IU/mL (range, -0.38 to 0.25 log IU/mL). The method was superior to commercial assays in detecting unstable hepatitis C virus RNA (P < 0.05). This quantitative RT-PCR method can effectively eliminate the influence of RNA instability on nucleic acid testing. The principle of primer design strategy may be applied to the detection of other RNA or DNA viruses. PMID:26612712

  9. The use of specific and generic primers to identify trypanosome infections of wild tsetse flies in Tanzania by PCR.

    PubMed

    Malele, Imna; Craske, Lisa; Knight, Claire; Ferris, Vanessa; Njiru, Zablon; Hamilton, Patrick; Lehane, Stella; Lehane, Mike; Gibson, Wendy

    2003-11-01

    The accurate identification of trypanosome species and subspecies remains a challenging task in the epidemiology of human and animal trypanosomiasis in tropical Africa. Currently, there are specific PCR tests to identify about 10 different species, subspecies or subgroups of African tsetse-transmitted trypanosomes. These PCR tests have been used here to identify trypanosomes in four species of tsetse (Glossina brevipalpis, G. pallidipes, G. swynnertoni, G. morsitans morsitans) from two areas of Tanzania. PCR using species-specific primers was performed on 1041 dissection-positive proboscides, giving an overall positive identification in 254 (24%). Of these, 61 proboscides (24%) contained two or more trypanosomes. The trypanosome with the greatest overall prevalence at both field sites was Trypanosoma simiae Tsavo, which was identified in a total of 118 infected tsetse proboscides (46%). At Pangani, T. godfreyi was found in G. pallidipes but not in G. brevipalpis, suggesting that these flies might have different susceptibility to this trypanosome or might have fed on a different range of hosts. A high proportion (about 75%) of trypanosome infections remained unidentified. To investigate the identity of these unidentified samples, we used primers complementary to the conserved regions of trypanosomal small subunit ribosomal RNA (ssu rRNA) genes to amplify variable segments of the gene. Amplified DNA fragments were cloned, sequenced and compared with ssu rRNA genes on database of known trypanosome species. In this way, we have tentatively identified two new trypanosomes: a trypanosome related to Trypanosoma vivax and a trypanosome related to T. godfreyi. The T. godfreyi-related trypanosome occurred frequently in the Tanzanian field samples and appears to be widespread. Molecular identification of these two new trypanosomes should now facilitate their isolation and full biological characterisation. PMID:14636688

  10. PCR-Based Serotyping of Streptococcus pneumoniae from Culture-Negative Specimens: Novel Primers for Detection of Serotypes within Serogroup 18

    PubMed Central

    Tanmoy, Arif M.; Saha, Senjuti; Darmstadt, Gary L.; Whitney, Cynthia G.

    2016-01-01

    Six multiplex-compatible PCR primers were designed to distinguish Streptococcus pneumoniae serotypes within serogroup 18 from culturable/nonculturable pneumococcal specimens, with no cross-reactivity with other serotypes and respiratory organisms. These primers will aid in the generation of better data on vaccine/nonvaccine serotypes in invasive and carriage pneumococcal surveillance and contribute to future vaccine formulation and impact studies. PMID:27252464

  11. PCR-Based Serotyping of Streptococcus pneumoniae from Culture-Negative Specimens: Novel Primers for Detection of Serotypes within Serogroup 18.

    PubMed

    Tanmoy, Arif M; Saha, Senjuti; Darmstadt, Gary L; Whitney, Cynthia G; Saha, Samir K

    2016-08-01

    Six multiplex-compatible PCR primers were designed to distinguish Streptococcus pneumoniae serotypes within serogroup 18 from culturable/nonculturable pneumococcal specimens, with no cross-reactivity with other serotypes and respiratory organisms. These primers will aid in the generation of better data on vaccine/nonvaccine serotypes in invasive and carriage pneumococcal surveillance and contribute to future vaccine formulation and impact studies. PMID:27252464

  12. Mitochondrial D-loop {open_quotes}signatures{close_quotes} produced by low-stringency single specific primer PCR constitute a simple comparative human identity test

    SciTech Connect

    Barreto, G.; Vago, A.R.; Pena, S.D.J.

    1996-03-01

    We have developed a technique called {open_quotes}LSSP-PCR{close_quotes} (low-stringency single specific primer PCR) that detects single or multiple mutations in DNA. A purified DNA fragment is submitted to PCR by using a single primer specific for one of the extremities of the fragment, under conditions of very low stringency. The primer hybridizes specifically to its complementary extremity and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner. A complex set of reaction products is thus created that, when separated by electrophoresis, constitutes a unique {open_quotes}gene signature.{close_quotes} We here report the application of LSSP-PCR to the detection of sequence variation in the control (D-loop) region of human mtDNA, which is known to differ significantly between unrelated individuals. We prepared human DNA samples from blood and amplified a 1,024-bp portion of the mtDNA control region, using primers L15996 and H408. The amplified mtDNA fragments were then reamplified under LSSP-PCR conditions by using L15996 or H408 as drivers to produce complex signatures that always differed between unrelated individuals and yet were highly reproducible. In contrast, all mother-child pairs tested were identical, as expected from the matrilineal inheritance of mtDNA. Thus, the use of LSSP-PCR to produce D-loop signatures constitutes a powerful new technique for mtDNA-based comparative identity testing. 18 refs., 7 figs.

  13. Primers with 5' flaps improve the efficiency and sensitivity of multiplex PCR assays for the detection of Salmonella and Escherichia coli O157:H7.

    PubMed

    Timmons, Chris; Dobhal, Shefali; Fletcher, Jacqueline; Ma, Li Maria

    2013-04-01

    Foodborne illnesses caused by Salmonella enterica and Escherichia coli O157:H7 are worldwide health concerns. Rapid, sensitive, and robust detection of these pathogens in foods and in clinical and environmental samples is essential for routine food quality testing, effective surveillance, and outbreak investigations. The aim of this study was to evaluate the effect on PCR sensitivity of adding a short, AT-rich overhanging nucleotide sequence (flap) to the 5' end of PCR primers specific for the detection of Salmonella and E. coli O157:H7. Primers targeting the invA gene of Salmonella and the rfbE gene of E. coli O157:H7 were synthesized with or without a 12-bp, AT-rich 5' flap (5'-AATAAATCATAA-3'). Singleplex PCR, multiplex PCR, and real-time PCR sensitivity assays were conducted using purified bacterial genomic DNA and crude cell lysates of bacterial cells. The effect of background flora on detection was evaluated by spiking tomato and jalapeno pepper surface washes with E. coli O157:H7 and Salmonella Saintpaul. When targeting individual pathogens, end-point PCR assays using flap-amended primers were more efficient than nonamended primers, with 20.4 and 23.5% increases in amplicon yield for Salmonella and E. coli O157:H7, respectively. In multiplex PCR assays, a 10- to 100-fold increase in detection sensitivity was observed when the primer flap sequence was incorporated. This improvement in both singleplex and multiplex PCR efficiency and sensitivity can lead to improved Salmonella and E. coli O157:H7 detection. PMID:23575131

  14. Specific primer sets used to amplify by PCR the hepatitis B virus overlapping S/Pol region select different viral variants.

    PubMed

    Cuestas, M L; Mathet, V L; Oubiña, J R

    2012-10-01

    PCR detection of viral genomes has provided new insights into viral diagnosis. Nowadays, it is the most frequently used nucleic acid testing (qualitative and quantitative) technique. The aim of this study was to analyse the major circulating hepatitis B virus (HBV) variants PCR-amplified by three sets of primers in a patient infected with genotype E. The HBV S/Pol overlapping genomic region was amplified from the serum of an infected child using three primer sets previously described. Sequence analysis corresponding to the HBV S/Pol region revealed the presence of different viral populations depending on the set of primers used. D144A S-escape mutant was detected with two of the primer sets, while the rtL217R mutant within the Pol - conferring resistance to Adefovir - could be picked up with a different pair of primer sets. This study undoubtedly implies that the description of viral polymorphisms should be stated together with the sequence of the primers used for PCR amplification when studies of escape and/or antiviral-resistant HBV mutants are carried out. PMID:22967107

  15. PCR detection of DNAs of animal origin in feed by primers based on sequences of short and long interspersed repetitive elements.

    PubMed

    Tajima, Kiyoshi; Enishi, Osamu; Amari, Masahiro; Mitsumori, Makoto; Kajikawa, Hiroshi; Kurihara, Mitsunori; Yanai, Satoshi; Matsui, Hiroki; Yasue, Hiroshi; Mitsuhashi, Tadayoshi; Kawashima, Tomoyuki; Matsumoto, Mitsuto

    2002-10-01

    PCR primers for the detection of materials derived from ruminants, pigs, and chickens were newly designed on the basis of sequences of the Art2 short interspersed repetitive element (SINE), PRE-1 SINE, and CR1 long interspersed repetitive element (LINE), respectively. These primers amplified the SINE or LINE from total DNA extracted from the target animals and from test feed containing commercial meat and bone meal (MBM). With the primers, detection of Art2, PRE-1, or CR1 in test feed at concentrations of 0.01% MBM or less was possible. This method was suitable for the detection of microcontamination of feed by animal materials. PMID:12450143

  16. Prey choice by carabid beetles feeding on an earthworm community analysed using species- and lineage-specific PCR primers.

    PubMed

    King, R Andrew; Vaughan, Ian P; Bell, James R; Bohan, David A; Symondson, William O C

    2010-04-01

    The carabid beetle Pterostichus melanarius is a major natural enemy of pests, such as aphids and slugs in agricultural systems. Earthworms are a dominant non-pest component of the diet of P. melanarius which help sustain the beetles during periods when the pest population is low or absent. In this study we wanted to test whether this predator exercises prey choice among different earthworm species or ecological groups. High levels of genetic diversity within morphological species of earthworm necessitated the development of primers that were specific not just to species but lineages and sub-lineages within species as well. Gut samples from beetles were analysed using multiplex-PCR and fluorescent-labelled primers. Calibratory feeding trials were undertaken to calculate median detection times for prey DNA following ingestion. Extensive testing demonstrated that the primers were species-specific, that detection periods were negatively related to amplicon size and that meal size had a highly significant effect on detection periods. Monte Carlo simulations showed that, in general, worms were being predated in proportion to their densities in the field with little evidence of prey choice, other than probable avoidance of the larger, deep-living species. There was no evidence that epigeic species were being taken preferentially in comparison with endogeic species. There was also no evidence that defensive secretions by Allolobophora chlorotica reduced predation pressure on this species by P. melanarius. We concluded that any management system that increases earthworm densities generally, regardless of component species, is likely to be optimal for increasing numbers of this beneficial beetle predator. PMID:20345680

  17. RT-PCR for detecting five distinct Tospovirus species using degenerate primers and dsRNA template.

    PubMed

    Okuda, M; Hanada, K

    2001-08-01

    RT-PCR procedures for detection of multiple species of tospovirus from plant tissues were investigated. Downstream primers were designated from the 3' untranslated sequences of the S RNA. An upstream primer was designated from the degenerated sequences of the nucleocapsid protein. Approximately 450 bp DNA fragments were detected when Tomato spotted wilt virus (TSWV)- or Impatiens necrotic spot virus (INSV)- infected tissues were examined. Approximately 350 bp DNA fragments were detected when Watermelon silver mottle virus (WSMoV)- or Melon yellow spot virus (MYSV)-infected tissues were examined. Template RNA was extracted using CF 11 cellulose powder, and nonspecific amplification became unnoticeable when double-stranded RNA was used. The amplified fragments of WSMoV were differentiated from those of MYSV by AluI or TaqI digestion. The amplified fragments of TSWV were differentiated from those of INSV by DraI or HindIII digestion. An alstroemeria plant that was infected with an unidentified tospovirus was also examined, and a 350 bp fragment that was 97% identical to Iris yellow spot virus was detected. This method, therefore, detected at least five distinct Tospovirus species. PMID:11445145

  18. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    PubMed

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. PMID:25449112

  19. Design and evaluation of specific PCR primers for rapid and reliable identification of Staphylococcus xylosus strains isolated from dry fermented sausages.

