Charlton, Bruce G
2008-01-01
In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and
James E. Watson, Jr.: Named to the Health Physics Society
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strom, Daniel J.; Stansbury, Paul S.
At its 2010 Annual Meeting, the Health Physics Society named James E. Watson, Jr. to its Honor Roll of distinguished members. This citation summarizes Professor Jim Watson's life and professional career at the University of North Carolina at Chapel Hill, where he led the Radiological Hygiene program in the School of Public Health for nearly 3 decades. He was President of the Health Physics Society during the 1985-1986 term. He did pioneering work in radiation dose reconstruction for epidemiology as part of the U.S. Department of Energy Health and Mortality Studies.
Discovering Watson's Crick in High School Chemistry.
ERIC Educational Resources Information Center
Whitman, Mark
1984-01-01
High school chemistry students begin the school year by reading and studying "The Double Helix" by James B. Watson. Rationale, objectives, and instructional strategies for this assignment are discussed. Sample discussion questions based on the book are included. (JN)
James Watson's most inconvenient truth: race realism and the moralistic fallacy.
Rushton, J Philippe; Jensen, Arthur R
2008-11-01
Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.
James Craig Watson (1838-1880)
NASA Astrophysics Data System (ADS)
Broughton, Peter
1996-04-01
Canadians feel a bittersweet pride when young people leave to make their fame and fortune in the United States. The life of the eminent nineteenth century astronomer, J. C. Watson, is another example from history that our brightest and best emigrate when educational and career opportunities are lacking at home.
Data Discovery with IBM Watson
NASA Astrophysics Data System (ADS)
Fessler, J.
2016-12-01
BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies
76 FR 58817 - National Boating Safety Advisory Council; Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-22
... and RADM James Watson, USCG Director of Prevention Policy; (2) Receipt and discussion of the following... October 3, 2011. Dated: September 16, 2011. James A. Watson, Rear Admiral, U.S. Coast Guard, Director of...
Portrait of a discovery. Watson, Crick, and the double helix.
de Chadarevian, Soraya
2003-03-01
This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.
James Cameron discusses record dive and science concerns
NASA Astrophysics Data System (ADS)
Showstack, Randy; Balcerak, Ernie
2012-12-01
James Cameron, the explorer and filmmaker, led a 4 December panel at the AGU Fall Meeting in San Francisco to discuss his daring dive on 26 March to the bottom of the ocean in a one-person vertical "torpedo" submarine, the Deepsea Challenger, and to present some initial science findings from expedition samples and data. The dive touched the bottom of the Challenger Deep, a valley in the floor of the nearly 11-kilometer-deep Mariana Trench in the western Pacific Ocean. The vessel landed close to the same depth and at a location similar to where Don Walsh and Jacques Piccard descended in the Trieste bathyscaphe on 23 January 1960 at a then record-setting depth of 10,911 meters.
Weighted Watson-Crick automata
NASA Astrophysics Data System (ADS)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
2014-07-01
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.
NASA Astrophysics Data System (ADS)
Sheehan, William
1996-05-01
The first director of the Washburn Observatory, Watson began his career at the University of Michigan, where he discovered more than a score of asteroids and planned (but did not live to carry out) the first search for a trans-Neptunian planet. He became a strong supporter of Le Verrier's hypothesis that a planet closer to the Sun than Mercury (Vulcan) was causing the anomalous advance of 38" of arc per century of Mercury's perihelion, and mounted a special search for Vulcan at the July 29, 1878 total eclipse, at Separation, Wyoming, recording two strange reddish stars near the Sun which he assumed were intra-Mercurial bodies. With the exception of Lewis Swift at Denver, Colorado, no one else confirmed his observations, and they were sharply criticized by Clinton College (New York) astronomer C. H. F. Peters. Nevertheless, Watson remained absolutely convinced of what he had seen, and his move from Ann Arbor to Madison in 1879 was partly motivated by the prospects of obtaining better instruments with which to further his search for Vulcan, which became the obsession of his later years. He was in the process of constructing an underground solar observatory from which he hoped to see stars near the Sun in broad daylight when he died, unexpectedly, in 1880. Though it is now known that Vulcan does not exist, Watson's observations at the July 1878 eclipse remain problematic; it is probable that he observed at least one and possibly two pygmy comets in the neighborhood of the Sun.
Closure properties of Watson-Crick grammars
NASA Astrophysics Data System (ADS)
Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh
2015-12-01
In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.
ERIC Educational Resources Information Center
Sternod, Latisha; French, Brian
2016-01-01
The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…
Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.
Digdon, Nancy; Powell, Russell A; Harris, Ben
2014-11-01
In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.
NASA Discusses Recent Testing of the James Webb Space Telescope
2018-01-10
Members of the media were invited to NASA’s Johnson Space Center in Houston on Jan. 10, to hear about the results of recent cryogenic vacuum tests on the James Webb Space Telescope, and the next steps on the observatory’s path to space. Webb was tested as a complete optical system in Chamber A at Johnson, which mimics the space environment the telescope will experience during its mission. Built in 1965 to conduct thermal-vacuum testing on the Apollo command and service modules, Chamber A is the largest structure of its kind in the world and is a listed National Historic Landmark. The James Webb Space Telescope is the world’s premier infrared space observatory of the next decade. Webb will help to solve mysteries of our solar system, look to distant worlds orbiting other stars, and probe the mysterious structures and origins of our universe and our place in it. Webb is an international program led by NASA with its partners, the ESA (European Space Agency) and the Canadian Space Agency.
Elevation, west portal. Sign on portal reads Watson Mill Bridge, ...
Elevation, west portal. Sign on portal reads Watson Mill Bridge, est. 1885. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA
Making IBM's Computer, Watson, Human
ERIC Educational Resources Information Center
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…
Charpa, Ulrich
2008-01-01
This article opens with general and historical remarks on philosophy of science's problems with the concept of discovery. Then, drawing upon simple examples of Watson's and Crick's non-philosophical usage, I characterize phrases of the type "x discovers y" semantically. It will subsequently be shown how widespread philosophical discussion on discovery violates the semantic constraints of phrases of the type "x discovers y." Then I provide a philosophical reconstruction of "x discovers y" that is in keeping with the "folk" notion of discovery. The philosophical ingredients of this approach are taken from a certain aspect of action theory and from epistemological reliabilism. The approach draws upon the concept of superior action and connects this concept to progressive research. In contrast to normal actions, superior actions are primarily explained by competencies. This perspective includes reminders of what some nineteenth-century philosopher-scientists had advocated as a competence-oriented view on scientific research. Finally, this approach is applied to the case of Watson's and Crick's discovery.
How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.
Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw
2014-04-02
A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.
John B. Watson's Legacy: Learning and Environment.
ERIC Educational Resources Information Center
Horowitz, Frances Degen
1992-01-01
Evaluates John B. Watson's contributions to developmental psychology. Watson's insistence on objective methodology in psychology retains its influence, but his extreme environmentalism has been rejected. His concern with the principles of learning is reflected in the work of Hull and Skinner. (BC)
The multiple personalities of Watson and Crick strands.
Cartwright, Reed A; Graur, Dan
2011-02-08
In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.
The multiple personalities of Watson and Crick strands
2011-01-01
Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin. PMID:21303550
Making IBM's Computer, Watson, Human
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, Jeopardy, to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered and rejected. The viewpoint of the essay is that of teleological behaviorism. Mental states are defined as temporally extended patterns of overt behavior. From this viewpoint (although Watson does not currently have them), essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer. Most crucially, a computer may possess self-control and may act altruistically. However, the computer's appearance, its ability to make specific movements, its possession of particular internal structures (e.g., whether those structures are organic or inorganic), and the presence of any nonmaterial “self,” are all incidental to its humanity. PMID:22942530
Making IBM's Computer, Watson, Human.
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, Jeopardy, to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered and rejected. The viewpoint of the essay is that of teleological behaviorism. Mental states are defined as temporally extended patterns of overt behavior. From this viewpoint (although Watson does not currently have them), essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer. Most crucially, a computer may possess self-control and may act altruistically. However, the computer's appearance, its ability to make specific movements, its possession of particular internal structures (e.g., whether those structures are organic or inorganic), and the presence of any nonmaterial "self," are all incidental to its humanity.
Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.
Cubero, Elena; Luque, F Javier; Orozco, Modesto
2006-02-01
A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2006-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814
Speculation on Curriculum from the Perspective of William James.
ERIC Educational Resources Information Center
Shubert, William H; Zissis, Georgiana
1988-01-01
This article discusses the implications for curriculum theory, research, and practice of William James' thought. Also considered is the question of what curriculum theory and research might be like if James had garnered greater influence than Thorndike. (IAH)
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
The Joint Chiefs of Staff and National Policy Volume III 1950-1951, The Korean War: Part One,
1998-01-01
National Policy Volume III 1950-1951 The Korean War Part One James F . Schnabel Robert J. Watson Office of Joint History Office of the Chairman...transferred to other du- ties, Mr. James F . Schnabel assumed responsibility for the volume and planned, Foreword researched, and wrote the...into publishable form. JAMES F . SCHNABEL ROBERT J.WATSON vm Contents 1. Korea in US Policy, 1945-1950 1 The Partition of Korea 1 Establishment
Replication infidelity via a mismatch with Watson-Crick geometry.
Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A
2011-02-01
In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.
ERIC Educational Resources Information Center
Detterman, Douglas K.
2011-01-01
Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…
L. Young James Young Postdoctoral Researcher-Chemistry James.Young@nrel.gov | 303-275-4456 Orcid ID http://orcid.org/0000-0001-7291-0079 Dr. James L. Young is a Postdoctoral Researcher at the National -splitting photocathode," Nature Energy (2017). View all NREL publications for James L. Young.
NASA Astrophysics Data System (ADS)
Jang, Sa-Han
Galton-Watson branching processes of relevance to human population dynamics are the subject of this thesis. We begin with an historical survey of the invention of the invention of this model in the middle of the 19th century, for the purpose of modelling the extinction of unusual surnames in France and Britain. We then review the principal developments and refinements of this model, and their applications to a wide variety of problems in biology and physics. Next, we discuss in detail the case where the probability generating function for a Galton-Watson branching process is a geometric series, which can be summed in closed form to yield a fractional linear generating function that can be iterated indefinitely in closed form. We then describe the matrix method of Keyfitz and Tyree, and use it to determine how large a matrix must be chosen to model accurately a Galton-Watson branching process for a very large number of generations, of the order of hundreds or even thousands. Finally, we show that any attempt to explain the recent evidence for the existence thousands of generations ago of a 'mitochondrial Eve' and a 'Y-chromosomal Adam' in terms of a the standard Galton-Watson branching process, or indeed any statistical model that assumes equality of probabilities of passing one's genes to one's descendents in later generations, is unlikely to be successful. We explain that such models take no account of the advantages that the descendents of the most successful individuals in earlier generations enjoy over their contemporaries, which must play a key role in human evolution.
From theory to practice: caring science according to Watson and Brewer.
Clarke, Pamela N; Watson, Jean; Brewer, Barbara B
2009-10-01
Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.
Oncologists partner with Watson on genomics.
2015-08-01
A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.
John B. Watson's Alleged Sex Research: An Appraisal of the Evidence
ERIC Educational Resources Information Center
Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.
2007-01-01
In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…
IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics
2016-01-01
Background We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. Objective To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. Methods The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Results Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence
IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.
Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita
2016-10-11
We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix
Some Lady! A Conversation with Dorothy Watson, Outstanding Educator in the Language Arts.
ERIC Educational Resources Information Center
Bishop, Rudine Sims
2002-01-01
Presents a conversation with Dorothy Watson, the 2002 Outstanding Educator in the Language Arts recipient. Hopes that this profile will provide insight into Dorothy Watson and her intellectual foundations, her humaneness, and her passion for teaching and learning. (SG)
[From humanism to nihilism: dialectics on Jean Watson's caring theory].
Krol, Pawel J; Lavoie, Mireille
2015-09-01
nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.
78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-03-20
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-10-25
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-11-13
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-06-04
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
The James Bay Project: Reaction or Action?
ERIC Educational Resources Information Center
Mackwood, Gae
1991-01-01
Discusses the plan to restructure northern Quebec's landscape through the James Bay hydroelectric project. Suggests that the project offers opportunities to study development versus preservation, federal versus provincial powers, and the conflict between business and Native communities. Explores the need to teach students to care about social…
James Galway: Music as a Way of Life.
ERIC Educational Resources Information Center
Spaeth, Jeanne
1999-01-01
Presents an interview with the flutist, James Galway, in which he discusses issues such as the musical culture of Ireland, his technical mastery as a musician, and the importance of music education in the lives of young people. (CMK)
Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.
Doyle-Lindrud, Susan
2015-02-01
IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.
Dust Cloud Models: Sensitivity of Calculated Transmittances to Variations in Input Parameters
1981-06-01
Artillery School ATTN: DELEW-M-STO (Dr. Steven Kovel) ATTN: ATSF- CF -R (CPT James M. Watson) White Sands Missile Range, NM 88002 Fort Sill, OK 73503 Office...STEWS-PT-AL (Laurel B. Saunders) ATTN: ATSF- CF -R White Sands Missile Range, RM 88002 Fort Sill, OK 73503 Commander Commandant US Army RAD Coordinator...Army Field Artillery School ATTN: OELEW-M-STO (Dr. Steven Kovel) ATTN: ATSF- CF -R (CPT James M. Watson) White Sands Missile Range, NM 88002 Fort Sill, OK
Validating the Watson Glaser Critical Thinking Appraisal
ERIC Educational Resources Information Center
Hassan, Karma El; Madhum, Ghida
2007-01-01
This study validated the Watson Glaser Critical Thinking Appraisal (WGCTA) on a sample of 273 private university students in Lebanon. For that purpose, evidence for construct validation was investigated through identifying the test's factor structure and subscale total correlations, in addition to differences in scores by gender, different levels,…
[Nicolas Dobo and Pierre Jame about the army medical general Lucian Jame].
Dobo, N; Jame, P
1996-01-01
Lucien Jame was born October the 20th 1891 at Gourdon (Lot). State Police Officer's son, he studied in Lyon at the Military Health School. Called up August the 6th 1914, he shined among many fights and wore a lot of medals. After the armistice he defended his thesis upon "Venereal diseases prophylaxis study". March the 9th 1921, medical Officer in South Algeria, he published some original articles regarding to leprosis, tuberculosis and malaria. After a competitive examination in France, Lucien Jame became a Medical Commanding Officer of Military Health Service in Toulouse where Nicolas Dobo was at his disposal. August the 6th 1943, in the same rank in Algier then in Rabat, Lucien Jame reached the top of his career as Chief Executive of Military Health Service. He planed First French army medical operations through Italy, France and Germany battles. "Grand-Officier de la Légion d'honneur", the Army Medical General Lucien Jame retired but kept on with works dedicated to hygiene and preventive medicine till he died, June the 16th, 1969.
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Robert Green's "James IV:" Love, Power, and Justice.
ERIC Educational Resources Information Center
Hayashi, Tetsumaro
1984-01-01
How events of the late medieval period of Great Britain are depicted in Robert Greene's play, "The Scottish History of James the Fourth," is discussed. The play reflects the spirit of a time in which some began to claim that women were the intellectual equals of men. (RM)
ERIC Educational Resources Information Center
Cooper, Wesley
2003-01-01
James's moral theory, primarily as set out in "The Moral Philosopher and the Moral Life" (in his "The Will To Believe" (1897)), is presented here as having a two-level structure, an empirical or historical level where progress toward greater moral inclusiveness is central, and a metaphysical or end-of-history level--James's "kingdom of…
Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D
2004-09-28
Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.
Watson for Genomics: Moving Personalized Medicine Forward.
Rhrissorrakrai, Kahn; Koyama, Takahiko; Parida, Laxmi
2016-08-01
The confluence of genomic technologies and cognitive computing has brought us to the doorstep of widespread usage of personalized medicine. Cognitive systems, such as Watson for Genomics (WG), integrate massive amounts of new omic data with the current body of knowledge to assist physicians in analyzing and acting on patient's genomic profiles. Copyright © 2016 Elsevier Inc. All rights reserved.
20. VIEW OF WATSON STILHMAN DISMOUNTING WHEEL PRESS. 600 tons. ...
20. VIEW OF WATSON STILHMAN DISMOUNTING WHEEL PRESS. 600 tons. Gary Stich, operator. - Juniata Shops, Erecting Shop & Machine Shop, East of Fourth Avenue, between Fourth & Fifth Streets, Altoona, Blair County, PA
Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian
2011-12-01
We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.
Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.
Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika
2017-07-01
The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.
IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.
Chen, Ying; Elenee Argentinis, J D; Weber, Griff
2016-04-01
Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Toni Wolff-James Kirsch correspondence.
Kirsch, Thomas B
2003-09-01
This paper draws on the letters between Toni Wolff and James Kirsch from 1929-1933 and from 1949-1953 to highlight some aspects of Toni Wolff's relationship with her superviser and former analysand, James Kirsch. Her personality, her approach to her work as analyst, and her relationship with Jung and with colleagues are illustrated with selected quotes from the correspondence.
Re-Presenting James Britton: A Symposium.
ERIC Educational Resources Information Center
Tirrell, Mary Kay; And Others
1990-01-01
Presents revised versions of four symposium papers examining the work of linguist, teacher, and educator of teachers James Britton. Includes "James Britton: An Impressionistic Sketch" (Mary Kay Tirrell); "Collaborating with Jimmy Britton" (Gordon M. Pradl); "Rejoicing in the Margins" (John Warnock); and "A…
Annual Quality Assurance Conference Files by Nicola Watson and Rui Li
26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li
A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.
Sawada, Tomohisa; Fujita, Makoto
2010-05-26
Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.
Maniac Talk - Dr. James Garvin
2014-05-28
James Garvin Maniac Lecture, 28 May 2014 Dr. James Garvin, Chief Scientist, NASA Goddard Space Flight Center, presented a Maniac Talk entitled "From Brownian Motion to Mars, by way of hockey on the rocks." Jim shared how his passion for rocks and landscapes drove him to promote new remote sensing approaches for measuring their topologies and led to founding of the Mars Science Laboratory and its Curiosity Rover.
Watson: A new link in the IIE iron chain
NASA Technical Reports Server (NTRS)
Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence
1994-01-01
Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Atmospheric Science Data Center
2013-04-17
article title: Hudson Bay and James Bay, Canada ... which scatters more light in the backward direction. This example illustrates how multi-angle viewing can distinguish physical structures ... MD. The MISR data were obtained from the NASA Langley Research Center Atmospheric Science Data Center in Hampton, VA. Image ...
Yusupov, Marat; Yusupova, Gulnara
2014-01-01
The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524
NASA Astrophysics Data System (ADS)
Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.
2017-12-01
Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as
Poor and Rich in James: A Relevance Theory Approach to James's Use of the Old Testament
ERIC Educational Resources Information Center
Morales, Nelson R.
2015-01-01
The epistle of James was for years a forgotten book in academic circles. In recent decades, however, a renewed focus on early Judaism has generated interest in looking at James with new eyes. Poverty and wealth in the epistle continues to be a point of interest. Other topics, however, are still to be explored. One of these topics is the rhetorical…
Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes
Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.
2015-01-01
Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137
Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.
Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M
2015-03-19
Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker
2001-04-01
Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.
Space perception and William James's metaphysical presuppositions.
Farrell, Martin J
2011-05-01
William James's overtly philosophical work may be more continuous with his psychological work than is sometimes thought. His Essays in Radical Empiricism can be understood as an explicit statement of the absolute presupposition that formed the basis of Jamesian psychology: that direct experience is primary and has to be taken at face value. An examination of James's theory of space perception suggests that, even in his early work, he presupposed the primacy of direct experience, and that later changes in his account of space perception can be understood as making his view more consistent with this presupposition. In his earlier view of space perception, James argued that sensations were directly experienced as spatial, though he accepted that spatial relations between sensations may be constructed by higher order thought. In his later view, however, James argued that spatial relations were just as directly experienced as sensations. The work of T. H. Green may have prompted James to recognize the full consequence of his ideas and to realize that taking experience at face value required that spatial relations be thought of as intrinsic to experience rather than the result of intellectual construction.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Observing Exoplanets with the James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Clampin Mark
2011-01-01
The search for exoplanets and characterization of their properties has seen increasing success over the last few years. In excess of 500 exoplanets are known and Kepler has approx. 1000 additional candidates. Recently, progress has been made in direct imaging planets, both from the ground and in space. This presentation will discuss the history and current state of technology used for such discoveries, and highlight the new capabilities that will be enabled by the James Webb Space Telescope.
Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.
Müller, Andreas; Frey, Jann A; Leutwyler, Samuel
2005-06-16
The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 <-- S0 vibronic spectra of 2PY.U, 2PY.3MU, 2PY.1MU, and 2PY.T were measured using UV laser resonant two-photon ionization (R2PI). The spectra of the Watson-Crick and wobble isomers of 2PY.1MU were separated using UV-UV spectral hole-burning. We identify the different isomers by combining three different diagnostic tools: (1) Selective methylation of the uracil N3-H group, which allows formation of the sugar-edge isomer only, and methylation of the N1-H group, which leads to formation of the Watson-Crick and wobble isomers. (2) The experimental S1 <-- S0 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give
The 14th Annual James L. Waters Symposium at Pittcon: Raman Spectroscopy
ERIC Educational Resources Information Center
Gardner, Charles W.
2007-01-01
Raman Spectroscopy was the main topic of the 14th Annual James L. Waters Symposium, which was held in March 2003 at Pittcon. The development of the enabling technologies that have made Raman spectroscopy a routine analysis tool in many laboratories worldwide is discussed.
The Darwinian Center to the Vision of William James.
ERIC Educational Resources Information Center
Bredo, Eric
The essence of William James's vision can sometimes be hard to discover due to emotional volatility and exploratory impulsiveness. On the other hand, beneath James's apparent inconsistency was a constancy of purpose that can be easily underestimated. This paper argues that the center of James's vision lay in an interpretation of Darwinism. By…
Re-Birthing the Monstrous: James Whale's (Mis)Reading of Mary Shelley's "Frankenstein."
ERIC Educational Resources Information Center
Picart, Caroline Joan S.
1998-01-01
Contributes to scholarship on film and feminism by showing how James Whale's film attempts to excise or severely delimit the disturbing critique of the Romantic politics of gender in Mary Shelley's novel "Frankenstein." Discusses parthenogenesis, showing how the novel critiques the Romantic rhetorical reconstructions of masculine…
Henry James on the Art of Acting.
ERIC Educational Resources Information Center
Thompson, David W.
Henry James, the nineteenth-century American novelist, also served on occasion as a theatre critic. Between 1875 and 1890 he reviewed several productions in Boston, New York, London, and Paris for "Atlantic Monthly" and other periodicals. The reviews are of interest because of James' high standards regarding acting and his often…
Watson-Glaser Critical Thinking Appraisal, Form-S for Education Majors
ERIC Educational Resources Information Center
Gadzella, Bernadette M.; Stacks, James; Stephens, Rebecca C.; Masten, William G.
2005-01-01
The purpose of this study was to investigate whether the Watson-Glaser Critical Thinking Appraisal-Form S was a reliable and valid instrument to measure critical thinking for students pursuing a teacher career. The participants were 137 students enrolled in Educational Psychology. The data showed that the alpha for the total WGTA-FS was 0.76 and…
'Filling Bellies and Brains': The Educational and Political Thought of Frederick James Gould.
ERIC Educational Resources Information Center
Manton, Kevin
2001-01-01
Focuses on the pioneering efforts concerning moral education and educational reform by British educator Frederick James Gould. Discusses the application of his socialistic ideas to further three causes: (1) socialism and secularism; (2) positivism; and (3) a form of middle class radicalism. (KDR)
Serendipity in the Theater: Maude Adams as James M. Barrie's American Muse.
ERIC Educational Resources Information Center
Diaz de Chumaceiro, Cora L.
2003-01-01
This essay discusses how Maude Adams influenced James M. Barrie's creative process and became his inspiration. Set change theory is underscored as a cognitive explanation for Barrie's illumination. The psychoanalytic theory of transference is proposed as an underlying mechanism for facilitating the change of mental set during the incubation stage.…
Hagemann, Rudolf
2007-01-01
At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B
2018-01-01
Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P < .001). Despite the high correlation, the Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
Applications of the Galton Watson process to human DNA evolution and demography
NASA Astrophysics Data System (ADS)
Neves, Armando G. M.; Moreira, Carlos H. C.
2006-08-01
We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton-Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman Nbar is constrained to a small range depending on the probability p that a child is a female. Assuming that the value p≈0.488 valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable probability is 2.0492
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
ERIC Educational Resources Information Center
Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.
2010-01-01
The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…
The Revolving Cage: The Views, Values, and Visions of James Harvey Robinson.
ERIC Educational Resources Information Center
Binford, Paul E.
This paper profiles James Harvey Robinson, an important scholar of history and social issues. The paper presents a biographical sketch of Harvey's early life and education and discusses his teaching and scholarly work, including his co-founding (with Charles A. Beard) of the New School for Social Research (New York) in 1919, noting that Robinson…
NASA Astrophysics Data System (ADS)
Davenhall, Clive
2012-03-01
The year 2010 marked the three hundredth anniversary of the birth of the astronomer, author and lecturer James Ferguson (1710-1776). Subsequently I visited the site of the churchyard where Ferguson is buried. He is mentioned in a plaque on the site and I thought that the details might be of interest.
Bende, Attila; Muntean, Cristina M
2014-03-01
The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.
Charlton, Bruce G
2008-01-01
Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.
Finding Little Albert: A Journey to John B. Watson's Infant Laboratory
ERIC Educational Resources Information Center
Beck, Hall P.; Levinson, Sharman; Irons, Gary
2009-01-01
In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Breo, D.L.
The best-selling The Double Helix, published 20 years ago, describes the events that had led to the discovery by James Watson and Francis Crick in 1953 of the structure of deoxyribonucleic acid (DNA), the building block of genes and heredity. At the time, the 25-year-old Watson was widely perceived as arrogant, brash, gawky, and intense. Subsequent events did little to change that impression. Today, at age 61, James Dewey Watson is still an angry young man. As director since 1968 of the Cold Spring Harbor Laboratory on Long Island, NY, and as director since 1988 of the National Center formore » Human Genome Research at the National Institutes of Health (NIH), he is coordinating the attempt to decipher biology's deepest secrets: the mapping, sequencing, and defining of the estimated 50,000 to 100,000 human genes arranged over the 23 pairs of chromosomes. The results, expected by early next century, may reveal the chemical script of life and help solve the riddles of inherited genetic diseases and certain cancers.« less
William James, Nitrous Oxide, and the Anaesthetic Revelation.
Moon, Jane S; Kuza, Catherine M; Desai, Manisha S
2018-01-01
William James greatly influenced the fields of psychology, philosophy, and religion during the late 19 th and early 20 th centuries. This was the era of Modernism, a time when many writers rejected the certainty of Enlightenment ideals. Positivism, which rose to prominence in the early 19th century, had emphasized physical phenomena, empirical evidence, and the scientific method. Darwin's On the Origin of Species (1859), with its theory of natural selection, provided an explanation for the evolution of species apart from a divine Creator. Within this context, William James served as a "mediator between scientific agnosticism and the religious view of the world." James' own experience inhaling nitrous oxide played an important role in shaping his views. For James, the use of nitrous oxide served a key role in elucidating some of his most central ideas: 1) the value of religion, and the emphasis on mysticism and revelation (as opposed to theology and doctrine) as religion's foundation; 2) the universe as pluralistic (as opposed to absolutist, constant, eternal), driven by chance, experience, and change. Copyright © 2017 Elsevier Inc. All rights reserved.
A Scientific Revolution: The Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2011-01-01
Astronomy is going through a scientific revolution, responding to a Rood of data from the Hubble Space Telescope, other space missions, and large telescopes on the ground. In this talk, Dr. Gardner will discuss some of the most important astronomical discoveries of the last 10 years, and the role that space telescopes have played in those discoveries. The next decade looks equally bright with the newly refurbished Hubble and the promise of its successor, the James Webb Space Telescope.
Famous optician: James Clerk Maxwell
NASA Astrophysics Data System (ADS)
Haidar, Riad
2018-04-01
Mainly known for his unifying theory of electricity, magnetism and induction, James Clerk Maxwell also concluded that light was an electromagnetic wave, and was responsible for the first true colour photograph.
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
77 FR 58773 - Drawbridge Operation Regulations; James River, Newport News, VA
Federal Register 2010, 2011, 2012, 2013, 2014
2012-09-24
... Operation Regulations; James River, Newport News, VA AGENCY: Coast Guard, DHS. ACTION: Notice of temporary... schedule that governs the US 17/258 Bridge across the James River, mile 5.0, at Newport News, VA. The... 17/258 Bridge over the James River, mile 5.0, at Newport News, VA opens on signal as required by 33...
1787 and 1776: Patrick Henry, James Madison, and the Revolutionary Legitimacy of the Constitution.
ERIC Educational Resources Information Center
Banning, Lance
1988-01-01
Discusses Patrick Henry's and James Madison's opinions on how the U.S. Constitution should be constructed. Describes how Henry introduced a set of substantive objections which were shared by Antifederalists throughout the country and persuaded many Revolutionaries that the Constitution was essentially at odds with the principles of 1776. (BSR)
Optical Modeling of the Alignment and Test of the NASA James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Howard, Joseph M.; Hayden, Bill; Keski-Kuha, Ritva; Feinberg, Lee
2007-01-01
Optical modeling challenges of the ground alignment plan and optical test and verification of the NASA James Webb Space Telescope are discussed. Issues such as back-out of the gravity sag of light-weighted mirrors, as well as the use of a sparse-aperture auto-collimating flat system are discussed. A walk-through of the interferometer based alignment procedure is summarized, and sensitivities from the sparse aperture wavefront test are included as examples.'
Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert
2018-02-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.
Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius
2018-07-01
A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that
Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York
IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti
Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration
NASA Technical Reports Server (NTRS)
Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell
2018-01-01
Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.
The discovery of the structure of DNA
NASA Astrophysics Data System (ADS)
Squires, G. L.
2003-04-01
On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.
Caplan, R M
1982-06-01
The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.
Status of the James Webb Space Telescope Observatory
NASA Technical Reports Server (NTRS)
Clampin, Mark
2013-01-01
The James Webb Space Telescope (JWST) is the largest cryogenic, space telescope ever built, and will address a broad range of scientific goals from first light in the universe and re-ionization, to characterization of the atmospheres of extrasolar planets. Recently, significant progress has been made in the construction of the observatory with the completion of all 21 flight mirrors that comprise the telescope's optical chain, and the start of flight instrument deliveries to the Goddard Space Flight Center. In this paper we discuss the design of the observatory, and focus on the recent milestone achievements in each of the major observatory sub-systems.
