Science.gov

Sample records for kinases c-kit egf-r

  1. Receptor tyrosine kinase (c-Kit) inhibitors: a potential therapeutic target in cancer cells.

    PubMed

    Abbaspour Babaei, Maryam; Kamalidehghan, Behnam; Saleem, Mohammad; Huri, Hasniza Zaman; Ahmadipour, Fatemeh

    2016-01-01

    c-Kit, a receptor tyrosine kinase, is involved in intracellular signaling, and the mutated form of c-Kit plays a crucial role in occurrence of some cancers. The function of c-Kit has led to the concept that inhibiting c-Kit kinase activity can be a target for cancer therapy. The promising results of inhibition of c-Kit for treatment of cancers have been observed in some cancers such as gastrointestinal stromal tumor, acute myeloid leukemia, melanoma, and other tumors, and these results have encouraged attempts toward improvement of using c-Kit as a capable target for cancer therapy. This paper presents the findings of previous studies regarding c-Kit as a receptor tyrosine kinase and an oncogene, as well as its gene targets and signaling pathways in normal and cancer cells. The c-Kit gene location, protein structure, and the role of c-Kit in normal cell have been discussed. Comprehending the molecular mechanism underlying c-Kit-mediated tumorogenesis is consequently essential and may lead to the identification of future novel drug targets. The potential mechanisms by which c-Kit induces cellular transformation have been described. This study aims to elucidate the function of c-Kit for future cancer therapy. In addition, it has c-Kit inhibitor drug properties and their functions have been listed in tables and demonstrated in schematic pictures. This review also has collected previous studies that targeted c-Kit as a novel strategy for cancer therapy. This paper further emphasizes the advantages of this approach, as well as the limitations that must be addressed in the future. Finally, although c-Kit is an attractive target for cancer therapy, based on the outcomes of treatment of patients with c-Kit inhibitors, it is unlikely that Kit inhibitors alone can lead to cure. It seems that c-Kit mutations alone are not sufficient for tumorogenesis, but do play a crucial role in cancer occurrence. PMID:27536065

  2. Receptor tyrosine kinase (c-Kit) inhibitors: a potential therapeutic target in cancer cells

    PubMed Central

    Abbaspour Babaei, Maryam; Kamalidehghan, Behnam; Saleem, Mohammad; Huri, Hasniza Zaman; Ahmadipour, Fatemeh

    2016-01-01

    c-Kit, a receptor tyrosine kinase, is involved in intracellular signaling, and the mutated form of c-Kit plays a crucial role in occurrence of some cancers. The function of c-Kit has led to the concept that inhibiting c-Kit kinase activity can be a target for cancer therapy. The promising results of inhibition of c-Kit for treatment of cancers have been observed in some cancers such as gastrointestinal stromal tumor, acute myeloid leukemia, melanoma, and other tumors, and these results have encouraged attempts toward improvement of using c-Kit as a capable target for cancer therapy. This paper presents the findings of previous studies regarding c-Kit as a receptor tyrosine kinase and an oncogene, as well as its gene targets and signaling pathways in normal and cancer cells. The c-Kit gene location, protein structure, and the role of c-Kit in normal cell have been discussed. Comprehending the molecular mechanism underlying c-Kit-mediated tumorogenesis is consequently essential and may lead to the identification of future novel drug targets. The potential mechanisms by which c-Kit induces cellular transformation have been described. This study aims to elucidate the function of c-Kit for future cancer therapy. In addition, it has c-Kit inhibitor drug properties and their functions have been listed in tables and demonstrated in schematic pictures. This review also has collected previous studies that targeted c-Kit as a novel strategy for cancer therapy. This paper further emphasizes the advantages of this approach, as well as the limitations that must be addressed in the future. Finally, although c-Kit is an attractive target for cancer therapy, based on the outcomes of treatment of patients with c-Kit inhibitors, it is unlikely that Kit inhibitors alone can lead to cure. It seems that c-Kit mutations alone are not sufficient for tumorogenesis, but do play a crucial role in cancer occurrence. PMID:27536065

  3. Tyrosine Kinase Inhibitors Induce Down-Regulation of c-Kit by Targeting the ATP Pocket

    PubMed Central

    Descarpentries, Clotilde; Frisan, Emilie; Adam, Kevin; Verdier, Frederique; Floquet, Célia; Dubreuil, Patrice; Lacombe, Catherine; Fontenay, Michaela; Mayeux, Patrick; Kosmider, Olivier

    2013-01-01

    The stem cell factor receptor (SCF) c-Kit plays a pivotal role in regulating cell proliferation and survival in many cell types. In particular, c-Kit is required for early amplification of erythroid progenitors, while it must disappear from cell surface for the cell entering the final steps of maturation in an erythropoietin-dependent manner. We initially observed that imatinib (IM), an inhibitor targeting the tyrosine kinase activity of c-Kit concomitantly down-regulated the expression of c-Kit and accelerated the Epo-driven differentiation of erythroblasts in the absence of SCF. We investigated the mechanism by which IM or related masitinib (MA) induce c-Kit down-regulation in the human UT-7/Epo cell line. We found that the down-regulation of c-Kit in the presence of IM or MA was inhibited by a pre-incubation with methyl-β-cyclodextrin suggesting that c-Kit was internalized in the absence of ligand. By contrast to SCF, the internalization induced by TKI was independent of the E3 ubiquitin ligase c-Cbl. Furthermore, c-Kit was degraded through lysosomal, but not proteasomal pathway. In pulse-chase experiments, IM did not modulate c-Kit synthesis or maturation. Analysis of phosphotyrosine peptides in UT-7/Epo cells treated or not with IM show that IM did not modify overall tyrosine phosphorylation in these cells. Furthermore, we showed that a T670I mutation preventing the full access of IM to the ATP binding pocket, did not allow the internalization process in the presence of IM. Altogether these data show that TKI-induced internalization of c-Kit is linked to a modification of the integrity of ATP binding pocket. PMID:23637779

  4. PI3 kinase is indispensable for oncogenic transformation by the V560D mutant of c-Kit in a kinase-independent manner.

    PubMed

    Lindblad, Oscar; Kazi, Julhash U; Rönnstrand, Lars; Sun, Jianmin

    2015-11-01

    Oncogenic mutants of c-Kit are often found in mastocytosis, gastrointestinal stromal tumors and acute myeloid leukemia. The activation mechanism of the most commonly occurring mutation, D816V in exon 17 of c-Kit, has been well-studied while other mutations remain fairly uncharacterized in this respect. In this study, we show that the constitutive activity of the exon 11 mutant V560D is weaker than the D816V mutant. Phosphorylation of downstream signaling proteins induced by the ligand for c-Kit, stem cell factor, was stronger in c-Kit/V560D expressing cells than in cells expressing c-kit/D816V. Although cells expressing c-Kit/V560D showed increased ligand-independent proliferation and survival compared to wild-type c-Kit-expressing cells, these biological effects were weaker than in c-Kit/D816V-expressing cells. In contrast to cells expressing wild-type c-Kit, cells expressing c-Kit/V560D were independent of Src family kinases for downstream signaling. However, the independence of Src family kinases was not due to a Src-like kinase activity that c-Kit/D816V displayed. Point mutations that selectively block the association of PI3 kinase with c-Kit/V560D inhibited ligand-independent activation of the receptor, while inhibition of the kinase activity of PI3 kinase with pharmacological inhibitors did not affect the kinase activity of the receptor. This suggests a lipid kinase-independent key role of PI3 kinase in c-Kit/V560D-mediated oncogenic signal transduction. Thus, PI3 kinase is an attractive therapeutic target in malignancies induced by c-Kit mutations independent of its lipid kinase activity. PMID:26040420

  5. Imatinib Analogs as Potential Agents for PET Imaging of Bcr-Abl/c-KIT Expression at a Kinase Level

    PubMed Central

    Peng, Zhenghong; Maxwell, David S.; Sun, Duoli; Bhanu Prasad, Basvoju A.; Pal, Ashutosh; Wang, Shimei; Balatoni, Julius; Ghosh, Pradip; Lim, Seok T.; Volgin, Andrei; Shavrin, Aleksander; Alauddin, Mian M.; Gelovani, Juri G.; Bornmann, William G.

    2014-01-01

    We synthesized two series of imatinib mesylate (STI-571) analogs to develop a Bcr-Abl and c-KIT receptor-specific labeling agent for positron emission tomography (PET) imaging to measure Bcr-Abl and c-KIT expression levels in a mouse model. The methods of molecular modeling, synthesis of STI-571 and its analogs, in vitro kinase assays, and radiolabeling are described. Molecular modeling revealed that these analogs bind the same Bcr-Abl and c-KIT binding sites as those bound by STI-571. The analogs potently inhibit the tyrosine kinase activity of Bcr-Abl and c-KIT, similarly to STI-571. [18F]-labeled STI-571 was prepared with high specific activity (75 GBq/μmol) by nucleophilic displacement and an average radiochemical yield of 12%. [131I]-labeled STI-571 was prepared with high purity (>95%) and an average radiochemical yield of 23%. The uptake rates of [18F]-STI-571 in K562 cells expressing Abl and in U87WT cells overexpressing c-KIT were significantly higher than those in the U87 cell and could be inhibited by STI-71 (confirming the specificity of uptake). PET scans of K562 and U87WT tumor-bearing mice with [18F]-STI-571 as a contrast agent showed visible tumor uptake and tumor-to-non-target contrast. PMID:24280068

  6. Involvement of transcription factor encoded by the mi locus in the expression of c-kit receptor tyrosine kinase in cultured mast cells of mice.

    PubMed

    Tsujimura, T; Morii, E; Nozaki, M; Hashimoto, K; Moriyama, Y; Takebayashi, K; Kondo, T; Kanakura, Y; Kitamura, Y

    1996-08-15

    The mi locus of mice encodes a member of the basic-helix-loop-helix-leucine zipper (bHLH-Zip) protein family of transcription factors (hereafter called MITF). Cultured mast cells of mi/mi genotype (mi/mi CMCs) did not normally respond to stem cell factor (SCF), a ligand for the c-kit receptor tyrosine kinase. The poor response of mi/mi CMCs to SCF was attributed to the deficient expression of c-kit both the mRNA and protein levels. The purpose of the present study is to investigate the effect of MITF on the transcription of the c-kit gene. First, we introduced cDNA encoding normal (+) MITF or mutant (mi) MITF into mi/mi CMCs using the retroviral vector. Overexpression of (+)-MITF but not mi-MITF normalized the expression of the c-kit and the poor response of mi/mi CMCs to SCF, indicating the involvement of (+)-MITF in the c-kit gene transactivation. Second, we analyzed the promoter of the c-kit gene. Three CANNTG motifs recognized by bHLH-Zip-type transcription factors were conserved between the mouse and human c-kit promoters. Among these three CANNTG motifs, only the CACCTG motif (nt -356 to -351) was specifically bound by (+)-MITF. When the luciferase gene under the control of the c-kit promoter was contransfected into NIH/3T3 fibroblasts with cDNA encoding (+)-MITF or mi-MITF, the luciferase activity significantly increased only when (+)-MITF cDNA was cotransfected. The deletion of the promoter region containing the CACCTG motif or the mutation of the CACCTG to CTCCAG abolished the transactivation effect of (+)-MITF, indicating that (+)-MITF transactivated the c-kit gene through the CACCTG motif. When the luciferase gene under the control of the c-kit promoter was introduced into the FMA3 mastocytoma and FEC-P1 myeloid cell lines, remarkable luciferase activity was observed only in FMA3 cells. Thus, the involvement of (+)-MITF in the c-kit transactivation appeared to be specific to the mast cell lineage. PMID:8695840

  7. SCF/c-kit transactivates CXCR4-serine 339 phosphorylation through G protein-coupled receptor kinase 6 and regulates cardiac stem cell migration.

    PubMed

    Zuo, Ke; Kuang, Dong; Wang, Ying; Xia, Yanli; Tong, Weilin; Wang, Xiaoyan; Chen, Yaobin; Duan, Yaqi; Wang, Guoping

    2016-01-01

    C-kit positive cardiac stem cells (CSCs) have been shown to contribute to myocardial regeneration after infarction. Previously, we have shown that the c-kit ligand stem cell factor (SCF) can induce CSC migration into the infarcted area during myocardial infarction (MI). However, the precise mechanism involved is not fully understood. In this study, we found that CSCs also express C-X-C chemokine receptor type 4 (CXCR4), which is a typical member of the seven transmembrane-spanning G protein-coupled receptor (GPCR). In vitro, activation of c-kit signalling by SCF promotes migration of CSCs with increased phosphorylation of CXCR4-serine 339, p38 mitogen-activated protein kinase (p38 MAPK) and extracellular regulated protein kinases 1/2 (ERK1/2). Knockdown of CXCR4 expression by siRNA reduces SCF/c-kit-induced migration and downstream signalling. As previously reported, CXCR4-serine 339 phosphorylation is mainly regulated by GPCR kinase 6 (GRK6); thus, silencing of GRK6 expression by siRNA impairs CXCR4-serine 339 phosphorylation and migration of CSCs caused by SCF. In vivo, knockdown of GRK6 impairs the ability of CSCs to migrate into peri-infarcted areas. These results demonstrate that SCF-induced CSC migration is regulated by the transactivation of CXCR4-serine 339 phosphorylation, which is mediated by GRK6. PMID:27245949

  8. SCF/c-kit transactivates CXCR4-serine 339 phosphorylation through G protein-coupled receptor kinase 6 and regulates cardiac stem cell migration

    PubMed Central

    Zuo, Ke; Kuang, Dong; Wang, Ying; Xia, Yanli; Tong, Weilin; Wang, Xiaoyan; Chen, Yaobin; Duan, Yaqi; Wang, Guoping

    2016-01-01

    C-kit positive cardiac stem cells (CSCs) have been shown to contribute to myocardial regeneration after infarction. Previously, we have shown that the c-kit ligand stem cell factor (SCF) can induce CSC migration into the infarcted area during myocardial infarction (MI). However, the precise mechanism involved is not fully understood. In this study, we found that CSCs also express C-X-C chemokine receptor type 4 (CXCR4), which is a typical member of the seven transmembrane-spanning G protein-coupled receptor (GPCR). In vitro, activation of c-kit signalling by SCF promotes migration of CSCs with increased phosphorylation of CXCR4-serine 339, p38 mitogen-activated protein kinase (p38 MAPK) and extracellular regulated protein kinases 1/2 (ERK1/2). Knockdown of CXCR4 expression by siRNA reduces SCF/c-kit-induced migration and downstream signalling. As previously reported, CXCR4-serine 339 phosphorylation is mainly regulated by GPCR kinase 6 (GRK6); thus, silencing of GRK6 expression by siRNA impairs CXCR4-serine 339 phosphorylation and migration of CSCs caused by SCF. In vivo, knockdown of GRK6 impairs the ability of CSCs to migrate into peri-infarcted areas. These results demonstrate that SCF-induced CSC migration is regulated by the transactivation of CXCR4-serine 339 phosphorylation, which is mediated by GRK6. PMID:27245949

  9. Discovery of Aryl Aminoquinazoline Pyridones as Potent, Selective, and Orally Efficacious Inhibitors of Receptor Tyrosine Kinase c-Kit

    SciTech Connect

    Hu, Essa; Tasker, Andrew; White, Ryan D.; Kunz, Roxanne K.; Human, Jason; Chen, Ning; Bürli, Roland; Hungate, Randall; Novak, Perry; Itano, Andrea; Zhang, Xuxia; Yu, Violeta; Nguyen, Yen; Tudor, Yanyan; Plant, Matthew; Flynn, Shaun; Xu, Yang; Meagher, Kristin L.; Whittington, Douglas A.; Ng, Gordon Y.

    2008-12-09

    Inhibition of c-Kit has the potential to treat mast cell associated fibrotic diseases. We report the discovery of several aminoquinazoline pyridones that are potent inhibitors of c-Kit with greater than 200-fold selectivity against KDR, p38, Lck, and Src. In vivo efficacy of pyridone 16 by dose-dependent inhibition of histamine release was demonstrated in a rodent pharmacodynamic model of mast cell activation.

  10. EGF-R small inhibitors and anti-EGF-R antibodies: advantages and limits of a new avenue in anticancer therapy.

    PubMed

    Caraglia, Michele; Marra, Monica; Meo, Giuseppina; Addeo, Santolo R; Tagliaferri, Pierosandro; Budillon, Alfredo

    2006-06-01

    Cellular receptors for the Epidermal Growth Factor (EGF-R) are members of the ErbB receptor family and are considered important targets for the experimental treatment of human cancer. Monoclonal antibodies as well as small tyrosine kinase inhibitors (TKIs) have been developed and have undergone extensive evaluation in preclinical and clinical studies based on the general idea that EGF-R plays a critical role on the growth and survival of human tumors. This assumption has been derived by the successful development of BCR/ABL tyrosine kinase inhibitors in human chronic myeloid leukemia as well as on the activity of therapy with monoclonal antibodies (mAb) in breast cancer and lymphoproliferative diseases. It is now becoming clear that factors regulating sensitivity to kinase inhibitors may differ from monoclonal antibodies and that the molecules targeted by interfering drugs must be prioritaire for growth and survival of those specific tumors in order to achieve valuable results. In this article, we will describe the signal transduction pathways regulated by EGF-R and the principal pharmacological and biotechnological agents directed against EGF-R. We will discuss the significance of targeting the EGF-R driven survival pathways and the compensatory intracellular survival mechanisms that counteract the specific EGF-R inhibition and are the cause of the poor clinical results derived from study based on the use of these agents. We will describe new multipotent TKIs that target also other members of ErbB family (i.e. ErbB2) blocking one of the compensatory mechanism that can be triggered in cancer cells. Moreover, we will report new patent on bispecific mAbs that bind EGF-R and immune effectors in order to increase the immunological function of this agent that could be the basis of the different clinical results achieved with the use of TKI and mAbs. Finally, we will propose a pharmacological model able to make cancer cells dependent on EGF-R for their survival and

  11. The Src and c-Kit kinase inhibitor dasatinib enhances p53-mediated targeting of human acute myeloid leukemia stem cells by chemotherapeutic agents

    PubMed Central

    Dos Santos, Cedric; McDonald, Tinisha; Ho, Yin Wei; Liu, Hongjun; Lin, Allen; Forman, Stephen J.; Kuo, Ya-Huei

    2013-01-01

    The SRC family kinases (SFKs) and the receptor tyrosine kinase c-Kit are activated in human acute myeloid leukemia (AML) cells. We show here that the SFKs LYN, HCK, or FGR are overexpressed and activated in AML progenitor cells. Treatment with the SFK and c-KIT inhibitor dasatinib selectively inhibits human AML stem/progenitor cell growth in vitro. Importantly, dasatinib markedly increases the elimination of AML stem cells capable of engrafting immunodeficient mice by chemotherapeutic agents. In vivo dasatinib treatment enhances chemotherapy-induced targeting of primary murine AML stem cells capable of regenerating leukemia in secondary recipients. Our studies suggest that enhanced targeting of AML cells by the combination of dasatinib with daunorubicin may be related to inhibition of AKT-mediated human mouse double minute 2 homolog phosphorylation, resulting in enhanced p53 activity in AML cells. Combined treatment using dasatinib and chemotherapy provides a novel approach to increasing p53 activity and enhancing targeting of AML stem cells. PMID:23896410

  12. Candidate ligand for the c-kit transmembrane kinase receptor: KL, a fibroblast derived growth factor stimulates mast cells and erythroid progenitors.

    PubMed Central

    Nocka, K; Buck, J; Levi, E; Besmer, P

    1990-01-01

    The c-kit proto-oncogene encodes a transmembrane tyrosine kinase receptor for an unidentified ligand and is allelic with the murine white-spotting locus (W). W mutations affect melanogenesis, gametogenesis and hematopoiesis during development and in adult life. Cellular targets of W mutations in hematopoiesis include distinct cell populations in the erythroid and mast cell lineages as well as stem cells. In the absence of interleukin-3 (IL-3) mast cells derived from normal mice but not from W mutant mice can be maintained by co-culture with 3T3 fibroblasts. Based on the defective proliferative response of W mast cells in the 3T3 fibroblast co-culture system it had been proposed that fibroblasts produce the c-kit ligand. We have used a mast cell proliferation assay to purify a 30 kd protein, designated KL, from conditioned medium of Balb/3T3 fibroblasts to apparent homogeneity. KL stimulates the proliferation of normal bone marrow derived mast cells but not mast cells from W mice, although both normal and mutant mast cells respond similarly to IL-3. Connective tissue-type mast cells derived from the peritoneal cavity of normal mice were found to express a high level of c-kit protein on their surface and to proliferate in response to KL. The effect of KL on erythroid progenitor cells was investigated as well. In combination with erythropoietin, KL was found to stimulate early erythroid progenitors (BFU-E) from fetal liver and spleen cells but not from bone marrow cells of adult mice and from fetal liver cells of W/W mice.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 1. Fig. 3. Fig. 5. Fig. 7. PMID:1698611

  13. Discovery of N-(3-((1-Isonicotinoylpiperidin-4-yl)oxy)-4-methylphenyl)-3-(trifluoromethyl)benzamide (CHMFL-KIT-110) as a Selective, Potent, and Orally Available Type II c-KIT Kinase Inhibitor for Gastrointestinal Stromal Tumors (GISTs).

    PubMed

    Wang, Qiang; Liu, Feiyang; Wang, Beilei; Zou, Fengming; Chen, Cheng; Liu, Xiaochuan; Wang, Aoli; Qi, Shuang; Wang, Wenchao; Qi, Ziping; Zhao, Zheng; Hu, Zhenquan; Wang, Wei; Wang, Li; Zhang, Shanchun; Wang, Yuexiang; Liu, Jing; Liu, Qingsong

    2016-04-28

    c-KIT kinase is a validated drug discovery target for gastrointestinal stromal tumors (GISTs). Clinically used c-KIT kinase inhibitors, i.e., Imatinib and Sunitinib, bear other important targets such as ABL or FLT3 kinases. Here we report our discovery of a more selective c-KIT inhibitor, compound 13 (CHMFL-KIT-110), which completely abolished ABL and FLT3 kinase activity. KinomeScan selectivity profiling (468 kinases) of 13 exhibited a high selectivity (S score (1) = 0.01). 13 displayed great antiproliferative efficacy against GISTs cell lines GIST-T1 and GIST-882 (GI50: 0.021 and 0.043 μM, respectively). In the cellular context, it effectively affected c-KIT-mediated signaling pathways and induced apoptosis as well as cell cycle arrest. In addition, 13 possessed acceptable bioavailability (36%) and effectively suppressed the tumor growth in GIST-T1 cell inoculated xenograft model without apparent toxicity. 13 currently is undergoing extensive preclinical evaluation and might be a potential drug candidate for GISTs. PMID:27077705

  14. BRAF, KIT and NRAS mutations and expression of c-KIT, phosphorylated extracellular signal-regulated kinase and phosphorylated AKT in Japanese melanoma patients.

    PubMed

    Oyama, Satomi; Funasaka, Yoko; Watanabe, Atsushi; Takizawa, Toshihiro; Kawana, Seiji; Saeki, Hidehisa

    2015-05-01

    To clarify the status of gene mutation and activation of growth signal in melanoma of Japanese patients in vivo, we analyzed the mutation of BRAF exon 15, NRAS exon 2, and KIT exons 9, 11, 13, 17 and 18 in melanoma cells obtained by laser capture microdissection, and performed direct sequencing in 20 cases of acral lentiginous melanoma (ALM) and 17 cases of superficial spreading melanoma (SSM). In the study of the mutation of BRAF, pyrosequencing was also done. To examine the cell proliferation signaling, immunohistochemistry for phosphorylated extracellular signal-regulated kinase (pERK), phosphorylated AKT (phosphorylated AKT) and c-KIT was done. The mutation of BRAF p.V600E was detected in 13 cases of ALM (65.0%) and 12 cases of SSM (70.6%). No NRAS mutation was found in all cases. The mutation in exons 9, 11, and 18 of KIT was detected in nine cases. The mutation of BRAF and KIT showed no correlation with clinical stage, lymph node metastasis, tumor thickness, ulceration and histology. pERK and pAKT was observed in small population of melanoma cells and there was no correlation with gene mutation. Our results indicate that the mutations of BRAF and KIT exist in Japanese melanoma patients, however, the cell growth signaling may be regulated by not only these mutated genes, but by other unknown regulatory factors, which may affect the prognosis of melanoma. PMID:25766129

  15. c-Kit signaling determines neointimal hyperplasia in arteriovenous fistulae

    PubMed Central

    Skartsis, Nikolaos; Martinez, Laisel; Duque, Juan Camilo; Tabbara, Marwan; Velazquez, Omaida C.; Asif, Arif; Andreopoulos, Fotios; Salman, Loay H.

    2014-01-01

    Stenosis of arteriovenous (A-V) fistulae secondary to neointimal hyperplasia (NIH) compromises dialysis delivery, which worsens patients' quality of life and increases medical costs associated with the maintenance of vascular accesses. In the present study, we evaluated the role of the receptor tyrosine kinase c-Kit in A-V fistula neointima formation. Initially, c-Kit was found in the neointima and adventitia of human brachiobasilic fistulae, whereas it was barely detectable in control veins harvested at the time of access creation. Using the rat A-V fistula model to study venous vascular remodeling, we analyzed the spatial and temporal pattern of c-Kit expression in the fistula wall. Interestingly, c-Kit immunoreactivity increased with time after anastomosis, which concurred with the accumulation of cells in the venous intima. In addition, c-Kit expression in A-V fistulae was positively altered by chronic kidney failure conditions. Both blockade of c-Kit with imatinib mesylate (Gleevec) and inhibition of stem cell factor production with a specific short hairpin RNA prevented NIH in the outflow vein of experimental fistulae. In agreement with these data, impaired c-Kit activity compromised the development of NIH in A-V fistulae created in c-KitW/Wv mutant mice. These results suggest that targeting of the c-Kit signaling pathway may be an effective approach to prevent postoperative NIH in A-V fistulae. PMID:25186298

  16. Discovery of amido-benzisoxazoles as potent c-Kit inhibitors

    SciTech Connect

    Kunz, Roxanne K.; Rumfelt, Shannon; Chen, Ning; Zhang, Dawei; Tasker, Andrew S.; Bürli, Roland; Hungate, Randall; Yu, Violeta; Nguyen, Yen; Whittington, Douglas A.; Meagher, Kristin L.; Plant, Matthew; Tudor, Yanyan; Schrag, Michael; Xu, Yang; Ng, Gordon Y.; Hu, Essa

    2010-01-12

    Deregulation of the receptor tyrosine kinase c-Kit is associated with an increasing number of human diseases, including certain cancers and mast cell diseases. Interference of c-Kit signaling with multi-kinase inhibitors has been shown clinically to successfully treat gastrointestinal stromal tumors and mastocytosis. Targeted therapy of c-Kit activity may provide therapeutic advantages against off-target effects for non-oncology applications. A new structural class of c-Kit inhibitors is described, including in vitro c-Kit potency, kinase selectivity, and the observed binding mode.

  17. The expression of c-kit protein in human adult and fetal tissues.

    PubMed

    Horie, K; Fujita, J; Takakura, K; Kanzaki, H; Suginami, H; Iwai, M; Nakayama, H; Mori, T

    1993-11-01

    The c-kit proto-oncogene encodes a tyrosine kinase receptor and is allelic with the dominant white-spotting (W) locus of the mouse. In this study we investigated the expression of human c-kit protein in various adult and fetal human tissues immunohistochemically using anti-human c-kit monoclonal antibody. To discriminate c-kit+ cells from mast cells expressing c-kit, mast cells were identified by staining with Toluidine blue. In oogonia, spermatogonia and skin melanocytes of the fetus and in oocytes of adult ovary, c-kit expression was detected. In adult uterus, c-kit+ cells were widely distributed in the basal layer of the endometrium, myometrium and cervix, the number and distribution being almost identical to those of mast cells. In fetal uterus, c-kit+ non-mast cells clustered beneath the epithelium and a few mast cells were observed in the myometrium and subserosal layer. In both adult and fetus, c-kit+ non-mast cells were detected within smooth muscle layers of the intestine, colon and oesophagus, while mast cells were observed in the mucosal and submucosal layers of these organs. In contrast to mice, no expression of c-kit protein was detected in the human placenta and decidua. Thus, the distribution of c-kit+ cells in various tissues is similar but not identical between adult and fetus and between human and mouse. PMID:7507133

  18. Imatinib in pulmonary arterial hypertension: c-Kit inhibition.

    PubMed

    Farha, Samar; Dweik, Raed; Rahaghi, Franck; Benza, Raymond; Hassoun, Paul; Frantz, Robert; Torres, Fernando; Quinn, Deborah A; Comhair, Suzy; Erzurum, Serpil; Asosingh, Kewal

    2014-09-01

    Pulmonary arterial hypertension (PAH) is a progressive disease characterized by severe remodeling of the pulmonary artery resulting in increased pulmonary artery pressure and right ventricular hypertrophy and, ultimately, failure. Bone marrow-derived progenitor cells play a critical role in vascular homeostasis and have been shown to be involved in the pathogenesis of PAH. A proliferation of c-Kit(+) hematopoietic progenitors and mast cells has been noted in the remodeled vessels in PAH. Imatinib, a tyrosine kinase inhibitor that targets c-Kit, has been shown to be beneficial for patients with PAH. Here we hypothesize that the clinical benefit of imatinib in PAH could be related to c-Kit inhibition of progenitor cell mobilization and maturation into mast cells. As a corollary to the phase 3 study using imatinib in PAH, blood samples were collected from 12 patients prior to starting study drug (baseline) and while on treatment at weeks 4 and 24. Eight were randomized to imatinib and 4 to placebo. Circulating c-Kit(+) and CD34(+)CD133(+) hematopoietic progenitors as well as biomarkers of mast cell numbers and activation were measured. Circulating CD34(+)CD133(+) and c-Kit(+) progenitor cells as well as c-Kit(+)/CD34(+)CD133(+) decreased with imatinib therapy (all P < 0.05). In addition, total tryptase, a marker of mast cell load, dropped with imatinib therapy (P = 0.02) and was related to pulmonary vascular resistance (R = 0.7, P = 0.02). The findings support c-Kit inhibition as a potential mechanism of action of imatinib in PAH and suggest that tryptase is a potential biomarker of response to therapy. PMID:25621158

  19. Activated c-Kit receptor in the heart promotes cardiac repair and regeneration after injury

    PubMed Central

    Di Siena, S; Gimmelli, R; Nori, S L; Barbagallo, F; Campolo, F; Dolci, S; Rossi, P; Venneri, M A; Giannetta, E; Gianfrilli, D; Feigenbaum, L; Lenzi, A; Naro, F; Cianflone, E; Mancuso, T; Torella, D; Isidori, A M; Pellegrini, M

    2016-01-01

    The role of endogenous c-Kit receptor activation on cardiac cell homeostasis and repair remains largely unexplored. Transgenic mice carrying an activating point mutation (TgD814Y) in the kinase domain of the c-Kit gene were generated. c-KitTgD814Y receptor was expressed in the heart during embryonic development and postnatal life, in a similar timing and expression pattern to that of the endogenous gene, but not in the hematopoietic compartment allowing the study of a cardiac-specific phenotype. c-KitTgD814Y mutation produced a constitutive active c-Kit receptor in cardiac tissue and cells from transgenic mice as demonstrated by the increased phosphorylation of ERK1/2 and AKT, which are the main downstream molecular effectors of c-Kit receptor signaling. In adult transgenic hearts, cardiac morphology, size and total c-Kit+ cardiac cell number was not different compared with wt mice. However, when c-KitTgD814Y mice were subjected to transmural necrotic heart damage by cryoinjury (CI), all transgenic survived, compared with half of wt mice. In the sub-acute phase after CI, transgenic and wt mice showed similar heart damage. However, 9 days after CI, transgenic mice exhibited an increased number of c-Kit+CD31+ endothelial progenitor cells surrounding the necrotic area. At later follow-up, a consistent reduction of fibrotic area, increased capillary density and increased cardiomyocyte replenishment rate (as established by BrdU incorporation) were observed in transgenic compared with wt mice. Consistently, CD45−c-Kit+ cardiac stem cells isolated from transgenic c-KitTgD814Y mice showed an enhanced endothelial and cardiomyocyte differentiation potential compared with cells isolated from the wt. Constitutive activation of c-Kit receptor in mice is associated with an increased cardiac myogenic and vasculogenic reparative potential after injury, with a significant improvement of survival. PMID:27468693

  20. c-kit mRNA expression in human and murine hematopoietic cell lines.

    PubMed

    André, C; d'Auriol, L; Lacombe, C; Gisselbrecht, S; Galibert, F

    1989-08-01

    The c-kit proto-oncogene belongs to the tyrosine kinase receptor family. Although its ligand is still unknown, there is increasing evidence to suggest its involvement in hematopoiesis. In order to detect lineage or differentiation related specificity, we have studied c-kit mRNA expression in both human and murine hematopoietic organs and cell lines. We show that c-kit mRNA expression is found at early stages of erythroid and myeloid differentiation. There is however, no evidence of c-kit expression in the lymphoid lineage. Our results suggest a possible role for c-kit as a receptor in the early stages of the erythroid/myeloid differentiation. PMID:2474787

  1. Emerging functions of c-kit and its ligand stem cell factor in dendritic cells

    PubMed Central

    Ray, Prabir; Krishnamoorthy, Nandini; Ray, Anuradha

    2013-01-01

    The receptor tyrosine kinase, c-kit, and its ligand, stem cell factor (SCF), function in a diverse range of biological functions. The role of c-kit in the maintenance and survival of hematopoietic stem cells and of mast cells is well recognized. c-kit also plays an important role in melanogenesis, erythropoiesis and spermatogenesis. Recent work from our laboratory highlights an important role of c-kit in the regulation of expression of two molecules in dendritic cells (DCs), interleukin-6 (IL-6) and Jagged-2 (a ligand of Notch), which are known to regulate T helper cell differentiation. Our study shows that induction of c-kit expression and its signaling in DCs promotes Th2 and Th17 responses but not Th1 response. c-kit inhibition by imatinib mesylate (Gleevec) in DCs was previously shown to promote natural killer cell activation which may be due to dampening of IL-6 production by the DCs. Since dysregulation of c-kit function has been associated with various disease states including cancer, in this perspective we have focused on known and novel functions of c-kit to include molecules such as IL-6 and Notch that were not previously recognized to be within the purview of c-kit biology. We have also reviewed the differential expression pattern of SCF and c-kit on various cell types and its variation during development or pathology. The recognition of previously unappreciated roles for c-kit will provide better insights into its function within and beyond the immune system and pave the way for developing better therapeutic strategies. PMID:18787413

  2. Signaling of c-kit in dendritic cells influences adaptive immunity

    PubMed Central

    Ray, Prabir; Krishnamoorthy, Nandini; Oriss, Timothy B.; Ray, Anuradha

    2013-01-01

    The binding of the receptor tyrosine kinase, c-kit, to its ligand, stem cell factor (SCF), mediates numerous biological functions. Important roles for c-kit in hematopoiesis, melanogenesis, erythropoiesis, spermatogenesis, and carcinogenesis are well documented. Similarly, activation of granulocytes, mast cells, and of eosinophils in particular, by c-kit ligation has long been known to result in degranulation with concomitant release of pro-inflammatory mediators, including cytokines. However, recent work from a number of laboratories, including our own, highlights previously unappreciated functions for c-kit in immunologic processes. These novel findings strongly suggest that signaling through the c-kit–SCF axis could have a significant impact on the pathogenesis of diseases associated with an immunologic component. In our own studies, c-kit upregulation on dendritic cells via T helper (Th)2- and Th17-inducing stimuli led to c-kit activation and immune skewing toward these T helper subsets and away from Th1 responses. Others have shown that dendritic cell treatment with inhibitors of c-kit activation, such as imatinib mesylate (Gleevec), favored breaking of T-cell tolerance, skewing of responses toward production of Th1 cytokines, and activation of natural killer cells. These data all indicate that deeper understanding of, and ability to control, the c-kit–SCF axis could lead to improved treatment modalities aimed at redirecting unwanted and/or deleterious immune responses in a wide variety of conditions. PMID:20146711

  3. The SCF/c-KIT system in the male: Survival strategies in fertility and cancer.

    PubMed

    Cardoso, Henrique J; Figueira, Marília I; Correia, Sara; Vaz, Cátia V; Socorro, Sílvia

    2014-12-01

    Maintaining the delicate balance between cell survival and death is of the utmost importance for the proper development of germ cells and subsequent fertility. On the other hand, the fine regulation of tissue homeostasis by mechanisms that control cell fate is a factor that can prevent carcinogenesis. c-KIT is a type III receptor tyrosine kinase activated by its ligand, stem cell factor (SCF). c-KIT signaling plays a crucial role in cell fate decisions, specifically controlling cell proliferation, differentiation, survival, and apoptosis. Indeed, deregulating the SCF/c-KIT system by attenuation or overactivation of its signaling strength is linked to male infertility and cancer, and rebalancing its activity via c-KIT inhibitors has proven beneficial in treating human tumors that contain gain-of-function mutations or overexpress c-KIT. This review addresses the roles of SCF and c-KIT in the male reproductive tract, and discusses the potential application of c-KIT target therapies in disorders of the reproductive system. PMID:25359157

  4. Cardiomyogenic potential of c-kit+ expressing cells derived from neonatal and adult mouse hearts

    PubMed Central

    Zaruba, Marc-Michael; Soonpaa, Mark; Reuter, Sean; Field, Loren J.

    2010-01-01

    Summary Background c-kit is a receptor tyrosine kinase family member expressed in hematopoietic stem cells. c-kit is also transiently expressed in cardiomyocyte precursors during development, and in a rare cell population in the normal adult heart. Here, the cardiomyogenic potential of c-kit+ cells isolated from normal neonatal, normal adult and infarcted adult mouse hearts was evaluated. Methods and Results Magnetic activated cell sorting (MACS) was used to prepare c-kit+ cells from the hearts of ACT-EGFP/MHC-nLAC double transgenic mice. These animals exhibit widespread enhanced green fluorescent protein (EGFP) expression and cardiomyocyte-restricted nuclear β-galactosidase activity, thus permitting simultaneous tracking of cell survival and differentiation. A subset of the c-kit+ cells from double transgenic neonatal hearts acquired a cardiomyogenic phenotype when co-cultured with fetal cardiomyocytes (2.4% of all EGFP+ cells screened), but not when cultured alone or when co-cultured with mouse fibroblasts (0.03% and 0.05% of the EGFP+ cells screened, respectively). In contrast, c-kit+ cells from normal adult double transgenic hearts failed to undergo cardiomyogenic differentiation when co-cultured with non-transgenic fetal cardiomyocytes (>18,000 EGFP+ cells screened) or when transplanted into normal or infarcted adult mouse hearts (14 EGFP+ grafts examined). A single c-kit+ cell from an infarcted double transgenic adult heart was observed to acquire a cardiomyogenic phenotype in co-culture (>37,000 EGFP+ cells screened). Conclusions These data suggest that the ability of cardiac-resident c-kit+ cells to acquire a cardiomyogenic phenotype is subject to temporal limitations, or alternatively that the cardiomyogenic population is lost. Elucidation of the underlying molecular basis may permit robust cardiomyogenic induction in adult-derived cardiac c-kit+ cells. PMID:20421520

  5. Differential regulation of gene expression in mouse spermatogonial cells after blocking c-kit-SCF interaction with RNAi

    PubMed Central

    Sikarwar, Arun P; Rambabu, Murali K; Reddy, K V R

    2008-01-01

    c-Kit, the gene product of the W locus is a receptor tyrosine kinase that regulates the survival, growth and differentiation of spermatogonial cells (SGCs). Stem cell factor (SCF), the gene product of the steel (Sl) locus is the ligand for c-kit. Normal function of SGCs requires cross-talk between c-kit and SCF through which the receptor-ligand pair regulates the functions of SGCs. The implications of cross-talk between c-kit and SCF in regulating SGC function remains unclear due to the molecular complexity of this interaction. In the present study, we analyzed the interactions between c-kit and SCF in mouse primary SGCs after blocking the c-kit expression by c-kit siRNA and its effect on cell fate were determined using cDNA Expression Array and Real-time PCR. Immunofluorescence (IF) and western blot studies revealed that c-kit protein was detected in SGCs and knocked down to undetectable levels at 24 hr post transfection with 10 nM concentration of c-kit siRNA. We further demonstrated that expression of various genes involved in cell signaling, cell differentiation, apoptosis and cell cycle pathways was altered. SGC functions are affected by SCF signaling through c-kit receptor and this signaling appears to be important to maintain balance between cell proliferation and apoptosis along with the modulation of inflammatory responses of SGCs. To the best of our knowledge, this is the first report that identifies the putative molecular pathways in murine SGCs in response to specific blocking of c-kit-SCF interactions by siRNA. In conclusion, the present study may provide useful insights into siRNA function and hopefully aid in understanding the involvement of c-kit in the early events of SGC activities and spermatogenesis in mice. PMID:19771240

  6. A potencial theranostic agent for EGF-R expression tumors: (177)Lu-DOTA-nimotuzumab.

    PubMed

    Calzada, Victoria; Zhang, Xiuli; Fernandez, Marcelo; Diaz-Miqueli, Arlhee; Iznaga-Escobar, Normando; Deutscher, Susan L; Balter, Henia; Quinn, Thomas P; Cabral, Pablo

    2012-10-01

    In this work Nimotuzumab (monoclonal antibody, recognizes the EGF-R) was radiolabeled with (177)Lu as a potential cancer therapy radiopharmaceutical. In-vitro cell binding studies and in-vivo biodistribution and imaging studies were performed to determine the radiochemical stability, targeting specificity and pharmacokinetics of the (177)Lu-labeled antibody. Nimotuzumab was derivatized with DOTA-NHS at room temperature for 2 hours. DOTA-Nimotuzumab was radiolabeled with (177)LuCl3 (15 MBq/mg) at 37°C for 1 h. The radiochemical purity was assessed by ITLC, silica gel and by RP-HPLC. Binding specificity studies were performed with EGF-R positive A431 human epithelial carcinoma and EGF-R negative MDA-MB-435 breast carcinoma cells. Biodistribution studies were performed in healthy female CD-1 mice at 1 h, 4 h, 24 h, and A431 xenografted nude mice at 10 min, 1 h, 4 h, 24 h, 48 h, and 96 h. SPECT-CT imaging studies were performed in A431 xenografted mice at 24 h post injection. DOTA-Nimotuzumab was efficiently labeled with (177) LuCl(3) at 37°C. The in vitro stability of labeled product was optimal over 24 h in buffered saline and mouse serum. Specific recognition of EGF-R by (177)Lu-DOTA-Nimotuzumab was observed in A431 cell binding studies. Biodistribution studies demonstrated increasing tumor uptake of (177)Lu-DOTA-Nimotuzumab over time, with tumor to muscle ratios of 6.26, 10.68, and 18.82 at 4 h, 24 h, and 96 h post injection. Imaging of A431 xenografted mice showed high uptake in the tumor. (177)Lu-DOTA-Nimotuzumab has the potential to be a promising therapy agent, which may be useful in the treatment of patients with EGF-R positive cancer. PMID:22280117

  7. Development and biological evaluation of potent and selective c-KIT(D816V) inhibitors.

    PubMed

    Lee, Soyoung; Lee, Hyunseung; Kim, Jinhee; Lee, Suhyun; Kim, Soo Jung; Choi, Byong-Seok; Hong, Soon-Sun; Hong, Sungwoo

    2014-08-14

    The c-KIT tyrosine kinase has emerged as a potential therapeutic target for an array of diseases. However, there exists a drug resistance that is caused by mutations in c-KIT; therefore, c-KIT remains as a clinical challenge due to limited effective treatment options for therapies. For example, the acquired activating point mutation D816V significantly impairs the efficacy of targeted cancer therapies. Understanding the mechanisms of drug resistance at the molecular level will aid in designing and developing particular inhibitors with the potential to overcome these resistance mutations. We undertake a structure-based de novo design of 7-azaindole as the molecular core using the modified scoring function. This approach led to an identification of new c-KIT inhibitors over 100-fold specific for the D816V mutant relative to the wild-type c-KIT with nanomolar inhibitory activity. More importantly, these compounds potently inhibit clinically relevant D816V mutations of c-KIT in biochemical and cellular studies. PMID:25004409

  8. C-Kit plays a critical role in induction of intravenous tolerance in experimental autoimmune encephalomyelitis

    PubMed Central

    Safavi, Farinaz; Li, Hongmei; Gonnella, Patricia; Mari, Elisabeth Rose; Rasouli, Javad; Zhang, Guang Xian; Rostami, Abdolmohamad

    2015-01-01

    c-Kit (CD117) is a tyrosine kinase receptor found in various types of immune cells. It has been shown that c-Kit plays a role in the pathogenesis of multiple sclerosis, an inflammatory demyelinating disorder of the CNS. Recent data have suggested an immunoregulatory effect of c-Kit. We therefore examined the role of c-Kit in autoantigen-induced i.v. tolerance in experimental autoimmune encephalomyelitis (EAE), an animal model of MS. Our results show that induction of intravenous tolerance against EAE in B6 mice is characterized by increased numbers of CD117+ cells and altered mast-cell associated molecules in the periphery and in the CNS. W−sh (c-Kit deficient) mice were resistant to i.v autoantigen-induced tolerance, with increased proinflammatory cytokine production in the periphery. I.v. autoantigen in WT mice suppressed production of proinflammatory cytokines IFN-γ and IL-6 and up-regulated expression of FoxP3, a transcription factor of Tregs; however, in W−sh mice IFN-γ and IL-6 were increased with a failure of FoxP3 induction upon i.v. autoantigen injection, and is thus a mechanism for resistance to i.v. tolerance induction in these mice. We conclude that c-kit signaling has a regulatory role in i.v. tolerance and could be a target for potential immunotherapy in autoimmune disorders. PMID:25588867

  9. C-kit signaling promotes proliferation and invasion of colorectal mucinous adenocarcinoma in a murine model

    PubMed Central

    Tan, Jun; Yang, Shu; Shen, Ping; Sun, Haimei; Xiao, Jie; Wang, Yaxi; Wu, Bo; Ji, Fengqing; Yan, Jihong; Xue, Hong; Zhou, Deshan

    2015-01-01

    It was reported that the receptor tyrosine kinase (RTK) family often highly expressed in several mucinous carcinomas. In the present study, we established a murine model of colorectal mucinous adenocardinoma (CRMAC) by treating C57 mice [both wild type (WT) and loss-of-function c-kit mutant type (Wads−/−)] with AOM+DSS for 37 weeks and found that c-kit, a member of RTK family, clearly enhanced the tumor cell proliferation by decreasing p53 and increasing cyclin D1 through AKT pathway. Significantly, c-kit strongly promoted tumor cell invasiveness by increasing ETV4, which induced MMP7 expression and epithelial-mesenchymal transition (EMT) via ERK pathway. In vitro up- or down-regulating c-kit activation in human colorectal cancer HCT-116 cells further consolidated these results. In conclusion, our data suggested that the c-kit signaling obviously promoted proliferation and invasion of CRMAC. Therefore, targeting the c-kit signaling and its downstream molecules might provide the potential strategies for treatment of patients suffering from CRMAC in the future. PMID:26356816

  10. Antagonism of Stem Cell Factor/c-kit Signaling Attenuates Neonatal Chronic Hypoxia-Induced Pulmonary Vascular Remodeling

    PubMed Central

    Young, Karen C; Torres, Eneida; Hehre, Dorothy; Wu, Shu; Suguihara, Cleide; Hare, Joshua M.

    2015-01-01

    Background Accumulating evidence suggests that c-kit positive cells are present in the remodeled pulmonary vasculature bed of patients with pulmonary hypertension (PH). Whether stem cell factor (SCF)/ c-kit regulated pathways potentiate pulmonary vascular remodeling is unknown. Here, we tested the hypothesis that attenuated c-kit signaling would decrease chronic hypoxia-induced pulmonary vascular remodeling by decreasing pulmonary vascular cell mitogenesis. Methods Neonatal FVB/NJ mice treated with non-immune IgG (PL), or c-kit neutralizing antibody (ACK2) as well as c-kit mutant mice (WBB6F1- Kit W− v/ +) and their congenic controls, were exposed to normoxia (FiO2=0.21) or hypoxia (FiO2=0.12) for two weeks. Following this exposure, right ventricular systolic pressure (RVSP), right ventricular hypertrophy (RVH), pulmonary vascular cell proliferation and remodeling were evaluated. Results As compared to chronically hypoxic controls, c-kit mutant mice had decreased RVSP, RVH, pulmonary vascular remodeling and proliferation. Consistent with these findings, administration of ACK2 to neonatal mice with chronic hypoxia-induced PH decreased RVSP, RVH, pulmonary vascular cell proliferation and remodeling. This attenuation in PH was accompanied by decreased extracellular signal-regulated protein kinase (ERK) 1/2 activation. Conclusion SCF/c-kit signaling may potentiate chronic hypoxia-induced vascular remodeling by modulating ERK activation. Inhibition of c-kit activity may be a potential strategy to alleviate PH. PMID:26705118

  11. Evaluation of the relationship between c-Kit expression and mean platelet volume in classic Kaposi's sarcoma*

    PubMed Central

    Sehitoglu, Ibrahim; Bedir, Recep; Cure, Erkan; Cure, Medine Cumhur; Yuce, Suleyman; Dilek, Nursel

    2016-01-01

    Background c-Kit is a proto-oncogene that encodes tyrosine kinase receptor (CD117). Mean platelet volume (MPV) is a useful marker, providing information on platelet function and diameter. Objective To investigate c-Kit expression and intensity in patients with Kaposi's sarcoma (KS) and to investigate the relation between Ki-67 proliferation and MPV. Methods A total of 32 patients, diagnosed with classic cutaneous KS, were included in this study. We reevaluated the histopathological reports with the preparations, confirmed the diagnosis and then determined the patients' histopathological stages. c-Kit expression and Ki-67 proliferation were investigated immunohistochemically in KS cases, while MPV in all cases was checked. Results Although c-Kit expression was detected in 22 cases (68.8%), it was not expressed in 10 cases (31.2%). We detected 8 cases with + (25%), 6 with ++ (18.8%) and 8 with +++ (25%). Ki-67 expression was 5.0% (min-max 1.0-20.0). Relapse was observed in 5 cases (15.6%) out of 32. There was positive correlation between c-Kit expression and MPV (rs=0.598, p<0.001), and between c-Kit intensity and MPV (rs=0.588, p<0.001). Conclusion c-Kit is highly positive in KS. c-Kit positivity indicates a high risk of tumor growth, invasion and relapse. Furthermore, c-Kit expression stimulates megakaryocytes to release young and large thrombocytes into the periphery. Thus, high MPV, c-Kit expression and immunostaining intensity indicate high invasion and relapse in KS subjects. PMID:27579736

  12. Disruption of c-Kit Signaling in KitW-sh/W-sh Growing Mice Increases Bone Turnover

    PubMed Central

    Lotinun, Sutada; Krishnamra, Nateetip

    2016-01-01

    c-Kit tyrosine kinase receptor has been identified as a regulator of bone homeostasis. The c-Kit loss-of-function mutations in WBB6F1/J-KitW/W-v mice result in low bone mass. However, these mice are sterile and it is unclear whether the observed skeletal phenotype is secondary to a sex hormone deficiency. In contrast, C57BL/6J-KitW-sh/W-sh (Wsh/Wsh) mice, which carry an inversion mutation affecting the transcriptional regulatory elements of the c-Kit gene, are fertile. Here, we showed that Wsh/Wsh mice exhibited osteopenia with elevated bone resorption and bone formation at 6- and 9-week-old. The c-Kit Wsh mutation increased osteoclast differentiation, the number of committed osteoprogenitors, alkaline phosphatase activity and mineralization. c-Kit was expressed in both osteoclasts and osteoblasts, and c-Kit expression was decreased in Wsh/Wshosteoclasts, but not osteoblasts, suggesting an indirect effect of c-Kit on bone formation. Furthermore, the osteoclast-derived coupling factor Wnt10b mRNA was increased in Wsh/Wsh osteoclasts. Conditioned medium from Wsh/Wsh osteoclasts had elevated Wnt10b protein levels and induced increased alkaline phosphatase activity and mineralization in osteoblast cultures. Antagonizing Wnt10b signaling with DKK1 or Wnt10b antibody inhibited these effects. Our data suggest that c-Kit negatively regulates bone turnover, and disrupted c-Kit signaling couples increased bone resorption with bone formation through osteoclast-derived Wnt 10 b. PMID:27527615

  13. Disruption of c-Kit Signaling in Kit(W-sh/W-sh) Growing Mice Increases Bone Turnover.

    PubMed

    Lotinun, Sutada; Krishnamra, Nateetip

    2016-01-01

    c-Kit tyrosine kinase receptor has been identified as a regulator of bone homeostasis. The c-Kit loss-of-function mutations in WBB6F1/J-Kit(W/W-v) mice result in low bone mass. However, these mice are sterile and it is unclear whether the observed skeletal phenotype is secondary to a sex hormone deficiency. In contrast, C57BL/6J-Kit(W-sh)/(W-sh) (W(sh)/W(sh)) mice, which carry an inversion mutation affecting the transcriptional regulatory elements of the c-Kit gene, are fertile. Here, we showed that W(sh)/W(sh) mice exhibited osteopenia with elevated bone resorption and bone formation at 6- and 9-week-old. The c-Kit W(sh) mutation increased osteoclast differentiation, the number of committed osteoprogenitors, alkaline phosphatase activity and mineralization. c-Kit was expressed in both osteoclasts and osteoblasts, and c-Kit expression was decreased in W(sh)/W(sh)osteoclasts, but not osteoblasts, suggesting an indirect effect of c-Kit on bone formation. Furthermore, the osteoclast-derived coupling factor Wnt10b mRNA was increased in W(sh)/W(sh) osteoclasts. Conditioned medium from W(sh)/W(sh) osteoclasts had elevated Wnt10b protein levels and induced increased alkaline phosphatase activity and mineralization in osteoblast cultures. Antagonizing Wnt10b signaling with DKK1 or Wnt10b antibody inhibited these effects. Our data suggest that c-Kit negatively regulates bone turnover, and disrupted c-Kit signaling couples increased bone resorption with bone formation through osteoclast-derived Wnt 10 b. PMID:27527615

  14. Aberrant expressions of c-KIT and DOG-1 in mucinous and nonmucinous colorectal carcinomas and relation to clinicopathologic features and prognosis.