    PubMed

    Blaiotta, Giuseppe; Pennacchia, Carmelina; Parente, Eugenio; Villani, Francesco

    2003-11-01

    Rapid and reliable identification of Staphylococcus xylosus was achieved by species-specific PCR assays. Two sets of primers, targeting on xylulokinase (xylB) and 60 kDa heat-shock protein (hsp60) genes of S. xylosus, respectively, were designed. Species-specificity of both sets of primers was evaluated by using 27 reference strains of the DSM collection, representing 23 different species of the Staphylococcus genus and 3 species of the Kocuria genus. Moreover, 90 wild strains isolated from different fermented dry sausages were included in the analysis. By using primers xylB-F and xylB-R the expected PCR fragment was obtained only when DNA from S. xylosus was used. By contrast, amplification performed by using primers xylHs-F and xylHs-R produced a single PCR fragment, of the expected length, when DNA from S. xylosus, S. haemolyticus, S. intermedius and S. kloosii were used as template. Nevertheless, AluI digestion of the xylHs-F/xylHs-R PCR fragment allowed a clear differentiation of these 4 species. The rapidity (about 4 h from DNA isolation to results) and reliability of the PCR procedures established suggests that the method may be profitably applied for specific detection and identification of S. xylosus strains. PMID:14666989

  20. Species-specific ITS primers for the identification of Picoa juniperi and Picoa lefebvrei and using nested-PCR for detection of P. juniperi in planta.

    PubMed

    Jamali, Samad; Banihashemi, Zia

    2013-10-01

    Desert truffles, hypogeous Pezizales (Ascomycota), are difficult to identify due to evolutionary convergence of morphological characters among taxa that share a similar habitat and mode of spore dispersal. Also, during their symbiotic phase, these are barely distinguishable morphologically, and molecular probes are needed for their identification. We have developed a PCR-based method for the identification of Picoa juniperi and Picoa lefebvrei based on internal transcribed spacers of rDNA. Two PCR primers specific for P. lefebvrei (FLE/RLE) and two specific for P. juniperi (FJU/RJU) were designed. A collection of samples from different geographical areas representing diversity of these species were examined for unique regions of internal transcribed spacers 1, 2 and 5.8S gene of rDNA (ITS) compared to other closely related species. Annealing temperatures and extension times were optimized for each set of primers for maximum specificity and efficiency. They proved to be efficient to specifically detect the presence of P. juniperi and P. lefebvrei by PCR and neither set amplified purified DNA from other truffle species as well as some ascomycetous fungi. The partial small subunit of ribosomal DNA genes of P. juniperi were amplified with the genomic DNA extracted from Helianthemum ledifolium var. ledifolium roots by nested polymerase chain reaction (PCR) using the universal fungal primer pair ITS1/ITS4 and specific primer pair FTC/RTC, which was designed based on internal transcribed spacer 1, 2 and 5.8S gene of rDNA sequences of P juniperi. The nested-PCR was sensitive enough to re-amplify the direct-PCR product, resulting in a DNA fragment of 426 bp. The efficacy of nested-PCR showed that it could re-amplify the direct-PCR product and detect 200 fg genomic DNA. PMID:24065525

  1. Coamplification of eukaryotic DNA with 16S rRNA gene-based PCR primers: possible consequences for population fingerprinting of complex microbial communities.

    PubMed

    Huys, Geert; Vanhoutte, Tom; Joossens, Marie; Mahious, Amal S; De Brandt, Evie; Vermeire, Severine; Swings, Jean

    2008-06-01

    The main aim of this study was to evaluate the specificity of three commonly used 16S rRNA gene-based polymerase chain reaction (PCR) primer sets for bacterial community analysis of samples contaminated with eukaryotic DNA. The specificity of primer sets targeting the V3, V3-V5, and V6-V8 hypervariable regions of the 16S rRNA gene was investigated in silico and by community fingerprinting of human and fish intestinal samples. Both in silico and PCR-based analysis revealed cross-reactivity of the V3 and V3-V5 primers with the 18S rRNA gene of human and sturgeon. The consequences of this primer anomaly were illustrated by denaturing gradient gel electrophoresis (DGGE) profiling of microbial communities in human feces and mixed gut of Siberian sturgeon. DGGE profiling indicated that the cross-reactivity of 16S rRNA gene primers with nontarget eukaryotic DNA might lead to an overestimation of bacterial biodiversity. This study has confirmed previous sporadic indications in literature indicating that several commonly applied 16S rRNA gene primer sets lack specificity toward bacteria in the presence of eukaryotic DNA. The phenomenon of cross-reactivity is a potential source of systematic error in all biodiversity studies where no subsequent analysis of individual community amplicons by cloning and sequencing is performed. PMID:18301945

  2. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

    PubMed

    Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  3. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

    PubMed Central

    Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  4. Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

    PubMed Central

    2014-01-01

    Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

  5. Genus- and Species-Specific PCR-Based Detection of Dairy Propionibacteria in Environmental Samples by Using Primers Targeted to the Genes Encoding 16S rRNA

    PubMed Central

    Rossi, Franca; Torriani, Sandra; Dellaglio, Franco

    1999-01-01

    PCR assays with primers targeted to the genes encoding 16S rRNA were developed for detection of dairy propionibacteria. Propionibacterium thoenii specific oligonucleotide PT3 was selected after partial resequencing. Tests allowed the detection of less than 10 cells per reaction from milk and cheese and 102 cells per reaction from forage and soil. PMID:10473444

  6. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  7. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  8. Design and testing of multiplex RT-PCR primers for the rapid detection of influenza A virus genomic segments: Application to equine influenza virus.

    PubMed

    Lee, EunJung; Kim, Eun-Ju; Shin, Yeun-Kyung; Song, Jae-Young

    2016-02-01

    The avian influenza A virus causes respiratory infections in animal species. It can undergo genomic recombination with newly obtained genetic material through an interspecies transmission. However, the process is an unpredictable event, making it difficult to predict the emergence of a new pandemic virus and distinguish its origin, especially when the virus is the result of multiple infections. Therefore, identifying a novel influenza is entirely dependent on sequencing its whole genome. Occasionally, however, it can be time-consuming, costly, and labor-intensive when sequencing many influenza viruses. To compensate for the difficulty, we developed a rapid, cost-effective, and simple multiplex RT-PCR to identify the viral genomic segments. As an example to evaluate its performance, H3N8 equine influenza virus (EIV) was studied for the purpose. In developing this protocol to amplify the EIV eight-segments, a series of processes, including phylogenetic analysis based on different influenza hosts, in silico analyses to estimate primer specificity, coverage, and variation scores, and investigation of host-specific amino acids, were progressively conducted to reduce or eliminate the negative factors that might affect PCR amplification. Selectively, EIV specific primers were synthesized with dual priming oligonucleotides (DPO) system to increase primer specificity. As a result, 16 primer pairs were selected to screen the dominantly circulating H3N8 EIV 8 genome segments: PA (3), PB2 (1), PA (3), NP (3), NA8 (2), HA3 (1), NS (1), and M (2). The diagnostic performance of the primers was evaluated with eight sets composing of four segment combinations using viral samples from various influenza hosts. The PCR results suggest that the multiplex RT-PCR has a wide range of applications in detection and diagnosis of newly emerging EIVs. Further, the proposed procedures of designing multiplex primers are expected to be used for detecting other animal influenza A viruses. PMID

  9. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection.

    PubMed

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

    2016-08-01

    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

  10. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection

    PubMed Central

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

    2016-01-01

    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

  11. Development, validation, and application of PCR primers for detection of tetracycline efflux genes of gram-negative bacteria.

    PubMed

    Aminov, R I; Chee-Sanford, J C; Garrigues, N; Teferedegne, B; Krapac, I J; White, B A; Mackie, R I

    2002-04-01

    Phylogenetic analysis of tetracycline resistance genes, which confer resistance due to the efflux of tetracycline from the cell catalyzed by drug:H(+) antiport and share a common structure with 12 transmembrane segments (12-TMS), suggested the monophyletic origin of these genes. With a high degree of confidence, this tet subcluster unifies 11 genes encoding tet efflux pumps and includes tet(A), tet(B), tet(C), tet(D), tet(E), tet(G), tet(H), tet(J), tet(Y), tet(Z), and tet(30). Phylogeny-aided alignments were used to design a set of PCR primers for detection, retrieval, and sequence analysis of the corresponding gene fragments from a variety of bacterial and environmental sources. After rigorous validation with the characterized control tet templates, this primer set was used to determine the genotype of the corresponding tetracycline resistance genes in total DNA of swine feed and feces and in the lagoons and groundwater underlying two large swine production facilities known to be impacted by waste seepage. The compounded tet fingerprint of animal feed was found to be tetCDEHZ, while the corresponding fingerprint of total intestinal microbiota was tetBCGHYZ. Interestingly, the tet fingerprints in geographically distant waste lagoons were identical (tetBCEHYZ) and were similar to the fecal fingerprint at the third location mentioned above. Despite the sporadic detection of chlortetracycline in waste lagoons, no auxiliary diversity of tet genes in comparison with the fecal diversity could be detected, suggesting that the tet pool is generated mainly in the gut of tetracycline-fed animals, with a negligible contribution from selection imposed by tetracycline that is released into the environment. The tet efflux genes were found to be percolating into the underlying groundwater and could be detected as far as 250 m downstream from the lagoons. With yet another family of tet genes, this study confirmed our earlier findings that the antibiotic resistance gene pool

  12. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.

    PubMed

    Pappu, H R; Druffel, K L

    2009-04-01

    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus. PMID:19100290

  13. Patho-Genes.org: a website dedicated to gene sequences of potential bioterror bacteria and PCR primers used to amplify them.

    PubMed

    Gardès, Julien; Bachar, Dipankar; Croce, Olivier; Christen, Richard

    2012-09-01

    Pathogenic agents can be very hard to detect, and usually they do not cause illness for several hours or days. To improve the speed and the accuracy of detection tests and satisfy the needs of early diagnosis, molecular biology methods such as PCR are now used. However, selecting a proper target gene and designing good primers is often not easy. We present a dedicated website, http://patho-genes.org, where we provide every sequence, functional annotation, published primer and relevant article for every annotated gene of major pathogenic bacterial species listed as key agents to be used for a bioterrorism attack. Each published primer was analysed to determine its melting temperature, its specificity and its coverage (i.e. its sensitivity against every allele of its target gene). Data generated have been organized in the form of data sheet for each gene, which are available through multiple browser panels and query systems. PMID:22681780

  14. Development of an extraction and concentration procedure and comparison of RT-PCR primer systems for the detection of hepatitis A virus and norovirus GII in green onions.

    PubMed

    Guévremont, Evelyne; Brassard, Julie; Houde, Alain; Simard, Carole; Trottier, Yvon-Louis

    2006-06-01

    Vegetables can be considered as a vector of transmission for human hepatic and enteric viruses such as hepatitis A virus (HAV) and noroviruses when contaminated by spoiled irrigation water or when prepared by infected food handlers. Recently, outbreaks of HAV have been reported in the USA involving fresh green onions. A viral elution-concentration method was developed for the detection of HAV and norovirus contaminated green onions by RT-PCR. Repeated pipetting/washings of the surface with a pH 9.5 glycine-buffered solution allowed the elution of viruses from the vegetables. Concentration of the viral load was performed by a polyethylene glycol (PEG) precipitation procedure. Viral RNAs were extracted and purified using a combination of Trizol-chloroform and poly(dT) magnetic beads methods. Different sets of primers, including two newly designed primers sets for HAV RT-PCR, were tested in order to achieve the best analytical sensitivity. Using the new primer design, it was possible to detect 10(0) TCID(50%)/25 g of HAV in fresh green onions, while 1 RT-PCRU/25 g was detected for noroviruses GII using previously described primers. This method, based on molecular tools, would be useful for diagnostic laboratories in order to perform viral analyses of such commodities as fresh vegetables in cases of foodborne infections. PMID:16423413

  15. Primers to block the amplification of symbiotic apostome ciliate 18S rRNA gene in a PCR-based copepod diet study

    NASA Astrophysics Data System (ADS)

    Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing

    2014-05-01

    Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.