James Madison High School. A Curriculum for American Students.
ERIC Educational Resources Information Center
Bennett, William J.
This document presents the Secretary of Education's personal concept of a sound secondary school core curriculum. It is called "James Madison High School" in honor of President James Madison and his strong views that the people, in order to govern properly, must arm themselves with knowledge. The theoretical curriculum consists of four…
1. Historic American Buildings Survey James F. and Jean B. ...
1. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 EXTERIOR FROM THE SOUTHEAST Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA
2. Historic American Buildings Survey James F. and Jean B. ...
2. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 EXTERIOR FROM THE SOUTHWEST Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Aerial photographic water color variations from pollution in the James River
NASA Technical Reports Server (NTRS)
Bressette, W. E.
1978-01-01
A photographic flight was made over the James River on May 17, 1977. The data show that, in general, James River water has very high sunlight reflectance. In the Bailey Bay area this reflectance is drastically reduced. Also shown is a technique for normalizing off-axis variations in radiance film exposure from camera falloff and uneven sunlight conditions to the nadir value. After data normalization, a spectral analysis is performed that identifies Bailey Creek water in James River water. The spectral results when compared with laboratory spectrometer data indicate that reflectance from James River water is dominated by suspended matter, while the substance most likely responsible for reduced reflectance in Bailey Creek water is dissolved organic carbon.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
ERIC Educational Resources Information Center
White, John
2004-01-01
In "EPAT", vol. 36, no. 1, 2004, James Muir takes the author and fellow philosophers of education to task for their ignorance of the history of philosophy of education. "[T]oo many currently influential educationists, Professor White in particular, are literally unaware that educational philosophy has a history more than three hundred years in…
ERIC Educational Resources Information Center
Lincoln, Kenneth
2005-01-01
In the early 1970s James Welch enters American literature as an Indian postmodernist, a fractured classicist of the West, drawing fragments from both sides of the Buckskin Curtain. Reading the likes of Cesar Vallejo and early modernists from Ezra Pound to Theodore Roethke and decreationists such as Ray Carver (through Richard Hugo's tutelage at…
The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.
ERIC Educational Resources Information Center
Hicks, R. E.; Southey, G. N.
1990-01-01
The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)
3. Historic American Buildings Survey James F. and Jean B. ...
3. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 ORIGINAL MANTELPIECE AND WINDOW SHUTTERS, FIRST FLOOR Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA
ERIC Educational Resources Information Center
Goldstein, Evan R., Comp.
2008-01-01
Reading through news-media clippings about James Wood, one might reasonably conclude that "pre-eminent critic" is his official job title. In fact, Wood is a staff writer for "The New Yorker" and a professor of the practice of literary criticism at Harvard University. But at a time when there is much hand-wringing about the death of the…
4. Historic American Buildings Survey James F. and Jean B. ...
4. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 LATE 19th-CENTURY MANTELPIECE IN FIRST FLOOR ROOM Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA
A Scientific Revolution: the Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2011-01-01
Astronomy is going through a scientific revolution, responding to a flood of data from the Hubble Space Telescope, other space missions, and large telescopes on the ground. In this talk, I will discuss some of the most important astronomical discoveries of the last 10 years, and the role that space telescopes have played in those discoveries. The next decade looks equally bright with the newly refurbished Hubble and the promise of its successor, the James Webb Space Telescope. I will describe how Hubble was upgraded and how and why we are building Webb.
A Scientific Revolution: The Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan
2011-01-01
Astronomy is going through a scientific revolution, responding to a flood of data from the Hubble Space Telescope, other space missions, and large telescopes on the ground. In this talk, I will discuss some of the most important astronomical discoveries of the last 10 years, and the role that space telescopes have played in those discoveries. The next decade looks equally bright with the newly refurbished Hubble and the promise of its successor, the James Webb Space Telescope. I will describe how Hubble was upgraded and how and why we are building Webb.
A Scientific Revolution: The Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2009-01-01
Astronomy is going through a scientific revolution, responding to a flood of data from the Hubble Space Telescope, other space missions, and large telescopes on the ground. In this talk, I will discuss the top 10 astronomical discoveries of the last 10 years, and the role that space telescopes have played in those discoveries. The next decade looks equally bright with the newly refurbished Hubble and the promise of its successor, the James Webb Space Telescope. I will describe how Hubble was upgraded and how and why we are building Webb.
A Scientific Revolution: the Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2012-01-01
Astronomy is going through a scientific revolution, responding to a flood of data from the Hubble Space Telescope, other space missions, and large telescopes on the ground. In this talk, I will discuss some of the most important astronomical discoveries of the last IO years, and the role that space telescopes have played in those discoveries. The next decade looks equally bright with the newly refurbished Hubble and the promise of its successor, the James Webb Space Telescope. I will describe how Hubble was upgraded and how and why we are building Webb.
Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering
NASA Astrophysics Data System (ADS)
Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.
2017-06-01
The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson
1992-01-01
Norman .................................... University of California, San Diego, CA Dan R . Olsen, Jr ........................................ Brigham...Peter G. Poison .............................................. University of Colorado, Boulder, CO James R . Rhyne ................. IBM T J Watson...and artificial intelligence, among which are: * reasoning about concurrent systems, including program verification ( Barringer , 1985), operating
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the
Flood Plain Information, Mill, Watson, and Lahaska Creeks, Bucks County, Pennsylvania.
1975-05-01
AD-AIOI 592 ARENGINEER DISTRICT PHI LADELPHIA P A F/6 8/8 T7LOOD PLAIN INFORMATION, MIL , WATSON, AND LAI4ASKA CREEKS, SUCK-’ETCIU) UNCLASSIFIED...will be iu LblckW V’ A PREPARED FOR THE BUCKS COUNTY PLANNING COMMISSION p BY CORPS OF ENGINEERS, U.S. ARMY PHILADELPHIA DISTRICT MAY 975 8 1 7 20 055...No. 4655 at Langhorne , Pennsylvania) ..... ................. 8 3 Peak Flows for the Intermediate Regional and Standard Project Floods
William James and the Heidelberg fiasco.
Gundlach, Horst
2018-02-01
Urged on by his father to become a physician instead of a painter, William James pursued 3 evasion stratagems. First, to avoid becoming a practitioner, he declared that he wanted to specialize in physiology. Based upon this premise, he left for Germany in the spring of 1867. The second step was giving up general physiology and announcing that he would specialize in the nervous system and psychology. Based upon this premise, he declared that he would go to Heidelberg and study with Helmholtz and Wundt. However, he then deferred going there. When, at last, he was urged by an influential friend of his father's to accompany him to Heidelberg, he employed his default stratagem: He simply fled. He returned home after 3 terms in Europe without enrolling at a single university. There is no evidence that he had learned anything there about psychology or experimental psychology, except, possibly, by reading books. James's "Heidelberg fiasco" was the apogee of his evasion of his father's directive. A dense fog of misinformation surrounds his stay in Heidelberg to this day. By analyzing circumstances and context, this article examines the fiasco and places it in the pattern of his behavior during his stay in Europe. Nevertheless, experiencing this fiasco potentially shaped James's ambivalent attitude toward experimental psychology on a long-term basis. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
8. John and James Dobson Carpet Mill, East and West ...
8. John and James Dobson Carpet Mill, East and West Parcels, site plan, and survey lower left, 1865. Hexamer, Ernest and Son. Hexamer General Surveys, 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1865, p. 279. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA
The Poetry of the King James Version of the Bible in the College Literature Class.
ERIC Educational Resources Information Center
Greenwood, Edward L.
This study discusses the literary excellence of the King James Version of the Bible, in order to encourage its use in college literature classes. Separate chapters present a brief history of the literary treatment of the Bible, a summary of the variety of literary genres contained in the Bible, a demonstration of structural features basic to…
DOE Office of Scientific and Technical Information (OSTI.GOV)
None
2008-02-07
L'association du personnel a le plaisir d'accueillir Mons. James F.Buckli, astronaute, né en 1947. Il a participé à la mission Space Lab D1 qui pour la première fois mettait 8 personnes sur orbite.L'ass.du pers. remercie aussi Gordon White(s) de la mission américaine d'avoir permis d'organiser cette conférence
2017-12-08
When the James Webb Space Telescope (JWST) reaches its orbit about a million miles (1.5 kilometers) from Earth and begins studying the distant reaches of the universe, the event will mark an unprecedented triumph on several technological fronts. Photo Credit: Chris Gunn For more information go to the Goddard Tech Trends Archive: Spring 2007 (http://gsfctechnology.gsfc.nasa.gov/TechTrendsArchive.html)
78 FR 48609 - Safety Zone; James River; Newport News, VA
Federal Register 2010, 2011, 2012, 2013, 2014
2013-08-09
...-AA00 Safety Zone; James River; Newport News, VA AGENCY: Coast Guard, DHS. ACTION: Temporary final rule...-0670 to read as follows: Sec. 165.T05-0670 Safety Zone, James River, Newport News, VA. (a) Definitions...'11'' N longitude 076[deg]38'40'' W, located near Fort Eustis in Newport News, VA. (c) Regulations. (1...
Author! Author!: James E. Ransome.
ERIC Educational Resources Information Center
School Library Media Activities Monthly, 1996
1996-01-01
Presents a profile of James E. Ransome, a children's book illustrator. Highlights include his background, the influence of filmmaking in his storyboards, illustration as storytelling, manuscript selection, the use of models and realistic themes, awards, future work, and advice for librarians and teachers about how to use his books. (AEF)
The James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Mather, John
2003-01-01
The James Webb Space Telescope (JWST) will extend the discoveries of the Hubble Space Telescope by deploying a large cooled infrared telescope at the Sun-Earth Lagrange point L2. It will have a 6 m aperture and three instruments covering the wavelength range from 0.6 to 28 microns.
11. John and James Dobson Carpet Mill, East and West ...
11. John and James Dobson Carpet Mill, East and West parcels, site plan-upper left, elevation-lower left, and survey-right, 1877. Hexamer, Ernest and Son. Hexamer General Surveys, 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1877, pp. 1095-1096. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA
13. John and James Dobson Carpet Mill, East and West ...
13. John and James Dobson Carpet Mill, East and West parcels, site plan-upper left, elevation-upper right, and survey-below, 1885. Hexamer, Ernest and Son. Hexamer General Surveys, 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1885, pp. 1890-1891. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA
9. John and James Dobson Carpet Mill, portion of West ...
9. John and James Dobson Carpet Mill, portion of West parcel, site plan-left, elevation-upper right, and survey-lower right, 1873. Hexamer, Ernest and Son. Hexamer General Surveys 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1873, pp. 670-671. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA
None
2017-12-09
L'association du personnel a le plaisir d'accueillir Mons. James F.Buckli, astronaute, né en 1947. Il a participé à la mission Space Lab D1 qui pour la première fois mettait 8 personnes sur orbite.L'ass.du pers. remercie aussi Gordon White(s) de la mission américaine d'avoir permis d'organiser cette conférence
Much Ado about Something? James Bryant Conant, Harvard University, and Nazi Germany in the 1930s
ERIC Educational Resources Information Center
Urban, Wayne J.; Smith, Marybeth
2015-01-01
This paper discusses the actions of noted Harvard University president James Bryant Conant, taken in regard to the Nazi government in Germany, from the time of Conant's becoming president of Harvard University in 1933 to the time of the widespread pogrom in Germany of 9-10 November 1938, known as Kristallnacht. Conant's attitudes and actions…
Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru
2010-06-15
The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.
New Hires at the National Cancer Institute at Frederick | Poster
Forty-nine people joined the facility in September and October 2013. The National Cancer Institute welcomes… Aamir Akram Clarissa Alexander Robert Buckheit Brian Chan Kelly Dempsey Christopher Descalzi Ahmed Fahim Devikala Gurusamy Jaewoo Hong Rhushikesh Kulkarni James Shaum Dionysios Watson Yuheng Xi Yi Xiang Thomas Zengeya
Finding our Origins with the Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2009-01-01
NASA is planning a successor to the Hubble Space Telescope designed to study the origins of galaxies, stars, planets and life in the universe. In this talk, Dr. Gardner will discuss the origin and evolution of galaxies, beginning with the Big Bang and tracing what we have learned with Hubble through to the present day. He will show that results from studies with Hubble have led to plans for its successor, the James Webb Space Telescope. Webb is scheduled to launch in 2014, and is designed to find the first galaxies that formed in the distant past and to penetrate the dusty clouds of gas where stars are still forming today. He will compare Webb to Hubble, and discuss recent progress in the construction of the observatory.
Finding our Origins with the Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan
2008-01-01
NASA is planning a successor to the Hubble Space Telescope designed to study the origins of galaxies, stars, planets and life in the universe. In this talk, Dr. Gardner will discuss the origin and evolution of galaxies, beginning with the Big Bang and tracing what we have learned with Hubble through to the present day. He will show that results from studies with Hubble have led to plans for its successor, the James Webb Space Telescope. Webb is scheduled to launch in 2013, and is designed to find the first galaxies that formed in the distant past and to penetrate the dusty clouds of gas where stars are still forming today. He will compare Webb to Hubble, and discuss recent progress in the construction of the observatory.
Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre
2012-01-01
The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274
Morari, Cristian; Bogdan, Diana; Muntean, Cristina M
2012-11-01
The binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. The calculations were carried out on Watson-Crick and Hoogsteen configurations of the base pairs. We have found, that in Watson-Crick configuration, the metal is coordinated to N7 atom of guanine while, in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen structures. Our results show that the vibrational amplitudes of metallic atoms are strong for wavenumbers lower than 600 cm⁻¹. Also, we predict that the distinction between Watson-Crick and Hoogsteen configurations can be seen around 85, 170 and 310 cm⁻¹.
2012-01-01
Howell, Maj Dean Hudson, LTC Marjorie Johnson, MAJ Colin Meghoo, MAJ Kyle Remick, MAJ Felecia Rivers, LTC James Sebesta, MAJ Leilani Siaki, Maj Adrian K... Stull , CPT Martha Swift, Capt Travis Taylor, Maj Ryan P. Tyner, Maj Gregory Watson, CPT Jennifer G. Ysmael. DISCLOSURE The views expressed in this
Confronting Science: The Dilemma of Genetic Testing.
ERIC Educational Resources Information Center
Zallen, Doris T.
1997-01-01
Considers the opportunities and ethical issues involved in genetic testing. Reviews the history of genetics from the first discoveries of Gregor Mendel, through the spurious pseudo-science of eugenics, and up to the discovery of DNA by James Watson and Francis Crick. Explains how genetic tests are done. (MJP)
"Restructuring" Stirs Outcry at James Madison.
ERIC Educational Resources Information Center
Magner, Denise K.
1995-01-01
An administration plan to discontinue the physics major at James Madison University (Virginia) has raised concerns about the president's leadership and management style, and the role of faculty in institutional decision making. Faculty were notified of the plan only after student leaders were told. (MSE)
Science with the James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2012-01-01
The science objectives of the James Webb Space Telescope fall into four themes. The End of the Dark Ages: First Light and Reionization theme seeks to identify the first luminous sources to form and to determine the ionization history of the universe. The Assembly of Galaxies theme seeks to determine how galaxies and the dark matter, gas, stars, metals, morphological structures, and black holes within them evolved from the epoch of reionization to the present. The Birth of Stars and Protoplanetary Systems theme seeks to unravel the birth and early evolution of stars, from infall onto dust-enshrouded protostars, to the genesis of planetary systems. The Planetary Systems and the Origins of Life theme seeks to determine the physical and chemical properties of planetary systems around nearby stars and of our own, and to investigate the potential for life in those systems. These four science themes were used to establish the design requirements for the observatory and instrumentation. Since Webb's capabilities are unique, those science themes will remain relevant through launch and operations and goals contained within these themes will continue to guide the design and implementation choices for the mission. More recently, it has also become clear that Webb will make major contributions to other areas of research, including dark energy, dark matter, active galactic nuclei, stellar populations, exoplanet characterization and Solar System objects. In this paper, we review the original four science themes and discuss how the scientific output of Webb will extend to these new areas of research. The James Webb Space Telescope was designed to meet science objectives in four themes: The End of the Dark Ages: First Light and Reionization, The Assembly of Galaxies, The Birth of Stars and Protoplanetary Systems, and Planetary Systems and the Origins of Life. More recently, it has become clear that Webb will also make major contributions to studies of dark energy, dark matter
The contribution of William James to the origins of "scientific" psychology.
Ferreri, Antonio M
2006-01-01
This paper illustrates the specific nature of the contribution made by the psychology of William James to the construction of modern scientific psychology. Universally recognized as the father of American scientific psychology, William James still remains a much-debated scientist, mainly for two reasons. First, he was interested in subjects that were often very far from the narrow and traditional approaches taken by the greater part of his contemporary colleagues. Secondly, in order to enlighten psychological issues, he continued to adopt multidisciplinary contributions, rather than selecting only those that stemmed from experimental and specifically laboratory contexts. James has been recently inserted in the more complex international consortium of psychologists, psychiatrists, physicians, psychotherapists, and philosophers that has been called "the French-Swiss-English-and-American psychotherapeutic alliance." This does in reality seem a more appropriate framework for understanding the specificity of James's psychology. In order to illustrate the peculiar Jamesian way of thinking about psychological issues, this paper undertakes an examination of his classical concept of the "stream of thought." Here, in fact, many different contributions converge in defining and outlining "the primary fact of consciousness"--personal, subjective, and introspective observation; philosophical arguments; "mental experiments," and psychopathological experiences; but, most of all, neurological data derived specifically from brain physiology. This last contribution has been too often underestimated, as has also the background of James's training in the development of experimental psychology, neurology, and physiology at Harvard before 1890. The paper concludes with the assertion that James represents the prototype of a new way of defining the scientific quality of modern psychology, far from the narrow definition given by the laboratory experimentalists fresh from the German
The James Webb Space Telescope: Capabilities for Exoplanet Science
NASA Technical Reports Server (NTRS)
Clampin, Mark
2011-01-01
The James Webb Space Telescope (JWST) is a large aperture (6.5 meter), cryogenic space telescope with a suite of near and mid-infrared instruments covering the wavelength range of 0.6 micron to 28 micron. JWST's primary science goal is to detect and characterize the first galaxies. It will also study the assembly of galaxies, stellar and planetary system formation, and the formation and evolution of planetary systems. We will review the design of JWST, and discuss the current status of the project, with emphasis on recent progress in the construction of the observatory. We also review the capabilities of the observatory for observations of exosolar planets and debris disks by means of coronagraphic imaging, and high contrast imaging and spectroscopy. This discussion will focus on the optical and thermal performance of the observatory, and will include the current predictions for the performance of the observatory, with special reference to the demands of exoplanet science observations.
John James Audubon & the Turkey
ERIC Educational Resources Information Center
Hinshaw, Craig
2012-01-01
In the first half of the 1800s, John James Audubon roamed the wilds of America attempting to draw all the birds in their natural habitat. He published his life-sized paintings in a huge book entitled "Birds of America." Audubon developed a unique system of depicting the birds in natural poses, such as flying. After shooting the bird, he would wire…
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Finding our Origins with the Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2007-01-01
NASA is planning a successor to the Hubble Space Telescope designed to study the origins of galaxies, stars, planets and life in the universe. In this talk, Dr. Gardner will discuss the origin and evolution of galaxies, beginning with the Big Bang and tracing what we have learned with Hubble through to the present day. He will show that results from studies with Hubble have led to plans for its successor, the James Webb Space Telescope. Webb is scheduled to launch in 201 3, and is designed to find the first galaxies that formed in the distant past and to penetrate the dusty clouds of gas where stars are still forming today. He will compare Webb to Hubble, and discuss recent progress in the construction of the observatory.
Reform, Racism and the Centrality of Whiteness: Assessment, Ability and the "New Eugenics"
ERIC Educational Resources Information Center
Gillborn, David
2010-01-01
The Nobel Prize winning scientist James Watson was vilified when his views on the supposedly inherent deficiencies of black people became public. The scientific establishment, mainstream media and politicians joined a chorus of disapproval that would seem to evidence a widespread rejection of the old myths of racially ordered intelligence.…
Allies and Competitors as Enscripted Audiences in Scientific Writing.
ERIC Educational Resources Information Center
Perry, Susan
A set of much examined scientific papers which specifically portray a controversial topic and also manifest ally-peer and competitor-peer enscripted audiences are those written by James Watson and Francis Crick concerning their discovery of the structure of deoxyribose nucleic acid (DNA). The theoretical perspective of an ally-peer and…
ERIC Educational Resources Information Center
Mid-Atlantic Teacher Corps Network, Philadelphia, PA.
The conference's keynote address is presented by Bernard C. Watson. Papers include: Vantage from the State Department of Education, by Robert G. Scanlon (Pennsylvania); Minimum Competency: As the Public Sees the Question, by Jacqueline Grennan Wexler; Minimum Competency Testing (MCT): A Tripartite Response from the Profession, by W. James Popham;…
75 FR 9904 - James A. Holland; Denial of Hearing; Final Debarment Order
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-04
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2009-N-0205] James A. Holland; Denial of Hearing; Final Debarment Order AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and Drug Administration (FDA) is denying James A. Holland's request for...
DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds
Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.
2008-01-01
We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765
Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan
2015-09-01
Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.
Kottemann, Molly C; Smogorzewska, Agata
2013-01-17
The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.
James Bernard Russell: Scholar, collaborator, mentor
USDA-ARS?s Scientific Manuscript database
At the time of his untimely death in 2009, ARS scientist Dr. James B. Russell had established himself as the premier rumen microbiologist of his generation. Dr. Russell’s many contributions to the field, including much of the early work on the Cornell Net Carbohydrate System model, were the product ...
James Madison and "The Federalist Papers."
ERIC Educational Resources Information Center
Patrick, John J.; And Others
A collection of resources for high school history and government teachers and their students, this volume treats core ideas on constitutional government in the United States. James Madison's ideas as found in "The Federalist Papers" are examined in conjunction with their counterpoints in essays of the Anti-Federalists. This volume…
Salvaging the self in a world without soul: William James's The Principles of psychology.
Coon, D J
2000-05-01
This article explores William James's transformation of the religious soul into the secular self in The Principles of Psychology. Although James's views on the self are familiar to many historians of psychology, the article places his treatment of the self within the broader social and cultural context of a secularizing, industrializing society. There were palpable tensions and anxieties that accompanied the cultural shift, and these are particularly transparent in James's Principles. James attempted the project of secularizing the soul in order to promote a natural science of the mind but with marked ambivalence for the project, because it left out some of the moral and metaphysical questions of great interest to him.
James Madison and a Shift in Precipitation Seasonality
NASA Astrophysics Data System (ADS)
Druckenbrod, D. L.; Mann, M. E.; Stahle, D. W.; Cleaveland, M. K.; Therrell, M. D.; Shugart, H. H.
2001-12-01
An eighteen-year meteorological diary and tree ring data from James Madison's Montpelier plantation provide a consistent reconstruction of early summer and prior fall rainfall for the 18th Century Virginia piedmont. The Madison meteorological diary suggests a seasonal shift in monthly rainfall towards an earlier wet season relative to 20th Century norms. Furthermore, dendroclimatic reconstructions of early summer and prior fall rainfall reflect this shift in the seasonality of summer rainfall. The most pronounced early summer drought during the Madison diary period is presented as a case study. This 1792 drought occurs during one of the strongest El Niño events on record and is highlighted in the correspondence of James Madison.
The delusion of the Master: the last days of Henry James.
Bartolomeo, Paolo
2013-11-01
The novelist Henry James shared with his brother William, the author of the Principles of Psychology, a deep interest in the ways in which personal identity is built through one's history and experiences. At the end of his life, Henry James suffered a vascular stroke in the right hemisphere and developed a striking identity delusion. He dictated in a perfectly clear and coherent manner two letters as if they were written by Napoleon Bonaparte. He also showed signs of reduplicative paramnesia. Negative symptoms resulting from right hemisphere damage may disrupt the feelings of "warmth and intimacy and immediacy" and the "resemblance among the parts of a continuum of feelings (especially bodily feelings)", which are the foundation of personal identity according to William James. On the other hand, a left hemisphere receiving inadequate input from the damaged right hemisphere may produce positive symptoms such as delusional, confabulatory narratives. Other fragments dictated during Henry James's final disease reveal some form of insight, if partial and disintegrated, into his condition. Thus, even when consciousness is impaired by brain damage, something of its deep nature may persist, as attested by the literary characteristics of the last fragments of the Master.
ERIC Educational Resources Information Center
Fraser, James W.; Watson, Audra M.
2014-01-01
Woodrow Wilson Senior Fellow James W. Fraser and Audra Watson, the Foundation's Director of Mentoring and Induction Strategy, take a look at emerging trends in clinical preparation for new teachers. This new white paper is based on experience with the Woodrow Wilson Teaching Fellowships, and includes observations from some of the colleges and…
ERIC Educational Resources Information Center
Van Vranken, Nancy S., Ed.
1987-01-01
The field of biotechnology, and specifically recombinant DNA technology, is transforming the way that many feel about the nature and purposes of biology. This newsletter annual supplement contains several articles addressing the topic of biotechnology and the importance that the topic should be given in science classes. James D. Watson's article,…
NASA Astrophysics Data System (ADS)
Tait, Alastair W.; Tomkins, Andrew G.; Godel, Bélinda M.; Wilson, Siobhan A.; Hasalova, Pavlina
2014-06-01
Despite the fact that the number of officially classified meteorites is now over 45,000, we lack a clearly defined sequence of samples from a single parent body that records the entire range in metamorphic temperatures from pristine primitive meteorites up to the temperatures required for extensive silicate partial melting. Here, we conduct a detailed analysis of Watson 012, an H7 ordinary chondrite, to generate some clarity on the textural and chemical changes associated with equilibrium-based silicate partial melting in chondritic meteorites. To do this we compare the textures in the meteorite with those preserved in metamorphic contact aureoles on Earth. The most distinctive texture generated by the partial melting that affected Watson 012 is an extensively interconnected plagioclase network, which is clearly observable with a petrographic microscope. Enlarged metal-troilite grains are encapsulated at widenings in this plagioclase network, and this is clearly visible in reflected light. Together with these features, we define a series of other characteristics that can be used to more clearly classify chondritic meteorites as being of petrologic Type 7. To provide comprehensive evidence of silicate partial melting and strengthen the case for using simple petrographic observations to classify similar meteorites, we use high-resolution X-ray computed tomography to demonstrate that the plagioclase network has a high degree of interconnectedness and crystallised as large (cm-scale) skeletal crystals within an olivine-orthopyroxene-clinopyroxene framework, essentially pseudomorphing a melt network. Back-scattered electron imaging and element mapping are used to show that some of the clino- and orthopyroxene in Watson 012 also crystallised from silicate melt, and the order of crystallisation was orthopyroxene → clinopyroxene → plagioclase. X-ray diffraction data, supported by bulk geochemistry, are used to show that plagioclase and ortho- and clinopyroxene were
James Madison and the Constitutional Convention.
ERIC Educational Resources Information Center
Scanlon, Thomas M.
1987-01-01
Part 1 of this three-part article traces James Madison's life and focuses primarily on those events that prepared him for leadership in the U.S. Constitutional Convention of 1787. It describes his early love of learning, education, and public service efforts. Part 2 chronicles Madison's devotion to study and preparation prior to the Constitutional…
Landscapes of Removal and Resistance: Edwin James's Nineteenth-Century Cross-Cultural Collaborations
ERIC Educational Resources Information Center
Lyndgaard, Kyhl
2010-01-01
The life of Edwin James (1797-1861) is bookended by the Lewis and Clark expedition (1803-6) and the Civil War (1861-65). James's work engaged key national concerns of western exploration, natural history, Native American relocation, and slavery. His principled stands for preservation of lands and animals in the Trans-Mississippi West and his…
The Case of James Leininger: An American Case of the Reincarnation Type.
Tucker, Jim B
2016-01-01
Numerous cases of young children who report memories of previous lives have been studied over the last 50 years. Though such cases are more easily found in cultures that have a general belief in reincarnation, they occur in the West as well. This article describes the case of James Leininger, an American child who at age two began having intense nightmares of a plane crash. He then described being an American pilot who was killed when his plane was shot down by the Japanese. He gave details that included the name of an American aircraft carrier, the first and last name of a friend who was on the ship with him, and a location and other specifics about the fatal crash. His parents eventually discovered a close correspondence between James׳s statements and the death of a World War II pilot named James Huston. Documentation of James׳s statements that was made before Huston was identified includes a television interview with his parents that never aired but which the author has been able to review. Copyright © 2016 Elsevier Inc. All rights reserved.
Croce, P J
1999-11-01
In the 5 years before 1878, when his career in psychology was becoming established, William James wrote a series of notes and reviews assessing the work of many of the pioneers in the new field. Adopting a public and confident voice, even while he was privately still uncertain and searching, James criticized the dogmatism of positivist and idealist claims to the study of the human brain and mind. In his short writings of 1873-1877, James started to formulate his own middle path. His first steps on that path show that he did not reject either scientific or philosophic inquiry; instead, he viewed scientific knowledge as a way to understand philosophical questions more deeply. Saving his sharpest critiques for positivism, James endorsed scientific investigation without materialist assmptions. While his career in psychology was still only a hope, James treated science as a means toward humanist insight.
ERIC Educational Resources Information Center
Bridgers, Lynn; Snarey, John R.
2003-01-01
Using a historical and biographical, then developmental, approach, this article examines William James's spiritual family history by reviewing key events in the life of his father, Henry James, Sr. It pays particular attention to Henry Sr's tumultuous relationship with his own father, William James of Albany, and Henry Sr's subsequent conversion…
James John Harpell: An Adult Education Pioneer.
ERIC Educational Resources Information Center
Quarter, Jack
2000-01-01
In early 20th-century Canada, James John Harpell began correspondence courses and study clubs and was instrumental in the cooperatives movement. He used small businesses to promote social and educational innovations and was an advocate for self-study and lifelong learning. (SK)
Is Watson's ``CHARGE-MODIFIED'' Reduced Mass always best for Diatomic Ions ?
NASA Astrophysics Data System (ADS)
Le Roy, Robert J.; Dattani, Nikesh S.