    PubMed

    Foda, Abd Al-Rahman Mohammad; Mohamed, Mie Ali

    2015-10-01

    c-KIT and DOG-1 are 2 highly expressed proteins in gastrointestinal stromal tumors. Few studies had investigated c-KIT, but not DOG-1, expression in colorectal carcinoma (CRC). This study aims to investigate expressions of c-KIT and DOG-1 in colorectal mucinous carcinoma and nonmucinous carcinoma using manual tissue microarray technique. In this work, we studied tumor tissue specimens from 150 patients with colorectal mucinous (MA) and nonmucinous adenocarcinoma (NMA). High-density manual tissue microarrays were constructed using modified mechanical pencil tip technique, and immunohistochemistry for c-KIT and DOG-1 was done. We found that aberrant c-KIT expression was detected in 12 cases (8%); 6 cases (4%) showed strong expression. Aberrant DOG-1 expression was detected in 15 cases (10%); among them, only 4 cases (2.7%) showed strong expression. Nonmucinous adenocarcinoma showed a significantly high expression of c-KIT, but not DOG-1, than MA. Aberrant c-KIT and DOG-1 expressions were significantly unrelated but were associated with excessive microscopic abscess formation. Neither c-KIT nor DOG-1 expression showed a significant impact on disease-free survival or overall survival. In conclusion, aberrant c-KIT and DOG-1 expressions in CRC are rare events, either in NMA or MA. Nonmucinous adenocarcinoma showed a significantly higher expression of c-KIT, but not DOG-1, than MA. The expressions of both in CRC are significantly unrelated but are associated with microscopic abscess formation. Neither c-KIT nor DOG-1 expression showed a significant impact on disease-free survival or overall survival. So, c-KIT and DOG-1 immunostaining is not a cost-effective method of identifying patients with CRC who may benefit from treatment with tyrosine kinase inhibitors. PMID:26272691

  15. Increased C-kit intensity is a poor prognostic factor for progression-free and overall survival in patients with newly diagnosed AML.

    PubMed

    Advani, Anjali S; Rodriguez, Cristina; Jin, Tao; Jawde, Rony Abou; Saber, Wael; Baz, Rachid; Kalaycio, Matt; Sobecks, Ronald; Sekeres, Mikkael; Tripp, Barbara; Hsi, Eric

    2008-06-01

    C-kit, a tyrosine kinase receptor, is expressed on most myeloid blasts and is thought to be important in the pathogenesis of AML. Activation of the c-kit receptor leads to phosphorylation and activation of downstream signaling proteins, which are important for cell survival and proliferation. Here, we discuss the prognostic impact of c-kit intensity, measured using the mean fluorescent index (MFI) in patients with newly diagnosed AML. On multivariate analysis, c-kit MFI>20.3 correlated with a decreased progression-free survival and overall survival, independent of known prognostic factors (age, white blood count at diagnosis and cytogenetics). Whether inhibiting c-kit in patients with AML will alter prognosis is the basis of ongoing clinical trials. PMID:17928050

  16. Transcription Factor SCL Is Required for c-kit Expression and c-Kit Function in Hemopoietic Cells

    PubMed Central

    Krosl, Gorazd; He, Gang; Lefrancois, Martin; Charron, Frédéric; Roméo, Paul-Henri; Jolicoeur, Paul; Kirsch, Ilan R.; Nemer, Mona; Hoang, Trang

    1998-01-01

    In normal hemopoietic cells that are dependent on specific growth factors for cell survival, the expression of the basic helix-loop-helix transcription factor SCL/Tal1 correlates with that of c-Kit, the receptor for Steel factor (SF) or stem cell factor. To address the possibility that SCL may function upstream of c-kit, we sought to modulate endogenous SCL function in the CD34+ hemopoietic cell line TF-1, which requires SF, granulocyte/macrophage colony–stimulating factor, or interleukin 3 for survival. Ectopic expression of an antisense SCL cDNA (as-SCL) or a dominant negative SCL (dn-SCL) in these cells impaired SCL DNA binding activity, and prevented the suppression of apoptosis by SF only, indicating that SCL is required for c-Kit–dependent cell survival. Consistent with the lack of response to SF, the level of c-kit mRNA and c-Kit protein was significantly and specifically reduced in as-SCL– or dn-SCL– expressing cells. c-kit mRNA, c-kit promoter activity, and the response to SF were rescued by SCL overexpression in the antisense or dn-SCL transfectants. Furthermore, ectopic c-kit expression in as-SCL transfectants is sufficient to restore cell survival in response to SF. Finally, enforced SCL in the pro–B cell line Ba/F3, which is both SCL and c-kit negative is sufficient to induce c-Kit and SF responsiveness. Together, these results indicate that c-kit, a gene that is essential for the survival of primitive hemopoietic cells, is a downstream target of the transcription factor SCL. PMID:9687522

  17. C-kit receptor (CD117) expression on plasma cells in monoclonal gammopathies.

    PubMed

    Kraj, Maria; Pogłód, Ryszard; Kopeć-Szlezak, Joanna; Sokołowska, Urszula; Woźniak, Jolanta; Kruk, Barbara

    2004-11-01

    The surface expression of CD117 antigen (c-kit) on plasma cells from 158 multiple myeloma (MM), 12 plasma cell leukemia (PCL), 7 MGUS, 7 IgM lymphoplasmacytic lymphoma patients and 10 healthy subjects has been analyzed by flow cytometry using triple staining with the monoclonal antibodies CD138, CD117 and CD38. The antigen expression intensity was calculated as relative fluorescence intensity (RFI) and for direct quantitative analysis the QuantiBRITE test (Becton Dickinson) was applied. Antibody bounding capacity (ABC) was calculated using QuantiCALC software. CD117 antigen was present in 49/158 MM, 5/12 PCL and 5/7 MGUS patients. The RFI values ranged from 0.2 to 20.2 in particular MM patients (mean: 11.0+/-5.3; median 11.5) while the number of CD117 binding sites (ABC) on MM plasma cells ranged from 637 to 6217 (mean: 3029+/-1568; median 2946) (r=0.8328). In responsive to chemotherapy c-kit positive MM patients the percentage of CD117+ plasma cells in the bone marrow decreased significantly while in c-kit negative MM patients the percentage of CD117+ cells in bone marrow did not change and remained in the normal limits. When comparing the clinical and biological disease characteristics (monoclonal protein isotype, albumin, beta2-microglobulin, lactate dehydrogenase, stage of disease, response to chemotherapy, survival time) of c-kit positive and c-kit negative cases, no significant differences were found. In CD117 positive PCL cases expression of CD117 was detected in bone marrow plasma cells as well as in peripheral blood plasma cells. Normal plasma cells and those in IgM lymphoplasmacytic lymphoma did not show reactivity for the CD117 antigen. We conclude that it may be rationale to consider usefulness of therapy with tyrosine kinase inhibitors in the management of c-kit positive plasma cell proliferations. In one third of MM and PCL patients c-kit antigen could be considered as a "tumor associated marker" and together with CD38 and CD138 it may be of value for

  18. cKit+ cardiac progenitors of neural crest origin

    PubMed Central

    Hatzistergos, Konstantinos E.; Takeuchi, Lauro M.; Saur, Dieter; Seidler, Barbara; Dymecki, Susan M.; Mai, Jia Jia; White, Ian A.; Balkan, Wayne; Kanashiro-Takeuchi, Rosemeire M.; Schally, Andrew V.; Hare, Joshua M.

    2015-01-01

    The degree to which cKit-expressing progenitors generate cardiomyocytes in the heart is controversial. Genetic fate-mapping studies suggest minimal contribution; however, whether or not minimal contribution reflects minimal cardiomyogenic capacity is unclear because the embryonic origin and role in cardiogenesis of these progenitors remain elusive. Using high-resolution genetic fate-mapping approaches with cKitCreERT2/+ and Wnt1::Flpe mouse lines, we show that cKit delineates cardiac neural crest progenitors (CNCkit). CNCkit possess full cardiomyogenic capacity and contribute to all CNC derivatives, including cardiac conduction system cells. Furthermore, by modeling cardiogenesis in cKitCreERT2-induced pluripotent stem cells, we show that, paradoxically, the cardiogenic fate of CNCkit is regulated by bone morphogenetic protein antagonism, a signaling pathway activated transiently during establishment of the cardiac crescent, and extinguished from the heart before CNC invasion. Together, these findings elucidate the origin of cKit+ cardiac progenitors and suggest that a nonpermissive cardiac milieu, rather than minimal cardiomyogenic capacity, controls the degree of CNCkit contribution to myocardium. PMID:26438843

  19. In silico exploration of c-KIT inhibitors by pharmaco-informatics methodology: pharmacophore modeling, 3D QSAR, docking studies, and virtual screening.

    PubMed

    Chaudhari, Prashant; Bari, Sanjay

    2016-02-01

    c-KIT is a component of the platelet-derived growth factor receptor family, classified as type-III receptor tyrosine kinase. c-KIT has been reported to be involved in, small cell lung cancer, other malignant human cancers, and inflammatory and autoimmune diseases associated with mast cells. Available c-KIT inhibitors suffer from tribulations of growing resistance or cardiac toxicity. A combined in silico pharmacophore and structure-based virtual screening was performed to identify novel potential c-KIT inhibitors. In the present study, five molecules from the ZINC database were retrieved as new potential c-KIT inhibitors, using Schrödinger's Maestro 9.0 molecular modeling suite. An atom-featured 3D QSAR model was built using previously reported c-KIT inhibitors containing the indolin-2-one scaffold. The developed 3D QSAR model ADHRR.24 was found to be significant (R2 = 0.9378, Q2 = 0.7832) and instituted to be sufficiently robust with good predictive accuracy, as confirmed through external validation approaches, Y-randomization and GH approach [GH score 0.84 and Enrichment factor (E) 4.964]. The present QSAR model was further validated for the OECD principle 3, in that the applicability domain was calculated using a "standardization approach." Molecular docking of the QSAR dataset molecules and final ZINC hits were performed on the c-KIT receptor (PDB ID: 3G0E). Docking interactions were in agreement with the developed 3D QSAR model. Model ADHRR.24 was explored for ligand-based virtual screening followed by in silico ADME prediction studies. Five molecules from the ZINC database were obtained as potential c-KIT inhibitors with high in -silico predicted activity and strong key binding interactions with the c-KIT receptor. PMID:26416560

  20. Molecular bases of dominant negative and loss of function mutations at the murine c-kit/white spotting locus: W37, Wv, W41 and W.

    PubMed Central

    Nocka, K; Tan, J C; Chiu, E; Chu, T Y; Ray, P; Traktman, P; Besmer, P

    1990-01-01

    The proto-oncogene c-kit encodes a transmembrane tyrosine protein kinase receptor for an unknown ligand and is allelic with the murine white-spotting locus (W). Mutations at the W locus affect various aspects of hematopoiesis, the proliferation and migration of primordial germ cells and melanoblasts during development. The original W mutation and W37 are severe lethal mutations when homozygous. In the heterozygous state the W mutation has a weak phenotype while W37 has dominant characteristics. Wv and W41 are weak W mutations with dominant characteristics. We have characterized the molecular basis of these four W mutations and determined their effects on mast cell differentiation by using a fibroblast/mast cell co-culture assay. We show that W37, Wv and W41 are the result of missense mutations in the kinase domain of the c-kit coding sequence (W37 E----K at position 582; Wv T----M position 660 and W41 V----M position 831), which affect the c-kit associated tyrosine kinase to varying degrees. The c-kit protein products in homozygous mutant mast cells are expressed normally, although the 160 kd cell membrane form of the c-kitW37 protein displays accelerated turnover characteristics. The W mutation is the result of a 78 amino acid deletion which includes the transmembrane domain of the c-kit protein. A 125 kd c-kit protein was detected in homozygous W/W mast cells which lacks kinase activity and is not expressed on the cell surface.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 2. Fig. 3. Fig. 5. PMID:1693331

  1. Screening of candidate G-quadruplex ligands for the human c-KIT promotorial region and their effects in multiple in-vitro models

    PubMed Central

    Zorzan, Eleonora; Ros, Silvia Da; Musetti, Caterina; Shahidian, Lara Zorro; Ramos Coelho, Nuno Filipe; Bonsembiante, Federico; Létard, Sébastien; Gelain, Maria Elena; Palumbo, Manlio; Dubreuil, Patrice; Giantin, Mery; Sissi, Claudia; Dacasto, Mauro

    2016-01-01

    Stabilization of G-quadruplex (G4) structures in promoters is a novel promising strategy to regulate gene expression at transcriptional and translational levels. c-KIT proto-oncogene encodes for a tyrosine kinase receptor. It is involved in several physiological processes, but it is also dysregulated in many diseases, including cancer. Two G-rich sequences able to fold into G4, have been identified in c-KIT proximal promoter, thus representing suitable targets for anticancer intervention. Herein, we screened an “in house” library of compounds for the recognition of these G4 elements and we identified three promising ligands. Their G4-binding properties were analyzed and related to their antiproliferative, transcriptional and post-transcriptional effects in MCF7 and HGC27 cell lines. Besides c-KIT, the transcriptional analysis covered a panel of oncogenes known to possess G4 in their promoters. From these studies, an anthraquinone derivative (AQ1) was found to efficiently downregulate c-KIT mRNA and protein in both cell lines. The targeted activity of AQ1 was confirmed using c-KIT–dependent cell lines that present either c-KIT mutations or promoter engineered (i.e., α155, HMC1.2 and ROSA cells). Present results indicate AQ1 as a promising compound for the target therapy of c-KIT-dependent tumors, worth of further and in depth molecular investigations. PMID:26942875

  2. Identification of Tyr-703 and Tyr-936 as the primary association sites for Grb2 and Grb7 in the c-Kit/stem cell factor receptor.

    PubMed Central

    Thömmes, K; Lennartsson, J; Carlberg, M; Rönnstrand, L

    1999-01-01

    In this paper we demonstrate the presence of two novel in vivo autophosphorylation sites in the c-Kit/stem cell factor receptor (c-Kit/SCFR): Tyr-703 in the kinase insert and Tyr-936 in the C-terminal tail. We furthermore demonstrate that the adapter protein Grb2 is a specific binding partner for both phosphorylated Tyr-703 and phosphorylated Tyr-936, whereas the adapter protein Grb7 binds selectively to phosphorylated Tyr-936. It is shown that the association occurs through the Src homology 2 (SH2) domains of Grb2 and Grb7. Binding of Grb2 to Tyr-703 in the c-Kit/SCFR provides a link to the Ras/mitogen-activated protein kinase pathway. PMID:10377264

  3. Dominant negative and loss of function mutations of the c-kit (mast/stem cell growth factor receptor) proto-oncogene in human piebaldism

    SciTech Connect

    Spritz, R.A.; Giebel, L.B.; Holmes, S.A. )

    1992-02-01

    Piebaldism is an autosomal dominant disorder of melanocyte development and is characterized by congenital white parches of skin and hair from which melanocytes are completely absent. A similar disorder of the mouse, 'dominant white spotting' (W), results from mutations of the c-kit proto-oncogene, which encodes the cellular tyrosine kinases receptor for the mast/stem cell growth factor. The authors have identified c-kit gene mutations in three patients with piebaldism. A missense substitution (Phe[r arrow]Leu) at codon 584, within the tyrosine kinases domain, is associated with a severe piebald phenotype, whereas two different frameshifts, within codons 561 and 642, are both associated with a variable and relatively mild piebald phenotype. This is consistent with a possible 'dominant negative' effect of missense c-kit polypeptides on the function of the dimeric receptor.

  4. Mast cells rescue implantation defects caused by c-kit deficiency

    PubMed Central

    Woidacki, K; Popovic, M; Metz, M; Schumacher, A; Linzke, N; Teles, A; Poirier, F; Fest, S; Jensen, F; Rabinovich, G A; Maurer, M; Zenclussen, A C

    2013-01-01

    Various physiologically relevant processes are regulated by the interaction of the receptor tyrosine kinase (c-Kit) and its ligand stem cell factor (SCF), with SCF known to be the most important growth factor for mast cells (MCs). In spite of their traditional role in allergic disorders and innate immunity, MCs have lately emerged as versatile modulators of a variety of physiologic and pathologic processes. Here we show that MCs are critical for pregnancy success. Uterine MCs presented a unique phenotype, accumulated during receptivity and expanded upon pregnancy establishment. KitW-sh/W-sh mice, whose MC deficiency is based on restricted c-Kit gene expression, exhibited severely impaired implantation, which could be completely rescued by systemic or local transfer of wild-type bone marrow-derived MCs. Transferred wild-type MCs favored normal implantation, induced optimal spiral artery remodeling and promoted the expression of MC proteases, transforming growth factor-β and connective tissue growth factor. MCs contributed to trophoblast survival, placentation and fetal growth through secretion of the glycan-binding protein galectin-1. Our data unveil unrecognized roles for MCs at the fetomaternal interface with critical implications in reproductive medicine. PMID:23328669

  5. Expression and mutation of c-Kit in intracranial germ cell tumors: A single-centre retrospective study of 30 cases in China

    PubMed Central

    GAO, YU-PING; JIANG, JI-YAO; LIU, QIANG

    2016-01-01

    Although primary central nervous system (CNS) germ cell tumors (GCTs) are one of the most treatable types of malignant brain tumor, a subset of patients remain resistant to standard chemotherapy. Gain-of-function mutations of the c-Kit gene, and KIT protein expression, have been observed in a number of GCTs, including testicular seminoma, ovarian dysgerminoma and mediastinal seminoma in various ethnic groups. Although a small number of studies have reported the role of c-Kit in CNS GCTs, few have focused on Chinese patients exhibiting CNS GCTs. In the present study, the frequency and location of c-Kit mutations and KIT protein expression levels in CNS GCTs were investigated in 30 patients, between January 1994 and October 2014. Immunohistochemical assays suggested that KIT protein expression was present in 59.1% patients (66.7% in males and 42.9% in females); however, no statistically significant correlation was identified between KIT protein expression and patient clinicopathological features. By performing PCR amplification and direct sequencing, 4 mutational hot spots of the c-Kit gene (exons 9, 11, 13 and 17) were examined, and c-Kit gene mutation was identified in 1/17 (5.9%) CNS germinoma cases. This mutation was located in exon 11 at codon 557–558 WK (Tryptophan-Lysine). No c-Kit gene mutations were detected in non-germinomatous GCTs. Imatinib, a tyrosine kinase inhibitor, may be an effective treatment against standard chemotherapy-resistant CNS germinoma patients exhibiting c-Kit mutations. PMID:27123048

  6. C-kit as a prognostic and therapeutic marker in canine cutaneous mast cell tumours: From laboratory to clinic.

    PubMed

    Gil da Costa, Rui M

    2015-07-01

    Cutaneous mast cell tumours (MCTs) are some of the most common canine neoplasms and their variable and often aggressive biological behaviour makes them particularly challenging for the veterinary practitioner. Over the years, scientists have accumulated a wealth of knowledge on these tumours and developed better prognostic markers and targeted therapies, mostly focused on inhibiting c-kit, a protein that plays a major role in the biopathology of MCTs. Masitinib and toceranib, targeted inhibitors of c-kit and other receptor tyrosine-kinases (RTKs), offer the promise of improving the outcome of patients with aggressive MCTs. Much of the available knowledge on MCTs is dispersed, making it difficult for practitioners to benefit when consulting a pathologist or making therapeutic decisions. This article seeks to bring together current knowledge on the biopathology of MCTs, reviewing prognostic markers and their applications, and the development of c-kit inhibitors in the context of the basic cellular, molecular and pathological features of MCTs. Future perspectives following recent biopathological data and experimental therapeutic approaches are also addressed. PMID:26021891

  7. c-kit mutation-positive advanced thymic carcinoma successfully treated as a mediastinal gastrointestinal stromal tumor: A case report

    PubMed Central

    HIRAI, FUMIHIKO; EDAGAWA, MAKOTO; SHIMAMATSU, SHINICHIRO; TOYOZAWA, RYO; TOYOKAWA, GOUJI; NOSAKI, KANAME; YAMAGUCHI, MASAFUMI; SETO, TAKASHI; TWAKENOYAMA, MITSUHIRO; ICHINOSE, YUKITO

    2016-01-01

    Thymic carcinoma is an exceptionally rare tumor, which has a very poor prognosis, differing from thymoma. Although cytotoxic chemotherapy is commonly used to treat advanced thymic carcinoma, its effectiveness has not been found to be sufficient. There are several reports that thymic carcinoma also harbors an oncogenic driver mutation, similar to lung cancer. A patient with a c-kit mutation-positive thymic carcinoma received imatinib followed by sunitinib consecutively, which are both c-Kit inhibitors. Although the patient had achieved long-term disease control for 21 months, the primary lesion and pulmonary metastases had increased in size by November, 2014. Following failure of imatinib treatment, the patient received sunitinib, a multiple kinase inhibitor, initiated in December, 2014. Following administration of sunitinib, a computed tomography scan revealed a partial response and the disease was effectively controlled with continued sunitinib treatment for 6 months, up to June, 2015. The patient achieved long-term disease control (~27 months) with imatinib followed by sunitinib. The efficacy of consecutive molecular-targeted therapy for thymic carcinoma was demonstrated in this case. Therefore, thymic carcinoma with oncogenic driver mutations should be treated with molecular-targeted agents rather than with cytotoxic drugs, and it may be suitable to treat c-kit mutation-positive thymic carcinoma as a mediastinal gastrointestinal stromal tumor. PMID:27073655

  8. JAK2, complemented by a second signal from c-kit or flt-3, triggers extensive self-renewal of primary multipotential hemopoietic cells

    PubMed Central

    Zhao, Shengming; Zoller, Karen; Masuko, Masayoshi; Rojnuckarin, Ponlapat; Yang, Xuexian O.; Parganas, Evan; Kaushansky, Kenneth; Ihle, James N.; Papayannopoulou, Thalia; Willerford, Dennis M.; Clackson, Tim; Blau, C.Anthony

    2002-01-01

    Defining signals that can support the self-renewal of multipotential hemopoietic progenitor cells (MHPCs) is pertinent to understanding leukemogenesis and may be relevant to developing stem cell-based therapies. Here we define a set of signals, JAK2 plus either c-kit or flt-3, which together can support extensive MHPC self-renewal. Phenotypically and functionally distinct populations of MHPCs were obtained, depending on which receptor tyrosine kinase, c-kit or flt-3, was activated. Self-renewal was abrogated in the absence of STAT5a/b, and in the presence of inhibitors targeting either the mitogen-activated protein kinase or phosphatidylinositol 3′ kinase pathways. These findings suggest that a simple two-component signal can drive MHPC self-renewal. PMID:11980713

  9. [Detection of NPM1, FLT3 and C-KIT mutations in acute myeloid leukemia and their prognostic analysis].

    PubMed

    Li, Ling; Lyu, Xiao-Dong; Mi, Rui-Hua; Ding, Jing; Chen, Lin; Wang, Qian; Yin, Qing-Song; Hu, Jie-Ying; Fan, Rui-Hua; Wei, Xu-Dong

    2013-06-01

    This study was aimed to evaluate the frequencies and prognostic significance of the nucleophosmin 1 (NPM1) mutation, the fms-like tyrosine kinase 3 (FLT3) mutation and c-KIT mutation in acute myeloid leukemia (AML) and to explore their relevance to clinical characteristics, cytogenetics and survival. Genomic DNA from 78 newly diagnosed AML from August 2010 to October 2012 was screened by PCR and sequencing or capillary electrophoresis (CE) for NPM1, FLT3 and c-KIT mutations. The results showed that the incidence of NPM1 mutation was 14.1% in AML patients and 26.7% in normal karyotype AML patients. NPM1 mutant cases were significantly associated with old age (P < 0.05), high peripheral white cell count and platelet counts (P < 0.05) and low expression of CD34 (P < 0.05), but no statistic difference was found in sex, percentage of bone marrow blasts, Hb, expression of CD117 and HLA-DR, complete remission rate, overall survival and relapse rate (P > 0.05). The prevalences of FLT3-ITD and FLT3-TKD mutations were 11.5% (9/78) and 3.8% (3/78) respectively, and no one patient has both of the two mutations. Patients with FLT3-ITD mutation had higher white blood cell counts and percentage of in bone marrow blasts (P < 0.05), and lower overall survival (P < 0.05), more relative to normal karyotype (P < 0.05), while no statistic difference was found in sex, age, platelet count, Hb level, complete remission rate and relapse rate (P > 0.05). No statistic analysis was performed due to the cases of less FLT3-TKD mutation. C-KIT mutation accounts for 7.7% (6/78). Patients with C-KIT mutation had a higher percentage in abnormal karyotype (P < 0.05), and higher relapse rate (P < 0.05), and lower overall survival, whereas no statistic difference was found in sex, age, percentage of bone marrow blasts, peripheral blood cell count, complete remission rate (P > 0.05). It is concluded that the detection of NPM1, FLT3 and C-KIT mutations may contribute to guiding treatment and evaluating

  10. Expression of c-kit receptor and its autophosphorylation in immature rat type A spermatogonia.

    PubMed

    Dym, M; Jia, M C; Dirami, G; Price, J M; Rabin, S J; Mocchetti, I; Ravindranath, N

    1995-01-01

    The objective of this study was to examine the expression and activation of the c-kit receptor, a specific receptor for kit ligand (stem cell factor, steel factor), in rat type A spermatogonia. Testes were obtained from 9-day-old rats, decapsulated, and then subjected to sequential enzymatic digestion. The mixture of testicular cell types was then separated by sedimentation velocity at unit gravity. The isolated type A spermatogonia were characterized by light and electron microscopy. They exhibited spherical nuclei containing several nucleoli and associated chromatin clumps and organelles generally in a perinuclear location similar to that found in the in vivo 9-day-old testis. The synthesis of the c-kit receptor by the spermatogonia was established by hybridization of total RNA with a specific cDNA for mouse c-kit receptor. Two mRNA transcripts migrating at 4.8 kb and 12 kb were observed. Localization of the c-kit receptor in the isolated cells was determined by immunocytochemistry using an antibody to c-kit protein. Specific staining for c-kit receptor was observed in the cytoplasm of the isolated type A spermatogonia. Furthermore, the presence of the c-kit receptor protein in the spermatogonia was confirmed by Western blot analysis using the same antibody. The antibody recognized the c-kit receptor at approximately 160 kDa. In an attempt to determine whether this receptor has a functional significance, we examined the effect of kit ligand on the phosphorylation of the c-kit receptor. The c-kit receptor appeared to be constitutively autophosphorylated on tyrosine at low basal levels, and upon stimulation with kit ligand, the amount of phosphorylated protein increased significantly. These observations indicate that kit ligand induces autophosphorylation of the c-kit receptor, which may lead to the activation of other cellular target proteins responsible for spermatogonial proliferation and/or differentiation. PMID:7536046

  11. Deletion of the c-kit protooncogene in the human developmental defect piebald trait.

    PubMed

    Fleischman, R A; Saltman, D L; Stastny, V; Zneimer, S

    1991-12-01

    The protooncogene c-kit is critical for development of hematopoietic stem cells, germ cells, and melanoblasts in the mouse. Homozygous mutations of this gene in the mouse cause anemia, infertility, and albinism, whereas heterozygous mutant mice usually exhibit only a white forehead blaze and depigmentation of the ventral body, tail, and feet. The heterozygous mouse phenotype is very similar to human piebald trait, which is characterized by a congenital white hair forelock and ventral and extremity depigmentation. To investigate the possibility that alterations in the human c-kit gene may be a cause of piebald trait, DNA from seven unrelated affected individuals was examined by Southern blot analysis. One subject, although cytogenetically normal, has a heterozygous deletion of the c-kit protooncogene. This deletion encompasses the entire coding region for c-kit and also involves the closely linked gene for platelet-derived growth factor receptor alpha. Fluorescence in situ hybridization of genomic c-kit probes to metaphase chromosomes independently confirmed the deletion in this case. These findings provide molecular evidence mapping piebald trait to the c-kit locus on chromosome 4. Although we cannot exclude the involvement of other closely linked genes, the demonstration of a genomic c-kit deletion in one subject with piebald trait and the marked concordance of the human and mouse phenotypes provide strong evidence for the role of c-kit in the development of human melanocytes and in the pathogenesis of piebald trait. PMID:1720553

  12. Regulation of ferritin mRNA translation in primary erythroblasts: exogenous c-Kit plus EpoR signaling mimics v-ErbA oncoprotein activity.

    PubMed

    Mikulits, W; Schranzhofer, M; Deiner, E M; Beug, H; Müllner, E W

    2000-08-28

    In general, translation efficiency of ferritin mRNAs is modulated by variations in iron supply. In primary avian erythroblasts undergoing short-term proliferation, however, ferritin heavy chain (ferH) mRNA is repressed at all iron levels. Yet, expression of v-ErbA oncoprotein is sufficient to reinduce ferH mRNA utilization at physiological iron concentrations. Since overexpression of the receptor tyrosine kinase c-Kit and erythropoietin receptor (EpoR) stimulates long-term proliferation of primary erythroblasts like v-ErbA, we analyzed the impact of cooperation between c-Kit and EpoR on the regulation of iron storage. Whereas endogenous c-Kit in combination with exogenous EpoR had no significant effect, ectopic overexpression of both receptors abolished translational repression of ferH mRNA upon iron administration. Thus, high-intensity signaling through c-Kit plus EpoR pathways mimics the v-ErbA-mediated regulatory phenotype. PMID:10964660

  13. The usefulness of c-Kit in the immunohistochemical assessment of melanocytic lesions

    PubMed Central

    Pilloni, L.; Bianco, P.; Difelice, E.; Cabras, S.; Castellanos, M.E.; Atzori, L.; Ferreli, C.; Mulas, P.; Nemolato, S.; Faa, G.

    2011-01-01

    C-Kit (CD117), the receptor for the stem cell factor, a growth factor for melanocyte migration and proliferation, has shown differential immunostaining in various benign and malignant melanocytic lesions. The purpose of this study is to compare c-Kit immunostaining in benign nevi and in primary and metastatic malignant melanomas, to determine whether c-Kit can aid in the differential diagnosis of these lesions. c-Kit immunostaining was performed in 60 cases of pigmented lesions, including 39 benign nevi (5 blue nevi, 5 intra-dermal nevi, 3 junctional nevi, 15 cases of primary compound nevus, 11 cases of Spitz nevus), 18 cases of primary malignant melanoma and 3 cases of metastatic melanoma. The vast majority of nevi and melanomas examined in this study were positive for c-Kit, with minimal differences between benign and malignant lesions. C-Kit cytoplasmatic immunoreactivity in the intraepidermal proliferating nevus cells, was detected in benign pigmented lesions as well as in malignant melanoma, increasing with the age of patients (P=0.007) in both groups. The patient’s age at presentation appeared to be the variable able to cluster benign and malignant pigmented lesions. The percentage of c-Kit positive intraepidermal nevus cells was better associated with age despite other variables (P=0.014). The intensity and percentage of c-Kit positivity in the proliferating nevus cells in the dermis was significantly increased in malignant melanocytic lesions (P=0.015 and P=0.008) compared to benign lesions (compound melanocytic nevi, Spitz nevi, intradermal nevi, blue nevi). Immunostaning for c-Kit in metastatic melanomas was negative. Interestingly in two cases of melanoma occurring on a pre-existent nevus, the melanoma tumor cells showed strong cytoplasmatic and membranous positivity for c-kit, in contrast with the absence of any immunoreactivity in pre-existent intradermal nevus cells. C-Kit does not appear to be a strong immunohistochemical marker for distinguishing

  14. A New Method to Stabilize C-Kit Expression in Reparative Cardiac Mesenchymal Cells.

    PubMed

    Wysoczynski, Marcin; Dassanayaka, Sujith; Zafir, Ayesha; Ghafghazi, Shahab; Long, Bethany W; Noble, Camille; DeMartino, Angelica M; Brittian, Kenneth R; Bolli, Roberto; Jones, Steven P

    2016-01-01

    Cell therapy improves cardiac function. Few cells have been investigated more extensively or consistently shown to be more effective than c-kit sorted cells; however, c-kit expression is easily lost during passage. Here, our primary goal was to develop an improved method to isolate c-kit(pos) cells and maintain c-kit expression after passaging. Cardiac mesenchymal cells (CMCs) from wild-type mice were selected by polystyrene adherence properties. CMCs adhering within the first hours are referred to as rapidly adherent (RA); CMCs adhering subsequently are dubbed slowly adherent (SA). Both RA and SA CMCs were c-kit sorted. SA CMCs maintained significantly higher c-kit expression than RA cells; SA CMCs also had higher expression endothelial markers. We subsequently tested the relative efficacy of SA vs. RA CMCs in the setting of post-infarct adoptive transfer. Two days after coronary occlusion, vehicle, RA CMCs, or SA CMCs were delivered percutaneously with echocardiographic guidance. SA CMCs, but not RA CMCs, significantly improved cardiac function compared to vehicle treatment. Although the mechanism remains to be elucidated, the more pronounced endothelial phenotype of the SA CMCs coupled with the finding of increased vascular density suggest a potential pro-vasculogenic action. This new method of isolating CMCs better preserves c-kit expression during passage. SA CMCs, but not RA CMCs, were effective in reducing cardiac dysfunction. Although c-kit expression was maintained, it is unclear whether maintenance of c-kit expression per se was responsible for improved function, or whether the differential adherence property itself confers a reparative phenotype independently of c-kit. PMID:27536657

  15. Expression of Epidermal c-Kit+ of Vitiligo Lesions Is Related to Responses to Excimer Laser

    PubMed Central

    Park, Oun Jae; Han, Ji Su; Lee, Sang Hyung; Park, Chan-Sik; Won, Chong Hyun; Lee, Mi Woo; Choi, Jee Ho

    2016-01-01

    Background The survival and growth of melanocytes are controlled by the binding of stem cell factor to its cell surface receptor c-kit+ (CD117). We have observed that c-kit+ melanocytes existed in some lesions of vitiligo, while Melan A+ cells were absent. Objective To verify possible relation between c-kit+ expression and treatment response in non-segmental vitiligo lesions Methods Skin biopsies were done from the center of the 47 lesions from the 47 patients with non-segmental vitiligo. Expression of c-kit+ and Melan A, and amounts of melanin in the epidermis were assessed in each lesion, and treatment responses to excimer laser were evaluated. Results Thirty-five of the 47 lesions (74.5%) had c-kit+ phenotypes. There was significant difference of c-kit staining value between good responders in 3 months of excimer laser treatment (average of 24 sessions) and the others. Conclusion c-Kit expression in vitiliginous epidermis may be related to better treatment responses to excimer laser. PMID:27489428

  16. The Roles of Testicular C-kit Positive Cells in De novo Morphogenesis of Testis

    PubMed Central

    Zhang, Man; Zhou, Hai; Zheng, Chunxing; Xiao, Jun; Zuo, Erwei; Liu, Wujuan; Xie, Da; Shi, Yufang; Wu, Chunlian; Wang, Hongyan; Li, Dangsheng; Li, Jinsong

    2014-01-01

    C-kit positive (c-kit+) cells are usual tissue-specific stem cells. However, in postnatal testis, undifferentiated spermatogonial stem cells (SSCs) are c-kit negative (c-kit−) and activation of c-kit represents the start of SSC differentiation, leaving an intriguing question whether other c-kit+ cells exist and participate in the postnatal development of testis. To this end, a feasible system for testicular reconstitution, in which a specific type of cells can be manipulated, is needed. Here, we first establish de novo morphogenesis of testis by subcutaneous injection of testicular cells from neonatal testes into the backs of nude mice. We observe testicular tissue formation and spermatogenesis from all injected sites. Importantly, functional spermatids can be isolated from these testicular tissues. Using this system, we systemically analyze the roles of c-kit+ cells in testicular reconstitution and identify a small population of cells (c-kit+:CD140a+:F4/80+), which express typical markers of macrophages, are critical for de novo morphogenesis of testis. Interestingly, we demonstrate that these cells are gradually replaced by peripheral blood cells of recipient mice during the morphogenesis of testis. Thus, we develop a system, which may mimic the complete developmental process of postnatal testis, for investigating the testicular development and spermatogenesis. PMID:25088917

  17. Resident c-kit(+) cells in the heart are not cardiac stem cells.

    PubMed

    Sultana, Nishat; Zhang, Lu; Yan, Jianyun; Chen, Jiqiu; Cai, Weibin; Razzaque, Shegufta; Jeong, Dongtak; Sheng, Wei; Bu, Lei; Xu, Mingjiang; Huang, Guo-Ying; Hajjar, Roger J; Zhou, Bin; Moon, Anne; Cai, Chen-Leng

    2015-01-01

    Identifying a bona fide population of cardiac stem cells (CSCs) is a critical step for developing cell-based therapies for heart failure patients. Previously, cardiac c-kit(+) cells were reported to be CSCs with a potential to become myocardial, endothelial and smooth muscle cells in vitro and after cardiac injury. Here we provide further insights into the nature of cardiac c-kit(+) cells. By targeting the c-kit locus with multiple reporter genes in mice, we find that c-kit expression rarely co-localizes with the expression of the cardiac progenitor and myogenic marker Nkx2.5, or that of the myocardial marker, cardiac troponin T (cTnT). Instead, c-kit predominantly labels a cardiac endothelial cell population in developing and adult hearts. After acute cardiac injury, c-kit(+) cells retain their endothelial identity and do not become myogenic progenitors or cardiomyocytes. Thus, our work strongly suggests that c-kit(+) cells in the murine heart are endothelial cells and not CSCs. PMID:26515110

  18. Deletion of the c-kit protooncogene in the human developmental defect piebald trait

    SciTech Connect

    Fleischman, R.A.; Stastny, V.; Zneimer, S. ); Saltman, D.L. )

    1991-12-01

    The protooncogene c-kit is critical for development of hematopoietic stem cells, germ cells, and melanoblasts in the mouse. Homozygous mutations of this gene in the mouse cause anemia, infertility, and albinism, whereas heterozygous mutant mice usually exhibit only a white forehead blaze and depigmentation of the ventral body, tail, and feet. The heterozygous mouse phenotype is very similar to human piebald trait, which is characterized by a congenital white hair forelock and ventral and extremity depigmentation. To investigate the possibility that alterations in the human c-kit gene may be a cause of piebald trait, DNA from seven unrelated affected individuals was examined by Southern blot analysis. One subject, although cytogenetically normal, has a heterozygous deletion of the c-kit protooncogene. This deletion encompasses the entire coding region for c-kit and also involves the closely linked gene for platelet-derived growth factor receptor {alpha}. These findings provide molecular evidence mapping piebald trait to the c-kit locus on chromosome 4. Although the authors cannot exclude the involvement of other closely linked genes, the demonstration of a genomic c-kit deletion in one subject with piebald trait and the marked concordance of the human and mouse phenotypes provide strong evidence for the role of c-kit in the development of human melanocytes and in the pathogenesis of piebald trait.

  19. Resident c-kit+ cells in the heart are not cardiac stem cells

    PubMed Central

    Sultana, Nishat; Zhang, Lu; Yan, Jianyun; Chen, Jiqiu; Cai, Weibin; Razzaque, Shegufta; Jeong, Dongtak; Sheng, Wei; Bu, Lei; Xu, Mingjiang; Huang, Guo-Ying; Hajjar, Roger J.; Zhou, Bin; Moon, Anne; Cai, Chen-Leng

    2015-01-01

    Identifying a bona fide population of cardiac stem cells (CSCs) is a critical step for developing cell-based therapies for heart failure patients. Previously, cardiac c-kit+ cells were reported to be CSCs with a potential to become myocardial, endothelial and smooth muscle cells in vitro and after cardiac injury. Here we provide further insights into the nature of cardiac c-kit+ cells. By targeting the c-kit locus with multiple reporter genes in mice, we find that c-kit expression rarely co-localizes with the expression of the cardiac progenitor and myogenic marker Nkx2.5, or that of the myocardial marker, cardiac troponin T (cTnT). Instead, c-kit predominantly labels a cardiac endothelial cell population in developing and adult hearts. After acute cardiac injury, c-kit+ cells retain their endothelial identity and do not become myogenic progenitors or cardiomyocytes. Thus, our work strongly suggests that c-kit+ cells in the murine heart are endothelial cells and not CSCs. PMID:26515110

  20. Stem cell factor (SCF) protects osteoblasts from oxidative stress through activating c-Kit-Akt signaling

    SciTech Connect

    Yang, Lei; Wu, Zhong; Yin, Gang; Liu, Haifeng; Guan, Xiaojun; Zhao, Xiaoqiang; Wang, Jianguang; Zhu, Jianguo

    2014-12-12

    Highlights: • SCF receptor c-Kit is functionally expressed in primary and transformed osteoblasts. • SCF protects primary and transformed osteoblasts from H{sub 2}O{sub 2}. • SCF activation of c-Kit in osteoblasts, required for its cyto-protective effects. • c-Kit mediates SCF-induced Akt activation in cultured osteoblasts. • Akt activation is required for SCF-regulated cyto-protective effects in osteoblasts. - Abstract: Osteoblasts regulate bone formation and remodeling, and are main target cells of oxidative stress in the progression of osteonecrosis. The stem cell factor (SCF)-c-Kit pathway plays important roles in the proliferation, differentiation and survival in a range of cell types, but little is known about its functions in osteoblasts. In this study, we found that c-Kit is functionally expressed in both osteoblastic-like MC3T3-E1 cells and primary murine osteoblasts. Its ligand SCF exerted significant cyto-protective effects against hydrogen peroxide (H{sub 2}O{sub 2}). SCF activated its receptor c-Kit in osteoblasts, which was required for its cyto-protective effects against H{sub 2}O{sub 2}. Pharmacological inhibition (by Imatinib and Dasatinib) or shRNA-mediated knockdown of c-Kit thus inhibited SCF-mediated osteoblast protection. Further investigations showed that protection by SCF against H{sub 2}O{sub 2} was mediated via activation of c-Kit-dependent Akt pathway. Inhibition of Akt activation, through pharmacological or genetic means, suppressed SCF-mediated anti-H{sub 2}O{sub 2} activity in osteoblasts. In summary, we have identified a new SCF-c-Kit-Akt physiologic pathway that protects osteoblasts from H{sub 2}O{sub 2}-induced damages, and might minimize the risk of osteonecrosis caused by oxidative stress.

  1. Normal peripheral prostate stromal cells stimulate prostate cancer development: roles of c-kit signal

    PubMed Central

    Guo, Jian-Hua; Zhou, Juan; Zhao, Yang; Liu, Peng-Yue; Yao, Hai-Jun; Da, Jun; Zhang, Ming; Zhou, Zhe; Chen, Qi; Peng, Yu-Bing; Wang, Zhong

    2015-01-01

    Background: To investigated the peripheral stromal cell conditioned medium (CM) -stimulated c-kit-JAK2-STAT1 pathway in prostate cancer. Methods: CM harvested from normal prostate peripheral stromal cells was added to DU145 cells. DU145 cell viability and migration were measured by cell counting kit-8 reagent and Transwell analysis respectively. Colony and sphere formation efficiencies of DU145 cells co-cultured with CM from human prostate stromal cells were also measured. DU145cells were stably transfected with lentivirus-mediated shRNA for c-kit silencing. Results: C-kit expression in prostate cancer was found to be significantly higher than in benign prostatic hyperplasia and positively associated with Gleason scores. The growth, migration and capacity of clonogenic property of DU145 cells significantly increased upon exposure to peripheral stromal CM and then were inhibited after silencing the expression of c-kit. The levels of c-kit, pJAK2 and pSTAT1 were significantly induced by peripheral zone stromal CM compared with controls in serum free medium and the levels of pJAK2 and pSTAT1 decreased after c-kit silencing. Conclusions: C-kit hyper-expression promotes the development of prostate cancer. The peripheral stromal cell CM stimulated c-kit-JAK2-STAT1 pathway in prostate cancer cell viability, migration, and capacity of clonogenic property. This may lead to a greater understanding of the role of c-kit in prostate cancer and provide a potential therapeutic target for prostate cancer. PMID:26045890

  2. A New Method to Stabilize C-Kit Expression in Reparative Cardiac Mesenchymal Cells

    PubMed Central

    Wysoczynski, Marcin; Dassanayaka, Sujith; Zafir, Ayesha; Ghafghazi, Shahab; Long, Bethany W.; Noble, Camille; DeMartino, Angelica M.; Brittian, Kenneth R.; Bolli, Roberto; Jones, Steven P.

    2016-01-01

    Cell therapy improves cardiac function. Few cells have been investigated more extensively or consistently shown to be more effective than c-kit sorted cells; however, c-kit expression is easily lost during passage. Here, our primary goal was to develop an improved method to isolate c-kitpos cells and maintain c-kit expression after passaging. Cardiac mesenchymal cells (CMCs) from wild-type mice were selected by polystyrene adherence properties. CMCs adhering within the first hours are referred to as rapidly adherent (RA); CMCs adhering subsequently are dubbed slowly adherent (SA). Both RA and SA CMCs were c-kit sorted. SA CMCs maintained significantly higher c-kit expression than RA cells; SA CMCs also had higher expression endothelial markers. We subsequently tested the relative efficacy of SA vs. RA CMCs in the setting of post-infarct adoptive transfer. Two days after coronary occlusion, vehicle, RA CMCs, or SA CMCs were delivered percutaneously with echocardiographic guidance. SA CMCs, but not RA CMCs, significantly improved cardiac function compared to vehicle treatment. Although the mechanism remains to be elucidated, the more pronounced endothelial phenotype of the SA CMCs coupled with the finding of increased vascular density suggest a potential pro-vasculogenic action. This new method of isolating CMCs better preserves c-kit expression during passage. SA CMCs, but not RA CMCs, were effective in reducing cardiac dysfunction. Although c-kit expression was maintained, it is unclear whether maintenance of c-kit expression per se was responsible for improved function, or whether the differential adherence property itself confers a reparative phenotype independently of c-kit. PMID:27536657

  3. Mutation of the proto-oncogene c-kit blocks development of interstitial cells and electrical rhythmicity in murine intestine.

    PubMed Central

    Ward, S M; Burns, A J; Torihashi, S; Sanders, K M

    1994-01-01

    1. Interstitial cells of Cajal (ICs) have been proposed as pacemakers in the gastrointestinal tract. We studied the characteristics and distribution of ICs and electrical activity of small intestinal muscles from mice with mutations at the dominant-white spotting/c-kit (W) locus because the tyrosine kinase function of c-kit may be important in the development of the IC network. 2. W/WV mutants (days 3-30 postpartum) had few ICs in the myenteric plexus region compared with wild type (+/+) siblings. The few ICs present were associated with neural elements and lay between myenteric ganglia and the longitudinal muscle layer. 3. Electrical recordings from intestinal muscle strips showed that electrical slow waves were always present in muscles of +/+ siblings, but were absent in W/WV mice. 4. Muscles from W/WV mice responded to stimulation of intrinsic nerves. Neural responses, attributed to the release of acetylcholine, nitric oxide and other unidentified transmitters, were recorded. 5. These findings are consistent with the hypothesis that ICs are a critical element in the generation of electrical rhythmicity in intestinal muscles. The data also show that neural regulation of gastrointestinal muscles can develop independently of the IC network. 6. W locus mutants provide a powerful new model for studies of the physiological role of ICs and the significance of electrical rhythmicity to normal gastrointestinal motility. Images Figure 1 Figure 2 PMID:7853230

  4. Analysis of c-KIT exon 11 mutations in canine gastrointestinal stromal tumours.

    PubMed

    Takanosu, M; Amano, S; Kagawa, Y

    2016-01-01

    The aim of this study was to determine the type and frequency of c-KIT exon 11 mutations in canine gastrointestinal stromal tumours (GISTs) and investigate the association between the c-KIT mutation status and KIT immunohistochemical staining pattern. Mutations in exon 11 of c-KIT were examined in 46 formalin-fixed paraffin-embedded canine GISTs using PCR of genomic DNA and reverse transcription-PCR (RT-PCR) of cDNA. Exon 11 c-KIT mutations were detected in 15/46 (32.6%) cases by conventional PCR and 34/46 (73.9%) cases by RT-PCR; the mutation detection rate was significantly higher for RT-PCR (P = 0.004, Fisher's exact test). Ten different mutations, including deletion, internal tandem duplication and point mutations, were identified by RT-PCR. Immunohistochemistry was performed using an anti-KIT antibody; diffuse KIT staining was detected in the tumour cell cytoplasm in 32/46 (69.6%) cases and partial or stippled cytoplasmic staining of KIT was observed in 14/46 (30.4%) cases. Neither pattern was significantly associated with c-KIT exon 11 mutation status (P = 1.000, chi-square test). These data indicate that c-KIT exon 11 mutations occur frequently in canine GISTs, similar to human GISTs; however, there is no association between c-KIT mutations and the KIT expression pattern in canine GISTs. This study suggests that RT-PCR is more sensitive than conventional PCR for the detection of c-KIT mutations in canine GISTs. PMID:26631948

  5. Quantitative immunohistochemical expression of c Kit in breast carcinomas is predictive of patients' outcome

    PubMed Central

    Charpin, C; Giusiano, S; Charfi, S; Secq, V; Carpentier, S; Andrac, L; Lavaut, M-N; Allasia, C; Bonnier, P; Garcia, S

    2009-01-01

    Background: c Kit (CD117) expression in tissues has been reported as a relevant target for specific therapy in some human malignancies, but has been poorly documented in breast carcinomas Methods: The prognostic significance of c Kit in a series of 924 breast carcinomas (mean follow-up, 79 months) was investigated using standardised high-throughput quantitative densitometry of immunohistochemical precipitates in tissue microarrays. Results: c Kit was expressed in 14.7% breast carcinomas (and in 42 out of 586 node-negative tumours). In univariate analysis, (log-rank test) the score of c Kit expression correlated with poor patient outcome P=0.02 and particularly in node-negative cases (P=0.002). In multivariate Cox analysis, c Kit was an indicator of metastasis independent of 25 other concomitantly evaluated markers of prognosis. Logistic regression showed that c Kit ranked 10 out of 25 (P=0.041), and was included in a 10-marker signature that allowed 79.2% of the patients to be correctly classified in the metastatic or metastasis-free categories independently of hormone receptors and HER-2 status. Interestingly, c Kit was also a significant predictor of metastasis in node-negative tumours (2 out of 25 ranking, P<0.0001) and included in a six-marker signature of prognosis, correctly classifying 88.6% of the patients (P<0.0001). Conclusion: We concluded that, as assessed by quantitative immunohistochemistry, c Kit is an independent prognostic indicator that could also potentially serve as a target for specific therapy in breast carcinomas. PMID:19513067

  6. Antileukemic Activity of 2-Deoxy-d-Glucose through Inhibition of N-Linked Glycosylation in Acute Myeloid Leukemia with FLT3-ITD or c-KIT Mutations.

    PubMed

    Larrue, Clément; Saland, Estelle; Vergez, François; Serhan, Nizar; Delabesse, Eric; Mansat-De Mas, Véronique; Hospital, Marie-Anne; Tamburini, Jérôme; Manenti, Stéphane; Sarry, Jean Emmanuel; Récher, Christian

    2015-10-01

    We assessed the antileukemic activity of 2-deoxy-d-glucose (2-DG) through the modulation of expression of receptor tyrosine kinases (RTK) commonly mutated in acute myeloid leukemia (AML). We used human leukemic cell lines cells, both in vitro and in vivo, as well as leukemic samples from AML patients to demonstrate the role of 2-DG in tumor cell growth inhibition. 2-DG, through N-linked glycosylation inhibition, affected the cell-surface expression and cellular signaling of both FTL3-ITD and mutated c-KIT and induced apoptotic cell death. Leukemic cells harboring these mutated RTKs (MV4-11, MOLM-14, Kasumi-1, and TF-1 c-KIT D816V) were the most sensitive to 2-DG treatment in vitro as compared with nonmutated cells. 2-DG activity was also demonstrated in leukemic cells harboring FLT3-TKD mutations resistant to the tyrosine kinase inhibitor (TKI) quizartinib. Moreover, the antileukemic activity of 2-DG was particularly marked in c-KIT-mutated cell lines and cell samples from core binding factor-AML patients. In these cells, 2-DG inhibited the cell-surface expression of c-KIT, abrogated STAT3 and MAPK-ERK pathways, and strongly downregulated the expression of the receptor resulting in a strong in vivo effect in NOD/SCID mice xenografted with Kasumi-1 cells. Finally, we showed that 2-DG decreases Mcl-1 protein expression in AML cells and induces sensitization to both the BH3 mimetic inhibitor of Bcl-xL, Bcl-2 and Bcl-w, ABT-737, and cytarabine. In conclusion, 2-DG displays a significant antileukemic activity in AML with FLT3-ITD or KIT mutations, opening a new therapeutic window in a subset of AML with mutated RTKs. PMID:26206337

  7. C-kit induces epithelial-mesenchymal transition and contributes to salivary adenoid cystic cancer progression

    PubMed Central

    Li, Kai-de; Zheng, Min; Chen, Wei; Ma, Xiang-rui; Geng, Ning; Chen, Qian-ming; Chen, Yu; Liang, Xin-hua

    2014-01-01

    Epithelial–mesenchymal transition (EMT) is associated with salivary adenoid cystic cancer (ACC) progression and metastasis. Here, we report that ectopic overexpression of c-kit in ACC cell lines is sufficient for acquisition of mesenchymal traits, enhanced cell invasion, along with stem cell properties defined by the presence of a CD133 + /CD44 + cell subpopulation. c-kit positively regulated expression of known EMT inducers, also activating TGF-β to contribute to EMT. c-kit itself was induced by TGF-β in ACC cell lines and required for TGF-β–induced EMT. Xenograft experiments showed that c-kit cooperated with oncogenic Ras to promote tumorigenesis in vivo. Finally, in human specimens of ACC, we found that c-kit was abnormally overexpressed and correlated with the prognosis of ACC. Our findings define an important function for c-kit in ACC progression by orchestrating EMT, and they implicate this gene product as a marker of poor prognosis in this disease. PMID:24721839

  8. Tracheal Smooth Muscle Cells Stimulated by Stem Cell Factor-c-Kit Coordinate the Production of Transforming Growth Factor-β1 and Fibroblast Growth Factor-2 Mediated by Chemokine (C-C Motif) Ligand 3.