  16. Identification of the corn pathogen Pantoea stewartii by mass spectrometry of whole-cell extracts and its detection with novel PCR primers.

    PubMed

    Wensing, Annette; Zimmermann, Stefan; Geider, Klaus

    2010-09-01

    Pantoea stewartii subsp. stewartii is the causative agent of Stewart's wilt, a bacterial disease transmitted by the corn flea beetle mainly to sweet corn (Zea mays). In many countries, it is classified as a quarantine organism and must be differentiated from other yellow enteric bacteria frequently occurring with corn. We have created novel primers from the pstS-glmS region of P. stewartii for use in conventional PCR (cPCR) and quantitative PCR (qPCR). To facilitate rapid diagnosis, we applied matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS) analysis. Using whole-cell protein extracts, profiles were generated with a Bruker microflex machine, and the bacteria classified. P. stewartii strains were clearly distinguished from strains of Pantoea agglomerans, Pantoea dispersa, and Pantoea ananatis. Dendrogram analysis of the protein profiles confirmed the score values and showed the formation of separate clades for each species. The identification achieved by MALDI-TOF MS analysis agrees with the diagnosis by specific PCR primers. The combination of both methods allows a rapid and simple identification of the corn pathogen. P. stewartii subsp. stewartii and P. stewartii subsp. indologenes are highly related and can be distinguished not only by virulence assays and indole tests but also by a characteristic pattern in the nucleotide sequence of recA. PMID:20656863

  17. Development of PCR primers and a DNA macroarray for the simultaneous detection of major Staphylococcus species using groESL gene.

    PubMed

    Chiang, Yu-Cheng; Lu, Hsi-Chi; Li, Sheng-Chih; Chang, Yu-Hsin; Chen, Hsin-Yen; Lin, Chia-Wei; Tsen, Hau-Yang

    2012-03-01

    Staphylococcus spp., including S. aureus, S. intermedius, S. hyicus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. xylosus, and S. carnosus, are major bacterial species associated with food poisoning, and human and veterinary clinics. Traditional methods for the identification of these staphylococci are time-consuming, laborious, or inaccurate. Therefore, rapid and accurate diagnostic methods are needed. In this study, we designed the DNA probes and polymerase chain reaction (PCR) primers for the detection of the aforementioned Staphylococcus species. These primers were proved to be specific for the detection of their corresponding target strains. Furthermore, by using a consensus primer pair, we were able to co-amplify the intergenic region of groES-groEL for these staphylococci. Followed by a chromogenic macroarray system with the specific probes on the plastic chips, these staphylococci in milk products or clinical samples could be simultaneously detected. When the system was used for the inspection of milk or urine samples containing N × 10⁰ target cells per milliliter of the sample, all these staphylococcal species could be identified after an 8-h pre-enrichment step. This system also allowed the adequate diagnosis of bacteremia, since N × 10⁰ target cells per milliliter of the blood samples could be detected after a 12-h pre-enrichment. Compared to the multiplex PCR method, this approach has the additional advantage that it allowed the discrimination of more bacterial strains-even some bacterial strains that may generate PCR products with the same molecular sizes. PMID:22300167

  18. Novel method for preparation of the template DNA and selection of primers to differentiate the material rice cultivars of rice wine by PCR.

    PubMed

    Ohtsubo, Ken'ichi; Suzuki, Keitaro; Haraguchi, Kazutomo; Nakamura, Sumiko

    2008-04-24

    As many rice wine brewers label the name of the cultivar of the material rice, authentication technology is necessary. The problems are (1) decomposition of DNAs during the fermentation, (2) contamination of DNAs from microorganisms, (3) co-existence of PCR inhibitors, such as polyphenols. The present authors improved the PCR method by (1) lyophilizing and pulverizing the rice wine to concentrate DNAs, (2) decomposition of starches and proteins so as not to inhibit DNA extraction by the use of heat-resistant amylase and proteinase K, (3) purification of the template DNA by the combination of CTAB method and fractional precipitation by 70% EtOH. To prevent the amplification of microorganism's DNAs during PCR, the present authors selected the suitable plant-specific primers. It became possible to prepare the template DNAs for PCR from the rice wine. The sequences of the amplified DNAs by PCR were ascertained to be same with those of material rice. Mislabeling of material rice cultivar was detected by PCR using the commercial rice wine. It became possible to extract and purify the template DNAs for PCR from the rice wine and to differentiate the material rice cultivars by the PCR using the rice wine as a sample. PMID:17675162

  19. Genus-specific primers targeting the 16S rRNA gene for PCR detection of members of the genus Verrucosispora.

    PubMed

    Xie, Qingyi; Hong, Kui; Goodfellow, Michael

    2011-06-01

    Little is known about the genus Verrucosispora though it does contain organisms which produce novel antibiotics. A set of genus-specific oligonucleotide primers was generated to gain an insight into the presence, distribution and taxonomic diversity of members of this genus in diverse samples taken from marine habitats. In silico and pure culture studies showed that the primers matched perfectly with target sequences of the 16S rRNA genes of representatives of the genus Verrucosispora. The primers, designated S-G-Verr-0195-a-S-20 and S-G-Verr-1152-a-A-18, amplified an ≈960 bp stretch of the 16S rRNA genes of Verrucosispora strains but not those of representatives of other genera classified in the family Micromonosporaceae. Genus-specific amplicons were detected from 17 out of 20 community DNA samples prepared from diverse marine sediments and coastal soils. Phylogenetic analysis of over 40% of clones derived from five of the samples indicated they belonged to novel Verrucosispora species. The primers were also used to confirm the identity of Verrucosispora-like strains isolated from two of the environmental samples. The primers can be used to facilitate the isolation of novel Verrucosispora strains by allowing prescreening of environmental samples and the subsequent identification of verrucosisporae on selective isolation plates. For this purpose, a novel medium facilitating the recovery of Verrucosispora strains was formulated and used to recover novel isolates validated using the novel PCR primers. This medium may be useful as the basis for development of a selective medium. PMID:21374042

  20. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    ERIC Educational Resources Information Center

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  1. Trypanosoma cruzi: specific detection of parasites by PCR in infected humans and vectors using a set of primers (BP1/BP2) targeted to a nuclear DNA sequence.

    PubMed

    Silber, A M; Búa, J; Porcel, B M; Segura, E L; Ruiz, A M

    1997-03-01

    In the present work we evaluate Trypanosoma cruzi DNA detection by PCR using the nuclear oligonucleotides BP1/BP2 as primers. These primers are targeted to the 5' and 3' ends of the coding region for the flagellar protein F29. An amplification product of BP1/BP2 is a DNA band 692 bp long. Titration assays were performed to evaluate the minimum amount of parasite DNA that can be detected by this assay, resulting in 10 fg (equivalent to about 1/20 of the genome). The assay was also performed using T. cruzi DNA from different strains, clones, and human-derived isolates obtaining, in all cases, amplification products. No DNA amplification was observed when the PCR was performed using DNA from Leishmania braziliensis, but when T. rangeli DNA was used, a 615-bp-long fragment was amplified. Under appropriate gel conditions T. cruzi and T. rangeli DNA amplicons could be differentiated. When both conventional xenodiagnosis and PCR detection of parasite DNA in the feces of insect vectors fed with blood from infected patients were compared, 10 of 20 samples were positive by both techniques. However, 2 other samples with positive serology were also positive by PCR. When PCR was performed on blood samples from infected and uninfected individuals, 62 of 65 serologically positive human samples amplified the BP1/BP2 692-bp T. cruzi DNA fragment (sensitivity >95%). The 3 negative samples were positive when Southern blot hybridization was performed using the radiolabeled PCR amplification product as probe (sensitivity 100%). PMID:9085919

  2. Selection strategy and the design of hybrid oligonucleotide primers for RACE-PCR: cloning a family of toxin-like sequences from Agelena orientalis

    PubMed Central

    Pan, Zhensheng; Barry, Richard; Lipkin, Alexey; Soloviev, Mikhail

    2007-01-01

    Background the use of specific but partially degenerate primers for nucleic acid hybridisations and PCRs amplification of known or unknown gene families was first reported well over a decade ago and the technique has been used widely since then. Results here we report a novel and successful selection strategy for the design of hybrid partially degenerate primers for use with RT-PCR and RACE-PCR for the identification of unknown gene families. The technique (named PaBaLiS) has proven very effective as it allowed us to identify and clone a large group of mRNAs encoding neurotoxin-like polypeptide pools from the venom of Agelena orientalis species of spider. Our approach differs radically from the generally accepted CODEHOP principle first reported in 1998. Most importantly, our method has proven very efficient by performing better than an independently generated high throughput EST cloning programme. Our method yielded nearly 130 non-identical sequences from Agelena orientalis, whilst the EST cloning technique yielded only 48 non-identical sequences from 2100 clones obtained from the same Agelena material. In addition to the primer design approach reported here, which is almost universally applicable to any PCR cloning application, our results also indicate that venom of Agelena orientalis spider contains a much larger family of related toxin-like sequences than previously thought. Conclusion with upwards of 100,000 species of spider thought to exist, and a propensity for producing diverse peptide pools, many more peptides of pharmacological importance await discovery. We envisage that some of these peptides and their recombinant derivatives will provide a new range of tools for neuroscience research and could also facilitate the development of a new generation of analgesic drugs and insecticides. PMID:17498297

  3. Diversity of Methane-Cycling Archaea in Hydrothermal Sediment Investigated by General and Group-Specific PCR Primers

    PubMed Central

    Teske, Andreas P.

    2014-01-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primer pairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group-specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs in detection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group-specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm (∼2 to 40°C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40°C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (≥60°C). While mcrA-based and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature. PMID:25527539

  4. Undergraduate Virology Exercises Demonstrate Conventional and Real-Time PCR Using Commercially Available HIV Primers and Noninfectious Target

    ERIC Educational Resources Information Center

    Sulzinski, Michael A.; Wasilewski, Melissa A.; Farrell, James C.; Glick, David L.

    2009-01-01

    It is an extraordinary challenge to offer an undergraduate laboratory course in virology that teaches hands-on, relevant molecular biology techniques using nonpathogenic models of human virus detection. To our knowledge, there exists no inexpensive kits or reagent sets that are appropriate for demonstrating real-time PCR (RT-PCR) in an…

  5. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

    PubMed Central

    Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

    2015-01-01

    We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

  6. Development and Validation of PCR Primers To Assess the Diversity of Clostridium spp. in Cheese by Temporal Temperature Gradient Gel Electrophoresis

    PubMed Central

    Le Bourhis, Anne-Gaëlle; Saunier, Katiana; Doré, Joël; Carlier, Jean-Philippe; Chamba, Jean-François; Popoff, Michel-Robert; Tholozan, Jean-Luc

    2005-01-01

    A nested-PCR temporal temperature gradient gel electrophoresis (TTGE) approach was developed for the detection of bacteria belonging to phylogenetic cluster I of the genus Clostridium (the largest clostridial group, which represents 25% of the currently cultured clostridial species) in cheese suspected of late blowing. Primers were designed based on the 16S rRNA gene sequence, and the specificity was confirmed in PCRs performed with DNAs from cluster I and non-cluster I species as the templates. TTGE profiles of the PCR products, comprising the V5-V6 region of the 16S rRNA gene, allowed us to distinguish the majority of cluster I species. PCR-TTGE was applied to analyze commercial cheeses with defects. All cheeses gave a signal after nested PCR, and on the basis of band comigration with TTGE profiles of reference strains, all the bands could be assigned to a clostridial species. The direct identification of Clostridium spp. was confirmed by sequencing of excised bands. C. tyrobutyricum and C. beijerinckii contaminated 15 and 14 of the 20 cheese samples tested, respectively, and C. butyricum and C. sporogenes were detected in one cheese sample. Most-probable-number counts and volatile fatty acid were determined for comparison purposes. Results obtained were in agreement, but only two species, C. tyrobutyricum and C. sporogenes, could be isolated by the plating method. In all cheeses with a high amount of butyric acid (>100 mg/100 g), the presence of C. tyrobutyricum DNA was confirmed by PCR-TTGE, suggesting the involvement of this species in butyric acid fermentation. These results demonstrated the efficacy of the PCR-TTGE method to identify Clostridium in cheeses. The sensitivity of the method was estimated to be 100 CFU/g. PMID:15640166

  7. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.