2016-06-01
Watson's landmark reformulation of the Born-Oppenheimer separation problem has been the basis of most combined-isotopologue analyses of diatomic spectroscopic data since 1980. One noteworthy feature of this work was his proposal that description of the dynamical behaviour of a diatomic ion with (±) charge Q, formed from atoms with isotopic masses of M_1 and M_2, should use a ``charge-modified'' reduced mass: μWat≡ M_1 M_2 /(M_1 + M_2 - Q m_e) , in which m_e is the electron mass, and this proposal seems to have been benignly accepted and adopted. The first quantitative test of this proposal was in the pioneering combined-isotopologue direct-potential-fit (CI-DPF) study of HeH^+ by Coxon and Hajigeorgiou in 1999, where they compared the quality of fit for analyses that used different choices for the definition of the reduced masses of the various isotopologues, and found that the best choice seemed to be to use conventional two-body reduced masses for (M_1 - 1/2 m_e) and (M_2 - 1/2 m_e ). This question was re-examined recently in the context of a CI-DPF study of CH^+, and a rather different conclusion was reached. The present paper combines new CI-DPF studies of HeH^+ and BeH^+ with our recent CH^+ work, and attempts to draw some general conclusions on this matter. J.K.G. Watson, J. Mol. Spectrosc. 80, 411 (1980) J.A. Coxon and P. Hajigeorgiou, J. Mol. Spectrosc. 193, 306 (1999). Y.-S. Cho and R.J. Le Roy, J. Chem. Phys. 144, 024311 (2016)
Continued Development of a Precision Cryogenic Dilatometer for the James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Karlmann, Paul B.; Dudik, Matthew J.; Halverson, Peter G.; Levine, Marie; Marcin, Martin; Peters, Robert D.; Shaklan, Stuart; VanBuren, David
2004-01-01
As part of the James Webb Space Telescope (JWST) materials working group, a novel cryogenic dilatometer was designed and built at NASA Jet Propulsion Laboratory to help address stringent coefficient of thermal expansion (CTE) knowledge requirements. Previously reported results and error analysis have estimated a CTE measurement accuracy for ULE of 1.7 ppb/K with a 20K thermal load and 0.1 ppb/K with a 280K thermal load. Presented here is a further discussion of the cryogenic dilatometer system and a description of recent work including system modifications and investigations.
Solar System Observations with the James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Norwood, James; Hammel, Heidi; Milam, Stefanie; Stansberry, John; Lunine, Jonathan; Chanover, Nancy; Hines, Dean; Sonneborn, George; Tiscareno, Matthew; Brown, Michael;
2016-01-01
The James Webb Space Telescope (JWST) will enable a wealth of new scientific investigations in the near- and mid-infrared, with sensitivity and spatial/spectral resolution greatly surpassing its predecessors. In this paper, we focus upon Solar System science facilitated by JWST, discussing the most current information available concerning JWST instrument properties and observing techniques relevant to planetary science. We also present numerous example observing scenarios for a wide variety of Solar System targets to illustrate the potential of JWST science to the Solar System community. This paper updates and supersedes the Solar System white paper published by the JWST Project in 2010. It is based both on that paper and on a workshop held at the annual meeting of the Division for Planetary Sciences in Reno, NV, in 2012.
James Wardrop and equine recurrent uveitis.
Paglia, Danielle T; Miller, Paul E; Dubielzig, Richard R
2004-08-01
James Wardrop should be remembered not only as one of the founders of ocular pathology but also for his contributions to the field of comparative ophthalmology. He described a "specific inflammation" that veterinarians today know as equine recurrent uveitis. As described by Wardrop in the 19th century, this condition is known today to eventually lead to blindness.
J D Bernal: the sage of science
NASA Astrophysics Data System (ADS)
Brown, Andrew P.
2007-02-01
John Desmond Bernal (1901-1971) was one of the most influential and original scientists of the twentieth century. No less an authority than James Watson has stated that Bernal's genius inspired the birth of molecular biology. By examining Bernal's interactions with others, I attempt to illustrate his personality, brilliance, breadth, foibles and essential humanity.
James Dunlop's historical catalogue of southern nebulae and clusters
NASA Astrophysics Data System (ADS)
Cozens, Glen; Walsh, Andrew; Orchiston, Wayne
2010-03-01
In 1826 James Dunlop compiled the second ever catalogue of southern star clusters, nebulae and galaxies from Parramatta (NSW, Australia) using a 23-cm reflecting telescope. Initially acclaimed, the catalogue and author were later criticised and condemned by others - including Sir John Herschel and both the catalogue and author are now largely unknown. The criticism of the catalogue centred on the large number of fictitious or ‘missing’ objects, yet detailed analysis reveals the remarkable completeness of the catalogue, despite its inherent errors. We believe that James Dunlop was an important early Australian astronomer, and his catalogue should be esteemed as the southern equivalent of Messier's famous northern catalogue.
"I May Be Crackin', But Um Fackin": Racial Humor in "The Watsons Go To Birmingham--1963"
ERIC Educational Resources Information Center
McNair, Jonda C.
2008-01-01
This article examines the utilization of racial humor in Christopher Paul Curtis' novel, "The Watsons Go To Birmingham--1963." The theoretical perspectives that inform the analysis include critical race theory and humor theory. The results of the analysis reveal that the use of humor in this book is influenced to a significant degree by race and…
Astronaut James Buchli wearing extravehicular mobility unit
NASA Technical Reports Server (NTRS)
1985-01-01
Astronaut James F. Buchli, wearing an extravehicular mobility unit (EMU), is about to be submerged in the weightless environment training facility (WETF) to simulate a contingency extravehicular activity (EVA) for STS 61-A. In this portrait view, Buchli is wearing a communications carrier assembly (CCA).
James Webb Space Telescope Launch Window Trade Analysis
NASA Technical Reports Server (NTRS)
Yu, Wayne; Richon, Karen
2014-01-01
The James Webb Space Telescope (JWST) is a large-scale space telescope mission designed to study fundamental astrophysical questions ranging from the formation of the universe to the origin of planetary systems and the origins of life. JWSTs orbit design is a Libration Point Orbit (LPO) around the Sun-EarthMoon (SEM) L2 point for a planned mission lifetime of 10.5 years. The launch readiness period for JWST is from Oct 1st, 2018 November 30th, 2018. This paper presents the first launch window analysis for the JWST observatory using finite-burn modeling; previous analysis assumed a single impulsive midcourse correction to achieve the mission orbit. The physical limitations of the JWST hardware stemming primarily from propulsion, communication and thermal requirements alongside updated mission design requirements result in significant launch window within the launch readiness period. Future plans are also discussed.
Overview of the James Webb Space Telescope observatory
NASA Astrophysics Data System (ADS)
Clampin, Mark
2011-09-01
The James Webb Space Telescope (JWST) is a large aperture, space telescope designed to provide imaging and spectroscopy over the near and mid-infrared from 1.0 μm to 28 μm. JWST is a passively cooled infrared telescope, employing a five layer sunshield to achieve an operating temperature of ~40 K. JWST will be launched to an orbit at L2 aboard an Ariane 5 launcher in 2013. The Goddard Space Flight Center (GSFC) is the lead center for the JWST program and manages the project for NASA. The prime contractor for JWST is Northrop Grumman Aerospace Systems (NGST). JWST is an international partnership with the European Space Agency (ESA), and the Canadian Space Agency (CSA). ESA will contribute the Ariane 5 launch, and a multi-object infrared spectrograph. CSA will contribute the Fine Guidance Sensor (FGS), which includes the Tunable Filter Imager (TFI). A European consortium, in collaboration with the Jet Propulsion Laboratory (JPL), builds the mid-infrared imager (MIRI). In this paper we present an overview of the JWST science program, and discuss recent progress in the development of the observatory. In this paper we will discuss the scientific motivations for JWST, and discuss recent progress in the construction of the observatory, focusing on the telescope and its optics, which have recently completed polishing.
Watson, Swellengrebel and species sanitation: environmental and ecological aspects.
Bradley, D J
1994-08-01
Following the discovery of mosquito transmission of malaria, the theory and practice of malaria control by general and selective removal of specific vector populations resulted particularly from Malcolm Watson's empirical work in peninsular Malaysia, first in the urban and peri-urban areas of Klang and Port Swettenham and subsequently in the rural rubber plantations, and from the work of N.H. Swellengrebel in nearby Indonesia on the taxonomy, ecology and control of anophelines. They developed the concept of species sanitation: the selective modification of the environment to render a particular anopheline of no importance as a vector in a particular situation. The lack of progress along these lines in India at that time is contrasted with that in south-east Asia. The extension of species sanitation and related concepts to other geographical areas and to other vector-borne disease situations is outlined.
ERIC Educational Resources Information Center
Thayer-Bacon, Barbara J.
2017-01-01
In "A Pluralistic Universe," James argues that the world we experience is more than we can describe. Our theories are incomplete, open, and imperfect. Concepts function to try to shape, organize, and describe this open, flowing universe, while the universe continually escapes beyond our artificial boundaries. For James and myself, the…
James Ferguson: A Commemoration
NASA Astrophysics Data System (ADS)
Davenhall, Clive
2010-11-01
James Ferguson (1710-1776) was a renowned author and lecturer on scientific subjects and maker of scientific instruments. His Astronomy Explained upon Sir Isaac Newton's Principles of 1756 was an extremely popular non-mathematical exposition of Newton's ideas in English. He wrote numerous other books, some of which remained in print until the mid-nineteenth century. Ferguson rose from humble beginnings as a shepherd in northeast Scotland to become a wealthy lecturer, author and Fellow of the Royal Society, enjoying an international reputation. April 2010 marked the three hundredth anniversary of Ferguson's birth, and the present short communication briefly commemorates this event.
X-Ray Diffraction and the Discovery of the Structure of DNA
ERIC Educational Resources Information Center
Crouse, David T.
2007-01-01
A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…
77 FR 10604 - Qualification of Drivers; Exemption Applications; Vision
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-22
... renewable two-year period. They are: William M. Arbogast (FL), Cris D. Bush (TN), John E. Cain (NM), Billy C.... Ferguson (VA), Randy M. Garcia (NM), John A. Graham (PA), Henry J. Gregoire, Jr. (MN), Jason L. Hoovan (UT.... Schneider (NM), James Vickery (KY), Norman J. Watson (NC), Lewis H. West, Jr. (MA), Billy R. Wilkey (TX...
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Young James Madison: His Character and Civic Values.
ERIC Educational Resources Information Center
Bennett, William J.
1987-01-01
Examines the life of James Madison, Founding Father and "theoretic statesman." Focuses specifically on Madison's education and character, his friendship with Thomas Jefferson, and his civic legacy: a selfless devotion to republican government and union. (JDH)
Jović, Ozren
2016-12-15
A novel method for quantitative prediction and variable-selection on spectroscopic data, called Durbin-Watson partial least-squares regression (dwPLS), is proposed in this paper. The idea is to inspect serial correlation in infrared data that is known to consist of highly correlated neighbouring variables. The method selects only those variables whose intervals have a lower Durbin-Watson statistic (dw) than a certain optimal cutoff. For each interval, dw is calculated on a vector of regression coefficients. Adulteration of cold-pressed linseed oil (L), a well-known nutrient beneficial to health, is studied in this work by its being mixed with cheaper oils: rapeseed oil (R), sesame oil (Se) and sunflower oil (Su). The samples for each botanical origin of oil vary with respect to producer, content and geographic origin. The results obtained indicate that MIR-ATR, combined with dwPLS could be implemented to quantitative determination of edible-oil adulteration. Copyright © 2016 Elsevier Ltd. All rights reserved.
Aerial photographic water color variations from the James River
NASA Technical Reports Server (NTRS)
Bressette, W. E.
1979-01-01
Photographic flights from 305 meters altitude were made throughout the day of May 17, 1977, over seven water data stations in the James River. The flights resulted in wide-angle, broadband, spectral radiance film exposure data between the wavelengths of 500 to 900 nanometers for sun elevation angles ranging from 37 to 64 deg and variable atmospheric haze conditions. It is shown from densitometer data that: (1) the dominant observed color from James River waters is determined by the optical properties of the total suspended solid load, (2) variability in observed color is produced by a changing solar elevation angle; and (3) the rate at which observed color changes is influenced by both solar elevation angle and atmospheric conditions.
Obscurity and Gender Resistance in Patricia Duncker's James Miranda Barry
Funke, Jana
2012-01-01
Since his death in 1865, military surgeon James Barry has alternately been classified as a cross-dressing woman or as an intersexed individual. Patricia Duncker's novel James Miranda Barry (1999) poses an important challenge to such readings, as it does not reveal any foundational truth about Barry's sex. Resting on obscurity rather than revelation, the text frustrates the desire to know the past in terms of gender binaries and stable sexual identity categories. Drawing on feminist and queer theorisations of the relation between gender and time, this essay demonstrates that Duncker's use of obscurity opens up alternative strategies of gender resistance. PMID:25400502
ERIC Educational Resources Information Center
Barker, Jani L.
2010-01-01
Multiethnic children's literature addresses multiple audiences, providing different reading experiences and benefits for each. Using critical race theory as an interpretive tool, this article examines how two African American historical fiction novels, Mildred Taylor's "Roll of Thunder, Hear My Cry" and Christopher Paul Curtis's "The Watsons Go to…
James Madison University Survey of Faculty Activities.
ERIC Educational Resources Information Center
James Madison Univ., Harrisonburg, VA.
The activities of the faculty at James Madison University during the fall term of the academic year 1978-79 are described. Full-time instructional faculty, part-time faculty involved in resident instruction, administrators and classified employees who taught at least one course, and graduate teaching assistants were surveyed. Information was…
James Abbot McNeill Whistler: "At the Piano."
ERIC Educational Resources Information Center
Hallenberg, Heather
1987-01-01
"At the Piano," an oil-on-canvas painting completed in 1859 by James Abbot McNeill Whistler, is used as the basis of a lesson designed to help junior high school students analyze the painting's mood, subject matter, and composition. (JDH)
NASA Astrophysics Data System (ADS)
colleagues; Brown, R. R.; Goldberg, R. A.; Rosenberg, T. J.; Patel, V. L.
James Roy Barcus, professor of physics at the University of Denver, Colo., died January 3, 1988, at his home in Denver after a long battle with lung cancer.Barcus was born in Kansas City, Mo., on September 30, 1930. He served in the U.S. Navy before enrolling as an undergraduate at the University of New Mexico, where he obtained his B.S., M.S., and Ph.D. degrees. His doctoral research was on extensive air showers of cosmic radiation, under J. R. Green.
JAMES RIVER FACE WILDERNESS, VIRGINIA.
Brown, C. Ervin; Gazdik, Gertrude C.
1984-01-01
A mineral survey concluded that the James River Face Wilderness, Virginia, had little promise for the occurrence of metallic mineral resources. Two major rock units in the area do contain large nonmetallic mineral resources of quartzite and shale that have been mined for silica products and for brick and expanded aggregate, respectively. Because large deposits of the same material are more easily available in nearby areas, demand for the deposits within the wilderness is highly unlikely. No energy resources were identified in the course of this study.
Making James Joyce Contemporary: Recreating Classical Fiction
ERIC Educational Resources Information Center
Clay, Rebecca
2015-01-01
Can you make James Joyce's short story "Eveline" contemporary and create a modern short story based on Joyce's work? The purpose of this study was to provide a context to Joyce's short story "Eveline," illustrate the journey of my fiction writing, and expand the conversation on using classical fiction as a guide to modern short…
2004-03-16
James Ross Island captured by NASA photographer James Ross(no relation), from NASA's DC-8 aircraft during an AirSAR 2004 mission over the Antarctic Peninsula. James Ross Island, named for 19th century British polar explorer Sir James Clark Ross, is located at the northern tip of the Antarctic Peninsula. The island is about 1500 m high and 40-60 km wide. In recent decades, the area has experienced significant atmospheric warming (about 2 degrees C since 1950), which has triggered a vast and spectacular retreat of its floating ice shelves, glacier reduction, a decrease in permanent snow cover and a lengthening of the melt season. AirSAR 2004 is a three-week expedition in Central and South America by an international team of scientists that is using an all-weather imaging tool, called the Airborne Synthetic Aperture Radar (AirSAR), located onboard NASA's DC-8 airborne laboratory. Scientists from many parts of the world are combining ground research with NASA's AirSAR technology to improve and expand on the quality of research they are able to conduct. These photos are from the DC-8 aircraft while flying an AirSAR mission over Antarctica. The Antarctic Peninsula is more similar to Alaska and Patagonia than to the rest of the Antarctic continent. It is drained by fast glaciers, receives abundant precipitation, and melts significantly in the summer months. This region is being studied by NASA using a DC-8 equipped with the Airborne Synthetic Aperture Radar developed by scientists from NASA’s Jet Propulsion Laboratory. AirSAR will provide a baseline model and unprecedented mapping of the region. This data will make it possible to determine whether the warming trend is slowing, continuing or accelerating. AirSAR will also provide reliable information on ice shelf thickness to measure the contribution of the glaciers to sea level.
Introspecting in the Spirit of William James: Comment on Fox, Ericsson, and Best (2011)
ERIC Educational Resources Information Center
Schooler, Jonathan W.
2011-01-01
Fox, Ericsson, and Best's (2011) thoughtful justification of the use of think-aloud protocols for revealing the stream of consciousness comes on the centennial of the death of William James, history's greatest practitioner and advocate of introspection. This confluence naturally invites speculation about how James might have responded to the…
Quality of water in James Creek, Monroe County, Mississippi
Bednar, G.A.
1981-01-01
A short-term quality-of-water study of James Creek near Aberdeen , Mississippi was conducted on November 14-16, 1978, during a period of low streamflow. During the study, the water in the 2.6-mile stream reach was undesireable for many uses. Wastewater inflow immediately upstream of the study area contributed to the dissolved-solids load in James Creek. The specific conductance of the water ranged from 775 to 890 micromhos at the head of the study reach and from 650 to 750 micromhos at the end of the study reach. A substantial biochemical oxygen-demand was evident in James Creek. Five-day biochemical oxygen demand values downstream of a sewage disposal pond outfall ranged from 8.3 to 11 milligrams per liter and dissolved-oxygen concentrations ranged from 0.4 to 4.5 milligrams per liter. Nitrogen and phosphorus compounds and fecal bacteria densities were highest downstream. Total ammonia nitrogen and phosphorus concentrations in the water leaving the study area ranged from 0.29 to 1.4 milligrams per liter and from 0.65 to 1.7 milligrams per liter, respectively. Fecal coliform densities exceeding 50,000 colonies per 100 milliliters of sample were observed in the study area. The median fecal coliform density of the water leaving the study area was 2,800 colonies per 100 milliliters. (USGS)
A 3D-DNA Molecule Made of PlayMais
ERIC Educational Resources Information Center
Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl
2015-01-01
More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…
Cultural Resources Survey of the Angelina Revetment Item, St. James Parish, Louisiana.
1986-10-22
Corps G) of Engineers O New Oreans Dist 0 N In CULTURAL RESOURCES SURVEY OF THE ANGELINA REVETMENT ITEM, ST. JAMES . PARISH, LOUISIANA. FINAL REPORT...PD-86/0 3 AF Go 4. TITLE (ad S-belde) S. TYPE OF REPORT & PENIOO COVERED Cultural Resources Survey of the Final Angelina Revetment Item, St. James...the Angelina Revetment Item, adjacent to the Mississippi River channel, during August and September, 1985. b-The area was settled during the Spanish
Federal Register 2010, 2011, 2012, 2013, 2014
2013-08-19
... Nuclear Operations, Inc., James A. Fitzpatrick Nuclear Power Plant, Vermont Yankee Nuclear Power Station, Pilgrim Nuclear Power Station, Request for Action AGENCY: Nuclear Regulatory Commission. ACTION: Request... that the NRC take action with regard to James A. Fitzpatrick Nuclear Power Plant, Vermont Yankee...
NASA Discusses Upcoming Launch of Next Planet Hunter
2018-03-28
During a press conference at NASA Headquarters in Washington, D.C., astrophysics experts discussed the upcoming launch of NASA’s next planet hunter, the Transiting Exoplanet Survey Satellite (TESS). Scheduled to launch April 16, TESS is expected to find thousands of planets outside our solar system, known as exoplanets, orbiting the nearest and brightest stars in our cosmic neighborhood. Powerful telescopes like NASA’s upcoming James Webb Space Telescope can then further study these exoplanets to search for important characteristics, like their atmospheric composition and whether they could support life.
NASA Astrophysics Data System (ADS)
Millar, W.; White, G. L.; Filipović, M. D.; Hons, A.
2008-06-01
We discuss the means by which students collect, analyze and use original data to fulfill the research component of the Internet-based, professional ``Doctor of Astronomy'' degree, at the James Cook University Centre for Astronomy. We give an example of such data obtained with the 1.9 meter telescope at the South African Astronomical Observatory. We also discuss the use of such data in an introductory level astronomy class at a community college.
ERIC Educational Resources Information Center
Stob, Paul
2012-01-01
On May 31, 1897, William James, one of America's most influential philosophers and psychologists, delivered the first civic oration of his career. The principal orator at the dedication of the Robert Gould Shaw memorial in Boston, James did what commemorative speakers are not supposed to do. He chose to be confrontational and divisive in a…
1. Historic American Buildings Survey James Butters, Photographer. Mar, 28, ...
1. Historic American Buildings Survey James Butters, Photographer. Mar, 28, 1936. GENERAL FRONT VIEW (SOUTHWEST ELEVATION) - Marschalk Printing Office, Wall & Franklin Streets, Natchez, Adams County, MS
Depth Acuity Methodology for Electronic 3D Displays: eJames (eJ)
2016-07-01
AFRL-RH-WP-TR-2016-0060 Depth Acuity Methodology for Electronic 3D Displays: eJames (eJ) Eric L. Heft, John McIntire...AND SUBTITLE Depth Acuity Methodology for Electronic 3D Displays: eJames (eJ) 5a. CONTRACT NUMBER FA8650-08-D-6801-0050 5b. GRANT NUMBER...of 3D electronic displays: one active-eyewear Stereo 3D (S3D) and two non-eyewear full parallax Field-of-Light Display (FoLD) systems. The two FoLD
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
An interview with James Wilbur, Ph.D. General Manager, Life Sciences, Meso Scale Discovery.
Wilbur, James
2004-06-01
James L. Wilbur, Ph.D. received a Bachelor's degree from the University of California, San Diego and a Ph.D. in Chemistry from Stanford University. After completing an NIH Postdoctoral Fellowship with Professor George M. Whitesides in the Department of Chemistry at Harvard University, he joined IGEN International, Inc., where he held a variety of positions in Research and Development. During that time, he was part of the team that developed the core technology and products for Meso Scale Discovery. He assumed his current position in 2001 when Meso Scale Discovery launched the products discussed here.
Astronaut James Newman with latch hook for tether device
NASA Technical Reports Server (NTRS)
1993-01-01
Astronaut James H. Newman, mission specialist, shows off a latch hook for a tether device used during the STS-51 extravehicular activity (EVA) on September 16, 1993. Newman, on Discovery's middeck, appears surrounded by sleep restraints.
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Swyer-James syndrome associated with Noonan syndrome: report of a case.
Lin, Y M; Huang, W L; Hwang, J J; Ko, Y L; Lien, W P
1995-12-01
A 28-year-old man with Noonan syndrome associated with unilateral hyperlucent lung is reported. He had the typical craniofacial appearance and short stature of Noonan syndrome; he had mild mental retardation, atrophic testis, mild funnel chest and kyphosis. cardiovascular abnormalities included asymmetric hypertrophic cardiomyopathy and a significantly different caliber of the left and right pulmonary arteries. The unilateral hyperlucent lung was shown to result from acquired nondestructive emphysema caused by nonvalvular obstruction of the bronchi (Swyer-James syndrome or Macleod's syndrome). To the authors' knowledge, this is the first reported case of Noonan syndrome associated with Swyer-James syndrome.
2. Historic American Buildings Survey James Butters, Photographer April 8, ...
2. Historic American Buildings Survey James Butters, Photographer April 8, 1936 GENERAL REAR VIEW (SOUTHWEST ELEVATION) - Hope Farm (Villa), Auburn Avenue & Homochitto Street, Natchez, Adams County, MS
Detectors for the James Webb Space Telescope near-infrared spectrograph
NASA Astrophysics Data System (ADS)
Rauscher, Bernard J.; Figer, Donald F.; Regan, Michael W.; Boeker, Torsten; Garnett, James; Hill, Robert J.; Bagnasco, Giorgio; Balleza, Jesus; Barney, Richard; Bergeron, Louis E.; Brambora, Clifford; Connelly, Joe; Derro, Rebecca; DiPirro, Michael J.; Doria-Warner, Christina; Ericsson, Aprille; Glazer, Stuart D.; Greene, Charles; Hall, Donald N.; Jacobson, Shane; Jakobsen, Peter; Johnson, Eric; Johnson, Scott D.; Krebs, Carolyn; Krebs, Danny J.; Lambros, Scott D.; Likins, Blake; Manthripragada, Sridhar; Martineau, Robert J.; Morse, Ernie C.; Moseley, Samuel H.; Mott, D. Brent; Muench, Theo; Park, Hongwoo; Parker, Susan; Polidan, Elizabeth J.; Rashford, Robert; Shakoorzadeh, Kamdin; Sharma, Rajeev; Strada, Paolo; Waczynski, Augustyn; Wen, Yiting; Wong, Selmer; Yagelowich, John; Zuray, Monica
2004-10-01
The Near-Infrared Spectrograph (NIRSpec) is the James Webb Space Telescope"s primary near-infrared spectrograph. NASA is providing the NIRSpec detector subsystem, which consists of the focal plane array, focal plane electronics, cable harnesses, and software. The focal plane array comprises two closely-butted λco ~ 5 μm Rockwell HAWAII-2RG sensor chip assemblies. After briefly describing the NIRSpec instrument, we summarize some of the driving requirements for the detector subsystem, discuss the baseline architecture (and alternatives), and presents some recent detector test results including a description of a newly identified noise component that we have found in some archival JWST test data. We dub this new noise component, which appears to be similar to classical two-state popcorn noise in many aspects, "popcorn mesa noise." We close with the current status of the detector subsystem development effort.
Detectors for the James Webb Space Telescope Near-Infrared Spectrograph
NASA Technical Reports Server (NTRS)
Rauscher, Bernard J.; Figer, Donald F.; Regan, Michael W.; Boeker, Torsten; Garnett, James; Hill, Robert J.; Bagnasco, Georgio; Balleza, Jesus; Barney, Richard; Bergeron, Louis E.
2004-01-01
The Near-Infrared Spectrograph (NIRSpec) is the James Webb Space Telescope's primary near-infrared spectrograph. NASA is providing the NIRSpec detector subsystem, which consists of the focal plane array, focal plane electronics, cable harnesses, and software. The focal plane array comprises two closely-butted lambda (sub co) approximately 5 micrometer Rockwell HAWAII- 2RG sensor chip assemblies. After briefly describing the NIRSpec instrument, we summarize some of the driving requirements for the detector subsystem, discuss the baseline architecture (and alternatives), and presents some recent detector test results including a description of a newly identified noise component that we have found in some archival JWST test data. We dub this new noise component, which appears to be similar to classical two-state popcorn noise in many aspects, "popcorn mesa noise." We close with the current status of the detector subsystem development effort.
The James Madison College Student Handbook, 1970-71.
ERIC Educational Resources Information Center
Michigan State Univ., East Lansing. James Madison Coll.
James Madison College of Michigan State University provides a 4-year, residentially-based program devoted to the study of major social, economic, and political policy problems. It offers 5 fields of concentration: (1) Ethnic and Religious Intergroup Relations Policy Problems; (2) International Relations Policy Problems; (3) Justice, Morality and…
Nephrology in A Medicinal Dictionary of Robert James (1703-1776).
Bisaccia, Carmela; De Santo, Natale G; Cirillo, Massimo; Perna, Alessandra; De Santo, Rosalba; Richet, Gabriel
2011-01-01
Robert James was a member of the College of Physicians at Cambridge and a practitioner. He was considered one of the "three best known characters in London--perhaps in Europe. The other two being the lexycographer Samuel Johnson and the Shakespearean actor David Garrick." James became famous for his powerful ability to write and publish, which produced many books, including the ponderous A Medicinal Dictionary, With a History of Drugs, in 3 volumes in folio, published in London in the years 1743-1745, and dedicated to the famous professor and royal physician John Mead. The Dictionary was translated into French by Denis Diderot, François-Vincent Toussaint and Marc Antoine Eidous, and was revised by Juliene T. Busson, president of the University of Paris. During the translation, Diderot learned much biology and medicine, which he used subsequently in developing his Encyclopédie. Interesting chapters are devoted to urine, predictions from urine, bloody urine, good urine, bad urine, urine portending death, diabetes, dropsy, nephritis, stone, ischury, dysury and urine incontinence. In general their strength resides in their accurate clinical descriptions. The paragraphs on urine are concise and clinically sound, and the description of procedures for urine analysis and the utilization of results (quantity, quantity, colors, sediments and consistency) in diagnosis and prognosis of bloody urine is accurate. The section on diabetes is excellent and is comparable to that of Desault written decades later in the Encyclopédie of Diderot. In the chapter on dropsy (he does not use the word oedema), patients are well described and their remedies are appropriate for the time. The contributions of kidney and liver are clear. The plants for renal treatment can be traced to Dioscorides. Concerning dosage, he is precise and helpful to his readers. The chapter on stones is a real masterpiece, clinically well centered and giving all the pertinent information to localize them, their
8. Historic American Buildings Survey, James C. Massey, Photographer November, ...
8. Historic American Buildings Survey, James C. Massey, Photographer November, 1959 INTERIOR LOOKING TO REAR. - Provident Life & Trust Company Bank, 407-409 Chestnut Street, Philadelphia, Philadelphia County, PA
7. Historic American Buildings Survey James Butters, Photographer, April 14, ...
7. Historic American Buildings Survey James Butters, Photographer, April 14, 1936. FRONT VIEW OF SERVANTS HOME (WEST ELEVATION) - Auburn, Auburn Boulevard, Duncan Memorial Park, Natchez, Adams County, MS
3. Historic American Buildings Survey James Butters, Photographer April 8, ...
3. Historic American Buildings Survey James Butters, Photographer April 8, 1936 FRONT VIEW REAR WING (NORTH ELEVATION) - Hope Farm (Villa), Auburn Avenue & Homochitto Street, Natchez, Adams County, MS
4. James L. Dillon and Company, Inc., photographer January, 1967 ...
4. James L. Dillon and Company, Inc., photographer January, 1967 INTERESTING OVAL STAIRWELL, LOOKING STRAIGHT UP FROM SECOND FLOOR - 626 South Front Street (House), Philadelphia, Philadelphia County, PA
Die Another Day, James Bond's smoking over six decades.