    PubMed

    Oliveira, Luis Cezar Farias de; Danilucci, Taís Marolato; Chaves-Neto, Antonio Hernandes; Campanelli, Ana Paula; Silva, Tereza Cristina Cardoso da; Oliveira, Sandra Helena Penha

    2016-06-01

    The aim of this study was to evaluate the mechanism involved in the stem cell factor (SCF)-induced production of fibroblast growth factor-2 (FGF-2), transforming growth factor-β1 (TGF-β1), and chemokine (C-C motif) ligand 3 (CCL3) in tracheal smooth muscle cells (tSMCs) and the signaling pathway involved in the process. tSMC primary cultures were stimulated with SCF and evaluated at 24 h. Cells treated with specific antibodies did not show any immunolabeling for cytokeratin or fibroblast activation protein, but were positive for α-smooth muscle actin, indicating the purity of the primary cell line. Western blot analysis showed constitutive phosphorylation of c-Kit, as well as increased total protein and phosphorylated c-Kit levels in tSMCs after SCF stimulation. Flow cytometry analysis also showed an increase in cell-surface c-Kit expression in the presence of SCF. SCF induced TGF-β mRNA expression in tSMCs, as well as the production of TGF-β1, CCL3, and FGF-2. Pretreatment with anti-CCL3 antibody blocked TGF-β1 expression and partially inhibited FGF-2 production. On the other hand, anti-c-Kit antibody blocked TGF-β1 expression and FGF-2 production. Thus, TGF-β1 and FGF-2 production were mediated by CCL3 production through c-Kit. Pretreatment with mitogen-activated protein kinase kinase 1, p38, and Jun N-terminal kinase inhibitors showed that the effects mediated by SCF were involved with the modulation of mitogen-activated protein kinase (MAPK) pathways. Development of inhibitors targeting CCL3 through MAPK activation could thus be an attractive strategy to inhibit tSMC activation during asthma. PMID:27123814

  9. Esculetin Downregulates the Expression of AML1-ETO and C-Kit in Kasumi-1 Cell Line by Decreasing Half-Life of mRNA

    PubMed Central

    Sawney, Sharad; Arora, Rashi; Aggarwal, Kamal K.; Saluja, Daman

    2015-01-01

    One of the most frequent genetic aberrations in acute myeloid leukemia (AML) is chromosomal translocation between AML1/RUNX1 on chromosome 21 and ETO gene on chromosome 8 resulting in the expression of chimeric oncogene AML1-ETO. Although patients with t(8;21) translocation have good prognosis, 5-year survival is observed only in 50% of the cases. AML1-ETO translocation is usually accompanied by overexpression of mutant C-Kit, a tyrosine kinase, which contributes to uncontrolled proliferation of premature blood cells leading to relapse and poor prognosis. We illustrate the potential use of esculetin on leukemic cell line, Kasumi-1, bearing t(8;21) translocation and mutated C-Kit gene. Esculetin decreases the expression of AML1-ETO at both protein and transcript level within 24 hours of treatment. Half-life of AML1-ETO mRNA was reduced from 7 hours to 1.5 hours. Similarly half-life of C-Kit mRNA was reduced to 2 hours from 5 hours in esculetin treated cells. Esculetin also perturbed the expression of ectopically expressed AML1-ETO in U937 cells. The decreased expression of AML1-ETO chimeric gene was associated with increased expression of LAT1 and RUNX3 genes, targets of AML1. We envisage that discovery of a drug candidate which could target both these mutated genes would be a considerable breakthrough for future application. PMID:25861270

  10. [Drug-induced anomalous contraction of gastrointestinal tract of mice with impaired c-kit function].

    PubMed

    Tokutomi, Naofumi; Tokutomi, Yoshiko; Nishi, Katsuhide

    2004-03-01

    Drug-induced contraction of gastrointestinal tracts seems to depend upon the extent of their rhythmic contraction that is driven by the activity of gastrointestinal pacemaker cells. In BALB/c mice chronically administrated with a neutralizing anti-c-Kit monoclonal antibody (ACK2), rhythmic contraction of the gastrointestinal tract was impaired and contractile responses to drugs, including acetylcholine, prostaglandin F(2alpha), and bradykinin, were anomalously augmented. Histochemical analysis of the c-kit-positive cells in the gastrointestinal tract revealed the decreased number of c-kit-positive cells in the ACK2-treated animals, which lead to the impaired rhythmic contraction. Since the intestinal c-kit-positive cells in primary culture developed Ca(2+)-dependent rhythmic Cl(-) current, the rhythmic current is supposed to be an origin of gastrointestinal pacemakers. The extent of anomaly in drug-induced contraction correlated with the extent of impairment in rhythmic contraction. The drug-induced anomalous contraction in the preparation from ACK2-treated animals, which is accompanied by the impaired rhythmic contraction, was mimicked when the gastrointestinal segments from control animals were superfused with a low temperature organ bath solution at 25 degrees C. These results suggest that rhythmic discharge of excitation of smooth muscle cells, which is triggered by rhythmic excitatory input from c-kit cells, regulates the extent of drug-induced contraction. PMID:14993728

  11. Inhibition of c-Kit signaling by diosmetin isolated from Chrysanthemum morifolium.

    PubMed

    Lee, Seong Jin; Jung, Tae-Hoon; Kim, Hojeong; Jeong, Daeyoung; Choi, Gildon; Park, Woo-Kyu; Kong, Jae Yang; Jin, Mu-Hyun; Cho, Heeyeong

    2014-02-01

    The interaction of stem cell factor (SCF) with its cognate receptor c-Kit is closely associated with the survival and maturation of melanocytes. To investigate novel depigmentation agents, we screened 2,000 plant extracts for c-Kit inhibitors to identify active small molecules by using time-resolved fluorescence enzyme assays. For the active extracts identified as inhibitors of c-Kit enzyme, we evaluated the effects of the active extracts and isolated flavonoids on c-Kit phosphorylation in MO7e/melanocytes. Anti-melanogenic activity was also examined in melanocytes and melanoderm model. The flavonoids such as diosmetin, apigenin, acacetin and luteolin isolated from Chrysanthemum morifolium were found to be active in inhibiting c-Kit both at enzyme and cellular levels. In addition, these flavonoids attenuated SCF-induced proliferation of human primary melanocytes without toxicity and suppressed ultraviolet (UV) B irradiation-mediated melanin synthesis significantly. Among the active flavonoids, diosmetin was found to inhibit SCF-induced melanogenesis in a human melanoderm model. These results strongly suggest that C. morifolium extract and diosmetin have potential to suppress SCF-/UVB-induced melanogenesis, and could be developed as anti-pigmentation agents. PMID:23709168

  12. Synthesis and Evaluation of Quinazolone Derivatives as a New Class of c-KIT G-Quadruplex Binding Ligands.

    PubMed

    Wang, Xiaoxiao; Zhou, Chen-Xi; Yan, Jin-Wu; Hou, Jin-Qiang; Chen, Shuo-Bin; Ou, Tian-Miao; Gu, Lian-Quan; Huang, Zhi-Shu; Tan, Jia-Heng

    2013-10-10

    The c-KIT G-quadruplex structures are a novel class of attractive targets for the treatment of gastrointestinal stromal tumor (GIST). Herein, a series of new quinazolone derivatives with the expansion of unfused aromatic ring system were designed and synthesized. Subsequent biophysical studies demonstrated that the derivatives with adaptive scaffold could effectively bind to and stabilize c-KIT G-quadruplexes with good selectivity against duplex DNA. More importantly, these ligands further inhibited the transcription and expression of c-KIT gene and exhibited significant cytotoxicity on the GIST cell line HGC-27. Overall, these quinazolone derivatives represent a new class of promising c-KIT G-quadruplex ligands. The experimental results have also reinforced the idea of inhibition of c-KIT expression through targeting c-KIT G-quadruplex DNA. PMID:24900584

  13. C-kit overexpression correlates with KIT gene copy numbers increases in phyllodes tumors of the breast.

    PubMed

    Liu, Junjun; Liu, Xiaozhen; Feng, Xiaolong; Liu, Jian; Lv, Shuhua; Zhang, Wei; Niu, Yun

    2015-01-01

    We determined c-kit expression in the stroma and epithelia of benign, borderline, and malignant phyllodes tumors (PTs), respectively, as well as the relationship between c-kit expression in stromal elements and KIT gene copy number variations (CNVs). To assess c-kit expression and KIT CNVs, 348 PT cases were studied: 120 (34.4 %) benign cases, 115 (33.1 %) borderline cases, and 113 (32.5 %) malignant cases. All of these cases were evaluated for c-kit (CD117) expression using immunohistochemistry. Forty-two cases (29 c-kit-positive in the stromal cells cases and 13 negative cases) were investigated for KIT gene CNVs via genomic polymerase chain reaction (PCR). The overall rate of c-kit positivity in the stroma was 46.8 %, as well as 24.2, 53.1, and 64.6 %, respectively, in PTs of three different grades. However, in the majority of cases, the epithelia were c-kit positive (98.2 %), and the positivity was 100, 99.1, and 95 % in PTs of three different grades, respectively. There was a significant change in the expression of c-kit in the stroma and epithelia according to grade (P < 0.001, P = 0.014). From the genomic PCR results, we can confirm that c-kit positivity in the stroma is directly correlated with KIT gene copy numbers increases (P = 0.003, P = 0.041). We demonstrated that c-kit expression in the stroma of PTs is positively associated with malignancy. c-Kit epithelial positivity was inversely correlated with PTs malignancy. c-Kit overexpression in the stroma was related to KIT gene copy numbers increases. PMID:25534827

  14. Restoration of spermatogenesis after transplantation of c-Kit positive testicular cells in the fowl

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transplantation of male germ line cells into sterilized recipients has been used in mammals for conventional breeding as well as for transgenesis. This study presents an improvement in the approach for germ cell transplantation between fowl males by using an enriched subpopulation of c-Kit positive ...

  15. Analysis of mutation of the c-Kit gene and PDGFRA in gastrointestinal stromal tumors

    PubMed Central

    XU, CHUN-WEI; LIN, SHAN; WANG, WU-LONG; GAO, WEN-BIN; LV, JIN-YAN; GAO, JING-SHAN; ZHANG, LI-YING; LI, YANG; WANG, LIN; ZHANG, YU-PING; TIAN, YU-WANG

    2015-01-01

    The aim of the present study was to investigate mutation status of the c-Kit gene (KIT) and PDGFRA in patients with a gastrointestinal stromal tumor (GIST). In total, 93 patients with a GIST were included in the study, in which polymerase chain reaction amplification and gene sequencing were used to detect the sequences of exons 9, 11, 13 and 17 in KIT and exons 12 and 18 in PDGFRA. KIT mutations were detected in 64 cases (68.82%), of which exon 11 mutations were detected in 56 cases (60.22%), exon 13 mutations were detected in three cases (3.23%) and one case (1.08%) was shown to have a mutation in exon 17. The most common mutation in exon 11 was a deletion, which accounted for 55.36% (31/56) of the cases, followed by a point mutation observed in 26.79% (15/56) of the cases, while an insertion (tandem repeats) was identified in 14.29% (8/56) of the cases, and 3.57% (2/56) of the exon 11 mutations were deletions associated with a point mutation. The majority of the mutations were heterozygous, with only a few homozygous mutations. Mutational analysis revealed the mutations to be more concentrated in the classic hot zone at the 5′-end, followed by the tandem repeat frame at the 3′-end. In four cases, a mutation was detected in exon 18 of PDGFRA, of which one was associated with a mutation in KIT. The remaining three cases (10.34%, 3/29) were not associated with mutations in KIT and accounted for 37.5% (3/8) of the CD117-negative GIST cases. Therefore, the majority of the GIST cases were characterized by mutations in KIT or PDGFRA, which were directly associated with the disease. Pairs of different mutations in the same exon of KIT, or KIT mutations coupled with pairs of mutations in PDGFRA, were detected in a small number of patients. Imatinib is a small molecule tyrosine kinase inhibitor and is the first line targeted treatment for GIST, resulting in markedly improved survival rates. Thus, gene mutation genotyping may provide inspiration and guidance for

  16. Core binding factor acute myeloid leukaemia and c-KIT mutations.

    PubMed

    Riera, Ludovica; Marmont, Filippo; Toppino, Daniela; Frairia, Chiara; Sismondi, Francesca; Audisio, Ernesta; Di Bello, Cristiana; D'Ardia, Stefano; Di Celle, Paola Francia; Messa, Emanuela; Inghirami, Giorgio; Vitolo, Umberto; Pich, Achille

    2013-05-01

    Core binding factor (CBF) acute myeloid leukaemia (AML) represents 5-8% of all AMLs and has a relatively favourable prognosis. However, activating c-KIT mutations are reported to be associated with higher risk of relapse and shorter survival. To verify the incidence and prognostic value of c-KIT mutations in CBF AML, we retrospectively analysed bone marrow samples of 23 consecutive adult patients with de novo CBF AML [14 inv(16) and 9 t(8;21)] treated at a single institution from 2000 to 2011. All patients received standard induction chemotherapy with cytarabine, idarubicin and etoposide; 13 underwent allogeneic stem cell transplantation. c-KIT mutations in exons 8, 9, 10, 11, 13, 14 and 17 were assessed by PCR amplification in combination with direct sequencing. c-KIT mutations (3 in exon 10 and 4 in exon 17) were detected in 7/23 (30.4%) patients, 3 with t(8;21) and 4 with inv(16). No difference in c-KIT mutation status was observed between cases with inv(16) or t(8;21) alone and cases with additional cytogenetic abnormalities. No association between gender, age, white blood cell and platelet count, peripheral blood and bone marrow blast cells at diagnosis, achievement of complete remission, cytogenetic risk groups and Wilms tumour gene 1 (WT1) levels was found. On the contrary, lactate dehydrogenase (LDH) values were higher in mutated than in non-mutated patients (p=0.01). Overall survival (OS) rates were longer in CBF compared to the other types of AML and disease-free survival (DFS) was longer in inv(16) than in t(8;21) AML. OS and DFS were similar in mutated and non-mutated CBF AML patients. Our results confirm a better prognosis for CBF AML than all other AML categories, and for inv(16) than t(8;21) AML. However, no prognostic value for c-KIT mutational status was found in our series. The association between LDH levels and c-KIT mutation would indicate a more active proliferation for mutated CBF AML. PMID:23467883

  17. Functional TRPV2 and TRPV4 channels in human cardiac c-kit(+) progenitor cells.

    PubMed

    Che, Hui; Xiao, Guo-Sheng; Sun, Hai-Ying; Wang, Yan; Li, Gui-Rong

    2016-06-01

    The cellular physiology and biology of human cardiac c-kit(+) progenitor cells has not been extensively characterized and remains an area of active research. This study investigates the functional expression of transient receptor potential vanilloid (TRPV) and possible roles for this ion channel in regulating proliferation and migration of human cardiac c-kit(+) progenitor cells. We found that genes coding for TRPV2 and TRPV4 channels and their proteins are significantly expressed in human c-kit(+) cardiac stem cells. Probenecid, an activator of TRPV2, induced an increase in intracellular Ca(2+) (Ca(2+) i ), an effect that may be attenuated or abolished by the TRPV2 blocker ruthenium red. The TRPV4 channel activator 4α-phorbol 12-13-dicaprinate induced Ca(2+) i oscillations, which can be inhibited by the TRPV4 blocker RN-1734. The alteration of Ca(2+) i by probenecid or 4α-phorbol 12-13-dicprinate was dramatically inhibited in cells infected with TRPV2 short hairpin RNA (shRNA) or TRPV4 shRNA. Silencing TRPV2, but not TRPV4, significantly reduced cell proliferation by arresting cells at the G0/G1 boundary of the cell cycle. Cell migration was reduced by silencing TRPV2 or TRPV4. Western blot revealed that silencing TRPV2 decreased expression of cyclin D1, cyclin E, pERK1/2 and pAkt, whereas silencing TRPV4 only reduced pAkt expression. Our results demonstrate for the first time that functional TRPV2 and TRPV4 channels are abundantly expressed in human cardiac c-kit(+) progenitor cells. TRPV2 channels, but not TRPV4 channels, participate in regulating cell cycle progression; moreover, both TRPV2 and TRPV4 are involved in migration of human cardiac c-kit(+) progenitor cells. PMID:26865051

  18. Decreased expression of c-kit and telomerase in a rat model of chronic endometrial ischemia

    PubMed Central

    Hu, JianGuo; Yuan, Rui

    2011-01-01

    Summary Background It was unclear whether chronic endometrial ischemia contributed to the pathogenesis of thin endometrium and was associated with decreased endometrial stem/progenitor cell. Thus, we explored the role of chronic endometrial ischemia in the pathogenesis of thin endometrium and its effect on endometrial stem/progenitor cells apoptosis. Material/Methods In vitro, endometrial side population (ESP) cell apoptosis models were built, and apoptosis was quantified by fluorescence-activated cell sorter (FACS) analysis, pou5f1, and c-kit mRNA was detected by qPCR. In vivo, a rat model of chronic endometrial ischemia was induced by performing bilateral uterine artery ligation. TERT and caspase3 were detected by immunohistochemistry. Pou5f1 and c-kit mRNA was examined by qPCR. C-kit, caspase3 and telomerase were detected by Western blot. Results In the in vitro endometrial SP (ESP) cells apoptosis model, we found that the apoptotic rate was gradually increased with time, prolonging the expression of TERT, and c-kit mRNA was gradually decreased. In the in vivo endometrial SP (ESP) cells apoptosis model, we found that endometrial thickness, luminal epithelium thickness, gland epithelium thickness and the number of glands in the experiment group were significantly decreased compared with those in the control group (P<0.05). The expression levels of c-kit, pou5f1 and telomerase was significantly lower in the experimental group than those in the control group (P<0.05). The expression level of caspase3 was significantly higher in the experimental group compared with that in the control group (P<0.05). Conclusions The present work shows that chronic ischemia and chronic endometrial ischemia-associated stem/progenitor cells apoptosis may be responsible for the pathogenesis of thin endometrium. PMID:21455098

  19. Silencing c-Kit expression in human DCs suppresses Th2, Th17 response but enhances Th1 response

    PubMed Central

    Yang, Bin; Yang, Qin; Huang, Qianchuan; Yan, Hongbo; Sun, Ting; Tong, Hui

    2015-01-01

    Dendritic cells (DCs) are integral to the differentiation of T helper cells into T helper type 1 TH1, TH2 and TH17 subsets. RNA interference (RNAi), which causes the degradation of any RNA in a sequence specific manner, is a posttranscriptional gene silencing mechanism. Targeting the c-Kit in DCs has been used as an approach to enhance antitumor immunity. Here, we shwed that transfection of DCs with siRNA specific for c-Kit gene can significantly knock down c-Kit. When exposed to TNF-α, immature DCs transfected with c-Kit siRNA can differentiate into mature DCs without reducing viability or IL-12p70 production. The c-Kit siRNA-treated DCs exhibited an increased allostimulatory capacity in a lymphocyte proliferation assay. Furthermore, c-Kit siRNA-transfected DCs enhanced TH1 responses by increasing IFN-γ and decreasing IL-4 production, and much stronger cytotoxic activity was observed when DCs were co-transfected with c-Kit siRNA and an endogenous tumor antigen in vitro. Our findings indicate that silencing the c-Kit gene in DCs with siRNA may offer a potential approach to enhance antitumor immunotherapy. PMID:26550451

  20. c-KIT receptor expression is strictly associated with the biological behaviour of thyroid nodules

    PubMed Central

    2012-01-01

    Background A large amount of information has been collected on the molecular tumorigenesis of thyroid cancer. A low expression of c-KIT gene has been reported during the transformation of normal thyroid epithelium to papillary carcinoma suggesting a possible role of the gene in the differentiation of thyroid tissue rather than in the proliferation. The initial presentation of thyroid carcinoma is through a nodule and the best way nowadays to evaluate it is by fine-needle aspiration (FNA). However many thyroid FNAs are not definitively benign or malignant, yielding an indeterminate or suspicious diagnosis which ranges from 10 to 25% of FNAs. BRAF mutational analysis is commonly used to assess the malignancy of thyroid nodules but unfortunately it still leaves indeterminate diagnoses. The development of molecular initial diagnostic tests for evaluating a thyroid nodule is needed in order to define optimal surgical approach for patients with uncertain diagnosis pre- and intra-operatively. Methods In this study we extracted RNA from 82 FNA smears, 46 malignant and 36 benign at the histology, in order to evaluate by quantitative Real Time PCR the expression levels of c-KIT gene. Results We have found a highly preferential decrease rather than increase in transcript of c-KIT in malignant thyroid lesions compared to the benign ones. To explore the diagnostic utility of c-KIT expression in thyroid nodules, its expression values were divided in four arbitrarily defined classes, with class I characterized by the complete silencing of the gene. Class I and IV represented the two most informative groups, with 100% of the samples found malignant or benign respectively. The molecular analysis was proven by ROC (receiver operating characteristic) analysis to be highly specific and sensitive improving the cytological diagnostic accuracy of 15%. Conclusion We propose the use of BRAF test (after uncertain cytological diagnosis) to assess the malignancy of thyroid nodules at first

  1. Mast Cell-Deficient W-sash c-kit Mutant KitW-sh/W-sh Mice as a Model for Investigating Mast Cell Biology in Vivo

    PubMed Central

    Grimbaldeston, Michele A.; Chen, Ching-Cheng; Piliponsky, Adrian M.; Tsai, Mindy; Tam, See-Ying; Galli, Stephen J.

    2005-01-01

    Mice carrying certain mutations in the white spotting (W) locus (ie, c-kit) exhibit reduced c-kit tyrosine kinase-dependent signaling that results in mast cell deficiency and other phenotypic abnormalities. The c-kit mutations in KitW/W-v mice impair melanogenesis and result in anemia, sterility, and markedly reduced levels of tissue mast cells. In contrast, KitW-sh/W-sh mice, bearing the W-sash (Wsh) inversion mutation, have mast cell deficiency but lack anemia and sterility. We report that adult KitW-sh/W-sh mice had a profound deficiency in mast cells in all tissues examined but normal levels of major classes of other differentiated hematopoietic and lymphoid cells. Unlike KitW/W-v mice, KitW-sh/W-sh mice had normal numbers of TCRγδ intraepithelial lymphocytes in the intestines and did not exhibit a high incidence of idiopathic dermatitis, ulcers, or squamous papillomas of the stomach, but like KitW/W-v mice, they lacked interstitial cells of Cajal in the gut and exhibited bile reflux into the stomach. Systemic or local reconstitution of mast cell populations was achieved in nonirradiated adult KitW-sh/W-sh mice by intravenous, intraperitoneal, or intradermal injection of wild-type bone marrow-derived cultured mast cells but not by transplantation of wild-type bone marrow cells. Thus, KitW-sh/W-sh mice represent a useful model for mast cell research, especially for analyzing mast cell function in vivo. PMID:16127161

  2. Mast cell-deficient W-sash c-kit mutant Kit W-sh/W-sh mice as a model for investigating mast cell biology in vivo.

    PubMed

    Grimbaldeston, Michele A; Chen, Ching-Cheng; Piliponsky, Adrian M; Tsai, Mindy; Tam, See-Ying; Galli, Stephen J

    2005-09-01

    Mice carrying certain mutations in the white spotting (W) locus (ie, c-kit) exhibit reduced c-kit tyrosine kinase-dependent signaling that results in mast cell deficiency and other phenotypic abnormalities. The c-kit mutations in Kit(W/W-v) mice impair melanogenesis and result in anemia, sterility, and markedly reduced levels of tissue mast cells. In contrast, Kit(W-sh/W-sh) mice, bearing the W-sash (W(sh)) inversion mutation, have mast cell deficiency but lack anemia and sterility. We report that adult Kit(W-sh/W-sh) mice had a profound deficiency in mast cells in all tissues examined but normal levels of major classes of other differentiated hematopoietic and lymphoid cells. Unlike Kit(W/W-v) mice, Kit(W-sh/W-sh) mice had normal numbers of TCR gammadelta intraepithelial lymphocytes in the intestines and did not exhibit a high incidence of idiopathic dermatitis, ulcers, or squamous papillomas of the stomach, but like Kit(W/W-v) mice, they lacked interstitial cells of Cajal in the gut and exhibited bile reflux into the stomach. Systemic or local reconstitution of mast cell populations was achieved in nonirradiated adult Kit(W-sh/W-sh) mice by intravenous, intraperitoneal, or intradermal injection of wild-type bone marrow-derived cultured mast cells but not by transplantation of wild-type bone marrow cells. Thus, Kit(W-sh/W-sh) mice represent a useful model for mast cell research, especially for analyzing mast cell function in vivo. PMID:16127161

  3. Lnk-dependent axis of SCF–cKit signal for osteogenesis in bone fracture healing

    PubMed Central

    Matsumoto, Tomoyuki; Ii, Masaaki; Nishimura, Hiromi; Shoji, Taro; Mifune, Yutaka; Kawamoto, Atsuhiko; Kuroda, Ryosuke; Fukui, Tomoaki; Kawakami, Yohei; Kuroda, Tomoya; Kwon, Sang Mo; Iwasaki, Hiroto; Horii, Miki; Yokoyama, Ayumi; Oyamada, Akira; Lee, Sang Yang; Hayashi, Shinya; Kurosaka, Masahiro; Takaki, Satoshi

    2010-01-01

    The therapeutic potential of hematopoietic stem cells/endothelial progenitor cells (HSCs/EPCs) for fracture healing has been demonstrated with evidence for enhanced vasculogenesis/angiogenesis and osteogenesis at the site of fracture. The adaptor protein Lnk has recently been identified as an essential inhibitor of stem cell factor (SCF)–cKit signaling during stem cell self-renewal, and Lnk-deficient mice demonstrate enhanced hematopoietic reconstitution. In this study, we investigated whether the loss of Lnk signaling enhances the regenerative response during fracture healing. Radiological and histological examination showed accelerated fracture healing and remodeling in Lnk-deficient mice compared with wild-type mice. Molecular, physiological, and morphological approaches showed that vasculogenesis/angiogenesis and osteogenesis were promoted in Lnk-deficient mice by the mobilization and recruitment of HSCs/EPCs via activation of the SCF–cKit signaling pathway in the perifracture zone, which established a favorable environment for bone healing and remodeling. In addition, osteoblasts (OBs) from Lnk-deficient mice had a greater potential for terminal differentiation in response to SCF–cKit signaling in vitro. These findings suggest that inhibition of Lnk may have therapeutic potential by promoting an environment conducive to vasculogenesis/angiogenesis and osteogenesis and by facilitating OB terminal differentiation, leading to enhanced fracture healing. PMID:20855498

  4. c-kit(+) cells: the tell-tale heart of cardiac regeneration?

    PubMed

    Nigro, Patrizia; Perrucci, Gianluca Lorenzo; Gowran, Aoife; Zanobini, Marco; Capogrossi, Maurizio C; Pompilio, Giulio

    2015-05-01

    Cardiovascular disease is the leading cause of morbidity and mortality in the developed world. Although ongoing therapeutic strategies ameliorate symptoms and prolong life for patients with cardiovascular diseases, they do not solve the critical issue related to the loss of cardiac tissue. Accordingly, stem/progenitor cell therapy has emerged as a paramount approach for cardiac repair and regeneration. In this regard, c-kit(+) cells have animated much interest and controversy. These cells are self-renewing, clonogenic, and multipotent and display a noteworthy potential to differentiate into all cardiovascular lineages. However, their functional contribution to cardiomyocyte turnover is one of the centrally debated issues concerning their regenerative potential. Regardless, plentiful preclinical and clinical studies have been conducted which provide evidence for the capacity of c-kit(+) cells to improve cardiac function. The purpose of this review is to give a comprehensive, impartial, critical description and evaluation of the literature on c-kit(+) cells from bench to bedside in order to address their true potential, benefits and controversies. PMID:25575564

  5. Analysis of POU5F1, c-Kit, PLAP, AP2γ and SALL4 in gonocytes of patients with cryptorchidism.

    PubMed

    Vigueras-Villaseñor, Rosa María; Cortés-Trujillo, Lucero; Chávez-Saldaña, Margarita; Vázquez, Francisco García; Carrasco-Daza, Daniel; Cuevas-Alpuche, Osvaldo; Rojas-Castañeda, Julio César

    2015-10-01

    Cryptorchidism is a risk factor for the development of testicular germ cell tumors (TGCTs). The most common type of TGCT in cryptorchidism is seminoma. The intratubular germ cell neoplasia unclassified (ITGCNU) is a histological pattern preceding the development of seminomas and non-seminomas. It was suggested that in patients with cryptorchidism, the gonocytes remained undifferentiated with pluripotent abilities expressing proteins like POU domain class 5 transcription factor 1 (POU5F1), tyrosine kinase receptor c-Kit, placental-like alkaline phosphatase (PLAP), the transcription factor AP2γ and sal-like protein 4 (SALL4) that confer to the gonocytes this ability and therefore make them susceptible to develop ITGCNU. The aim of the present study was to determine if the gonocytes of patients with cryptorchidism express POU5F1, c-Kit, PLAP, AP2γ and SALL4 proteins after their differentiation period. Based on this, we evaluated samples of testicular tissue from newborns to 16-year old subjects with or without cryptorchidism in search of POU5F1, c-Kit, PLAP, AP2γ and SALL4 using immunocytochemical method, the results of which were validated by RT-PCR. The results showed that control subjects witnessed a down-regulation in the expression of these five proteins in the first year of life, which eventually disappeared. On the other hand, it was determined that 21.6% (8/37) of the patients with cryptorchidism continued to express, at least, one of the proteins analyzed in this study after the second year of life. And only 5.4% (2/37) of the patients were positive to the five markers. These data sustain the proposed hypothesis that in cryptorchid patients, ITGCNU arises from gonocytes that fail in their differentiation process to spermatogonia with conservation of the proteins (POU5F1, c-Kit, PLAP, AP2γ and SALL4) that maintain pluripotency and undifferentiated characteristics and which are responsible for making the gonocytes susceptible to malignancy. However, we

  6. Intratumoral CD3+ T-Lymphocytes Immunoexpression and Its Association with c-Kit, Angiogenesis, and Overall Survival in Malignant Canine Mammary Tumors

    PubMed Central

    Carvalho, Maria Isabel; Pires, Isabel; Dias, Marlene; Prada, Justina; Gregório, Hugo; Lobo, Luis; Queiroga, Felisbina

    2015-01-01

    In this study 80 malignant CMT were submitted to immunohistochemical detection of CD3, c-kit, VEGF, and CD31, together with clinicopathological parameters of tumor aggressiveness. CD3+ T-cells and c-kit overexpression revealed a positive correlation with VEGF (r = 0.503, P < 0.0001; r = 0.284, P = 0.023 for CD3 and c-kit, resp.) and CD31 (r = 0.654, P < 0.0001; r = 0.365, P = 0.003 for CD3 and c-kit, resp.). A significant association (P = 0.039) and a positive correlation (r = 0.263, P = 0.039) between CD3 and c-kit were also observed. High CD3/VEGF, c-kit/VEGF, and CD3/c-kit tumors were associated with elevated grade of malignancy (P < 0.0001 for all groups), presence of intravascular emboli (P < 0.0001 for CD3/VEGF and CD3/c-kit; P = 0.002 for c-kit/VEGF), and presence of lymph node metastasis (P < 0.0001 for all groups). Tumors with high CD3/VEGF (P = 0.006), c-kit/VEGF (P < 0.0001), and CD3/c-kit (P = 0.002) were associated with poor prognosis. Interestingly high c-kit/VEGF tumors retained their significance by multivariate analysis arising as independent prognostic factor. PMID:26346272

  7. Intratumoral CD3+ T-lymphocytes immunoexpression and its association with c-Kit, angiogenesis, and overall survival in malignant canine mammary tumors.

    PubMed

    Carvalho, Maria Isabel; Pires, Isabel; Dias, Marlene; Prada, Justina; Gregório, Hugo; Lobo, Luis; Queiroga, Felisbina

    2015-01-01

    In this study 80 malignant CMT were submitted to immunohistochemical detection of CD3, c-kit, VEGF, and CD31, together with clinicopathological parameters of tumor aggressiveness. CD3+ T-cells and c-kit overexpression revealed a positive correlation with VEGF (r = 0.503, P < 0.0001; r = 0.284, P = 0.023 for CD3 and c-kit, resp.) and CD31 (r = 0.654, P < 0.0001; r = 0.365, P = 0.003 for CD3 and c-kit, resp.). A significant association (P = 0.039) and a positive correlation (r = 0.263, P = 0.039) between CD3 and c-kit were also observed. High CD3/VEGF, c-kit/VEGF, and CD3/c-kit tumors were associated with elevated grade of malignancy (P < 0.0001 for all groups), presence of intravascular emboli (P < 0.0001 for CD3/VEGF and CD3/c-kit; P = 0.002 for c-kit/VEGF), and presence of lymph node metastasis (P < 0.0001 for all groups). Tumors with high CD3/VEGF (P = 0.006), c-kit/VEGF (P < 0.0001), and CD3/c-kit (P = 0.002) were associated with poor prognosis. Interestingly high c-kit/VEGF tumors retained their significance by multivariate analysis arising as independent prognostic factor. PMID:26346272

  8. NPM1, FLT3, and c-KIT mutations in pediatric acute myeloid leukemia in Russian population.

    PubMed

    Yatsenko, Yuliya; Kalennik, Olga; Maschan, Mikhail; Kalinina, Irina; Maschan, Alexey; Nasedkina, Tatyana

    2013-04-01

    We evaluated frequencies of NPM1, FLT3, c-KIT mutations in childhood acute myeloid leukemia (AML) in Russia and assessed prognostic relevance of the mutations. RNA and DNA were extracted from bone marrow samples of 186 (106 male and 80 female) pediatric patients younger than 17 year with de novo AML. Mutations and chromosomal rearrangements were detected by sequencing of a corresponding gene. NPM1 mutations were found in 5.2%, FLT3 mutations in 12.1%, c-KIT mutations in 3.7% of the patients. NPM1 mutations were associated with the absence of chromosomal aberrations (P=0.007) and FLT3/ITD (P=0.018). New data on incidence of c-KIT mutations in various AML subtypes as well as new variations of c-KIT mutations in the exon 8 are presented. The results are compared to previously published studies on NPM1, FLT3, c-KIT mutations in various populations. No statistically significant differences in survival rates between groups with or without of FLT3, NPM1, c-KIT mutations were found (P>0.05). Meanwhile, 4-year overall survival rates were higher in patients having NPM1 mutations comparing with NPM1/WT patients (100% vs. 50%) and in patients having FLT3 mutations comparing with FLT3/WT patients (70% vs. 50%). The data presented contribute to knowledge on incidence and prognostic significance of the mutations in pediatric AML. PMID:23511494

  9. Low c-Kit Expression Level Induced by Stem Cell Factor Does Not Compromise Transplantation of Hematopoietic Stem Cells.

    PubMed

    Chen, Chia-Ling; Faltusova, Katerina; Molik, Martin; Savvulidi, Filipp; Chang, Ko-Tung; Necas, Emanuel

    2016-07-01

    The c-Kit expression level is decreased in regenerating bone marrow, and such bone marrow performs poorly when co-transplanted with normal bone marrow. We asked whether diminished numbers of c-Kit receptors on hematopoietic stem and progenitor cells (HSPCs) after their internalization induced by the binding of the cytokine stem cell factor (SCF) would jeopardize transplantability of HSPCs. We used a battery of functional assays to evaluate the capacity of HSPCs with markedly different c-Kit expression levels to be transplanted. Surprisingly, our experiments testing the homing of transplanted HSPCs to bone marrow of recipient mice and their short-term and long-term engraftment did not reveal any defects in HSPCs with severely reduced numbers of c-Kit receptor molecules. This unexpected result can be ascribed to the fact that HSPCs exposed to SCF replace the consumed c-Kit receptors rapidly. This article demonstrates that exposure of HSPCs to SCF and diminished number of c-Kit receptors in their cell membranes do not compromise the capacity of HSPCs to reconstitute damaged hematopoietic tissue. PMID:27040393

  10. Relationship between gene mutations and protein expressions of PDGFR α and C-kit in gastrointestinal stromal tumors

    PubMed Central

    He, Jun-Yi; Tong, HX; Zhang, Y; Wang, JY; Shao, YB; Zhu, J; Lu, Wei-Qi

    2015-01-01

    Objective: To investigate the relationship between gene mutations and protein expressions of PDGFR α and C-kit in gastrointestinal stromal tumors (GIST) and its significance in tumorigenesis. Methods: Single strand conformation polymorphism-polymerase chain reaction (PCR-SSCP), immunohistochemistry and Western blot were used to detect the gene mutations in PDGFR α and C-kit and their protein expressions in 105 cases of GIST specimens. Results: In 105 cases of GIST, PDGFR α gene mutation was found in 12 cases (11.4%), which was common in the stomach- derived spindle cell GIST. C-kit gene mutation was found in 58 cases (55.2%), which was common in the small intestine. Mutations of PDGFR α is in 12 cases of GIST were stronger than the C-kit mutations in GIST, normal gastrointestinal tissues and schwannomas. No significant correlation was found between mutations and C-kit protein expression (P>0.05), while the protein expression of PDGFR α was significantly correlated with mutations (P<0.0001). Conclusion: Mutations of PDGFR α and C-kit plays an important role in part of GIST tumorigenesis. Mutation sites were related with original sites and histological types. Most protein expressions were closely related to their gene mutations in GIST. PMID:26221304

  11. Celastrol Induces Cell Apoptosis and Inhibits the Expression of the AML1-ETO/C-KIT Oncoprotein in t(8;21) Leukemia.

    PubMed

    Yu, Xianjun; Ruan, Xuzhi; Zhang, Jingxuan; Zhao, Qun

    2016-01-01

    Resistance to chemotherapy is a major challenge to improving overall survival in Acute Myeloid Leukemia (AML). Therefore, the development of innovative therapies and the identification of more novel agents for AML are urgently needed. Celastrol, a compound extracted from the Chinese herb Tripterygium wilfordii Hook, exerts anticancer activity. We investigated the effect of celastrol in the t(8;21) AML cell lines Kasumi-1 and SKNO-1. We demonstrated that inhibition of cell proliferation activated caspases and disrupted mitochondrial function. In addition, we found that celastrol downregulated the AML1-ETO fusion protein, therefore downregulating C-KIT kinases and inhibiting AKT, STAT3 and Erk1/2. These findings provide clear evidence that celastrol might provide clinical benefits to patients with t(8;21) leukemia. PMID:27144550

  12. Prognostic significance of c-KIT in vulvar cancer: bringing this molecular marker from bench to bedside

    PubMed Central

    2012-01-01

    Background Vulvar carcinomas are rare tumors, and there is limited data regarding molecular alterations. To our knowledge there are no published studies on c-KIT and squamous cell carcinomas of the vulva (VSCC). Although there are a significant number of other tumor types which express c-KIT, there remains controversy as to its relationship to patient outcome. Thus, we wished to investigate such controversial findings to determine the prognostic importance of c-KIT by evaluating its protein and mRNA expression in VSCCs, correlating these findings with clinicopathological features and Human Papillomavirus (HPV) infection. Methods c-KIT expression was scored by immunohistochemistry (IHC) as positive or negative in 139 formalin-fixed paraffin-embedded (FFPE) cases of vulvar carcinomas arrayed in a tissue microarray (TMA) using the DAKO® A4502 rabbit polyclonal c-KIT antibody (diluted 1:100). c-KIT mRNA was evaluated by qRT-PCR in 34 frozen samples from AC Camargo Hospital Biobank (17 tumoral and 17 non-tumoral samples) using TaqMan probes–Applied Biosystems [Hs00174029_m1]. HPV genotyping was assessed in 103 samples using Linear Array® HPV Genotyping Test kit (Roche Molecular Diagnostics, Basel, Switzerland). All results obtained were correlated with clinical and pathological data of the patients. Results c-KIT protein was positive by immunohistochemistry in 70.5% of the cases and this was associated with a higher global survival (p = 0.007), a higher recurrence-free survival (p < 0.0001), an absence of associated lesions (p = 0.001), lymph node metastasis (p = 0.0053), and HPV infection (p = 0.034). Furthermore, c-KIT mRNA quantitation revealed higher levels of transcripts in normal samples compared to tumor samples (p = 0,0009). Conclusions Our findings indicate that those vulvar tumors staining positively for c-KIT present better prognosis. Thus, positivity of c-KIT as evaluated by IHC may be a good predictor for use of more conservative

  13. Inhibition of Histone Deacetylase-induced Myocardial Repair Is Mediated by c-kit in Infarcted Hearts*

    PubMed Central

    Zhang, Ling; Chen, Bing; Zhao, Yu; Dubielecka, Patrycja M.; Wei, Lei; Qin, Gang J.; Chin, Y. Eugene; Wang, Yigang; Zhao, Ting C.

    2012-01-01

    Histone deacetylases (HDACs) play a critical role in the regulation of gene transcription, cardiac development, and diseases. The aim of this study was to test whether inhibition of HDACs induces myocardial repair and cardiac function restoration through c-kit signaling in mouse myocardial infarction models. Myocardial infarction in wild type Kit+/+ and KitW/KitW-v mice was created following thoracotomy by applying permanent ligation to the left anterior descending artery. The HDAC inhibitor, trichostatin A (TSA, 0.1 mg/kg), was intraperitoneally injected daily for a consecutive 8 weeks after myocardial infarction. 5-Bromo-2-deoxyuridine (BrdU, 50 mg/kg) was intraperitoneally delivered every other day to pulse-chase label in vivo endogenous cardiac replication. Eight weeks later, inhibition of HDACs in vivo resulted in an improvement in ventricular functional recovery and the prevention of myocardial remodeling in Kit+/+mice, which was eliminated in KitW/KitW-v mice. HDAC inhibition promoted cardiac repairs and neovascularization in the infarcted myocardium, which were absent in KitW/KitW-v mice. Re-introduction of TSA-treated wild type c-kit+ CSCs into KitW/KitW-v myocardial infarction heart restored myocardial functional improvement and cardiac repair. To further validate that HDAC inhibition stimulates c-kit+ cardiac stem cells (CSCs) to facilitate myocardial repair, GFP+ c-kit+ CSCs were preconditioned with TSA (50 nmol/liter) for 24 h and re-introduced into infarcted hearts for 2 weeks. Preconditioning of c-kit+ CSCs via HDAC inhibition with trichostatin A significantly increased c-kit+ CSC-derived myocytes and microvessels and enhanced functional recovery in myocardial infarction hearts in vivo. Our results provide evidence that HDAC inhibition promotes myocardial repair and prevents cardiac remodeling, which is dependent upon c-kit signaling. PMID:23024362

  14. Involvement of c-KIT mutation in the development of gastrointestinal stromal tumors through proliferation promotion and apoptosis inhibition

    PubMed Central

    Ma, Ying-Yu; Yu, Sheng; He, Xu-Jun; Xu, Yuan; Wu, Fang; Xia, Ying-Jie; Guo, Kun; Wang, Hui-Ju; Ye, Zai-Yuan; Zhang, Wei; Tao, Hou-Quan

    2014-01-01

    The aim of this study was to discuss the role of c-KIT mutation in the pathogenesis of gastrointestinal stromal tumors (GISTs) and analyze its correlation with proliferation and apoptosis. c-KIT and PDGFRA genotypes were examined by deoxyribonucleic acid sequencing. Immunohistochemistry was performed to determine the expression levels of Kit, Ki-67 (proliferation marker), and apoptotic protease-activating factor (APAF)-1 (apoptosis marker) and the relationship between their three genes. In the 68 cases examined, 44 cases (64.7%) showed mutations in one of the four exons of c-KIT. The mutations were most frequently found in exon 11 (30 cases [44.1%]), followed by exon 9 (ten cases [14.7%]) and exon 13 (four cases [5.9%]). c-KIT mutation showed no association with prognostic factors using the classification of risk of aggressive behavior in GIST proposed by Fletcher et al. No cases had mutated exon 17 of c-KIT, and neither did exon 12, 14, or 18 of PDGFRA in our present study. There was a positive correlation between the expression level of Kit and Ki-67 (R=0.282, P=0.020). Conversely, a negative correlation was found between the expression levels of Kit and APAF1 (R=−0.243, P=0.046). In conclusion, most GISTs with Kit expression showed c-KIT mutation. Kit expression has a positive correlation with Ki-67 and a negative correlation with APAF1, showing that c-KIT is involved in GIST occurrence and development through proliferation promotion and apoptosis inhibition. PMID:24833907

  15. CD45{sup low}c-Kit{sup high} cells have hematopoietic properties in the mouse aorta-gonad-mesonephros region

    SciTech Connect

    Nobuhisa, Ikuo

    2012-04-01

    Long-term reconstituting hematopoietic stem cells first arise from the aorta of the aorta-gonad-mesonephros (AGM) region in a mouse embryo. We have previously reported that in cultures of the dispersed AGM region, CD45{sup low}c-Kit{sup +} cells possess the ability to reconstitute multilineage hematopoietic cells, but investigations are needed to show that this is not a cultured artifact and to clarify when and how this population is present. Based on the expression profile of CD45 and c-Kit in freshly dissociated AGM cells from embryonic day 9.5 (E9.5) to E12.5 and aorta cells in the AGM from E13.5 to E15.5, we defined six cell populations (CD45{sup -}c-Kit{sup -}, CD45{sup -}c-Kit{sup low}, CD45{sup -}c-Kit{sup high}, CD45{sup low}c-Kit{sup high}, CD45{sup high}c-Kit{sup high}, and CD45{sup high}c-Kit{sup very} {sup low}). Among these six populations, CD45{sup low}c-Kit{sup high} cells were most able to form hematopoietic cell colonies, but their ability decreased after E11.5 and was undetectable at E13.5 and later. The CD45{sup low}c-Kit{sup high} cells showed multipotency in vitro. We demonstrated further enrichment of hematopoietic activity in the Hoechst dye-effluxing side population among the CD45{sup low}c-Kit{sup high} cells. Here, we determined that CD45{sup low}c-Kit{sup high} cells arise from the lateral plate mesoderm using embryonic stem cell-derived differentiation system. In conclusion, CD45{sup low}c-Kit{sup high} cells are the major hematopoietic cells of mouse AGM.

  16. Fibroblast Growth Factor-9 Activates c-Kit Progenitor Cells and Enhances Angiogenesis in the Infarcted Diabetic Heart

    PubMed Central

    Singla, Dinender; Wang, Jing

    2016-01-01

    We hypothesized that fibroblast growth factor-9 (FGF-9) would enhance angiogenesis via activating c-kit positive stem cells in the infarcted nondiabetic and diabetic heart. In brief, animals were divided into three groups: Sham, MI, and MI+FGF-9. Two weeks following MI or sham surgery, our data suggest that treatment with FGF-9 significantly diminished vascular apoptosis compared to the MI group in both C57BL/6 and db/db mice (p < 0.05). Additionally, the number of c-kit+ve/SM α-actin+ve cells and c-kit+ve/CD31+ve cells were greatly enhanced in the MI+FGF-9 groups relative to the MI suggesting FGF-9 enhances c-Kit cell activation and their differentiation into vascular smooth muscle cells and endothelial cells, respectively (p < 0.05). Histology shows that the total number of vessels were quantified for all groups and our data suggest that the FGF-9 treated groups had significantly more vessels than their MI counterparts (p < 0.05). Finally, echocardiographic data suggests a significant improvement in left ventricular output, as indicated by fractional shortening and ejection fraction in both nondiabetic and diabetic animals treated with FGF-9 (p < 0.05). Overall, our data suggests FGF-9 has the potential to attenuate vascular cell apoptosis, activate c-Kit progenitor cells, and enhance angiogenesis and neovascularization in C57BL/6 and db/db mice leading to improved cardiac function. PMID:26682010

  17. c-kit+AT2R+ Bone Marrow Mononuclear Cell Subset Is a Superior Subset for Cardiac Protection after Myocardial Infarction

    PubMed Central

    Du, Mingjun; Zhang, Wentian; Wang, Chenxi; Lian, Feng; Xue, Song

    2016-01-01

    Although the bone marrow mononuclear cell (BMMNC) is known as an ideal cell type for cell-based therapy for MI treatment, the effective subpopulation still remains unknown. Our study aimed at identifying the optimal subset of BMMNCs suited for cardiac regeneration. In this study, we observed that MI led to (i) a significant increase of the c-kit+AT2R+ BMMNC subpopulation in mice and (ii) a modest increase of AT2R+ BMMNCs in humans. c-kit+AT2R+ and c-kit+AT2R− BMMNC subpopulations were obtained from mice after MI. Then, we cocultured cardiac H9C2 cells with c-kit+AT2R+, c-kit+AT2R−, and unfractionated BMMNCs; finally, we found that the c-kit+AT2R+ subset is superior to the c-kit+AT2R− subset in improving cardiomyocyte protection in vitro. Of note, c-kit+AT2R+ BMMNCs showed a more robust migration capacity than c-kit+AT2R− and unfractionated BMMNCs in vitro and in vivo. Additionally, compared to c-kit+AT2R− and unfractionated BMMNCs, intravenous transplantation of c-kit+AT2R+ BMMNC resulted in smaller infarct size and lower levels of inflammatory reactions in heart tissue, leading to a higher global heart function improvement. In conclusion, our results indicate that the c-kit+AT2R+ BMMNC subpopulation exerts a protective effect against MI and shows promising therapeutic possibilities with regard to the treatment of ischemic heart disease. PMID:27429622

  18. Enhanced Nox1 expression and oxidative stress resistance in c-kit-positive hematopoietic stem/progenitor cells.

    PubMed

    Urata, Yoshishige; Goto, Shinji; Luo, Lan; Doi, Hanako; Kitajima, Yuriko; Masuda, Shinya; Ono, Yusuke; Li, Tao-Sheng

    2014-10-24

    Although stem cells are generally thought to be resistant to oxidative stress, the fact and in detail molecular mechanism are still to be clearly identified. We herein tried to understand the overall characterization of redox regulatory signaling in hematopoietic stem cells. We purified c-kit-positive hematopoietic stem/progenitor cells from the bone marrow of healthy mice, and then evaluated their redox regulatory property. Compared to the c-kit-negative matured mononuclear cells, c-kit-positive stem/progenitor cells showed lower basic levels of intracellular reactive oxygen species, faster clearance of the accumulated intracellular reactive oxygen species, and higher resistant to oxidative stress. An overall view on the gene expression profile associated with redox regulation showed to be widely differed between cell types. We confirmed that the c-kit-positive stem/progenitor cells expressed significantly higher of Nox1 and catalase, but less of lactoperoxidase than these matured mononuclear cells. Our data suggests that stem cells keep specific redox regulatory property for defensing against oxidative stress. PMID:25451257

  19. Internal associations and dynamic expression of c-kit and nanog genes in ventricular remodelling induced by adriamycin

    PubMed Central

    Liu, Zhen; Li, Shuo; Liu, Lingling; Guo, Zhikun; Wang, Pengfei

    2016-01-01

    The present study aimed to investigate the dynamic expression of the c-kit and nanog genes in rats with left ventricular remodelling induced by adriamycin (ADR), and explore its internal association and mechanism of action. Sprague-Dawley male rats were randomly divided into a normal control group and a heart failure model group. Heart failure was induced by a single intraperitoneal injection of ADR (4 mg/kg) weekly for six weeks. The normal control group was given the same amount of saline. At the eighth week, rat cardiac function was examined to demonstrate the formation of heart failure. The rat hearts were harvested frozen and sectioned, and the expression levels of the nanog and c-kit genes in the myocardial tissue samples were detected using immunohistochemistry, immunofluorescence and reverse transcription-polymerase chain reaction (RT-PCR). Hematoxylin and eosin staining demonstrated various pathological changes in the myocardial cells in the heart failure model group, whereas myocardial infarction was not observed in the normal control group. Immunohistochemistry and immunofluorescence demonstrated that nanog-positive cells were predominantly expressed in the vascular endothelium, with a few myocardial cells and stem cells in normal myocardium. The expression levels of c-kit and nanog in the myocardium of the rats with heart failure decreased significantly. c-kit-positive cells clustered together in the epicardium and its vicinity, and c-kit expression significantly decreased in the myocardium of rats with heart failure, as compared with normal rats. In both groups, some cells co-expressed both the c-kit and nanog genes. The RT-PCR results demonstrated that the expression levels of the two genes in the heart failure model group were significantly lower compared with those in the normal control group (P<0.05). In conclusion, the c-kit- and nanog-positive stem cells decreased in the myocardium of the rats with left ventricular remodelling induced by ADR

  20. c-Kit Expression is Rate-Limiting for Stem Cell Factor-Mediated Disease Progression in Adenoid Cystic Carcinoma of the Salivary Glands12

    PubMed Central

    Phuchareon, Janyaporn; van Zante, Annemieke; Overdevest, Jonathan B.; McCormick, Frank; Eisele, David W.; Tetsu, Osamu

    2014-01-01

    Adenoid cystic carcinoma (ACC) is an aggressive malignant neoplasm of the salivary glands in which c-Kit is overexpressed and activated, although the mechanism for this is as yet unclear. We analyzed 27 sporadic ACC tumor specimens to examine the biologic and clinical significance of c-Kit activation. Mutational analysis revealed expression of wild-type c-Kit in all, eliminating gene mutation as a cause of activation. Because stem cell factor (SCF) is c-Kit's sole ligand, we analyzed its expression in the tumor cells and their environment. Immunohistochemistry revealed its presence in c-Kit–positive tumor cells, suggesting an activation of autocrine signaling. We observed a significant induction of ERK1/2 in the cells. SCF staining was also found in other types of non-cancerous cells adjacent to tumors within salivary glands, including stromal fibroblasts, neutrophils, peripheral nerve, skeletal muscle, vascular endothelial cells, mucous acinar cells, and intercalated ducts. Quantitative PCR showed that the top quartile of c-Kit mRNA expression distinguished ACCs from normal salivary tissues and was cross-correlated with short-term poor prognosis. Expression levels of SCF and c-Kit were highly correlated in the cases with perineural invasion. These observations suggest that c-Kit is potentially activated by receptor dimerization upon stimulation by SCF in ACC, and that the highest quartile of c-Kit mRNA expression could be a predictor of poor prognosis. Our findings may support an avenue for c-Kit-targeted therapy to improve disease control in ACC patients harboring the top quartile of c-Kit mRNA expression. PMID:25389449

  1. "String theory" of c-kit(pos) cardiac cells: a new paradigm regarding the nature of these cells that may reconcile apparently discrepant results.