    PubMed Central

    Greisen, K; Loeffelholz, M; Purohit, A; Leong, D

    1994-01-01

    A set of broad-range PCR primers for the 16S rRNA gene in bacteria were tested, along with three series of oligonucleotide probes to detect the PCR product. The first series of probes is broad in range and consists of a universal bacterial probe, a gram-positive probe, a Bacteroides-Flavobacterium probe, and two probes for other gram-negative species. The second series was designed to detect PCR products from seven major bacterial species or groups frequently causing meningitis: Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, S. agalactiae, Escherichia coli and other enteric bacteria, Listeria monocytogenes, and Staphylococcus aureus. The third series was designed for the detection of DNA from species or genera commonly considered potential contaminants of clinical samples, including cerebrospinal fluid (CSF): Bacillus, Corynebacterium, Propionibacterium, and coagulase-negative Staphylococcus spp. The primers amplified DNA from all 124 different species of bacteria tested. Southern hybridization testing of the broad-range probes with washes containing 3 M tetramethylammonium chloride indicated that this set of probes correctly identified all but two of the 102 bacterial species tested, the exceptions being Deinococcus radiopugnans and Gardnerella vaginalis. The gram-negative and gram-positive probes hybridized to isolates of two newly characterized bacteria, Alloiococcus otitis and Rochalimaea henselii, as predicted by Gram stain characteristics. The CSF pathogen and contaminant probe sequences were compared with available sequence information and with sequencing data for 32 different species. Testing of the CSF pathogen and contaminant probes against DNA from over 60 different strains indicated that, with the exception of the coagulase-negative Staphylococcus probes, these probes provided the correct identification of bacterial species known to be found in CSF. Images PMID:7512093

  8. Improved Multiplex PCR Using Conserved and Species-Specific 16S rRNA Gene Primers for Simultaneous Detection of Actinobacillus actinomycetemcomitans, Bacteroides forsythus, and Porphyromonas gingivalis

    PubMed Central

    Tran, Simon Dangtuan; Rudney, Joel D.

    1999-01-01

    Among putative periodontal pathogens, Actinobacillus actinomycetemcomitans, Bacteroides forsythus, and Porphyromonas gingivalis are most convincingly implicated as etiological agents in periodontitis. Therefore, techniques for detection of those three species would be of value. We previously published a description of a multiplex PCR that detects A. actinomycetemcomitans and P. gingivalis. The present paper presents an improvement on that technique, which now allows more sensitive detection of all three periodontal pathogens. Sensitivity was determined by testing serial dilutions of A. actinomycetemcomitans, B. forsythus, and P. gingivalis cells. Primer specificity was tested against (i) all gene sequences from the GenBank-EMBL database, (ii) six A. actinomycetemcomitans, one B. forsythus, and four P. gingivalis strains, (iii) eight different species of oral bacteria, and (iv) supra- and subgingival plaque samples from 20 healthy subjects and subgingival plaque samples from 10 patients with periodontitis. The multiplex PCR had a detection limit of 10 A. actinomycetemcomitans, 10 P. gingivalis, and 100 B. forsythus cells. Specificity was confirmed by the fact that (i) none of our forward primers were homologous to the 16S rRNA genes of other oral species, (ii) amplicons of predicted size were detected for all A. actinomycetemcomitans, B. forsythus, and P. gingivalis strains tested, and (iii) no amplicons were detected for the eight other bacterial species. A. actinomycetemcomitans, B. forsythus, and P. gingivalis were detected in 6 of 20, 1 of 20, and 11 of 20 of supragingival plaque samples, respectively, and 4 of 20, 7 of 20, and 13 of 20 of subgingival plaque samples, respectively, from periodontally healthy subjects. Among patients with periodontitis, the organisms were detected in 7 of 10, 10 of 10, and 7 of 10 samples, respectively. The simultaneous detection of three periodontal pathogens is an advantage of this technique over conventional PCR assays. PMID

  9. A combined method for rescue of modified enteroviruses by mutagenic primers, long PCR and T7 RNA polymerase-driven in vivo transcription.

    PubMed

    Heikkilä, Outi; Kainulainen, Markus; Susi, Petri

    2011-01-01

    The current methods for manipulation of enteroviral RNA genomes and production of modified virus particles include stepwise subcloning procedures and in vitro transcription and RNA transfection steps that are both time-consuming and inefficient. Several enteroviral cDNA clones with 5'-terminal T7 promoter and coxsackievirus A9 (CAV9) PCR product with the T7 promoter were transfected successfully into target cells expressing T7 RNA polymerase for the rescue of virus particles. This demonstrated the overall feasibility of the in vivo transcription method. Furthermore, a rapid method using high-fidelity DNA polymerase, Phusion™, for amplification and mutagenesis of CAV9 cDNA was generated. A long PCR method was employed together with mutagenic primers for direct introduction of a unique restriction enzyme site into the VP1-2A junction of the CAV9 cDNA clone during the PCR amplification process. Enhanced green fluorescent protein was subcloned to that site, and CAV9-eGFP cDNA was transfected to the target cells for in vivo transcription and successful rescue of CAV9-eGFP particles. The method allowed a straightforward mutagenesis and in vivo production of infectious enteroviral particles, and may be applicable routinely for rapid production of the modified picornaviruses over the use of the traditional subcloning protocols. PMID:20974179

  10. The production of PCR products with 5' single-stranded tails using primers that incorporate novel phosphoramidite intermediates.

    PubMed Central

    Newton, C R; Holland, D; Heptinstall, L E; Hodgson, I; Edge, M D; Markham, A F; McLean, M J

    1993-01-01

    We have prepared several novel phosphoramidites and have synthesised oligonucleotides incorporating them internally. The presence of these residues in an oligonucleotide template presents an impossible barrier to primed synthesis by Taq DNA polymerase. When extended as polymerase chain reaction products, these oligonucleotides no longer serve as templates for the polymerase beyond the insertion sites of the modified intermediates, thereby producing single-stranded tails on amplification products. These tails can then be used for solid phase capture and colorimetric detection of PCR products. Images PMID:8464700

  11. Designing Polymerase Chain Reaction Primers Using Primer3Plus.

    PubMed

    Hung, Jui-Hung; Weng, Zhiping

    2016-01-01

    Designing oligonucleotide primers is a crucial step for successful molecular biology experiments that require the use of the polymerase chain reaction (PCR). PCR involves cycles of three steps: denaturation, annealing, and extension. During denaturation, double-stranded DNA (dsDNA) molecules (templates) are separated into single strands. During annealing, a pair of primers is annealed to the complementary regions of the single-stranded molecules. In the extension step, DNA polymerase extends the primers to produce DNA molecules that correspond to the region bracketed by the primers (the amplicons). All of these steps are temperature sensitive, and the common choice of temperatures is 94°C, 60°C, and 70°C, respectively. Poorly designed primers may lead to no amplification product or additional undesired amplified fragments. The goals of primer design include good primer specificity, high annealing efficiency, appropriate melting temperature, proper GC content, and the prevention of primer hairpins or primer dimers. PMID:27574202

  12. Detection of Mycobacterium tuberculosis by PCR amplification with pan-Mycobacterium primers and hybridization to an M. tuberculosis-specific probe.

    PubMed Central

    Tevere, V J; Hewitt, P L; Dare, A; Hocknell, P; Keen, A; Spadoro, J P; Young, K K

    1996-01-01

    Nucleic acid amplification techniques such as the PCR are very useful in the rapid diagnosis of infections by Mycobacterium tuberculosis. However, recent studies have shown that the accuracy of results can vary widely when tests are performed with nonstandardized reagents. We have developed a PCR assay for the detection of M. tuberculosis that is both rapid and accurate. The assay reagents are standardized and quality controlled. False-positive results due to carryover contamination are prevented by the incorporation of dUTP coupled with uracil-N-glycosylase restriction. This assay also employs pan-Mycobacterium amplification primers, allowing for flexibility in the mycobacterial species that can be identified from a single amplification reaction. The amplification is very sensitive; amplification products generated from as few as three bacteria can be detected by agarose gel electrophoresis. DNAs isolated from 33 of 34 mycobacterial species tested were amplified efficiently. Only DNA from Mycobacterium simiae did not amplify. The amplification is also very specific. Amplification products were generated only from the DNAs of bacteria in closely related genera such as Corynebacterium. The nonmycobacterial amplicons do not pose a problem, as they do not hybridize to mycobacterium-specific probes. Hybridization of amplicons to an M. tuberculosis-specific probe allows for the unambiguous identification of M. tuberculosis complex organisms. The clinical performance of this PCR assay was evaluated against that of culture in 662 respiratory specimens. Sensitivities of 100 and 73.1% were obtained from smear-positive and -negative respiratory specimens, respectively. The corresponding specificities were 100 and 99.8%. The high sensitivity and specificity, coupled with the potential for detecting a wide range of mycobacteria, make this assay a useful tool in the clinical management of mycobacterial infections. PMID:8815108

  13. Phylogenetic relationships of the soybean sudden death syndrome pathogen Fusarium solani f. sp. phaseoli inferred from rDNA sequence data and PCR primers for its identification.

    PubMed

    O'Donnell, K; Gray, L E

    1995-01-01

    Phylogenetic relationships of several species within the Fusarium solani-complex were investigated using characters from the nuclear ribosomal DNA. Genetic variation within 24 isolates, including 5 soybean sudden death syndrome (SDS) strains, was assessed using rDNA sequence data and restriction fragment length polymorphic markers. By these techniques, the causal agent of soybean SDS was identified as F. solani f. sp. phaseoli. In separate cladistic analyses, Plectosphaerella cucumerina and Nectria cinnabarina or F. ventricosum were used for rooting purposes. Monophyly of the F. solani-complex was strongly supported by bootstrap and decay analyses. Parsimony analysis indicates that this complex is composed of a number of phylogenetically distinct species, including Neocosmospora vasinfecta, F. solani f. sp. phaseoli, and biological species designated as MPI, MPV, and MPVI of N. haematococca. The results demonstrate complete congruence between biological and phylogenetic species within the N. haematococca-complex. In addition, DNA sequence data were used to design a PCR primer pair which could specifically amplify DNA from isolates of the SDS pathogen from infected plants. PMID:7579615

  14. Multi-primer qPCR assay capable of highly efficient and specific detection of the vast majority of all known Mycoplasma.

    PubMed

    Salling, H K; Bang-Christensen, S R

    2016-05-01

    Mycoplasma bacteria are able to pass through sterilizing grade filters due to their small size and lack of a cell wall, making them a common contaminant of biopharmaceutical productions. The classical method for detecting Mycoplasma is described in the European Pharmacopeia (Ph.Eur) 2.6.7. The method takes 28 days to perform, due to the slow growing nature of some Mycoplasma species. The Ph.Eur has described Nucleic Acid Testing (NAT) as a rapid alternative to the classical method. Here we present the development of a quantitative polymerase chain reaction (qPCR) assay capable of unambiguous detection of Mycoplasma with high sensitivity and specificity. The broadness of detection and the specificity towards Mycoplasma has been investigated by in silico analysis of the primer sequences followed by testing on purified Mycoplasma DNA as well as DNA from closely related genera. The assay will in all probability detect at least 356 species and strains of Mycoplasma, Spiroplasma and Acholeplasma with high sensitivity. To our knowledge this assay has the most uniform amplification efficiency over the broadest range of species and it is extremely specific towards Mycoplasma. With appropriate validation, the assay can be applied as a powerful tool for rapid Mycoplasma detection in the biopharmaceutical industry. PMID:27067447

  15. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

    PubMed Central

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-01-01

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

  16. Rapid and efficient identification of the mouse leptin receptor mutation (C57BL/KsJ-db/db) by tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) analysis

    PubMed Central

    Jung, Harry; Nam, Hajin

    2016-01-01

    The C57BLKS/J-Leprdb mouse has a point mutation in the leptin receptor gene and is one of the most useful animal model for non-insulin dependent diabetes mellitus in human. Since the homozygote of C57BLKS/J-Leprdb mouse is infertile, detection of point mutation in the leptin receptor gene is important for efficient maintaining strains as well as mass production of homozygotes. To develop a rapid and efficient genotyping method for C57BLKS/J-Leprdb mouse, the tetra-primer amplification-refractory mutation system polymerase chain reaction (ARMS-PCR) was used. The 407 and 199 bp PCR products were amplified from normal (+/+) mice; while the 407 and 268 bp PCR products were amplified from homozygotes (db/db) mice; and the 407, 268, and 199 bp PCR products were amplified from heterozygotes (db/+) mice. This result showed that the tetra-primer ARMS-PCR analysis by us is suitable to detect point mutation of the leptin receptor gene. Taken together, our method will dramatically reduce animal use for maintenance of strains as well as production of homozygote in the C57BLKS/J-Leprdb strains. PMID:27051445

  17. Rapid and efficient identification of the mouse leptin receptor mutation (C57BL/KsJ-db/db) by tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) analysis.