Wilson, Nick; Tucker, Anne
2016-09-01
We aimed to examine smoking-related content in all 24 James Bond movies in the Eon Productions series from 1962 to 2015. There were favourable downward trends for any smoking by James Bond (p=0.015 for trend), and for tobacco-related spy-gadgetry (p=0.009). Around 20% of Bond's 60 sexual partners smoked in each decade, and most recently in 2012. There were regular mentions of smoking risks to health (starting from 1967) and product placement of branded packs was present in two movies. Overall, the persisting smoking content remains problematic from a public health perspective, especially given the popularity of this movie series. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
ERIC Educational Resources Information Center
Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.
2014-01-01
The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…
9. Historic American Buildings Survey, James C. Massey, Photographer November, ...
9. Historic American Buildings Survey, James C. Massey, Photographer November, 1959 DETAIL OF EXPOSED ROOF TRUSS. - Provident Life & Trust Company Bank, 407-409 Chestnut Street, Philadelphia, Philadelphia County, PA
7. Historic American Buildings Survey, James C. Massey, Photographer November, ...
7. Historic American Buildings Survey, James C. Massey, Photographer November, 1959 REAR FACADE ON RANSTEAD STREET. - Provident Life & Trust Company Bank, 407-409 Chestnut Street, Philadelphia, Philadelphia County, PA
James Webb Space Telescope (JWST) Town Hall - Panel question and
2016-11-02
James Webb Space Telescope (JWST) Town Hall - Panel question and answer - Bill Ochs; Dr. John Mather; Dr. Eric Smith; Thomas Zurbuchen; Center Director Chris Scolese; NASA Administrator Charlie Bolden.
James Madison's "Public" As Interpreter of the Constitution.
ERIC Educational Resources Information Center
Dewey, Donald O.
James Madison's thoughts on various interpretations of the Constitution maintain that public opinion is the ultimate method of legitimizing the document. The Constitution must prevail against mere public opinion, but public opinion may be used to establish the meaning of the Constitution when conflicting interpretations exist. The public good and…
Finding Our Origins with the Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2003-01-01
NASA's Origins program is a series of space telescopes designed to study the origins of galaxies, stars, planets and life in the universe. In this talk, I will concentrate on the origin and evolution of galaxies, beginning with the Big Bang and tracing what we have learned with the Hubble Space Telescope through to the present day. I will introduce several of the tools that astronomers use to measure distances, measure velocities, and look backwards in time. I will show that results from studies with Hubble have led to plans for its successor, the James Webb Space Telescope, which is designed to find the first galaxies that formed in the distant past. I will finish with a short discussion of other missions in the Origins theme, including the Terrestrial Planet Finder.
Finding our Origins with the Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2004-01-01
NASA s Origins program is a series of space telescopes designed to study the origins of galaxies, stars, planets and life in the universe. In this talk, I will concentrate on the origin and evolution of galaxies, beginning with the Big Bang and tracing what we have learned with the Hubble Space Telescope through to the present day. I will introduce several of the tools that astronomers use to measure distances, measure velocities, and look backwards in time. I will show that results from studies with Hubble have led to plans for its successor, the James Webb Space Telescope, which is designed to find the first galaxies that formed in the distant past. I will finish with a short discussion of other missions in the Origins theme, including the Terrestrial Planet Finder.
10. Historic American Buildings Survey, James C. Massey, Photographer November, ...
10. Historic American Buildings Survey, James C. Massey, Photographer November, 1959 DETAIL OF COLUMN CAPITAL, FRONT ALCOVE. - Provident Life & Trust Company Bank, 407-409 Chestnut Street, Philadelphia, Philadelphia County, PA
5. William Beardsley standing along canal section. Photographer James Dix ...
5. William Beardsley standing along canal section. Photographer James Dix Schuyler, 1903. Source: Schuyler report. - Waddell Dam, On Agua Fria River, 35 miles northwest of Phoenix, Phoenix, Maricopa County, AZ
James Webb Space Telescope Optical Telescope Element Mirror Development History and Results
NASA Technical Reports Server (NTRS)
Feinber, Lee D.; Clampin, Mark; Keski-Kuha, Ritva; Atkinson, Charlie; Texter, Scott; Bergeland, Mark; Gallagher, Benjamin B.
2012-01-01
In a little under a decade, the James Webb Space Telescope (JWST) program has designed, manufactured, assembled and tested 21 flight beryllium mirrors for the James Webb Space Telescope Optical Telescope Element. This paper will summarize the mirror development history starting with the selection of beryllium as the mirror material and ending with the final test results. It will provide an overview of the technological roadmap and schedules and the key challenges that were overcome. It will also provide a summary or the key tests that were performed and the results of these tests.
A Conversation with James E. Gilliam on Autism.
ERIC Educational Resources Information Center
Gilliam, James E.; Smith, Burt Kruger
James E. Gilliam is the author of a book entitled "Autism," published in 1981 by Charles C. Thomas Company. This brochure records an interview with Mr. Gilliam conducted by Burt Smith and later converted to narrative form for publication by Charlene Warren. Adapted from a series of radio broadcasts entitled "The Human…
Looking Backward: James Madison University's General Education Reform.
ERIC Educational Resources Information Center
Reynolds, Charles W.; Allain, Violet Anselmini; Erwin, T. Dary; Halpern, Linda Cabe; McNallie, Robin; Ross, Martha K.
1998-01-01
Describes the new general education program at James Madison University (Virginia) and the process by which it was developed. Indicates that the program is organized by five broad areas of knowledge that are defined by interdisciplinary clusters of learning objectives, which in turn were developed using input from every academic department on…
James Williamson d/b/a Golden Triangle Builders Information Sheet
James Williamson d/b/a Golden Triangle Builders (the Company) is located in Pittsburgh, Pennsylvania. The settlement involves renovation activities conducted at property constructed prior to 1978, located in Pittsburgh, Pennsylvania.
6. Watchman Robert 'Jerry' Jones at Camp Dyer. Photographer James ...
6. Watchman Robert 'Jerry' Jones at Camp Dyer. Photographer James Dix Schuyler, 1903. Source: Schuyler report. - Waddell Dam, On Agua Fria River, 35 miles northwest of Phoenix, Phoenix, Maricopa County, AZ
5. Historic American Buildings Survey James Rainey, Photographer May 10, ...
5. Historic American Buildings Survey James Rainey, Photographer May 10, 1936 GRINDING PLATFORM, VIEW OF INTERIOR LOOKING WEST - Old Town Mill, Mill Brook, near Mill Street, New London, New London County, CT
The James Webb Space Telescope Integrated Science Instrument Module
NASA Technical Reports Server (NTRS)
Greenhouse, Matthew A.; Sullivan, Pamela C.; Boyce, Leslye A.; Glazer, Stuart D.; Johnson, Eric L.; McCloskey, John C.; Voyton, Mark F.
2004-01-01
The Integrated Science Instrument Module of the James Webb Space Telescope is described from a systems perspective with emphasis on unique and advanced technology aspects. The major subsystems of this flight element are described including: structure, thermal, command and data handling, and software.
The King James Bible and the Politics of Religious Education: Secular State and Sacred Scripture
ERIC Educational Resources Information Center
Gearon, Liam
2013-01-01
This article provides an outline historical-educational analysis of the King James Bible from its 1611 publication through to its four-hundredth anniversary commemoration in 2011. With particular focus on England, the article traces the educational impact of the King James Bible and charts, in the country of its origin, its progressive decline in…
"To Mediate Relevantly": A Response to James Simpson
ERIC Educational Resources Information Center
Waters, Alan
2009-01-01
In Waters (2009), it was contended that, because of its ideological orientation, a good deal of applied linguistics for language teaching (ALLT) fails to "mediate relevantly" between academic and practitioner perspectives. James Simpson's rejoinder to my article (Simpson 2009) attempts to refute its claims. However, in my view, it fails to do so,…
Engineering new medicine: an interview with James Collins.
Collins, James
2010-01-01
At first glance, the commonality among synthetic gene networks, nerve cell response times and the emergence of antibiotic resistance is obscure. Yet, when speaking with James (Jim) Collins, the relationship becomes clear: all are applications-oriented problems, and all inspire unique approaches from this unusual engineer who is empowered by his freedom to fail.
James Van Allen and His Namesake NASA Mission
NASA Astrophysics Data System (ADS)
Baker, D. N.; Hoxie, V. C.; Jaynes, A.; Kale, A.; Kanekal, S. G.; Li, X.; Reeves, G. D.; Spence, H. E.
2013-12-01
In many ways, James A. Van Allen defined and "invented" modern space research. His example showed the way for government-university partners to pursue basic research that also served important national and international goals. He was a tireless advocate for space exploration and for the role of space science in the spectrum of national priorities.
James Madison's Practical Ideals for the 1990s.
ERIC Educational Resources Information Center
Delattre, Edwin J.
This paper examines recent behavior of public officials at various levels of government in the United States, finds a systemic failure to meet ethical standards, and concludes that the wisdom of James Madison has much applicability to current times. Given his keen perception of human nature, Madison would not be too surprised at today's poor…
Qualitative research in psychology: Could William James get a job?
Marchel, Carol; Owens, Stephanie
2007-11-01
Considering the case of William James, the author examines the likelihood of a successful career as a qualitative researcher in contemporary U.S. psychology. Fifty-seven journals affiliated with the American Psychological Association or its divisions were analyzed to show the place of qualitative research in U.S. psychology over the past 50 years. Journal abstracts, mission statements, and a short e-mail questionnaire from editors were used to understand patterns and trends in qualitative research in U.S. psychology. Editors are generally accepting of qualitative work, although mission statements do not always signal likely interest in qualitative work. The amount of qualitative work published is comparably low, but patterns of increased publication are found in some journals. Trends in methodologies, topics of research, and ways in which qualitative research enters journals over time are discussed. Suggestions for the publication of qualitative work are provided.
Launch Window Trade Analysis for the James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Yu, Wayne H.; Richon, Karen
2014-01-01
The James Webb Space Telescope (JWST) is a large-scale space telescope mission designed to study fundamental astrophysical questions ranging from the formation of the universe to the origin of planetary systems and the origins of life. JWSTs orbit design is a Libration Point Orbit (LPO) around the Sun-Earth/Moon (SEM) L2 point for a planned mission lifetime of 10.5 years. The launch readiness period for JWST is from Oct 1st, 2018 November 30th, 2018. This paper presents the first launch window analysis for the JWST observatory using finite-burn modeling; previous analysis assumed a single impulsive midcourse correction to achieve the mission orbit. The physical limitations of the JWST hardware stemming primarily from propulsion, communication and thermal requirements alongside updated mission design requirements result in significant launch window within the launch readiness period. Future plans are also discussed.
6. Historic American Buildings Survey James Rainey, Photographer May 7, ...
6. Historic American Buildings Survey James Rainey, Photographer May 7, 1936 STAIRS FROM ROOM OF SECRETARY OF STATE SECOND FLOOR (Looking North) - Old State House, Main Street & Central Row, Hartford, Hartford County, CT
Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A
2011-03-07
Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.
The James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2011-01-01
The James Webb Space Telescope is the scientific successor to the Hubble and Spitzer Space Telescopes, and is currently the largest scientific project under construction in the United States. It will be a large (6.6m) cold (50K) telescope launched in about 5 years into orbit around the second Earth-Sun Lagrange point. It is a partnership of NASA with the European and Canadian Space Agencies. Science with the James Webb Space Telescope falls into four themes. The End of the Dark Ages: First Light and Reionization theme seeks to identify the first luminous sources to form and to determine the ionization history of the universe. The Assembly of Galaxies theme seeks to determine how galaxies and the dark matter, gas, stars, metals, morphological structures, and black holes within them evolved from the epoch of reionization to the present. The Birth of Stars and Proto planetary Systems theme seeks to unravel the birth and early evolution of stars, from infall onto dust-enshrouded protostars, to the genesis of planetary systems. The Planetary Systems and the Origins of Life theme seeks to determine the physical and chemical properties of planetary systems around nearby stars and of our own, and investigate the potential for life in those systems. Webb will have four instruments: The Near-Infrared Camera, the Near-Infrared multi-object Spectrograph, and the Tunable Filter Imager will cover the wavelength range 0.6 to 5 microns, while the Mid-Infrared Instrument will do both imaging and spectroscopy from 5 to 28.5 microns. I will conclude the talk with a description of recent technical progress in the construction of the observatory.
The James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2011-01-01
The James Webb Space Telescope is the scientific successor to the Hubble and Spitzer Space Telescopes, and is currently the largest scientific project under construction in the United States. It will be a large (6.6m) cold (50K) telescope launched into orbit around the second Earth-Sun Lagrange point. It is a partnership of NASA with the European and Canadian Space Agencies. Science with the James Webb Space Telescope falls into four themes. The End of the Dark Ages: First Light and Reionization theme seeks to identify the first luminous sources to form and to determine the ionization history of the universe. The Assembly of Galaxies theme seeks to determine how galaxies and the dark matter, gas, stars, metals, morphological structures, and black holes within them evolved from the epoch of reionization to the present. The Birth of Stars and Protoplanetary Systems theme seeks to unravel the birth and early evolution of stars, from infall onto dust-enshrouded protostars, to the genesis of planetary systems. The Planetary Systems and the Origins of Life theme seeks to determine the physical and chemical properties of planetary systems around nearby stars and of our own, and investigate the potential for life in those systems. Webb will have four instruments: The Near-Infrared Camera, the Near-Infrared multi-object Spectrograph, and the Tunable Filter Imager will cover the wavelength range 0.6 to 5 microns, while the Mid-Infrared Instrument will do both imaging and spectroscopy from 5 to 28.5 microns. I will conclude the talk with a description of recent technical progress in the construction of the observatory.
The James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2011-01-01
The James Webb Space Telescope is the scientific successor to the Hubble and Spitzer Space Telescopes, and is currently the largest scientific project under construction in the United States. It will be a large (6.6m) cold (50K) telescope launched in about 5 years into orbit around the second Earth-Sun Lagrange point. It is a partnership of NASA with the European and Canadian Space Agencies. Science with the James Webb Space Telescope falls into four themes. The End of the Dark Ages: First Light and Reionization theme seeks to identify the first luminous sources to form and to determine the ionization history of the universe. The Assembly of Galaxies theme seeks to determine how galaxies and the dark matter, gas, stars, metals, morphological structures, and black holes within them evolved from the epoch of reionization to the present. The Birth of Stars and Protoplanetary Systems theme seeks to unravel the birth and early evolution of stars, from infall onto dust-enshrouded protostars, to the genesis of planetary systems. The Planetary Systems and the Origins of Life theme seeks to determine the physical and chemical properties of planetary systems around nearby stars and of our own, and investigate the potential for life in those systems. Webb will have four instruments: The Near-Infrared Camera, the Near-Infrared multi-object Spectrograph, and the Tunable Filter Imager will cover the wavelength range 0.6 to 5 microns, while the Mid-Infrared Instrument will do both imaging and spectroscopy from 5 to 28.5 microns. I will conclude the talk with a description of recent technical progress in the construction of the observatory.
Astronaut James Lovell hoisted from water by recovery helicopter
NASA Technical Reports Server (NTRS)
1965-01-01
Astronaut James A. Lovell Jr., pilot of the Gemini 7 space flight, is hoisted from the water by a recovery helicopter from the Aircraft Carrier U.S.S. Wasp. Astronaut Frank Borman, command pilot, waits in the raft to be hoisted aboard the helicopter.
Astronaut James Newman with latch hook for tether device
1993-09-19
STS051-26-002 (12-22 Sept 1993) --- Astronaut James H. Newman, mission specialist, shows off a latch hook for a tether device used during the STS-51 extravehicular activity (EVA) on September 16, 1993. Newman, on Discovery's middeck, appears surrounded by sleep restraints.
Picking up Galen: James Joyce in Cecilia Street.
Lyons, J B
1997-07-01
James Joyce (1882-1941) registered as a student of the Catholic University Medical School, Cecilia Street, in 1902. His attendance in November was brief; by early December, Joyce was in Paris. A recently-acquired Guide for Medical Students, a booklet compiled by Ambrose Birmingham, dean of the Cecilia Street school, sheds light on this hitherto obscure episode.
James Madison High: A School at the Crossroads
ERIC Educational Resources Information Center
Stroup, John T.; Salmonowicz, Michael J.; Broom, Christopher C.
2007-01-01
This case tells the story of James Madison High School, which became the epicenter of a debate over the future reorganization and control of large secondary schools in the Los Angeles Unified School District (LAUSD). The LAUSD, recently taken over by the newly elected mayor, was fighting for control of this 3,000-student high school with a charter…
The James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Mather, John C.
2003-01-01
The James Webb Space Telescope (JWST) will extend the discoveries of the Hubble Space Telescope by deploying a large cooled infrared telescope at the Sun-Earth Lagrange point L2. With a 6 m aperture and three instruments covering the wavelength range from 0.6 to 28 pm, it will provide sensitivities orders of magnitude better than any other facilities. It is intended to observe the light from the first galaxies and the first supernovae, the assembly of galaxies, and the formation and evolution of stars and planetary systems. In this talk I will review the scientific objectives, the hardware concepts and technology, and the predicted system performance.
NASA Technical Reports Server (NTRS)
Mather, John C.
2003-01-01
The James Webb Space Telescope (JWST) will extend the discoveries of the Hubble Space Telescope by deploying a large cooled infrared telescope at the Sun-Earth Lagrange point L2. With a 6 m aperture and three instruments covering the wavelength range from 0.6 to 28 microns, it will provide sensitivities orders of magnitude better than any other facilities. It is intended to observe the light from the first galaxies and the first supernovae, the assembly of galaxies, and the formation and evolution of stars and planetary systems. In this talk I will review the scientific objectives, the hardware concepts and technology, and the predicted system performance.
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-09
... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2012-0114] RIN 1625-AA00 Safety Zone; Rocketts Red Glare Fireworks, Ancarrows Landing Park, James River, Richmond, VA... Glare Fireworks, Ancarrows Landing Park, James River, Richmond, VA in the Federal Register (76 FR 13525...
President Nixon at Hickam AFB congratulates Astronaut James Lovell
NASA Technical Reports Server (NTRS)
1970-01-01
President Richard M. Nixon and Astronaut James A. Lovell Jr., Apollo 13 commander, shake hands at special ceremonies at Hickam Air Force Base, Hawaii. President Nixon was in Hawaii to present the Apollo 13 crew with the Presidential Medal of Freedom, the nation's highest civilian honor.
STS-69 Mission Specialist James H. Newman in white room
NASA Technical Reports Server (NTRS)
1995-01-01
At Launch Pad 39A, STS-69 Mission Specialist James H. Newman chats with white room closeout crew members Rene Arriens (far left), Travis Thompson and Bob Saulnier (right) prior to entering the Space Shuttle Endeavour.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
Karl Pribram, the James Arthur Lectures, and What Makes Us Human
Tattersall, Ian
2006-01-01
Background The annual James Arthur lecture series on the Evolution of the Human Brain was inaugurated at the American Museum of Natural History in 1932, through a bequest from a successful manufacturer with a particular interest in mechanisms. Karl Pribram's thirty-ninth lecture of the series, delivered in 1970, was a seminal event that heralded much of the research agenda, since pursued by representatives of diverse disciplines, that touches on the evolution of human uniqueness. Discussion In his James Arthur lecture Pribram raised questions about the coding of information in the brain and about the complex association between language, symbol, and the unique human cognitive system. These questions are as pertinent today as in 1970. The emergence of modern human symbolic cognition is often viewed as a gradual, incremental process, governed by inexorable natural selection and propelled by the apparent advantages of increasing intelligence. However, there are numerous theoretical considerations that render such a scenario implausible, and an examination of the pattern of acquisition of behavioral and anatomical novelties in human evolution indicates that, throughout, major change was both sporadic and rare. What is more, modern bony anatomy and brain size were apparently both achieved well before we have any evidence for symbolic behavior patterns. This suggests that the biological substrate underlying the symbolic thought that is so distinctive of Homo sapiens today was exaptively achieved, long before its potential was actually put to use. In which case we need to look for the agent, perforce a cultural one, that stimulated the adoption of symbolic thought patterns. That stimulus may well have been the spontaneous invention of articulate language. PMID:17134484
NASA Invites Artists to Visit James Webb Space Telescope
2017-12-08
Witness History: Be inspired by giant, golden, fully-assembled James Webb Space Telescope mirror on display at NASA Goddard. Read more: go.nasa.gov/2dUOmSX Are you an artist? If so, we have a unique opportunity to view the amazing and aesthetic scientific marvel that is the James Webb Space Telescope. Because of Webb’s visually striking appearance, we are hosting a special viewing event on Wednesday, Nov. 2, 2016, at NASA’s Goddard Space Flight Center in Greenbelt, Maryland. Artists are invited to apply to attend. Credit: NASA/Goddard/Chris Gunn NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA’s accomplishments by contributing compelling scientific knowledge to advance the Agency’s mission. Follow us on Twitter Like us on Facebook Find us on Instagram
Berkas, W.R.
1987-01-01
Before upgrading the Southwest Wastewater-Treatment Plant near Springfield, Missouri, to tertiary treatment, adverse water quality conditions resulting from discharge of wastewater effluent to Wilson Creek were documented in the creek and in the James River. About 7 years after the upgrading of the treatment plant, traveltime, reaeration, and water quality characteristics were determined in Wilsons Creek and the James River. Traveltime was measured once in Wilsons Creek and twice in the James River during low-flow conditions. Traveltimes in the James River were estimated for discharge between 55 and 200 cu ft/sec at a site near Boaz. Reaeration coefficients were calculated for five reaches in Wilsons Creek and the James River using the modified-tracer technique. Calculated reaeration coefficients were compared with coefficients predicted by twelve empirical equations and one equation was chosen that best fit the data. Water quality data were collected during two 44-hr periods, August 14 to 16, 1984, and July 23 to 25, 1985. Samples were collected at the outflow of the Southwest Wastewater Treatment Plant at seven sites along Wilsons Creek and the James River. Dissolved-oxygen concentrations in Wilsons Creek and the James River were all larger than Missouri 's water quality standard of 5.0 mg/l. Ammonia concentrations and 5-day carbonaceous biochemical oxygen demands were small, which indicated that the oxygen consumption by oxidizing ammonia and carbonaceous organic materials would be insignificant. Measured streambed oxygen demand in the James River was largest directly downstream from Wilsons Creek. (USGS)
4. Historic American Buildings Survey James C. Massey, Photographer 1964 ...
4. Historic American Buildings Survey James C. Massey, Photographer 1964 MAIN (SOUTH) ENTRANCE (4x5' b&w film copy neg. from 35mm slide) - Albert F. Madlener House, 4 West Burton Place, Chicago, Cook County, IL
James Franck and the ÂFranck ReportÂ
, The University of Chicago "James Franck was one of Germany's leading experimental physicists in Spectroscopy and Franck Condon Factors (video) Top Some links on this page may take you to non-federal websites
Pestalozzi and James Pierrepont Greaves: A Shared Educational Philosophy.
ERIC Educational Resources Information Center
Latham, Jackie E. M.
2002-01-01
Focuses on Johann H. Pestalozzi, James Pierrepont Greaves, and Reverend Charles Mayo. States that Greaves and Mayo disseminated Pestalozzi's ideas and techniques in England. Explains that Pestalozzi and Greaves trained elementary teachers to view students' talents and personal growth as a whole person concept. Argues less effort would limit…
Federal Register 2010, 2011, 2012, 2013, 2014
2013-02-15
... Operation Regulation; James River, Between Isle of Wight and Newport News, VA AGENCY: Coast Guard, DHS... River, mile 5.0, between Isle of Wight and Newport News, VA. This deviation is necessary to facilitate... Isle of Isle and Newport News, VA opens on signal. The James River Bridge has vertical clearances in...
James J. Gallagher: Man in the White Hat
ERIC Educational Resources Information Center
Jolly, Jennifer L.; Robinson, Ann
2014-01-01
In classic Western movies, the good guy could be frequently identified by his trademark white Stetson hat, whereas the bad guy always wore black. James J. Gallagher wore many hats during his career that spanned over six decades; he too would be known as the "man in the white hat,"--trusted to do the right thing. From 1967 to 1970,…
5. Historic American Buildings Survey James C. Massey, Photographer 1964 ...
5. Historic American Buildings Survey James C. Massey, Photographer 1964 MAIN (SOUTH) ENTRANCE DETAIL (4x5' b&w film copy neg. from 35mm slide) - Albert F. Madlener House, 4 West Burton Place, Chicago, Cook County, IL
Sir James Reid and the Death of Queen Victoria: An Early Model for End-of-Life Care.
Abrams, Robert C
2015-12-01
An appraisal of the last ten days of Queen Victoria's life, viewed primarily from the perspective of her personal physician, Sir James Reid, is presented. Sir James' clinical encounters with his patient and the Royal Family are examined to reveal his strategic and medical thinking and gauge his level of success in basic palliative aims. It was found that the lack of effective medical interventions, tensions within the Royal Family, the importance of his post to Sir James' professional career, and the political ramifications unavoidably connected with the illness of a head of state, all presented challenges to Reid's efforts to ease the physical and emotional pain of Queen Victoria's dying. Key features of Sir James' approach included reliance on physician-patient and physician-family relationships, emphasis on emotional support for the patient, and the careful selection of interventions for the family. In the first years of the 20th century, an era when the contemporary concepts of palliative care, hospice, and family dynamics did not exist, Sir James' management of the Queen's final illness suggested an early model for end-of-life care. By the end of Queen Victoria's life, Sir James was seen to have preserved his patient's comfort and dignity, at the same time advancing family and societal acceptance of the death of this matriarchal figure. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Comparing the Concept of Caring in Islamic Perspective with Watson and Parse's Nursing Theories
Sadat-Hoseini, Akram-Sadat; Khosropanah, Abdoul-Hosein
2017-01-01
Background: In the nursing profession, it is apparent that the definition of caring differs between various perspectives. This article compares the difference of caring in Islamic with the Parse and Watson theories. Materials and Methods: In this study, we use concept analyses of Walker–Avants and compare research methods. Material used is all Islamic documents. Results: According to Islamic documents, there are four major types of caring, namely, (1) God taking care of humans, (2) Humans taking care of themselves, (3) Other humans taking care of humans, and (4) The universe taking care of humans and vice versa. God caring for humans affects the three other types of caring. All three definitions of caring have humanistic and holistic view. According to Watson's and Parse's definition, the development of the caring theory is based on the person's experiences that result from human interactions with, and experiences of, their environment. In Islamic definition, although the caring process is affected by environmental experiences and interactions, human not developed only base the effect of environment; rather, it is developed on the basis of human nature and divine commands. God taking care of humans is specific to Islamic perspective and is not found in other definitions. Islamic perspective maintains that God is the creator of humanity and is in charge of guiding humans. A superior form of human can always be discovered. Conclusions: Thus, nursing implementation in Muslims must be done based on Islamic commands, and Islamic commands are superior to human experiences. However, Islamic commands interpreted with human wisdom and thought can be striving toward excellence. PMID:28584543
A Scientific Revolution: The Hubble and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2010-01-01
Astronomy is going through a scientific revolution, responding to a flood of data from the Hubble Space Telescope, other space missions, and large telescopes on the ground. In this talk, I will discuss some of the important discoveries of the last decade, from dwarf planets in the outer Solar System to the mysterious dark energy that overcomes gravity to accelerate the expansion of the Universe. The next decade will be equally bright with the newly refurbished Hubble and the promise of its successor, the James Webb Space Telescope. An infrared-optimized 6.5m space telescope, Webb is designed to find the first galaxies that formed in the early universe and to peer into the dusty gas clouds where stars and planets are born. With MEMS technology, a deployed primary mirror and a tennis-court sized sunshield, the mission presents many technical challenges. I will describe Webb's scientific goals, its design and recent progress in constructing the observatory. Webb is scheduled for launch in 2014.
ERIC Educational Resources Information Center
Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian
2014-01-01
In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…
Astronaut James D. van Hoften examines student experiment on Challenger
NASA Technical Reports Server (NTRS)
1984-01-01
Astronaut James D. van Hoften, 41-C mission specialist, holds an aluminum box full of honeybees. The experiment in earth orbit is duplicated with another colony of the bees on earth. This is an experiment submitted by student researchers.
ASTRONAUT JAMES A. LOVELL, JR. - MISC. - GT-7 RECOVERY
1965-12-18
S65-61828 (18 Dec. 1965) --- Astronaut James A. Lovell Jr., pilot of the Gemini-7 spaceflight, is hoisted from the water by a recovery helicopter from the Aircraft Carrier USS Wasp. Astronaut Frank Borman, command pilot, waits in the raft to be hoisted aboard the helicopter. Photo credit: NASA
THE JAMES MADISON WOOD QUADRANGLE, STEPHENS COLLEGE, COLUMBIA, MISSOURI.
ERIC Educational Resources Information Center
MCBRIDE, WILMA
THE JAMES MADISON WOOD QUADRANGLE AT STEPHENS COLLEGE IS A COMPLEX OF BUILDINGS DESIGNED TO MAKE POSSIBLE A FLEXIBLE EDUCATIONAL ENVIRONMENT. A LIBRARY HOUSES A GREAT VARIETY OF AUDIO-VISUAL RESOURCES AND BOOKS. A COMMUNICATION CENTER INCORPORATES TELEVISION AND RADIO FACILITIES, A FILM PRODUCTION STUDIO, AND AUDIO-VISUAL FACILITIES. THE LEARNING…
[Delocalizing the mind. Peirce, James, Wittgenstein, Descombes].
Chauviré, Christiane
2010-01-01
The cognitive sciences have breathed fresh air into the old problem of localizing mental functions, which was often laughed off. Regarding the most philosophical form of the question on the localization of the mind, authors such as Peirce, James, Wittgenstein, and most recently Descombes have imagined delocalizing the mind in order to spread the conviction that the idea itself of a location of the mental is meaningless and to criticize the localisationism of today's cognitive scientists.
NASA Astrophysics Data System (ADS)
Olczak, Gene; Fischer, David J.; Connelly, Mark; Wells, Conrad
2011-09-01
The James Webb Space Telescope (JWST) integration includes a center of curvature test on its 18 primary mirror segment assemblies (PMSAs). This important test is the only ground test that will demonstrate the ability to align all 18 PMSAs. Using a multi-wavelength interferometer (MWIF) integrated to the test bed telescope (TBT), a one-sixth scale model of the JWST, we verify our ability to align and phase the 18 PMSAs. In this paper we will discuss data analysis and test results when using the MWIF to align the segments of the TBT in preparation for alignment of the JWST.