    PubMed

    Keith, Matthew C L; Bolli, Roberto

    2015-03-27

    Although numerous preclinical investigations have consistently demonstrated salubrious effects of c-kit(pos) cardiac cells administered after myocardial infarction, the mechanism of action remains highly controversial. We and others have found little or no evidence that these cells differentiate into mature functional cardiomyocytes, suggesting paracrine effects. In this review, we propose a new paradigm predicated on a comprehensive analysis of the literature, including studies of cardiac development; we have (facetiously) dubbed this conceptual construct "string theory" of c-kit(pos) cardiac cells because it reconciles multifarious and sometimes apparently discrepant results. There is strong evidence that, during development, the c-kit receptor is expressed in different pools of cardiac progenitors (some capable of robust cardiomyogenesis and others with little or no contribution to myocytes). Accordingly, c-kit positivity, in itself, does not define the embryonic origins, lineage capabilities, or differentiation capacities of specific cardiac progenitors. C-kit(pos) cells derived from the first heart field exhibit cardiomyogenic potential during development, but these cells are likely depleted shortly before or after birth. The residual c-kit(pos) cells found in the adult heart are probably of proepicardial origin, possess a mesenchymal phenotype (resembling bone marrow mesenchymal stem/stromal cells), and are capable of contributing significantly only to nonmyocytic lineages (fibroblasts, smooth muscle cells, and endothelial cells). If these 2 populations (first heart field and proepicardium) express different levels of c-kit, the cardiomyogenic potential of first heart field progenitors might be reconciled with recent results of c-kit(pos) cell lineage tracing studies. The concept that c-kit expression in the adult heart identifies epicardium-derived, noncardiomyogenic precursors with a mesenchymal phenotype helps to explain the beneficial effects of c-kit

  2. Polymer microfiber meshes facilitate cardiac differentiation of c-kit(+) human cardiac stem cells.

    PubMed

    Kan, Lijuan; Thayer, Patrick; Fan, Huimin; Ledford, Benjamin; Chen, Miao; Goldstein, Aaron; Cao, Guohua; He, Jia-Qiang

    2016-09-10

    Electrospun microfiber meshes have been shown to support the proliferation and differentiation of many types of stem cells, but the phenotypic fate of c-kit(+) human cardiac stem cells (hCSCs) have not been explored. To this end, we utilized thin (~5µm) elastomeric meshes consisting of aligned 1.7µm diameter poly (ester-urethane urea) microfibers as substrates to examine their effect on hCSC viability, morphology, proliferation, and differentiation relative to cells cultured on tissue culture polystyrene (TCPS). The results showed that cells on microfiber meshes displayed an elongated morphology aligned in the direction of fiber orientation, lower proliferation rates, but increased expressions of genes and proteins majorly associated with cardiomyocyte phenotype. The early (NK2 homeobox 5, Nkx2.5) and late (cardiac troponin I, cTnI) cardiomyocyte genes were significantly increased on meshes (Nkx=2.5 56.2±13.0, cTnl=2.9±0.56,) over TCPS (Nkx2.5=4.2±0.9, cTnl=1.6±0.5, n=9, p<0.05 for both groups) after differentiation. In contrast, expressions of smooth muscle markers, Gata6 and myosin heavy chain (SM-MHC), were decreased on meshes. Immunocytochemical analysis with cardiac antibody exhibited the similar pattern of above cardiac differentiation. We conclude that aligned microfiber meshes are suitable for guiding cardiac differentiation of hCSCs and may facilitate stem cell-based therapies for treatment of cardiac diseases. PMID:27481582

  3. A clinicopathological review of 33 patients with vulvar melanoma identifies c-KIT as a prognostic marker.

    PubMed

    Heinzelmann-Schwarz, Viola A; Nixdorf, Sheri; Valadan, Mehrnaz; Diczbalis, Monica; Olivier, Jake; Otton, Geoff; Fedier, André; Hacker, Neville F; Scurry, James P

    2014-04-01

    Vulvar melanoma is the second most common vulvar cancer. Patients with vulvar melanoma usually present with the disease at a late stage and have a poor prognosis. The prognostic predictors reported in the literature are not unequivocal and the role of lichen sclerosus and c-KIT mutations in the aetiology of vulvar melanoma is unclear. Breslow staging currently seems to be the most adequate predictor of prognosis. We thus performed a clinicopathological and literature review to identify suitable predictors of prognosis and survival and investigated the expression of c-KIT (by immunohistochemistry) in patients with vulvar melanoma (n=33) from the Gynaecological Cancer Centres of the Royal Hospital for Women (Sydney, Australia) and John Hunter Hospital (Newcastle, Australia). Our series of 33 patients fitted the expected clinical profile of older women: delayed presentation, high stage, limited response to treatment and poor prognosis. We identified 3 patients (9.1%) with lichen sclerosus associated with melanoma in situ, although no lichen sclerosus was found in the areas of invasive melanoma. No patient had vulvar nevi. We identified a) Breslow's depth, b) an absence of any of the pathological risk factors, such as satellitosis, in-transit metastasis, lymphovascular space invasion (LVSI) and dermal mitosis, c) removal of inguino-femoral lymph nodes, d) lateral margin of >1 cm, and e) c-KIT expression as valuable prognostic predictors for disease-free survival. We conclude that c-KIT expression is, apart from Breslow's depth, another valuable predictor of prognosis and survival. Lichen sclerosus may be associated with vulvar melanoma. PMID:24535703

  4. A clinicopathological review of 33 patients with vulvar melanoma identifies c-KIT as a prognostic marker

    PubMed Central

    HEINZELMANN-SCHWARZ, VIOLA A.; NIXDORF, SHERI; VALADAN, MEHRNAZ; DICZBALIS, MONICA; OLIVIER, JAKE; OTTON, GEOFF; FEDIER, ANDRÉ; HACKER, NEVILLE F.; SCURRY, JAMES P.

    2014-01-01

    Vulvar melanoma is the second most common vulvar cancer. Patients with vulvar melanoma usually present with the disease at a late stage and have a poor prognosis. The prognostic predictors reported in the literature are not unequivocal and the role of lichen sclerosus and c-KIT mutations in the aetiology of vulvar melanoma is unclear. Breslow staging currently seems to be the most adequate predictor of prognosis. We thus performed a clinicopathological and literature review to identify suitable predictors of prognosis and survival and investigated the expression of c-KIT (by immunohistochemistry) in patients with vulvar melanoma (n=33) from the Gynaecological Cancer Centres of the Royal Hospital for Women (Sydney, Australia) and John Hunter Hospital (Newcastle, Australia). Our series of 33 patients fitted the expected clinical profile of older women: delayed presentation, high stage, limited response to treatment and poor prognosis. We identified 3 patients (9.1%) with lichen sclerosus associated with melanoma in situ, although no lichen sclerosus was found in the areas of invasive melanoma. No patient had vulvar nevi. We identified a) Breslow’s depth, b) an absence of any of the pathological risk factors, such as satellitosis, in-transit metastasis, lymphovascular space invasion (LVSI) and dermal mitosis, c) removal of inguino-femoral lymph nodes, d) lateral margin of >1 cm, and e) c-KIT expression as valuable prognostic predictors for disease-free survival. We conclude that c-KIT expression is, apart from Breslow’s depth, another valuable predictor of prognosis and survival. Lichen sclerosus may be associated with vulvar melanoma. PMID:24535703

  5. Suppression of c-Kit signaling induces adult neurogenesis in the mouse intestine after myenteric plexus ablation with benzalkonium chloride

    PubMed Central

    Tamada, Hiromi; Kiyama, Hiroshi

    2016-01-01

    Adult neurogenesis rarely occurs in the enteric nervous system (ENS). In this study, we demonstrated that, after intestinal myenteric plexus (MP) ablation with benzalkonium chloride (BAC), adult neurogenesis in the ENS was significantly induced in c-kit loss-of-function mutant mice (W/Wv). Almost all neurons and fibers in the MP disappeared after BAC treatment. However, 1 week after ablation, substantial penetration of nerve fibers from the non-damaged area was observed in the MP, longitudinal muscle and subserosal layers in both wildtype and W/Wv mice. Two weeks after BAC treatment, in addition to the penetrating fibers, a substantial number of ectopic neurons appeared in the subserosal and longitudinal muscle layers of W/Wv mice, whereas only a few ectopic neurons appeared in wildtype mice. Such ectopic neurons expressed either excitatory or inhibitory intrinsic motor neuron markers and formed ganglion-like structures, including glial cells, synaptic vesicles and basal lamina. Furthermore, oral administration of imatinib, an inhibitor of c-Kit and an anticancer agent for gastrointestinal stromal tumors, markedly induced appearance of ectopic neurons after BAC treatment, even in wildtype mice. These results suggest that adult neurogenesis in the ENS is negatively regulated by c-Kit signaling in vivo. PMID:27572504

  6. Suppression of c-Kit signaling induces adult neurogenesis in the mouse intestine after myenteric plexus ablation with benzalkonium chloride.

    PubMed

    Tamada, Hiromi; Kiyama, Hiroshi

    2016-01-01

    Adult neurogenesis rarely occurs in the enteric nervous system (ENS). In this study, we demonstrated that, after intestinal myenteric plexus (MP) ablation with benzalkonium chloride (BAC), adult neurogenesis in the ENS was significantly induced in c-kit loss-of-function mutant mice (W/W(v)). Almost all neurons and fibers in the MP disappeared after BAC treatment. However, 1 week after ablation, substantial penetration of nerve fibers from the non-damaged area was observed in the MP, longitudinal muscle and subserosal layers in both wildtype and W/W(v) mice. Two weeks after BAC treatment, in addition to the penetrating fibers, a substantial number of ectopic neurons appeared in the subserosal and longitudinal muscle layers of W/W(v) mice, whereas only a few ectopic neurons appeared in wildtype mice. Such ectopic neurons expressed either excitatory or inhibitory intrinsic motor neuron markers and formed ganglion-like structures, including glial cells, synaptic vesicles and basal lamina. Furthermore, oral administration of imatinib, an inhibitor of c-Kit and an anticancer agent for gastrointestinal stromal tumors, markedly induced appearance of ectopic neurons after BAC treatment, even in wildtype mice. These results suggest that adult neurogenesis in the ENS is negatively regulated by c-Kit signaling in vivo. PMID:27572504

  7. C-Kit Binding Properties of Hesperidin (a Major Component of KMP6) as a Potential Anti-Allergic Agent

    PubMed Central

    Jeong, Hyun-Ja; Choi, Youngjin; Kim, Kyu-Yeob; Kim, Min-Ho; Kim, Hyung-Min

    2011-01-01

    Accumulation of mast cells can be causally related to several allergic inflammations. Stem cell factor (SCF) as a mast cell chemotaxin induces mast cell migration. To clarify a new effect of Pyeongwee-San extract (KMP6, a drug for indigestion) for the treatment of allergy, we investigated the effects of KMP6 on SCF-induced migration of rat peritoneal mast cells (RPMCs). A molecular docking simulation showed that hesperidin, a major component of KMP6, controls the SCF and c-kit binding by interaction with the active site of the c-kit. KMP6 and hesperidin significantly inhibited SCF-induced migration of RPMCs (P<0.05). The ability of the SCF to enhance morphological alteration and F-actin formation was also abolished by treatment with KMP6 or hesperidin. KMP6 and hesperidin inhibited SCF-induced p38 MAPK activation. In addition, SCF-induced inflammatory cytokine production was significantly inhibited by treatment with KMP6 or hesperidin (P<0.05). Our results show for the first time that KMP6 potently regulates SCF-induced migration, p38 MAPK activation and inflammatory cytokines production through hindrance of SCF and c-kit binding in RPMCs. Such modulation may have functional consequences during KMP6 treatment, especially mast cell-mediated allergic inflammation disorders. PMID:21559359

  8. Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products.

    PubMed

    Cui, Xiaojie; Lin, Sen; Yuan, Gu

    2012-05-01

    The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene. PMID:22405847

  9. The use of COLD-PCR, DHPLC and GeneScanning for the highly sensitive detection of c-KIT somatic mutations in canine mast cell tumours.

    PubMed

    Gentilini, F; Mantovani, V; Turba, M E

    2015-09-01

    The conventional polymerase chain reaction (PCR)/sequencing methods may be poorly suited for the detection of somatic mutations in canine mast cell tumour (MCT) samples owing to limited sensitivity. This study was aimed at establishing novel and more sensitive methods, assessing their limit of detection and comparing their sensitivity with conventional methods.Two different 'driver' somatic mutations of c-KIT, together with the wild-type counterparts, were cloned in plasmids to prepare standard samples with known concentrations of mutated alleles in a background of wild-type alleles; the plasmids standards were assayed using either conventional or novel, highly sensitive technique. Conventional PCR/sequencing showed a sensitivity of 50-20%. Conversely, all the novel methods obtained higher sensitivities allowed reaching as low as 2.5-1.2% of the mutated DNA.The study demonstrates that early conventional methods could likely have underestimated the prevalence of KIT mutations of MCTs, therefore affecting the assessment of their relevance in prognosis and tyrosine kinase inhibitor (TKI) treatment effectiveness. PMID:23654224

  10. Withaferin A abolishes the stem cell factor-stimulated pigmentation of human epidermal equivalents by interrupting the auto-phosphorylation of c-KIT in human melanocytes.

    PubMed

    Terazawa, Shuko; Nakajima, Hiroaki; Fukasawa, Katsunori; Imokawa, Genji

    2015-01-01

    We characterized the mechanism(s) underlying the abrogating effect of withaferin A (WFA) on the stem cell factor (SCF)-stimulated pigmentation of human epidermal equivalents (HEEs). Increased gene and protein expression levels of tyrosinase, tyrosinase-related protein1, dopachrome tautomerase, PMEL17, c-KIT and their targeted transcription factor, microphthalmia-associated transcription factor (MITF) were significantly reversed at days 7 and 10, respectively, by treatment with WFA. In WFA-treated normal human melanocytes (NHMs), there was a marked deficiency in the SCF-stimulated series of phosphorylations of c-KIT, Shc, Raf-1, MEK, ERK, MITF and CREB. Treatment with dithiothreitol (DTT) distinctly abolished the suppressive effect of WFA on the SCF-stimulated phosphorylation of c-KIT in NHMs. On the other hand, even after incubation at 4 °C for 2 h with 5 nM SCF, followed by the removal of unbound SCF by washing and then raising the temperature to 37 °C to start the signaling reaction, c-KIT was distinctly phosphorylated to a similar extent by incubation for 15 min with SCF only or with SCF + WFA. These findings indicate that WFA attenuates the SCF-induced activation of c-KIT in NHMs by interrupting the auto-phosphorylation of c-KIT through DTT-suppressible Michael addition thioalkylation reactions without interrupting the binding of SCF to the c-KIT receptor. PMID:25376854

  11. Protein kinase D1 drives pancreatic acinar cell reprogramming and progression to intraepithelial neoplasia

    NASA Astrophysics Data System (ADS)

    Liou, Geou-Yarh; Döppler, Heike; Braun, Ursula B.; Panayiotou, Richard; Scotti Buzhardt, Michele; Radisky, Derek C.; Crawford, Howard C.; Fields, Alan P.; Murray, Nicole R.; Wang, Q. Jane; Leitges, Michael; Storz, Peter

    2015-02-01

    The transdifferentiation of pancreatic acinar cells to a ductal phenotype (acinar-to-ductal metaplasia, ADM) occurs after injury or inflammation of the pancreas and is a reversible process. However, in the presence of activating Kras mutations or persistent epidermal growth factor receptor (EGF-R) signalling, cells that underwent ADM can progress to pancreatic intraepithelial neoplasia (PanIN) and eventually pancreatic cancer. In transgenic animal models, ADM and PanINs are initiated by high-affinity ligands for EGF-R or activating Kras mutations, but the underlying signalling mechanisms are not well understood. Here, using a conditional knockout approach, we show that protein kinase D1 (PKD1) is sufficient to drive the reprogramming process to a ductal phenotype and progression to PanINs. Moreover, using 3D explant culture of primary pancreatic acinar cells, we show that PKD1 acts downstream of TGFα and Kras, to mediate formation of ductal structures through activation of the Notch pathway.

  12. Specific Stabilization of c-MYC and c-KIT G-Quadruplex DNA Structures by Indolylmethyleneindanone Scaffolds.

    PubMed

    Diveshkumar, K V; Sakrikar, Saaz; Rosu, Frédéric; Harikrishna, S; Gabelica, Valérie; Pradeepkumar, P I

    2016-06-28

    Stabilization of G-quadruplex DNA structures by small molecules has emerged as a promising strategy for the development of anticancer drugs. Since G-quadruplex structures can adopt various topologies, attaining specific stabilization of a G-quadruplex topology to halt a particular biological process is daunting. To achieve this, we have designed and synthesized simple structural scaffolds based on an indolylmethyleneindanone pharmacophore, which can specifically stabilize the parallel topology of promoter quadruplex DNAs (c-MYC, c-KIT1, and c-KIT2), when compared to various topologies of telomeric and duplex DNAs. The lead ligands (InEt2 and InPr2) are water-soluble and meet a number of desirable criteria for a small molecule drug. Highly specific induction and stabilization of the c-MYC and c-KIT quadruplex DNAs (ΔT1/2 up to 24 °C) over telomeric and duplex DNAs (ΔT1/2 ∼ 3.2 °C) by these ligands were further validated by isothermal titration calorimetry and electrospray ionization mass spectrometry experiments (Ka ∼ 10(5) to 10(6) M(-1)). Low IC50 (∼2 μM) values were emerged for these ligands from a Taq DNA polymerase stop assay with the c-MYC quadruplex forming template, whereas the telomeric DNA template showed IC50 values >120 μM. Molecular modeling and dynamics studies demonstrated the 5'- and 3'-end stacking modes for these ligands. Overall, these results demonstrate that among the >1000 quadruplex stabilizing ligands reported so far, the indolylmethyleneindanone scaffolds stand out in terms of target specificity and structural simplicity and therefore offer a new paradigm in topology specific G-quadruplex targeting for potential therapeutic and diagnostic applications. PMID:27226253

  13. Induction of mast cell proliferation, maturation, and heparin synthesis by the rat c-kit ligand, stem cell factor

    SciTech Connect

    Tsai, M.; Takeishi, Takashi; Geissler, E.N. ); Thompson, H.; Metcalfe, D.D. ); Langley, K.E.; Zsebo, K.M.; Galli, S.J. )

    1991-07-15

    The authors investigated the effects of a newly recognized multifunctional growth factor, the c-kit ligand stem cell factor (SCF), on mouse mast cell proliferation and phenotype. Recombinant rat SCF{sup 164} (rrSCF{sup 164}) induced the development of large numbers of dermal mast cells in normal mice in vivo. Many of these mast cells had features of connective tissue-type mast cells (CTMC), in that they were reactive both with the heparin-binding fluorescent dye berberine sulfate and with safranin. In vitro, rrSCF{sup 164} induced the proliferation of cloned interleukin 3 (IL-3)-dependent mouse mast cells and primary populations of IL-3-dependent, bone marrow-derived cultured mast cells (BMCMC), which represent immature mast cells, and purified peritoneal mast cells, which represent a type of mature CTMC> BMCMC maintained in rrSCF{sup 164} not only proliferated but also matured. These findings identify SCF as a single cytokine that can induce immature, IL-3-dependent mast cells to mature and to acquire multiple characteristics of CTMC. These findings also directly demonstrate that SCF can regulate the development of a cellular lineage expressing c-kit through effects on both proliferation and maturation.

  14. Endothelial cell-fatty acid binding protein 4 promotes angiogenesis: role of stem cell factor/c-kit pathway.

    PubMed

    Elmasri, Harun; Ghelfi, Elisa; Yu, Chen-wei; Traphagen, Samantha; Cernadas, Manuela; Cao, Haiming; Shi, Guo-Ping; Plutzky, Jorge; Sahin, Mustafa; Hotamisligil, Gokhan; Cataltepe, Sule

    2012-09-01

    Fatty acid binding protein 4 (FABP4) plays an important role in regulation of glucose and lipid homeostasis as well as inflammation through its actions in adipocytes and macrophages. FABP4 is also expressed in a subset of endothelial cells, but its role in this cell type is not known. We found that FABP4-deficient human umbilical vein endothelial cells (HUVECs) demonstrate a markedly increased susceptibility to apoptosis as well as decreased migration and capillary network formation. Aortic rings from FABP4(-/-) mice demonstrated decreased angiogenic sprouting, which was recovered by reconstitution of FABP4. FABP4 was strongly regulated by mTORC1 and inhibited by Rapamycin. FABP4 modulated activation of several important signaling pathways in HUVECs, including downregulation of P38, eNOS, and stem cell factor (SCF)/c-kit signaling. Of these, the SCF/c-kit pathway was found to have a major role in attenuated angiogenic activity of FABP4-deficient ECs as provision of exogenous SCF resulted in a significant recovery in cell proliferation, survival, morphogenesis, and aortic ring sprouting. These data unravel a novel pro-angiogenic role for endothelial cell-FABP4 and suggest that it could be exploited as a potential target for diseases associated with pathological angiogenesis. PMID:22562362

  15. Endothelial cell-fatty acid binding protein 4 promotes angiogenesis: role of stem cell factor/c-kit pathway

    PubMed Central

    Elmasri, Harun; Ghelfi, Elisa; Yu, Chen-wei; Traphagen, Samantha; Cernadas, Manuela; Cao, Haiming; Shi, Guo-Ping; Plutzky, Jorge; Sahin, Mustafa; Hotamisligil, Gokhan; Cataltepe, Sule

    2013-01-01

    Fatty acid binding protein 4 (FABP4) plays an important role in regulation of glucose and lipid homeostasis as well as inflammation through its actions in adipocytes and macrophages. FABP4 is also expressed in a subset of endothelial cells, but its role in this cell type is not known. We found that FABP4-deficient human umbilical vein endothelial cells (HUVECs) demonstrate a markedly increased susceptibility to apoptosis as well as decreased migration and capillary network formation. Aortic rings from FABP4−/− mice demonstrated decreased angiogenic sprouting, which was recovered by reconstitution of FABP4. FABP4 was strongly regulated by mTORC1 and inhibited by Rapamycin. FABP4 modulated activation of several important signaling pathways in HUVECs, including downregulation of P38, eNOS, and stem cell factor (SCF)/c-kit signaling. Of these, the SCF/c-kit pathway was found to have a major role in attenuated angiogenic activity of FABP4-deficient ECs as provision of exogenous SCF resulted in a significant recovery in cell proliferation, survival, morphogenesis, and aortic ring sprouting. These data unravel a novel pro-angiogenic role for endothelial cell-FABP4 and suggest that it could be exploited as a potential target for diseases associated with pathological angiogenesis. PMID:22562362

  16. Cutaneous mastocytosis with a mutation in the juxtamembrane domain of c-kit in a young laboratory beagle dog

    PubMed Central

    Kato, Yuki; Kashiwagi, Emi; Masuno, Koichi; Fujisawa, Kae; Tsuchiya, Noriko; Matsushima, Shuuichi; Torii, Mikinori; Takasu, Nobuo

    2015-01-01

    Cutaneous mastocytosis, which resembles a subset of urticaria pigmentosa in humans, is rare in dogs. We herein report unrepresentative neoplastic proliferation of mast cells in ventral skin removed routinely from a nine-month-old female laboratory beagle dog at necropsy. A histological examination revealed diffuse extensive cellular infiltration from the superficial to deep dermis in most parts of the skin around the fourth and fifth mammary papilla without nodule formation. Tumor cells were fairly monomorphic, well-differentiated mast cells with round nuclei of small distinct nucleoli and moderate to abundant, slightly eosinophilic and granular cytoplasm. A perivascular arrangement of mast cells was noted at the margin of the lesions. Infiltration of eosinophils and degeneration of collagen were not observed in the dermis. Cutaneous mastocytosis was diagnosed based on these features. A sequence analysis of lesions revealed the deletion of Gln555 to Ile570 within the juxtamembrane domain of c-kit (exon 11). PMID:26989302

  17. Cutaneous mastocytosis with a mutation in the juxtamembrane domain of c-kit in a young laboratory beagle dog.

    PubMed

    Kato, Yuki; Kashiwagi, Emi; Masuno, Koichi; Fujisawa, Kae; Tsuchiya, Noriko; Matsushima, Shuuichi; Torii, Mikinori; Takasu, Nobuo

    2016-01-01

    Cutaneous mastocytosis, which resembles a subset of urticaria pigmentosa in humans, is rare in dogs. We herein report unrepresentative neoplastic proliferation of mast cells in ventral skin removed routinely from a nine-month-old female laboratory beagle dog at necropsy. A histological examination revealed diffuse extensive cellular infiltration from the superficial to deep dermis in most parts of the skin around the fourth and fifth mammary papilla without nodule formation. Tumor cells were fairly monomorphic, well-differentiated mast cells with round nuclei of small distinct nucleoli and moderate to abundant, slightly eosinophilic and granular cytoplasm. A perivascular arrangement of mast cells was noted at the margin of the lesions. Infiltration of eosinophils and degeneration of collagen were not observed in the dermis. Cutaneous mastocytosis was diagnosed based on these features. A sequence analysis of lesions revealed the deletion of Gln555 to Ile570 within the juxtamembrane domain of c-kit (exon 11). PMID:26989302

  18. A G-Rich Sequence within the c-kit Oncogene Promoter Forms a Parallel G-Quadruplex Having Asymmetric G-Tetrad Dynamics

    PubMed Central

    Hsu, Shang-Te Danny; Varnai, Peter; Bugaut, Anthony; Reszka, Anthony P.; Neidle, Stephen; Balasubramanian, Shankar

    2011-01-01

    Guanine-rich DNA sequences with the ability to form quadruplex structures are enriched in the promoter regions of protein-coding genes, particularly those of proto-oncogenes. G-quadruplexes are structurally polymorphic and their folding topologies can depend on the sample conditions. We report here on a structural study using solution state NMR spectroscopy of a second G-quadruplex-forming motif (c-kit2) that has been recently identified in the promoter region of the c-kit oncogene. In the presence of potassium ions, c-kit2 exists as an ensemble of structures that share the same parallel-stranded propeller-type conformations. Subtle differences in structural dynamics have been identified using hydrogen–deuterium exchange experiments by NMR spectroscopy, suggesting the coexistence of at least two structurally similar but dynamically distinct substates, which undergo slow interconversion on the NMR timescale. PMID:19705869

  19. A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics.

    PubMed

    Hsu, Shang-Te Danny; Varnai, Peter; Bugaut, Anthony; Reszka, Anthony P; Neidle, Stephen; Balasubramanian, Shankar

    2009-09-23

    Guanine-rich DNA sequences with the ability to form quadruplex structures are enriched in the promoter regions of protein-coding genes, particularly those of proto-oncogenes. G-quadruplexes are structurally polymorphic and their folding topologies can depend on the sample conditions. We report here on a structural study using solution state NMR spectroscopy of a second G-quadruplex-forming motif (c-kit2) that has been recently identified in the promoter region of the c-kit oncogene. In the presence of potassium ions, c-kit2 exists as an ensemble of structures that share the same parallel-stranded propeller-type conformations. Subtle differences in structural dynamics have been identified using hydrogen-deuterium exchange experiments by NMR spectroscopy, suggesting the coexistence of at least two structurally similar but dynamically distinct substates, which undergo slow interconversion on the NMR timescale. PMID:19705869

  20. C-Kit expression in the gallbladder of guinea pig with chronic calculous cholecystitis and the effect of Artemisia capillaris Thunb on interstitial cells of Cajal

    PubMed Central

    Feng, Hua; Wang, Fang; Wang, Changmiao

    2016-01-01

    Objective(s): To study the c-Kit expression in the gallbladder of cholesterol lithogenic guinea pig model and the effect of Artemisia capillaris Thunb on interstitial cells of Cajal (ICCs). Materials and Methods: A total of 45 guinea pigs were randomly assigned into three groups: the control group (guinea pigs fed a standard diet, normal group); the model group (guinea pigs fed a cholesterol gallstone-inducing diet); and the Chinese medicine group (guinea pigs fed the cholesterol gallstone-inducing diet and treated with A. capillaris through intragastric administration, therapy group). Each group had 15 guinea pigs. The gallbladders of the guinea pigs were harvested after 8 weeks. C-Kit expression was detected using an immunohistochemistry staining, real-time PCR, and Western blot analyses. The effect of A. capillaris on ICCs was evaluated by muscle strip contraction experiments. Results: C-Kit expression significantly decreased in the gallbladder of model group, but increased in the Chinese medicine group. The Contractility of guinea pig gallbladder muscle strip significantly improved in the Chinese medicine group. Conclusion: Our results indicated that A. capillaris improves gallbladder impairment by up-regulating c-Kit expression, and it also can improve the contractile response of in vitro guinea pig gallbladder muscle strips.

  1. Loss of c-Kit and bone marrow failure upon conditional removal of the GATA-2 C-terminal zinc finger domain in adult mice.

    PubMed

    Li, Haiyan S; Jin, Jin; Liang, Xiaoxuan; Matatall, Katie A; Ma, Ying; Zhang, Huiyuan; Ullrich, Stephen E; King, Katherine Y; Sun, Shao-Cong; Watowich, Stephanie S

    2016-09-01

    Heterozygous mutations in the transcriptional regulator GATA-2 associate with multilineage immunodeficiency, myelodysplastic syndrome (MDS), and acute myeloid leukemia (AML). The majority of these mutations localize in the zinc finger (ZnF) domains, which mediate GATA-2 DNA binding. Deregulated hematopoiesis with GATA-2 mutation frequently develops in adulthood, yet GATA-2 function in the bone marrow remains unresolved. To investigate this, we conditionally deleted the GATA-2 C-terminal ZnF (C-ZnF) coding sequences in adult mice. Upon Gata2 C-ZnF deletion, we observed rapid peripheral cytopenia, bone marrow failure, and decreased c-Kit expression on hematopoietic progenitors. Transplant studies indicated GATA-2 has a cell-autonomous role in bone marrow hematopoiesis. Moreover, myeloid lineage populations were particularly sensitive to Gata2 hemizygosity, while molecular assays indicated GATA-2 regulates c-Kit expression in multilineage progenitor cells. Enforced c-Kit expression in Gata2 C-ZnF-deficient hematopoietic progenitors enhanced myeloid colony activity, suggesting GATA-2 sustains myelopoiesis via a cell intrinsic role involving maintenance of c-Kit expression. Our results provide insight into mechanisms regulating hematopoiesis in bone marrow and may contribute to a better understanding of immunodeficiency and bone marrow failure associated with GATA-2 mutation. PMID:26660446

  2. Safety of Intracoronary Infusion of 20 Million C-Kit Positive Human Cardiac Stem Cells in Pigs

    PubMed Central

    Ghafghazi, Shahab; Moore IV, Joseph; Hong, Kyung U.; Elmore, Brandon; Amraotkar, Alok; Ganzel, Brian L.; Grubb, Kendra J.; Flaherty, Michael P.; Hunt, Gregory; Vajravelu, Bathri; Wysoczynski, Marcin; Bolli, Roberto

    2015-01-01

    Background There is mounting interest in using c-kit positive human cardiac stem cells (c-kitpos hCSCs) to repair infarcted myocardium in patients with ischemic cardiomyopathy. A recent phase I clinical trial (SCIPIO) has shown that intracoronary infusion of 1 million hCSCs is safe. Higher doses of CSCs may provide superior reparative ability; however, it is unknown if doses >1 million cells are safe. To address this issue, we examined the effects of 20 million hCSCs in pigs. Methods Right atrial appendage samples were obtained from patients undergoing cardiac surgery. The tissue was processed by an established protocol with eventual immunomagnetic sorting to obtain in vitro expanded hCSCs. A cumulative dose of 20 million cells was given intracoronarily to pigs without stop flow. Safety was assessed by measurement of serial biomarkers (cardiac: troponin I and CK-MB, renal: creatinine and BUN, and hepatic: AST, ALT, and alkaline phosphatase) and echocardiography pre- and post-infusion. hCSC retention 30 days after infusion was quantified by PCR for human genomic DNA. All personnel were blinded as to group assignment. Results Compared with vehicle-treated controls (n=5), pigs that received 20 million hCSCs (n=9) showed no significant change in cardiac function or end organ damage (assessed by organ specific biomarkers) that could be attributed to hCSCs (P>0.05 in all cases). No hCSCs could be detected in left ventricular samples 30 days after infusion. Conclusions Intracoronary infusion of 20 million c-kit positive hCSCs in pigs (equivalent to ~40 million hCSCs in humans) does not cause acute cardiac injury, impairment of cardiac function, or liver and renal injury. These results have immediate translational value and lay the groundwork for using doses of CSCs >1 million in future clinical trials. Further studies are needed to ascertain whether administration of >1 million hCSCs is associated with greater efficacy in patients with ischemic cardiomyopathy. PMID

  3. Successful treatment of c-kit-positive metastatic Adenoid Cystic Carcinoma (ACC) with a combination of curcumin plus imatinib: A case report.

    PubMed

    Demiray, M; Sahinbas, H; Atahan, S; Demiray, H; Selcuk, D; Yildirim, I; Atayoglu, A T

    2016-08-01

    Adenoid cystic carcinoma (ACC) is an aggressive malignant neoplasm of the secretory glands. Conventional chemotherapy has poor effectiveness against metastatic ACC. Thus, a novel effective therapy is needed against metastatic ACC. A majority of ACCs (up to 94%) express c-kit. Imatinib is monoclonal antibody with specific activity against c-kit but has not been found to be effective in treating patients with ACC in which c-kit is overexpressed and activated. The NF-κB and mTOR pathways have been shown that ubiquitously and concurrently activated, indicating that the inhibition of these pathways may represent a novel treatment approach for patients with ACC. Curcumin has been shown to inhibit NF-κB and NF-κB-related pathways. 43-year-old patient was diagnosed ACC from submandibular salivary gland. After complete resection of tumor adjuvant radiotherapy was initiated. Seven years later multiple lung metastases were detected and ACC was confirmed by re-biopsy. First-line chemotherapy failed. NF-κB and c-kit were overexpressed in the metastatic specimens. Therefore, we treated the patient with metastatic chemoresistant ACC with imatinib 400mg/day and intravenous curcumin 225mg/m(2) twice a week plus oral bioavailable curcumin Arantal(®) 2×84mg/day. At 24 months, we observed near complete anatomic and complete metabolic response. To our knowledge, this is the first report of a patient with a c-kit-positive ACC that is successfully treated with the combination of imatinib and curcumin in an integrative approach. PMID:27515884

  4. Receptor Tyrosine Kinase and Tyrosine Kinase Inhibitors

    PubMed Central

    Mirshafiey, Abbas; Ghalamfarsa, Ghasem; Asghari, Babak

    2014-01-01

    Receptor tyrosine kinases (RTKs) are essential components of signal transduction pathways that mediate cell-to-cell communication and their function as relay points for signaling pathways. They have a key role in numerous processes that control cellular proliferation and differentiation, regulate cell growth and cellular metabolism, and promote cell survival and apoptosis. Recently, the role of RTKs including TCR, FLT-3, c-Kit, c-Fms, PDGFR, ephrin, neurotrophin receptor, and TAM receptor in autoimmune disorder, especially rheumatoid arthritis and multiple sclerosis has been suggested. In multiple sclerosis pathogenesis, RTKs and their tyrosine kinase enzymes are selective important targets for tyrosine kinase inhibitor (TKI) agents. TKIs, compete with the ATP binding site of the catalytic domain of several tyrosine kinases, and act as small molecules that have a favorable safety profile in disease treatment. Up to now, the efficacy of TKIs in numerous animal models of MS has been demonstrated, but application of these drugs in human diseases should be tested in future clinical trials. PMID:25337443

  5. Podocalyxin-like protein 1 is a relevant marker for human c-kit(pos) cardiac stem cells.

    PubMed

    Moscoso, Isabel; Tejados, Naiara; Barreiro, Olga; Sepúlveda, Pilar; Izarra, Alberto; Calvo, Enrique; Dorronsoro, Akaitz; Salcedo, Juan Manuel; Sádaba, Rafael; Díez-Juan, Antonio; Trigueros, César; Bernad, Antonio

    2016-07-01

    Cardiac progenitor cells (CPCs) from adult myocardium offer an alternative cell therapy approach for ischaemic heart disease. Improved clinical performance of CPCs in clinical trials requires a comprehensive definition of their biology and specific interactions with the environment. In this work we characterize specific human CPC surface markers and study some of their related functions. c-kit(pos) human CPCs (hCPCs) were characterized for cell surface marker expression, pluripotency, early and late cardiac differentiation markers and therapeutic activity in a rat model of acute myocardial infarction. The results indicate that hCPCs are a mesenchymal stem cell (MSC)-like population, with a similar immunoregulatory capacity. A partial hCPC membrane proteome was analysed by liquid chromatography-mass spectrometry/mass spectrometry and 36 proteins were identified. Several, including CD26, myoferlin and podocalyxin-like protein 1 (PODXL), have been previously described in other stem-cell systems. Suppression and overexpression analysis demonstrated that PODXL regulates hCPC activation, migration and differentiation; it also modulates their local immunoregulatory capacity. Therefore, hCPCs are a resident cardiac population that shares many features with hMSCs, including their capacity for local immunoregulation. Expression of PODXL appears to favour the immature state of hCPCs, while its downregulation facilitates their differentiation. Copyright © 2016 John Wiley & Sons, Ltd. PMID:23897803

  6. Overexpression of angiopoietin-1 increases CD133+/c-kit+ cells and reduces myocardial apoptosis in db/db mouse infarcted hearts.

    PubMed

    Zeng, Heng; Li, Lanfang; Chen, Jian-Xiong

    2012-01-01

    Hematopoietic progenitor CD133(+)/c-kit(+) cells have been shown to be involved in myocardial healing following myocardial infarction (MI). Previously we demonstrated that angiopoietin-1(Ang-1) is beneficial in the repair of diabetic infarcted hearts. We now investigate whether Ang-1 affects CD133(+)/c-kit(+) cell recruitment to the infarcted myocardium thereby mediating cardiac repair in type II (db/db) diabetic mice. db/db mice were administered either adenovirus Ang-1 (Ad-Ang-1) or Ad-β-gal systemically immediately after ligation of the left anterior descending coronary artery (LAD). Overexpression of Ang-1 resulted in a significant increase in CXCR-4/SDF-1α expression and promoted CD133(+)/c-kit(+), CD133(+)/CXCR-4(+) and CD133(+)/SDF-1α(+) cell recruitment into ischemic hearts. Overexpression of Ang-1 led to significant increases in number of CD31(+) and smooth muscle-like cells and VEGF expression in bone marrow (BM). This was accompanied by significant decreases in cardiac apoptosis and fibrosis and an increase in myocardial capillary density. Ang-1 also upregulated Jagged-1, Notch3 and apelin expression followed by increases in arteriole formation in the infarcted myocardium. Furthermore, overexpression of Ang-1 resulted in a significant improvement of cardiac functional recovery after 14 days of ischemia. Our data strongly suggest that Ang-1 attenuates cardiac apoptosis and promotes cardiac repair by a mechanism involving in promoting CD133(+)/c-kit(+) cells and angiogenesis in diabetic db/db mouse infarcted hearts. PMID:22558265

  7. The afatinib resistance of in vivo generated H1975 lung cancer cell clones is mediated by SRC/ERBB3/c-KIT/c-MET compensatory survival signaling

    PubMed Central

    Booth, Laurence; Roberts, Jane L.; Tavallai, Mehrad; Webb, Timothy; Leon, Daniel; Chen, Jesse; McGuire, William P.; Poklepovic, Andrew; Dent, Paul

    2016-01-01

    We generated afatinib resistant clones of H1975 lung cancer cells by transient exposure of established tumors to the drug and collected the re-grown tumors. Afatinib resistant H1975 clones did not exhibit any additional mutations in proto-oncogenes when compared to control clones. Afatinib resistant H1975 tumor clones expressed less PTEN than control clones and in afatinib resistant clones this correlated with increased basal SRC Y416, ERBB3 Y1289, AKT T308 and mTOR S2448 phosphorylation, decreased expression of ERBB1, ERBB2 and ERBB3 and increased total expression of c-MET, c-KIT and PDGFRβ. Afatinib resistant clones were selectively killed by knock down of [ERBB3 + c-MET + c-KIT] but not by the individual or doublet knock down combinations. The combination of the ERBB1/2/4 inhibitor afatinib with the SRC family inhibitor dasatinib killed afatinib resistant H1975 cells in a greater than additive fashion; other drugs used in combination with dasatinib such as sunitinib, crizotinib and amufatinib were less effective. [Afatinib + dasatinib] treatment profoundly inactivated ERBB3, AKT and mTOR in the H1975 afatinib resistant clones and increased ATG13 S318 phosphorylation. Knock down of ATG13, Beclin1 or eIF2α strong suppressed killing by [ERBB3 + c-MET + c-KIT] knock down, but were only modestly protective against [afatinib + dasatinib] lethality. Thus afatinib resistant H1975 NSCLC cells rely on ERBB1- and SRC-dependent hyper-activation of residual ERBB3 and elevated signaling, due to elevated protein expression, from wild type c-MET and c-KIT to remain alive. Inhibition of ERBB3 signaling via both blockade of SRC and ERBB1 results in tumor cell death. PMID:26934000

  8. [Study of a role of the expression of a transmembranous CD117/C-Kit receptor in the progression of uveal melanomas].

    PubMed

    Anurova, O A; Likhvantseva, V G; Vereshchagina, M V

    2007-01-01

    The authors studied the expression of the protooncogen receptor involved in the regulation of major cell cycle processes in uveal melanoma. The studies performed by a highly sensitive immunohistochemical technique. The findings have allowed the authors to state that the membranous CD117/C-Kit receptor plays an important role in the progression of uveal melanomas. It is suggested that the use of the new drug Glivec is promising in treating uveal melanoma. PMID:18078058

  9. Epithelial cell-specific Act1 adaptor mediates interleukin-25-dependent helminth expulsion through expansion of Lin−c-Kit+ innate cell population

    PubMed Central

    Kang, Zizhen; Swaidani, Shadi; Yin, Weiguo; Wang, Chenhui; Barlow, Jillian L.; Gulen, Muhammet Fatih; Bulek, Katarzyna; Do, Jeong-su; Aronica, Mark; McKenzie, Andrew N. J.; Min, Booki; Li, Xiaoxia

    2012-01-01

    SUMMARY Interleukin-25 (IL-25 or IL-17E), a member of the structurally related IL-17 family, functions as an important mediator of T helper 2 cell-type (type 2) responses. We examined the cell-type specific role of IL-25-induced Act1-mediated signaling in protective immunity against helminth infection. Targeted Act1 deficiency in epithelial cells resulted in a marked delay in worm expulsion and abolished the expansion of the Lin−c-kit+ innate cell population in the mesenteric lymph node, lung and liver. Th2 cell-inducing cytokines (IL-25 and IL-33) expression were reduced in the intestinal epithelial cells from the infected and IL-25-injected epithelial-specific Act1-deficient mice. Adoptive transfer of Lin−c-kit+ cells or combined injection of IL-25 and IL-33 restored the type 2 responses in these mice. Taken together, these results suggest that epithelial-specific Act1 mediates the expansion of the Lin−c-kit+ innate cell population through the positive feedback loop of IL-25, initiating the type 2 immunity against helminth infection. PMID:22608496

  10. Epithelial cell-specific Act1 adaptor mediates interleukin-25-dependent helminth expulsion through expansion of Lin(-)c-Kit(+) innate cell population.

    PubMed

    Kang, Zizhen; Swaidani, Shadi; Yin, Weiguo; Wang, Chenhui; Barlow, Jillian L; Gulen, Muhammet Fatih; Bulek, Katarzyna; Do, Jeong-su; Aronica, Mark; McKenzie, Andrew N J; Min, Booki; Li, Xiaoxia

    2012-05-25

    Interleukin-25 (IL-25 or IL-17E), a member of the structurally related IL-17 family, functions as an important mediator of T helper 2 cell-type (type 2) responses. We examined the cell type-specific role of IL-25-induced Act1-mediated signaling in protective immunity against helminth infection. Targeted Act1 deficiency in epithelial cells resulted in a marked delay in worm expulsion and abolished the expansion of the Lin(-)c-Kit(+) innate cell population in the mesenteric lymph node, lung, and liver. Th2 cell-inducing cytokine (IL-25 and IL-33) expression were reduced in the intestinal epithelial cells from the infected and IL-25-injected epithelial-specific Act1-deficient mice. Adoptive transfer of Lin(-)c-Kit(+) cells or combined injection of IL-25 and IL-33 restored the type 2 responses in these mice. Taken together, these results suggest that epithelial-specific Act1 mediates the expansion of the Lin(-)c-Kit(+) innate cell population through the positive-feedback loop of IL-25, initiating the type 2 immunity against helminth infection. PMID:22608496

  11. Establishment of a novel high-affinity IgE receptor-positive canine mast cell line with wild-type c-kit receptors

    SciTech Connect

    Amagai, Yosuke; Tanaka, Akane; Ohmori, Keitaro; Matsuda, Hiroshi

    2008-02-15

    Much is known regarding participations of mast cells with innate and acquired immunity by secreting various cytokines and chemical mediators. However, details of mast cell biology still remain unclear. In this study, we successfully established a novel growth factor-independent mast cell line (MPT-1) derived from canine mast cell tumor. MPT-1 cells manifested factor-independent proliferation as floating cells containing a large amount of histamine, as well as chymase-like dog mast cell protease 3, in cytosolic granules. Particularly, MPT-1 cells expressed high-affinity IgE receptors (Fc{epsilon}RI) and wild-type c-kit receptors. Degranulation of MPT-1 cells was induced not only by stimulation with calcium ionophore but also by cross-linkage of the surface IgE. Given that MPT-1 is the first mast cell line with Fc{epsilon}RI which has no c-kit mutations, MPT-1 cells may provide great contribution for investigation of IgE-mediated activation mechanisms of mast cells, leading to development of effective treatment for allergic disorders.

  12. SCF/c-kit signaling is required in 12-O-tetradecanoylphorbol-13-acetate-induced migration and differentiation of hair follicle melanocytes for epidermal pigmentation.

    PubMed

    Qiu, Weiming; Yang, Ke; Lei, Mingxing; Yan, Hongtao; Tang, Hui; Bai, Xiufeng; Yang, Guihong; Lian, Xiaohua; Wu, Jinjin

    2015-05-01

    Hair follicle melanocyte stem cells (McSCs) are responsible for hair pigmentation and also function as a major melanocyte reservoir for epidermal pigmentation. However, the molecular mechanism promoting McSCs for epidermal pigmentation remains elusive. 12-O-tetradecanoylphorbol-13-acetate (TPA) mimics key signaling involved in melanocyte growth, migration and differentiation. We therefore investigated the molecular basis for the contribution of hair follicle McSCs to epidermal pigmentation using the TPA induction model. We found that repetitive TPA treatment of female C57BL/6 mouse dorsal skin induced epidermal pigmentation by increasing the number of epidermal melanocytes. Particularly, TPA treatment induced McSCs to initiate proliferation, exit the stem cell niche and differentiate. We also demonstrated that TPA promotes melanoblast migration and differentiation in vitro. At the molecular level, TPA treatment induced robust expression of stem cell factor (SCF) in keratinocytes and c-kit in melanoblasts and melanocytes. Administration of ACK2, a neutralizing antibody against the Kit receptor, suppressed mouse epidermal pigmentation, decreased the number of epidermal melanocytes, and inhibited melanoblast migration. Taken together, our data demonstrate that TPA promotes the expansion, migration and differentiation of hair follicle McSCs for mouse epidermal pigmentation. SCF/c-kit signaling was required for TPA-induced migration and differentiation of hair follicle melanocytes. Our findings may provide an excellent model to investigate the signaling mechanisms regulating epidermal pigmentation from mouse hair follicle McSCs, and a potential therapeutic option for skin pigmentation disorders. PMID:25727244

  13. mRNA Expression of Platelet-Derived Growth Factor Receptor-{beta} and C-KIT: Correlation With Pathologic Response to Cetuximab-Based Chemoradiotherapy in Patients With Rectal Cancer

    SciTech Connect

    Erben, Philipp Horisberger, Karoline; Muessle, Benjamin; Mueller, Martin Christian; Treschl, Anne; Ernst, Thomas; Kaehler, Georg; Stroebel, Philipp; Wenz, Frederik; Kienle, Peter; Post, Stefan; Hochhaus, Andreas; Willeke, Frank; Hofheinz, Ralf-Dieter

    2008-12-01

    Purpose: Deviant expression of platelet-derived growth factor receptor-{beta} (PDGFR{beta}) and c-kit was shown in patients with colorectal cancer. In the present study, mRNA expression of PDGFR{beta} and c-kit in 33 patients with locally advanced rectal cancer undergoing preoperative chemoradiotherapy with cetuximab/capecitabine/irinotecan in correlation with the tumor regression rate was investigated. Methods and Materials: Pretherapeutic biopsy cores and tumor material from the resected specimens were collected in parallel with normal rectal mucosa. The expression levels of PDGFR{beta} and c-kit were measured by quantitative polymerase chain reaction. Tumors were classified as good responders (tumor regression grade [TRG], 2-3) or poor responders (TRG, 0-1). Results: The TRG evaluation of the resected specimen was TRG 0-1 in 11 and TRG 2-3 in 22. The median normalized ratios in the pretreatment mucosa vs. tumor biopsy cores was as follows: PDGFR{beta} ratio of 15.2 vs. 49.5 (p <0.0001) and c-kit ratio of 0.94 vs. 0.67 (p = 0.014). The same tendency was observed for the median PDGFR{beta} ratios after chemoradiotherapy completion: 34.2 vs. 170.0 (p <0.0001). The PDGFR{beta} and c-kit mRNA expression values in the pretreatment tumor biopsy cores were lower than the values in the resected specimens: PDGFR{beta} ratio 49.5 vs. 170.0 (p = 0.0002) and c-kit ratio 0.67 vs. 1.1 (p = 0.0003). Nevertheless, no correlation was seen between the pretherapeutic PDGFR{beta} and c-kit mRNA expression and the pathologic regression rate. Conclusion: Cetuximab-based chemoradiotherapy increased PDGFR{beta} levels even further compared with the pretreatment samples and deserves further investigation.

  14. The Transcription Factor Ehf Is Involved in TGF-β-Induced Suppression of FcεRI and c-Kit Expression and FcεRI-Mediated Activation in Mast Cells.