    PubMed

    Jung, Harry; Nam, Hajin; Suh, Jun-Gyo

    2016-03-01

    The C57BLKS/J-Lepr(db) mouse has a point mutation in the leptin receptor gene and is one of the most useful animal model for non-insulin dependent diabetes mellitus in human. Since the homozygote of C57BLKS/J-Lepr(db) mouse is infertile, detection of point mutation in the leptin receptor gene is important for efficient maintaining strains as well as mass production of homozygotes. To develop a rapid and efficient genotyping method for C57BLKS/J-Lepr(db) mouse, the tetra-primer amplification-refractory mutation system polymerase chain reaction (ARMS-PCR) was used. The 407 and 199 bp PCR products were amplified from normal (+/+) mice; while the 407 and 268 bp PCR products were amplified from homozygotes (db/db) mice; and the 407, 268, and 199 bp PCR products were amplified from heterozygotes (db/+) mice. This result showed that the tetra-primer ARMS-PCR analysis by us is suitable to detect point mutation of the leptin receptor gene. Taken together, our method will dramatically reduce animal use for maintenance of strains as well as production of homozygote in the C57BLKS/J-Lepr(db) strains. PMID:27051445

  18. Comparison of Flavivirus Universal Primer Pairs and Development of a Rapid, Highly Sensitive Heminested Reverse Transcription-PCR Assay for Detection of Flaviviruses Targeted to a Conserved Region of the NS5 Gene Sequences

    PubMed Central

    Scaramozzino, Natale; Crance, Jean-Marc; Jouan, Alain; DeBriel, Dominique A.; Stoll, Françoise; Garin, Daniel

    2001-01-01

    Arthropod-transmitted flaviviruses are responsible for considerable morbidity and mortality, causing severe encephalitic, hemorrhagic, and febrile illnesses in humans. Because there are no specific clinical symptoms for infection by a determined virus and because different arboviruses could be present in the same area, a genus diagnosis by PCR would be a useful first-line diagnostic method. The six published Flavivirus genus primer pairs localized in the NS1, NS3, NS5, and 3′ NC regions were evaluated in terms of specificity and sensitivity with flaviviruses (including the main viruses pathogenic for humans) at a titer of 105 50% tissue culture infectious doses (TCID50s) ml−1 with a common identification step by agarose gel electrophoresis. Only one NS5 primer pair allowed the detection of all tested flaviviruses with the sensitivity limit of 105 TCID50s ml−1. Using a heminested PCR with new primers designed in the same region after an alignment of 30 different flaviviruses, the sensitivity of reverse transcription-PCR was improved and allowed the detection of about 200 infectious doses ml−1 with all of the tick- and mosquito-borne flaviviruses tested. It was confirmed that the sequenced amplified products in the NS5 region allowed predictability of flavivirus species by dendrogram, including the New York 99 West Nile strain. This technique was successfully performed with a cerebrospinal fluid sample from a patient hospitalized with West Nile virus encephalitis. PMID:11326014

  19. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes.

    PubMed

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  20. Influence of primer sequences and DNA extraction method on detection of non-O157 Shiga toxin-producing Escherichia coli in ground beef by real-time PCR targeting the eae, stx, and serogroup-specific genes.

    PubMed

    Wasilenko, Jamie L; Fratamico, Pina M; Narang, Neelam; Tillman, Glenn E; Ladely, Scott; Simmons, Mustafa; Cray, William C

    2012-11-01

    Non-O157 Shiga toxin-producing Escherichia coli (STEC) infections, particularly those caused by the "big six" or "top six" non-O157 serogroups (O26, O45, O103, O111, O121, and O145) can result in severe illness and complications. Because of their significant public health impact and the notable prevalence of STEC in cattle, methods for detection of the big six non-O157 STEC in ground beef have been established. Currently, the U.S. Department of Agriculture, Food Safety and Inspection Service detection methods for screening beef samples for non-O157 STEC target the stx(1), stx(2), and eae virulence genes, with the 16S rRNA gene as an internal control, in a real-time PCR multiplex assay. Further, the serogroup is determined by PCR targeting genes in the E. coli O-antigen gene clusters of the big six non-O157 serogroups. The method that we previously reported was improved so that additional stx variants, stx(1d), stx(2e), and stx(2g), are detected. Additionally, alignments of the primers targeting the eae gene were used to improve the detection assay so that eae subtypes that could potentially be of clinical significance would also be detected. Therefore, evaluation of alternative real-time PCR assay primers and probes for the stx and eae reactions was carried out in order to increase the stx and eae subtypes detected. Furthermore, a Tris-EDTA DNA extraction method was compared with a previously used procedure that was based on a commercially available reagent. The Tris-EDTA DNA extraction method significantly decreased the cycle threshold values for the stx assay (P < 0.0001) and eae assay (P < 0.0001), thereby increasing the ability to detect the targets. The use of different stx primers and probes increased the subtypes detected to include stx(1d), stx(2e), and stx(2g), and sequence data showed that modification of the eae primer should allow the known eae subtypes to be detected. PMID:23127702

  1. Detection and analysis of six lizard adenoviruses by consensus primer PCR provides further evidence of a reptilian origin for the atadenoviruses.

    PubMed

    Wellehan, James F X; Johnson, April J; Harrach, Balázs; Benkö, Mária; Pessier, Allan P; Johnson, Calvin M; Garner, Michael M; Childress, April; Jacobson, Elliott R

    2004-12-01

    A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses. PMID:15542689

  2. Detection and Analysis of Six Lizard Adenoviruses by Consensus Primer PCR Provides Further Evidence of a Reptilian Origin for the Atadenoviruses

    PubMed Central

    Wellehan, James F. X.; Johnson, April J.; Harrach, Balázs; Benkö, Mária; Pessier, Allan P.; Johnson, Calvin M.; Garner, Michael M.; Childress, April; Jacobson, Elliott R.

    2004-01-01

    A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses. PMID:15542689

  3. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  4. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  5. Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

    PubMed Central

    Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

    2015-01-01

    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers

  6. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.

    PubMed

    Van Campenhout, S; Stappen, J V; Volckaert, G

    2001-08-01

    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array. PMID:11550886

  7. Development and comparison of a Primer-Probe Energy Transfer based assay and a 5' conjugated Minor Groove Binder assay for sensitive real-time PCR detection of infectious laryngotracheitis virus.

    PubMed

    McMenamy, M J; McKillen, J; Hjertner, B; Kiss, I; Yacoub, A; Leijon, M; Duffy, C; Belák, S; Welsh, M; Allan, G

    2011-08-01

    In this study the design and development of two real-time PCR assays for the rapid, sensitive and specific detection of infectious laryngotracheitis virus (ILTV) DNA is described. A Primer-Probe Energy Transfer (PriProET) assay and 5' conjugated Minor Groove Binder (MGB) method are compared and contrasted. Both have been designed to target the thymidine kinase gene of the ILTV genome. Both PriProET and MGB assays are capable of detecting 20 copies of a DNA standard per reaction and are linear from 2×10(8) to 2×10(2)copies/μl. Neither PriProET, nor MGB reacted with heterologous herpesviruses, indicating a high specificity of the two methods as novel tools for virus detection and identification. This study demonstrates the suitability of PriProET and 5' conjugated MGB probes as real-time PCR chemistries for the diagnosis of respiratory diseases caused by ILTV. PMID:21539859

  8. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  9. RATMAC PRIMER

    SciTech Connect

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine

    1980-10-01

    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  10. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  11. Nucleic acid amplification using modular branched primers

    DOEpatents

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  12. Virtual PCR

    SciTech Connect

    Gardner, S N; Clague, D S; Vandersall, J A; Hon, G; Williams, P L

    2006-02-23

    The polymerase chain reaction (PCR) stands among the keystone technologies for analysis of biological sequence data. PCR is used to amplify DNA, to generate many copies from as little as a single template. This is essential, for example, in processing forensic DNA samples, pathogen detection in clinical or biothreat surveillance applications, and medical genotyping for diagnosis and treatment of disease. It is used in virtually every laboratory doing molecular, cellular, genetic, ecologic, forensic, or medical research. Despite its ubiquity, we lack the precise predictive capability that would enable detailed optimization of PCR reaction dynamics. In this LDRD, we proposed to develop Virtual PCR (VPCR) software, a computational method to model the kinetic, thermodynamic, and biological processes of PCR reactions. Given a successful completion, these tools will allow us to predict both the sequences and concentrations of all species that are amplified during PCR. The ability to answer the following questions will allow us both to optimize the PCR process and interpret the PCR results: What products are amplified when sequence mixtures are present, containing multiple, closely related targets and multiplexed primers, which may hybridize with sequence mismatches? What are the effects of time, temperature, and DNA concentrations on the concentrations of products? A better understanding of these issues will improve the design and interpretation of PCR reactions. The status of the VPCR project after 1.5 years of funding is consistent with the goals of the overall project which was scoped for 3 years of funding. At half way through the projected timeline of the project we have an early beta version of the VPCR code. We have begun investigating means to improve the robustness of the code, performed preliminary experiments to test the code and begun drafting manuscripts for publication. Although an experimental protocol for testing the code was developed, the preliminary

  13. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-02-01

    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  14. Loop-mediated amplification accelerated by stem primers.

    PubMed

    Gandelman, Olga; Jackson, Rebecca; Kiddle, Guy; Tisi, Laurence

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility. PMID:22272122

  15. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.