Reaching beyond Uncle William: a century of William James in theory and in life.
Croce, Paul J
2010-11-01
During the hundred years since his death, James's works have developed a reputation for literary flair and personal appeal, but also for inconsistency and lack of rigor; this has contributed to more admiration than influence. He had a talent rare among intellectuals for popularization of complex ideas. Meanwhile, his difficult coming of age and his compelling personality have contributed to an iconic status as a kind of uncle figure in philosophy, psychology, religious studies, and more fields that he influenced, and in American intellectual life in general, rather than as a major philosopher and scholar. Often reflecting these ways of depicting James, his biographies have gone through three phases: in the early-to-middle twentieth century, emphasis on his development of theories as solutions to personal problems; since the 1960s, increased scrutiny of deep troubles in his private life; and recently renewed attention to intellectual factors especially as amplified by greater appreciation of James's theories in the last generation. Now, with so much knowledge and insight achieved for understanding his personal life and his contributions to many fields, a next frontier for biographical work will be in synthesis of these strands of the life of William James. Recent and prospective work offers the promise of finding deeper meaning and implications in his work beyond, and even through, his informal style, and with integration of his apparent inconsistencies.
Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J
2001-06-01
A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.
Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian
2014-04-01
The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.
History through Red Eyes: A Conversation with James Loewen
ERIC Educational Resources Information Center
Jetty, Mike
2006-01-01
This article presents a conversation with James Loewen. Loewen is an author, historian, and professor. In a recent conversation with the author, he shared his views on how American Indian topics and events are traditionally taught and offered his insights into what teachers can do to accommodate multiple perspectives in their examination of…
Beyond Walls: A Strategic Plan for James White Library.
ERIC Educational Resources Information Center
Andrews Univ., Berrien Springs, MI. James White Library.
The strategic plan for the James White Library of Andrews University uses the phrase "beyond walls," rather than the catchphrase "library without walls," to acknowledge that printed matter is here to stay but that the paradigm in which it operates is open to innovation and exploration. The fundamental changes taking place in…
A Shattering Epiphany in James Joyce's "Araby"
ERIC Educational Resources Information Center
Rokeya, Ms.; Ahammed, A.K. Zunayet
2017-01-01
This article attempts to show an adolescent boy's continuing process of self-realisation through his disillusionment with the bleak reality of Dublin in the early twentieth century in the short story "Araby" by James Joyce. Brought up in the drab and deadening surroundings with his uncle and aunt in conservative Catholic cultures, the…
The James Webb Space Telescope and its Potential for Exoplanet Science
NASA Technical Reports Server (NTRS)
Clampin, Mark
2008-01-01
The James Webb Space Telescope (JWST) is a large aperture (6.5 meter), cryogenic space telescope with a suite of near and mid-infrared instruments covering the wavelength range of 0.6 microns to 28 microns. JWST s primary science goal is to detect and characterize the first galaxies. It will also study the assembly of galaxies, star formation, and the formation of evolution of planetary systems. Recent progress in hardware development for the observatory will be presented, including a discussion of the status of JWST s optical system and Beryllium mirror fabrication, progress with sunshield prototypes, and recent changes in the integration and test configuration. We also review the expected scientific performance of the observatory for observations of exosolar planets by means of transit imaging and spectroscopy and direct imaging. We also review the recent discovery of Fomalhaut B and implications for debris disk imaging nd exoplanet detection with JWST.
Astronomy from Space: The Hubble, Herschel and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2009-01-01
Space-based astronomy is going through a renaissance, with three Great Observatories currently flying: Hubble in the visible and ultraviolet, Spitzer in the infrared and Chandra in X-rays. The future looks equally bright. The final servicing mission to Hubble will take place in February 2009 and promises to make the observatory more capable than ever with two new cameras, and refurbishment that will allow it to last at least five years. The upcoming launch of the Herschel Space Telescope will open the far-infrared to explore the cool and dusty Universe. Finally, we look forward to the launch of the James Webb Space Telescope in 2013, which wil provide a successor to both Hubble and Spitzer. In this talk, the author discusses some of the highlights of scientific discovery in the last 10 years and reveals the promise to the next 10 years.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 33 Navigation and Navigable Waters 2 2014-07-01 2014-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 2 2011-07-01 2011-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...
Code of Federal Regulations, 2013 CFR
2013-07-01
... 33 Navigation and Navigable Waters 2 2013-07-01 2013-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...
Code of Federal Regulations, 2012 CFR
2012-07-01
... 33 Navigation and Navigable Waters 2 2012-07-01 2012-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...
Federal Register 2010, 2011, 2012, 2013, 2014
2012-10-23
... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2012-0939] RIN 1625-AA00 Safety Zone; Steam Ship Col. James M. Schoonmaker Relocation Project, Maumee River, Toledo, OH...-0939 as follows: Sec. 165.T09-0939 Safety Zone; Steam Ship Col. James M. Schoonmaker relocation project...
Reflections on Policy in Gifted Education: James J. Gallagher
ERIC Educational Resources Information Center
Brown, Elissa F.; Garland, Rebecca B.
2015-01-01
In this article, Brown and Garland, reflect on issues raised by James J. Gallagher, such as educational policies helping to create and support an infrastructure within which the needs of students can be addressed. Gallagher felt that a strong federal policy, such as IDEA, was critical to building and maintaining a solid infrastructure. Gallagher…
Dr. John Mather and the James Webb Space Telescope
2017-12-08
Nobel Laureate and James Webb Space Telescope project scientist Dr. John Mather takes a selfie with the telescope. May 4, 2016 was a rare day for JWST, as it briefly faced the cleanroom observation window. The telescope was eventually rotated face-down in prep for the installation of the flight instruments. Credit: Meredith Gibb
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
Astronaut James Newman works with computers and GPS
1993-09-20
STS051-16-028 (12-22 Sept 1993) --- On Discovery's middeck, astronaut James H. Newman, mission specialist, works with an array of computers, including one devoted to Global Positioning System (GPS) operations, a general portable onboard computer displaying a tracking map, a portable audio data modem and another payload and general support computer. Newman was joined by four other NASA astronauts for almost ten full days in space.
Consciousness, social heredity, and development: the evolutionary thought of James Mark Baldwin.
Wozniak, Robert H
2009-01-01
James Mark Baldwin is one of the most important and least known early American scientific psychologists. Drawing inspiration from Charles Darwin and other evolutionists of the period, Baldwin developed a biosocial theory of psychological development that influenced both Jean Piaget and Lev S. Vygotsky; and he proposed a mechanism relating learned adaptations in the individual to phylogenesis (frequently termed the "Baldwin effect") that is of considerable interest to those currently modeling processes of learning and evolution. After a brief introduction to Baldwin's career, this article describes the intellectual context within which his evolutionary thinking developed. Three of his most important contributions are then discussed: his theory of individual adaptation or learning, his concept of "social heredity," and his articulation of the "Baldwin effect." The article concludes with a brief evaluation of the contemporary importance of Baldwin's ideas. 2009 APA, all rights reserved
Keening Woman and Today: James Welch's Early Unpublished Novel
ERIC Educational Resources Information Center
Orton, Thomas
2006-01-01
It was most likely in the spring of 1966 that the late American Indian novelist James Welch wrote his first novel, predating his first published fiction by eight years. The titleless, hand-corrected typescript, stored in his Missoula home for many years, is 114 pages long and unfinished. The book is playful and experimental the way warm-ups…
Alternative Fuels Data Center: James Madison University Teaches Alternative
TransportationA> James Madison University Teaches Alternative Transportation to someone by E-mail public. For information about this project, contact Virginia Clean Cities. Download QuickTime Video Videos Photo of a car Electric Vehicles Charge up at State Parks in West Virginia Dec. 9, 2017 Photo of a
APOLLO 13 CREW JOHN SWIGERT, JAMES LOVELL, AND FRED HAISE
NASA Technical Reports Server (NTRS)
1970-01-01
John L. Swigert, Jr., left, the Apollo 13 backup crewman being considered as command module pilot in place of Thomas K. Mattingly II because of the latter's exposure to measles, has been training with the prime crew -- James A. Lovell, Jr., center and Fred W. Haise, Jr.
75 FR 16520 - James A. Fitzpatrick Nuclear Power Plant; Exemption
Federal Register 2010, 2011, 2012, 2013, 2014
2010-04-01
... date for all operating nuclear power plants, but noted that the Commission's regulations provide... Power Plant; Exemption 1.0 Background Entergy Nuclear Operations, Inc. (the licensee) is the holder of Facility Operating License No. DPR-59, which authorizes operation of the James A. FitzPatrick Nuclear Power...
The Towers Watson Approach to Improving Corporate Wellness.
Wootton, Adam
2012-06-01
Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-27
... Federal Health Care Center Demonstration Project AGENCY: Office of the Secretary, Department of Defense. ACTION: Notice of TRICARE Co-Pay waiver at Captain James A. Lovell Federal Health Care Center... ``TRICARE Co-Pay Waiver at Captain James A. Lovell Federal Health Care (FHCC) Demonstration Project.'' Under...
7. VARIABLEANGLE LAUNCHER DEDICATION PLAQUE SHOWING JAMES H. JENNISON (LEFT), ...
7. VARIABLE-ANGLE LAUNCHER DEDICATION PLAQUE SHOWING JAMES H. JENNISON (LEFT), AND W.H. SAYLOR (RIGHT), AT THE DEDICATION CEREMONY, May 7, 1948. (Original photograph in possession of Dave Willis, San Diego, California.) - Variable Angle Launcher Complex, CA State Highway 39 at Morris Reservior, Azusa, Los Angeles County, CA
James Moffett's Mistake: Ignoring the Rational Capacities of the Other
ERIC Educational Resources Information Center
Donehower, Kim
2013-01-01
Using Alasdair MacIntyre's theory of tradition-bound rationalities, this essay analyses James Moffett's depiction of the censors who opposed his "Interactions" textbook series in the Kanawha County, West Virginia, schools. Many reviewers have found Moffett's analysis of the censors in "Storm in the Mountains" even-handed and…
Astronauts James Lovell uses scoop from ALHT during simulation
1969-12-01
S70-20272 (December 1969) --- Astronaut James A. Lovell Jr., commander of the upcoming Apollo 13 lunar landing mission, uses a scoop from the Apollo Lunar Hand Tools (ALHT) during a simulated lunar surface traverse at the Kapoho, Hawaii training site. While at the Hawaii training sites, Lovell and Haise are participating in thorough rehearsals of their extravehicular activity (EVA). Photo credit: NASA
Growing Physics and Astronomy at James Madison University
NASA Astrophysics Data System (ADS)
Whisnant, C. Steven
2010-02-01
James Madison University is a public, primarily undergraduate institution with a student enrollment of over 18,000. We have a 10.8% minority population and a 60:40 female/male ratio. Drawing 29% of its students from other states, JMU serves a diverse student body. Since the mid '90's, the Department of Physics and Astronomy has grown to 110 majors. There are 15 tenured/tenure-track and 6 non-tenure-track full-time faculty in the department. Graduation rates have grown from five or fewer/year to typically 15-20/year. Eleven faculty are currently engaged in externally funded research with undergraduates. In the 2007-2008 academic year, 45 students were engaged in research. We produced a total of 89 publications and presentations that included 27 students as authors or co-authors. The growth of our department over the last decade is due to a variety of reforms. Foremost among the changes under the control of the department are the initiation of our multi-track BS and BA degree programs and a renewed focus on undergraduate research. These and other significant factors contributing to our success such as student recruiting, outreach, teaching and research integration/balance, promotion of a department culture, visibility on-and off-campus, and university support will be discussed. )
NASA Technical Reports Server (NTRS)
Homan, Jonathan L.; Lauterbach, John; Garcia, Sam
2016-01-01
Chamber A is the largest thermal vacuum chamber at the Johnson Space Center and is one of the largest space environment chambers in the world. The chamber is 19.8 m (65 ft) in diameter and 36.6 m (120 ft) tall and is equipped with cryogenic liquid nitrogen panels (shrouds) and gaseous helium shrouds to create a simulated space environment. The chamber was originally built to support testing of the Apollo Service and Command Module for lunar missions, but underwent major modifications to be able to test the James Webb Space Telescope in a simulated deep space environment. To date seven tests have been performed in preparation of testing the flight optics for the James Webb Space Telescope (JWST). Each test has had a uniquie thermal profile and set of thermal requirements for cooling down and warming up, controlling contamination, and releasing condensed air. These range from temperatures from 335K to 15K, with tight uniformity and controllability for maintining thermal stability and pressure control. One unique requirement for two test was structurally proof loading hardware by creating thermal gradients at specific temperatures. This paper will discuss the thermal requirements and goals of the tests, the original requirements of the chamber thermal systems for planned operation, and how the new requirements were met by the team using the hardware, system flexiblilty, and engineering creativity. It will also discuss the mistakes and successes to meet the unique goals, especially when meeting the thermal proof load.
James Webb Space Telescope Status
NASA Technical Reports Server (NTRS)
Mather, John C.
2005-01-01
The James Webb Space Telescope (JWST) is the first deployable infrared to millimeter wave space telescopes. We will describe the progress on JWST and introduce other speakers in the session. The JWST will operate at the Sun-Earth Lagrange point L2, where radiative cooling lowers the telescope and instrument temperatures to about 35 K. It will have an 18-segment beryllium primary mirror with a 25 m2 area fitting inside a 6.6m circumscribed circle, and will provide spectroscopy and imaging over the wavelength range from 0.6 to 28 microns. It is planned for launch in 2011 on an Ariane 5 rocket. The project is a partnership of NASA, ESA, and CSA, and the prime contractor is Northrop Grumman. See http://www.jwst.nasa.gov for more details on JWST.
35. James River Visitor Center. Opened as an open air ...
35. James River Visitor Center. Opened as an open air visitor center in 1962, it was enclosed and a heating system installed in 1984 to allow use through the cooler months and help reduce vandalism. Looking northeast. - Blue Ridge Parkway, Between Shenandoah National Park & Great Smoky Mountains, Asheville, Buncombe County, NC
Groundbreaking Investigator of Creativity: An Interview with James C. Kaufman
ERIC Educational Resources Information Center
Henshon, Suzanna E.
2010-01-01
This article presents an interview with James C. Kaufman, an associate professor of psychology at the California State University at San Bernardino, where he directs the Learning Research Institute. Kaufman received his PhD in cognitive psychology from Yale University in 2001. Dr. Kaufman's research broadly focuses on nurturing and encouraging…
75 FR 13323 - James A. Fitzpatrick Nuclear Power Plant; Exemption
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-19
... Power Plant; Exemption 1.0 Background Entergy Nuclear Operations, Inc. (the licensee) is the holder of Facility Operating License No. DPR-59, which authorizes operation of the James A. FitzPatrick Nuclear Power... nuclear power plants that were licensed before January 1, 1979, satisfy the requirements of 10 CFR Part 50...
Stationkeeping Monte Carlo Simulation for the James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Dichmann, Donald J.; Alberding, Cassandra M.; Yu, Wayne H.
2014-01-01
The James Webb Space Telescope (JWST) is scheduled to launch in 2018 into a Libration Point Orbit (LPO) around the Sun-Earth/Moon (SEM) L2 point, with a planned mission lifetime of 10.5 years after a six-month transfer to the mission orbit. This paper discusses our approach to Stationkeeping (SK) maneuver planning to determine an adequate SK delta-V budget. The SK maneuver planning for JWST is made challenging by two factors: JWST has a large Sunshield, and JWST will be repointed regularly producing significant changes in Solar Radiation Pressure (SRP). To accurately model SRP we employ the Solar Pressure and Drag (SPAD) tool, which uses ray tracing to accurately compute SRP force as a function of attitude. As an additional challenge, the future JWST observation schedule will not be known at the time of SK maneuver planning. Thus there will be significant variation in SRP between SK maneuvers, and the future variation in SRP is unknown. We have enhanced an earlier SK simulation to create a Monte Carlo simulation that incorporates random draws for uncertainties that affect the budget, including random draws of the observation schedule. Each SK maneuver is planned to optimize delta-V magnitude, subject to constraints on spacecraft pointing. We report the results of the Monte Carlo simulations and discuss possible improvements during flight operations to reduce the SK delta-V budget.
Interpreting "Mind-Cure": William James and the "chief task…of the science of human nature".
Sutton, Emma Kate
2012-01-01
The private papers of the philosopher-psychologist, William James, indicate that he frequented several mental healers during his life, undertaking 100-200 therapeutic sessions concerning a range of symptoms from angina to insomnia. The success of the mind-cure movement constituted for James both a corroboration, and an extension, of the new research into the subconscious self and the psychogenesis of disease. Epistemologically, the experiences of those converts to the "mind-cure religion" exemplified his conviction that positivistic scientific enquiry can only reveal only one part of a wider reality. Metaphysically their reports comprised a powerful body of support for the existence of a "higher consciousness," a supernatural world of some description. The positing of such a source of "supernormal" healing power was, for James, the best way to reconcile the accounts of those who had been regenerated, via their faith, despite having exhausted all natural reserves of energy and will. © 2012 Wiley Periodicals, Inc.
Alvarado, Carlos S
2016-03-01
Mediumship was a topic of great interest to some nineteenth-century students of mental phenomena. Together with the phenomena of hypnosis and other manifestations, mediumship was seen by many as a dissociative phenomenon. The purpose of this Classic Text is to present an excerpt of an article about the topic that William James (1842-1910) published in 1886 in the Proceedings of the American Society for Psychical Research about American medium Leonora E. Piper (1857-1950). The article, an indication of late nineteenth-century interactions between dissociation studies and psychical research, was the first report of research with Mrs Piper, a widely investigated medium of great importance for the development of mediumship studies. In addition to studying the case as a dissociative experience, James explored the possibility that Piper's mentation contained verifiable information suggestive of 'supernormal' knowledge. Consequently, James provides an example of a topic neglected in historical studies, the ideas of those who combined conventional dissociation studies with psychical research. © The Author(s) 2016.
Integrated Modeling Activities for the James Webb Space Telescope: Optical Jitter Analysis
NASA Technical Reports Server (NTRS)
Hyde, T. Tupper; Ha, Kong Q.; Johnston, John D.; Howard, Joseph M.; Mosier, Gary E.
2004-01-01
This is a continuation of a series of papers on the integrated modeling activities for the James Webb Space Telescope(JWST). Starting with the linear optical model discussed in part one, and using the optical sensitivities developed in part two, we now assess the optical image motion and wavefront errors from the structural dynamics. This is often referred to as "jitter: analysis. The optical model is combined with the structural model and the control models to create a linear structural/optical/control model. The largest jitter is due to spacecraft reaction wheel assembly disturbances which are harmonic in nature and will excite spacecraft and telescope structural. The structural/optic response causes image quality degradation due to image motion (centroid error) as well as dynamic wavefront error. Jitter analysis results are used to predict imaging performance, improve the structural design, and evaluate the operational impact of the disturbance sources.
Astronaut James D. van Hoften examines student experiment on Challenger
1984-04-15
41C-05-188 (12 April 1984) --- Astronaut James D. van Hoften, mission specialist, holds an aluminum box, full of honeybees. The experiment in Earth-orbit is duplicated with another colony of the young honeycomb builders on Earth. Dan Poskevich submitted the experiment to NASA as part of the Shuttle student involvement program.
Apollo 13 Astronaut James Lovel during lunar surface simulation training
1970-01-16
S70-28229 (16 Jan. 1970) --- Astronaut James A. Lovell Jr., commander of the Apollo 13 lunar landing mission, participates in lunar surface simulation training at the Manned Spacecraft Center. Lovell is attached to a Six Degrees of Freedom Simulator. He is carrying an Apollo Lunar Hand Tools carrier in his right hand.
1984-05-01
energy- intensive crop, and agricultural advisors expect alfalfa prices to rise significantly in the future. Sonoma County Dairy Advisor Dr. Richard...Bermon Alfred Heller John Tuteur. Jr James D Hobbs* Volker E#1ee Sonoma County I. Michael Heyman Mrs Robert Watson Alemo County JunO Foote Marilyn...86 ,. Sunnyvale 5 571 Sonoma County 56 21,266 i Class C -- Little or no protection of diked baylands at local level Alameda County 1 228 Alameda 2 71
On the centenary of the birth of Francis H. C. Crick - from physics to genetics and neuroscience.
Teive, Hélio A G
2016-04-01
The year 2016 marks the centenary of the birth of Francis Crick (1916-2004), who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.
The Visioceilometer: A Portable Visibility and Cloud Ceiling Height Lidar.
1982-01-01
Artillery School ATTN: STEDP-MT-DA-L ATTN: ATSF- CF -R (CPT James M. Watson) Dugway, UT 84022 Fort Sill, OK 73503 Commander Commandant US Army Dugway Proving...Commandant US Army Dugway Proving Ground US Army Field Artillery School ATTN: STEDP-MT-DA-T (Mr. John Trethewey) ATTN: ATSF- CF -R Dugway, UT 84022 Fort...Base, VA 23655 Fort !elvoir, VA 22060 Commander Director US Army INSCOM/Quest Research Corporation US Army Night Vision & ATTN: Mr. Donald Wilmot
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-06-21
Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)<-->A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.
Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho
2018-04-01
Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was
Sommer, Andreas
2012-04-01
Largely unacknowledged by historians of the human sciences, late-19th-century psychical researchers were actively involved in the making of fledgling academic psychology. Moreover, with few exceptions historians have failed to discuss the wider implications of the fact that the founder of academic psychology in America, William James, considered himself a psychical researcher and sought to integrate the scientific study of mediumship, telepathy and other controversial topics into the nascent discipline. Analysing the celebrated exposure of the medium Eusapia Palladino by German-born Harvard psychologist Hugo Münsterberg as a representative example, this article discusses strategies employed by psychologists in the United States to expel psychical research from the agenda of scientific psychology. It is argued that the traditional historiography of psychical research, dominated by accounts deeply averse to its very subject matter, has been part of an ongoing form of 'boundary-work' to bolster the scientific status of psychology.
NASA Astrophysics Data System (ADS)
Proffitt, Charles R.; Birkmann, Stephan; Ferruit, Pierre; Guilbert, Aurelie; Holler, Bryan J.; Stansberry, John
2017-10-01
The NIRSpec Instrument on the James Webb Space Telescope will allow near-IR spectroscopy in the wavelength range between 0.6 and 5.3 microns with resolving power of ~100, 1000, or 2700. We review strategies for performing spectral observations of solar system objects using each of NIRSpec's available observing modes, including the integral field unit (IFU), multi-Object Spectroscopy (MOS), and fixed slit (FS) templates, and discuss how the choice of mode affects the limiting target brightness as well as the detailed wavelength and spatial coverage obtained. We also discuss the expected pointing accuracy and target acquisition options for moving targets, including the use and limitations of the Wide Aperture Target Acquisition (WATA) capability and of the pre-defined field points that will be available for use with the MOS template to enable the use of custom micro-shutter patterns including ones emulating very long slits.
Lights Out on the James Webb Space Telescope
2017-12-08
What happens when the lights are turned out in the enormous clean room that currently houses NASA's James Webb Space Telescope? The technicians who are inspecting the telescope and its expansive golden mirrors look like ghostly wraiths in this image as they conduct a "lights out inspection" in the Spacecraft Systems Development and Integration Facility (SSDIF) at NASA's Goddard Space Flight Center in Greenbelt, Maryland. The clean room lights were turned off to inspect the telescope after it experienced vibration and acoustic testing. The contamination control engineer used a bright flashlight and special ultraviolet flashlights to inspect for contamination because it's easier to find in the dark. NASA photographer Chris Gunn said "The people have a ghostly appearance because it's a long exposure." He left the camera's shutter open for a longer than normal time so the movement of the technicians appear as a blur. He also used a special light "painting" technique to light up the primary mirror. The James Webb Space Telescope is the scientific successor to NASA's Hubble Space Telescope. It will be the most powerful space telescope ever built. Webb is an international project led by NASA with its partners, ESA (European Space Agency) and the Canadian Space Agency. For more information about the Webb telescope visit: www.jwst.nasa.gov or www.nasa.gov/webb Image Credit: NASA/Chris Gunn
"Attacking the Citadel": James Moncreiff's Proposals to Reform Scottish Education, 1851-69.
ERIC Educational Resources Information Center
Bain, Wilson H.
1978-01-01
A review of the parliamentary actions of Lord Advocate James Moncreiff to create a fully national Scottish educational system against the opposition by church groups reluctant to lose control over parish schools and schoolmasters. (SJL)
The Word for Teaching Is Learning: Essays for James Britton.
ERIC Educational Resources Information Center
Lightfoot, Martin, Ed.; Martin, Nancy, Ed.
Reflecting the influence of James Britton in the field of language and learning, this book--a collection of essays by researchers and practitioners in the area of language and learning--focuses on recent issues of language development in learning. The book contains the following 27 essays: (1) "Social Interaction as Scaffold: The Power and…
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
Late-Eighteenth-Century Precipitation Reconstructions from James Madison's Montpelier Plantation.
NASA Astrophysics Data System (ADS)
Druckenbrod, Daniel L.; Mann, Michael E.; Stahle, David W.; Cleaveland, Malcolm K.; Therrell, Matthew D.; Shugart, Herman H.
2003-01-01
This study presents two independent reconstructions of precipitation from James Madison's Montpelier plantation at the end of the eighteenth century. The first is transcribed directly from meteorological diaries recorded by the Madison family for 17 years and reflects the scientific interests of James Madison and Thomas Jefferson. In his most active period as a scientist, Madison assisted Jefferson by observing the climate and fauna in Virginia to counter the contemporary scientific view that the humid, cold climate of the New World decreased the size and number of its species. The second reconstruction is generated using tree rings from a forest in the Montpelier plantation and connects Madison's era to the modern instrumental precipitation record. These trees provide a significant reconstruction of both early summer and prior fall precipitation. Comparison of the dendroclimatic and diary reconstructions suggests a delay in the seasonality of precipitation from Madison's era to the mid-twentieth century. Furthermore, the dendroclimatic reconstructions of early summer and prior fall precipitation appear to track this shift in seasonality.
The James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Mather, John C.
2004-01-01
The James Webb Space Telescope (JWST) will extend the discoveries of the Hubble Space Telescope (HST) and the Spitzer Space Telescope (SST) by deploying a large cooled infrared telescope around the Sun-Earth Lagrange point L2. With a 6 m aperture and three instruments covering the wavelength range from 0.6 to 28 microns, it will provide sensitivities orders of magnitude better than any other facilities. It is intended to observe the light from the first galaxies and the first supernovae, the assembly of galaxies, and the formation and evolution of stars and planetary systems. In this talk I will review the scientific objectives and the ability of the system to meet them. I will close with a summary of possible future IR space missions, ranging from the far IR to planet-finding coronagraphs and interferometers
Water resources of St. James Parish, Louisiana
White, Vincent E.; Prakken, Lawrence B.
2015-01-01
Information concerning the availability, use, and quality of water in St. James Parish, Louisiana, is critical for proper water-supply management. The purpose of this fact sheet is to present information that can be used by water managers, parish residents, and others for stewardship of this vital resource. Information on the availability, past and current use, use trends, and water quality from groundwater and surface-water sources in the parish is presented. Previously published reports and data stored in the U.S. Geological Survey’s National Water Information System (http://waterdata.usgs.gov/nwis) are the primary sources of the information presented here.
View west of the James and Lucy Alexander gravestone and ...
View west of the James and Lucy Alexander gravestone and family plot among other demarcated family plots in the Female Union Band Cemetery. - Mount Zion Cemetery/ Female Union Band Cemetery, Bounded by 27th Street right-of-way N.W. (formerly Lyons Mill Road), Q Street N.W., & Mill Road N.W., Washington, District of Columbia, DC
INTERIOR VIEW OF JAMES HARRIS CUTTING SCREW THREADS INTO THE ...
INTERIOR VIEW OF JAMES HARRIS CUTTING SCREW THREADS INTO THE INTERIOR OF FITTINGS ON ONE IN A BANK OF TAPPING MACHINES, EACH OPERATED BY THE SAME WORKER SIMULTANEOUSLY BUT TIMED TO REQUIRE WORKER ACTION AT INTERVALS THAT DO NOT INTERFERE WITH THE OTHER MACHINES. - Stockham Pipe & Fittings Company, Tapping Room, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL
Shake, Rattle and Roll: James Webb Telescope Components Pass Tests
NASA Technical Reports Server (NTRS)
2008-01-01
This image shows a model of one of three detectors for the Mid-Infrared Instrument on NASA's upcoming James Webb Space Telescope. The detector, which looks green in this picture, and is similar to the charge-coupled devices, or 'CCDs,' in digital cameras, is housed in the brick-like unit shown here, called a focal plane module.Plan of the principal (second) floor of James H. Windrim ...
Plan of the principal (second) floor of James H. Windrim and George Summerss competition design for the New Masonic Temple, Philadelphia, 1867. The exterior wall outline of the architects Early Norman alternative design is shown overlaid across the left third of the drawing. - Masonic Temple, 1 North Broad Street, Philadelphia, Philadelphia County, PA
García-Mieres, Helena; Ochoa, Susana; Salla, Marta; López-Carrilero, Raquel; Feixas, Guillem
2016-01-01
In this paper we illustrate the potential of the repertory grid technique as an instrument for case formulation and understanding of the personal perception and meanings of people with a diagnosis of psychotic disorders. For this purpose, the case of James is presented: A young man diagnosed with schizophrenia and personality disorder, with severe persecutory delusions and other positive symptoms that have not responded to antipsychotic medication, as well with depressive symptomatology. His case was selected because of the way his symptoms are reflected in his personal perception of self and others, including his main persecutory figure, in the different measures that result from the analysis of his repertory grid. Some key clinical hypotheses and possible targets for therapy are discussed. PMID:27679779
ASTRONAUT LOVELL, JAMES A., JR. - APOLLO VIII (GUIDANCE & NAVIGATION [G&N])
1969-05-25
S69-35099 (21-27 Dec. 1968) --- Astronaut James A. Lovell Jr., Apollo 8 command module pilot, is seen at the Apollo 8 Spacecraft Command Module's Guidance and Navigation station during the Apollo 8 lunar orbit mission. This picture was taken from 16mm motion picture film.
Photographic copy of photograph, B.G. James, photographer, 9 September 1935 ...