    PubMed

    Yamazaki, Susumu; Nakano, Nobuhiro; Honjo, Asuka; Hara, Mutsuko; Maeda, Keiko; Nishiyama, Chiharu; Kitaura, Jiro; Ohtsuka, Yoshikazu; Okumura, Ko; Ogawa, Hideoki; Shimizu, Toshiaki

    2015-10-01

    FcεRI, which is composed of α, β, and γ subunits, plays an important role in IgE-mediated allergic responses. TGF-β1 has been reported to suppress FcεRI and stem cell factor receptor c-Kit expression on mast cell surfaces and to suppress mast cell activation induced by cross-linking of FcεRI. However, the molecular mechanism by which these expressions and activation are suppressed by TGF-β1 remains unclear. In this study, we found that the expression of Ets homologous factor (Ehf), a member of the Ets family transcriptional factors, is upregulated by TGF-β/Smad signaling in mouse bone marrow-derived mast cells (BMMCs). Forced expression of Ehf in BMMCs repressed the transcription of genes encoding FcεRIα, FcεRIβ, and c-Kit, resulting in a reduction in cell surface FcεRI and c-Kit expression. Additionally, forced expression of Ehf suppressed FcεRI-mediated degranulation and cytokine production. Ehf inhibited the promoter activity of genes encoding FcεRIα, FcεRIβ, and c-Kit by binding to these gene promoters. Furthermore, the mRNA levels of Gata1, Gata2, and Stat5b were lower in BMMCs stably expressing Ehf compared with control cells. Because GATA-1 and GATA-2 are positive regulators of FcεRI and c-Kit expression, decreased expression of GATAs may be also involved in the reduction of FcεRI and c-Kit expression. Decreased expression of Stat5 may contribute to the suppression of cytokine production by BMMCs. In part, mast cell response to TGF-β1 was mimicked by forced expression of Ehf, suggesting that TGF-β1 suppresses FcεRI and c-Kit expression and suppresses FcεRI-mediated activation through upregulation of Ehf. PMID:26297757

  15. Increased SCF/c-kit by hypoxia promotes autophagy of human placental chorionic plate-derived mesenchymal stem cells via regulating the phosphorylation of mTOR.

    PubMed

    Lee, Youjin; Jung, Jieun; Cho, Kyung Jin; Lee, Seoung-Kwan; Park, Jong-Wan; Oh, Il-Hoan; Kim, Gi Jin

    2013-01-01

    Hypoxia triggers physiological and pathological cellular processes, including proliferation, differentiation, and death, in several cell types. Mesenchymal stem cells (MSCs) derived from various tissues have self-renewal activity and can differentiate towards multiple lineages. Recently, it has been reported that hypoxic conditions tip the balance between survival and death by hypoxia-induced autophagy, although the underlying mechanism is not clear. The objectives of this study are to compare the effect of hypoxia on the self-renewal of bone marrow-derived mesenchymal stem cells (BM-MSCs) and placental chorionic plate-derived mesenchymal stem cells (CP-MSCs) and to investigate the regulatory mechanisms of self-renewal in each MSC type during hypoxia. The expression of self-renewal markers (e.g., Oct4, Nanog, Sox2) was assessed in both cell lines. PI3K and stem cell factor (SCF) expression gradually increased in CP-MSCs but were markedly downregulated in BM-MSCs by hypoxia. The phosphorylation of ERK and mTOR was augmented by hypoxia in CP-MSCs compared to control. Also, the expression of LC3 II, a component of the autophagosome and the hoof-shaped autophagosome was detected more rapidly in CP-MSCs than in BM-MSCs under hypoxia. Hypoxia induced the expression of SCF in CP-MSCs and increased SCF/c-kit pathway promotes the self-renewal activities of CP-MSCs via an autocrine/paracrine mechanism that balances cell survival and cell death events by autophagy. These activities occur to a greater extent in CP-MSCs than in BM-MSCs through regulating the phosphorylation of mTOR. These findings will provide useful guidelines for better understanding the function of SCF/c-kit in the self-renewal and autophagy-regulated mechanisms that promote of MSC survival. PMID:22833529

  16. Amyloid precursor protein cooperates with c-KIT mutation/overexpression to regulate cell apoptosis in AML1-ETO-positive leukemia via the PI3K/AKT signaling pathway.

    PubMed

    Yu, Guopan; Yin, Changxin; Jiang, Ling; Zheng, Zhongxin; Wang, Zhixiang; Wang, Chunli; Zhou, Hongsheng; Jiang, Xuejie; Liu, Qifa; Meng, Fanyi

    2016-09-01

    It has been reported that amyloid precursor protein (APP) promotes cell proliferation and metastasis in various types of solid cancers. In our previous study, we showed that APP is highly expressed and regulates leukemia cell migration in AML1‑ETO-positive (AE) leukemia. Whether APP is involved in the regulation of AE leukemia cell proliferation or apoptosis is unclear. In the present study we focused on the correlation of APP with c-KIT mutation/overexpression and cell proliferation and apoptosis in AE leukemia. APP and c-KIT expression detected by quantitative real-time (qPCR) method, and c-KIT mutations screened using PCR in bone marrow cells from 65 patients with AE leukemia before their first chemotherapy, were simultaneously assessed. Furthermore, the Kasumi-1 cell line was chosen as the cell model, and the APP gene was knocked down using siRNA technology. The correlation of cell cycle distribution and apoptosis and c-Kit expression with APP expression levels, as well as the regulation of the PI3K/AKT signaling pathway by APP were analyzed in the Kasumi-1 cell line. The results showed that peripheral white blood cell counts (P=0.008) and bone marrow cellularity (P=0.031), but not bone marrow blasts, were correlated with APP expression. Moreover, the patients with APP high expression had a significantly higher incidence of c-KIT mutations (P<0.001) and increased levels of c-KIT expression (P=0.001) and poorer disease outcome. In the Kasumi-1 cell line, as compared with the wild-type and negative control cells, cell apoptosis, both early (P<0.001) and late (P<0.001), was significantly increased when the APP gene was knocked down, concomitant with reduced levels of anti-apoptotic protein Bcl-2 and increased levels of caspase-3 and -9, however, no apparent change was observed in the cell cycle distribution (P>0.05). Moreover, the knockdown of APP markedly decreased c-KIT expression at both the transcription (as evidenced by qPCR analysis) and translation

  17. Biological effect of tyrosine kinase inhibitors on three canine mast cell tumor cell lines with various KIT statuses.

    PubMed

    Takeuchi, Y; Fujino, Y; Fukushima, K; Watanabe, M; Nakagawa, T; Ohno, K; Sasaki, N; Sugano, S; Tsujimoto, H

    2012-02-01

    Tyrosine kinase inhibitors (TKIs) can be important in the treatment of canine mast cell tumor (cMCT). Meanwhile, some TKIs have been identified as substrates for ABCB1. The inhibitory effect of four TKIs (axitinib, imatinib, masitinib, and vatalanib) for proliferation and phosphorylation of c-Kit receptor as well as the expression and function of ABCB1 were investigated in three cMCT cell lines (HRMC, VIMC1, and CMMC1). The IC(50) values of the TKIs in HRMC, the only cell line with wild-type KIT, were clearly higher than those in CMMC1 and VIMC1. In HRMC and CMMC1, both the growth and phosphorylation of c-Kit receptor were suppressed proportionally by the TKIs. VIMC1 required higher concentrations for the inhibition of c-Kit receptor phosphorylation than those in cell growth. The treatment with cyclosporine increased the effects of the TKIs on VIMC1 since ABCB1 was expressed in VIMC1. The results indicated that cMCT cell lines harboring wild-type KIT had lower sensitivity to TKIs. The growth of VIMC1 was seemingly reduced by TKIs through the inhibition of other tyrosine kinases than c-Kit receptor. There was little influence of ABCB1 on TKI effects to the proliferation of VIMC1. These results will be helpful to understand the different sensitivity to TKIs in cMCT patients. PMID:21480930

  18. Nicotinic acetylcholine receptors induce c-Kit ligand/Stem Cell Factor and promote stemness in an ARRB1/ β-arrestin-1 dependent manner in NSCLC

    PubMed Central

    Perumal, Deepak; Pillai, Smitha; Nguyen, Jonathan; Schaal, Courtney; Coppola, Domenico; Chellappan, Srikumar P.

    2014-01-01

    Lung cancer remains the leading cause of cancer-related deaths worldwide. β-arrestin-1 (ARRB1), a scaffolding protein involved in the desensitization of signals arising from activated G-protein-coupled receptors (GPCRs), has been shown to play a role in invasion and proliferation of cancer cells, including nicotine-induced proliferation of human non–small cell lung cancers (NSCLCs). In this study, we identified genes that are differentially regulated by nicotine in an ARRB1/β-arrestin-1 dependent manner in NSCLC cells by microarray analysis. Among the identified genes, SCF (Stem cell factor) strongly differentiated smokers from non-smokers in the Director's Challenge Set expression data and its high expression correlated with poor prognosis. SCF, a major cytokine is the ligand for the c-Kit proto-oncogene and was found to be over expressed in human lung adenocarcinomas, but not squamous cell carcinomas. Data presented here show that transcription factor E2F1 can induce SCF expression at the transcriptional level and depletion of E2F1 or ARRB1/β-arrestin-1 could not promote self-renewal of SP cells. These studies suggest that nicotine might be promoting NSCLC growth and metastasis by inducing the secretion of SCF, and raise the possibility that targeting signalling cascades that activate E2F1 might be an effective way to combat NSCLC. PMID:25401222

  19. Interferon-producing killer dendritic cells (IKDCs) arise via a unique differentiation pathway from primitive c-kitHiCD62L+ lymphoid progenitors.

    PubMed

    Welner, Robert S; Pelayo, Rosana; Garrett, Karla P; Chen, Xinrong; Perry, S Scott; Sun, Xiao-Hong; Kee, Barbara L; Kincade, Paul W

    2007-06-01

    Interferon-producing killer dendritic cells (IKDCs) have only recently been described and they share some properties with plasmacytoid dendritic cells (pDCs). We now show that they can arise from some of the same progenitors. However, IKDCs expressed little or no RAG-1, Spi-B, or TLR9, but responded to the TLR9 agonist CpG ODN by production of IFNgamma. The RAG-1(-)pDC2 subset was more similar to IKDCs than RAG-1(+) pDC1s with respect to IFNgamma production. The Id-2 transcriptional inhibitor was essential for production of IKDCs and natural killer (NK) cells, but not pDCs. IKDCs developed from lymphoid progenitors in culture but, unlike pDCs, were not affected by Notch receptor ligation. While IKDCs could be made from estrogen-sensitive progenitors, they may have a slow turnover because their numbers did not rapidly decline in hormone-treated mice. Four categories of progenitors were compared for IKDC-producing ability in transplantation assays. Of these, Lin(-)Sca-1(+)c-Kit(Hi)Thy1.1(-)L-selectin(+) lymphoid progenitors (LSPs) were the best source. While NK cells resemble IKDCs in several respects, they develop from different progenitors. These observations suggest that IKDCs may arise from a unique differentiation pathway, and one that diverges early from those responsible for NK cells, pDCs, and T and B cells. PMID:17317852

  20. Transformation of erythroid progenitors by viral and cellular tyrosine kinases.

    PubMed

    Beug, H; Schroeder, C; Wessely, O; Deiner, E; Meyer, S; Ischenko, I D; Hayman, M J

    1995-08-01

    Recently, two different normal avian erythroid progenitors were described. They differ in the receptor tyrosine kinases they express and in their ability to undergo self-renewal in culture. A common progenitor, termed stem cell factor (SCF) progenitor, expresses the receptor for avian SCF c-Kit, and undergoes short-term self-renewal when grown in the presence of avian SCF. A second progenitor, referred to as SCF/transforming growth factor-alpha progenitor, coexpresses c-Kit and the avian epidermal growth factor receptor homologue c-ErbB. These progenitors undergo sustained self-renewal when grown in the presence of transforming growth factor-alpha plus estradiol. The phenotype of the normal SCF/transforming growth factor-alpha progenitors closely corresponded to that of erythroid cells transformed by the tyrosine kinase oncogenes v-erbB or v-sea. This suggested that these cells, but not the SCF progenitors, would be the target cells for erythroblast transformation by these oncogenes. However, we demonstrate that both progenitor cells can be transformed by the v-erbB and v-sea oncogenes and also by the ligand-activated proto-oncogene product c-ErbB. We conclude that the target cell specificity of certain tyrosine kinase oncoproteins for erythroid cells is a reflection of their ability to provide signals for self-renewal that normally emanate from the endogenous c-ErbB protein. PMID:8547228

  1. Long noncoding RNA H19 mediates melatonin inhibition of premature senescence of c-kit(+) cardiac progenitor cells by promoting miR-675.

    PubMed

    Cai, Benzhi; Ma, Wenya; Bi, Chongwei; Yang, Fan; Zhang, Lai; Han, Zhenbo; Huang, Qi; Ding, Fengzhi; Li, Yuan; Yan, Gege; Pan, Zhenwei; Yang, Baofeng; Lu, Yanjie

    2016-08-01

    Melatonin, a hormone secreted by the pineal gland, possesses multiple biological activities such as antitumor, antioxidant, and anti-ischemia. C-kit(+) cardiac progenitor cells (CPCs) have emerged as a promising tool for the treatment of heart diseases. However, the senescence of CPCs due to pathological stimuli leads to the decline of CPCs' functions and regenerative potential. This study was conducted to demonstrate whether melatonin antagonizes the senescence of CPCs in response to oxidative stress. Here, we found that the melatonin treatment markedly inhibited the senescent characteristics of CPCs after exposed to sublethal concentration of H2 O2 , including the increase in senescence-associated β-galactosidase (SA-β-gal)-positive CPCs, senescence-associated heterochromatin loci (SAHF), secretory IL-6 level, and the upregulation of p53 and p21 proteins. Senescence-associated proliferation reduction was also attenuated by melatonin in CPCs. Luzindole, the melatonin membrane receptor blocker, may block the melatonin-mediated suppression of premature senescence in CPCs. Interestingly, we found that long noncoding RNA H19 and its derived miR-675 were downregulated by H2 O2 in CPCs, but melatonin treatment could counter this alteration. Furthermore, knockdown of H19 or miR-675 blocked antisenescence actions of melatonin on H2 O2 -treated CPCs. It was further verified that H19-derived miR-675 targeted at the 3'UTR of USP10, which resulted in the downregulation of p53 and p21 proteins. In summary, melatonin antagonized premature senescence of CPCs via H19/miR-675/USP10 pathway, which provides new insights into pharmacological actions and potential applications of melatonin on the senescence of CPCs. PMID:27062045

  2. TGFBIp regulates differentiation of EPC (CD133(+) C-kit(+) Lin(-) cells) to EC through activation of the Notch signaling pathway.

    PubMed

    Maeng, Yong-Sun; Choi, Yeon Jeong; Kim, Eung Kweon

    2015-06-01

    Endothelial progenitor cells (EPCs) in the circulatory system have been suggested to maintain vascular homeostasis and contribute to adult vascular regeneration and repair. These processes require that EPCs recognize the extracellular matrix (ECM), migrate, differentiate, and undergo tube morphogenesis. The ECM plays a critical role by providing biochemical and biophysical cues that regulate cellular behavior. Here, we tested the importance of transforming growth factor-beta-induced protein (TGFBIp) in regulation of the differentiation and angiogenic potential of human cord blood-derived EPCs (CD133(+) C-kit(+) Lin(-) cells). EPCs displayed increased endothelial differentiation when plated on TGFBIp compared to fibronectin. EPCs also exhibited increased adhesion and migration upon TGFBIp stimulation. Moreover, TGFBIp induced phosphorylation of the intracellular signaling molecules SRC, FAK, AKT, JNK, and ERK in EPCs. Using integrin-neutralizing antibodies, we showed that the effects of TGFBIp on EPCs are mediated by integrins α4 and α5. Furthermore, TGFBIp increased the adhesion, migration, and tube formation of CD34(+) mouse bone marrow stem cells in vitro. Gene expression analysis of EPCs plated on TGFBIp revealed that EPCs stimulated by TGFBIp exhibit increased expression of Notch ligands, such as delta-like 1 (DLL1) and Jagged1 (JAG1), through nuclear factor-kappa B signaling activation. Collectively, our findings demonstrate, for the first time, that locally generated TGFBIp at either wounds or tumor sites may contribute to differentiation and angiogenic function of EPCs by augmenting the recruitment of EPCs and regulating the expression of endothelial genes DLL1 and JAG1. PMID:25786978

  3. Annexin A8 identifies a subpopulation of transiently quiescent c-kit positive luminal progenitor cells of the ductal mammary epithelium.

    PubMed

    Iglesias, Juan Manuel; Cairney, Claire J; Ferrier, Roderick K; McDonald, Laura; Soady, Kelly; Kendrick, Howard; Pringle, Marie-Anne; Morgan, Reginald O; Martin, Finian; Smalley, Matthew J; Blyth, Karen; Stein, Torsten

    2015-01-01

    We have previously shown that Annexin A8 (ANXA8) is strongly associated with the basal-like subgroup of breast cancers, including BRCA1-associated breast cancers, and poor prognosis; while in the mouse mammary gland AnxA8 mRNA is expressed in low-proliferative isolated pubertal mouse mammary ductal epithelium and after enforced involution, but not in isolated highly proliferative terminal end buds (TEB) or during pregnancy. To better understand ANXA8's association with this breast cancer subgroup we established ANXA8's cellular distribution in the mammary gland and ANXA8's effect on cell proliferation. We show that ANXA8 expression in the mouse mammary gland was strong during pre-puberty before the expansion of the rudimentary ductal network and was limited to a distinct subpopulation of ductal luminal epithelial cells but was not detected in TEB or in alveoli during pregnancy. Similarly, during late involution its expression was found in the surviving ductal epithelium, but not in the apoptotic alveoli. Double-immunofluorescence (IF) showed that ANXA8 positive (+ve) cells were ER-alpha negative (-ve) and mostly quiescent, as defined by lack of Ki67 expression during puberty and mid-pregnancy, but not terminally differentiated with ∼15% of ANXA8 +ve cells re-entering the cell cycle at the start of pregnancy (day 4.5). RT-PCR on RNA from FACS-sorted cells and double-IF showed that ANXA8+ve cells were a subpopulation of c-kit +ve luminal progenitor cells, which have recently been identified as the cells of origin of basal-like breast cancers. Over expression of ANXA8 in the mammary epithelial cell line Kim-2 led to a G0/G1 arrest and suppressed Ki67 expression, indicating cell cycle exit. Our data therefore identify ANXA8 as a potential mediator of quiescence in the normal mouse mammary ductal epithelium, while its expression in basal-like breast cancers may be linked to ANXA8's association with their specific cells of origin. PMID:25803307

  4. Tyrosine kinase receptors as molecular targets In pheochromocytomas and paragangliomas

    PubMed Central

    Cassol, Clarissa A.; Winer, Daniel; Liu, Wei; Guo, Miao; Ezzat, Shereen; Asa, Sylvia L.

    2016-01-01

    Pheochromocytomas and paragangliomas are neuroendocrine tumors shown to be responsive to multi-targeted tyrosine kinase inhibitor treatment. Despite growing knowledge regarding their genetic basis, the ability to predict behavior in these tumors remains challenging. There is also limited knowledge of their tyrosine kinase receptor expression and whether the clinical response observed to the tyrosine kinase inhibitor Sunitinib relates only to its anti-angiogenic properties or also due to a direct effect on tumor cells. To answer these questions, an in vitro model of sunitinib treatment of a pheochromocytoma cell line was created. Sunitinib targets (VEGFRs, PDGFRs, C-KIT), FGFRs and cell cycle regulatory proteins were investigated in human tissue microarrays. SDHB immunohistochemistry was used as a surrogate marker for the presence of succinate dehydrogenase mutations. The FGFR4 G388R SNP was also investigated. Sunitinib treatment in vitro decreases cell proliferation mainly by targeting cell cycle, DNA metabolism, and cell organization genes. FGFR1, -2 and -4, VEGFR2, PDGFRα and p16 were overexpressed in primary human pheochromocytomas and paragangliomas. Discordant results were observed for VEGFR1, p27 and p21 (overexpressed in paragangliomas but underexpressed in pheochromoctyomas); PDGFRβ, Rb and Cyclin D1 (overexpressed in paragangliomas only) and FGFR3 (overexpressed in pheochromocytomas and underexpressed in paragangliomas). Low expression of C-KIT, p53, Aurora Kinase A and B was observed. Nuclear FGFR2 expression was associated with increased risk of metastasis (odds ratio [OR]=7.61; p=0.008), as was membranous PDGFRα (OR= 13.71, p=0.015), membranous VEGFR1 (OR=8.01; p=0.037), nuclear MIB1 (OR=1.26, p=0.008) and cytoplasmic p27 (OR=1.037, p=0.030). FGFR3, VEGFR2 and C-KIT levels were associated with decreased risk of metastasis. We provide new insights into the mechanistic actions of sunitinib in pheochromoctyomas and paragangliomas and support current

  5. Mutation D816V Alters the Internal Structure and Dynamics of c-KIT Receptor Cytoplasmic Region: Implications for Dimerization and Activation Mechanisms

    PubMed Central

    Laine, Elodie; Chauvot de Beauchêne, Isaure; Perahia, David; Auclair, Christian; Tchertanov, Luba

    2011-01-01

    The type III receptor tyrosine kinase (RTK) KIT plays a crucial role in the transmission of cellular signals through phosphorylation events that are associated with a switching of the protein conformation between inactive and active states. D816V KIT mutation is associated with various pathologies including mastocytosis and cancers. D816V-mutated KIT is constitutively active, and resistant to treatment with the anti-cancer drug Imatinib. To elucidate the activating molecular mechanism of this mutation, we applied a multi-approach procedure combining molecular dynamics (MD) simulations, normal modes analysis (NMA) and binding site prediction. Multiple 50-ns MD simulations of wild-type KIT and its mutant D816V were recorded using the inactive auto-inhibited structure of the protein, characteristic of type III RTKs. Computed free energy differences enabled us to quantify the impact of D816V on protein stability in the inactive state. We evidenced a local structural alteration of the activation loop (A-loop) upon mutation, and a long-range structural re-organization of the juxta-membrane region (JMR) followed by a weakening of the interaction network with the kinase domain. A thorough normal mode analysis of several MD conformations led to a plausible molecular rationale to propose that JMR is able to depart its auto-inhibitory position more easily in the mutant than in wild-type KIT and is thus able to promote kinase mutant dimerization without the need for extra-cellular ligand binding. Pocket detection at the surface of NMA-displaced conformations finally revealed that detachment of JMR from the kinase domain in the mutant was sufficient to open an access to the catalytic and substrate binding sites. PMID:21698178

  6. Identification of the STAT5B-RARα fusion transcript in an acute promyelocytic leukemia patient without FLT3, NPM1, c-Kit and C/EBPα mutation.

    PubMed

    Qiao, Chun; Zhang, Su-Jiang; Chen, Li-Juan; Miao, Kou-Rong; Zhang, Jian-Fu; Wu, Yu-Jie; Qiu, Hai-Rong; Li, Jian-Yong

    2011-05-01

    T(15;17) is the most common chromosomal aberration in patients with acute promyelocytic leukemia (APL), leading to the formation of PML-RARα fusion gene. In a small subset of patients with APL, the RARα gene is fused with different partners. Here, we report a rare APL case with STAT5B-RARα fusion transcript. Cytomorphologic and immunophenotypic analyses showed typical features of APL. However, cytogenetic analysis showed normal karyotype, and interphase fluorescence in situ hybridization (FISH) showed PML-RARα negative. Quantitative RT-PCR also showed PML-RARα negative but STAT5B-RARα positive and sequencing analysis confirmed the result. Molecular markers including FLT3, NPM1, c-Kit and C/EBPα mutation were all negative. To our knowledge, this is the first APL patient with STAT5B-RARα in Chinese population and the fifth patient around the world according to published paper. PMID:21447089

  7. The prevalence and clinical profiles of FLT3-ITD, FLT3-TKD, NPM1, C-KIT, DNMT3A, and CEBPA mutations in a cohort of patients with de novo acute myeloid leukemia from southwest China.

    PubMed

    Gou, Haimei; Zhou, Juan; Ye, Yuanxin; Hu, Xuejiao; Shang, Mengqiao; Zhang, Jingya; Zhao, Zhenzhen; Peng, Wu; Zhou, Yanhong; Zhou, Yi; Song, Xingbo; Lu, Xiaojun; Ying, Binwu

    2016-06-01

    While a substantial amount of data on gene mutations related to acute myeloid leukemia (AML) prognosis from western and other populations have been reported, these studies largely describe one or two genes. Additionally, in southwest China, only insufficient data exist regarding FLT3-ITD, FLT3-TKD, NPM1, C-KIT, DNMT3A, and CEBPA mutations have been widely used in clinical settings. Therefore, a comprehensive study about these mutations of clinical importance in the prognosis of AML in western China is necessary. In a cohort of 255 patients with de novo AML, we retrospectively analyzed the prevalence of the six gene mutations, and then we assessed the results in conjunction with clinical characteristics and treatment responses. As for the frequencies of these mutations, the NPM1 mutation occurred most frequently (17.7 %; 42/237), followed by the CEBPA mutation (15.0 %; 19/127) and the FLT3-ITD mutation (10.2 %; 25/244). The frequencies of the FLT3-TKD, DNMT3A, and C-KIT mutations were 3.7 % (9/234), 4.0 % (9/225) and 4.2 % (10/238), respectively. These mutations were closely related to clinical characteristics including FAB classification, gender and age, hemogram, blasts (%), fusion genes, and immunophenotypes. Additionally, a higher complete remission (CR) rate was found in NPM1-mutated patients. The occurrence of these mutations is variable among different countries and regions worldwide, which may provide clues to the etiology of AML. Besides, we identified new clinical characteristics that advance our understanding of these mutations and further clarify the involvement of these mutations in the development of leukemia. PMID:26676635

  8. Tyrosine kinase inhibitors (TKIs) in human and pet tumours with special reference to breast cancer: a comparative review.

    PubMed

    Ranieri, Girolamo; Pantaleo, Marianna; Piccinno, Mariagrazia; Roncetti, Maria; Mutinati, Maddalena; Marech, Ilaria; Patruno, Rosa; Rizzo, Annalisa; Sciorsci, Raffaele Luigi

    2013-11-01

    Tyrosine kinase receptors (TKRs) play a key role in tumour cell proliferation and survival since they are involved in endothelial cell activation leading to tumour neoangiogenesis. In particular, vascular endothelial growth factor receptors (VEGFRs), platelet-derived growth factor receptor (PDGFR), stem cell factor receptor (c-KitR), and colony-stimulating factor 1 (CSF-1) are overexpressed or constitutively activated in human and pet malignancies. A variety of small molecule inhibitors targeting specific tyrosine kinases (known as tyrosine kinase inhibitors or TKIs) have recently been approved, or are under investigation, for the treatment of human cancer. TKI application in animal cancer is however relatively recent. This review aims to illustrate the major aspects of tyrosine kinase dysfunctions, with special regard to human and animal cancer of the mammary gland, providing an update on the background of the anti-angiogenic and anti-neoplastic properties of TKIs in human and veterinary cancer. PMID:23768779

  9. Combined targeting of BCL-2 and BCR-ABL tyrosine kinase eradicates chronic myeloid leukemia stem cells.

    PubMed

    Carter, Bing Z; Mak, Po Yee; Mu, Hong; Zhou, Hongsheng; Mak, Duncan H; Schober, Wendy; Leverson, Joel D; Zhang, Bin; Bhatia, Ravi; Huang, Xuelin; Cortes, Jorge; Kantarjian, Hagop; Konopleva, Marina; Andreeff, Michael

    2016-09-01

    BCR-ABL tyrosine kinase inhibitors (TKIs) are effective against chronic myeloid leukemia (CML), but they rarely eliminate CML stem cells. Disease relapse is common upon therapy cessation, even in patients with complete molecular responses. Furthermore, once CML progresses to blast crisis (BC), treatment outcomes are dismal. We hypothesized that concomitant targeting of BCL-2 and BCR-ABL tyrosine kinase could overcome these limitations. We demonstrate increased BCL-2 expression at the protein level in bone marrow cells, particularly in Lin(-)Sca-1(+)cKit(+) cells of inducible CML in mice, as determined by CyTOF mass cytometry. Further, selective inhibition of BCL-2, aided by TKI-mediated MCL-1 and BCL-XL inhibition, markedly decreased leukemic Lin(-)Sca-1(+)cKit(+) cell numbers and long-term stem cell frequency and prolonged survival in a murine CML model. Additionally, this combination effectively eradicated CD34(+)CD38(-), CD34(+)CD38(+), and quiescent stem/progenitor CD34(+) cells from BC CML patient samples. Our results suggest that BCL-2 is a key survival factor for CML stem/progenitor cells and that combined inhibition of BCL-2 and BCR-ABL tyrosine kinase has the potential to significantly improve depth of response and cure rates of chronic-phase and BC CML. PMID:27605552

  10. Novel aspects of therapy with the dual Src and Abl kinase inhibitor bosutinib in chronic myeloid leukemia.

    PubMed

    Keller-V Amsberg, Gunhild; Brümmendorf, Tim H

    2012-09-01

    The dual Src/Abl kinase inhibitor bosutinib (SKI-606) targets the tyrosine kinase brc-abl, the key enzyme in the development of chronic myeloid leukemia (CML). In clinical trials, bosutinib yielded promising results with regard to efficacy, tolerability and toxicity in first-, second- and third-line therapy of CML patients. Remarkably, bosutinib is able to overcome most imatinib-resistant BCR-ABL1-1 mutations except V299L and T315I. Mostly, low-to-moderate grade gastrointestinal toxicitis are the most common treatment-emergent adverse events observed under bosutinib. Unlike other tyrosine kinase inhibitors approved for CML treatment to date, bosutinib shows only minimal inhibitory activity against c-KIT and the PDGF receptor. This may be causative for its favorable hematologic toxicity profile. In this review, the authors give an overview on the mechanism of action and currently available preclinical and clinical data for bosutinib in CML. PMID:23098112

  11. How tyrosine kinase inhibitors impair metabolism and endocrine system function: a systematic updated review.

    PubMed

    Breccia, Massimo; Molica, Matteo; Alimena, Giuliana

    2014-12-01

    Tyrosine kinase inhibitors (TKIs) advent has deeply changed the outcome of chronic myeloid leukemia (CML) patients, with improved rates of response and overall survival. However, for this success some patients paid the price of a number of peculiar side effects, the so-called off-target side effects, specific for each one TKI. These effects are due to non-selective inhibition of other tyrosine kinase receptors, such as PDGFR, c-KIT, Src, VEGF. Consequences of this inhibition, some metabolic changes during the treatment with TKIs are reported. Aim of present review is to report metabolic changes and potential mechanisms involved in the pathogenesis related to imatinib, second (nilotinib and dasatinib) and third generation (bosutinib and ponatinib) TKIs. PMID:25449685

  12. Open trial of topical tacalcitol [1 alpha 24(OH)2D3] and solar irradiation for vitiligo vulgaris: upregulation of c-Kit mRNA by cultured melanocytes.

    PubMed

    Katayama, Ichiro; Ashida, Miwa; Maeda, Aki; Eishi, Kumiko; Murota, Hiroyuki; Bae, Sang Jae

    2003-01-01

    Vitiligo vulgaris is a common skin disease, however some cases show poor clinical responses to topical steroid ointment or PUVA therapy. Such regimens are generally avoided in the treatment of facial lesions or in pediatric cases because of the undesirable side effects. To confirm the excellent response to combination therapy with topical vitamin D3 ointment and solar irradiation for vitiligo achieved in the initial patients, we conducted an open trial on other patients, most of whom had poor clinical responses to the prior therapies. Fifteen patients (9 men and 6 women) with vitiligo vulgaris were enrolled in this study. Each patient was instructed to sunbathe for 30 minutes within 1 hour after topical application of the tacalcitol [1 alpha 24(OH)(2)D(3)] ointment or cream to the skin lesions every day. Six of 15 patients showed a fair and excellent clinical response to the combination therapy (more than 30% clearance of the vitiligo). The clinical effect was more apparent in patients with a history of less than 5 years of vitiligo (4 of 6 cases) in contrast to those with a history of more than 5 years (2 of 9 cases). In vitro experiments revealed that tacalcitol upregulated the expression of c-Kit mRNA by melanocytes irradiated with linear polarized infrared, UVA or short period solar irradiation. These results suggest that combination therapy with topical vitamin D(3) ointment and solar irradiation can be used as an alternate therapy for vitiligo vulgaris. PMID:12948918

  13. [MORPHOFUNCTIONAL STATE OF BLOOD CELLS AFTER CHRONIC EXPOSURE OF THE PROTEIN KINASES INHIBITOR MALEIMIDE DERIVATIVE].

    PubMed

    Byelinska, I V; Lynchak, O V; Tsyvinska, S M; Rybalchenko, V K

    2015-01-01

    The effect of the protein kinases inhibitor maleimide derivative (MI-1, 1-(4-Cl-benzyl)-3-Cl-4-(CF3-phenylamino)-1H-pyrrole-2,5-dione), inhibitor of VEGF-R1,2,3, FGF-R1, EGF-R(h), PDK1, Src(h), Syk(h), YES, ZAP70 et al. with antineoplastic activity, on blood cells parameters of rats after chronic exposure has been studied. Administration of MI-1 at doses 0.027 and 2.7 mg/kg (suppress colon carcinogenesis) for 20 and 26 weeks does not affect the morphofunctional state of red blood cells in healthy rats. This is confirmed by the lack of differences in the concentration of hemoglobin in blood, red blood cells count, mean corpuscular hemoglobin and mean corpuscular hemoglobin concentration, hematocrit and mean corpuscular volume, and the number of reticulocytes in blood after 20 and 26 weeks of exposure compared with the control group. MI-1 at indicated doses does not influence total leukocytes count and content (eosinophilic and neutrophilic granulocytes, lymphocytes, monocytes) and does not inhibit thrombocytopoiesis (platelet count remains unchanged). No negative effect of MI-1 on hematopoiesis is not limited (by the hemopoietic system) use of this compound as a potential antitumor drug PMID:26552308

  14. Next generation sequencing analysis of platinum refractory advanced germ cell tumor sensitive to Sunitinib (Sutent®) a VEGFR2/PDGFRβ/c-kit/ FLT3/RET/CSF1R inhibitor in a phase II trial

    PubMed Central

    2014-01-01

    Background Germ cell tumors (GCT) are the most common solid tumors in adolescent and young adult males (age 15 and 35 years) and remain one of the most curable of all solid malignancies. However a subset of patients will have tumors that are refractory to standard chemotherapy agents. The management of this refractory population remains challenging and approximately 400 patients continue to die every year of this refractory disease in the United States. Methods Given the preclinical evidence implicating vascular endothelial growth factor (VEGF) signaling in the biology of germ cell tumors, we hypothesized that the vascular endothelial growth factor receptor (VEGFR) inhibitor sunitinib (Sutent) may possess important clinical activity in the treatment of this refractory disease. We proposed a Phase II efficacy study of sunitinib in seminomatous and non-seminomatous metastatic GCT’s refractory to first line chemotherapy treatment (ClinicalTrials.gov Identifier: NCT00912912). Next generation targeted exome sequencing using HiSeq 2000 (Illumina Inc., San Diego, CA, USA) was performed on the tumor sample of the unusual responder. Results Five patients are enrolled into this Phase II study. Among them we report here the clinical course of a patient (Patient # 5) who had an exceptional response to sunitinib. Next generation sequencing to understand this patient’s response to sunitinib revealed RET amplification, EGFR and KRAS amplification as relevant aberrations. Oncoscan MIP array were employed to validate the copy number analysis that confirmed RET gene amplification. Conclusion Sunitinib conferred clinical benefit to this heavily pre-treated patient. Next generation sequencing of this ‘exceptional responder’ identified the first reported case of a RET amplification as a potential basis of sensitivity to sunitinib (VEGFR2/PDGFRβ/c-kit/ FLT3/RET/CSF1R inhibitor) in a patient with refractory germ cell tumor. Further characterization of GCT patients using

  15. Oncoprotein kinase

    DOEpatents

    Karin, Michael; Hibi, Masahiko; Lin, Anning

    2001-02-27

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD or 55 kD as determined by reducing SDS-PAGE, having serine and theonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  16. Essential Role of the p110β Subunit of Phosphoinositide 3-OH Kinase in Male Fertility

    PubMed Central

    Ciraolo, Elisa; Morello, Fulvio; Hobbs, Robin M.; Wolf, Frieder; Marone, Romina; Iezzi, Manuela; Lu, Xiaoyun; Mengozzi, Giulio; Altruda, Fiorella; Sorba, Giovanni; Guan, Kaomei; Pandolfi, Pier Paolo; Wymann, Matthias P.

    2010-01-01

    Phosphoinositide 3-kinases (PI3K) are key molecular players in male fertility. However, the specific roles of different p110 PI3K catalytic subunits within the spermatogenic lineage have not been characterized so far. Herein, we report that male mice expressing a catalytically inactive p110β develop testicular hypotrophy and impaired spermatogenesis, leading to a phenotype of oligo-azoospermia and defective fertility. The examination of testes from p110β-defective tubules demonstrates a widespread loss in spermatogenic cells, due to defective proliferation and survival of pre- and postmeiotic cells. In particular, p110β is crucially needed in c-Kit–mediated spermatogonial expansion, as c-Kit–positive cells are lost in the adult testis and activation of Akt by SCF is blocked by a p110β inhibitor. These data establish that activation of the p110β PI3K isoform by c-Kit is required during spermatogenesis, thus opening the way to new treatments for c-Kit positive testicular cancers. PMID:20053680

  17. Inhibitory effects of homeodomain-interacting protein kinase 2 on the aorta-gonad-mapharsen hematopoiesis

    SciTech Connect

    Ohtsu, Naoki; Nobuhisa, Ikuo; Mochita, Miyuki; Taga, Tetsuya . E-mail: taga@kaiju.medic.kumamoto-u.ac.jp

    2007-01-01

    Definitive hematopoiesis starts in the aorta-gonad-mesonephros (AGM) region of the mouse embryo. Our previous studies revealed that STAT3, a gp130 downstream transcription factor, is required for AGM hematopoiesis and that homeodomain-interacting protein kinase 2 (HIPK2) phosphorylates serine-727 of STAT3. HIPK2 is a serine/threonine kinase known to be involved in transcriptional repression and apoptosis. In the present study, we examined the role of HIPK2 in hematopoiesis in mouse embryo. HIPK2 transcripts were found in fetal hematopoietic tissues such as the mouse AGM region and fetal liver. In cultured AGM cells, HIPK2 protein was detected in adherent cells. Functional analyses of HIPK2 were carried out by introducing wild-type and mutant HIPK2 constructs into AGM cultures. Production of CD45{sup +} hematopoietic cells was suppressed by forced expression of HIPK2 in AGM cultures. This suppression required the kinase domain and nuclear localization signals of HIPK2, but the kinase activity was dispensable. HIPK2-overexpressing AGM-derived nonadherent cells did not form cobblestone-like colonies in cultures with stromal cells. Furthermore, overexpression of HIPK2 in AGM cultures impeded the expansion of CD45{sup low}c-Kit{sup +} cells, which exhibit the immature hematopoietic progenitor phenotype. These data indicate that HIPK2 plays a negative regulatory role in AGM hematopoiesis in the mouse embryo.

  18. Rho-Associated Kinase Inhibitor (Y-27632) Attenuates Doxorubicin-Induced Apoptosis of Human Cardiac Stem Cells

    PubMed Central

    Kan, Lijuan; Smith, Aubrie; Chen, Miao; Ledford, Benjamin T.; Fan, Huimin; Liu, Zhongmin; He, Jia-Qiang

    2015-01-01

    Background Recent clinical trials using c-kit+ human cardiac stem cells (CSCs) demonstrated promising results in increasing cardiac function and improving quality of life. However, CSC efficiency is low, likely due to limited cell survival and engraftment after transplantation. The Rho-associated protein kinase (ROCK) inhibitor, Y-27632, significantly increased cell survival rate, adhesion, and migration in numerous types of cells, including stem cells, suggesting a common feature of the ROCK-mediated apoptotic pathway that may also exist in human CSCs. In this study, we examine the hypothesis that pretreatment of human CSCs with Y-27632 protects cells from Doxorubicin (Dox) induced apoptosis. Methods and Results c-kit+ CSCs were cultured in CSC medium for 3–5 days followed by 48hr treatment with 0 to 10μM Y-27632 alone, 0 to 1.0μM Dox alone, or Y-27632 followed by Dox (48hrs). Cell viability, toxicity, proliferation, morphology, migration, Caspase-3 activity, expression levels of apoptotic-related key proteins and c-kit+ were examined. Results showed that 48hr treatment with Y-27632 alone did not result in great changes in c-kit+ expression, proliferation, Caspase-3 activity, or apoptosis; however cell viability was significantly increased and cell migration was promoted. These effects likely involve the ROCK/Actin pathways. In contrast, 48hr treatment with Dox alone dramatically increased Caspase-3 activity, resulting in cell death. Although Y-27632 alone did not affect the expression levels of apoptotic-related key factors (p-Akt, Akt, Bcl-2, Bcl-xl, Bax, cleaved Caspase-3, and Caspase-3) under basal conditions, it significantly inhibited the Dox-induced increase in cleaved Caspase-3 and reduced cell death under Dox treatment. Conclusions We conclude that preconditioning human CSCs with Y-27632 significantly reduces Dox-induced cell death and possibly involves the cleaved Caspase-3 and ROCK/Actin pathways. The beneficial effects of Y-27632 may be applied to

  19. Epidermal growth factor system regulates mucin production in airways

    PubMed Central

    Takeyama, Kiyoshi; Dabbagh, Karim; Lee, Heung-Man; Agustí, Carlos; Lausier, James A.; Ueki, Iris F.; Grattan, Kathleen M.; Nadel, Jay A.

    1999-01-01

    Goblet-cell hyperplasia is a critical pathological feature in hypersecretory diseases of airways. However, the underlying mechanisms are unknown, and no effective therapy exists. Here we show that stimulation of epidermal growth factor receptors (EGF-R) by its ligands, EGF and transforming growth factor α (TGFα), causes MUC5AC expression in airway epithelial cells both in in vitro and in vivo. We found that a MUC5AC-inducing epithelial cell line, NCI-H292, expresses EGF-R constitutively; EGF-R gene expression was stimulated further by tumor necrosis factor α (TNFα). EGF-R ligands increased the expression of MUC5AC at both gene and protein levels, and this effect was potentiated by TNFα. Selective EGF-R tyrosine kinase inhibitors blocked MUC5AC expression induced by EGF-R ligands. Pathogen-free rats expressed little EGF-R protein in airway epithelial cells; intratracheal instillation of TNFα induced EGF-R in airway epithelial cells, and subsequent instillation of EGF-R ligands increased the number of goblet cells, Alcian blue–periodic acid–Schiff staining (reflecting mucous glycoconjugates), and MUC5AC gene expression, whereas TNFα, EGF, or TGFα alone was without effect. In sensitized rats, three intratracheal instillations of ovalbumin resulted in EGF-R expression and goblet-cell production in airway epithelium. Pretreatment with EGF-R tyrosine kinase inhibitor, BIBX1522, prevented goblet-cell production both in rats stimulated by TNFα-EGF-R ligands and in an asthma model. These findings suggest potential roles for inhibitors of the EGF-R cascade in hypersecretory diseases of airways. PMID:10077640

  20. A novel anticancer diarylurea derivative HL-40 as a multi-kinases inhibitor with good pharmacokinetics in Wistar rats.

    PubMed

    Lu, Yu-Yin; Zhao, Cui-Rong; Wang, Rui-Qi; Li, Wen-Bao; Qu, Xian-Jun

    2015-02-01

    HL-40, N-(4-(1-(4-chlorine indazole)) phenyl)-N-(4-chloro-3-three fluorine methyl phenyl) urea, is a novel diarylurea derivative. In this study, we investigated the kinases activities and binding constants, pharmacokinetics of HL-40, and then evaluated its anticancer efficacy by both in vitro and in vivo methods. Enzyme activities assays in vitro were employed to identify eight candidate kinase targets. The competition binding assays against eight candidate kinases suggested that HL-40 showed strong affinity to c-Kit, PDGFRβ and FLT3. The pharmacokinetic studies in Wistar rats showed that HL-40 could maintain high compound concentration and long residence time in the blood circulation. HL-40 possessed strong inhibition activities against 12 human cancer cells. Meanwhile, HL-40 effectively delayed the growth of cancer xenografts without significant toxicity to mice. Based on these in vitro and in vivo results, we suggested that HL-40 might be developed as a potential multi-kinases inhibitor for cancer treatment. PMID:25661367

  1. Prokaryotic Diacylglycerol Kinase and Undecaprenol Kinase

    PubMed Central

    Van Horn, Wade D.; Sanders, Charles R.

    2013-01-01

    Prokaryotic diacylglycerol kinase (DAGK) and undecaprenol kinase (UDPK) are the lone members of a family of multispan membrane enzymes that are very small, lack relationships to any other family of proteins—including water soluble kinases, and that exhibit an unusual structure and active site architecture. Escherichia coli DAGK plays an important role in recycling diacylglycerol produced as a byproduct of biosynthesis of molecules located in the periplasmic space. UDPK seems to play an analogous role in Gram-positive bacteria, where its importance is evident by the fact that UDPK is essential for biofilm formation by the oral pathogen Streptococcus mutans. DAGK has also long served as a model system for studies of membrane protein biocatalysis, folding, stability, and structure. This review explores our current understanding of the microbial physiology, enzymology, structural biology, and folding of the prokaryotic diacylglycerol kinase family, which is based on over 40 years of studies. PMID:22224599

  2. Protein Kinases and Addiction

    PubMed Central

    Lee, Anna M.; Messing, Robert O.

    2011-01-01

    Although drugs of abuse have different chemical structures and interact with different protein targets, all appear to usurp common neuronal systems that regulate reward and motivation. Addiction is a complex disease that is thought to involve drug-induced changes in synaptic plasticity due to alterations in cell signaling, gene transcription, and protein synthesis. Recent evidence suggests that drugs of abuse interact with and change a common network of signaling pathways that include a subset of specific protein kinases. The best studied of these kinases are reviewed here and include extracellular signal-regulated kinase, cAMP-dependent protein kinase, cyclin-dependent protein kinase 5, protein kinase C, calcium/calmodulin-dependent protein kinase II, and Fyn tyrosine kinase. These kinases have been implicated in various aspects of drug addiction including acute drug effects, drug self-administration, withdrawal, reinforcement, sensitization, and tolerance. Identifying protein kinase substrates and signaling pathways that contribute to the addicted state may provide novel approaches for new pharma-cotherapies to treat drug addiction. PMID:18991950

  3. Src kinase inhibitors induce apoptosis and mediate cell cycle arrest in lymphoma cells.

    PubMed

    Nowak, Daniel; Boehrer, Simone; Hochmuth, Simone; Trepohl, Bettina; Hofmann, Wencke; Hoelzer, Dieter; Hofmann, Wolf-Karsten; Mitrou, Paris S; Ruthardt, Martin; Chow, Kai Uwe

    2007-10-01

    Src kinases are involved in multiple cellular contexts such as proliferation, adhesion, tumor invasiveness, angiogenesis, cell cycle control and apoptosis. We here demonstrate that three newly developed dual selective Src/Abl kinase inhibitors (SrcK-I) (AZM559756, AZD0530 and AZD0424) are able to induce apoptosis and cell cycle arrest in BCR-ABL, c-KIT and platelet-derived growth factor-negative lymphoma cell lines. Treatment of DOHH-2, WSU-NHL, Raji, Karpas-299, HUT78 and Jurkat cells with SrcK-I revealed that the tested substances were effective on these parameters in the cell lines DOHH-2 and WSU-NHL, whereas the other tested cell lines remained unaffected. Phosphorylation of Lyn and in particular Lck were affected most heavily by treatment with the SrcK-I. Extrinsic as well as intrinsic apoptosis pathways were activated and elicited unique expressional patterns of apoptosis-relevant proteins such as downregulation of survivin, Bcl-XL and c-FLIP. Protein levels of c-abl were downregulated and Akt phosphorylation was decreased by treatment with SrcK-I. Basal expression levels of c-Myc were notably lower in sensitive cell lines as compared with nonsensitive cell lines, possibly providing an explanation for sensitivity versus resistance against these novel substances. This study provides the first basis for establishing novel SrcK-I as weapons in the arsenal against lymphoma cells. PMID:17704648

  4. Enhancement of myocardial regeneration through genetic engineering of cardiac progenitor cells expressing Pim-1 kinase

    PubMed Central

    Fischer, Kimberlee M.; Cottage, Chistopher T.; Wu, Weitao; Din, Shabana; Gude, Natalie A.; Avitable, Daniele; Quijada, Pearl; Collins, Brett L.; Fransioli, Jenna; Sussman, Mark A.

    2009-01-01

    Background Despite numerous studies demonstrating efficacy of cellular adoptive transfer for therapeutic myocardial regeneration, problems remain for donated cells with regard to survival, persistence, engraftment, and long-term benefits. This study redresses these concerns by enhancing the regenerative potential of adoptively transferred cardiac progenitor cells (CPCs) via genetic engineering to overexpress Pim-1, a cardioprotective kinase that enhances cell survival and proliferation. Methods and Results Intramyocardial injections of CPCs overexpressing Pim-1 were given to infarcted female mice. Animals were monitored over 4, 12, and 32-weeks to assess cardiac function and engraftment of Pim-1 CPCs using echocardiography, in vivo hemodynamics, and confocal imagery. CPCs overexpressing Pim-1 show increased proliferation and expression of markers consistent with cardiogenic lineage commitment following dexamethasone exposure in vitro. Animals that received CPCs overexpressing Pim-1 also produce greater levels of cellular engraftment, persistence, and functional improvement relative to control CPCs up to 32-weeks post-delivery. Salutary effects include reduction of infarct size, greater number of c-kit+ cells, and increased vasculature in the damaged region. Conclusions Myocardial repair is significantly enhanced by genetic engineering of CPCs using Pim-1 kinase. Ex vivo gene delivery to enhance cellular survival, proliferation, and regeneration may overcome current limitations of stem cell-based therapeutic approaches. PMID:19901187

  5. High fat diet induced obesity alters ovarian phosphatidylinositol-3 kinase signaling gene expression

    PubMed Central

    Nteeba, J.; Ross, J.W.; Perfield, J.W.; Keating, A.F.

    2013-01-01

    Insulin regulates ovarian phosphatidylinositol-3-kinase (PI3K) signaling, important for primordial follicle viability and growth activation. This study investigated diet-induced obesity impacts on: 1) insulin receptor (Insr) and insulin receptor substrate 1 (Irs1); 2) PI3K components (Kit ligand (Kitlg), kit (c-Kit), protein kinase B alpha (Akt1) and forkhead transcription factor subfamily 3 (Foxo3a)); 3) xenobiotic biotransformation (microsomal epoxide hydrolase (Ephx1), Cytochrome P450 isoform 2E1 (Cyp2e1), Glutathione S-transferase (Gst) isoforms mu (Gstm) and pi (Gstp)) and 4) microRNA’s 184, 205, 103 and 21 gene expression. INSR, GSTM and GSTP protein levels were also measured. Obese mouse ovaries had decreased Irs1, Foxo3a, Cyp2e1, MiR-103, and MiR-21 but increased Kitlg, Akt1, and miR-184 levels relative to lean littermates. These results support that diet-induced obesity potentially impairs ovarian function through aberrant gene expression. PMID:23954404

  6. KEA: kinase enrichment analysis

    PubMed Central

    Lachmann, Alexander; Ma'ayan, Avi

    2009-01-01

    Motivation: Multivariate experiments applied to mammalian cells often produce lists of proteins/genes altered under treatment versus control conditions. Such lists can be projected onto prior knowledge of kinase–substrate interactions to infer the list of kinases associated with a specific protein list. By computing how the proportion of kinases, associated with a specific list of proteins/genes, deviates from an expected distribution, we can rank kinases and kinase families based on the likelihood that these kinases are functionally associated with regulating the cell under specific experimental conditions. Such analysis can assist in producing hypotheses that can explain how the kinome is involved in the maintenance of different cellular states and can be manipulated to modulate cells towards a desired phenotype. Summary: Kinase enrichment analysis (KEA) is a web-based tool with an underlying database providing users with the ability to link lists of mammalian proteins/genes with the kinases that phosphorylate them. The system draws from several available kinase–substrate databases to compute kinase enrichment probability based on the distribution of kinase–substrate proportions in the background kinase–substrate database compared with kinases found to be associated with an input list of genes/proteins. Availability: The KEA system is freely available at http://amp.pharm.mssm.edu/lib/kea.jsp Contact: avi.maayan@mssm.edu PMID:19176546

  7. Discovery of (R)-1-(3-(4-Amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-2-(dimethylamino)ethanone (CHMFL-FLT3-122) as a Potent and Orally Available FLT3 Kinase Inhibitor for FLT3-ITD Positive Acute Myeloid Leukemia.