    PubMed

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus

    2011-07-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at http://www.cbs.dtu.dk/services/phuser/. PMID:21622660

  16. Better primer design for metagenomics applications by increasing taxonomic distinguishability

    PubMed Central

    2013-01-01

    Current methods of understanding microbiome composition and structure rely on accurately estimating the number of distinct species and their relative abundance. Most of these methods require an efficient PCR whose forward and reverse primers bind well to the same, large number of identifiable species, and produce amplicons that are unique. It is therefore not surprising that currently used universal primers designed many years ago are not as efficient and fail to bind to recently cataloged species. We propose an automated general method of designing PCR primer pairs that abide by primer design rules and uses current sequence database as input. Since the method is automated, primers can be designed for targeted microbial species or updated as species are added or deleted from the database. In silico experiments and laboratory experiments confirm the efficacy of the newly designed primers for metagenomics applications. PMID:24564926

  17. Overlap extension PCR cloning.

    PubMed

    Bryksin, Anton; Matsumura, Ichiro

    2013-01-01

    Rising demand for recombinant proteins has motivated the development of efficient and reliable cloning methods. Here we show how a beginner can clone virtually any DNA insert into a plasmid of choice without the use of restriction endonucleases or T4 DNA ligase. Chimeric primers encoding plasmid sequence at the 5' ends and insert sequence at the 3' ends are designed and synthesized. Phusion(®) DNA polymerase is utilized to amplify the desired insert by PCR. The double-stranded product is subsequently employed as a pair of mega-primers in a PCR-like reaction with circular plasmids. The original plasmids are then destroyed in restriction digests with Dpn I. The product of the overlap extension PCR is used to transform competent Escherichia coli cells. Phusion(®) DNA polymerase is used for both the amplification and fusion reactions, so both steps can be monitored and optimized in the same way. PMID:23996437

  18. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-01-01

    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  19. Microsatellite primers for red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  20. Universal multiplexable matK primers for DNA barcoding of angiosperms1

    PubMed Central

    Heckenhauer, Jacqueline; Barfuss, Michael H. J.; Samuel, Rosabelle

    2016-01-01

    Premise of the study: PCR amplification of the matK barcoding region is often difficult when dealing with multiple angiosperm families. We developed a primer cocktail to amplify this region efficiently across angiosperm diversity. Methods and Results: We developed 14 matK primers (seven forward, seven reverse) for multiplex PCR, using sequences available in GenBank for 178 taxa belonging to 123 genera in 41 families and 18 orders. Universality of these new multiplexed primers was tested with 53 specimens from 44 representative angiosperm families in 23 different orders. Our primers showed high PCR amplification and sequencing success. Conclusions: These results show that our newly developed primers are highly effective for multiplex PCR and can be employed in future barcode projects involving taxonomically diverse samples across angiosperms. Using multiplex primers for barcoding will reduce the cost and time needed for PCR amplification. PMID:27347449

  1. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  2. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  3. Education Vouchers. A Primer.

    ERIC Educational Resources Information Center

    Richter, Philip C.; Hollender, Mary Jo

    This document is intended to serve both as a primer and as an annotated bibliography about educational vouchers. As a primer, it introduces the reader to the concept of vouchers and to the variety of issues--including political, economic, legal, and educational issues--associated with vouchers. As an annotated bibliography, it provides a summary…

  4. Exquisite allele discrimination by toehold hairpin primers

    PubMed Central

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  5. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  6. Identification of bacterial plant pathogens using multilocus PCR and electrospray ionization-mass spectrometry (PCR/ESI-MS)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    PCR/electrospray ionization-mass spectrometry (PCR/ESI-MS, previously known as “TIGER”) utilizes PCR with broad range primers to amplify products from wide array of organisms within a taxonomic group, followed by analysis of PCR amplicons using mass spectrometry. Computer analysis of precise masses ...

  7. Simultaneous detection of Legionella species and L. anisa, L. bozemanii, L. longbeachae and L. micdadei using conserved primers and multiple probes in a multiplex real-time PCR assay.

    PubMed

    Cross, Kristen E; Mercante, Jeffrey W; Benitez, Alvaro J; Brown, Ellen W; Diaz, Maureen H; Winchell, Jonas M

    2016-07-01

    Legionnaires' disease is a severe respiratory disease that is estimated to cause between 8,000 and 18,000 hospitalizations each year, though the exact burden is unknown due to under-utilization of diagnostic testing. Although Legionella pneumophila is the most common species detected in clinical cases (80-90%), other species have also been reported to cause disease. However, little is known about Legionnaires' disease caused by these non-pneumophila species. We designed a multiplex real-time PCR assay for detection of all Legionella spp. and simultaneous specific identification of four clinically-relevant Legionella species, L. anisa, L. bozemanii, L. longbeachae, and L. micdadei, using 5'-hydrolysis probe real-time PCR. The analytical sensitivity for detection of nucleic acid from each target species was ≤50fg per reaction. We demonstrated the utility of this assay in spiked human sputum specimens. This assay could serve as a tool for understanding the scope and impact of non-pneumophila Legionella species in human disease. PMID:27107536

  8. Association between the p73 gene G4C14-to-A4T14 single nucleotide polymorphism and risk of cervical cancer by high resolution melting and PCR with confronting two-pair primers in a Chinese population

    PubMed Central

    GUO, HAIYAN; YANG, SHAODI; XU, LIJIAN; LI, DING; TANG, JIANXIN; WANG, SHUANGSHAUNG; WEI, BENJIE; LIU, ZHENGCHUN

    2016-01-01

    As a member of the p53 gene family, the p73 gene can affect an individual's susceptibility to cancer through a p53-like manner. DNA sequence variation in the p73 gene has been reported to be associated with cancer risk. The present study aimed to identify whether the p73 gene G4C14-to-A4T14 single nucleotide polymorphism (SNP) is associated with risk of cervical cancer in a Chinese population. The p73 G4C14-to-A4T14 polymorphism was genotyped in 175 cervical cancer and 189 healthy control peripheral blood DNA samples using high resolution melting, polymerase chain reaction with confronting two-pair primers and direct DNA sequencing. The results demonstrated that carriers of the AT/AT genotype were associated with a significantly increased risk of cervical cancer (P=0.042; χ2=4.122; odds ratio = 2.241; 95% confidence interval = 1.013–4.956) compared with the GC/GC genotype carriers. In addition, there was a significant association between p73 genotypes and tumor size in patients with cervical cancer (P=0.014; χ2=8.607). However, no association was identified between p73 genotypes and tumor stage, histological type or lymph node metastasis in patients with cervical cancer. These results suggest that the p73 G4C14-to-A4T14 SNP may function as a marker of genetic susceptibility to cervical cancer in the Chinese population. PMID:27347206

  9. Specific Oligonucleotide Primers for Identification of Cladophialophora carrionii, a Causative Agent of Chromoblastomycosis

    PubMed Central

    Abliz, Paride; Fukushima, Kazutaka; Takizawa, Kayoko; Nishimura, Kazuko

    2004-01-01

    Cladophialophora carrionii is one of the relatively common causative agents of chromoblastomycosis. We have developed the specific oligonucleotide primer set based on the internal transcribed spacer regions of ribosomal DNA for the rapid identification of this pathogen. PCR with this primer set amplified a 362-bp amplicon from C. carrionii strains. From other relevant dematiaceous species, including medically important dematiaceous fungi, such as Fonsecaea pedrosoi, Phialophora verrucosa, and Exophiala dermatitidis, and eight species of medically important yeasts, such as Candida albicans and Cryptococcus neoformans var. neoformans, the primer set did not produce any amplicon. PCR with this primer set may be a useful tool for the identification of C. carrionii. PMID:14715791

  10. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics. PMID:25229098

  11. China Energy Primer

    SciTech Connect

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  12. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye

    2008-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  13. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  14. Nulcear materials production: Primer

    SciTech Connect

    Not Available

    1988-09-01

    The US Department of Energy's (DOE's) Office of Nuclear Materials Production (NMP) is responsible for managing the production and recovery of nuclear materials for national defense. NMP oversees the production of radioactive materials for government, commercial, industrial, and medical applications. This Primer is a general introduction to NMP's major activities.

  15. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  16. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

    PubMed Central

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

    2014-01-01

    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

  17. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method. PMID:25429503

  18. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  19. Crystalline Silica Primer

    USGS Publications Warehouse

    Staff- Branch of Industrial Minerals

    1992-01-01

    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  20. Primer on molecular genetics

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  1. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  2. A study of PCR inhibition mechanisms using real time PCR.

    PubMed

    Opel, Kerry L; Chung, Denise; McCord, Bruce R

    2010-01-01

    In this project, real time polymerase chain reaction (PCR) was utilized to study the mechanism of PCR inhibition through examination of the effect of amplicon length, melting temperature, and sequence. Specifically designed primers with three different amplicon lengths and three different melting temperatures were used to target a single homozygous allele in the HUMTH01 locus. The effect on amplification efficiency for each primer pair was determined by adding different concentrations of various PCR inhibitors to the reaction mixture. The results show that a variety of inhibition mechanisms can occur during the PCR process depending on the type of co-extracted inhibitor. These include Taq inhibition, DNA template binding, and effects on reaction efficiency. In addition, some inhibitors appear to affect the reaction in more than one manner. Overall we find that amplicon size and melting temperature are important in some inhibition mechanisms and not in others and the key issue in understanding PCR inhibition is determining the identity of the interfering substance. PMID:20015162

  3. Ligation-independent cloning of PCR products (LIC-PCR).

    PubMed Central

    Aslanidis, C; de Jong, P J

    1990-01-01

    A new procedure has been developed for the efficient cloning of complex PCR mixtures, resulting in libraries exclusively consisting of recombinant clones. Recombinants are generated between PCR products and a PCR-amplified plasmid vector. The procedure does not require the use of restriction enzymes, T4 DNA ligase or alkaline phosphatase. The 5'-ends of the primers used to generate the cloneable PCR fragments contain an additional 12 nucleotide (nt) sequence lacking dCMP. As a result, the amplification products include 12-nt sequences lacking dGMP at their 3'-ends. The 3'-terminal sequence can be removed by the action of the (3'----5') exonuclease activity of T4 DNA polymerase in the presence of dGTP, leading to fragments with 5'-extending single-stranded (ss) tails of a defined sequence and length. Similarly, the entire plasmid vector is amplified with primers homologous to sequences in the multiple cloning site. The vector oligos have additional 12-nt tails complementary to the tails used for fragment amplification, permitting the creation of ss-ends with T4 DNA polymerase in the presence of dCTP. Circularization can occur between vector molecules and PCR fragments as mediated by the 12-nt cohesive ends, but not in mixtures lacking insert fragments. The resulting circular recombinant molecules do not require in vitro ligation for efficient bacterial transformation. We have applied the procedure for the cloning of inter-ALU fragments from hybrid cell-lines and human cosmid clones. Images PMID:2235490

  4. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design PMID:24278254

  5. Plastid primers for angiosperm phylogenetics and phylogeography1

    PubMed Central

    Prince, Linda M.

    2015-01-01

    Premise of the study: PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Methods: Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Results: Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Discussion: Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. “Universal” primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications. PMID:26082876

  6. [Rapid PCR authentication Lonicera japanica].

    PubMed

    Jiang, Chao; Hou, Jing-Yi; Huang, Lu-Qi; Yuan, Yuan; Chen, Min; Jin, Yan

    2014-10-01

    To simply and rapid authenticate Lonicera japanica. Rapid allele-specific PCR primer was designed base on trnL-trnF 625 G/T Single nucleotide polymorphism and the PCR reaction systems including annealing temperature was optimized; optimized results were performed to authenticate L. japanica and its 9 adulterants. When 100 x SYBR Green I was added in the PCR product of 87 degrees C initial denatured 1 min; 87 degrees C denatured 5 s, 68 degrees C annealing 5 s, 30 cycle; L. japanica visualize strong green fluorescence under 365 nm UV lamp whereas adulterants without. The results indicate rapid allele-specific PCR could authenticate L. japanica and its adulterants rapidly and simply. PMID:25612418

  7. A Quantum Groups Primer

    NASA Astrophysics Data System (ADS)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  8. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.

    1985-01-01

    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  9. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  10. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  11. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  12. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR.

    PubMed

    Choi, Hoseong; Cho, Won Kyong; Yu, Jisuk; Lee, Jong-Seung; Kim, Kook-Hyung

    2013-03-01

    To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus) for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea. PMID:25288934

  13. Universal primers for the amplification and sequence analysis of actin-1 from diverse mosquito species.

    PubMed

    Staley, Molly; Dorman, Karin S; Bartholomay, Lyric C; Fernández-Salas, Ildefonso; Farfan-Ale, Jose A; Loroño-Pino, Maria A; Garcia-Rejon, Julian E; Ibarra-Juarez, Luis; Blitvich, Bradley J

    2010-06-01

    We report the development of universal primers for the reverse-transcription polymerase chain reaction (RT-PCR) amplification and nucleotide sequence analysis of actin cDNAs from taxonomically diverse mosquito species. Primers specific to conserved regions of the invertebrate actin-1 gene were designed after actin cDNA sequences of Anopheles gambiae, Bombyx mori, Drosophila melanogaster, and Caenorhabditis elegans. The efficacy of these primers was determined by RT-PCR with the use of total RNA from mosquitoes belonging to 30 species and 8 genera (Aedes, Anopheles, Culex, Deinocerites, Mansonia, Psorophora, Toxorhynchites, and Wyeomyia). The RT-PCR products were sequenced, and sequence data were used to design additional primers. One primer pair, denoted as Act-2F (5'-ATGGTCGGYATGGGNCAGAAGGACTC-3') and Act-8R (5'-GATTCCATACCCAGGAAGGADGG-3'), successfully amplified an RT-PCR product of the expected size (683-nt) in all mosquito spp. tested. We propose that this primer pair can be used as an internal control to test the quality of RNA from mosquitoes collected in vector surveillance studies. These primers can also be used in molecular experiments in which the detection, amplification or silencing of a ubiquitously expressed mosquito housekeeping gene is necessary. Sequence and phylogenetic data are also presented in this report. PMID:20649132

  14. Universal primers that amplify RNA from all three flavivirus subgroups

    PubMed Central

    Maher-Sturgess, Sheryl L; Forrester, Naomi L; Wayper, Paul J; Gould, Ernest A; Hall, Roy A; Barnard, Ross T; Gibbs, Mark J

    2008-01-01

    Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5) coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers. PMID:18218114

  15. A Brief Taxometrics Primer

    PubMed Central

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  16. STR primer concordance study.