Photographic copy of photograph, B.G. James, photographer, 9 September 1935 (original print located at National Archives and Records Center, Denver, Colorado). "DEBRIS IN SPILLWAY BASIN PILED BY HAND BY CCC WORKERS" - Kachess Dam, Kachess River, 1.5 miles north of Interstate 90, Easton, Kittitas County, WA
Sir James Paget: Paget's disease of the nipple, Paget's disease of bone.
Ellis, Harold
2013-04-01
Sir James Paget was one of the 'great' Victorians. Eminent as a surgeon, pathologist and teacher, his nobility of character and application to his work made him a leader in his profession in that age of great men.
Slowey, Aaron J.; Rytuba, James J.; Hothem, Roger L.; May, Jason T.
2007-01-01
Executive Summary The Oat Hill Extension (OHE) Mine is one of several mercury mines located in the James Creek/Pope Creek watershed that produced mercury from the 1870's until 1944 (U.S. Bureau of Mines, 1965). The OHE Mine developed veins and mineralized fault zones hosted in sandstone that extended eastward from the Oat Hill Mine. Waste material from the Oat Hill Mine was reprocessed at the OHE Mine using gravity separation methods to obtain cinnabar concentrates that were processed in a retort. The U.S. Bureau of Land Management requested that the U.S. Geological Survey measure and characterize mercury and other chemical constituents that are potentially relevant to ecological impairment of biota in tailings, sediment, and water at the OHE Mine and in the tributaries of James Creek that drain the mine area (termed Drainage A and B) (Figs. 1 and 2). This report summarizes such data obtained from sampling of tailings and sediments at the OHE on October 17, 2003; water, sediment, and biota from James Creek on May 20, 2004; and biota on October 29, 2004. These data are interpreted to provide a preliminary assessment of the potential ecological impact of the mine on the James Creek watershed. The mine tailings are unusual in that they have not been roasted and contain relatively high concentrations of mercury (400 to 1200 ppm) compared to unroasted waste rock at other mines. These tailings have contaminated a tributary to James Creek with mercury primarily by erosion, on the basis of higher concentration of mercury (780 ng/L) measured in unfiltered (total mercury, HgT) spring water flowing from the OHE to James Creek compared to 5 to 14 ng/L HgT measured in James Creek itself. Tailing piles (presumably from past Oat Hill mine dumping) near the USBLM property boundary and upstream of the main OHE mine drainage channel (Drainage A; Fig. 2) also likely emit mercury, on the basis of their mercury composition (930 to 1200 ppm). The OHE spring water is likely an
Standardization of XML Database Exchanges and the James Webb Space Telescope Experience
NASA Technical Reports Server (NTRS)
Gal-Edd, Jonathan; Detter, Ryan; Jones, Ron; Fatig, Curtis C.
2007-01-01
Personnel from the National Aeronautics and Space Administration (NASA) James Webb Space Telescope (JWST) Project have been working with various standard communities such the Object Management Group (OMG) and the Consultative Committee for Space Data Systems (CCSDS) to assist in the definition of a common extensible Markup Language (XML) for database exchange format. The CCSDS and OMG standards are intended for the exchange of core command and telemetry information, not for all database information needed to exercise a NASA space mission. The mission-specific database, containing all the information needed for a space mission, is translated from/to the standard using a translator. The standard is meant to provide a system that encompasses 90% of the information needed for command and telemetry processing. This paper will discuss standardization of the XML database exchange format, tools used, and the JWST experience, as well as future work with XML standard groups both commercial and government.
School Administrators' Perceptions of the James Stronge Teacher Evaluation System
ERIC Educational Resources Information Center
Schoenlank, Jean
2017-01-01
This qualitative study examined school administrators' perceptions of the James Stronge teacher evaluation system, one of five approved evaluation systems by the New Jersey Department of Education from the Teacher Effectiveness and Accountability for the Children of New Jersey Act (TEACHNJ) in 2012. Fourteen administrators from a suburban district…
Comparing Adam Smith's Wealth of Nations to James Madison's Federalist #10.
ERIC Educational Resources Information Center
Mundell, Jean
1987-01-01
Presents a lesson which calls upon students to compare Adam Smith's WEALTH OF NATIONS to James Madison's FEDERALIST #10 to see how the ancient concept of individual rights and liberties was used to describe both economic and governmental systems. Presents questions to provide the basis for comparison. (GEA)
Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane
2013-11-01
William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.
NASA Administrator James Webb and Lewis Director Abe Silverstein
1961-12-21
National Aeronautics and Space Administration (NASA) Administrator James Webb toured the new Plum Brook Reactor Facility in December 1961 with Abe Silverstein, the newly appointed Director of the Lewis Research Center. The 60-megawatt test reactor was built on 500 acres of the former Plum Brook Ordnance Works in Sandusky, Ohio. After nearly five years of construction, the facility went critical for the first time in June 1961. In late 1957 Hugh Dryden requested Silverstein’s assistance in creating the new space agency. After several months of commuting, Silverstein transferred to Headquarters in May 1958. Silverstein was a critical member of a team that devised a fiscal year 1960 budget and began planning missions. When NASA officially began operation on October 1, 1958, Silverstein was third in command. He directed mission planning, spacecraft design, launch operations, manned space missions, and unmanned probes. James Webb, named NASA administrator on January 7, 1961, sought to have those working on Apollo at the NASA centers report to a new Headquarters program office, not to the head of the Apollo Program. Silverstein requested to be appointed to the vacant center director position in Cleveland. He officially returned as director of the Lewis Research Center on November 1, 1961.
Titan Science with the James Webb Space Telescope
NASA Astrophysics Data System (ADS)
Nixon, Conor A.; Achterberg, Richard; Adamkovics, Mate; Bezard, Bruno; Bjoraker, Gordon; Cornet, Thomas; Hayes, Alexander; Lellouch, Emmanuel; Lemmon, Mark; Lopez Puertas, Manuel; Rodriguez, Sebastien; Sotin, Christophe; Teanby, Nicholas; Turtle, Elizabeth; West, Robert
2015-11-01
The James Webb Space Telescope (JWST), scheduled for launch in 2018, is an ambitious next-generation large-aperture (6.5 m) space observatory focused on pushing the boundaries of infrared astronomy (0.6-28.0 μm). This long-wavelength focus gives it very substantial potential for solar system science, since the thermal emissions from the surfaces and atmospheres of many planets, moons and small bodies peak in this part of the spectrum. Here we report the findings of a task team convened to examine the potential for Titan science using JWST. These can be divided into five broad areas: (i) the surface, especially the rotational lightcurve; (ii) clouds in the lower atmosphere from direct imaging and near-IR spectroscopy; (iii) composition of the lower atmosphere, especially methane relative humidity; (iv) composition of the middle atmosphere, including thermal and fluorescent emissions from gases; (v) hazes in the middle atmosphere, including seasonal changes in hemispheric contrast. The capability of the major JWST instruments in each area is considered, and limitations such as potential saturation is noted and mitigation strategies (such as sub-arraying) discussed. Overall we find that JWST can make significant contributions to Titan science in many areas, not least in temporal monitoring of seasonal change after the end of the Cassini mission in 2017, in partnership with other next-generation observing facilities (TMT, GMT, EELT, ALMA).
Seasonal Variations of the James Webb Space Telescope Orbital Dynamics
NASA Technical Reports Server (NTRS)
Brown, Jonathan; Petersen, Jeremy; Villac, Benjamin; Yu, Wayne
2015-01-01
While spacecraft orbital variations due to the Earth's tilt and orbital eccentricity are well-known phenomena, the implications for the James Webb Space Telescope present unique features. We investigate the variability of the observatory trajectory characteristics, and present an explanation of some of these effects using invariant manifold theory and local approximation of the dynamics in terms of the restricted three-body problem.
Astronaut James Newman evaluates tether devices in Discovery's payload bay
1993-09-16
Astronaut James H. Newman, mission specialist, uses a 35mm camera to take a picture of fellow astronaut Carl E. Walz (out of frame) in Discovery's cargo bay. The two were engaged in an extravehicular activity (EVA) to test equipment to be used on future EVA's. Newman is tethered to the starboard side, with the orbital maneuvering system (OMS) pod just behind him.
USDA-ARS?s Scientific Manuscript database
Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...
Gazdik, Gertrude C.; Ross, Robert B.
1982-01-01
The area, on the crest of the Blue Ridge Mountains, is drained by small tributaries of the James River. Altitudes range from 600 ft where U.S. Route 501 crosses the James River to 3,073 ft on Highcock Knob.
James Webb Space Telescope: The First Light Machine
NASA Technical Reports Server (NTRS)
Stahl, H. Philip
2007-01-01
Scheduled to begin its 10 year mission no sooner than 2013, the James Webb Space Telescope (JWST) will search for the first luminous objects of the Universe to help answer fundamental questions about how the Universe came to look like it does today. At 6.5 meters in diameter, JWST will be the world's largest space telescope. This talk reviews science objectives for JWST and how they drive the JWST architecture, e.g. aperture, wavelength range and operating temperature. Additionally, the talk provides an overview of the JWST primary mirror technology development and fabrication status.
Recent trends and changes in freshwater discharge into Hudson, James, and Ungava Bays
NASA Astrophysics Data System (ADS)
Déry, S. J.; Stieglitz, M.; McKenna, E.; Wood, E. F.
2004-05-01
Recent trends and changes in the observed river discharge into Hudson, James, and Ungava Bays (HJUBs) for the period 1964-1994 will be presented. Forty-two rivers with outlets into these bays contribute on average 700 cubic kilometers (= 0.02 sverdrups) of freshwater to the Arctic Ocean. River discharge attains a mean annual peak of 4.2 cubic kilometers per day on average each 17 June for the system as a whole, whereas the minimum of 0.6 cubic kilometers occurs on average each 3 April. The Nelson River supplies as much as 30% of the daily discharge for the entire system during winter, but diminishes in relative importance during spring and summer. Runoff rates per contributing area are highest (lowest) on the eastern (western) shores of Hudson and James Bays. Linear trend analyses reveal decreasing discharge in 38 out of the 42 rivers over the 31-year period. By 1994, the total annual freshwater discharge into the Arctic Ocean diminished by 110 cubic kilometers from its values in 1964, equivalent to a reduction of 0.0035 sverdrups. The annual peak discharge rates associated with snowmelt advanced by 16 days between 1964 and 1994 and has diminished slightly in intensity. There is a direct correlation between the time of this hydrological event and the latitude of a river's mouth; the timing of the peak discharge rates varies by 5 days for each degree of latitude. Continental snowmelt induces a seasonal pulse of freshwater from HJUBs that is tracked along its path into the Labrador Current and that coincides with ocean salinity anomalies on the inner Newfoundland Shelf. The talk will end with a discussion on the implications of a changing freshwater regime in HJUBs.
James Lawrence Cabell, one of the most influential of America's early surgeons.
DuBose, Joseph; Tribble, Curt
2015-04-01
Dr. James Lawrence Cabell was one of the most important, farsighted, and influential surgical educators and leaders in the United States in the 19th century. He was appointed as Chair of Surgery and Physiology at the University of Virginia by Thomas Jefferson's successor as Rector of the University, James Madison, and held that Chair for over 50 years, the longest tenure of any American medical academician. He was a founding member of the American Medical Association, the American Surgical Association, and the National Board of Health. He is best remembered as an articulate, incessant, and early proponent of public health and the delivery of quality health care in the United States. His legacy and that of his protégés has continued to influence health care in this country, especially in the realm of the prevention and treatment of infectious diseases, even into the present time.
James-Stein Estimation. Program Statistics Research, Technical Report No. 89-86.
ERIC Educational Resources Information Center
Brandwein, Ann Cohen; Strawderman, William E.
This paper presents an expository development of James-Stein estimation with substantial emphasis on exact results for nonnormal location models. The themes of the paper are: (1) the improvement possible over the best invariant estimator via shrinkage estimation is not surprising but expected from a variety of perspectives; (2) the amount of…
A history of James Craig's hall for the Royal College of Physicians of Edinburgh.
Lewis, A R
2008-06-01
The architectural history of the College's George Street hall, completed in 1781, has commonly been overlooked because it was demolished and deemed to have been a disappointment to both its owners and its architect, James Craig. This article reassesses the College's ambitions and Craig's efforts to match them, by accounting for the number of drawings which were made for the site and building, Craig's sources of inspiration and the building's appearance and influence. The paper reveals that the hall was actually intended to be part of a larger complex of buildings and rival Register House as the New Town's most impressive public edifice. The building has not been examined in this way before, and Craig's use of his library, drawing equipment and knowledge of London's architects and architecture are discussed to offer insight into his personal vision for the hall's appearance and meaning.
Looking Back in Time: Building the James Webb Space Telescope (JWST) Optical Telescope Element
NASA Technical Reports Server (NTRS)
Feinberg, Lee
2016-01-01
When it launches in 2018, the James Webb Space Telescope (JWST) will look back in time at the earliest stars and galaxies forming in the universe. This talk will look back in time at the development of the JWST telescope. This will include a discussion of the design, technology development, mirror development, wave front sensing and control algorithms, lightweight cryogenic deployable structure, pathfinder telescope, and integration and test program evolution and status. The talk will provide the engineering answers on why the mirrors are made of Beryllium, why there are 18 segments, where and how the mirrors were made, how the mirrors get aligned using the main science camera, and how the telescope is being tested. It will also look back in time at the many dedicated people all over the country who helped build it.
Balazik, Matthew T.; Farrae, Daniel J.; Darden, Tanya L.; Garman, Greg C.
2017-01-01
Atlantic sturgeon (Acipenser oxyrinchus oxyrinchus, Acipenseridae) populations are currently at severely depleted levels due to historic overfishing, habitat loss, and pollution. The importance of biologically correct stock structure for effective conservation and management efforts is well known. Recent improvements in our understanding of Atlantic sturgeon migrations, movement, and the occurrence of putative dual spawning groups leads to questions regarding the true stock structure of this endangered species. In the James River, VA specifically, captures of spawning Atlantic sturgeon and accompanying telemetry data suggest there are two discrete spawning groups of Atlantic sturgeon. The two putative spawning groups were genetically evaluated using a powerful microsatellite marker suite to determine if they are genetically distinct. Specifically, this study evaluates the genetic structure, characterizes the genetic diversity, estimates effective population size, and measures inbreeding of Atlantic sturgeon in the James River. The results indicate that fall and spring spawning James River Atlantic sturgeon groups are genetically distinct (overall FST = 0.048, F’ST = 0.181) with little admixture between the groups. The observed levels of genetic diversity and effective population sizes along with the lack of detected inbreeding all indicated that the James River has two genetically healthy populations of Atlantic sturgeon. The study also demonstrates that samples from adult Atlantic sturgeon, with proper sample selection criteria, can be informative when creating reference population databases. The presence of two genetically-distinct spawning groups of Atlantic sturgeon within the James River raises concerns about the current genetic assignment used by managers. Other nearby rivers may also have dual spawning groups that either are not accounted for or are pooled in reference databases. Our results represent the second documentation of genetically distinct dual
NASA Technical Reports Server (NTRS)
Milam, Stefanie N.; Stansberry, John A.; Sonneborn, George; Thomas, Cristina
2016-01-01
The James Webb Space Telescope (JWST) is optimized for observations in the near- and mid-infrared and will provide essential observations for targets that cannot be conducted from the ground or other missions during its lifetime. The state-of-the-art science instruments, along with the telescope's moving target tracking, will enable the infrared study, with unprecedented detail, for nearly every object (Mars and beyond) in the Solar System. The goals of this special issue are to stimulate discussion and encourage participation in JWST planning among members of the planetary science community. Key science goals for various targets, observing capabilities for JWST, and highlights for the complementary nature with other missions/observatories are described in this paper.
Ludic Literacies at the Intersections of Cultures: An Interview with James Paul Gee
ERIC Educational Resources Information Center
St. Clair, Ralf; Phipps, Alison
2008-01-01
Professor James Gee addresses issues of linguistics, literacies and cultures. Gee emphasises the importance of Discourses, and argues that the future of literacy studies lies in the interrogation of new media and the globalisation of culture.
Physics for Teachers: Understanding Physics: David Cassidy, Gerald Holton, & James Rutherford
NASA Astrophysics Data System (ADS)
Hubisz, John L.
2009-11-01
Physics for Teachers: Understanding Physics, by David Cassidy, Gerald Holton, & James Rutherford and published by Springer Verlag, New York, NY 10010 (2002), pp. xxiii + 851 80.00 hardback. ISBN 0-387-98756-8. Student Guide & Instructor Guide are also available. The text and Instructor Guide are available online at http://www.dcassidybooks.com/up.html
A Return to Love in William James and Jean-Luc Marion
ERIC Educational Resources Information Center
Rocha, Samuel
2009-01-01
In this essay Samuel Rocha primarily addresses, and challenges, the modern conception of reason and the lowly place of intuition, feeling, and love in what has become traditional philosophy and education. Drawing upon the rich thought of William James and Jean-Luc Marion, Rocha introduces the reader to a certain harmony between their ideas, most…
Asiatic clam (Corbicula manilensis) and other foods used by waterfowl in the James River, Virginia
Perry, M.C.; Uhler, F.M.
1981-01-01
Corbicula manilensis was found in the gizzards of 24 ducks of 5 species taken from the James River, Virginia, between 1973 and 1976. Percent average volume in these species ranged from trace to 6%. This is the first known occurrence of this exotic clam in the food of duck in Chesapeake Bay. A total of 135 other food items was identified from the 116 gizzards of 9 species that were examined. Food that predominated included Cyperus spp., Leersia oryzoides, Polygonum spp., and Zea mays. The great diversity of food consumed in this fresh tidal section of the James River indicates the high value of these wetlands to waterfowl.
William James, Gustav Fechner, and Early Psychophysics
Hawkins, Stephanie L.
2011-01-01
American psychologist and philosopher William James devoted the entirety of his career to exploring the nature of volition, as expressed by such phenomena as will, attention, and belief. As part of that endeavor, James’s unorthodox scientific pursuits, from his experiments with nitrous oxide and hallucinogenic drugs to his investigation of spiritualist mediums, represent his attempt to address the “hard problems” of consciousness for which his training in brain physiology and experimental psychology could not entirely account. As a student, James’s reading in chemistry and physics had sparked his interest in the concepts of energy and force, terms that he later deployed in his writing about consciousness and in his arguments against philosophical monism and scientific materialism, as he developed his “radically empiricist” ideas privileging discontinuity and plurality. Despite James’s long campaign against scientific materialism, he was, however, convinced of the existence of a naturalistic explanation for the more “wayward and fitful” aspects of mind, including transcendent experiences associated with hysteria, genius, and religious ecstasy. In this paper, I examine aspects of James’s thought that are still important for contemporary debates in psychology and neuroscience: his “transmission theory” of consciousness, his ideas on the “knowing of things together,” and, finally, the related concept of “the compounding of consciousness,” which postulates the theoretical possibility for individual entities within a conscious system of thought to “know” the thoughts of others within the system. Taken together, these ideas suggest that James, in spite of, or perhaps because of, his forays into metaphysics, was working toward a naturalistic understanding of consciousness, what I will term a “distributive model,” based on his understanding of consciousness as an “awareness” that interacts dynamically within, and in relation to
Astronaut Scott Carpenter - Medal Presentation - Dr. James Webb Post Mercury-Atlas (MA-7)
1962-01-01
S62-04114 (1962) --- Astronaut M. Scott Carpenter, pilot of the Mercury-Atlas 7 (MA-7) mission, receives the NASA Distinguished Service Medal from NASA Adminstrator James E. Webb during ceremonies at Cape Canaveral, Florida. Photo credit: NASA
NASA Technical Reports Server (NTRS)
Johnston, John; Mosier, Mark; Howard, Joe; Hyde, Tupper; Parrish, Keith; Ha, Kong; Liu, Frank; McGinnis, Mark
2004-01-01
This paper presents viewgraphs about structural analysis activities and integrated modeling for the James Webb Space Telescope (JWST). The topics include: 1) JWST Overview; 2) Observatory Structural Models; 3) Integrated Performance Analysis; and 4) Future Work and Challenges.
[Dr James Lovelock and story about GAIA hypothesis].
Gajić, Vladimir
2011-01-01
Gaia is the Anglo-Saxon term for the Hellenic term Gea or Ge, which means Earth. The GAIA hypothesis was launched almost 40 years ago by the famous chemist James Lovelock, who was engaged by the National Aeronautics and Space Administration (NASA) to create a sensitive instrument for searching forms of extraterrestrial life on other planets. Then he published the book The ages of GAIA, which perturbed the world's scientific public of those days. Lovelock struck upon this idea in the late sixties of the past century, during the space race with Russians, when he was hired hy the National Aeronautics and Space Administration to conduct a series of experiments to find and explore life forms on the planet Mars. Experiments executed by the American module Viking failed to trace any life form, as Lovelock had predicted. He called it a dead equilibrium. Then he turned to Earth, whose perspective is totally different from its first neighbors. Venus and Mars, and is far from a dead equilibrium. DAISYWORLD: In this hypothesis. Lovelock represents Earth as one living, giant super organism, composed of all living creatures and its material environnent. In that super organisnm, the level of oxygen, weather conditions, ocean salinity and so on are under constant influence of physical, chemical and biological processes, which provide the existence for such life forms on Earth. Dr James Lovelock represents a pioneer of climatology, and his hypothesis gives a unique insight into the correlation of dynamic processes on our planet, no matter whether they are of physical or biological nature.
The James Webb Space Telescope Sunshield Waterfall
2017-12-08
This shiny silver "waterfall" is actually the five layers of the full-scale engineering model of NASA's James Webb Space Telescope sunshield being laid out by technicians at the Northrop Grumman Aerospace Systems Space Park facility in Redondo Beach, Calif. who are conducting endurance tests on them. For more information, visit: jwst.nasa.gov Credit: Northrop Grumman NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA’s accomplishments by contributing compelling scientific knowledge to advance the Agency’s mission. Follow us on Twitter Like us on Facebook Find us on Instagram
Controversy as a Mode of Invention: The Example of James and Freud.
ERIC Educational Resources Information Center
McClish, Glen
1991-01-01
Counteracts the overemphasis on introspection that potentially limits composition students' progress in argumentation by endorsing a renewal of classical rhetoric and invention. Explores texts by William James and Sigmund Freud, which are suitable works to provide the framework necessary for a confrontation-based classroom approach to invention.…
A Student Activity for the James Bay Hydro Project. The Geography Teacher.
ERIC Educational Resources Information Center
Green-Milberg, Patricia
1999-01-01
Provides activities for grades 6 to 8 that will promote student awareness and understanding of the use of hydropower in Canada, the benefits and drawbacks to hydropower, and also the drawbacks of electricity transmission lines. Explains that the activities focus on the James Bay Hydro Project in Canada. (CMK)
The James Webb Space Telescope: Extending the Science
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2012-01-01
The science objectives of the James Webb Space Telescope fall into four themes. The End of the Dark Ages: First Light and Reionization theme seeks to identify the first luminous sources to form and to determine the ionization history of the universe. The Assembly of Galaxies theme seeks to determine how galaxies and the dark matter, gas, stars, metals, morphological structures, and black holes within them evolved from the epoch of reionization to the present. The Birth of Stars and Protoplanetary Systems theme seeks to unravel the birth and early evolution of stars, from infall onto dust-enshrouded protostars, to the genesis of planetary systems. The Planetary Systems and the Origins of Life theme seeks. to determine the physical and chemical properties of planetary systems around nearby stars and of our own, and to investigate the potential for life in those systems. These four science themes were used to establish the design requirements for the observatory and instrumentation. Since Webb's capabilities are unique, those science themes will remain relevant through launch and operations and goals contained within these themes will continue to guide the design and implementation choices for the mission. More recently, it has also become clear that Webb will make major contributions to other areas of research, including dark energy, dark matter, exoplanet characterization and Solar System objects. In this paper, I review the original four science themes and discuss how the scientific output of Webb will extend to these new areas of research.
Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.
Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A
2017-11-16
Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.
NASA Technical Reports Server (NTRS)
Packard, Edward A.
2004-01-01
This viewgraph presentation provides information on the design, construction, and operation of a cryogenic chamber, and its use in testing the Integrated Science Instrument Module (ISIM) for the James Webb Space Telescope (JWST).
Presidential Green Chemistry Challenge 2010 award winner, Dr. James C. Liao, genetically engineered microorganisms to make higher alcohols (with 3 to 8 carbon atoms) from glucose or directly from carbon dioxide (CO2).
James Hillman: Toward a poetic psychology.
Avens, R
1980-09-01
InThe Dream and the Underworld James Hillman continues to deepen and to refine Jung's recovery of the spontaneous image-making of the soul. Hillman's contribution lies in his "imaginai reduction"-relating of images to their archetypal background in Greek mythology. Myth is seen as the maker of the psyche, and, in turn, the soul-making ispoesis-a return to the imaginal and poetic basis of consciousness. Dreams, understood poetically, are neither messages to be deciphered and used for the benefit of the rational ego (Freud) nor compensatory to the ego (Jung); they are complete in themselves and must be allowed to speak for themselves. Hillman also sees dreams as initiations into the underworld of death-the other side of life where our imaginal substance is unobstructed by the literal and dualistic standpoints of the dayworld.
James Monroe High School Proyecto Nuevos Horizontes, 1985-1986. OEA Evaluation Report.
ERIC Educational Resources Information Center
New York City Board of Education, Brooklyn. Office of Educational Assessment.
Proyecto Nuevos Horizontes, a 3-year Title VII-funded bilingual education program, serves 287 Spanish speaking students at James Monroe High School (Bronx, New York). This report evaluates the project's first year of operation, 1985-86. The report contains an introduction describing the school and project goals; information on student…
Consciousness, Social Heredity, and Development: The Evolutionary Thought of James Mark Baldwin
ERIC Educational Resources Information Center
Wozniak, Robert H.
2009-01-01
James Mark Baldwin is one of the most important and least known early American scientific psychologists. Drawing inspiration from Charles Darwin and other evolutionists of the period, Baldwin developed a biosocial theory of psychological development that influenced both Jean Piaget and Lev S. Vygotsky; and he proposed a mechanism relating learned…
James Webb Space Telescope (JWST): The First Light Machine
NASA Technical Reports Server (NTRS)
Stahl, H. Philip
2008-01-01
The James Webb Space Telescope (JWST), expected to launch in 2011, will study the origin and evolution of luminous objects, galaxies, stars, planetary systems and the origins of life. It is optimized for near infrared wavelength operation of 0.6-28 micrometers and will have a 5 year mission life (with a 10 year goal). This presentation reviews JWST's science objectives, the JWST telescope and mirror requirements and how they support the JWST architecture. Additionally, an overview of the JWST primary mirror technology development effort is highlighted.
Retsky, Michael
2009-04-02
This paper by John D. Keen and James E. Keen addresses a thorny subject. The numerical findings and commentaries in their paper will be disturbing to some readers and seem to defy logic and well established viewpoints. It may well generate angry letters to the editor. However such numerical analysis and reporting including civil discussion should be welcomed and are the basis for informed decision making - something that is highly needed in this field.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.
The Oral History of Evaluation: The Professional Development of James R. Sanders
ERIC Educational Resources Information Center
American Journal of Evaluation, 2010
2010-01-01
Over a period spanning 8 years, the Oral History Project Team has conducted interviews with individuals who have made significant contributions to the scholarship, practice, and profession of evaluation. In 2006, Robin Miller, Chris Coryn, and Daniela Schroeter conducted an oral history interview with James R. Sanders at the Evaluation Center that…
Stapp's quantum dualism: The James and Heisenberg model of consciousness
NASA Astrophysics Data System (ADS)
Noyes, H. P.
1994-02-01
Henry Stapp attempts to resolve the Cartesian dilemma by introducing what the author would characterize as an ontological dualism between mind and matter. His model for mind comes from William James' description of conscious events and for matter from Werner Heisenberg's ontological model for quantum events (wave function collapse). His demonstration of the isomorphism between the two types of events is successful, but in the author's opinion fails to establish a monistic, scientific theory. The author traces Stapp's failure to his adamant rejection of arbitrariness, or 'randomness.' This makes it impossible for him (or for Bohr and Pauli before him) to understand the power of Darwin's explanation of biology, let alone the triumphs of modern 'neo-Darwinism.' The author notes that the point at issue is a modern version of the unresolved opposition between Leucippus and Democritus on one side and Epicurus on the other. Stapp's views are contrasted with recent discussions of consciousness by two eminent biologists: Crick and Edelman. They locate the problem firmly in the context of natural selection on the surface of the earth. Their approaches provide a sound basis for further scientific work. The author briefly examines the connection between this scientific (rather than ontological) framework and the new fundamental theory based on bit-strings and the combinatorial hierarchy.
James Webb Space Telescope Project (JWST) Overview
NASA Technical Reports Server (NTRS)
Dutta, Mitra
2008-01-01
This presentation provides an overview of the James Webb Space Telescope (JWST) Project. The JWST is an infrared telescope designed to collect data in the cosmic dark zone. Specifically, the mission of the JWST is to study the origin and evolution of galaxies, stars and planetary systems. It is a deployable telescope with a 6.5 m diameter, segmented, adjustable primary mirror. outfitted with cryogenic temperature telescope and instruments for infrared performance. The JWST is several times more sensitive than previous telescope and other photographic and electronic detection methods. It hosts a near infrared camera, near infrared spectrometer, mid-infrared instrument and a fine guidance sensor. The JWST mission objection and architecture, integrated science payload, instrument overview, and operational orbit are described.
Yes, the James Webb Space Telescope Mirrors 'Can'
2017-12-08
The powerful primary mirrors of the James Webb Space Telescope will be able to detect the light from distant galaxies. The manufacturer of those mirrors, Ball Aerospace & Technologies Corp. of Boulder, Colo., recently celebrated their successful efforts as mirror segments were packed up in special shipping canisters (cans) for shipping to NASA. The Webb telescope has 21 mirrors, with 18 primary mirror segments working together as one large 21.3-foot (6.5-meter) primary mirror. The mirror segments are made of beryllium, which was selected for its stiffness, light weight and stability at cryogenic temperatures. Bare beryllium is not very reflective of near-infrared light, so each mirror is coated with about 0.12 ounce of gold. Northrop Grumman Corp. Aerospace Systems is the principal contractor on the telescope and commissioned Ball for the optics system's development, design, manufacturing, integration and testing. The Webb telescope is the world's next-generation space observatory and successor to the Hubble Space Telescope. The most powerful space telescope ever built, the Webb telescope will provide images of the first galaxies ever formed, and explore planets around distant stars. It is a joint project of NASA, the European Space Agency and the Canadian Space Agency. For more information about the James Webb Space Telescope, visit: www.jwst.nasa.gov Credit: Ball Aerospace NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA’s accomplishments by contributing compelling scientific knowledge to advance the Agency’s mission. Follow us on Twitter Like us on Facebook Find us on Instagram
James Monroe High School Proyecto Nuevos Horizontes, 1986-1987. OEA Evaluation Report.