    PubMed

    Li, Xixiang; Wang, Aoli; Yu, Kailin; Qi, Ziping; Chen, Cheng; Wang, Wenchao; Hu, Chen; Wu, Hong; Wu, Jiaxin; Zhao, Zheng; Liu, Juan; Zou, Fengming; Wang, Li; Wang, Beilei; Wang, Wei; Zhang, Shanchun; Liu, Jing; Liu, Qingsong

    2015-12-24

    FLT3-ITD mutant has been observed in about 30% of AML patients and extensively studied as a drug discovery target. On the basis of the structure of PCI-32765 (ibrutinib), a BTK kinase inhibitor that was recently reported to bear FLT3 kinase activity through a structure-guided drug design approach, we have discovered compound 18 (CHMFL-FLT3-122), which displayed an IC50 of 40 nM against FLT3 kinase and achieved selectivity over BTK kinase (over 10-fold). It significantly inhibited the proliferation of FLT3-ITD positive AML cancer cell lines MV4-11 (GI50 = 22 nM), MOLM13/14 (GI50 = 21 nM/42 nM). More importantly, 18 demonstrated 170-fold selectivity between FLT3 kinase and c-KIT kinase (GI50 = 11 nM versus 1900 nM) in the TEL-fusion isogenic BaF3 cells indicating a potential to avoid the FLT3/c-KIT dual inhibition induced myelosuppression toxicity. In the cellular context it strongly affected FLT3-ITD mediated signaling pathways and induced apoptosis by arresting the cell cycle into the G0/G1 phase. In the in vivo studies 18 demonstrated a good bioavailability (30%) and significantly suppressed the tumor growth in MV4-11 cell inoculated xenograft model (50 mg/kg) without exhibiting obvious toxicity. Compound 18 might be a potential drug candidate for FLT3-ITD positive AML. PMID:26630553

  8. From Phosphosites to Kinases.

    PubMed

    Munk, Stephanie; Refsgaard, Jan C; Olsen, Jesper V; Jensen, Lars J

    2016-01-01

    Kinases play a pivotal role in propagating the phosphorylation-mediated signaling networks in living cells. With the overwhelming quantities of phosphoproteomics data being generated, the number of identified phosphorylation sites (phosphosites) is ever increasing. Often, proteomics investigations aim to understand the global signaling modulation that takes place in different biological conditions investigated. For phosphoproteomics data, identifying the kinases central to mediating this response is key. This has prompted several efforts to catalogue the immense amounts of phosphorylation data and known or predicted kinases responsible for the modifications. However, barely 20 % of the known phosphosites are assigned to a kinase, initiating various bioinformatics efforts that attempt to predict the responsible kinases. These algorithms employ different approaches to predict kinase consensus sequence motifs, mostly based on large scale in vivo and in vitro experiments. The context of the kinase and the phosphorylated proteins in a biological system is equally important for predicting association between the enzymes and substrates, an aspect that is also being tackled with available bioinformatics tools. This chapter summarizes the use of the larger phosphorylation databases, and approaches that can be applied to predict kinases that phosphorylate individual sites or that are globally modulated in phosphoproteomics datasets. PMID:26584935

  9. Pyruvate kinase blood test

    MedlinePlus

    ... break down faster than normal, a condition called hemolytic anemia . This test helps diagnose pyruvate kinase deficiency (PKD) . ... Pa: Elsevier Saunders; 2011:chap 32. Gallagher PG. Hemolytic anemias: red cell membrane and metabolic defects In: Goldman ...

  10. Activity-based kinase profiling of approved tyrosine kinase inhibitors.

    PubMed

    Kitagawa, Daisuke; Yokota, Koichi; Gouda, Masaki; Narumi, Yugo; Ohmoto, Hiroshi; Nishiwaki, Eiji; Akita, Kensaku; Kirii, Yasuyuki

    2013-02-01

    The specificities of nine approved tyrosine kinase inhibitors (imatinib, dasatinib, nilotinib, gefitinib, erlotinib, lapatinib, sorafenib, sunitinib, and pazopanib) were determined by activity-based kinase profiling using a large panel of human recombinant active kinases. This panel consisted of 79 tyrosine kinases, 199 serine/threonine kinases, three lipid kinases, and 29 disease-relevant mutant kinases. Many potential targets of each inhibitor were identified by kinase profiling at the K(m) for ATP. In addition, profiling at a physiological ATP concentration (1 mm) was carried out, and the IC(50) values of the inhibitors against each kinase were compared with the estimated plasma-free concentration (calculated from published pharmacokinetic parameters of plasma C(trough) and C(max) values). This analysis revealed that the approved kinase inhibitors were well optimized for their target kinases. This profiling also implicates activity at particular off-target kinases in drug side effects. Thus, large-scale kinase profiling at both K(m) and physiological ATP concentrations could be useful in characterizing the targets and off-targets of kinase inhibitors. PMID:23279183

  11. Significant blockade of multiple receptor tyrosine kinases by MGCD516 (Sitravatinib), a novel small molecule inhibitor, shows potent anti-tumor activity in preclinical models of sarcoma.

    PubMed

    Patwardhan, Parag P; Ivy, Kathryn S; Musi, Elgilda; de Stanchina, Elisa; Schwartz, Gary K

    2016-01-26

    Sarcomas are rare but highly aggressive mesenchymal tumors with a median survival of 10-18 months for metastatic disease. Mutation and/or overexpression of many receptor tyrosine kinases (RTKs) including c-Met, PDGFR, c-Kit and IGF1-R drive defective signaling pathways in sarcomas. MGCD516 (Sitravatinib) is a novel small molecule inhibitor targeting multiple RTKs involved in driving sarcoma cell growth. In the present study, we evaluated the efficacy of MGCD516 both in vitro and in mouse xenograft models in vivo. MGCD516 treatment resulted in significant blockade of phosphorylation of potential driver RTKs and induced potent anti-proliferative effects in vitro. Furthermore, MGCD516 treatment of tumor xenografts in vivo resulted in significant suppression of tumor growth. Efficacy of MGCD516 was superior to imatinib and crizotinib, two other well-studied multi-kinase inhibitors with overlapping target specificities, both in vitro and in vivo. This is the first report describing MGCD516 as a potent multi-kinase inhibitor in different models of sarcoma, superior to imatinib and crizotinib. Results from this study showing blockade of multiple driver signaling pathways provides a rationale for further clinical development of MGCD516 for the treatment of patients with soft-tissue sarcoma. PMID:26675259

  12. Significant blockade of multiple receptor tyrosine kinases by MGCD516 (Sitravatinib), a novel small molecule inhibitor, shows potent anti-tumor activity in preclinical models of sarcoma

    PubMed Central

    Musi, Elgilda; de Stanchina, Elisa; Schwartz, Gary K.

    2016-01-01

    Sarcomas are rare but highly aggressive mesenchymal tumors with a median survival of 10–18 months for metastatic disease. Mutation and/or overexpression of many receptor tyrosine kinases (RTKs) including c-Met, PDGFR, c-Kit and IGF1-R drive defective signaling pathways in sarcomas. MGCD516 (Sitravatinib) is a novel small molecule inhibitor targeting multiple RTKs involved in driving sarcoma cell growth. In the present study, we evaluated the efficacy of MGCD516 both in vitro and in mouse xenograft models in vivo. MGCD516 treatment resulted in significant blockade of phosphorylation of potential driver RTKs and induced potent anti-proliferative effects in vitro. Furthermore, MGCD516 treatment of tumor xenografts in vivo resulted in significant suppression of tumor growth. Efficacy of MGCD516 was superior to imatinib and crizotinib, two other well-studied multi-kinase inhibitors with overlapping target specificities, both in vitro and in vivo. This is the first report describing MGCD516 as a potent multi-kinase inhibitor in different models of sarcoma, superior to imatinib and crizotinib. Results from this study showing blockade of multiple driver signaling pathways provides a rationale for further clinical development of MGCD516 for the treatment of patients with soft-tissue sarcoma. PMID:26675259

  13. Phosphatidylinositol kinase from rabbit reticulocytes

    SciTech Connect

    Tuazon, P.T.; Heng, A.B.W.; Traugh, J.A.

    1986-05-01

    Phosphatidylinositol (PI) kinase was isolated from the postribosomal supernatant of rabbit reticulocytes. This activity was identified by the formation of a product that comigrated with phosphatidylinositol-4-phosphate (PIP) when purified PI was phosphorylated in the presence of (/sup 32/P)ATP and Mg/sup 2 +/. Three major peaks of PI kinase activity were resolved by chromatography on DEAE-cellulose. The first peak eluted at 50-100 mM NaCl together with several serine protein kinases, casein kinase (CK) I and protease activated kinase (PAK) I and II. The PI kinase was subsequently separated from the protein kinases by chromatography on phosphocellulose. The second peak eluted at 125-160 mM NaCl and contained another lipid kinase activity that produced a product which comigrated with phosphatidic acid on thin layer chromatography. The third peak, which eluted at 165-200 mM NaCl, partly comigrated with casein kinase (CK) II and an active protein kinase(s) which phosphorylated mixed histone and histone I. CK II and the histone kinase activities were also separated by chromatography on phosphocelluslose. The different forms of PI kinase were characterized and compared with respect to substrate and salt requirements.

  14. Oncoprotein protein kinase

    DOEpatents

    Karin, Michael; Hibi, Masahiko; Linn, Anning

    1996-01-01

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK.

  15. Targeting cancer with kinase inhibitors

    PubMed Central

    Gross, Stefan; Rahal, Rami; Stransky, Nicolas; Lengauer, Christoph; Hoeflich, Klaus P.

    2015-01-01

    Kinase inhibitors have played an increasingly prominent role in the treatment of cancer and other diseases. Currently, more than 25 oncology drugs that target kinases have been approved, and numerous additional therapeutics are in various stages of clinical evaluation. In this Review, we provide an in-depth analysis of activation mechanisms for kinases in cancer, highlight recent successes in drug discovery, and demonstrate the clinical impact of selective kinase inhibitors. We also describe the substantial progress that has been made in designing next-generation inhibitors to circumvent on-target resistance mechanisms, as well as ongoing strategies for combining kinase inhibitors in the clinic. Last, there are numerous prospects for the discovery of novel kinase targets, and we explore cancer immunotherapy as a new and promising research area for studying kinase biology. PMID:25932675

  16. Oncoprotein protein kinase

    DOEpatents

    Karin, Michael; Hibi, Masahiko; Lin, Anning; Davis, Roger; Derijard, Benoit

    2005-03-08

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  17. Oncoprotein protein kinase

    DOEpatents

    Davis, Roger; Derijard, Benoit; Karin, Michael; Hibi, Masahiko; Lin, Anning

    2005-01-25

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  18. Oncoprotein protein kinase

    DOEpatents

    Karin, Michael; Hibi, Masahiko; Lin, Anning

    1999-01-01

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD or 55 kD as determined by reducing SDS-PAGE, having serine and theonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  19. Oncoprotein protein kinase

    DOEpatents

    Karin, Michael; Hibi, Masahiko; Lin, Anning

    1997-01-01

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  20. Oncoprotein protein kinase

    DOEpatents

    Karin, Michael; Hibi, Masahiko; Lin, Anning

    1998-01-01

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  1. Oncoprotein protein kinase

    DOEpatents

    Karin, Michael; Hibi, Masahiko; Lin, Anning; Davis, Roger; Derijard, Benoit

    2003-02-04

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  2. Oncoprotein protein kinase

    DOEpatents

    Karin, M.; Hibi, M.; Lin, A.

    1997-02-25

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE is disclosed. The polypeptide has serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences. The method of detection of JNK is also provided. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites. 44 figs.

  3. Oncoprotein protein kinase

    DOEpatents

    Karin, Michael; Hibi, Masahiko; Lin, Anning

    1997-01-01

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  4. Oncoprotein protein kinase

    DOEpatents

    Karin, Michael; Lin, Anning

    1999-11-30

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD or 55 kD as determined by reducing SDS-PAGE, having serine and theonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  5. Oncoprotein protein kinase

    DOEpatents

    Karin, Michael; Hibi, Masahiko; Lin, Anning

    2004-03-16

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  6. Cyclin-dependent kinases

    PubMed Central

    2014-01-01

    Summary Cyclin-dependent kinases (CDKs) are protein kinases characterized by needing a separate subunit - a cyclin - that provides domains essential for enzymatic activity. CDKs play important roles in the control of cell division and modulate transcription in response to several extra- and intracellular cues. The evolutionary expansion of the CDK family in mammals led to the division of CDKs into three cell-cycle-related subfamilies (Cdk1, Cdk4 and Cdk5) and five transcriptional subfamilies (Cdk7, Cdk8, Cdk9, Cdk11 and Cdk20). Unlike the prototypical Cdc28 kinase of budding yeast, most of these CDKs bind one or a few cyclins, consistent with functional specialization during evolution. This review summarizes how, although CDKs are traditionally separated into cell-cycle or transcriptional CDKs, these activities are frequently combined in many family members. Not surprisingly, deregulation of this family of proteins is a hallmark of several diseases, including cancer, and drug-targeted inhibition of specific members has generated very encouraging results in clinical trials. PMID:25180339

  7. Protein Kinase Mitogen-activated Protein Kinase Kinase Kinase Kinase 4 (MAP4K4) Promotes Obesity-induced Hyperinsulinemia.

    PubMed

    Roth Flach, Rachel J; Danai, Laura V; DiStefano, Marina T; Kelly, Mark; Menendez, Lorena Garcia; Jurczyk, Agata; Sharma, Rohit B; Jung, Dae Young; Kim, Jong Hun; Kim, Jason K; Bortell, Rita; Alonso, Laura C; Czech, Michael P

    2016-07-29

    Previous studies revealed a paradox whereby mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) acted as a negative regulator of insulin sensitivity in chronically obese mice, yet systemic deletion of Map4k4 did not improve glucose tolerance. Here, we report markedly reduced glucose-responsive plasma insulin and C-peptide levels in whole body Map4k4-depleted mice (M4K4 iKO) as well as an impaired first phase of insulin secretion from islets derived from M4K4 iKO mice ex vivo After long-term high fat diet (HFD), M4K4 iKO mice pancreata also displayed reduced β cell mass, fewer proliferating β cells and reduced islet-specific gene mRNA expression compared with controls, although insulin content was normal. Interestingly, the reduced plasma insulin in M4K4 iKO mice exposed to chronic (16 weeks) HFD was not observed in response to acute HFD challenge or short term treatment with the insulin receptor antagonist S961. Furthermore, the improved insulin sensitivity in obese M4K4 iKO mice was abrogated by high exogenous insulin over the course of a euglycemic clamp study, indicating that hypoinsulinemia promotes insulin sensitivity in chronically obese M4K4 iKO mice. These results demonstrate that protein kinase Map4k4 drives obesity-induced hyperinsulinemia and insulin resistance in part by promoting insulin secretion from β cells in mice. PMID:27226575

  8. A High-Throughput Radiometric Kinase Assay.

    PubMed

    Duong-Ly, Krisna C; Peterson, Jeffrey R

    2016-01-01

    Aberrant kinase signaling has been implicated in a number of diseases. While kinases have become attractive drug targets, only a small fraction of human protein kinases have validated inhibitors. Screening of libraries of compounds against a kinase or kinases of interest is routinely performed during kinase inhibitor development to identify promising scaffolds for a particular target and to identify kinase targets for compounds of interest. Screening of more focused compound libraries may also be conducted in the later stages of inhibitor development to improve potency and optimize selectivity. The dot blot kinase assay is a robust, high-throughput kinase assay that can be used to screen a number of small-molecule compounds against one kinase of interest or several kinases. Here, a protocol for a dot blot kinase assay used for measuring insulin receptor kinase activity is presented. This protocol can be readily adapted for use with other protein kinases. PMID:26501904

  9. Redox Regulation of Protein Kinases

    PubMed Central

    Truong, Thu H.; Carroll, Kate S.

    2015-01-01

    Protein kinases represent one of the largest families of genes found in eukaryotes. Kinases mediate distinct cellular processes ranging from proliferation, differentiation, survival, and apoptosis. Ligand-mediated activation of receptor kinases can lead to the production of endogenous H2O2 by membrane-bound NADPH oxidases. In turn, H2O2 can be utilized as a secondary messenger in signal transduction pathways. This review presents an overview of the molecular mechanisms involved in redox regulation of protein kinases and its effects on signaling cascades. In the first half, we will focus primarily on receptor tyrosine kinases (RTKs), whereas the latter will concentrate on downstream non-receptor kinases involved in relaying stimulant response. Select examples from the literature are used to highlight the functional role of H2O2 regarding kinase activity, as well as the components involved in H2O2 production and regulation during cellular signaling. In addition, studies demonstrating direct modulation of protein kinases by H2O2 through cysteine oxidation will be emphasized. Identification of these redox-sensitive residues may help uncover signaling mechanisms conserved within kinase subfamilies. In some cases, these residues can even be exploited as targets for the development of new therapeutics. Continued efforts in this field will further basic understanding of kinase redox regulation, and delineate the mechanisms involved in physiologic and pathological H2O2 responses. PMID:23639002

  10. MAP kinase dynamics in yeast.

    PubMed

    van Drogen, F; Peter, M

    2001-09-01

    MAP kinase pathways play key roles in cellular responses towards extracellular signals. In several cases, the three core kinases interact with a scaffold molecule, but the function of these scaffolds is poorly understood. They have been proposed to contribute to signal specificity, signal amplification, or subcellular localization of MAP kinases. Several MAP kinases translocate to the nucleus in response to their activation, suggesting that nuclear transport may provide a regulatory mechanism. Here we describe new applications for Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP), to study dynamic translocations of MAPKs between different subcellular compartments. We have used these methods to measure the nuclear/cytoplasmic dynamics of several yeast MAP kinases, and in particular to address the role of scaffold proteins for MAP-kinase signaling. PMID:11730324

  11. Functions of the Lyn tyrosine kinase in health and disease

    PubMed Central

    2012-01-01

    Abstract Src family kinases such as Lyn are important signaling intermediaries, relaying and modulating different inputs to regulate various outputs, such as proliferation, differentiation, apoptosis, migration and metabolism. Intriguingly, Lyn can mediate both positive and negative signaling processes within the same or different cellular contexts. This duality is exemplified by the B-cell defect in Lyn−/− mice in which Lyn is essential for negative regulation of the B-cell receptor; conversely, B-cells expressing a dominant active mutant of Lyn (Lynup/up) have elevated activities of positive regulators of the B-cell receptor due to this hyperactive kinase. Lyn has well-established functions in most haematopoietic cells, viz. progenitors via influencing c-kit signaling, through to mature cell receptor/integrin signaling, e.g. erythrocytes, platelets, mast cells and macrophages. Consequently, there is an important role for this kinase in regulating hematopoietic abnormalities. Lyn is an important regulator of autoimmune diseases such as asthma and psoriasis, due to its profound ability to influence immune cell signaling. Lyn has also been found to be important for maintaining the leukemic phenotype of many different liquid cancers including acute myeloid leukaemia (AML), chronic myeloid leukaemia (CML) and B-cell lymphocytic leukaemia (BCLL). Lyn is also expressed in some solid tumors and here too it is establishing itself as a potential therapeutic target for prostate, glioblastoma, colon and more aggressive subtypes of breast cancer. Lay Abstract To relay information, a cell uses enzymes that put molecular markers on specific proteins so they interact with other proteins or move to specific parts of the cell to have particular functions. A protein called Lyn is one of these enzymes that regulate information transfer within cells to modulate cell growth, survival and movement. Depending on which type of cell and the source of the information input, Lyn can

  12. Phosphatidylinositol 3-kinase in myogenesis.

    PubMed

    Kaliman, P; Zorzano, A

    1997-08-01

    Phosphatidylinositol 3-kinase (PI 3-kinase) has been cloned and characterized in a wide range of organisms. PI 3-kinases are activated by a diversity of extracellular stimuli and are involved in multiple cell processes such as cell proliferation, protein trafficking, cell motility, differentiation, regulation of cytoskeletal structure, and apoptosis. It has recently been shown that PI 3-kinase is a crucial second messenger in the signaling of myogenesis. Two structurally unrelated highly specific inhibitors of PI 3-kinase-wortmannin and LY294002-block the morphological and biochemical differentiation program of different skeletal-muscle cell models. Moreover, L6E9 myoblasts overexpressing a dominant-negative mutant of PI 3-kinase p85 regulatory subunit (Δp85) are unable to differentiate. Furthermore, PI 3-kinase is specifically involved in the insulinlike growth factor (IGF)-dependent myogenic pathway. Indeed, the ability of IGF-I, des-1,3-IGF-I, and IGF-II to promote cell fusion and muscle-specific protein expression is impaired after treatment with PI 3-kinase inhibitors or in cells overexpressing Δp85. The identification of additional key downstream elements of the IGF/PI 3-kinase myogenic cascade is crucial to a detailed understanding of the process of muscle differentiation and may generate new tools for skeletal and cardiac muscle regeneration therapies. (Trends Cardiovasc Med 1997;7:198-202). © 1997, Elsevier Science Inc. PMID:21235885

  13. [Kinase inhibitors and their resistance].

    PubMed

    Togashi, Yosuke; Nishio, Kazuto

    2015-08-01

    Kinase cascades are involved in all stages of tumorigenesis through modulation of transformation and differentiation, cell-cycle progression, and motility. Advances in molecular targeted drug development allow the design and synthesis of inhibitors targeting cancer-associated signal transduction pathways. Potent selective inhibitors with low toxicity can benefit patients especially with several malignancies harboring an oncogenic driver addictive signal. This article evaluates information on solid tumor-related kinase signals and inhibitors, including receptor tyrosine kinase or serine/threonine kinase signals that lead to successful application in clinical settings. In addition, the resistant mechanisms to the inhibitors is summarized. PMID:26281685

  14. Adenylate kinase complements nucleoside diphosphate kinase deficiency in nucleotide metabolism.

    PubMed Central

    Lu, Q; Inouye, M

    1996-01-01

    Nucleoside diphosphate (NDP) kinase is a ubiquitous nonspecific enzyme that evidently is designed to catalyze in vivo ATP-dependent synthesis of ribo- and deoxyribonucleoside triphosphates from the corresponding diphosphates. Because Escherichia coli contains only one copy of ndk, the structural gene for this enzyme, we were surprised to find that ndk disruption yields bacteria that are still viable. These mutant cells contain a protein with a small amount NDP kinase activity. The protein responsible for this activity was purified and identified as adenylate kinase. This enzyme, also called myokinase, catalyzes the reversible ATP-dependent synthesis of ADP from AMP. We found that this enzyme from E. coli as well as from higher eukaryotes has a broad substrate specificity displaying dual enzymatic functions. Among the nucleoside monophosphate kinases tested, only adenylate kinase was found to have NDP kinase activity. To our knowledge, this is the first report of NDP kinase activity associated with adenylate kinase. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8650159

  15. MAP kinase-interacting kinases--emerging targets against cancer.

    PubMed

    Diab, Sarah; Kumarasiri, Malika; Yu, Mingfeng; Teo, Theodosia; Proud, Christopher; Milne, Robert; Wang, Shudong

    2014-04-24

    Mitogen-activated protein kinase (MAPK)-interacting kinases (Mnks) regulate the initiation of translation through phosphorylation of eukaryotic initiation factor 4E (eIF4E). Mnk-mediated eIF4E activation promotes cancer development and progression. While the phosphorylation of eIF4E is necessary for oncogenic transformation, the kinase activity of Mnks seems dispensable for normal development. For this reason, pharmacological inhibition of Mnks could represent an ideal mechanism-based and nontoxic therapeutic strategy for cancer treatment. In this review, we discuss the current understanding of Mnk biological roles, structures, and functions, as well as clinical implications. Importantly, we propose different strategies for identification of highly selective small molecule inhibitors of Mnks, including exploring a structural feature of their kinase domain, DFD motif, which is unique within the human kinome. We also argue that a combined targeting of Mnks and other pathways should be considered given the complexity of cancer. PMID:24613018

  16. Neuronal migration and protein kinases

    PubMed Central

    Ohshima, Toshio

    2015-01-01

    The formation of the six-layered structure of the mammalian cortex via the inside-out pattern of neuronal migration is fundamental to neocortical functions. Extracellular cues such as Reelin induce intracellular signaling cascades through the protein phosphorylation. Migrating neurons also have intrinsic machineries to regulate cytoskeletal proteins and adhesion properties. Protein phosphorylation regulates these processes. Moreover, the balance between phosphorylation and dephosphorylation is modified by extracellular cues. Multipolar-bipolar transition, radial glia-guided locomotion and terminal translocation are critical steps of radial migration of cortical pyramidal neurons. Protein kinases such as Cyclin-dependent kinase 5 (Cdk5) and c-Jun N-terminal kinases (JNKs) involve these steps. In this review, I shall give an overview the roles of protein kinases in neuronal migration. PMID:25628530

  17. Protein Crystals of Raf Kinase

    NASA Technical Reports Server (NTRS)

    1995-01-01

    This image shows crystals of the protein raf kinase grown on Earth (photo a) and on USML-2 (photo b). The space-grown crystals are an order of magnitude larger. Principal Investigator: Dan Carter of New Century Pharmaceuticals

  18. Isolation of chloroplastic phosphoglycerate kinase

    SciTech Connect

    Macioszek, J.; Anderson, L.E. ); Anderson, J.B. )

    1990-09-01

    We report here a method for the isolation of high specific activity phosphoglycerate kinase (EC 2.7.2.3) from chloroplasts. The enzyme has been purified over 200-fold from pea (Pisum sativum L.) stromal extracts to apparent homogeneity with 23% recovery. Negative cooperativity is observed with the two enzyme phosphoglycerate kinase/glyceraldehyde-3-P dehydrogenase (EC 1.2.1.13) couple restored from the purified enzymes when NADPH is the reducing pyridine nucleotide, consistent with earlier results obtained with crude chloroplastic extracts. Michaelis Menten kinetics are observed when 3-phosphoglycerate is held constant and phosphoglycerate kinase is varied, which suggests that phosphoglycerate kinase-bound 1,3-bisphosphoglycerate may be the preferred substrate for glyceraldehyde-3-P dehydrogenase in the chloroplast.

  19. Tyrosine kinase gene rearrangements in epithelial malignancies

    PubMed Central

    Shaw, Alice T.; Hsu, Peggy P.; Awad, Mark M.; Engelman, Jeffrey A.

    2014-01-01

    Chromosomal rearrangements that lead to oncogenic kinase activation are observed in many epithelial cancers. These cancers express activated fusion kinases that drive the initiation and progression of malignancy, and often have a considerable response to small-molecule kinase inhibitors, which validates these fusion kinases as ‘druggable’ targets. In this Review, we examine the aetiologic, pathogenic and clinical features that are associated with cancers harbouring oncogenic fusion kinases, including anaplastic lymphoma kinase (ALK), ROS1 and RET. We discuss the clinical outcomes with targeted therapies and explore strategies to discover additional kinases that are activated by chromosomal rearrangements in solid tumours. PMID:24132104

  20. Multi-kinase inhibitors, AURKs and cancer.

    PubMed

    Cicenas, Jonas; Cicenas, Erikas

    2016-05-01

    Inhibitors that impact function of kinases are valuable both for the biological research as well as therapy of kinase-associated diseases, such as different cancers. There are quite a number of inhibitors, which are quite specific for certain kinases and several of them are either already approved for the cancer therapy or are in clinical studies of various phases. However, that does not mean that each single kinase inhibitor is suitable for targeted therapy. Some of them are not effective others might be toxic or fail some other criteria for the use in vivo. On the other hand, even in case of successful therapy, many responders eventually develop resistance to the inhibitors. The limitations of various single kinase inhibitors can be fought using compounds which target multiple kinases. This tactics can increase effectiveness of the inhibitors by the synergistic effect or help to diminish the likelihood of drug resistance. To date, several families of kinases are quite popular targets of the inhibition in cancers, such as tyrosine kinases, cycle-dependent kinases, mitogen-activated protein kinases, phosphoinositide 3-kinases as well as their pathway "players" and aurora kinases. Aurora kinases play an important role in the control of the mitosis and are often altered in diverse human cancers. Here, we will describe the most interesting multi-kinase inhibitors which inhibit aurora kinases among other targets and their use in preclinical and clinical cancer studies. PMID:27038473

  1. Discovering the first tyrosine kinase

    PubMed Central

    Hunter, Tony

    2015-01-01

    In the middle of the 20th century, animal tumor viruses were heralded as possible models for understanding human cancer. By the mid-1970s, the molecular basis by which tumor viruses transform cells into a malignant state was beginning to emerge as the first viral genomic sequences were reported and the proteins encoded by their transforming genes were identified and characterized. This was a time of great excitement and rapid progress. In 1978, prompted by the discovery from Ray Erikson’s group that the Rous sarcoma virus (RSV) v-Src–transforming protein had an associated protein kinase activity specific for threonine, my group at the Salk Institute set out to determine whether the polyomavirus middle T-transforming protein had a similar kinase activity. Here, I describe the experiments that led to the identification of a kinase activity associated with middle T antigen and our serendipitous discovery that this activity was specific for tyrosine in vitro, and how this in turn led to the fortuitous observation that the v-Src–associated kinase activity was also specific for tyrosine. Our finding that v-Src increased the level of phosphotyrosine in cellular proteins in RSV-transformed cells confirmed that v-Src is a tyrosine kinase and transforms cells by phosphorylating proteins on tyrosine. My colleague Bart Sefton and I reported these findings in the March issue of PNAS in 1980. Remarkably, all of the experiments in this paper were accomplished in less than one month. PMID:26130799

  2. Modelling the 2-kinase domain of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase on adenylate kinase.

    PubMed Central

    Bertrand, L; Vertommen, D; Depiereux, E; Hue, L; Rider, M H; Feytmans, E

    1997-01-01

    Simultaneous multiple alignment of available sequences of the bifunctional enzyme 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase revealed several segments of conserved residues in the 2-kinase domain. The sequence of the kinase domain was also compared with proteins of known three-dimensional structure. No similarity was found between the kinase domain of 6-phosphofructo-2-kinase and 6-phosphofructo-1-kinase. This questions the modelling of the 2-kinase domain on bacterial 6-phosphofructo-1-kinase that has previously been proposed [Bazan, Fletterick and Pilkis (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 9642-9646]. However, sequence similarities were found between the 2-kinase domain and several nucleotide-binding proteins, the most similar being adenylate kinase. A structural model of the 2-kinase domain based on adenylate kinase is proposed. It accommodates all the results of site-directed mutagenesis studies carried out to date on residues in the 2-kinase domain. It also allows residues potentially involved in catalysis and/or substrate binding to be predicted. PMID:9032445

  3. A phase I trial of the aurora kinase inhibitor, ENMD-2076, in patients with relapsed or refractory acute myeloid leukemia or chronic myelomonocytic leukemia.

    PubMed

    Yee, Karen W L; Chen, Hsiao-Wei T; Hedley, David W; Chow, Sue; Brandwein, Joseph; Schuh, Andre C; Schimmer, Aaron D; Gupta, Vikas; Sanfelice, Deborah; Johnson, Tara; Le, Lisa W; Arnott, Jamie; Bray, Mark R; Sidor, Carolyn; Minden, Mark D

    2016-10-01

    ENMD-2076 is a novel, orally-active molecule that inhibits Aurora A kinase, as well as c-Kit, FLT3 and VEGFR2. A phase I study was conducted to determine the maximum tolerated dose (MTD), recommended phase 2 dose (RP2D) and toxicities of ENMD-2076 in patients with acute myeloid leukemia (AML) and chronic myelomonocytic leukemia (CMML). Patients received escalating doses of ENMD-2076 administered orally daily [225 mg (n = 7), 375 mg (n = 6), 325 mg (n = 9), or 275 mg (n = 5)]. Twenty-seven patients were treated (26 AML; 1 CMML-2). The most common non-hematological toxicities of any grade, regardless of association with drug, were fatigue, diarrhea, dysphonia, dyspnea, hypertension, constipation, and abdominal pain. Dose-limiting toxicities (DLTs) consisted of grade 3 fatigue, grade 3 typhilitis, grade 3 syncope and grade 3 QTc prolongation). Of the 16 evaluable patients, one patient achieved a complete remission with incomplete count recovery (CRi), three experienced a morphologic leukemia-free state (MLFS) with a major hematologic improvement in platelets (HI-P), and 5 other patients had a reduction in marrow blast percentage (i.e. 11-65 %). The RP2D in this patient population is 225 mg orally once daily. PMID:27406088

  4. A Mathematical Exploration of MAP Kinase Behavior

    NASA Astrophysics Data System (ADS)

    Adams, Rhys; Balazsi, Gabor

    2008-03-01

    Mitogen-Activated Protein (MAP) kinase pathways are highly conserved from yeast to humans and are implicated in cell survival and cell death. Signaling through these pathways starts with the phosphorylation of the most upstream component (MAP kinase kinase kinase, MAPKKK), continues with phosphorylation of a MAP kinase kinase (MAPKK), and ends with phosphorylation of the target MAP kinase (MAPK). Theoretical studies over the past few decades have generated important insights into the dynamical behavior and signal processing capability of these pathways, including bistability, oscillations, signal amplification, etc. Prompted by the possibility of complex behavior in simpler signaling units than a full MAP kinase pathway, we investigate the possibility of In-Band Detection (IBD) within a single step of the cascade. We show that a basal rate of target phosphorylation can lead to IBD in a simpler system than the one described before, and define a precise relationship between the various reaction rates that is necessary to obtain IBD.

  5. MAP kinase cascades: scaffolding signal specificity.

    PubMed

    van Drogen, Frank; Peter, Matthias

    2002-01-22

    Scaffold proteins organize many MAP kinase pathways by interacting with several components of these cascades. Recent studies suggest that scaffold proteins provide local activation platforms that contribute to signal specificity by insulating different MAP kinase pathways. PMID:11818078

  6. Characterization and response of newly developed high-grade glioma cultures to the tyrosine kinase inhibitors, erlotinib, gefitinib and imatinib

    SciTech Connect

    Kinsella, Paula; Howley, Rachel; Doolan, Padraig; Clarke, Colin; Madden, Stephen F.; Clynes, Martin; Farrell, Michael; Amberger-Murphy, Verena

    2012-03-10

    High-grade gliomas (HGG), are the most common aggressive brain tumours in adults. Inhibitors targeting growth factor signalling pathways in glioma have shown a low clinical response rate. To accurately evaluate response to targeted therapies further in vitro studies are necessary. Growth factor pathway expression using epidermal growth factor receptor (EGFR), mutant EGFR (EGFRvIII), platelet derived growth factor receptor (PDGFR), C-Kit and C-Abl together with phosphatase and tensin homolog (PTEN) expression and downstream activation of AKT and phosphorylated ribosomal protein S6 (P70S6K) was analysed in 26 primary glioma cultures treated with the tyrosine kinase inhibitors (TKIs) erlotinib, gefitinib and imatinib. Response to TKIs was assessed using 50% inhibitory concentrations (IC{sub 50}). Response for each culture was compared with the EGFR/PDGFR immunocytochemical pathway profile using hierarchical cluster analysis (HCA) and principal component analysis (PCA). Erlotinib response was not strongly associated with high expression of the growth factor pathway components. PTEN expression did not correlate with response to any of the three TKIs. Increased EGFR expression was associated with gefitinib response; increased PDGFR-{alpha} expression was associated with imatinib response. The results of this in vitro study suggest gefitinib and imatinib may have therapeutic potential in HGG tumours with a corresponding growth factor receptor expression profile. -- Highlights: Black-Right-Pointing-Pointer Non-responders had low EGFR expression, high PDGFR-{beta}, and a low proliferation rate. Black-Right-Pointing-Pointer PTEN is not indicative of response to a TKI. Black-Right-Pointing-Pointer Erlotinib response was not associated with expression of the proteins examined. Black-Right-Pointing-Pointer Imatinib-response correlated with expression of PDGFR-{alpha}. Black-Right-Pointing-Pointer Gefitinib response correlated with increased expression of EGFR.

  7. Receptor tyrosine kinase inhibition causes simultaneous bone loss and excess bone formation within growing bone in rats

    SciTech Connect

    Nurmio, Mirja; Joki, Henna; Kallio, Jenny; Maeaettae, Jorma A.; Vaeaenaenen, H. Kalervo; Toppari, Jorma; Jahnukainen, Kirsi; Laitala-Leinonen, Tiina

    2011-08-01

    During postnatal skeletal growth, adaptation to mechanical loading leads to cellular activities at the growth plate. It has recently become evident that bone forming and bone resorbing cells are affected by the receptor tyrosine kinase (RTK) inhibitor imatinib mesylate (STI571, Gleevec (registered)) . Imatinib targets PDGF, ABL-related gene, c-Abl, c-Kit and c-Fms receptors, many of which have multiple functions in the bone microenvironment. We therefore studied the effects of imatinib in growing bone. Young rats were exposed to imatinib (150 mg/kg on postnatal days 5-7, or 100 mg/kg on postnatal days 5-13), and the effects of RTK inhibition on bone physiology were studied after 8 and 70 days (3-day treatment), or after 14 days (9-day treatment). X-ray imaging, computer tomography, histomorphometry, RNA analysis and immunohistochemistry were used to evaluate bone modeling and remodeling in vivo. Imatinib treatment eliminated osteoclasts from the metaphyseal osteochondral junction at 8 and 14 days. This led to a resorption arrest at the growth plate, but also increased bone apposition by osteoblasts, thus resulting in local osteopetrosis at the osteochondral junction. The impaired bone remodelation observed on day 8 remained significant until adulthood. Within the same bone, increased osteoclast activity, leading to bone loss, was observed at distal bone trabeculae on days 8 and 14. Peripheral quantitative computer tomography (pQCT) and micro-CT analysis confirmed that, at the osteochondral junction, imatinib shifted the balance from bone resorption towards bone formation, thereby altering bone modeling. At distal trabecular bone, in turn, the balance was turned towards bone resorption, leading to bone loss. - Research Highlights: > 3-Day imatinib treatment. > Causes growth plate anomalies in young rats. > Causes biomechanical changes and significant bone loss at distal trabecular bone. > Results in loss of osteoclasts at osteochondral junction.

  8. Attenuation of pattern recognition receptor signaling is mediated by a MAP kinase kinase kinase.

    PubMed

    Mithoe, Sharon C; Ludwig, Christina; Pel, Michiel J C; Cucinotta, Mara; Casartelli, Alberto; Mbengue, Malick; Sklenar, Jan; Derbyshire, Paul; Robatzek, Silke; Pieterse, Corné M J; Aebersold, Ruedi; Menke, Frank L H

    2016-03-01

    Pattern recognition receptors (PRRs) play a key role in plant and animal innate immunity. PRR binding of their cognate ligand triggers a signaling network and activates an immune response. Activation of PRR signaling must be controlled prior to ligand binding to prevent spurious signaling and immune activation. Flagellin perception in Arabidopsis through FLAGELLIN-SENSITIVE 2 (FLS2) induces the activation of mitogen-activated protein kinases (MAPKs) and immunity. However, the precise molecular mechanism that connects activated FLS2 to downstream MAPK cascades remains unknown. Here, we report the identification of a differentially phosphorylated MAP kinase kinase kinase that also interacts with FLS2. Using targeted proteomics and functional analysis, we show that MKKK7 negatively regulates flagellin-triggered signaling and basal immunity and this requires phosphorylation of MKKK7 on specific serine residues. MKKK7 attenuates MPK6 activity and defense gene expression. Moreover, MKKK7 suppresses the reactive oxygen species burst downstream of FLS2, suggesting that MKKK7-mediated attenuation of FLS2 signaling occurs through direct modulation of the FLS2 complex. PMID:26769563

  9. Src kinase regulation by phosphorylation and dephosphorylation

    SciTech Connect

    Roskoski, Robert . E-mail: biocrr@lsuhsc.edu

    2005-05-27

    Src and Src-family protein-tyrosine kinases are regulatory proteins that play key roles in cell differentiation, motility, proliferation, and survival. The initially described phosphorylation sites of Src include an activating phosphotyrosine 416 that results from autophosphorylation, and an inhibiting phosphotyrosine 527 that results from phosphorylation by C-terminal Src kinase (Csk) and Csk homologous kinase. Dephosphorylation of phosphotyrosine 527 increases Src kinase activity. Candidate phosphotyrosine 527 phosphatases include cytoplasmic PTP1B, Shp1 and Shp2, and transmembrane enzymes include CD45, PTP{alpha}, PTP{epsilon}, and PTP{lambda}. Dephosphorylation of phosphotyrosine 416 decreases Src kinase activity. Thus far PTP-BL, the mouse homologue of human PTP-BAS, has been shown to dephosphorylate phosphotyrosine 416 in a regulatory fashion. The platelet-derived growth factor receptor protein-tyrosine kinase mediates the phosphorylation of Src Tyr138; this phosphorylation has no direct effect on Src kinase activity. The platelet-derived growth factor receptor and the ErbB2/HER2 growth factor receptor protein-tyrosine kinases mediate the phosphorylation of Src Tyr213 and activation of Src kinase activity. Src kinase is also a substrate for protein-serine/threonine kinases including protein kinase C (Ser12), protein kinase A (Ser17), and CDK1/cdc2 (Thr34, Thr46, and Ser72). Of the three protein-serine/threonine kinases, only phosphorylation by CDK1/cdc2 has been demonstrated to increase Src kinase activity. Although considerable information on the phosphoprotein phosphatases that catalyze the hydrolysis of Src phosphotyrosine 527 is at hand, the nature of the phosphatases that mediate the hydrolysis of phosphotyrosine 138 and 213, and phosphoserine and phosphothreonine residues has not been determined.

  10. The JAK kinases: not just another kinase drug discovery target.

    PubMed

    Wilks, Andrew F

    2008-08-01

    There are four members of the JAK family of protein tyrosine kinases (PTKs) in the human genome. Since their discovery in 1989, great strides have been made in the understanding of their role in normal intracellular signalling. Importantly, their roles in pathologies ranging from cancer to immune deficiencies have placed them front and centre as potential drug targets. The recent discovery of the role of activating mutations in the kinase-like domain (KLD) of JAK2 in the development of polycythemia rubra vera, and the elaboration of KLD mutation as a broader mechanism by which cells might become hyperproliferative has sparked enormous interest in the development of JAK selective drug candidates. I review herein the progress that has been made in the discovery of JAK-targeted inhibitors, and discuss the challenges that face the development of these drugs for use in the clinic. PMID:18721891

  11. PTK787/ZK 222584, a novel and potent inhibitor of vascular endothelial growth factor receptor tyrosine kinases, impairs vascular endothelial growth factor-induced responses and tumor growth after oral administration.

    PubMed

    Wood, J M; Bold, G; Buchdunger, E; Cozens, R; Ferrari, S; Frei, J; Hofmann, F; Mestan, J; Mett, H; O'Reilly, T; Persohn, E; Rösel, J; Schnell, C; Stover, D; Theuer, A; Towbin, H; Wenger, F; Woods-Cook, K; Menrad, A; Siemeister, G; Schirner, M; Thierauch, K H; Schneider, M R; Drevs, J; Martiny-Baron, G; Totzke, F

    2000-04-15

    PTK787/ZK 222584 (1-[4-chloroanilino]-4-[4-pyridylmethyl] phthalazine succinate) is a potent inhibitor of vascular endothelial growth factor (VEGF) receptor tyrosine kinases, active in the submicromolar range. It also inhibits other class III kinases, such as the platelet-derived growth factor (PDGF) receptor beta tyrosine kinase, c-Kit, and c-Fms, but at higher concentrations. It is not active against kinases from other receptor families, such as epidermal growth factor receptor, fibroblast growth factor receptor-1, c-Met, and Tie-2, or intracellular kinases such as c-Src, c-Abl, and protein kinase C-alpha. PTK787/ZK 222584 inhibits VEGF-induced autophosphorylation of kinase insert domain-containing receptor (KDR), endothelial cell proliferation, migration, and survival in the nanomolar range in cell-based assays. In concentrations up to 1 microM, PTK787/ZK 222584 does not have any cytotoxic or antiproliferative effect on cells that do not express VEGF receptors. After oral dosing (50 mg/kg) to mice, plasma concentrations of PTK787/ZK 222584 remain above 1 microM for more than 8 h. PTK787/ZK 222584 induces dose-dependent inhibition of VEGF and PDGF-induced angiogenesis in a growth factor implant model, as well as a tumor cell-driven angiogenesis model after once-daily oral dosing (25-100 mg/kg). In the same dose range, it also inhibits the growth of several human carcinomas, grown s.c. in nude mice, as well as a murine renal carcinoma and its metastases in a syngeneic, orthotopic model. Histological examination of tumors revealed inhibition of microvessel formation in the interior of the tumor. PTK787/ZK 222584 is very well tolerated and does not impair wound healing. It also does not have any significant effects on circulating blood cells or bone marrow leukocytes as a single agent or impair hematopoetic recovery after concomitant cytotoxic anti-cancer agent challenge. This novel compound has therapeutic potential for the treatment of solid tumors and other

  12. Protein Kinase A: A Master Kinase of Granulosa Cell Differentiation

    PubMed Central

    Puri, Pawan; Little-Ihrig, Lynda; Chandran, Uma; Law, Nathan C.; Hunzicker-Dunn, Mary; Zeleznik, Anthony J.

    2016-01-01

    Activation of protein kinase A (PKA) by follicle stimulating hormone (FSH) transduces the signal that drives differentiation of ovarian granulosa cells (GCs). An unresolved question is whether PKA is sufficient to initiate the complex program of GC responses to FSH. We compared signaling pathways and gene expression profiles of GCs stimulated with FSH or expressing PKA-CQR, a constitutively active mutant of PKA. Both FSH and PKA-CQR stimulated the phosphorylation of proteins known to be involved in GC differentiation including CREB, ß-catenin, AKT, p42/44 MAPK, GAB2, GSK-3ß, FOXO1, and YAP. In contrast, FSH stimulated the phosphorylation of p38 MAP kinase but PKA-CQR did not. Microarray analysis revealed that 85% of transcripts that were up-regulated by FSH were increased to a comparable extent by PKA-CQR and of the transcripts that were down-regulated by FSH, 76% were also down-regulated by PKA-CQR. Transcripts regulated similarly by FSH and PKA-CQR are involved in steroidogenesis and differentiation, while transcripts more robustly up-regulated by PKA-CQR are involved in ovulation. Thus, PKA, under the conditions of our experimental approach appears to function as a master upstream kinase that is sufficient to initiate the complex pattern of intracellular signaling pathway and gene expression profiles that accompany GC differentiation. PMID:27324437

  13. Activation of phosphatidylinositol 3-kinase by insulin.

    PubMed Central

    Ruderman, N B; Kapeller, R; White, M F; Cantley, L C

    1990-01-01

    Insulin action appears to require the protein-tyrosine kinase domain of the beta subunit of the insulin receptor. Despite this, the identities and biochemical functions of the cellular targets of this tyrosine kinase are unknown. A phosphatidylinositol 3-kinase (PI 3-kinase) that phosphorylates the D-3 position of the inositol ring associates with several protein-tyrosine kinases. Here we report that PI 3-kinase activity is immunoprecipitated from insulin-stimulated CHO cells by antiphosphotyrosine and anti-insulin receptor antibodies. Insulin as low as 0.3 nM increased immunoprecipitable PI 3-kinase activity within 1 min. Increases in activity were much greater in CHO cells expressing the human insulin receptor (100,000 receptors per cell) than in control CHO cells (2000 receptors per cell). During insulin stimulation, various lipid products of the PI 3-kinase either appeared or increased in quantity in intact cells, suggesting that the appearance of immunoprecipitable PI 3-kinase reflects an increase in its activity in vivo. These results indicate that insulin at physiological concentrations regulates the PI 3-kinase and suggest that this regulation involves a physical association between the insulin receptor and the PI 3-kinase and tyrosyl phosphorylation. Images PMID:2154747

  14. Regulation and function of yeast PAS kinase

    PubMed Central

    Grose, Julianne H.; Sundwall, Eleanor; Rutter, Jared

    2016-01-01

    The inability to coordinate cellular metabolic processes with the cellular and organismal nutrient environment leads to a variety of disorders, including diabetes and obesity. Nutrient-sensing protein kinases, such as AMPK and mTOR, play a pivotal role in metabolic regulation and are promising therapeutic targets for the treatment of disease. In this Extra View, we describe another member of the nutrient-sensing protein kinase group, PAS kinase, which plays a role in the regulation of glucose utilization in both mammals and yeast. PAS kinase deficient mice are resistant to high fat diet-induced weight gain, insulin resistance and hepatic triglyceride hyperaccumulation, suggesting a role for PAS kinase in the regulation of glucose and lipid metabolism in mammals. Likewise, PAS kinase deficient yeast display altered glucose partitioning, favoring glycogen biosynthesis at the expense of cell wall biosynthesis. As a result, PAS kinase deficient yeast are sensitive to cell wall perturbing agents. This partitioning of glucose in response to PAS kinase activation is due to phosphorylation of Ugp1, the enzyme primarily responsible for UDP-glucose production. The two yeast PAS kinase homologs, Psk1 and Psk2, are activated by two stimuli, cell integrity stress and nonfermentative carbon sources. We review what is known about yeast PAS kinase and describe a genetic screen that may help elucidate pathways involved in PAS kinase activation and function. PMID:19440050

  15. Myogenic signaling of phosphatidylinositol 3-kinase requires the serine-threonine kinase Akt/protein kinase B

    PubMed Central

    Jiang, Bing-Hua; Aoki, Masahiro; Zheng, Jenny Z.; Li, Jian; Vogt, Peter K.

    1999-01-01

    The oncogene p3k, coding for a constitutively active form of phosphatidylinositol 3-kinase (PI 3-kinase), strongly activates myogenic differentiation. Inhibition of endogenous PI 3-kinase activity with the specific inhibitor LY294002, or with dominant-negative mutants of PI 3-kinase, interferes with myotube formation and with the expression of muscle-specific proteins. Here we demonstrate that a downstream target of PI 3-kinase, serine-threonine kinase Akt, plays an important role in myogenic differentiation. Expression of constitutively active forms of Akt dramatically enhances myotube formation and expression of the muscle-specific proteins MyoD, creatine kinase, myosin heavy chain, and desmin. Transdominant negative forms of Akt inhibit myotube formation and the expression of muscle-specific proteins. The inhibition of myotube formation and the reduced expression of muscle-specific proteins caused by the PI 3-kinase inhibitor LY294002 are completely reversed by constitutively active forms of Akt. Wild-type cellular Akt effects a partial reversal of LY294002-induced inhibition of myogenic differentiation. This result suggests that Akt can substitute for PI 3-kinase in the stimulation of myogenesis; Akt may be an essential downstream component of PI 3-kinase-induced muscle differentiation. PMID:10051597

  16. Oncoprotein protein kinase antibody kit

    DOEpatents

    Karin, Michael; Hibi, Masahiko; Lin, Anning

    2008-12-23

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  17. Mevalonate kinase deficiency: current perspectives

    PubMed Central

    Favier, Leslie A; Schulert, Grant S

    2016-01-01

    Mevalonate kinase deficiency (MKD) is a recessively inherited autoinflammatory disorder with a spectrum of manifestations, including the well-defined clinical phenotypes of hyperimmunoglobulinemia D and periodic fever syndrome and mevalonic aciduria. Patients with MKD have recurrent attacks of hyperinflammation associated with fever, abdominal pain, arthralgias, and mucocutaneous lesions, and more severely affected patients also have dysmorphisms and central nervous system anomalies. MKD is caused by mutations in the gene encoding mevalonate kinase, with the degree of residual enzyme activity largely determining disease severity. Mevalonate kinase is essential for the biosynthesis of nonsterol isoprenoids, which mediate protein prenylation. Although the precise pathogenesis of MKD remains unclear, increasing evidence suggests that deficiency in protein prenylation leads to innate immune activation and systemic hyperinflammation. Given the emerging understanding of MKD as an autoinflammatory disorder, recent treatment approaches have largely focused on cytokine-directed biologic therapy. Herein, we review the current genetic and pathologic understanding of MKD, its various clinical phenotypes, and the evolving treatment approach for this multifaceted disorder. PMID:27499643

  18. High-Throughput Kinase Profiling: A More Efficient Approach towards the Discovery of New Kinase Inhibitors

    PubMed Central

    Miduturu, Chandrasekhar V.; Deng, Xianming; Kwiatkowski, Nicholas; Yang, Wannian; Brault, Laurent; Filippakopoulos, Panagis; Chung, Eunah; Yang, Qingkai; Schwaller, Juerg; Knapp, Stefan; King, Randall W.; Lee, Jiing-Dwan; Herrgard, Sanna; Zarrinkar, Patrick; Gray, Nathanael S.