    PubMed

    Budowle, B; Masibay, A; Anderson, S J; Barna, C; Biega, L; Brenneke, S; Brown, B L; Cramer, J; DeGroot, G A; Douglas, D; Duceman, B; Eastman, A; Giles, R; Hamill, J; Haase, D J; Janssen, D W; Kupferschmid, T D; Lawton, T; Lemire, C; Llewellyn, B; Moretti, T; Neves, J; Palaski, C; Schueler, S; Sgueglia, J; Sprecher, C; Tomsey, C; Yet, D

    2001-12-15

    Over 1500 population database samples comprising African Americans, Caucasians, Hispanics, Native Americans, Chamorros and Filipinos were typed using the PowerPlex 16 and the Profiler Plus/COfiler kits. Except for the D8S1179 locus in Chamorros and Filipinos from Guam, there were eight examples in which a typing difference due to allele dropout was observed. At the D8S1179 locus in the population samples from Guam, there were 13 examples of allele dropout observed when using the Profiler Plus kit. The data support that the primers used in the PowerPlex 16, Profiler Plus, and COfiler kits are reliable for typing reference samples that are for use in CODIS. In addition, allele frequency databases have been established for the STR loci Penta D and Penta E. Both loci are highly polymorphic. PMID:11741760

  17. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  18. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  19. Sensitivity of PCR and real-time PCR for the diagnosis of human visceral leishmaniasis using peripheral blood

    PubMed Central

    da Costa Lima, Manoel Sebastião; Zorzenon, Denielly Christina Rodrigues; Dorval, Maria Elizabeth Cavalheiros; Pontes, Elenir Rose Jardim Cury; Oshiro, Elisa Teruya; Cunha, Rodrigo; Andreotti, Renato; Matos, Maria de Fatima Cepa

    2013-01-01

    Objective To evaluate the effectiveness of PCR and real-time PCR for the diagnosis of human visceral leishmaniasis using peripheral blood samples. Methods DNA extraction was performed using Promega Wizard® Genomic kits. PCR employing RV1/RV2 primers yielded 145-bp amplicons. Real-time PCR was performed with the same primers and SYBR Green ROX Plus mix. These techniques were used to analyze 100 peripheral blood samples from patients with clinical signs of the disease. Results The sensitivity and specificity levels were 91,3%% and 29,6%, respectively, for real-time PCR and 97.78% and 61.82%, respectively, for PCR. Conclusions Real-time PCR proved to be a satisfactory method for the diagnosis of human visceral leishmaniasis.

  20. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  1. Intrageneric primer design: Bringing bioinformatics tools to the class.

    PubMed

    Lima, André O S; Garcês, Sérgio P S

    2006-09-01

    Bioinformatics is one of the fastest growing scientific areas over the last decade. It focuses on the use of informatics tools for the organization and analysis of biological data. An example of their importance is the availability nowadays of dozens of software programs for genomic and proteomic studies. Thus, there is a growing field (private and academic) with a need for bachelor of science students with bioinformatics skills. In consideration of this need, described here is a problem-based class in which students are asked to design a set of intrageneric primers for PCR. The exercise is divided into five classes of 1 h each, in which students use freeware bioinformatics tools and data bases available through the Internet. Besides designing the set of primers, the students will consequently learn the significance and use of the major bioinformatics procedures, such as searching a data base, conducting and analyzing sequence multialignment, comparing sequences with a data base, and selecting primers. PMID:21638710

  2. Optimization of primer design for the detection of variable genomic lesions in cancer.

    PubMed

    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet

    2007-11-01

    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  3. REAL-TIME PCR ASSAY DEVELOPMENT FOR MULTIPLE MAIZE PATHOGENS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This talk presents updates on the development of real-time PCR assays for two seedborne pathogens of maize, Pantoea (Erwinia) stewartii, the causal agent of Stewart's bacterial wilt, and Stenocarpella (Diplodia) maydis, the causal agent of Diplodia ear rot. We developed primers and a real-time PCR p...

  4. A web server for performing electronic PCR

    PubMed Central

    Rotmistrovsky, Kirill; Jang, Wonhee; Schuler, Gregory D.

    2004-01-01

    ‘Electronic PCR’ (e-PCR) refers to a computational procedure that is used to search DNA sequences for sequence tagged sites (STSs), each of which is defined by a pair of primer sequences and an expected PCR product size. To gain speed, our implementation extracts short ‘words’ from the 3′ end of each primer and stores them in a sorted hash table that can be accessed efficiently during the search. One recent improvement is the use of overlapping discontinuous words to allow matches to be found despite the presence of a mismatch. Moreover, it is possible to allow gaps in the alignment between the primer and the sequence. The effect of these changes is to improve sensitivity without significantly affecting specificity. The new software provides a search mode using a query STS against a sequence database to augment the previously available mode using a query sequence against an STS database. Finally, e-PCR may now be used through a web service, with search results linked to other web resources such as the UniSTS database and the MapViewer genome browser. The e-PCR web server may be found at www.ncbi.nlm.nih.gov/sutils/e-pcr. PMID:15215361

  5. Use of Repetitive Element Palindromic-PCR (rep-PCR) for the Epidemiologic Discrimination of Food-Borne Pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The use of defined primers for polymerase chain reactions (PCR) amplicifcations of interspersed repetitive DNA elements present at distinct locations in prokaryotic genomes is referred to as Repetitive Element Palindromic Sequences Based-Polymerase Chain Reactions, rep-PCR. The initial discovery of...

  6. Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

    PubMed Central

    Bokulich, Nicholas A.

    2013-01-01

    Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

  7. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  8. A simple procedure eliminating multiple optimization steps required in developing multiplex PCR reactions

    SciTech Connect

    Grondin, V.; Roskey, M.; Klinger, K.; Shuber, T.

    1994-09-01

    The PCR technique is one of the most powerful tools in modern molecular genetics and has achieved widespread use in the analysis of genetic diseases. Typically, a region of interest is amplified from genomic DNA or cDNA and examined by various methods of analysis for mutations or polymorphisms. In cases of small genes and transcripts, amplification of single, small regions of DNA are sufficient for analysis. However, when analyzing large genes and transcripts, multiple PCRs may be required to identify the specific mutation or polymorphism of interest. Ever since it has been shown that PCR could simultaneously amplify multiple loci in the human dystrophin gene, multiplex PCR has been established as a general technique. The properities of multiplex PCR make it a useful tool and preferable to simultaneous uniplex PCR in many instances. However, the steps for developing a multiplex PCR can be laborious, with significant difficulty in achieving equimolar amounts of several different amplicons. We have developed a simple method of primer design that has enabled us to eliminate a number of the standard optimization steps required in developing a multiplex PCR. Sequence-specific oligonucleotide pairs were synthesized for the simultaneous amplification of multiple exons within the CFTR gene. A common non-complementary 20 nucleotide sequence was attached to each primer, thus creating a mixture of primer pairs all containing a universal primer sequence. Multiplex PCR reactions were carried out containing target DNA, a mixture of several chimeric primer pairs and primers complementary to only the universal portion of the chimeric primers. Following optimization of conditions for the universal primer, limited optimization was needed for successful multiplex PCR. In contrast, significant optimization of the PCR conditions were needed when pairs of sequence specific primers were used together without the universal sequence.

  9. Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

    PubMed Central

    Marcon, Helena Sanches; Coscrato, Virgínia Elias; Selivon, Denise; Perondini, André Luiz Paranhos; Marino, Celso Luis

    2011-01-01

    Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity. PMID:24031693

  10. Simultaneous multiplex PCR detection of seven cucurbit-infecting viruses.

    PubMed

    Kwon, Ji Yeon; Hong, Jin Sung; Kim, Min Jea; Choi, Sun Hee; Min, Byeong Eun; Song, Eun Gyeong; Kim, Hyun Hee; Ryu, Ki Hyun

    2014-09-01

    Two multiplex polymerase chain reaction (PCR) systems using dual priming oligonucleotide (DPO) primers were developed for the simultaneous detection of seven cucurbit-infecting viruses. One system allows for the detection of papaya ringspot virus, watermelon mosaic virus, and zucchini yellow mosaic virus, whereas the other permits the detection of cucumber green mottle mosaic virus, cucumber fruit mottle mosaic virus, kyuri green mottle mosaic virus, and zucchini green mottle mosaic virus. Viral species-specific DPO primers developed in this study detected as little as 10 fg/μl of viral RNA under monoplex conditions and 10 pg/μl of viral RNA under multiplex conditions. Multiplex PCR using the DPO primer sets was capable of amplifying viral genes at annealing temperatures ranging from 53 °C to 63 °C. Whereas the use of conventional primers gave rise to non-specific bands, the DPO primers detected target viral genes in the absence of non-specific amplification. When these DPO multiplex primer sets were applied to virus-infected cucurbit samples obtained in the field, multiple infection as well as single infection was accurately identified. This novel approach could also detect multiple viruses in infected seeds. The reliability of multiplex PCR systems using DPO primers for plant virus detection is discussed. PMID:24937806

  11. Global RT-PCR and RT-qPCR Analysis of the mRNA Expression of the Human PTPome.

    PubMed

    Nunes-Xavier, Caroline E; Pulido, Rafael

    2016-01-01

    Comprehensive comparative gene expression analysis of the tyrosine phosphatase superfamily members (PTPome) under cell- or tissue-specific growth conditions may help to define their individual and specific role in physiology and disease. Semi-quantitative and quantitative PCR are commonly used methods to analyze and measure gene expression. Here, we describe technical aspects of PTPome mRNA expression analysis by semi-quantitative RT-PCR and quantitative RT-PCR (RT-qPCR). We provide a protocol for each method consisting in reverse transcription followed by PCR using a global platform of specific PTP primers. The chapter includes aspects from primer validation to the setup of the PTPome RT-qPCR platform. Examples are given of PTP-profiling gene expression analysis using a human breast cancer cell line upon long-term or short-term treatment with cell signaling-activation agents. PMID:27514798

  12. ecoPrimers: inference of new DNA barcode markers from whole genome sequence analysis

    PubMed Central

    Riaz, Tiayyba; Shehzad, Wasim; Viari, Alain; Pompanon, François; Taberlet, Pierre; Coissac, Eric

    2011-01-01

    Using non-conventional markers, DNA metabarcoding allows biodiversity assessment from complex substrates. In this article, we present ecoPrimers, a software for identifying new barcode markers and their associated PCR primers. ecoPrimers scans whole genomes to find such markers without a priori knowledge. ecoPrimers optimizes two quality indices measuring taxonomical range and discrimination to select the most efficient markers from a set of reference sequences, according to specific experimental constraints such as marker length or specifically targeted taxa. The key step of the algorithm is the identification of conserved regions among reference sequences for anchoring primers. We propose an efficient algorithm based on data mining, that allows the analysis of huge sets of sequences. We evaluate the efficiency of ecoPrimers by running it on three different sequence sets: mitochondrial, chloroplast and bacterial genomes. Identified barcode markers correspond either to barcode regions already in use for plants or animals, or to new potential barcodes. Results from empirical experiments carried out on a promising new barcode for analyzing vertebrate diversity fully agree with expectations based on bioinformatics analysis. These tests demonstrate the efficiency of ecoPrimers for inferring new barcodes fitting with diverse experimental contexts. ecoPrimers is available as an open source project at: http://www.grenoble.prabi.fr/trac/ecoPrimers. PMID:21930509

  13. Degenerative primer design and gene sequencing validation for select turkey genes.

    PubMed

    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald

    2016-06-01

    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. PMID:27053625

  14. PCR thermocycler

    DOEpatents

    Benett, William J.; Richards, James B.