ERIC Educational Resources Information Center
Martinez, Ana L.; And Others
In its second year of Title VII funding, James Monroe High Schools's Proyecto Nuevos Horizontes (Project New Horizons) served 344 limited-English-speaking recent arrivals from Latin America and the Caribbean, in grades 9 through 12. The program has built on the strengths of the high school's extensive computer-assisted instruction (CAI) program,…
Engineers Work on the James Webb Space Telescope
2017-12-08
Engineers at Ball Aerospace test the Wavefront Sensing and Control testbed to ensure that the 18 primary mirror segments and one secondary mirror on JWST work as one. The test is performed on a 1/6 scale model of the JWST mirrors. Credit: NASA/Northrop Grumman/Ball Aerospace To read more about the James Webb Space Telescope go to: www.nasa.gov/topics/technology/features/partnerships.html NASA Goddard Space Flight Center is home to the nation's largest organization of combined scientists, engineers and technologists that build spacecraft, instruments and new technology to study the Earth, the sun, our solar system, and the universe.
James F. Crow: His Life in Public Service
Abrahamson, Seymour
2012-01-01
The readers of this journal may well be aware of Professor Crow’s scientific achievements and his role as the editor of Perspectives. In addition, for many thousands of students at the University of Wisconsin over many generations, James F. Crow was one of the most memorable teachers at both the undergraduate and graduate levels. What is less known is his major role in public service where he served as chair of many important committees for the National Academy of Sciences, the National Institutes of Health, the National Institutes of Justice as well as various international programs. In all of these efforts, Professor Crow has left a lasting impact. PMID:22219505
Hubble Space Telescope and James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Straughn, Amber
2011-01-01
Over the past 20 years the Hubble Space Telescope has revolutionized our understanding of the Universe. Most recently, the complete refurbishment of Hubble in 2009 has given new life to the telescope and the new science instruments have already produced ground breaking science results, revealing some of the most distant galaxy candidates ever discovered. Despite the remarkable advances in astrophysics that Hubble has provided, the new questions that have arisen demand a new space telescope with new technologies and capabilities. I will present the exciting new technology development and science goals of NASA's James Webb Space Telescope, which is currently being built and tested and will be launched this decade.
James F. Crow: his life in public service.
Abrahamson, Seymour
2012-01-01
The readers of this journal may well be aware of Professor Crow's scientific achievements and his role as the editor of Perspectives. In addition, for many thousands of students at the University of Wisconsin over many generations, James F. Crow was one of the most memorable teachers at both the undergraduate and graduate levels. What is less known is his major role in public service where he served as chair of many important committees for the National Academy of Sciences, the National Institutes of Health, the National Institutes of Justice as well as various international programs. In all of these efforts, Professor Crow has left a lasting impact.
We know in part: James McCosh on evolution and Christian faith.
Morris, Matthew
2014-01-01
James McCosh (1811–1894), president of Princeton College from 1868 to 1888, played a significant role in the American reception of evolution in the late 1800s – he was one of the more prominent clergyman to assuage the public’s fears of evolution while incorporating evolution into a conservative Christian worldview. McCosh was a prolific writer, whose books document his intellectual journey from hostility to acceptance of evolution. Three things will stand out in this overview that have not been emphasized in detail in other works: (1) James McCosh’s perspective on evolution dramatically changed over time; (2) McCosh’s motivations for engaging in the evolution-religion debate serve to clear up confusion regarding McCosh’s final position on evolution; and (3) the theological and philosophical basis for McCosh’s acceptance of evolution was established while McCosh was still hostile to evolution. His theological background therefore ‘pre-adapted’ him for evolution, and he was able to preach theology and evolution without substantially altering his theology.
Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J
2007-05-01
Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.
DOT National Transportation Integrated Search
2014-10-01
This report summarizes findings from monitoring data that was collected over a two-year period from Bridge No. : 61390613004101 in the John James Audubon Project, which was formerly designated as Bridge #2 prior to : construction completion. The brid...
Ferreira, Francisco R M; Nogueira, Maria I; Defelipe, Javier
2014-01-01
In this article we discuss the influence of William James and Charles Darwin on the thoughts of Santiago Ramón y Cajal concerning the structure, plasticity, and evolution of the nervous system at the cellular level. Here we develop Cajal's notion that neuronal theory is a necessary condition to explain the plasticity of neural connections. Although the roots of the term "plasticity" in reference to neuroscience are not completely clear, Cajal was an important figure in the propagation and popularization of its use. It is true that he carried out a large number of studies throughout his career in favor of the neuronal theory, but perhaps one of the most interesting aspects of his studies was his innovative capacity to interpret structure as being the result of evolutionary mechanisms, i.e., natural selection. This capacity would ultimately lead Cajal to the conclusion that, in relation to the histology of the nervous system, such selection occurs in the establishment of connections between cells. The present article is divided into five sections: (1) Learning and general notions of organic plasticity in the 19th century; (2) The idea of "mental" plasticity proposed by James; (3) Neuronal theory and "structural" plasticity: general considerations; (4) Evolutionary factors of the nervous system in Cajal's work; and (5) Final considerations.
Five new Lamiinae (Coleoptera, Cerambycidae) from Bolivia in honor of James E. Wappes.
Galileo, Maria Helena M; Martins, Ubirajara R; Santos-Silva, Antonio
2015-01-01
Five new species of Lamiinae are described from Bolivia, all named after James E. Wappes: Xenofreawappesi (Xenofreini); Anobriumwappesi (Pteropliini); Cotycicuiarawappesi, Nesozineuswappesi, and Psapharochruswappesi (Acanthoderini). Anobriumwappesi, Cotycicuiarawappesi, and Nesozineuswappesi are included in known keys. A short note on the name and date of Anobriumoberthueri Belon, 1903 is provided.
Rumor Processes in Random Environment on and on Galton-Watson Trees
NASA Astrophysics Data System (ADS)
Bertacchi, Daniela; Zucca, Fabio
2013-11-01
The aim of this paper is to study rumor processes in random environment. In a rumor process a signal starts from the stations of a fixed vertex (the root) and travels on a graph from vertex to vertex. We consider two rumor processes. In the firework process each station, when reached by the signal, transmits it up to a random distance. In the reverse firework process, on the other hand, stations do not send any signal but they “listen” for it up to a random distance. The first random environment that we consider is the deterministic 1-dimensional tree with a random number of stations on each vertex; in this case the root is the origin of . We give conditions for the survival/extinction on almost every realization of the sequence of stations. Later on, we study the processes on Galton-Watson trees with random number of stations on each vertex. We show that if the probability of survival is positive, then there is survival on almost every realization of the infinite tree such that there is at least one station at the root. We characterize the survival of the process in some cases and we give sufficient conditions for survival/extinction.
NASA Technical Reports Server (NTRS)
Howard, Joseph M.; Ha, Kong Q.; Shiri, Ron; Smith, J. Scott; Mosier, Gary; Muheim, Danniella
2008-01-01
This paper is part five of a series on the ongoing optical modeling activities for the James Webb Space Telescope (JWST). The first two papers discussed modeling JWST on-orbit performance using wavefront sensitivities to predict line of sight motion induced blur, and stability during thermal transients. The third paper investigates the aberrations resulting from alignment and figure compensation of the controllable degrees of freedom (primary and secondary mirrors), which may be encountered during ground alignment and on-orbit commissioning of the observatory, and the fourth introduced the software toolkits used to perform much of the optical analysis for JWST. The work here models observatory operations by simulating line-of-sight image motion and alignment drifts over a two-week period. Alignment updates are then simulated using wavefront sensing and control processes to calculate and perform the corrections. A single model environment in Matlab is used for evaluating the predicted performance of the observatory during these operations.
NASA Astrophysics Data System (ADS)
Keen, D. H.; Bateman, M. D.; Coope, G. R.; Field, M. H.; Langford, H. E.; Merry, J. S.; Mighall, T. M.
1999-08-01
Pollen, plant macrofossil, molluscan and coleopteran data from organic muds below the low terrace of the River Welland at Deeping St James, Lincolnshire indicate deposition in the mixed oak forest phase of a Late Pleistocene interglacial. Coleopteran and molluscan data suggest summer temperatures up to 4°C warmer than at present in eastern England, and plant macrofossil material suggests a climate more continental than that of Britain in the Holocene. No direct analogue of this biota, however, exists currently in Europe. Biostratigraphical indications from the pollen coleoptera and Mollusca suggest an age in the Ipswichian Interglacial. Thermoluminescence dates between 120 ka and 75 ka and amino-acid ratios with a mean of 0.11 show that deposition of the sediments took place during Oxygen Isotope Stage 5. This accurate dating of a partial Ipswichian succession allows discussion of the ages of a number of other interglacial sites in eastern England of assumed Ipswichian age.
William James's "Talks to Teachers" (1899) and McKeachie's "Teaching Tips" (1999)
ERIC Educational Resources Information Center
McKeachie, Wilbert J.
2003-01-01
What has changed and what has stayed the same in the years since the first publication of James's "Talks to Teachers on Psychology: And to Students on some of Life's Ideals" (1899) and the 10 editions of McKeachie's "Teaching Tips"? Although research and theory have given us better understanding of learning, memory, cognition, and motivation, much…
NASA Astrophysics Data System (ADS)
Calabozo, Fernando M.; Strelin, Jorge A.; Orihashi, Yuji; Sumino, Hirochika; Keller, Randall A.
2015-05-01
We present here the results of detailed mapping, lithofacies analysis and stratigraphy of the Neogene James Ross Island Volcanic Group (Antarctic Peninsula) in the Cerro Santa Marta area (northwest of James Ross Island), in order to give constraints on the evolution of a glaciated volcanic island. Our field results included recognition and interpretation of seventeen volcanic and glacial lithofacies, together with their vertical and lateral arrangements, supported by four new unspiked K-Ar ages. This allowed us to conclude that the construction of the volcanic pile in this area took place during two main eruptive stages (Eruptive Stages 1 and 2), separated from the Cretaceous bedrock and from each other by two major glacial unconformities (U1 and U2). The U1 unconformity is related to Antarctic Peninsula Ice sheet expansion during the late Miocene (before 6.2 Ma) and deposition of glacial lithofacies in a glaciomarine setting. Following this glacial advance, Eruptive Stage 1 (6.2-4.6 Ma) volcanism started with subaerial extrusion of lava flows from an unrecognized vent north of the study area, with eruptions later fed from vent/s centered at Cerro Santa Marta volcano, where cinder cone deposits and a volcanic conduit/lava lake are preserved. These lava flows fed an extensive (> 7 km long) hyaloclastite delta system that was probably emplaced in a shallow marine environment. A second unconformity (U2) was related to expansion of a local ice cap, centered on James Ross Island, which truncated all the eruptive units of Eruptive Stage 1. Concomitant with glacier advance, renewed volcanic activity (Eruptive Stage 2) started after 4.6 Ma and volcanic products were fed again by Cerro Santa Marta vents. We infer that glaciovolcanic eruptions occurred under a moderately thin (~ 300 m) glacier, in good agreement with previous estimates of paleo-ice thickness for the James Ross Island area during the Pliocene.
Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
William Kessen and James Mark Baldwin: Lessons from the History of Developmental Psychology.
ERIC Educational Resources Information Center
Ferrari, Michel; Runions, Kevin; Fueser, Josephine J.
2003-01-01
Considers the work of developmental scholar William Kessen (1925-1999) in light of James Mark Baldwin, one of the founders and principal architects of developmental psychology. Traces Kessen's interest in Baldwin's thought and examines Baldwin's legacy for developmental psychologists. Asserts that Baldwin's theory sought to integrate the role of…
Titan Science with the James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Nixon, Conor A.; Achterberg, Richard K.; Adamkovics, Mate; Bezard, Bruno; Bjoraker, Gordon L.; Comet, Thomas; Hayes, Alaxander G.; Lellouch, Emmanuel; Lemmon, Mark T.; Lopez-Puertas, Manuel;
2016-01-01
The James Webb Space Telescope (JWST), scheduled for launch in 2018, is the successor to the Hubble Space Telescope (HST) but with a signicantly larger aperture (6.5 m) and advanced instrumentation focusing on infrared science (0.6-28.0 microns). In this paper, we examine the potential for scientic investigation of Titan using JWST, primarily with three of the four instruments: NIRSpec, NIRCam, and MIRI, noting that science with NIRISS will be complementary. Five core scientic themes are identied: (1) surface (2) tropospheric clouds (3) tropospheric gases (4) stratospheric composition, and (5) stratospheric hazes. We discuss each theme in depth, including the scientic purpose, capabilities, and limitations of the instrument suite and suggested observing schemes. We pay particular attention to saturation, which is a problem for all three instruments, but may be alleviated for NIRCam through use of selecting small sub-arrays of the detectorssufcient to encompass Titan, but with signicantly faster readout times. We nd that JWST has very signicant potential for advancing Titan science, with a spectral resolution exceeding the Cassini instrument suite at near-infrared wavelengths and a spatial resolution exceeding HST at the same wavelengths. In particular, JWST will be valuable for time-domain monitoring of Titan, given a ve- to ten-year expected lifetime for the observatory, for example, monitoring the seasonal appearance of clouds. JWST observations in the post-Cassini period will complement those of other large facilities such as HST, ALMA, SOFIA, and next-generation ground-based telescopes (TMT, GMT, EELT).
Titan Science with the James Webb Space Telescope
NASA Astrophysics Data System (ADS)
Nixon, Conor A.; Achterberg, Richard K.; Ádámkovics, Máté; Bézard, Bruno; Bjoraker, Gordon L.; Cornet, Thomas; Hayes, Alexander G.; Lellouch, Emmanuel; Lemmon, Mark T.; López-Puertas, Manuel; Rodriguez, Sébastien; Sotin, Christophe; Teanby, Nicholas A.; Turtle, Elizabeth P.; West, Robert A.
2016-01-01
The James Webb Space Telescope (JWST), scheduled for launch in 2018, is the successor to the Hubble Space Telescope (HST) but with a significantly larger aperture (6.5 m) and advanced instrumentation focusing on infrared science (0.6-28.0 μm). In this paper, we examine the potential for scientific investigation of Titan using JWST, primarily with three of the four instruments: NIRSpec, NIRCam, and MIRI, noting that science with NIRISS will be complementary. Five core scientific themes are identified: (1) surface (2) tropospheric clouds (3) tropospheric gases (4) stratospheric composition, and (5) stratospheric hazes. We discuss each theme in depth, including the scientific purpose, capabilities, and limitations of the instrument suite and suggested observing schemes. We pay particular attention to saturation, which is a problem for all three instruments, but may be alleviated for NIRCam through use of selecting small sub-arrays of the detectors—sufficient to encompass Titan, but with significantly faster readout times. We find that JWST has very significant potential for advancing Titan science, with a spectral resolution exceeding the Cassini instrument suite at near-infrared wavelengths and a spatial resolution exceeding HST at the same wavelengths. In particular, JWST will be valuable for time-domain monitoring of Titan, given a five- to ten-year expected lifetime for the observatory, for example, monitoring the seasonal appearance of clouds. JWST observations in the post-Cassini period will complement those of other large facilities such as HST, ALMA, SOFIA, and next-generation ground-based telescopes (TMT, GMT, EELT).
Photographic copy of photograph, B.G. James, photographer, 15 October 1935 ...
Photographic copy of photograph, B.G. James, photographer, 15 October 1935 (original print located at National Archives and Records Center, Denver, Colorado). "PERSONNEL IN CONNECTION WITH WORK. LEFT TO RIGHT - PAUL TAYLOR (BUREAU), CAPTAIN ORDWAY (ARMY), LIEUT. MCCALL (ARMY), LIEUT. LAWSON (ARMY), CAMP SUPT H.E. HOLMAN, MECHANIC WM. PROCTOR WHO SUPERVISED CCC WORKERS" - Kachess Dam, Kachess River, 1.5 miles north of Interstate 90, Easton, Kittitas County, WA
ASTRONAUT JAMES A. LOVELL, JR. - PRELAUNCH - GT-12 - LEAVE TRAILER - CAPE
1966-11-11
S66-59974 (11 Nov. 1966) --- Prime crew for the Gemini-12 spaceflight, astronauts James A. Lovell Jr., (leading), command pilot, and Edwin E. Aldrin Jr., pilot, leave the suiting trailer at Launch Complex 16 during prelaunch countdown. Moments later they entered a transport van which carried them to Pad 19 and their waiting spacecraft. The liftoff was at 3:46 p.m. (EST), Nov. 11, 1966. Photo credit: NASA
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
Instrumenting caves to collect hydrologic and geochemical data: case study from James Cave, Virginia
Schreiber, Madeline E.; Schwartz, Benjamin F.; Orndorff, William; Doctor, Daniel H.; Eagle, Sarah D.; Gerst, Jonathan D.
2015-01-01
Karst aquifers are productive groundwater systems, supplying approximately 25 % of the world’s drinking water. Sustainable use of this critical water supply requires information about rates of recharge to karst aquifers. The overall goal of this project is to collect long-term, high-resolution hydrologic and geochemical datasets at James Cave, Virginia, to evaluate the quantity and quality of recharge to the karst system. To achieve this goal, the cave has been instrumented for continuous (10-min interval) measurement of the (1) temperature and rate of precipitation; (2) temperature, specific conductance, and rate of epikarst dripwater; (3) temperature of the cave air; and (4) temperature, conductivity, and discharge of the cave stream. Instrumentation has also been installed to collect both composite and grab samples of precipitation, soil water, the cave stream, and dripwater for geochemical analysis. This chapter provides detailed information about the instrumentation, data processing, and data management; shows examples of collected datasets; and discusses recommendations for other researchers interested in hydrologic and geochemical monitoring of cave systems. Results from the research, briefly described here and discussed in more detail in other publications, document a strong seasonality of the start of the recharge season, the extent of the recharge season, and the geochemistry of recharge.
EMC Test Challenges for NASAs James Webb Space Telescope
NASA Technical Reports Server (NTRS)
McCloskey, John
2016-01-01
This presentation describes the electromagnetic compatibility (EMC) tests performed on the Integrated Science Instrument Module (ISIM), the science payload of the James Webb Space Telescope (JWST), at NASAs Goddard Space Flight Center (GSFC) in August 2015. By its very nature of being an integrated payload, it could be treated as neither a unit level test nor an integrated spacecraft observatory test. Non-standard test criteria are described along with non-standard test methods that had to be developed in order to evaluate them. Results are presented to demonstrate that all test criteria were met in less than the time allocated.
EMC Test Challenges for NASA's James Webb Space Telescope
NASA Technical Reports Server (NTRS)
McCloskey, John
2016-01-01
This presentation describes the electromagnetic compatibility (EMC) tests performed on the Integrated Science Instrument Module (ISIM), the science payload of the James Webb Space Telescope (JWST), at NASAs Goddard Space Flight Center (GSFC) in August 2015. By its very nature of being an integrated payload, it could be treated as neither a unit level test nor an integrated spacecraft observatory test. Non-standard test criteria are described along with non-standard test methods that had to be developed in order to evaluate them. Results are presented to demonstrate that all test criteria were met in less than the time allocated.
James Webb Space Telescope (JWST): The First Light Machine
NASA Technical Reports Server (NTRS)
Stahl, Philip
2009-01-01
This slide presentation review the mission objective, the organization of the mission planning, the design, and testing of the James Webb Space Telescope (JWST). There is also information about the orbit, in comparison to the Hubble Space Telescope, the mirror design, and the science instruments. Pictures of the full scale mockup of the JWST are given. A brief history of the universe is also presented from the big bang through the formation of galaxies, and the planets, to life itself. One of the goals of the JWST is to search for extra solar planets and then to search for signs of life.
The James Webb Space Telescope: Inspiration and Context for Physics and Chemistry Teaching
ERIC Educational Resources Information Center
Hillier, Dan; Johnston, Tania; Davies, John
2012-01-01
This article describes the design, delivery, evaluation and impact of a CPD course for physics and chemistry teachers. A key aim of the course was to use the context of the James Webb Space Telescope project to inspire teachers and lead to enriched teaching of STEM subjects. (Contains 1 box and 3 figures.)
ERIC Educational Resources Information Center
Furniss, Tom
2014-01-01
Rather than focussing on the relationship between science and literature, this article attempts to read scientific writing as literature. It explores a somewhat neglected element of the story of the emergence of geology in the late eighteenth century--James Hutton's unpublished accounts of the tours of Scotland that he undertook in the years…
Astronaut James Lovell at his position in the Lunar Module
1970-04-14
AS13-59-8484 (April 1970) --- Astronaut James A. Lovell Jr., commander, is pictured at his position in the Lunar Module (LM). The Apollo 13 crew of astronauts Lovell; John L. Swigert Jr., command module pilot; and Fred W. Haise Jr., lunar module pilot, relied on the LM as a "lifeboat". The dependence on the LM was caused by an apparent explosion of oxygen tank number two in the Service Module (SM). The LM was jettisoned just prior to Earth re-entry by the Command Module (CM).
Astronaut James Newman works with power ratchet tool in payload bay
1993-09-16
In Discovery's cargo bay, astronaut James H. Newman works with the power ratchet tool (PRT). Astronaut Carl E. Walz, who joined Newman for the lengthy period of extravehicular activity (EVA), is partially visible in the background. The two mission specialists devoted part of their EVA to evaluating tools and equipment expected to be used in the Hubble Space Telescope servicing. A desert area in Africa forms the backdrop for the 70mm scene.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-06-30
...] James Campbell National Wildlife Refuge, Honolulu County, HI; Draft Comprehensive Conservation Plan and...`iwa, HI 96712. FOR FURTHER INFORMATION CONTACT: David Ellis, Project Leader, (808) 637-6330...`ahu National Wildlife Refuge Complex, 66-590 Kamehameha Highway, Room 2C, Hale`iwa, HI 96712. The...
Leary, David E
2009-01-01
This article focuses on the 20-year gap between Charles S. Peirce's classic proposal of pragmatism in 1877-1878 and William James's equally classic call for pragmatism in 1898. It fills the gap by reviewing relevant developments in the work of Peirce and James and by introducing G. Stanley Hall, for the first time, as a figure in the history of pragmatism. In treating Hall and pragmatism, the article reveals a previously unnoted relation between the early history of pragmatism and the early history of the "new psychology" that Hall helped to pioneer. (c) 2009 Wiley Periodicals, Inc.
The James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2012-01-01
The James Webb Space Telescope is the scientific successor to the Hubble and Spitzer Space Telescopes. It will be a large (6.6m) cold (SDK) telescope launched into orbit around the second Earth-Sun Lagrange point. It is a partnership of NASA with the European and Canadian Space Agencies. The science goals for JWST include the formation of the first stars and galaxies in the early universe; the chemical, morphological and dynamical buildup of galaxies and the formation of stars and planetary systems. Recently, the goals have expanded to include studies of dark energy, dark matter, active galactic nuclei, exoplanets and Solar System objects. Webb will have four instruments: The Near-Infrared Camera, the Near-Infrared multi-object Spectrograph, and the Near-Infrared Imager and Slitless Spectrograph will cover the wavelength range 0.6 to S microns, while the Mid-Infrared Instrument will do both imaging and spectroscopy from 5 to 28.5 microns. The observatory is confirmed for launch in 2018; the design is complete and it is in its construction phase. Recent progress includes the completion of the mirrors, the delivery of the first flight instruments and the start of the integration and test phase.
Foss, Donald J; Overmier, J Bruce
2013-01-01
Presents an obituary for James J. Jenkins. Jim Jenkins, fondly known as "J-cubed," was born on July 29, 1923, in St. Louis, Missouri. He attended William Jewell College but enlisted in the Army in 1942. He received a bachelor's degree in physics from the University of Chicago in 1944 as part of his training as a meteorologist. After serving in the South Pacific, he returned to William Jewell College, obtaining a bachelor's degree in psychology in 1947. Jenkins received a master's degree (1948) and a doctorate (1950) from the University of Minnesota under a giant in industrial psychology, Donald G. Paterson. He joined the Minnesota Psychology Department faculty upon graduation (turning down an offer from General Motors at triple the salary). Jenkins helped lead psychology's "cognitive revolution" from the second half of the 20th century into the present one. His work advanced multiple research areas: learning and memory, sentence processing, aphasia, speech perception, and perceptual organization. His remarkable combination of abilities led to nearly 200 scholarly publications and 500 conference and meeting presentations; multiple leadership positions, teaching awards, and professional accolades; and intense devotion from generations of students.
DOT National Transportation Integrated Search
2014-10-01
This project allowed the continuation of collecting monitoring data from Bridge #6139061300401 in the John James Audubon Project : for an additional two-year period. Bridge #6139061300401 was instrumented as part of an earlier project (LTRC Project N...
Stapp`s quantum dualism: The James/Heisenberg model of consciousness
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noyes, H.P.
1994-02-18
Henry Stapp attempts to resolve the Cartesian dilemma by introducing what the author would characterize as an ontological dualism between mind and matter. His model for mind comes from William James` description of conscious events and for matter from Werner Heisenberg`s ontological model for quantum events (wave function collapse). His demonstration of the isomorphism between the two types of events is successful, but in the author`s opinion fails to establish a monistic, scientific theory. The author traces Stapp`s failure to his adamant rejection of arbitrariness, or `randomness`. This makes it impossible for him (or for Bohr and Pauli before him)more » to understand the power of Darwin`s explanation of biology, let along the triumphs of modern `neo-Darwinism`. The author notes that the point at issue is a modern version of the unresolved opposition between Leucippus and Democritus on one side and Epicurus on the other. Stapp`s views are contrasted with recent discussions of consciousness by two eminent biologists: Crick and Edelman. They locate the problem firmly in the context of natural selection on the surface of the earth. Their approaches provide a sound basis for further scientific work. The author briefly examines the connection between this scientific (rather than ontological) framework and the new fundamental theory based on bit-strings and the combinatorial hierarchy.« less
An Interdisciplinary Program in Materials Science at James Madison University.
NASA Astrophysics Data System (ADS)
Hughes, Chris
2008-03-01
Over the past decade a core group of faculty at James Madison University has created an interdisciplinary program in materials science that provides our students with unique courses and research experiences that augment the existing, high-quality majors in physics and astronomy, chemistry and biochemistry, geology and environmental science, mathematics and statistics, and integrated science and technology. The university started this program by creating a Center for Materials Science whose budget is directly allocated by the provost. This source of funds acts as seed money for research, support for students, and a motivating factor for each of the academic units to support the participation of their faculty in the program. Courses were created at the introductory and intermediate level that are cross-listed by the departments to encourage students to enroll in them as electives toward their majors. Furthermore, the students are encouraged to participate in undergraduate research in materials since this is the most fundamental unifying theme across the disciplines. This talk will cover some of the curricular innovations that went into the design of the program to make it successful, examples of faculty and student research and how that feeds back into the classroom, and success stories of the interactions that have developed between departments because of this program. Student outcomes and future plans to improve the program will also be discussed.
An Insider's Perspective on the National Spelling Bee: An Interview with James Maguire
ERIC Educational Resources Information Center
Henkin, Roxanne; Harmon, Janis; Pate, Elizabeth; Moorman, Honor
2008-01-01
In this article, the coeditors of "Voices from the Middle" present an interview with James Maguire, author of "The American Bee: The National Spelling Bee and the Culture of Word Nerds." During the interview, Maguire talked about his experiences with the National Spelling Bee to provide some insight to middle-level teachers and students. Maguire…
NASA Technical Reports Server (NTRS)
Coulter, Phillip; Beaton, Alexander; Gum, Jeffrey S.; Hadjimichael, Theodore J.; Hayden, Joseph E.; Hummel, Susann; Hylan, Jason E.; Lee, David; Madison, Timothy J.; Maszkiewicz, Michael;
2014-01-01
The James Webb Space Telescope science instruments are in the final stages of being integrated into the Integrated Science Instrument Module (ISIM) element. Each instrument is tied into a common coordinate system through mechanical references that are used for optical alignment and metrology within ISIM after element-level assembly. In addition, a set of ground support equipment (GSE) consisting of large, precisely calibrated, ambient, and cryogenic structures are used as alignment references and gauges during various phases of integration and test (I&T). This GSE, the flight instruments, and ISIM structure feature different types of complimentary metrology targeting. These GSE targets are used to establish and track six degrees of freedom instrument alignment during I&T in the vehicle coordinate system (VCS). This paper describes the optomechanical metrology conducted during science instrument integration and alignment in the Spacecraft Systems Development and Integration Facility (SSDIF) cleanroom at NASA Goddard Space Flight Center (GSFC). The measurement of each instrument's ambient entrance pupil location in the telescope coordinate system is discussed. The construction of the database of target locations and the development of metrology uncertainties is also discussed.
NASA Astrophysics Data System (ADS)
Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq
2018-04-01
This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.
ASTRONAUT JAMES A. LOVELL, JR. - RECOVERY - GEMINI-TITAN (GT)-12 - ON BOARD CARRIER - ATLANTIC
1966-11-15
S66-59997 (15 Nov. 1966) --- A happy Gemini-12 prime crew arrives aboard the aircraft carrier, USS Wasp. Astronauts James A. Lovell Jr. (left), command pilot, and Edwin E. Aldrin Jr., pilot, had just been picked up from the splashdown area by helicopter. Photo credit: NASA
The Cabinet Member as a Representative of the President: The Case of James Watt.
ERIC Educational Resources Information Center
Renz, Mary Ann
1987-01-01
Compares the environmental rhetoric of former U.S. Interior Secretary James Watt and U.S. President Ronald Reagan, explaining that Watt's political value outweighed his political liability. Notes that cabinet members extend a President's influence by reaching issue-specific audiences while maintaining philosophical consistency, and serve as…
Inland diatoms from the McMurdo Dry Valleys and James Ross Island, Antarctica
Esposito, R.M.M.; Spaulding, S.A.; McKnight, Diane M.; Van De Vijver, B.; Kopalova, K.; Lubinski, D.; Hall, B.; Whittaker, T.