    2011-01-01

    SUMMARY Selective protein kinase inhibitors have only been developed against a small number of kinase targets. Here we demonstrate that “high-throughput kinase profiling” is an efficient method for the discovery of lead compounds for established as well as unexplored kinase targets. We screened a library of 118 compounds constituting two distinct scaffolds (furan-thiazolidinediones and pyrimido-diazepines) against a panel of 353 kinases. A distinct kinase selectivity profile was observed for each scaffold. Selective inhibitors were identified with submicromolar cellular activity against PIM1, ERK5, ACK1, MPS1/PLK1–3 and Aurora A,B kinases. In addition, we identified potent inhibitors for so far unexplored kinases such as DRAK1, HIPK2 and DCAMKL1 that await further evaluation. This inhibitor-centric approach permits comprehensive assessment of a scaffold of interest and represents an efficient and general strategy for identifying new selective kinase inhibitors. PMID:21802008

  19. The Role of Mitogen-Activated Protein Kinase-Activated Protein Kinases (MAPKAPKs) in Inflammation

    PubMed Central

    Moens, Ugo; Kostenko, Sergiy; Sveinbjørnsson, Baldur

    2013-01-01

    Mitogen-activated protein kinase (MAPK) pathways are implicated in several cellular processes including proliferation, differentiation, apoptosis, cell survival, cell motility, metabolism, stress response and inflammation. MAPK pathways transmit and convert a plethora of extracellular signals by three consecutive phosphorylation events involving a MAPK kinase kinase, a MAPK kinase, and a MAPK. In turn MAPKs phosphorylate substrates, including other protein kinases referred to as MAPK-activated protein kinases (MAPKAPKs). Eleven mammalian MAPKAPKs have been identified: ribosomal-S6-kinases (RSK1-4), mitogen- and stress-activated kinases (MSK1-2), MAPK-interacting kinases (MNK1-2), MAPKAPK-2 (MK2), MAPKAPK-3 (MK3), and MAPKAPK-5 (MK5). The role of these MAPKAPKs in inflammation will be reviewed. PMID:24705157

  20. MUC5AC, a Gel-Forming Mucin Accumulating in Gallstone Disease, Is Overproduced via an Epidermal Growth Factor Receptor Pathway in the Human Gallbladder

    PubMed Central

    Finzi, Laetitia; Barbu, Véronique; Burgel, Pierre-Regis; Mergey, Martine; Kirkwood, Kimberly S.; Wick, Elizabeth C.; Scoazec, Jean-Yves; Peschaud, Frédérique; Paye, François; Nadel, Jay A.; Housset, Chantal

    2006-01-01

    Despite evidence that mucin overproduction is critical in the pathogenesis of gallstones, the mechanisms triggering mucin production in gallstone disease are unknown. Here, we tested the potential implication of an inflammation-dependent epidermal growth factor receptor (EGF-R) pathway in the regulation of gallbladder mucin synthesis. In gallbladder tissue sections from subjects with cholesterol gallstones, mucus accumulation was associated with neutrophil infiltration and with increased expressions of EGF-R and of tumor necrosis factor-α (TNF-α). In primary cultures of human gallbladder epithelial cells, TNF-α induced EGF-R overexpression. In the presence of TNF-α, EGF-R ligands (either EGF or transforming growth factor-α) caused significant increases in MUC5AC mRNA and protein production, whereas expression of the other gallbladder mucins MUC1, MUC3, and MUC5B was unchanged. In addition, on gallbladder tissue sections from subjects with gallstones, increased MUC5AC immunoreactivity was detected in the epithelium and within mucus gel in the lumen. Studies in primary cultures demonstrated that MUC5AC up-regulation induced by the combination of TNF-α with EGF-R ligands was completely blunted by inhibitors of EGF-R tyrosine kinase and mitogen-activated protein/extracellular signal-related kinase kinase. In conclusion, an inflammation-dependent EGF-R cascade causes overproduction of the gel-forming mucin MUC5AC, which accumulates in cholesterol gallstone disease. The ability to interrupt this cascade is of potential interest in the prevention of cholesterol gallstones. PMID:17148666

  1. Labeling and Identification of Direct Kinase Substrates

    PubMed Central

    Carlson, Scott M.; White, Forest M.

    2013-01-01

    Identifying kinase substrates is an important step in mapping signal transduction pathways, but remains a difficult and time-consuming process. Analog-sensitive kinases (AS-kinases) have been used to selectively tag and identify direct kinase substrates in lysates from whole cells. In this approach a gamma-thiol ATP-analog and AS-kinase are used to selectively thiophosphorylate target proteins. Thiophosphate is used as a chemical handle to purify peptides from a tryptic digest, and target proteins are identified by liquid chromatography and tandem mass spectrometry (LC-MS/MS). Here, we describe an updated strategy for labeling AS-kinase substrates, solid-phase capture of thiophosphorylated peptides, incorporation of stable-isotopic labeling in cell culture (SILAC) for filtering nonspecific background peptides, enrichment of phosphorylated target peptides to identify low-abundance targets, and analysis by LC-MS/MS. PMID:22669844

  2. Receptor Tyrosine Kinases in Drosophila Development

    PubMed Central

    Sopko, Richelle; Perrimon, Norbert

    2013-01-01

    Tyrosine phosphorylation plays a significant role in a wide range of cellular processes. The Drosophila genome encodes more than 20 receptor tyrosine kinases and extensive studies in the past 20 years have illustrated their diverse roles and complex signaling mechanisms. Although some receptor tyrosine kinases have highly specific functions, others strikingly are used in rather ubiquitous manners. Receptor tyrosine kinases regulate a broad expanse of processes, ranging from cell survival and proliferation to differentiation and patterning. Remarkably, different receptor tyrosine kinases share many of the same effectors and their hierarchical organization is retained in disparate biological contexts. In this comprehensive review, we summarize what is known regarding each receptor tyrosine kinase during Drosophila development. Astonishingly, very little is known for approximately half of all Drosophila receptor tyrosine kinases. PMID:23732470

  3. Long Wavelength Monitoring of Protein Kinase Activity

    PubMed Central

    Oien, Nathan P.; Nguyen, Luong T.; Jernigan, Finith E.; Priestman, Melanie A.

    2014-01-01

    A family of long wavelength protein kinase fluorescent reporters is described in which the probing wavelength is pre-programmed using readily available fluorophores. These agents can assess protein kinase activity within the optical window of tissue, as exemplified by monitoring endogenous cAMP-dependent protein kinase activity (1) in erythrocyte lysates and (2) in intact erythrocytes using a light-activatable reporter. PMID:24604833

  4. Tec family kinases in inflammation and disease.

    PubMed

    Horwood, Nicole J; Urbaniak, Ania M; Danks, Lynett

    2012-04-01

    Over the last decade, the Tec family of nonreceptor tyrosine kinases (Btk, Tec, Bmx, Itk, and Rlk) have been shown to play a key role in inflammation and bone destruction. Bruton's tyrosine kinase (Btk) has been the most widely studied due to the critical role of this kinase in B-cell development and recent evidence showing that blocking Btk signaling is effective in ameliorating lymphoma progression and experimental arthritis. This review will examine the role of TFK in myeloid cell function and the potential of targeting these kinases as a therapeutic intervention in autoimmune disorders such as rheumatoid arthritis. PMID:22449071

  5. MST kinases in development and disease

    PubMed Central

    2015-01-01

    The mammalian MST kinase family, which is related to the Hippo kinase in Drosophila melanogaster, includes five related proteins: MST1 (also called STK4), MST2 (also called STK3), MST3 (also called STK24), MST4, and YSK1 (also called STK25 or SOK1). MST kinases are emerging as key signaling molecules that influence cell proliferation, organ size, cell migration, and cell polarity. Here we review the regulation and function of these kinases in normal physiology and pathologies, including cancer, endothelial malformations, and autoimmune disease. PMID:26370497

  6. A new “angle” on kinase inhibitor design: Prioritizing amphosteric activity above kinase inhibition

    PubMed Central

    Meyerowitz, Justin G; Weiss, William A; Gustafson, W Clay

    2015-01-01

    The MYCN oncoprotein has remained an elusive target for decades. We recently reported a new class of kinase inhibitors designed to disrupt the conformation of Aurora kinase A enough to block its kinase-independent interaction with MYCN, resulting in potent degradation of MYCN. These studies provide proof-of-principle for a new method of targeting enzyme activity-independent functions of kinases and other enzymes. PMID:27308435

  7. Sensitive kinase assay linked with phosphoproteomics for identifying direct kinase substrates.

    PubMed

    Xue, Liang; Wang, Wen-Horng; Iliuk, Anton; Hu, Lianghai; Galan, Jacob A; Yu, Shuai; Hans, Michael; Geahlen, Robert L; Tao, W Andy

    2012-04-10

    Our understanding of the molecular control of many disease pathologies requires the identification of direct substrates targeted by specific protein kinases. Here we describe an integrated proteomic strategy, termed kinase assay linked with phosphoproteomics, which combines a sensitive kinase reaction with endogenous kinase-dependent phosphoproteomics to identify direct substrates of protein kinases. The unique in vitro kinase reaction is carried out in a highly efficient manner using a pool of peptides derived directly from cellular kinase substrates and then dephosphorylated as substrate candidates. The resulting newly phosphorylated peptides are then isolated and identified by mass spectrometry. A further comparison of these in vitro phosphorylated peptides with phosphopeptides derived from endogenous proteins isolated from cells in which the kinase is either active or inhibited reveals new candidate protein substrates. The kinase assay linked with phosphoproteomics strategy was applied to identify unique substrates of spleen tyrosine kinase (Syk), a protein-tyrosine kinase with duel properties of an oncogene and a tumor suppressor in distinctive cell types. We identified 64 and 23 direct substrates of Syk specific to B cells and breast cancer cells, respectively. Both known and unique substrates, including multiple centrosomal substrates for Syk, were identified, supporting a unique mechanism that Syk negatively affects cell division through its centrosomal kinase activity. PMID:22451900

  8. Diacylglycerol kinases in membrane trafficking

    PubMed Central

    Xie, Shuwei; Naslavsky, Naava; Caplan, Steve

    2015-01-01

    Diacylglycerol kinases (DGKs) belong to a family of cytosolic kinases that regulate the phosphorylation of diacylglycerol (DAG), converting it into phosphatidic acid (PA). There are 10 known mammalian DGK isoforms, each with a different tissue distribution and substrate specificity. These differences allow regulation of cellular responses by fine-tuning the delicate balance of cellular DAG and PA. DGK isoforms are best characterized as mediators of signal transduction and immune function. However, since recent studies reveal that DAG and PA are also involved in the regulation of endocytic trafficking, it is therefore anticipated that DGKs also plays an important role in membrane trafficking. In this review, we summarize the literature discussing the role of DGK isoforms at different stages of endocytic trafficking, including endocytosis, exocytosis, endocytic recycling, and transport from/to the Golgi apparatus. Overall, these studies contribute to our understanding of the involvement of PA and DAG in endocytic trafficking, an area of research that is drawing increasing attention in recent years. PMID:27057419

  9. Rho Kinases and Cardiac Remodeling.

    PubMed

    Shimizu, Toru; Liao, James K

    2016-06-24

    Hypertensive cardiac remodeling is characterized by left ventricular hypertrophy and interstitial fibrosis, which can lead to heart failure with preserved ejection fraction. The Rho-associated coiled-coil containing kinases (ROCKs) are members of the serine/threonine protein kinase family, which mediates the downstream effects of the small GTP-binding protein RhoA. There are 2 isoforms: ROCK1 and ROCK2. They have different functions in different types of cells and tissues. There is growing evidence that ROCKs contribute to the development of cardiovascular diseases, including cardiac fibrosis, hypertrophy, and subsequent heart failure. Recent experimental studies using ROCK inhibitors, such as fasudil, have shown the benefits of ROCK inhibition in cardiac remodeling. Mice lacking each ROCK isoform also exhibit reduced myocardial fibrosis in a variety of pathological models of cardiac remodeling. Indeed, clinical studies with fasudil have suggested that ROCKs could be potential novel therapeutic targets for cardiovascular diseases. In this review, we summarize the current understanding of the roles of ROCKs in the development of cardiac fibrosis and hypertrophy and discuss their therapeutic potential for deleterious cardiac remodeling. (Circ J 2016; 80: 1491-1498). PMID:27251065

  10. Receptor Tyrosine Kinases with Intracellular Pseudokinase Domains

    PubMed Central

    Mendrola, Jeannine M.; Shi, Fumin; Park, Jin H.; Lemmon, Mark A.

    2013-01-01

    As with other groups of protein kinases, approximately 10% of the receptor tyrosine kinases (RTKs) in the human proteome contain intracellular pseudokinases that lack one or more conserved catalytically important residues. These include ErbB3, a member of the epidermal growth factor receptor (EGFR) family, and a series of unconventional Wnt receptors. We recently showed that, despite its reputation as a pseudokinase, the ErbB3 tyrosine kinase domain (TKD) does retain significant – albeit weak – kinase activity. This led us to suggest that a subgroup of RTKs may be able to signal even with very inefficient kinases. Recent work suggests that this is not the case, however. Other pseudokinase RTKs have not revealed significant kinase activity, and mutations that impair ErbB3’s weak kinase activity have not so far been found to exhibit signaling defects. These findings therefore point to models in which the TKDs of pseudokinase RTKs participate in receptor signaling by allosterically regulating associated kinases (such as ErbB3 regulation of ErbB2) and/or function as regulated ‘scaffolds’ for other intermolecular interactions central to signal propagation. Further structural and functional studies – particularly of the pseudokinase RTKs involved in Wnt signaling – are required to shed new light on these intriguing signaling mechanisms. PMID:23863174

  11. Genetics Home Reference: pyruvate kinase deficiency

    MedlinePlus

    ... National (UK) Information Centre for Metabolic Diseases National Organization for Rare Disorders (NORD): Pyruvate Kinase Deficiency Genetic Testing Registry (1 link) Pyruvate kinase deficiency of red cells Scientific articles on PubMed (1 link) PubMed OMIM (1 link) ...

  12. Aurora Kinase Inhibitors: Current Status and Outlook

    PubMed Central

    Bavetsias, Vassilios; Linardopoulos, Spiros

    2015-01-01

    The Aurora kinase family comprises of cell cycle-regulated serine/threonine kinases important for mitosis. Their activity and protein expression are cell cycle regulated, peaking during mitosis to orchestrate important mitotic processes including centrosome maturation, chromosome alignment, chromosome segregation, and cytokinesis. In humans, the Aurora kinase family consists of three members; Aurora-A, Aurora-B, and Aurora-C, which each share a conserved C-terminal catalytic domain but differ in their sub-cellular localization, substrate specificity, and function during mitosis. In addition, Aurora-A and Aurora-B have been found to be overexpressed in a wide variety of human tumors. These observations led to a number of programs among academic and pharmaceutical organizations to discovering small molecule Aurora kinase inhibitors as anti-cancer drugs. This review will summarize the known Aurora kinase inhibitors currently in the clinic, and discuss the current and future directions. PMID:26734566

  13. Sphingosine kinase regulation and cardioprotection

    PubMed Central

    Karliner, Joel S.

    2009-01-01

    Activation of sphingosine kinase/sphingosine-1-phosphate (SK/S1P)-mediated signalling has been recognized as critical for cardioprotection in response to acute ischaemia/reperfusion injury. Incubation of S1P with cultured cardiac myocytes subjected to hypoxia or treatment of isolated hearts either before ischaemia or at the onset of reperfusion (pharmacologic pre- or postconditioning) results in reduced myocyte injury. Synthetic agonists active at S1P receptors mimic these responses. Gene-targeted mice null for the SK1 isoform whose hearts are subjected to ischaemia/reperfusion injury exhibit increased infarct size and respond poorly either to ischaemic pre- or postconditioning. Measurements of cardiac SK activity and S1P parallel these observations. Ischaemic postconditioning combined with sphingosine and S1P rescues the heart from prolonged ischaemia. These observations may have considerable relevance for future therapeutic approaches to acute and chronic myocardial injury. PMID:19017750

  14. Insulin-induced Drosophila S6 kinase activation requires phosphoinositide 3-kinase and protein kinase B.

    PubMed Central

    Lizcano, Jose M; Alrubaie, Saif; Kieloch, Agnieszka; Deak, Maria; Leevers, Sally J; Alessi, Dario R

    2003-01-01

    An important mechanism by which insulin regulates cell growth and protein synthesis is through activation of the p70 ribosomal S6 protein kinase (S6K). In mammalian cells, insulin-induced PI3K (phosphoinositide 3-kinase) activation, generates the lipid second messenger PtdIns(3,4,5) P (3), which is thought to play a key role in triggering the activation of S6K. Although the major components of the insulin-signalling pathway are conserved in Drosophila, recent studies suggested that S6K activation does not require PI3K in this system. To investigate further the role of dPI3K (Drosophila PI3K) in dS6K (Drosophila S6K) activation, we examined the effect of two structurally distinct PI3K inhibitors on insulin-induced dS6K activation in Kc167 and S2 Drosophila cell lines. We found that both inhibitors prevented insulin-stimulated phosphorylation and activation of dS6K. To investigate further the role of the dPI3K pathway in regulating dS6K activation, we also used dsRNAi (double-stranded RNA-mediated interference) to decrease expression of dPI3K and the PtdIns(3,4,5) P (3) phosphatase dPTEN ( Drosophila phosphatase and tensin homologue deleted on chromosome 10) in Kc167 and S2 cells. Knock-down of dPI3K prevented dS6K activation, whereas knock-down of dPTEN, which would be expected to increase PtdIns(3,4,5) P (3) levels, stimulated dS6K activity. Moreover, when the expression of the dPI3K target, dPKB (Drosophila protein kinase B), was decreased to undetectable levels, we found that insulin could no longer trigger dS6K activation. This observation provides the first direct demonstration that dPKB is required for insulin-stimulated dS6K activation. We also present evidence that the amino-acid-induced activation of dS6K in the absence of insulin, thought to be mediated by dTOR (Drosophila target of rapamycin), which is unaffected by the inhibition of dPI3K by wortmannin. The results of the present study support the view that, in Drosophila cells, dPI3K and dPKB, as well d

  15. Phosphoinositide 3-kinase-gamma induces Xenopus oocyte maturation via lipid kinase activity.

    PubMed Central

    Hehl, S; Stoyanov, B; Oehrl, W; Schönherr, R; Wetzker, R; Heinemann, S H

    2001-01-01

    Type-I phosphoinositide 3-kinases (PI3Ks) were characterized as a group of intracellular signalling proteins expressing both protein and lipid kinase activities. Recent studies implicate PI3Ks as mediators of oocyte maturation, but the molecular mechanisms are poorly defined. Here we used the Xenopus oocyte expression system as a model to investigate a possible contribution of the gamma-isoform of PI3K (PI3Kgamma) in the different pathways leading to cell-cycle progression by monitoring the time course of germinal vesicle breakdown (GVBD). Expression of a constitutive active PI3Kgamma (PI3Kgamma-CAAX) induced GVBD and increased the levels of phosphorylated Akt/protein kinase B and mitogen-activated protein kinase (MAPK). Furthermore, PI3Kgamma-CAAX accelerated progesterone-induced GVBD, but had no effect on GVBD induced by insulin. The effects of PI3Kgamma-CAAX could be suppressed by pre-incubation of the oocytes with LY294002, PD98059 or roscovitine, inhibitors of PI3K, MEK (MAPK/extracellular-signal-regulated protein kinase kinase) and cdc2/cyclin B kinase, respectively. Mutants of PI3Kgamma-CAAX, in which either lipid kinase or both lipid and protein kinase activities were altered or eliminated, did not induce significant GVBD. Our data demonstrate that expression of PI3Kgamma in Xenopus oocytes accelerates their progesterone-induced maturation and that lipid kinase activity is required to induce this effect. PMID:11736661

  16. Mitotic regulation by NIMA-related kinases

    PubMed Central

    O'Regan, Laura; Blot, Joelle; Fry, Andrew M

    2007-01-01

    The NIMA-related kinases represent a family of serine/threonine kinases implicated in cell cycle control. The founding member of this family, the NIMA kinase of Aspergillus nidulans, as well as the fission yeast homologue Fin1, contribute to multiple aspects of mitotic progression including the timing of mitotic entry, chromatin condensation, spindle organization and cytokinesis. Mammals contain a large family of eleven NIMA-related kinases, named Nek1 to Nek11. Of these, there is now substantial evidence that Nek2, Nek6, Nek7 and Nek9 also regulate mitotic events. At least three of these kinases, as well as NIMA and Fin1, have been localized to the microtubule organizing centre of their respective species, namely the centrosome or spindle pole body. Here, they have important functions in microtubule organization and mitotic spindle assembly. Other Nek kinases have been proposed to play microtubule-dependent roles in non-dividing cells, most notably in regulating the axonemal microtubules of cilia and flagella. In this review, we discuss the evidence that NIMA-related kinases make a significant contribution to the orchestration of mitotic progression and thereby protect cells from chromosome instability. Furthermore, we highlight their potential as novel chemotherapeutic targets. PMID:17727698

  17. Dynamic architecture of a protein kinase

    PubMed Central

    McClendon, Christopher L.; Kornev, Alexandr P.; Gilson, Michael K.; Taylor, Susan S.

    2014-01-01

    Protein kinases are dynamically regulated signaling proteins that act as switches in the cell by phosphorylating target proteins. To establish a framework for analyzing linkages between structure, function, dynamics, and allostery in protein kinases, we carried out multiple microsecond-scale molecular-dynamics simulations of protein kinase A (PKA), an exemplar active kinase. We identified residue–residue correlated motions based on the concept of mutual information and used the Girvan–Newman method to partition PKA into structurally contiguous “communities.” Most of these communities included 40–60 residues and were associated with a particular protein kinase function or a regulatory mechanism, and well-known motifs based on sequence and secondary structure were often split into different communities. The observed community maps were sensitive to the presence of different ligands and provide a new framework for interpreting long-distance allosteric coupling. Communication between different communities was also in agreement with the previously defined architecture of the protein kinase core based on the “hydrophobic spine” network. This finding gives us confidence in suggesting that community analyses can be used for other protein kinases and will provide an efficient tool for structural biologists. The communities also allow us to think about allosteric consequences of mutations that are linked to disease. PMID:25319261

  18. [Mitogen-activated protein kinases in atherosclerosis].

    PubMed

    Bryk, Dorota; Olejarz, Wioletta; Zapolska-Downar, Danuta

    2014-01-01

    Intracellular signalling cascades, in which MAPK (mitogen-activated protein kinases) intermediate, are responsible for a biological response of a cell to an external stimulus. MAP kinases, which include ERK1/2 (extracellular signalling-regulated kinase), JNK (c-Jun N-terminal kinase) and p 38 MAPK, regulate the activity of many proteins, enzymes and transcription factors and thus have a wide spectrum of biological effects. Many basic scientific studies have defined numerous details of their pathway organization and activation. There are also more and more studies suggesting that individual MAP kinases probably play an important role in the pathogenesis of atherosclerosis. They may mediate inflammatory processes, endothelial cell activation, monocyte/macrophage recruitment and activation, smooth muscle cell proliferation and T-lymphocyte differentiation, all of which represent crucial mechanisms involved in pathogenesis of atherosclerosis. The specific inhibition of an activity of the respective MAP kinases may prove a new therapeutic approach to attenuate atherosclerotic plaque formation in the future. In this paper, we review the current state of knowledge concerning MAP kinase-dependent cellular and molecular mechanisms underlying atherosclerosis. PMID:24491891

  19. Functional analysis of anomeric sugar kinases.

    PubMed

    Conway, Louis P; Voglmeir, Josef

    2016-09-01

    Anomeric sugar kinases perform fundamental roles in the metabolism of carbohydrates. Under- or overexpression of these enzymes, or mutations causing functional impairments can give rise to diseases such as galactosaemia and so the study of this class of kinase is of critical importance. In addition, anomeric sugar kinases which are naturally promiscuous, or have been artificially made so, may find application in the synthesis of libraries of drug candidates (for example, antibiotics), and natural or unnatural oligosaccharides and glycoconjugates. In this review, we provide an overview of the biological functions of these enzymes, the tools which have been developed to investigate them, and the current frontiers in their study. PMID:27351442

  20. Differential AMP-activated Protein Kinase (AMPK) Recognition Mechanism of Ca2+/Calmodulin-dependent Protein Kinase Kinase Isoforms.

    PubMed

    Fujiwara, Yuya; Kawaguchi, Yoshinori; Fujimoto, Tomohito; Kanayama, Naoki; Magari, Masaki; Tokumitsu, Hiroshi

    2016-06-24

    Ca(2+)/calmodulin-dependent protein kinase kinase β (CaMKKβ) is a known activating kinase for AMP-activated protein kinase (AMPK). In vitro, CaMKKβ phosphorylates Thr(172) in the AMPKα subunit more efficiently than CaMKKα, with a lower Km (∼2 μm) for AMPK, whereas the CaMKIα phosphorylation efficiencies by both CaMKKs are indistinguishable. Here we found that subdomain VIII of CaMKK is involved in the discrimination of AMPK as a native substrate by measuring the activities of various CaMKKα/CaMKKβ chimera mutants. Site-directed mutagenesis analysis revealed that Leu(358) in CaMKKβ/Ile(322) in CaMKKα confer, at least in part, a distinct recognition of AMPK but not of CaMKIα. PMID:27151216

  1. Rac-1 and Raf-1 kinases, components of distinct signaling pathways, activate myotonic dystrophy protein kinase

    NASA Technical Reports Server (NTRS)

    Shimizu, M.; Wang, W.; Walch, E. T.; Dunne, P. W.; Epstein, H. F.

    2000-01-01

    Myotonic dystrophy protein kinase (DMPK) is a serine-threonine protein kinase encoded by the myotonic dystrophy (DM) locus on human chromosome 19q13.3. It is a close relative of other kinases that interact with members of the Rho family of small GTPases. We show here that the actin cytoskeleton-linked GTPase Rac-1 binds to DMPK, and coexpression of Rac-1 and DMPK activates its transphosphorylation activity in a GTP-sensitive manner. DMPK can also bind Raf-1 kinase, the Ras-activated molecule of the MAP kinase pathway. Purified Raf-1 kinase phosphorylates and activates DMPK. The interaction of DMPK with these distinct signals suggests that it may play a role as a nexus for cross-talk between their respective pathways and may partially explain the remarkable pleiotropy of DM.

  2. Gene expression profiles of lung adenocarcinoma linked to histopathological grading and survival but not to EGF-R status: a microarray study

    PubMed Central

    2010-01-01

    Background Several different gene expression signatures have been proposed to predict response to therapy and clinical outcome in lung adenocarcinoma. Herein, we investigate if elements of published gene sets can be reproduced in a small dataset, and how gene expression profiles based on limited sample size relate to clinical parameters including histopathological grade and EGFR protein expression. Methods Affymetrix Human Genome U133A platform was used to obtain gene expression profiles of 28 pathologically and clinically annotated adenocarcinomas of the lung. EGFR status was determined by fluorescent in situ hybridization and immunohistochemistry. Results Using unsupervised clustering algorithms, the predominant gene expression signatures correlated with the histopathological grade but not with EGFR protein expression as detected by immunohistochemistry. In a supervised analysis, the signature of high grade tumors but not of EGFR overexpressing cases showed significant enrichment of gene sets reflecting MAPK activation and other potential signaling cascades downstream of EGFR. Out of four different previously published gene sets that had been linked to prognosis, three showed enrichment in the gene expression signature associated with favorable prognosis. Conclusions In this dataset, histopathological tumor grades but not EGFR status were associated with dominant gene expression signatures and gene set enrichment reflecting oncogenic pathway activation, suggesting that high immunohistochemistry EGFR scores may not necessarily be linked to downstream effects that cause major changes in gene expression patterns. Published gene sets showed association with patient survival; however, the small sample size of this study limited the options for a comprehensive validation of previously reported prognostic gene expression signatures. PMID:20196851

  3. Pantothenate kinase-associated neurodegeneration.

    PubMed

    Hartig, Monika B; Prokisch, Holger; Meitinger, Thomas; Klopstock, Thomas

    2012-08-01

    Pantothenate kinase-associated neurodegeneration (PKAN) is a hereditary progressive disorder and the most frequent form of neurodegeneration with brain iron accumulation (NBIA). PKAN patients present with a progressive movement disorder, dysarthria, cognitive impairment and retinitis pigmentosa. In magnetic resonance imaging, PKAN patients exhibit the pathognonomic "eye of the tiger" sign in the globus pallidus which corresponds to iron accumulation and gliosis as shown in neuropathological examinations. The discovery of the disease causing mutations in PANK2 has linked the disorder to coenzyme A (CoA) metabolism. PANK2 is the only one out of four PANK genes encoding an isoform which localizes to mitochondria. At least two other NBIA genes (PLA2G6, C19orf12) encode proteins that share with PANK2 a mitochondrial localization and all are suggested to play a role in lipid homeostasis. With no causal therapy available for PKAN until now, only symptomatic treatment is possible. A multi-centre retrospective study with bilateral pallidal deep brain stimulation in patients with NBIA revealed a significant improvement of dystonia. Recently, studies in the PANK Drosophila model "fumble" revealed improvement by the compound pantethine which is hypothesized to feed an alternate CoA biosynthesis pathway. In addition, pilot studies with the iron chelator deferiprone that crosses the blood brain barrier showed a good safety profile and some indication of efficacy. An adequately powered randomized clinical trial will start in 2012. This review summarizes clinical presentation, neuropathology and pathogenesis of PKAN. PMID:22515741

  4. Genetics Home Reference: mevalonate kinase deficiency

    MedlinePlus

    ... cytoskeleton), gene activity (expression), and protein production and modification. Most MVK gene mutations that cause mevalonate kinase ... What are the different ways in which a genetic condition can be inherited? More about Inheriting Genetic ...

  5. How versatile are inositol phosphate kinases?

    PubMed Central

    Shears, Stephen B

    2004-01-01

    This review assesses the extent and the significance of catalytic versatility shown by several inositol phosphate kinases: the inositol phosphate multikinase, the reversible Ins(1,3,4) P (3)/Ins(3,4,5,6) P (4) kinase, and the kinases that synthesize diphosphoinositol polyphosphates. Particular emphasis is placed upon data that are relevant to the situation in vivo. It will be shown that catalytic promiscuity towards different inositol phosphates is not typically an evolutionary compromise, but instead is sometimes exploited to facilitate tight regulation of physiological processes. This multifunctionality can add to the complexity with which inositol signalling pathways interact. This review also assesses some proposed additional functions for the catalytic domains, including transcriptional regulation, protein kinase activity and control by molecular 'switching', all in the context of growing interest in 'moonlighting' (gene-sharing) proteins. PMID:14567754

  6. Pyruvate kinase and the "high ATP syndrome".

    PubMed Central

    Staal, G E; Jansen, G; Roos, D

    1984-01-01

    The erythrocytes of a patient with the so-called "high ATP syndrome" were characterized by a high ATP content and low 2,3-diphosphoglycerate level. The pyruvate kinase activity was specifically increased (about twice the normal level). After separation of the erythrocytes according to age by discontinuous Percoll density centrifugation, the pyruvate kinase activity was found to be increased in all Percoll fractions. Pyruvate kinase of the patient's cells was characterized by a decreased K0.5 for the substrate phosphoenolpyruvate and no inhibition by ATP. The Michaelis constant (Km) value for ADP, the nucleotide specificity, the thermostability, pH optimum, and immunological specific activity were normal. It is concluded that the high pyruvate kinase activity is due to a shift in the R(elaxed) in equilibrium T(ight) equilibrium to the R(elaxed) form. PMID:6736249

  7. Ocular Toxicity of Tyrosine Kinase Inhibitors

    PubMed Central

    Davis, Mary Elizabeth

    2016-01-01

    Purpose/Objectives To review common tyrosine kinase inhibitors, as well as their ocular side effects and management. Data Sources A comprehensive literature search was conducted using cINahl®, Pubmed, and cochrane databases for articles published since 2004 with the following search terms: ocular toxicities, tyrosine kinase inhibitors, ophthalmology, adverse events, eye, and vision. Data Synthesis Tyrosine kinase inhibitors can cause significant eye toxicity. Conclusions Given the prevalence of new tyrosine kinase inhibitor therapies and the complexity of possible pathogenesis of ocular pathology, oncology nurses can appreciate the occurrence of ocular toxicities and the role of nursing in the management of these problems. Implications for Nursing Knowledge of the risk factors and etiology of ocular toxicity of targeted cancer therapies can guide nursing assessment, enhance patient education, and improve care management. Including a review of eye symptoms and vision issues in nursing assessment can enhance early detection and treatment of ocular toxicity. PMID:26906134

  8. Kinase-interacting substrate screening is a novel method to identify kinase substrates

    PubMed Central

    Amano, Mutsuki; Hamaguchi, Tomonari; Shohag, Md. Hasanuzzaman; Kozawa, Kei; Kato, Katsuhiro; Zhang, Xinjian; Yura, Yoshimitsu; Matsuura, Yoshiharu; Kataoka, Chikako; Nishioka, Tomoki

    2015-01-01

    Protein kinases play pivotal roles in numerous cellular functions; however, the specific substrates of each protein kinase have not been fully elucidated. We have developed a novel method called kinase-interacting substrate screening (KISS). Using this method, 356 phosphorylation sites of 140 proteins were identified as candidate substrates for Rho-associated kinase (Rho-kinase/ROCK2), including known substrates. The KISS method was also applied to additional kinases, including PKA, MAPK1, CDK5, CaMK1, PAK7, PKN, LYN, and FYN, and a lot of candidate substrates and their phosphorylation sites were determined, most of which have not been reported previously. Among the candidate substrates for Rho-kinase, several functional clusters were identified, including the polarity-associated proteins, such as Scrib. We found that Scrib plays a crucial role in the regulation of subcellular contractility by assembling into a ternary complex with Rho-kinase and Shroom2 in a phosphorylation-dependent manner. We propose that the KISS method is a comprehensive and useful substrate screen for various kinases. PMID:26101221

  9. Identifying Kinase Substrates via a Heavy ATP Kinase Assay and Quantitative Mass Spectrometry.

    PubMed

    Müller, André C; Giambruno, Roberto; Weißer, Juliane; Májek, Peter; Hofer, Alexandre; Bigenzahn, Johannes W; Superti-Furga, Giulio; Jessen, Henning J; Bennett, Keiryn L

    2016-01-01

    Mass spectrometry-based in vitro kinase screens play an essential role in the discovery of kinase substrates, however, many suffer from biological and technical noise or necessitate genetically-altered enzyme-cofactor systems. We describe a method that combines stable γ-[(18)O2]-ATP with classical in vitro kinase assays within a contemporary quantitative proteomic workflow. Our approach improved detection of known substrates of the non-receptor tyrosine kinase ABL1; and identified potential, new in vitro substrates. PMID:27346722

  10. Identifying Kinase Substrates via a Heavy ATP Kinase Assay and Quantitative Mass Spectrometry

    PubMed Central

    Müller, André C.; Giambruno, Roberto; Weißer, Juliane; Májek, Peter; Hofer, Alexandre; Bigenzahn, Johannes W.; Superti-Furga, Giulio; Jessen, Henning J.; Bennett, Keiryn L.

    2016-01-01

    Mass spectrometry-based in vitro kinase screens play an essential role in the discovery of kinase substrates, however, many suffer from biological and technical noise or necessitate genetically-altered enzyme-cofactor systems. We describe a method that combines stable γ-[18O2]-ATP with classical in vitro kinase assays within a contemporary quantitative proteomic workflow. Our approach improved detection of known substrates of the non-receptor tyrosine kinase ABL1; and identified potential, new in vitro substrates. PMID:27346722

  11. Seeding collaborations to advance kinase science with the GSK Published Kinase Inhibitor Set (PKIS).

    PubMed

    Drewry, David H; Willson, Timothy M; Zuercher, William J

    2014-01-01

    To catalyze research on historically untargeted protein kinases, we created the PKIS, an annotated set of 367 small molecule kinase inhibitors. The set has been widely distributed to academic collaborators as an open access tool. It has been used to identify chemical starting points for development of chemical probes for orphan kinases and to investigate kinase signaling in high content phenotypic assays. Access to the set comes with few restrictions other than the requirement that assay results be released into the public domain for the benefit of the entire research community. Examples from the efforts of several collaborators are summarized. PMID:24283969

  12. Protein kinase domain of twitchin has protein kinase activity and an autoinhibitory region.

    PubMed

    Lei, J; Tang, X; Chambers, T C; Pohl, J; Benian, G M

    1994-08-19

    Twitchin is a 753-kDa polypeptide located in the muscle A-bands of the nematode, Caenorhabditis elegans. It consists of multiple copies of both fibronectin III and immunoglobulin C2 domains and, near the C terminus, a protein kinase domain with greatest homology to the catalytic domains of myosin light chain kinases. We have expressed and purified from Escherichia coli twitchin's protein kinase catalytic core and flanking sequences that do not include fibronectin III and immunoglobulin C2 domains. The protein was shown to phosphorylate a model substrate and to undergo autophosphorylation. The autophosphorylation occurs at a slow rate, attaining a maximum at 3 h with a stoichiometry of about 1.0 mol of phosphate/mol of protein, probably through an intramolecular mechanism. Sequence analysis of proteolytically derived phosphopeptides revealed that autophosphorylation occurred N-terminal to the catalytic core, predominantly at Thr-5910, with possible minor sites at Ser5912 and/or Ser-5913. This portion of twitchin (residues 5890-6268) was also phosphorylated in vitro by protein kinase C in the absence of calcium and phosphotidylserine, but not by cAMP-dependent protein kinase. By comparing the activities of three twitchin segments, the enzyme appears to be inhibited by the 60-amino acid residues lying just C-terminal to the kinase catalytic core. Thus, like a number of other protein kinases including myosin light chain kinases, the twitchin kinase appears to be autoregulated. PMID:8063727

  13. Kinase inhibitor profiling reveals unexpected opportunities to inhibit disease-associated mutant kinases

    PubMed Central

    Duong-Ly, Krisna C.; Devarajan, Karthik; Liang, Shuguang; Horiuchi, Kurumi Y.; Wang, Yuren; Ma, Haiching; Peterson, Jeffrey R.

    2016-01-01

    Summary Small-molecule kinase inhibitors have typically been designed to inhibit wild-type kinases rather than the mutant forms that frequently arise in diseases such as cancer. Mutations can have serious clinical implications by increasing kinase catalytic activity or conferring therapeutic resistance. To identify opportunities to repurpose inhibitors against disease-associated mutant kinases, we conducted a large-scale functional screen of 183 known kinase inhibitors against 76 recombinant, mutant kinases. The results revealed lead compounds with activity against clinically important mutant kinases including ALK, LRRK2, RET, and EGFR as well as unexpected opportunities for repurposing FDA-approved kinase inhibitors as leads for additional indications. Furthermore, using T674I PDGFRα as an example, we show how single-dose screening data can provide predictive structure-activity data to guide subsequent inhibitor optimization. This study provides a resource for the development of inhibitors against numerous disease-associated mutant kinases and illustrates the potential of unbiased profiling as an approach to compound-centric inhibitor development. PMID:26776524

  14. A Molecular Brake in the Kinase Hinge Region Regulates the Activity of Receptor Tyrosine Kinases

    SciTech Connect

    Chen,H.; Ma, J.; Li, W.; Eliseenkova, A.; Xu, C.; Neubert, T.; Miller, W.; Mohammadi, M.

    2007-01-01

    Activating mutations in the tyrosine kinase domain of receptor tyrosine kinases (RTKs) cause cancer and skeletal disorders. Comparison of the crystal structures of unphosphorylated and phosphorylated wild-type FGFR2 kinase domains with those of seven unphosphorylated pathogenic mutants reveals an autoinhibitory 'molecular brake' mediated by a triad of residues in the kinase hinge region of all FGFRs. Structural analysis shows that many other RTKs, including PDGFRs, VEGFRs, KIT, CSF1R, FLT3, TEK, and TIE, are also subject to regulation by this brake. Pathogenic mutations activate FGFRs and other RTKs by disengaging the brake either directly or indirectly.

  15. Redundant kinase activation and resistance of EGFR-tyrosine kinase inhibitors

    PubMed Central

    Luo, Min; Fu, Li-Wu

    2014-01-01

    Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have shown dramatic effects against that tumors harboring EGFR activating mutations in the EGFR intracytoplasmic tyrosine kinase domain and resulted in cell apoptosis. Unfortunately, a number of patients ultimately developed resistance by multiple mechanisms. Thus, elucidation of the mechanism of resistance to EGFR-TKIs can provide strategies for blocking or reversing the situation. Recent studies suggested that redundant kinase activation plays pivotal roles in escaping from the effects of EGFR-TKIs. Herein, we aimed to characterize several molecular events involved in the resistance to EGFR-TKIs mediated by redundant kinase activation. PMID:25520855

  16. Fibronectin phosphorylation by ecto-protein kinase

    SciTech Connect

    Imada, Sumi; Sugiyama, Yayoi; Imada, Masaru )

    1988-12-01

    The presence of membrane-associated, extracellular protein kinase (ecto-protein kinase) and its substrate proteins was examined with serum-free cultures of Swiss 3T3 fibroblast. When cells were incubated with ({gamma}-{sup 32})ATP for 10 min at 37{degree}C, four proteins with apparent molecular weights between 150 and 220 kDa were prominently phosphorylated. These proteins were also radiolabeled by lactoperoxidase catalyzed iodination and were sensitive to mild tryptic digestion, suggesting that they localized on the cell surface or in the extracellular matrix. Phosphorylation of extracellular proteins with ({gamma}-{sup 32}P)ATP in intact cell culture is consistent with the existence of ecto-protein kinase. Anti-fibronectin antibody immunoprecipitated one of the phosphoproteins which comigrated with a monomer and a dimer form of fibronectin under reducing and nonreducing conditions of electrophoresis, respectively. The protein had affinity for gelatin as demonstrated by retention with gelatin-conjugated agarose. This protein substrate of ecto-protein kinase was thus concluded to be fibronectin. The sites of phosphorylation by ecto-protein kinase were compared with those of intracellularly phosphorylated fibronectin by the analysis of radiolabeled amino acids and peptides. Ecto-protein kinase phosphorylated fibronectin at serine and threonine residues which were distinct from the sites of intracellular fibronectin phosphorylation.

  17. Ubiquitin-Mediated Degradation of Aurora Kinases

    PubMed Central

    Lindon, Catherine; Grant, Rhys; Min, Mingwei

    2016-01-01

    The Aurora kinases are essential regulators of mitosis in eukaryotes. In somatic cell divisions of higher eukaryotes, the paralogs Aurora kinase A (AurA) and Aurora kinase B (AurB) play non-overlapping roles that depend on their distinct spatiotemporal activities. These mitotic roles of Aurora kinases depend on their interactions with different partners that direct them to different mitotic destinations and different substrates: AurB is a component of the chromosome passenger complex that orchestrates the tasks of chromosome segregation and cytokinesis, while AurA has many known binding partners and mitotic roles, including a well-characterized interaction with TPX2 that mediates its role in mitotic spindle assembly. Beyond the spatial control conferred by different binding partners, Aurora kinases are subject to temporal control of their activation and inactivation. Ubiquitin-mediated proteolysis is a critical route to irreversible inactivation of these kinases, which must occur for ordered transition from mitosis back to interphase. Both AurA and AurB undergo targeted proteolysis after anaphase onset as substrates of the anaphase-promoting complex/cyclosome (APC/C) ubiquitin ligase, even while they continue to regulate steps during mitotic exit. Temporal control of Aurora kinase destruction ensures that AurB remains active at the midbody during cytokinesis long after AurA activity has been largely eliminated from the cell. Differential destruction of Aurora kinases is achieved despite the fact that they are targeted at the same time and by the same ubiquitin ligase, making these substrates an interesting case study for investigating molecular determinants of ubiquitin-mediated proteolysis in higher eukaryotes. The prevalence of Aurora overexpression in cancers and their potential as therapeutic targets add importance to the task of understanding the molecular determinants of Aurora kinase stability. Here, we review what is known about ubiquitin-mediated targeting

  18. Defective bone repair in mast cell deficient mice with c-Kit loss of function.

    PubMed

    Behrends, D A; Cheng, L; Sullivan, M B; Wang, M H; Roby, G B; Zayed, N; Gao, C; Henderson, J E; Martineau, P A

    2014-01-01

    KitW-sh mice carry an inactivating mutation in the gene encoding the receptor for stem cell factor, which is expressed at high levels on the surface of haematopoietic precursor cells. The mutation results in mast cell deficiency, a variety of defects in innate immunity and poorly defined abnormalities in bone. The present study was designed to characterise healing of a cortical window defect in skeletally mature KitW-sh mice using high-resolution micro computed tomographic imaging and histological analyses. The cortical bone defect healed completely in all wild type mice but failed to heal in about half of the KitW-sh mice by 12 weeks post-operative. Defective healing was associated with premature and excessive expression of TRAP positive cells embedded in fibrous marrow but with little change in ALP activity. Immuno-histochemical analyses revealed reduced CD34 positive vascular endothelial cells and F4/80 positive macrophages at 1 and 2 weeks post-operative. Impaired bone healing in the KitW-sh mice was therefore attributed to altered catabolic activity, impaired re-vascularisation and compromised replacement of woven with compact bone. PMID:25284141

  19. Mammary tumor growth and metastasis are reduced in c-Kit mutant Sash mice.

    PubMed

    He, Licai; Zhu, Zhenfeng; Chen, Shang; Wang, Yongping; Gu, Haihua

    2016-06-01

    Besides its well-known function in allergic response, mast cell, one of the key immune cells present in tumor microenvironment, plays important roles in cancer progression. However, the functional role of mast cells in breast cancer development and metastasis is not well understood. To test the involvement of mast cells in breast cancer, we examined the effects of loss of mast cells on mammary tumor development by crossing the well-known mast cell deficient mouse strain sash (Kit(W-sh/W-sh) ) with the mammary tumor transgenic mouse strain MMTV-Polyoma Middle T antigen (PyMT). Although mammary tumor onset was not affected in the absence of mast cells, mammary growth and metastasis were reduced in PyMT/Kit(W-sh/W-sh) mice compared with PyMT/wild-type mice (WT). Histological and immunofluorescent analyses showed that tumors from PyMT/Kit(W-sh/W-sh) mice showed largely differentiated morphology with reduced angiogenesis compared with MMTV-PyMT/WT mice. Our results suggest that mast cells may promote breast cancer growth and metastasis. Agents that can block mast cells growth are potential new therapies to treat metastatic breast cancer. PMID:26992445

  20. Mediator kinase module and human tumorigenesis

    PubMed Central

    Clark, Alison D.; Oldenbroek, Marieke; Boyer, Thomas G.

    2016-01-01

    Mediator is a conserved multi-subunit signal processor through which regulatory informatiosn conveyed by gene-specific transcription factors is transduced to RNA Polymerase II (Pol II). In humans, MED13, MED12, CDK8 and Cyclin C (CycC) comprise a four-subunit “kinase” module that exists in variable association with a 26-subunit Mediator core. Genetic and biochemical studies have established the Mediator kinase module as a major ingress of developmental and oncogenic signaling through Mediator, and much of its function in signal-dependent gene regulation derives from its resident CDK8 kinase activity. For example, CDK8-targeted substrate phosphorylation impacts transcription factor half-life, Pol II activity and chromatin chemistry and functional status. Recent structural and biochemical studies have revealed a precise network of physical and functional subunit interactions required for proper kinase module activity. Accordingly, pathologic change in this activity through altered expression or mutation of constituent kinase module subunits can have profound consequences for altered signaling and tumor formation. Herein, we review the structural organization, biological function and oncogenic potential of the Mediator kinase module. We focus principally on tumor-associated alterations in kinase module subunits for which mechanistic relationships as opposed to strictly correlative associations are established. These considerations point to an emerging picture of the Mediator kinase module as an oncogenic unit, one in which pathogenic activation/deactivation through component change drives tumor formation through perturbation of signal-dependent gene regulation. It follows that therapeutic strategies to combat CDK8-driven tumors will involve targeted modulation of CDK8 activity or pharmacologic manipulation of dysregulated CDK8-dependent signaling pathways. PMID:26182352

  1. Non-degradative Ubiquitination of Protein Kinases

    PubMed Central

    Ball, K. Aurelia; Johnson, Jeffrey R.; Lewinski, Mary K.; Guatelli, John; Verschueren, Erik; Krogan, Nevan J.; Jacobson, Matthew P.

    2016-01-01

    Growing evidence supports other regulatory roles for protein ubiquitination in addition to serving as a tag for proteasomal degradation. In contrast to other common post-translational modifications, such as phosphorylation, little is known about how non-degradative ubiquitination modulates protein structure, dynamics, and function. Due to the wealth of knowledge concerning protein kinase structure and regulation, we examined kinase ubiquitination using ubiquitin remnant immunoaffinity enrichment and quantitative mass spectrometry to identify ubiquitinated kinases and the sites of ubiquitination in Jurkat and HEK293 cells. We find that, unlike phosphorylation, ubiquitination most commonly occurs in structured domains, and on the kinase domain, ubiquitination is concentrated in regions known to be important for regulating activity. We hypothesized that ubiquitination, like other post-translational modifications, may alter the conformational equilibrium of the modified protein. We chose one human kinase, ZAP-70, to simulate using molecular dynamics with and without a monoubiquitin modification. In Jurkat cells, ZAP-70 is ubiquitinated at several sites that are not sensitive to proteasome inhibition and thus may have other regulatory roles. Our simulations show that ubiquitination influences the conformational ensemble of ZAP-70 in a site-dependent manner. When monoubiquitinated at K377, near the C-helix, the active conformation of the ZAP-70 C-helix is disrupted. In contrast, when monoubiquitinated at K476, near the kinase hinge region, an active-like ZAP-70 C-helix conformation is stabilized. These results lead to testable hypotheses that ubiquitination directly modulates kinase activity, and that ubiquitination is likely to alter structure, dynamics, and function in other protein classes as well. PMID:27253329

  2. Phospho-kinase profile of colorectal tumors guides in the selection of multi-kinase inhibitors

    PubMed Central

    Montero, Juan Carlos; Corrales-Sanchez, Verónica; Morales, Jorge Carlos; Núñez, Luz-Elena; Morís, Francisco; Pandiella, Atanasio; Ocaña, Alberto

    2015-01-01

    Protein kinases play a central role in the oncogenesis of colorectal tumors and are attractive druggable targets. Detection of activated kinases within a tumor could open avenues for drug selection and optimization of new kinase inhibitors. By using a phosphokinase arrays with human colorectal tumors we identified activated kinases, including the Epidermal Growth Factor Receptor (EGFR), components of the PI3K/mTOR pathway (AKT and S6), and STAT, among others. A pharmacological screening with kinase inhibitors against these proteins helped us to identify a new kinase inhibitor, termed EC-70124 that showed the highest anti-proliferative activity in cell lines. EC-70124 also inhibited cell migration and biochemical experiments demonstrated its effect targeting the PI3K/mTOR pathway. This drug also arrested cells at G2/M and induced apoptosis. Experiments in combination with standard chemotherapy used in the clinical setting indicated a synergistic effect. EC-70124 also reduced tumor growth in vivo and inhibited pS6 in the implanted tumors. In conclusion, by studying the kinase profile of colorectal tumors, we identified relevant activated pathways, and a new multi-kinase compound with significant antitumor properties. PMID:26418718

  3. Phospho-kinase profile of colorectal tumors guides in the selection of multi-kinase inhibitors.

    PubMed

    Serrano-Heras, Gemma; Cuenca-López, María Dolores; Montero, Juan Carlos; Corrales-Sanchez, Verónica; Morales, Jorge Carlos; Núñez, Luz-Elena; Morís, Francisco; Pandiella, Atanasio; Ocaña, Alberto

    2015-10-13

    Protein kinases play a central role in the oncogenesis of colorectal tumors and are attractive druggable targets. Detection of activated kinases within a tumor could open avenues for drug selection and optimization of new kinase inhibitors. By using a phosphokinase arrays with human colorectal tumors we identified activated kinases, including the Epidermal Growth Factor Receptor (EGFR), components of the PI3K/mTOR pathway (AKT and S6), and STAT, among others. A pharmacological screening with kinase inhibitors against these proteins helped us to identify a new kinase inhibitor, termed EC-70124 that showed the highest anti-proliferative activity in cell lines. EC-70124 also inhibited cell migration and biochemical experiments demonstrated its effect targeting the PI3K/mTOR pathway. This drug also arrested cells at G2/M and induced apoptosis. Experiments in combination with standard chemotherapy used in the clinical setting indicated a synergistic effect. EC-70124 also reduced tumor growth in vivo and inhibited pS6 in the implanted tumors. In conclusion, by studying the kinase profile of colorectal tumors, we identified relevant activated pathways, and a new multi-kinase compound with significant antitumor properties. PMID:26418718

  4. CDPKs are dual-specificity protein kinases and tyrosine autophosphorylation attenuates kinase activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Calcium-dependent protein kinases (CDPKs or CPKs) are classified as serine/threonine protein kinases but we made the surprising observation that soybean CDPK' and several Arabidopsis isoforms (AtCPK4 and AtCPK34) could also autophosphorylate on tyrosine residues. In studies with His6-GmCDPK', we ide...