    2003-01-01

    A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

  15. PCR thermocycler

    DOEpatents

    Benett, William J.; Richards, James B.

    2005-05-17

    A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

  16. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    PubMed

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments. PMID:26300291

  17. [Application of the PCR-APLP method to determine ABO genotypes in forensic samples].

    PubMed

    Watanabe, G; Umetsu, K; Osawa, M

    2000-08-01

    We carried out ABO genotyping of forensic samples by the amplified product length polymorphism (APLP) technique. We present two novel systems. One is termed as eight primers system, in which eight allele-specific primers are added into a single PCR reaction. Another is termed as six primers system. In both APLP systems, all alleles were clearly detected using DNA purified from forensic samples. In PCR amplification with direct addition of specimen, ABO genotyping was also possible to blood stain, seminal stain, blood, saliva and urine. Furthermore, ABO genotyping worked only to chimpanzee. This PCR-APLP method should be convepffnt and valuable for forensic practice. PMID:11060991

  18. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  19. Universal Primers for Detection and Sequencing of Hepatitis B Virus Genomes across Genotypes A to G

    PubMed Central

    Chook, Jack Bee; Teo, Woon Li; Ngeow, Yun Fong; Tee, Kok Keng; Ng, Kee Peng

    2015-01-01

    Hepatitis B virus (HBV) has been divided into 10 genotypes, A to J, based on an 8% nucleotide sequence divergence between genotypes. The conventional practice of using a single set of primers to amplify a near-complete HBV genome is hampered by its low analytical sensitivity. The current practice of using overlapping conserved primer sets to amplify a complete HBV genome in a clinical sample is limited by the lack of pan-primers to detect all HBV genotypes. In this study, we designed six highly conserved, overlapping primer sets to cover the complete HBV genome. We based our design on the sequences of 5,154 HBV genomes of genotypes A to I downloaded from the GenBank nucleotide database. These primer sets were tested on 126 plasma samples from Malaysia, containing genotypes A to D and with viral loads ranging from 20 to >79,780,000 IU/ml. The overall success rates for PCR amplification and sequencing were >96% and >94%, respectively. Similarly, there was 100% amplification and sequencing success when the primer sets were tested on an HBV reference panel of genotypes A to G. Thus, we have established primer sets that gave a high analytical sensitivity for PCR-based detection of HBV and a high rate of sequencing success for HBV genomes in most of the viral genotypes, if not all, without prior known sequence data for the particular genotype/genome. PMID:25788548

  20. Universal Primers for Detection and Sequencing of Hepatitis B Virus Genomes across Genotypes A to G.

    PubMed

    Chook, Jack Bee; Teo, Woon Li; Ngeow, Yun Fong; Tee, Kok Keng; Ng, Kee Peng; Mohamed, Rosmawati

    2015-06-01

    Hepatitis B virus (HBV) has been divided into 10 genotypes, A to J, based on an 8% nucleotide sequence divergence between genotypes. The conventional practice of using a single set of primers to amplify a near-complete HBV genome is hampered by its low analytical sensitivity. The current practice of using overlapping conserved primer sets to amplify a complete HBV genome in a clinical sample is limited by the lack of pan-primers to detect all HBV genotypes. In this study, we designed six highly conserved, overlapping primer sets to cover the complete HBV genome. We based our design on the sequences of 5,154 HBV genomes of genotypes A to I downloaded from the GenBank nucleotide database. These primer sets were tested on 126 plasma samples from Malaysia, containing genotypes A to D and with viral loads ranging from 20 to >79,780,000 IU/ml. The overall success rates for PCR amplification and sequencing were >96% and >94%, respectively. Similarly, there was 100% amplification and sequencing success when the primer sets were tested on an HBV reference panel of genotypes A to G. Thus, we have established primer sets that gave a high analytical sensitivity for PCR-based detection of HBV and a high rate of sequencing success for HBV genomes in most of the viral genotypes, if not all, without prior known sequence data for the particular genotype/genome. PMID:25788548

  1. Exogeneous controls to increase negative call veracity in multiplexed, quantitative PCR assays for Phakopsora pachyrhizi

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quantitative PCR (Q-PCR) utilizing specific primer sequences and a fluorogenic, 5’-exonuclease linear hydrolysis probe is well established as a detection and identification method for Phakopsora pachyrhizi and P. meibomiae, two rust pathogens of soybean. Because of the extreme sensitivity of Q-PCR, ...

  2. DEVELOPMENT OF AN IMPROVED PCR-BASED TECHNIQUE FOR DETECTION OF PHYTOPHTHORA CACTORUM IN STRAWBERRY PLANTS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Specific and rapid plant pathogen detection methods can aid in strawberry disease management decisions. PCR-based diagnostics for Phytophthora cactorum and other strawberry pathogens are hindered by PCR inhibitors and lack of species-specific PCR primers. We developed a DNA extraction and purificati...

  3. Evaluating Primers for Profiling Anaerobic Ammonia Oxidizing Bacteria within Freshwater Environments

    PubMed Central

    Sonthiphand, Puntipar; Neufeld, Josh D.

    2013-01-01

    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r

  4. Multiplex PCR for rapid diagnosis of tuberculous meningitis.

    PubMed

    Kusum, Sharma; Aman, Sharma; Pallab, Ray; Kumar, Sharma Shiv; Manish, Modi; Sudesh, Prabhakar; Subhash, Varma; Meera, Sharma

    2011-10-01

    Rapid and specific diagnosis of tubercular meningitis is of paramount importance to decrease morbidity and mortality. The aim of the study was to evaluate multiplex PCR using protein b, MPB 64, and IS6110 primers directed against M. tuberculosis complex for the diagnosis of tuberculous meningitis (TBM). Multiplex PCR was performed on 18 TBM confirmed cases (culture was positive), 92 clinically suspected TBM cases and 100 non-TBM (control group) patients. Multiplex PCR had a sensitivity of 94.4% for confirmed cases and specificity of 100% for confirmed TBM cases. In 92 clinically diagnosed but unconfirmed TBM cases, multiplex PCR was positive in 84.78% cases. The overall sensitivity of microscopy, culture and multiplex cases were 1.81, 16.73, and 86.63% and specificity was 100, 100, and 100% respectively. Multiplex PCR using protein b, MPB 64, and IS6110 primers has a high sensitivity and specificity in diagnosis of tubercular meningitis. PMID:21455603

  5. Epidemiological typing of Stenotrophomonas (Xanthomonas) maltophilia by PCR.

    PubMed Central

    Chatelut, M; Dournes, J L; Chabanon, G; Marty, N

    1995-01-01

    We used two PCR methods for epidemiological typing of Stenotrophomonas (Xanthomonas) maltophilia with either arbitrary primers (random amplified polymorphic DNA) or enterobacterial repetitive intergenic consensus sequences as primers (ERIC-PCR). The analysis was performed with 38 isolates of S. maltophilia, comprising 9 nosocomial isolates from a burn unit, 20 other clinical isolates epidemiologically unrelated, and 9 isolates from one cystic fibrosis patient. Both methods indicated that all of the nosocomial episodes were independent. In contrast, the nine isolates from the cystic fibrosis patient were assigned to very closely related profiles, especially by ERIC-PCR. We conclude that random amplified polymorphic DNA and ERIC-PCR have comparable reproducible and discriminatory powers for epidemiological typing of S. maltophilia, but ERIC-PCR profiles can be more easily evaluated. PMID:7790459

  6. DNA fingerprinting using arbitrary primer technology (APT): a tool or a torment.

    PubMed

    Bassam, B J; Bentley, S

    1994-01-01

    A recent variation of the PCR has allowed DNA fingerprints to be obtained independently of prior sequence information and with unparalleled ease. Several approaches, conveniently grouped under the general term of arbitrary primer technology (APT), include the popular RAPD, DAF, and AP-PCR methods. A great deal of attention has been focussed on these methods and questions have arisen regarding reproducibility, DNA fingerprint resolution, and even the future of the technology itself. Here we discuss these issues and examine some of the unique properties of DNA amplification using a single short arbitrary primer. PMID:7765270

  7. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  8. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  9. Comparison of arbitrarily primed PCR with restriction endonuclease and immunoblot analyses for typing Clostridium difficile isolates.

    PubMed Central

    Tang, Y J; Houston, S T; Gumerlock, P H; Mulligan, M E; Gerding, D N; Johnson, S; Fekety, F R; Silva, J

    1995-01-01

    Arbitrarily primed PCR (AP-PCR) was used to genotype 26 clinical isolates of Clostridium difficile previously analyzed by immunoblotting (IB) and 20 isolates typed by restriction endonuclease analysis (REA) with HindIII. Two levels of differentiation were achieved with the AP-PCR approach by use of two different arbitrary primers. With the 19-mer arbitrary primer T-7 (first level of differentiation), a good correlation was found between IB and AP-PCR typing. Twenty isolates grouped into six IB types were separated into seven major AP-PCR types. These seven AP-PCR groups were further discriminated into 12 subtypes after genotyping with the arbitrary primer PG-05 (second level of differentiation). The remaining six isolates, all of different IB types, showed a unique and distinct DNA banding pattern with both of the arbitrary primers, T-7 and PG-05. Twenty isolates representing 20 REA types from 15 REA groups were resolved into 13 AP-PCR DNA profiles with the arbitrary primer T-7. A good correlation was found at this level of differentiation between the major REA groups, Y and M, and AP-PCR typing. While AP-PCR with this primer failed to differentiate isolates in REA groups J, G, R, and B, AP-PCR with PG-05 resolved these four isolates into four distinct AP-PCR types. In addition, one of three M strains and one of four Y strains displayed a slightly different DNA banding pattern by AP-PCR (with PG-05) from that of the other strains in the group. We conclude that AP-PCR is a rapid and sensitive method which not only complements other typing schemes but also may be a substitute and prove to be especially suited for immediate epidemiological tracking of nosocomial infections due to C. difficile. PMID:8586695

  10. One-step PCR amplification of complete arthropod mitochondrial genomes.

    PubMed

    Hwang, U W; Park, C J; Yong, T S; Kim, W

    2001-06-01

    A new PCR primer set which enables one-step amplification of complete arthropod mitochondrial genomes was designed from two conserved 16S rDNA regions for the long PCR technique. For this purpose, partial 16S rDNAs amplified with universal primers 16SA and 16SB were newly sequenced from six representative arthropods: Armadillidium vulgare and Macrobrachium nipponense (Crustacea), Anopheles sinensis (Insecta), Lithobius forficatus and Megaphyllum sp. (Myriapoda), and Limulus polyphemus (Chelicerata). The genomic locations of two new primers, HPK16Saa and HPK16Sbb, correspond to positions 13314-13345 and 12951-12984, respectively, in the Drosophila yakuba mitochondrial genome. The usefulness of the primer set was experimentally examined and confirmed with five of the representative arthropods, except for A. vulgare, which has a linearized mitochondrial genome. With this set, therefore, we could easily and rapidly amplify complete mitochondrial genomes with small amounts of arthropod DNA. Although the primers suggested here were examined only with arthropod groups, a possibility of successful application to other invertebrates is very high, since the high degree of sequence conservation is shown on the primer sites in other invertebrates. Thus, this primer set can serve various research fields, such as molecular evolution, population genetics, and molecular phylogenetics based on DNA sequences, RFLP, and gene rearrangement of mitochondrial genomes in arthropods and other invertebrates. PMID:11399145