2008-01-01
Diatom taxa present in the inland streams and lakes of the McMurdo Dry Valleys and James Ross Island, Antarctica, are presented in this paper. A total of nine taxa are illustrated, with descriptions of four new species (Luticola austroatlantica sp. nov., Luticola dolia sp. nov., Luticola laeta sp. nov., Muelleria supra sp. nov.). In the perennially ice-covered lakes of the McMurdo Dry Valleys, diatoms are confined to benthic mats within the photic zone. In streams, diatoms are attached to benthic surfaces and within the microbial mat matrix. One species, L. austroatlantica, is found on James Ross Island, of the southern Atlantic archipelago, and the McMurdo Dry Valleys. The McMurdo Dry Valley populations are at the lower range of the size spectrum for the species. Streams flow for 6-10 weeks during the austral summer, when temperatures and solar radiation allow glacial ice to melt. The diatom flora of the region is characterized by species assemblages favored under harsh conditions, with naviculoid taxa as the dominant group and several major diatom groups conspicuously absent. ?? 2008 NRC.
The psychopathology of James Bond and its implications for the revision of the DSM-(00)7.
Alrutz, Anna Stowe; Kool, Bridget; Robinson, Tom; Moyes, Simon; Huggard, Peter; Hoare, Karen; Arroll, Bruce
2015-12-14
To develop a more concise, user-friendly edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM). The DSM advisory board is probably already hard at work on the DSM-6, so this study is focused on the DSM-(00)7 edition. We conducted an observational study, using a mixed methods approach to analyse the 50th edition boxset of James Bond experiences. James Bond was selected as a suitably complex subject for the basis of a trial of simplifying the DSM. Researchers' televisions and computers from late January to mid-April in Auckland, New Zealand. Following a review of the 23 James Bond video observations, we identified 32 extreme behaviours exhibited by the subject; these could be aggregated into 13 key domains. A Delphi process identified a cluster of eight behaviours that comprise the Bond Adequacy Disorder (BAD). A novel screening scale was then developed, the Bond Additive Descriptors of Anti-Sociality Scale (BADASS), with a binary diagnostic outcome, BAD v Normality Disorder. We propose that these new diagnoses be adopted as the foundation of the DSM-(00)7. The proposed DSM-(00)7 has benefits for both patients and clinicians. Patients will experience reduced stigma, as most individuals will meet the criteria for Normality Disorder. This parsimonious diagnostic approach will also mean clinicians have more time to focus on patient management.
Capabilities of the James Webb Space Telescope for Exoplanet Science
NASA Technical Reports Server (NTRS)
Clampin, Mark
2009-01-01
The James Webb Space Telescope (JWST) is a large aperture (6.5 meter), cryogenic space telescope with a suite of near and mid-infrared instruments covering the wavelength range of 0.6 m to 28 m. JWST s primary science goal is to detect and characterize the first galaxies. It will also study the assembly of galaxies, star formation, and the formation of evolution of planetary systems. We also review the expected scientific performance of the observatory for observations of exosolar planets by means of transit photometry and spectroscopy, and direct coronagraphic imaging.
The James Webb Space Telescope (JWST), The First Light Machine
NASA Technical Reports Server (NTRS)
Stahl, H. Philip
2013-01-01
Scheduled to begin its 10 year mission after 2018, the James Webb Space Telescope (JWST) will search for the first luminous objects of the Universe to help answer fundamental questions about how the Universe came to look like it does today. At 6.5 meters in diameter, JWST will be the world s largest space telescope. This talk reviews science objectives for JWST and how they drive the JWST architecture, e.g. aperture, wavelength range and operating temperature. Additionally, the talk provides an overview of the JWST primary mirror technology development and fabrication status.
Ferreira, Francisco R. M.; Nogueira, Maria I.; DeFelipe, Javier
2014-01-01
In this article we discuss the influence of William James and Charles Darwin on the thoughts of Santiago Ramón y Cajal concerning the structure, plasticity, and evolution of the nervous system at the cellular level. Here we develop Cajal’s notion that neuronal theory is a necessary condition to explain the plasticity of neural connections. Although the roots of the term “plasticity” in reference to neuroscience are not completely clear, Cajal was an important figure in the propagation and popularization of its use. It is true that he carried out a large number of studies throughout his career in favor of the neuronal theory, but perhaps one of the most interesting aspects of his studies was his innovative capacity to interpret structure as being the result of evolutionary mechanisms, i.e., natural selection. This capacity would ultimately lead Cajal to the conclusion that, in relation to the histology of the nervous system, such selection occurs in the establishment of connections between cells. The present article is divided into five sections: (1) Learning and general notions of organic plasticity in the 19th century; (2) The idea of “mental” plasticity proposed by James; (3) Neuronal theory and “structural” plasticity: general considerations; (4) Evolutionary factors of the nervous system in Cajal’s work; and (5) Final considerations. PMID:24523676
James Webb Space Telescope (JWST) Optical Telescope Element (OTE) Development Status
NASA Technical Reports Server (NTRS)
Feinberg, Lee D.
2004-01-01
The James Webb Space Telescope (JWST) Optical Telescope Element (OTE) is a segmented, cryogenic telescope scheduled for launch in 2011. In September of 2002, NASA selected prime contractor Northrop Grumman Space Technology (NGST) to build the observatory including management of the OTE. NGST is teamed with subcontractors Ball Aerospace, Alliant Techsystems (ATK). and Kodak. The team has completed several significant design, technology, architecture definition, and manufacturing milestones in the past year that are summarized in this paper.
Nuevos Horizontes, James Monroe High School, 1987-1988. Evaluation Section Report. OREA Report.
ERIC Educational Resources Information Center
Berney, Tomi D.; Lista, Carlos
Proyecto Nuevos Horizontes (Project New Horizons) at James Monroe High School (New York City) served 328 students of limited English proficiency (LEP) in grades 9-12 during the final year of a 3-year funding cycle. The project's purpose was to build on the strengths of the school's extensive computer-assisted instructional program in order to…
Five new Lamiinae (Coleoptera, Cerambycidae) from Bolivia in honor of James E. Wappes
Galileo, Maria Helena M.; Martins, Ubirajara R.; Santos-Silva, Antonio
2015-01-01
Abstract Five new species of Lamiinae are described from Bolivia, all named after James E. Wappes: Xenofrea wappesi (Xenofreini); Anobrium wappesi (Pteropliini); Cotycicuiara wappesi, Nesozineus wappesi, and Psapharochrus wappesi (Acanthoderini). Anobrium wappesi, Cotycicuiara wappesi, and Nesozineus wappesi are included in known keys. A short note on the name and date of Anobrium oberthueri Belon, 1903 is provided. PMID:25878524
Memories of Montpelier: Home of James and Dolley Madison. Teaching with Historic Places.
ERIC Educational Resources Information Center
Boyer, Candace
The paternal estate of U.S. President James Madison is nestled at the foot of Virginia's Blue Ridge Mountains. The estate, Montpelier, features a large mansion designed for hospitality, a fine garden, and a widespread lawn. In the early 19th century, countless visitors expressed a great sense of pleasure in the place and the people who lived…
Srivastava, Ruby
2018-03-01
We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-20
...] James Campbell National Wildlife Refuge, Honolulu County, HI; Final Comprehensive Conservation Plan and... Wildlife Refuge Complex, 66-590 Kamehameha Highway, Room 2C, Hale`iwa, HI 96712. In-Person Viewing or Pickup: O`ahu National Wildlife Refuge Complex, 66-590 Kamehameha Highway, Room 2C, Hale`iwa, HI 96712...
Astronaut James A. McDivitt on deck of ship prior to water egress training
1968-11-05
S68-54805 (5 Nov. 1968) --- Astronaut James A. McDivitt, commander of the Apollo 9 (Spacecraft 104/Lunar Module 3/Saturn 504) space mission, relaxes on the deck of the NASA Motor Vessel Retriever (MVR) prior to participating in water egress training in the Gulf of Mexico.
NASA Astrophysics Data System (ADS)
Meier, Lars A.; Krauze, Patryk; Prater, Isabel; Scholten, Thomas; Wagner, Dirk; Kühn, Peter; Mueller, Carsten W.
2017-04-01
Referring to the fundamental question in ecosystem research, how biotic and abiotic processes interact, only a few studies exist for polar regions that integrate microbiological and soil scientific studies . Soils comprise the complex structure and environment that fosters water storage and nutrient cycling determined by its unique chemical, physical and biological properties with respect to the specific climate and parent material. In the extreme environment of Antarctica, soil biological processes are primarily controlled by microbial communities (Bacteria, Archaea and Fungi), and thus microbiota may also determine soils chemical and physical properties in a landscape lacking higher plants at an average air temperature below 0°C. James Ross Island, Maritime Antarctica, offers a pristine laboratory and an exceptional opportunity to study pedogenesis without the influence of vascular plants and burrowing animals. We analysed micromorphological features, chemical and microbiological measures at two sites on James Ross Island (Brandy Bay and St. Martha Cove) with similar substrates (mostly fine-grained calcareous sandstones and siltstones of the Alpha Member of the Santa Martha Formation with varying amounts of conglomerates and mudstones) at similar topographic positions (small plateaus at similar elevation (80m a.s.l.)). The sites represent luv- and leeward conditions with respect to the main southwesterly winds. The climate on James Ross Island is to be described as semi-arid polar-continental, which is in clear contrast to the Southern Shetlands (e.g. King George Island) north of the Antarctic Peninsula. We will present first results of soil physical (bulk density, soil moisture and grains size distribution), pedochemical (SOC, total N and S, pH, CECeff, and pedogenic oxides) micromorphological and microbial analyses (Microbial DNA content, microbial abundances).
Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.
Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J
2013-04-18
Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Single-Stranded γPNAs for In Vivo Site-Specific Genome Editing via Watson-Crick Recognition
Bahal, Raman; Quijano, Elias; McNeer, Nicole Ali; Liu, Yanfeng; Bhunia, Dinesh C.; López-Giráldez, Francesco; Fields, Rachel J.; Saltzman, W. Mark; Ly, Danith H.; Glazer, Peter M.
2014-01-01
Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction. PMID:25174576
Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.
Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M
2014-01-01
Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-01-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536
Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G
2015-05-14
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
NASA Astrophysics Data System (ADS)
Hong, Bo; Shen, Jian; Xu, Hongzhou
2018-01-01
The water exchange between the James River and the Elizabeth River, an estuary and sub-estuary system in the lower Chesapeake Bay, was investigated using a 3D numerical model. The conservative passive tracers were used to represent the dissolved substances (DS) discharged from the Elizabeth River. The approach enabled us to diagnose the underlying physical processes that control the expansion of the DS, which is representative of potential transport of harmful algae blooms, pollutants from the Elizabeth River to the James River without explicitly simulating biological processes. Model simulations with realistic forcings in 2005, together with a series of processoriented numerical experiments, were conducted to explore the correlations of the transport process and external forcing. Model results show that the upriver transport depends highly on the freshwater discharge on a seasonal scale and maximum upriver transport occurs in summer with a mean transport time ranging from 15-30 days. The southerly/easterly wind, low river discharge, and neap tidal condition all act to strengthen the upriver transport. On the other hand, the northerly/westerly wind, river pulse, water level pulse, and spring tidal condition act to inhibit the upriver transport. Tidal flushing plays an important role in transporting the DS during spring tide, which shortens the travel time in the lower James River. The multivariable regression analysis of volume mean subtidal DS concentration in the mesohaline portion of the James River indicates that DS concentration in the upriver area can be explained and well predicted by the physical forcings (r = 0.858, p = 0.00001).
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.
Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T
2016-05-05
Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
A Marriage of Minds: James R. Jacobs & Shinjoung Yeo Univ. of California-San Diego
ERIC Educational Resources Information Center
Library Journal, 2005
2005-01-01
Their personalities and backgrounds are very different, but James R. Jacobs and Shinjoung Yeo are passionate about the same causes: librarianship, open government, and empowerment through information. They balance each other. Yeo is focused, realistic, critical, and an excellent researcher. Her superhero alter ego is Wet Blanket Woman, able to…
James Britton and John Keats: An Examination of the Theory and Practice of Composition.
ERIC Educational Resources Information Center
Gloster, Beulah H.
John Keats provides a convincing and helpful model of James Britton's philosophy and research on composition. While, contrary to Britton's paradigm, much of Keats's work is simultaneously in the expressive, transactional and poetic modes, early poems are primarily expressive: they record his perception of reality as filtered through his senses and…
Restoration planting options for limber pine (Pinus flexilis James) in the Southern Rocky Mountains
A. M. A. Casper; W. R. Jacobi; Anna Schoettle; K. S. Burns
2016-01-01
Limber pine Pinus flexilis James populations in the southern Rocky Mountains are threatened by the combined impacts of mountain pine beetles and white pine blister rust. To develop restoration planting methods, six P. flexilis seedling planting trial sites were installed along a geographic gradient from southern Wyoming to southern Colorado. Experimental...
A Conversation with James J. Morgan
NASA Astrophysics Data System (ADS)
Morgan, James J.; Newman, Dianne K.
2015-05-01
In conversation with professor Dianne Newman, Caltech geobiologist, James "Jim" J. Morgan recalls his early days in Ireland and New York City, education in parochial and public schools, and introduction to science in Cardinal Hayes High School, Bronx. In 1950, Jim entered Manhattan College, where he elected study of civil engineering, in particular water quality. Donald O'Connor motivated Jim's future study of O2 in rivers at Michigan, where in his MS work he learned to model O2 dynamics of rivers. As an engineering instructor at Illinois, Jim worked on rivers polluted by synthetic detergents. He chose to focus on chemical studies, seeing it as crucial for the environment. Jim enrolled for PhD studies with Werner Stumm at Harvard, who mentored his research in chemistry of particle coagulation and oxidation processes of Mn(II) and (IV). In succeeding decades, until retirement in 2000, Jim's teaching and research centered on aquatic chemistry; major themes comprised rates of abiotic manganese oxidation on particle surfaces and flocculation of natural water particles, and chemical speciation proved the key.
The Role of Integrated Modeling in the Design and Verification of the James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Mosler, Gary E.; Howard, Joseph M.; Johnston, John D.; Hyde, T. Tupper; McGinnis, Mark A.; Bluth, A. Marcel; Kim, Kevin; Ha, Kong Q.
2004-01-01
This viewgraph presentation gives an overview of the architecture of the James Webb Space Telescope, and explains how integrated modeling is useful for analyzing wavefront, thermal distortion, subsystems, and image motion/jitter for the telescope design.
DOT National Transportation Integrated Search
2017-12-01
Molecular genetic techniques provide tools that may be used to locate, monitor, and survey cryptic aquatic species. This study developed genetic markers useful in determining if the James Spinymussel (Pleurobema collina), an endangered species, can b...
Cloud Geometry Analysis of the Smoke Week III Obscuration Trials.
1982-01-01
GRAPIC 1LJu 4 Cf . .444,44 44- 0. 15, 25, TltME( SErs AOEDET. . **** *HEI HT0F CENTER OP MASS ABOVE DET. PT 42 SMOKE III EVENT # 07 1313 Z 08-12-80 STATION...PORTION OF CLOUD ATMOSPHEdIC SCIENCES LABORATORY WHITE SANDS MISSILE RANGE, N.M. 119 CLI-J000000 ) .0 0 1a 40 M M M MMMMMMMM ul zo w -ZIxJ z z w 0 L- CF ... CF -R (CPT James M. Watson) Dugway, UT 84022 Port Sill, OK 73503 Commander Commandant US Army Dugway Proving Ground US Army Field Artillery School ATTN
Durgun Ozan, Yeter; Okumuş, Hülya
2017-06-01
Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.
NASA Astrophysics Data System (ADS)
Egron, Sylvain; Lajoie, Charles-Philippe; Michau, Vincent; Bonnefois, Aurélie; Escolle, Clément; Leboulleux, Lucie; N'Diaye, Mamadou; Pueyo, Laurent; Choquet, Elodie; Perrin, Marshall D.; Ygouf, Marie; Fusco, Thierry; Ferrari, Marc; Hugot, Emmanuel; Soummer, Rémi
2017-09-01
The current generation of terrestrial telescopes has large enough primary mirror diameters that active optical control based on wavefront sensing is necessary. Similarly, in space, while the Hubble Space Telescope (HST) has a mostly passive optical design, apart from focus control, its successor the James Webb Space Telescope (JWST) has active control of many degrees of freedom in its primary and secondary mirrors.
ASTRONAUT JAMES A. LOVELL, JR. - TRAINING - WEIGHT AND BALANCE - PRIME CREW (GT-7)
1965-10-25
S65-57481 (25 Oct. 1965) --- Astronaut James A. Lovell Jr., pilot of the Gemini-7 spaceflight, undergoes weight and balance tests in the Pyrotechnic Installation Building, Merritt Island, Kennedy Space Center. Talking with Lovell are (left to right) Charlie Beaty, McDonnell Aircraft Corporation; Karl Stoien, MAC; NASA suit technician Al Rochferd; and Norm Batterson, Weber Aircraft Corporation. Photo credit: NASA
The James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Nowak, Maria; Eichorn, William; Hill, Michael; Hylan, Jason; Marsh, James; Ohl, Raymond; Sampler, Henry; Wright, Geraldine; Crane, Allen; Herrera, Acey;
2007-01-01
The James Webb Space Telescope (JWST) is a 6.6m diameter, segmented, deployable telescope for cryogenic IR space astronomy (approx.40K). The JWST Observatory architecture includes the Optical Telescope Element and the Integrated Science Instrument Module (ISIM) element that contains four science instruments (SI) including a Guider. The ISIM optical metering structure is a roughly 2.2x1.7x2.2mY, asymmetric frame that is composed of carbon fiber and resin tubes bonded to invar end fittings and composite gussets and clips. The structure supports the SIs, isolates the SIs from the OTE, and supports thermal and electrical subsystems. The structure is attached to the OTE structure via strut-like kinematic mounts. The ISM structure must meet its requirements at the approx.40K cryogenic operating temperature. The SIs are aligned to the structure s coordinate system under ambient, clean room conditions using laser tracker and theodolite metrology. The ISM structure is thermally cycled for stress relief and in order to measure temperature-induced mechanical, structural changes. These ambient-to-cryogenic changes in the alignment of SI and OTE-related interfaces are an important component in the JWST Observatory alignment plan and must be verified.
James Paget Henry--a retrospective.
Meehan, J P; Meehan, W P
1997-01-01
James Paget Henry really began his productive research career at the outset of the second world war. His studies of acceleration and the anoxia of high altitude were supported by the development of then new techniques of measuring and recording critical physiologic parameters such as vascular pressures, respiratory functions and haemoglobin saturation. His inquisitive mind made productive use of the instruments that had to be made by skilled instrument makers working in university shops. Much of this instrumentation has now found its way into the clinical arena where it is now the main armamentarium of cardiac diagnostic and respiratory function laboratories. His work in the space program preceeded that of the Russians but did not get recognition until Sputnik awakened the world to the possibilities of space flight. His development of the concept of a cardiovascular basis for fluid volume control and the supportive investigative work undertaken constitute a milestone in the annals of experimental physiology. The chimpanzees used in Project Mercury were found to be hypertensive which was related to the method of capture used by the commercial suppliers. This lead Jim to study the effect of early experience on resting blood pressure, an effort that soon developed into provocative studies of the biological basis of the stress response.
ERIC Educational Resources Information Center
Cairns, Robert B.
1992-01-01
James Baldwin's ideas, such as that of a genetic science, and their influence on later theorists such as Piaget, Vygotsky, and Kohlberg, are described. The further Baldwin moved from the study of infancy, the more speculative and the less empirically verifiable became his ideas. (BC)
James Franklin and Freedom of the Press in Massachusetts and Rhode Island, 1717-1735.
ERIC Educational Resources Information Center
Smith, Jeffery A.
The career of James Franklin, Benjamin Franklin's older brother, provides a case study in the use of polemics for a free press. A printer who actively courted controversy, Franklin found it necessary to use an unusual variety of strategies and justifications to evade or overcome potential legal, religious, and economic restraints. He demonstrated…
How James Kept the Pace?; A Look into the Organic Unity of "Daisy Miller"
ERIC Educational Resources Information Center
Movaghati, Sina; Comcar, Milad
2015-01-01
Many Critics believe that Henry James has set the definitive standards of modern fiction writing. Undoubtedly his groundbreaking article "The Art of Fiction," which published for the first time in 1884, has a major contribution in developing the theories of fiction writing. The term Organic Unity has derived from a major Formalist…
Liberating Literacy under Threat: Re-Reading James Moffett's "Storm in the Mountains"
ERIC Educational Resources Information Center
Mayher, John
2010-01-01
James Moffett's "Storm in the Mountains: A Case Study of Censorship, Conflict, and Consciousness" remains as relevant today as it was when it was published in 1988 for those who want to understand the nature and sources of contemporary conflicts in American language and literacy education. Censors continue to try to restrict student…
MEMS Microshutter Arrays for James Webb Space Telescope
NASA Technical Reports Server (NTRS)
Li, Mary J.; Beamesderfer, Michael; Babu, Sachi; Bajikar, Sateesh; Ewin, Audrey; Franz, Dave; Hess, Larry; Hu, Ron; Jhabvala, Murzy; Kelly, Dan;
2006-01-01
MEMS microshutter arrays are being developed at NASA Goddard Space Flight Center for use as an aperture array for a Near-Infrared Spectrometer (NirSpec). The instruments will be carried on the James Webb Space Telescope (JWST), the next generation of space telescope after Hubble Space Telescope retires. The microshutter arrays are designed for the selective transmission of light with high efficiency and high contrast, Arrays are close-packed silicon nitride membranes with a pixel size of 100x200 microns. Individual shutters are patterned with a torsion flexure permitting shutters to open 90 degrees with a minimized mechanical stress concentration. Light shields are made on to each shutter for light leak prevention so to enhance optical contrast, Shutters are actuated magnetically, latched and addressed electrostatically. The shutter arrays are fabricated using MEMS technologies.
Photographic copy of photograph (original print in possession of James ...
Photographic copy of photograph (original print in possession of James E. Zelinski, Earth Tech, Huntsville, AL). Photographer unknown. Aerial view (southwest to northeast) of remote sprint launch site #2, nearing completion. The RLOB has been earth-mounded. The limited access sentry station can be seen in the PAR right foreground, behind it are the waste stabilization ponds. Barely discernible is the exclusion area sentry station at the entrance to the sprint field - Stanley R. Mickelsen Safeguard Complex, Remote Sprint Launch Site No. 2, West of Mile Marker 220 on State Route 1, 6.0 miles North of Langdon, ND, Nekoma, Cavalier County, ND
James Webb Space Telescope - Applying Lessons Learned to I&T
NASA Technical Reports Server (NTRS)
Johns, Alan; Seaton, Bonita; Gal-Edd, Jonathan; Jones, Ronald; Fatig, Curtis; Wasiak, Francis
2008-01-01
The James Webb Space Telescope (JWST) is part of a new generation of spacecraft acquiring large data volumes from remote regions in space. To support a mission such as the JWST, it is imperative that lessons learned from the development of previous missions such as the Hubble Space Telescope and the Earth Observing System mission set be applied throughout the development and operational lifecycles. One example of a key lesson that should be applied is that core components, such as the command and telemetry system and the project database, should be developed early, used throughout development and testing, and evolved into the operational system. The purpose of applying lessons learned is to reap benefits in programmatic or technical parameters such as risk reduction, end product quality, cost efficiency, and schedule optimization. In the cited example, the early development and use of the operational command and telemetry system as well as the establishment of the intended operational database will allow these components to be used by the developers of various spacecraft components such that development, testing, and operations will all use the same core components. This will reduce risk through the elimination of transitions between development and operational components and improve end product quality by extending the verification of those components through continual use. This paper will discuss key lessons learned that have been or are being applied to the JWST Ground Segment integration and test program.
76 FR 54382 - Safety Zone; Labor Day Fireworks, Ancarrows Landing Park, James River, Richmond, VA
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-01
... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2011-0546] RIN 1625-AA00 Safety Zone; Labor Day Fireworks, Ancarrows Landing Park, James River, Richmond, VA AGENCY: Coast... notice of proposed rulemaking (NPRM) entitled Safety Zone; Labor Day Fireworks, Ancarrows Landing Park...
ERIC Educational Resources Information Center
Dentler, Robert A.
1999-01-01
James Traub, in his report for the "New York Times Magazine," suggests that some "adaptive" techniques, such as cascading applicants to other colleges and particular administrative approaches, will provide the benefits of affirmative action without its drawbacks. This is a misleading message. Adaptive techniques will not offset…
Media, Digital Technology and Learning in Sport: A Critical Response to Hodkinson, Biesta and James
ERIC Educational Resources Information Center
Enright, Eimear; Gard, Michael
2016-01-01
Background: In their 2008 paper, Hodkinson, Biesta and James draw on the sociological theories of Pierre Bourdieu to construct what they claim is a "holistic" theoretical framework for understanding learning. While not an attempt to dissolve the long-standing opposition between "cognitive" and "situated" theories, the…
Of Tipping Points and Sinking Ships: A Conversation between James Marriott and Suzi Gablik
ERIC Educational Resources Information Center
Gablik, Suzi; Marriott, James
2007-01-01
This article presents a conversation between the authors, James Marriott and Suzi Gablik. Marriott is a founding member and co-director of PLATFORM, a London-based, award-winning organization focused on social and ecological justice. Gablik is the author of "The Reenchantment of Art," "Conversations Before the End of Time," and "Living the Magical…
"There is One Story Worth Telling": An Essay for James Britton and Nancy Martin
ERIC Educational Resources Information Center
Lofty, John S.
2009-01-01
In 1992, the University of New Hampshire (UNH) held a conference featuring leaders in the field of composition studies, attended by a wish list of luminaries, including Lil Brannon, Ed Corbett, Peter Elbow, Donald Murray, and Ken Macrorie. James Britton and Nancy Martin flew over from England to join the conversation. The prestigious research…
James Webb Space Telescope Optical Telescope Element Mirror Coatings
NASA Technical Reports Server (NTRS)
Keski-Kuha, Ritva A.; Bowers, Charles W.; Quijada, Manuel A.; Heaney, James B.; Gallagher, Benjamin; McKay, Andrew; Stevenson, Ian
2012-01-01
James Webb Space Telescope (JWST) Optical Telescope Element (OTE) mirror coating program has been completed. The science goals of the JWST mission require a uniform, low stress, durable optical coating with high reflectivity over the JWST spectral region. The coating has to be environmentally stable, radiation resistant and compatible with the cryogenic operating environment. The large size, 1.52 m point to point, light weight, beryllium primary mirror (PM) segments and flawless coating process during the flight mirror coating program that consisted coating of 21 flight mirrors were among many technical challenges. This paper provides an overview of the JWST telescope mirror coating program. The paper summarizes the coating development program and performance of the flight mirrors.
President Nixon at Hickam AFB congratulates Astronaut James Lovell
1970-04-18
S70-15506 (18 April 1970) --- President Richard M. Nixon and astronaut James A. Lovell Jr., Apollo 13 commander, shake hands at special ceremonies at Hickam Air Force Base, Hawaii. President Nixon was in Hawaii to present the Apollo 13 crew with the Presidential Medal of Freedom, the nation's highest civilian honor. The wives of astronauts Lovell and Fred W. Haise Jr., lunar module pilot; and the parents of astronaut John L. Swigert Jr., command module pilot, flew with the Chief Executive to Hickam Air Force Base. The Apollo 13 splashdown occurred at 12:07:44 p.m. (CST), April 17, 1970, a day and a half prior to the awards ceremony.
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
James Webb Space Telescope's Golden Mirror Unveiled
2017-12-08
NASA engineers unveil the giant golden mirror of NASA's James Webb Space Telescope, and it's goldenly delicious! The 18 mirrors that make up the primary mirror were individually protected with a black covers when they were assembled on the telescope structure. Now, for the first time since the primary mirror was completed, the covers have been lifted. Standing tall and glimmering gold inside NASA's Goddard Space Flight Center's clean room in Greenbelt, Maryland, this mirror will be the largest yet sent into space. Currently, engineers are busy assembling and testing the other pieces of the telescope. Read more: go.nasa.gov/1TejHg4 Credit: NASA/Goddard/Chris Gunn NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA’s accomplishments by contributing compelling scientific knowledge to advance the Agency’s mission. Follow us on Twitter Like us on Facebook Find us on Instagram
What's the Point of Me? James Hillman's Acorn Theory and the Role of Teachers
ERIC Educational Resources Information Center
Roberts, Susan C.
2015-01-01
On the subject of identity crises which we all face from time to time, The late James Hillman, a maverick Jungian psychologist, summed up the problem this way: "Today's main paradigm for understanding a human life, the interplay of genetics and environment, omits something essential the particularity you feel to be you." In his 1996…
James Baldwin's "Everybody's Protest Novel": Educating Our Responses to Racism
ERIC Educational Resources Information Center
Frank, Jeff
2014-01-01
The aim of this article is to establish--and explore--James Baldwin's significance for educational theory. Through a close reading of "Everybody's Protest Novel", I show that Baldwin's thinking is an important (if unrecognized) precursor to the work of Stanley Cavell and Cora Diamond, and is relevant to a number of…
James D. Finn's Contribution to the Development of a Process View of Educational Technology.
ERIC Educational Resources Information Center
Januszewski, Alan
This study focuses on the thoughts and activities of James D. Finn and examines the influence that these thoughts and activities had on later events and outcomes in the field of educational technology. Finn aimed to upgrade the status of audiovisual education to a professional field of study and endeavored to change the name of the field to…
ERIC Educational Resources Information Center
Bouman, Jeffrey Paul
The history of James Burrill Angell as the president of the University of Michigan presents a case study of the role of 19th century liberal Protestant university builders in the eventual marginalization of religion from the mainstream of U.S. higher education. Angell's tenure, which began in 1871, encompassed the period in which the modern…
The 13th Annual James L. Waters Symposium at Pittcon: Electron Spectroscopy for Chemical Analysis
ERIC Educational Resources Information Center
Baltrus, John P.
2004-01-01
The objective of the James L. Waters Annual Symposium is to recognize pioneers in the development of instrumentation by preserving the early history of the cooperation and important contributions of inventors, scientists, engineers, entrepreneurs, and marketing organizations. The symposium was held in Pittsburgh, United States in March 2002 to…
Astronaut James Newman during in-space evaluation of portable foot restraint
1993-09-16
STS051-98-010 (16 Sept 1993) --- Astronaut James H. Newman, mission specialist, conducts an in-space evaluation of the Portable Foot Restraint (PFR) which will be used operationally on the first Hubble Space Telescope (HST) STS-61 servicing mission and future Shuttle missions. Astronauts Newman and Carl E. Walz spent part of their lengthy extravehicular activity (EVA) evaluating gear to be used on the STS-61 HST servicing mission. The frame was exposed with a 70mm handheld Hasselblad camera from the Space Shuttle Discovery's flight deck.