  5. Co-inhibition of polo-like kinase 1 and Aurora kinases promotes mitotic catastrophe.

    PubMed

    Li, Jingjing; Hong, Myung Jin; Chow, Jeremy P H; Man, Wing Yu; Mak, Joyce P Y; Ma, Hoi Tang; Poon, Randy Y C

    2015-04-20

    Mitosis is choreographed by a number of protein kinases including polo-like kinases and Aurora kinases. As these kinases are frequently dysregulated in cancers, small-molecule inhibitors have been developed for targeted anticancer therapies. Given that PLK1 and Aurora kinases possess both unique functions as well as co-regulate multiple mitotic events, whether pharmacological inhibition of these kinases together can enhance mitotic catastrophe remains an outstanding issue to be determined. Using concentrations of inhibitors that did not induce severe mitotic defects on their own, we found that both the metaphase arrest and mitotic slippage induced by inhibitors targeting Aurora A and Aurora B (MK-5108 and Barasertib respectively) were enhanced by a PLK1 inhibitor (BI 2536). We found that PLK1 is overexpressed in cells from nasopharyngeal carcinoma, a highly invasive cancer with poor prognosis, in comparison to normal nasopharyngeal epithelial cells. Nasopharyngeal carcinoma cells were more sensitive to BI 2536 as a single agent and co-inhibition with Aurora kinases than normal cells. These observations underscore the mechanism and potential benefits of targeting PLK1 and Aurora kinases to induce mitotic catastrophe in cancer cells. PMID:25871386

  6. KinasePA: Phosphoproteomics data annotation using hypothesis driven kinase perturbation analysis.

    PubMed

    Yang, Pengyi; Patrick, Ellis; Humphrey, Sean J; Ghazanfar, Shila; James, David E; Jothi, Raja; Yang, Jean Yee Hwa

    2016-07-01

    Mass spectrometry (MS)-based quantitative phosphoproteomics has become a key approach for proteome-wide profiling of phosphorylation in tissues and cells. Traditional experimental design often compares a single treatment with a control, whereas increasingly more experiments are designed to compare multiple treatments with respect to a control. To this end, the development of bioinformatic tools that can integrate multiple treatments and visualise kinases and substrates under combinatorial perturbations is vital for dissecting concordant and/or independent effects of each treatment. Here, we propose a hypothesis driven kinase perturbation analysis (KinasePA) to annotate and visualise kinases and their substrates that are perturbed by various combinatorial effects of treatments in phosphoproteomics experiments. We demonstrate the utility of KinasePA through its application to two large-scale phosphoproteomics datasets and show its effectiveness in dissecting kinases and substrates within signalling pathways driven by unique combinations of cellular stimuli and inhibitors. We implemented and incorporated KinasePA as part of the "directPA" R package available from the comprehensive R archive network (CRAN). Furthermore, KinasePA also has an interactive web interface that can be readily applied to annotate user provided phosphoproteomics data (http://kinasepa.pengyiyang.org). PMID:27145998

  7. The SH2 domain of Abl kinases regulates kinase autophosphorylation by controlling activation loop accessibility

    NASA Astrophysics Data System (ADS)

    Lamontanara, Allan Joaquim; Georgeon, Sandrine; Tria, Giancarlo; Svergun, Dmitri I.; Hantschel, Oliver

    2014-11-01

    The activity of protein kinases is regulated by multiple molecular mechanisms, and their disruption is a common driver of oncogenesis. A central and almost universal control element of protein kinase activity is the activation loop that utilizes both conformation and phosphorylation status to determine substrate access. In this study, we use recombinant Abl tyrosine kinases and conformation-specific kinase inhibitors to quantitatively analyse structural changes that occur after Abl activation. Allosteric SH2-kinase domain interactions were previously shown to be essential for the leukemogenesis caused by the Bcr-Abl oncoprotein. We find that these allosteric interactions switch the Abl activation loop from a closed to a fully open conformation. This enables the trans-autophosphorylation of the activation loop and requires prior phosphorylation of the SH2-kinase linker. Disruption of the SH2-kinase interaction abolishes activation loop phosphorylation. Our analysis provides a molecular mechanism for the SH2 domain-dependent activation of Abl that may also regulate other tyrosine kinases.

  8. Co-inhibition of polo-like kinase 1 and Aurora kinases promotes mitotic catastrophe

    PubMed Central

    Li, Jingjing; Hong, Myung Jin; Chow, Jeremy P.H.; Man, Wing Yu; Mak, Joyce P.Y.; Ma, Hoi Tang; Poon, Randy Y.C.

    2015-01-01

    Mitosis is choreographed by a number of protein kinases including polo-like kinases and Aurora kinases. As these kinases are frequently dysregulated in cancers, small-molecule inhibitors have been developed for targeted anticancer therapies. Given that PLK1 and Aurora kinases possess both unique functions as well as co-regulate multiple mitotic events, whether pharmacological inhibition of these kinases together can enhance mitotic catastrophe remains an outstanding issue to be determined. Using concentrations of inhibitors that did not induce severe mitotic defects on their own, we found that both the metaphase arrest and mitotic slippage induced by inhibitors targeting Aurora A and Aurora B (MK-5108 and Barasertib respectively) were enhanced by a PLK1 inhibitor (BI 2536). We found that PLK1 is overexpressed in cells from nasopharyngeal carcinoma, a highly invasive cancer with poor prognosis, in comparison to normal nasopharyngeal epithelial cells. Nasopharyngeal carcinoma cells were more sensitive to BI 2536 as a single agent and co-inhibition with Aurora kinases than normal cells. These observations underscore the mechanism and potential benefits of targeting PLK1 and Aurora kinases to induce mitotic catastrophe in cancer cells. PMID:25871386

  9. KIDFamMap: a database of kinase-inhibitor-disease family maps for kinase inhibitor selectivity and binding mechanisms.

    PubMed

    Chiu, Yi-Yuan; Lin, Chih-Ta; Huang, Jhang-Wei; Hsu, Kai-Cheng; Tseng, Jen-Hu; You, Syuan-Ren; Yang, Jinn-Moon

    2013-01-01

    Kinases play central roles in signaling pathways and are promising therapeutic targets for many diseases. Designing selective kinase inhibitors is an emergent and challenging task, because kinases share an evolutionary conserved ATP-binding site. KIDFamMap (http://gemdock.life.nctu.edu.tw/KIDFamMap/) is the first database to explore kinase-inhibitor families (KIFs) and kinase-inhibitor-disease (KID) relationships for kinase inhibitor selectivity and mechanisms. This database includes 1208 KIFs, 962 KIDs, 55 603 kinase-inhibitor interactions (KIIs), 35 788 kinase inhibitors, 399 human protein kinases, 339 diseases and 638 disease allelic variants. Here, a KIF can be defined as follows: (i) the kinases in the KIF with significant sequence similarity, (ii) the inhibitors in the KIF with significant topology similarity and (iii) the KIIs in the KIF with significant interaction similarity. The KIIs within a KIF are often conserved on some consensus KIDFamMap anchors, which represent conserved interactions between the kinase subsites and consensus moieties of their inhibitors. Our experimental results reveal that the members of a KIF often possess similar inhibition profiles. The KIDFamMap anchors can reflect kinase conformations types, kinase functions and kinase inhibitor selectivity. We believe that KIDFamMap provides biological insights into kinase inhibitor selectivity and binding mechanisms. PMID:23193279

  10. KIDFamMap: a database of kinase-inhibitor-disease family maps for kinase inhibitor selectivity and binding mechanisms

    PubMed Central

    Chiu, Yi-Yuan; Lin, Chih-Ta; Huang, Jhang-Wei; Hsu, Kai-Cheng; Tseng, Jen-Hu; You, Syuan-Ren; Yang, Jinn-Moon

    2013-01-01

    Kinases play central roles in signaling pathways and are promising therapeutic targets for many diseases. Designing selective kinase inhibitors is an emergent and challenging task, because kinases share an evolutionary conserved ATP-binding site. KIDFamMap (http://gemdock.life.nctu.edu.tw/KIDFamMap/) is the first database to explore kinase-inhibitor families (KIFs) and kinase-inhibitor-disease (KID) relationships for kinase inhibitor selectivity and mechanisms. This database includes 1208 KIFs, 962 KIDs, 55 603 kinase-inhibitor interactions (KIIs), 35 788 kinase inhibitors, 399 human protein kinases, 339 diseases and 638 disease allelic variants. Here, a KIF can be defined as follows: (i) the kinases in the KIF with significant sequence similarity, (ii) the inhibitors in the KIF with significant topology similarity and (iii) the KIIs in the KIF with significant interaction similarity. The KIIs within a KIF are often conserved on some consensus KIDFamMap anchors, which represent conserved interactions between the kinase subsites and consensus moieties of their inhibitors. Our experimental results reveal that the members of a KIF often possess similar inhibition profiles. The KIDFamMap anchors can reflect kinase conformations types, kinase functions and kinase inhibitor selectivity. We believe that KIDFamMap provides biological insights into kinase inhibitor selectivity and binding mechanisms. PMID:23193279

  11. Tyrosine kinase BMX phosphorylates phosphotyrosine-primed motif mediating the activation of multiple receptor tyrosine kinases.

    PubMed

    Chen, Sen; Jiang, Xinnong; Gewinner, Christina A; Asara, John M; Simon, Nicholas I; Cai, Changmeng; Cantley, Lewis C; Balk, Steven P

    2013-05-28

    The nonreceptor tyrosine kinase BMX (bone marrow tyrosine kinase gene on chromosome X) is abundant in various cell types and activated downstream of phosphatidylinositol-3 kinase (PI3K) and the kinase Src, but its substrates are unknown. Positional scanning peptide library screening revealed a marked preference for a priming phosphorylated tyrosine (pY) in the -1 position, indicating that BMX substrates may include multiple tyrosine kinases that are fully activated by pYpY sites in the kinase domain. BMX phosphorylated focal adhesion kinase (FAK) at Tyr⁵⁷⁷ subsequent to its Src-mediated phosphorylation at Tyr⁵⁷⁶. Loss of BMX by RNA interference or by genetic deletion in mouse embryonic fibroblasts (MEFs) markedly impaired FAK activity. Phosphorylation of the insulin receptor in the kinase domain at Tyr¹¹⁸⁹ and Tyr¹¹⁹⁰, as well as Tyr¹¹⁸⁵, and downstream phosphorylation of the kinase AKT at Thr³⁰⁸ were similarly impaired by BMX deficiency. However, insulin-induced phosphorylation of AKT at Ser⁴⁷³ was not impaired in Bmx knockout MEFs or liver tissue from Bmx knockout mice, which also showed increased insulin-stimulated glucose uptake, possibly because of decreased abundance of the phosphatase PHLPP (PH domain leucine-rich repeat protein phosphatase). Thus, by identifying the pYpY motif as a substrate for BMX, our findings suggest that BMX functions as a central regulator among multiple signaling pathways mediated by tyrosine kinases. PMID:23716717

  12. The protein interaction landscape of the human CMGC kinase group.

    PubMed

    Varjosalo, Markku; Keskitalo, Salla; Van Drogen, Audrey; Nurkkala, Helka; Vichalkovski, Anton; Aebersold, Ruedi; Gstaiger, Matthias

    2013-04-25

    Cellular information processing via reversible protein phosphorylation requires tight control of the localization, activity, and substrate specificity of protein kinases, which to a large extent is accomplished by complex formation with other proteins. Despite their critical role in cellular regulation and pathogenesis, protein interaction information is available for only a subset of the 518 human protein kinases. Here we present a global proteomic analysis of complexes of the human CMGC kinase group. In addition to subgroup-specific functional enrichment and modularity, the identified 652 high-confidence kinase-protein interactions provide a specific biochemical context for many poorly studied CMGC kinases. Furthermore, the analysis revealed a kinase-kinase subnetwork and candidate substrates for CMGC kinases. Finally, the presented interaction proteome uncovered a large set of interactions with proteins genetically linked to a range of human diseases, including cancer, suggesting additional routes for analyzing the role of CMGC kinases in controlling human disease pathways. PMID:23602568

  13. Protein kinase activators alter glial cholesterol esterification

    SciTech Connect

    Jeng, I.; Dills, C.; Klemm, N.; Wu, C.

    1986-05-01

    Similar to nonneural tissues, the activity of glial acyl-CoA cholesterol acyltransferase is controlled by a phosphorylation and dephosphorylation mechanism. Manipulation of cyclic AMP content did not alter the cellular cholesterol esterification, suggesting that cyclic AMP is not a bioregulator in this case. Therefore, the authors tested the effect of phorbol-12-myristate 13-acetate (PMA) on cellular cholesterol esterification to determine the involvement of protein kinase C. PMA has a potent effect on cellular cholesterol esterification. PMA depresses cholesterol esterification initially, but cells recover from inhibition and the result was higher cholesterol esterification, suggesting dual effects of protein kinase C. Studies of other phorbol analogues and other protein kinase C activators such as merezein indicate the involvement of protein kinase C. Oleoyl-acetyl glycerol duplicates the effect of PMA. This observation is consistent with a diacyl-glycerol-protein kinase-dependent reaction. Calcium ionophore A23187 was ineffective in promoting the effect of PMA. They concluded that a calcium-independent and protein C-dependent pathway regulated glial cholesterol esterification.

  14. Src Kinase Regulation in Progressively Invasive Cancer

    PubMed Central

    Xu, Weichen; Allbritton, Nancy; Lawrence, David S.

    2012-01-01

    Metastatic progression is a multistep process that involves tumor growth and survival, motility and invasion, and subsequent proliferation in an inappropriate environment. The Src protein tyrosine kinase has been implicated in many of the biochemical pathways that drive these behaviors. Although Src itself is only rarely mutated in human tumors, its aberrant activity has been noted in various cancers and suggested to serve as a barometer of metastatic potential. With these features in mind, we examined Src kinase regulation at the structural, enzymatic, and expression levels as a function of progressively invasive prostate cancer cell lines. Surprisingly, both total Src content and kinase activity decrease with increasing cell line aggressiveness, an observation that appears to be inconsistent with the well-documented role of Src in the signaling pathways that drive growth and invasion. However, we do observe a direct correlation between Src kinase specific activity (total Src kinase activity/total Src content) and metastatic aggressiveness, possibly suggesting that in highly aggressive cell lines, key signaling enzymes are globally recruited to drive the cancerous phenotype. In addition, although the expected enhanced phosphorylation of Src at Tyr-416 (activation site) is present in the most aggressive prostate cancer cell lines, unexpectedly high phosphorylation levels at the Tyr-527 inhibitory site are observed as well. The latter, rather than representative of inhibited enzyme, is more indicative of primed Src responsive to local phosphorylated binding partners. PMID:23145001

  15. Regulation of mitogen-activated protein kinase by protein kinase C and mitogen-activated protein kinase phosphatase-1 in vascular smooth muscle.

    PubMed

    Trappanese, Danielle M; Sivilich, Sarah; Ets, Hillevi K; Kako, Farah; Autieri, Michael V; Moreland, Robert S

    2016-06-01

    Vascular smooth muscle contraction is primarily regulated by phosphorylation of myosin light chain. There are also modulatory pathways that control the final level of force development. We tested the hypothesis that protein kinase C (PKC) and mitogen-activated protein (MAP) kinase modulate vascular smooth muscle activity via effects on MAP kinase phosphatase-1 (MKP-1). Swine carotid arteries were mounted for isometric force recording and subjected to histamine stimulation in the presence and absence of inhibitors of PKC [bisindolylmaleimide-1 (Bis)], MAP kinase kinase (MEK) (U0126), and MKP-1 (sanguinarine) and flash frozen for measurement of MAP kinase, PKC-potentiated myosin phosphatase inhibitor 17 (CPI-17), and caldesmon phosphorylation levels. CPI-17 was phosphorylated in response to histamine and was inhibited in the presence of Bis. Caldesmon phosphorylation levels increased in response to histamine stimulation and were decreased in response to MEK inhibition but were not affected by the addition of Bis. Inhibition of PKC significantly increased p42 MAP kinase, but not p44 MAP kinase. Inhibition of MEK with U0126 inhibited both p42 and p44 MAP kinase activity. Inhibition of MKP-1 with sanguinarine blocked the Bis-dependent increase of MAP kinase activity. Sanguinarine alone increased MAP kinase activity due to its effects on MKP-1. Sanguinarine increased MKP-1 phosphorylation, which was inhibited by inhibition of MAP kinase. This suggests that MAP kinase has a negative feedback role in inhibiting MKP-1 activity. Therefore, PKC catalyzes MKP-1 phosphorylation, which is reversed by MAP kinase. Thus the fine tuning of vascular contraction is due to the concerted effort of PKC, MAP kinase, and MKP-1. PMID:27053523

  16. Discovery of 2-((3-Amino-4-methylphenyl)amino)-N-(2-methyl-5-(3-(trifluoromethyl)benzamido)phenyl)-4-(methylamino)pyrimidine-5-carboxamide (CHMFL-ABL-053) as a Potent, Selective, and Orally Available BCR-ABL/SRC/p38 Kinase Inhibitor for Chronic Myeloid Leukemia.

    PubMed

    Liang, Xiaofei; Liu, Xiaochuan; Wang, Beilei; Zou, Fengming; Wang, Aoli; Qi, Shuang; Chen, Cheng; Zhao, Zheng; Wang, Wenchao; Qi, Ziping; Lv, Fengchao; Hu, Zhenquan; Wang, Li; Zhang, Shanchun; Liu, Qingsong; Liu, Jing

    2016-03-10

    Starting from a dihydropyrimidopyrimidine core scaffold based compound 27 (GNF-7), we discovered a highly potent (ABL1: IC50 of 70 nM) and selective (S score (1) = 0.02) BCR-ABL inhibitor 18a (CHMFL-ABL-053). Compound 18a did not exhibit apparent inhibitory activity against c-KIT kinase, which is the common target of currently clinically used BCR-ABL inhibitors. Through significant suppression of the BCR-ABL autophosphorylation (EC50 about 100 nM) and downstream mediators such as STAT5, Crkl, and ERK's phosphorylation, 18a inhibited the proliferation of CML cell lines K562 (GI50 = 14 nM), KU812 (GI50 = 25 nM), and MEG-01 (GI50 = 16 nM). A pharmacokinetic study revealed that 18a had over 4 h of half-life and 24% bioavailability in rats. A 50 mg/kg/day dosage treatment could almost completely suppress tumor progression in the K562 cells inoculated xenograft mouse model. As a potential useful drug candidate for CML, 18a is under extensive preclinical safety evaluation now. PMID:26789553

  17. Structure and Dynamic Regulation of Abl Kinases*

    PubMed Central

    Panjarian, Shoghag; Iacob, Roxana E.; Chen, Shugui; Engen, John R.; Smithgall, Thomas E.

    2013-01-01

    The c-abl proto-oncogene encodes a unique protein-tyrosine kinase (Abl) distinct from c-Src, c-Fes, and other cytoplasmic tyrosine kinases. In normal cells, Abl plays prominent roles in cellular responses to genotoxic stress as well as in the regulation of the actin cytoskeleton. Abl is also well known in the context of Bcr-Abl, the oncogenic fusion protein characteristic of chronic myelogenous leukemia. Selective inhibitors of Bcr-Abl, of which imatinib is the prototype, have had a tremendous impact on clinical outcomes in chronic myelogenous leukemia and revolutionized the field of targeted cancer therapy. In this minireview, we focus on the structural organization and dynamics of Abl kinases and how these features influence inhibitor sensitivity. PMID:23316053

  18. LKB1, the multitasking tumour suppressor kinase

    PubMed Central

    Marignani, P A

    2005-01-01

    Mutations in the lkb1 gene are found in Peutz-Jeghers syndrome (PJS), with loss of heterozygosity or somatic mutations at the lkb1 locus, suggesting the gene product, the serine/threonine kinase LKB1, may function as a tumour suppressor. Patients with PJS are at a greater risk of developing cancers of epithelial tissue origin. It is widely accepted that the presence of hamartomatous polyps in PJS does not in itself lead to the development of malignancy. The signalling mechanisms that lead to these PJS related malignancies are not well understood. However, it is evident from the recent literature that LKB1 is a multitasking kinase, with unlimited potential in orchestrating cell activity. Thus far, LKB1 has been found to play a role in chromatin remodelling, cell cycle arrest, Wnt signalling, cell polarity, and energy metabolism, all of which may require the tumour suppressor function of this kinase and/or its catalytic activity. PMID:15623475

  19. Structure of the human dimeric ATM kinase.

    PubMed

    Lau, Wilson C Y; Li, Yinyin; Liu, Zhe; Gao, Yuanzhu; Zhang, Qinfen; Huen, Michael S Y

    2016-01-01

    DNA-double strand breaks activate the serine/threonine protein kinase ataxia-telangiectasia mutated (ATM) to initiate DNA damage signal transduction. This activation process involves autophosphorylation and dissociation of inert ATM dimers into monomers that are catalytically active. Using single-particle electron microscopy (EM), we determined the structure of dimeric ATM in its resting state. The EM map could accommodate the crystal structure of the N-terminal truncated mammalian target of rapamycin (mTOR), a closely related enzyme of the phosphatidylinositol 3-kinase-related protein kinase (PIKK) family, allowing for the localization of the N- and the C-terminal regions of ATM. In the dimeric structure, the actives sites are buried, restricting the access of the substrates to these sites. The unanticipated domain organization of ATM provides a basis for understanding its mechanism of inhibition. PMID:27097373

  20. The Role of Mirk Kinase in Sarcomas

    PubMed Central

    Friedman, Eileen

    2011-01-01

    Targeting the tyrosine kinase KIT in gastrointestinal stromal tumors has led to improved treatment. Other kinases might serve as therapeutic targets in the more common forms of sarcoma. The kinase Mirk/dyrk1B is highly expressed in the vast majority of osteosarcomas and rhabdomyosarcomas and mediates their growth, as depletion of Mirk led to tumor cell apoptosis. Mirk is known to increase the expression of a series of antioxidant genes, which scavenge reactive oxygen species (ROS) within various tumor cells, mediating their survival. As a result, depleting Mirk led to increased levels of damaging ROS. Tumor cells depleted of Mirk were also sensitized to low levels of chemotherapeutic drugs that increase ROS levels. In contrast, Mirk expression is quite low in most normal cells, and Mirk depletion or embryonic knockout of Mirk did not detectably affect cell survival. Thus targeting Mirk for intervention in sarcomas might spare most normal tissues. PMID:21559261

  1. Structure of the human dimeric ATM kinase

    PubMed Central

    Lau, Wilson C. Y.; Li, Yinyin; Liu, Zhe; Gao, Yuanzhu; Zhang, Qinfen; Huen, Michael S. Y.

    2016-01-01

    ABSTRACT DNA-double strand breaks activate the serine/threonine protein kinase ataxia-telangiectasia mutated (ATM) to initiate DNA damage signal transduction. This activation process involves autophosphorylation and dissociation of inert ATM dimers into monomers that are catalytically active. Using single-particle electron microscopy (EM), we determined the structure of dimeric ATM in its resting state. The EM map could accommodate the crystal structure of the N-terminal truncated mammalian target of rapamycin (mTOR), a closely related enzyme of the phosphatidylinositol 3-kinase-related protein kinase (PIKK) family, allowing for the localization of the N- and the C-terminal regions of ATM. In the dimeric structure, the actives sites are buried, restricting the access of the substrates to these sites. The unanticipated domain organization of ATM provides a basis for understanding its mechanism of inhibition. PMID:27097373

  2. Crystal structure of human nicotinamide riboside kinase.

    PubMed

    Khan, Javed A; Xiang, Song; Tong, Liang

    2007-08-01

    Nicotinamide riboside kinase (NRK) has an important role in the biosynthesis of NAD(+) as well as the activation of tiazofurin and other NR analogs for anticancer therapy. NRK belongs to the deoxynucleoside kinase and nucleoside monophosphate (NMP) kinase superfamily, although the degree of sequence conservation is very low. We report here the crystal structures of human NRK1 in a binary complex with the reaction product nicotinamide mononucleotide (NMN) at 1.5 A resolution and in a ternary complex with ADP and tiazofurin at 2.7 A resolution. The active site is located in a groove between the central parallel beta sheet core and the LID and NMP-binding domains. The hydroxyl groups on the ribose of NR are recognized by Asp56 and Arg129, and Asp36 is the general base of the enzyme. Mutation of residues in the active site can abolish the catalytic activity of the enzyme, confirming the structural observations. PMID:17698003

  3. Crystal Structure of Human Nicotinamide Riboside Kinase

    SciTech Connect

    Khan,J.; Xiang, S.; Tong, L.

    2007-01-01

    Nicotinamide riboside kinase (NRK) has an important role in the biosynthesis of NAD{sup +} as well as the activation of tiazofurin and other NR analogs for anticancer therapy. NRK belongs to the deoxynucleoside kinase and nucleoside monophosphate (NMP) kinase superfamily, although the degree of sequence conservation is very low. We report here the crystal structures of human NRK1 in a binary complex with the reaction product nicotinamide mononucleotide (NMN) at 1.5 {angstrom} resolution and in a ternary complex with ADP and tiazofurin at 2.7 {angstrom} resolution. The active site is located in a groove between the central parallel {beta} sheet core and the LID and NMP-binding domains. The hydroxyl groups on the ribose of NR are recognized by Asp56 and Arg129, and Asp36 is the general base of the enzyme. Mutation of residues in the active site can abolish the catalytic activity of the enzyme, confirming the structural observations.

  4. Regulation of Axonal Transport by Protein Kinases.

    PubMed

    Gibbs, Katherine L; Greensmith, Linda; Schiavo, Giampietro

    2015-10-01

    The intracellular transport of organelles, proteins, lipids, and RNA along the axon is essential for neuronal function and survival. This process, called axonal transport, is mediated by two classes of ATP-dependent motors, kinesins, and cytoplasmic dynein, which carry their cargoes along microtubule tracks. Protein kinases regulate axonal transport through direct phosphorylation of motors, adapter proteins, and cargoes, and indirectly through modification of the microtubule network. The misregulation of axonal transport by protein kinases has been implicated in the pathogenesis of several nervous system disorders. Here, we review the role of protein kinases acting directly on axonal transport and discuss how their deregulation affects neuronal function, paving the way for the exploitation of these enzymes as novel drug targets. PMID:26410600

  5. Pharmacological inhibitors of cyclin-dependent kinases.

    PubMed

    Knockaert, Marie; Greengard, Paul; Meijer, Laurent

    2002-09-01

    Cyclin-dependent kinases (CDKs) regulate the cell division cycle, apoptosis, transcription and differentiation in addition to functions in the nervous system. Deregulation of CDKs in various diseases has stimulated an intensive search for selective pharmacological inhibitors of these kinases. More than 50 inhibitors have been identified, among which >20 have been co-crystallized with CDK2. These inhibitors all target the ATP-binding pocket of the catalytic site of the kinase. The actual selectivity of most known CDK inhibitors, and thus the underlying mechanism of their cellular effects, is poorly known. Pharmacological inhibitors of CDKs are currently being evaluated for therapeutic use against cancer, alopecia, neurodegenerative disorders (e.g. Alzheimer's disease, amyotrophic lateral sclerosis and stroke), cardiovascular disorders (e.g. atherosclerosis and restenosis), glomerulonephritis, viral infections (e.g. HCMV, HIV and HSV) and parasitic protozoa (Plasmodium sp. and Leishmania sp.). PMID:12237154

  6. Kinase signaling in the spindle checkpoint.

    PubMed

    Kang, Jungseog; Yu, Hongtao

    2009-06-01

    The spindle checkpoint is a cell cycle surveillance system that ensures the fidelity of chromosome segregation. In mitosis, it elicits the "wait anaphase" signal to inhibit the anaphase-promoting complex or cyclosome until all chromosomes achieve bipolar microtubule attachment and align at the metaphase plate. Because a single kinetochore unattached to microtubules activates the checkpoint, the wait anaphase signal is thought to be generated by this kinetochore and is then amplified and distributed throughout the cell to inhibit the anaphase-promoting complex/cyclosome. Several spindle checkpoint kinases participate in the generation and amplification of this signal. Recent studies have begun to reveal the activation mechanisms of these checkpoint kinases. Increasing evidence also indicates that the checkpoint kinases not only help to generate the wait anaphase signal but also actively correct kinetochore-microtubule attachment defects. PMID:19228686

  7. X-Ray Crystal Structure of Bone Marrow Kinase in the X Chromosome: A Tec Family Kinase

    SciTech Connect

    Muckelbauer, Jodi; Sack, John S.; Ahmed, Nazia; Burke, James; Chang, ChiehYing Y.; Gao, Mian; Tino, Joseph; Xie, Dianlin; Tebben, Andrew J.

    2012-06-27

    Bone marrow kinase in the X chromosome, a member of the Tec family of tyrosine kinases, plays a role in both monocyte/macrophage trafficking as well as cytokine secretion. Although the structures of Tec family kinases Bruton's tyrosine kinase and IL-2-inducible T-cell kinase are known, the crystal structures of other Tec family kinases have remained elusive. We report the X-ray crystal structures of bone marrow kinase in the X chromosome in complex with dasatinib at 2.4 {angstrom} resolution and PP2 at 1.9 {angstrom} resolution. The bone marrow kinase in the X chromosome structures reveal a typical kinase protein fold; with well-ordered protein conformation that includes an open/extended activation loop and a stabilized DFG-motif rendering the kinase in an inactive conformation. Dasatinib and PP2 bind to bone marrow kinase in the X chromosome in the ATP binding pocket and display similar binding modes to that observed in other Tec and Src protein kinases. The bone marrow kinase in the X chromosome structures identify conformational elements of the DFG-motif that could potentially be utilized to design potent and/or selective bone marrow kinase in the X chromosome inhibitors.

  8. Phosphorylation of varicella-zoster virus glycoprotein gpI by mammalian casein kinase II and casein kinase I

    SciTech Connect

    Grose, C.; Jackson, W. ); Traugh, J.A. )

    1989-09-01

    Varicella-zoster virus (VZV) glycoprotein gpI is the predominant viral glycoprotein within the plasma membranes of infected cells. This viral glycoprotein is phosphorylated on its polypeptide backbone during biosynthesis. In this report, the authors investigated the protein kinases which participate in the phosphorylation events. Under in vivo conditions, VZV gpI was phosphorylated on its serine and threonine residues by protein kinases present within lysates of either VZV-infected or uninfected cells. Because this activity was diminished by heparin, a known inhibitor of casein kinase II, isolated gpI was incubated with purified casein kinase II and shown to be phosphorylated in an in vitro assay containing ({gamma}-{sup 32}P)ATP. The same glycoprotein was phosphorylated when ({sup 32}P)GTP was substituted for ({sup 32}P)ATP in the protein kinase assay. They also tested whether VZV gpI was phosphorylated by two other ubiquitous mammalian protein kinases--casein kinase I and cyclic AMP-dependent kinase--and found that only casein kinase I modified gpI. When the predicted 623-amino-acid sequence of gpI was examined, two phosphorylation sites known to be optimal for casein kinase II were observed. In summary, this study showed that VZV gpI was phosphorylated by each of two mammalian protein kinases (casein kinase I and casein kinase II) and that potential serine-threonine phosphorylation sites for each of these two kinases were present in the viral glycoprotein.

  9. Phosphorylation of the Kinase Interaction Motif in Mitogen-activated Protein (MAP) Kinase Phosphatase-4 Mediates Cross-talk between Protein Kinase A and MAP Kinase Signaling Pathways*

    PubMed Central

    Dickinson, Robin J.; Delavaine, Laurent; Cejudo-Marín, Rocío; Stewart, Graeme; Staples, Christopher J.; Didmon, Mark P.; Trinidad, Antonio Garcia; Alonso, Andrés; Pulido, Rafael; Keyse, Stephen M.

    2011-01-01

    MAP kinase phosphatase 4 (DUSP9/MKP-4) plays an essential role during placental development and is one of a subfamily of three closely related cytoplasmic dual-specificity MAPK phosphatases, which includes the ERK-specific enzymes DUSP6/MKP-3 and DUSP7/MKP-X. However, unlike DUSP6/MKP-3, DUSP9/MKP-4 also inactivates the p38α MAP kinase both in vitro and in vivo. Here we demonstrate that inactivation of both ERK1/2 and p38α by DUSP9/MKP-4 is mediated by a conserved arginine-rich kinase interaction motif located within the amino-terminal non-catalytic domain of the protein. Furthermore, DUSP9/MKP-4 is unique among these cytoplasmic MKPs in containing a conserved PKA consensus phosphorylation site 55RRXSer-58 immediately adjacent to the kinase interaction motif. DUSP9/MKP-4 is phosphorylated on Ser-58 by PKA in vitro, and phosphorylation abrogates the binding of DUSP9/MKP-4 to both ERK2 and p38α MAP kinases. In addition, although mutation of Ser-58 to either alanine or glutamic acid does not affect the intrinsic catalytic activity of DUSP9/MKP-4, phospho-mimetic (Ser-58 to Glu) substitution inhibits both the interaction of DUSP9/MKP-4 with ERK2 and p38α in vivo and its ability to dephosphorylate and inactivate these MAP kinases. Finally, the use of a phospho-specific antibody demonstrates that endogenous DUSP9/MKP-4 is phosphorylated on Ser-58 in response to the PKA agonist forskolin and is also modified in placental tissue. We conclude that DUSP9/MKP-4 is a bona fide target of PKA signaling and that attenuation of DUSP9/MKP-4 function can mediate cross-talk between the PKA pathway and MAPK signaling through both ERK1/2 and p38α in vivo. PMID:21908610

  10. Selectivity of docking sites in MAPK kinases.

    PubMed

    Bardwell, A Jane; Frankson, Erlynn; Bardwell, Lee

    2009-05-01

    Protein kinases often recognize their substrates and regulators through docking interactions that occur outside of the active site; these interactions can help us to understand kinase networks, and to target kinases with drugs. During mitogen-activated protein kinase (MAPK) signaling, the ability of MAPK kinases (MKKs, or MEKs) to recognize their cognate MAPKs is facilitated by a short docking motif (the D-site) in the MKK N terminus, which binds to a complementary region on the MAPK. MAPKs then recognize many of their targets using the same strategy, because many MAPK substrates also contain D-sites. The extent to which docking contributes to the specificity of MAPK transactions is incompletely understood. Here we characterize the selectivity of the interaction between MKK-derived D-sites and MAPKs by measuring the ability of D-site peptides to inhibit MAPK-mediated phosphorylation of D-site-containing substrates. We find that all MKK D-sites bind better to their cognate MAPKs than they do to non-cognate MAPKs. For instance, the MKK3 D-site peptide, which is a remarkably potent inhibitor of p38alpha (IC(50) < 10 nm), does not inhibit JNK1 or JNK2. Likewise, MAPKs generally bind as well or better to cognate D-sites than to non-cognate D-sites. For instance, JNK1 and JNK2 do not appreciably bind to any D-sites other than their cognate D-sites from MKK4 and MKK7. In general, cognate, within-pathway interactions are preferred about an order of magnitude over non-cognate interactions. However, the selectivity of MAPKs and their cognate MKK-derived D-sites for each other is limited in some cases; in particular, ERK2 is not very selective. We conclude that MAPK-docking sites in MAPK kinases bind selectively to their cognate MAPKs. PMID:19196711

  11. Cell signaling by receptor-tyrosine kinases

    PubMed Central

    Lemmon, Mark A.; Schlessinger, Joseph

    2010-01-01

    Recent structural studies of receptor tyrosine kinases (RTKs) have revealed unexpected diversity in the mechanisms of their activation by growth factor ligands. Strategies for inducing dimerization by ligand binding are surprisingly diverse, as are mechanisms that couple this event to activation of the intracellular tyrosine kinase domains. As our understanding of these details becomes increasingly sophisticated, it provides an important context for therapeutically countering the effects of pathogenic RTK mutations in cancer and other diseases. Much remains to be learned, however, about the complex signaling networks downstream from RTKs and how alterations in these networks are translated into cellular responses. PMID:20602996

  12. Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase

    PubMed Central

    2011-01-01

    Background Haspin kinases are mitotic kinases that are well-conserved from yeast to human. Human Haspin is a histone H3 Thr3 kinase that has important roles in chromosome cohesion during mitosis. Moreover, phosphorylation of histone H3 at Thr3 by Haspin in fission yeast, Xenopus, and human is required for accumulation of Aurora B on the centromere, and the subsequent activation of Aurora B kinase activity for accurate chromosome alignment and segregation. Although extensive analyses of Haspin have been carried out in yeast and animals, the function of Haspin in organogenesis remains unclear. Results Here, we identified a Haspin kinase, designated AtHaspin, in Arabidopsis thaliana. The purified AtHaspin phosphorylated histone H3 at both Thr3 and Thr11 in vitro. Live imaging of AtHaspin-tdTomato and GFP-α-tubulin in BY-2 cells showed that AtHaspin-tdTomato localized on chromosomes during prometaphase and metaphase, and around the cell plate during cytokinesis. This localization of AtHaspin overlapped with that of phosphorylated Thr3 and Thr11 of histone H3 in BY-2 cells. AtHaspin-GFP driven by the native promoter was expressed in root meristems, shoot meristems, floral meristems, and throughout the whole embryo at stages of high cell division. Overexpression of a kinase domain mutant of AtHaspin decreased the size of the root meristem, which delayed root growth. Conclusions Our results indicated that the Haspin kinase is a histone H3 threonine kinase in A. thaliana. AtHaspin phosphorylated histone H3 at both Thr3 and Thr11 in vitro. The expression and dominant-negative analysis showed that AtHaspin may have a role in mitotic cell division during plant growth. Further analysis of coordinated mechanisms involving Haspin and Aurora kinases will shed new light on the regulation of chromosome segregation in cell division during plant growth and development. PMID:21527018

  13. Purification and characterization of a casein kinase 2-type protein kinase from pea nuclei

    NASA Technical Reports Server (NTRS)

    Li, H.; Roux, S. J.

    1992-01-01

    Almost all the polyamine-stimulated protein kinase activity associated with the chromatin fraction of nuclei purified from etiolated pea (Pisum sativum L.) plumules is present in a single enzyme that can be extracted from chromatin by 0.35 molar NaCl. This protein kinase can be further purified over 2000-fold by salt fractionation and anion-exchange and casein-agarose column chromatography, after which it is more than 90% pure. The purified kinase has a specific activity of about 650 nanomoles per minute per milligram protein in the absence of polyamines, with either ATP or GTP as phosphoryl donor. Spermidine can stimulate its activity fourfold, with half-maximal activation at about 2 millimolar. Spermine and putrescine also stimulate activity, although somewhat less effectively. This kinase has a tetrameric alpha 2 beta 2 structure with a native molecular weight of 130,000, and subunit molecular weights of 36,000 for the catalytic subunit (alpha) and 29,000 for the regulatory subunit (beta). In western blot analyses, only the alpha subunit reacts strongly with polyclonal antibodies to a Drosophila casein kinase II. The pea kinase can use casein and phosvitin as artificial substrates, phosphorylating both the serine and threonine residues of casein. It has a pH optimum near 8.0, a Vmax of 1.5 micromoles per minute per milligram protein, and a Km for ATP of approximately 75 micromolar. Its activity can be almost completely inhibited by heparin at 5 micrograms per milliliter, but is relatively insensitive to concentrations of staurosporine, K252a, and chlorpromazine that strongly antagonize Ca(2+) -regulated protein kinases. These results are discussed in relation to recent findings that casein kinase 2-type kinases may phosphorylate trans-acting factors that bind to light-regulated promoters in plants.

  14. Role of Protein Kinase C, PI3-kinase and Tyrosine Kinase in Activation of MAP Kinase by Glucose and Agonists of G-protein Coupled Receptors in INS-1 Cells

    PubMed Central

    Böcker, Dietmar

    2001-01-01

    MAP (mitogen-activated protein) kinase (also called Erk 1/2) plays a crucial role in cell proliferation and differentiation. Its impact on secretory events is less well established. The interplay of protein kinase C (PKC), PI3-kinase nd cellular tyrosine kinase with MAP kinase activity using inhibitors and compounds such as glucose, phorbol 12-myristate 13-acetate (PMA) and agonists of G-protein coupled receptors like gastrin releasing peptide (GRP), oxytocin (OT) and glucose-dependent insulinotropic peptide (GIP) was investigated in INS-1 cells, an insulin secreting cell line. MAP kinase activity was determined by using a peptide derived from the EGF receptor as a MAP kinase substrate and [ P 32 ]ATP. Glucose as well as GRP, OT and GIP exhibited a time-dependent increase in MAP kinase activity with a maximum at time point 2.5 min. All further experiments were performed using 2.5 min incubations. The flavone PD 098059 is known to bind to the inactive forms of MEK1 (MAPK/ERK-Kinase) thus preventing activation by upstream activators. 20 μM PD 098059 ( IC 50 =51 μM) inhibited MAP kinase stimulated by either glucose, GRP, OT, GIP or PMA. Inhibiton (“downregulation”) of PKC by a long term (22h) pretreatment with 1 μM PMA did not influence MAP kinase activity when augmented by either of the above mentioned compound. To investigate whether PI3-kinase and cellular tyrosine kinase are involved in G-protein mediated effects on MAP kinase, inhibitors were used: 100 nM wortmannin (PI3-kinase inhibitor) reduced the effects of GRP, OT and GIP but not that of PMA; 100 μM genistein (tyrosine kinase inhibitor) inhibited the stimulatory effect of either above mentioned compound on MAP kinase activation. Inhibition of MAP kinase by 20 μM PD 098059 did not influence insulin secretion modulated by either compound (glucose, GRP, OT or GIP). [ H 3 ]Thymidine incorporation, however, was severely inhibited by PD 098059. Thus MAP kinase is important for INS-1 cell proliferation but

  15. Designing novel kinases using evolutionary sequence analysis

    NASA Astrophysics Data System (ADS)

    Mody, Areez; Weiner, Joan; Iyer, Lakshman; Ramanathan, Sharad

    2006-03-01

    Cellular pathways with new functions are thought to arise from the duplication and divergence of proteins in existing pathways. The MAP kinase pathways in eukaryotes provide one example of this. These pathways consist of the MAP kinase proteins which are responsible for evoking the correct response to external stimuli. In the yeast Saccharomyces cerevisiae these pathways detect pheromones, osmolar stresses and nutrient levels, leading the cell into dramatic changes of morphology. Despite being homologous to each other, the MAP kinase proteins show specificity of function. We investigate the nature of the amino acid sequences conferring this specificity. To this end, we i) search the sequences of similar proteins in other Eukaryote species, ii) make a study of simple theoretical models exploring the constraints felt by these protein segments and iii) experimentally construct, a large suite of hybrid proteins made of segments taken from the homologous proteins. These are then expressed in Yeast cells to see what function they are able to perform. Particularly we also ask whether it is possible to design a new kinase protein possessing new function and specificity.

  16. Bruton tyrosine kinase (Btk) suppresses osteoblastic differentiation.

    PubMed

    Kaneshiro, Shoichi; Ebina, Kosuke; Shi, Kenrin; Yoshida, Kiyoshi; Otsuki, Dai; Yoshikawa, Hideki; Higuchi, Chikahisa

    2015-09-01

    The Tec family of nonreceptor tyrosine kinases has been shown to play a key role in inflammation and bone destruction. Bruton tyrosine kinase (Btk) has been the most widely studied because of its critical role in B cells. Furthermore, recent evidence has demonstrated that blocking Btk signaling is effective in ameliorating lymphoma progression and experimental arthritis. The role of Btk in osteoblastic differentiation has not been well elucidated. In this study, we demonstrated the role of Btk in osteoblastic differentiation and investigated the effects of a Btk inhibitor on osteoblastic differentiation in mouse preosteoblastic MC3T3-E1 cells, primary calvarial osteoblasts, and bone marrow stromal ST2 cells. Btk expression was detected in all three cell lines. Btk inhibition stimulated mRNA expression of osteoblastic markers (alkaline phosphatase, osteocalcin, and osterix) and promoted mineralization of the extracellular matrix. In addition, Btk knockdown caused increased mRNA expression of osteoblastic markers. Furthermore, Btk inhibition suppressed the phosphorylation of mitogen-activated protein kinase (MAPK), nuclear factor kappa B (NFκB), and protein kinase Cα (PKCα). Our results indicate that Btk may regulate osteoblastic differentiation through the MAPK, NFκB, and PKCα signaling pathways. PMID:25230818

  17. Mycobacterium tuberculosis Serine/Threonine Protein Kinases

    PubMed Central

    PRISIC, SLADJANA; HUSSON, ROBERT N.

    2014-01-01

    The Mycobacterium tuberculosis genome encodes 11 serine/threonine protein kinases (STPKs). A similar number of two-component systems are also present, indicating that these two signal transduction mechanisms are both important in the adaptation of this bacterial pathogen to its environment. The M. tuberculosis phosphoproteome includes hundreds of Ser- and Thr-phosphorylated proteins that participate in all aspects of M. tuberculosis biology, supporting a critical role for the STPKs in regulating M. tuberculosis physiology. Nine of the STPKs are receptor type kinases, with an extracytoplasmic sensor domain and an intracellular kinase domain, indicating that these kinases transduce external signals. Two other STPKs are cytoplasmic and have regulatory domains that sense changes within the cell. Structural analysis of some of the STPKs has led to advances in our understanding of the mechanisms by which these STPKs are activated and regulated. Functional analysis has provided insights into the effects of phosphorylation on the activity of several proteins, but for most phosphoproteins the role of phosphorylation in regulating function is unknown. Major future challenges include characterizing the functional effects of phosphorylation for this large number of phosphoproteins, identifying the cognate STPKs for these phosphoproteins, and determining the signals that the STPKs sense. Ultimately, combining these STPK-regulated processes into larger, integrated regulatory networks will provide deeper insight into M. tuberculosis adaptive mechanisms that contribute to tuberculosis pathogenesis. Finally, the STPKs offer attractive targets for inhibitor development that may lead to new therapies for drug-susceptible and drug-resistant tuberculosis. PMID:25429354

  18. Pink1, the first ubiquitin kinase

    PubMed Central

    Zheng, Xinde; Hunter, Tony

    2014-01-01

    Pink1 and Parkin, identified through studies of hereditary early onset Parkinson's disease, are involved in mitochondria quality control. Parkin E3 ubiquitin ligase activity is activated by Pink1 kinase activity, although the mechanism is still elusive. Three recent reports uncover a surprising mechanism in which Pink1 directly phosphorylates ubiquitin to boost Parkin activity. PMID:24942162

  19. Genetics Home Reference: phosphoglycerate kinase deficiency

    MedlinePlus

    ... the expand/collapse boxes. Download PDF Open All Close All Description Phosphoglycerate kinase deficiency is a genetic disorder that affects the body's ability to break down the simple sugar glucose, which is the primary energy source for most cells. Researchers have described two major ...

  20. Phosphotyrosine enrichment identifies focal adhesion kinase and other tyrosine kinases for targeting in canine hemangiosarcoma.

    PubMed

    Marley, K; Maier, C S; Helfand, S C

    2012-09-01

    Canine hemangiosarcoma (HSA) is an endothelial cell malignancy driven, in part, by activating mutations in receptor and non-receptor tyrosine kinases. Proteomics, Western blots and a tyrosine kinase inhibitor were used to elucidate activating mechanisms in HSA cell lines. Phosphotyrosine peptides from focal adhesion kinase (FAK) STAT3, Lyn, Fyn and other signal transduction kinases were identified by mass spectrometry. FAK was constitutively activated at tyrosine 397, the autophosphorylation site, and this was reversible with high concentrations of a FAK inhibitor. FAK inhibitor-14 suppressed migration and phosphorylation of FAK tyrosine 397 and tyrosines 576/577 and was cytotoxic to HSA cells suggesting FAK signalling may be an important contributor to canine HSA survival. PMID:22487216

  1. The crystal structure of choline kinase reveals a eukaryotic protein kinase fold

    SciTech Connect

    Peisach, D.; Gee, P.; Kent, K.; Xu, Z.

    2010-03-08

    Choline kinase catalyzes the ATP-dependent phosphorylation of choline, the first committed step in the CDP-choline pathway for the biosynthesis of phosphatidylcholine. The 2.0 {angstrom} crystal structure of a choline kinase from C. elegans (CKA-2) reveals that the enzyme is a homodimeric protein with each monomer organized into a two-domain fold. The structure is remarkably similar to those of protein kinases and aminoglycoside phosphotransferases, despite no significant similarity in amino acid sequence. Comparisons to the structures of other kinases suggest that ATP binds to CKA-2 in a pocket formed by highly conserved and catalytically important residues. In addition, a choline binding site is proposed to be near the ATP binding pocket and formed by several structurally flexible loops.

  2. Mitogen-Activated Protein Kinase Kinase 3 Is Required for Regulation during Dark-Light Transition.

    PubMed

    Lee, Horim

    2015-07-01

    Plant growth and development are coordinately orchestrated by environmental cues and phytohormones. Light acts as a key environmental factor for fundamental plant growth and physiology through photosensory phytochromes and underlying molecular mechanisms. Although phytochromes are known to possess serine/threonine protein kinase activities, whether they trigger a signal transduction pathway via an intracellular protein kinase network remains unknown. In analyses of mitogen-activated protein kinase kinase (MAPKK, also called MKK) mutants, the mkk3 mutant has shown both a hypersensitive response in plant hormone gibberellin (GA) and a less sensitive response in red light signaling. Surprisingly, light-induced MAPK activation in wild-type (WT) seedlings and constitutive MAPK phosphorylation in dark-grown mkk3 mutant seedlings have also been found, respectively. Therefore, this study suggests that MKK3 acts in negative regulation in darkness and in light-induced MAPK activation during dark-light transition. PMID:26082029

  3. A new autoinhibited kinase conformation reveals a salt-bridge switch in kinase activation

    PubMed Central

    Wei, Qiang; Yang, Shaoyuan; Li, Dan; Zhang, Xiaoying; Zheng, Jimin; Jia, Zongchao

    2016-01-01

    In the structure of autoinhibited EphA2 tyrosine kinase reported herein, we have captured the entire activation segment, revealing a previously unknown role of the conserved Arg762 in kinase autoinhibition by interacting with the essential Mg2+-chelating Asp757. While it is well known that this Arg residue is involved in an electrostatic interaction with the phospho-residue of the activation loop to stabilize the active conformation, our structure determination revealed a new role for the Arg, acting as a switch between the autoinhibited and activated conformations. Mutation of Arg762 to Ala in EphA2 sensitized Mg2+ response, resulting in enhanced kinase catalytic activity and Mg2+ cooperativity. Furthermore, mutation of the corresponding Arg/Lys to Ala in PKA and p38MAPK also exhibited similar behavior. This new salt bridge-mediated switch may thus be an important mechanism of activation on a broader scope for kinases which utilize autophosphorylation. PMID:27324091

  4. Crystal Structure of the Protein Kinase Domain of Yeast AMP-Activated Protein Kinase Snf1

    SciTech Connect

    Rudolph,M.; Amodeo, G.; Bai, Y.; Tong, L.

    2005-01-01

    AMP-activated protein kinase (AMPK) is a master metabolic regulator, and is an important target for drug development against diabetes, obesity, and other diseases. AMPK is a hetero-trimeric enzyme, with a catalytic ({alpha}) subunit, and two regulatory ({beta} and {gamma}) subunits. Here we report the crystal structure at 2.2 Angstrom resolution of the protein kinase domain (KD) of the catalytic subunit of yeast AMPK (commonly known as SNF1). The Snf1-KD structure shares strong similarity to other protein kinases, with a small N-terminal lobe and a large C-terminal lobe. Two negative surface patches in the structure may be important for the recognition of the substrates of this kinase.

  5. Unraveling Kinase Activation Dynamics Using Kinase-Substrate Relationships from Temporal Large-Scale Phosphoproteomics Studies

    PubMed Central

    Chaudhuri, Rima; Yang, Pengyi; Vafaee, Fatemeh; Fazakerley, Daniel; Humphrey, Sean; James, David; Kuncic, Zdenka

    2016-01-01

    In response to stimuli, biological processes are tightly controlled by dynamic cellular signaling mechanisms. Reversible protein phosphorylation occurs on rapid time-scales (milliseconds to seconds), making it an ideal carrier of these signals. Advances in mass spectrometry-based proteomics have led to the identification of many tens of thousands of phosphorylation sites, yet for the majority of these the kinase is unknown and the underlying network topology of signaling networks therefore remains obscured. Identifying kinase substrate relationships (KSRs) is therefore an important goal in cell signaling research. Existing consensus sequence motif based prediction algorithms do not consider the biological context of KSRs, and are therefore insensitive to many other mechanisms guiding kinase-substrate recognition in cellular contexts. Here, we use temporal information to identify biologically relevant KSRs from Large-scale In Vivo Experiments (KSR-LIVE) in a data-dependent and automated fashion. First, we used available phosphorylation databases to construct a repository of existing experimentally-predicted KSRs. For each kinase in this database, we used time-resolved phosphoproteomics data to examine how its substrates changed in phosphorylation over time. Although substrates for a particular kinase clustered together, they often exhibited a different temporal pattern to the phosphorylation of the kinase. Therefore, although phosphorylation regulates kinase activity, our findings imply that substrate phosphorylation likely serve as a better proxy for kinase activity than kinase phosphorylation. KSR-LIVE can thereby infer which kinases are regulated within a biological context. Moreover, KSR-LIVE can also be used to automatically generate positive training sets for the subsequent prediction of novel KSRs using machine learning approaches. We demonstrate that this approach can distinguish between Akt and Rps6kb1, two kinases that share the same linear consensus motif

  6. Unraveling Kinase Activation Dynamics Using Kinase-Substrate Relationships from Temporal Large-Scale Phosphoproteomics Studies.

    PubMed

    Domanova, Westa; Krycer, James; Chaudhuri, Rima; Yang, Pengyi; Vafaee, Fatemeh; Fazakerley, Daniel; Humphrey, Sean; James, David; Kuncic, Zdenka

    2016-01-01

    In response to stimuli, biological processes are tightly controlled by dynamic cellular signaling mechanisms. Reversible protein phosphorylation occurs on rapid time-scales (milliseconds to seconds), making it an ideal carrier of these signals. Advances in mass spectrometry-based proteomics have led to the identification of many tens of thousands of phosphorylation sites, yet for the majority of these the kinase is unknown and the underlying network topology of signaling networks therefore remains obscured. Identifying kinase substrate relationships (KSRs) is therefore an important goal in cell signaling research. Existing consensus sequence motif based prediction algorithms do not consider the biological context of KSRs, and are therefore insensitive to many other mechanisms guiding kinase-substrate recognition in cellular contexts. Here, we use temporal information to identify biologically relevant KSRs from Large-scale In Vivo Experiments (KSR-LIVE) in a data-dependent and automated fashion. First, we used available phosphorylation databases to construct a repository of existing experimentally-predicted KSRs. For each kinase in this database, we used time-resolved phosphoproteomics data to examine how its substrates changed in phosphorylation over time. Although substrates for a particular kinase clustered together, they often exhibited a different temporal pattern to the phosphorylation of the kinase. Therefore, although phosphorylation regulates kinase activity, our findings imply that substrate phosphorylation likely serve as a better proxy for kinase activity than kinase phosphorylation. KSR-LIVE can thereby infer which kinases are regulated within a biological context. Moreover, KSR-LIVE can also be used to automatically generate positive training sets for the subsequent prediction of novel KSRs using machine learning approaches. We demonstrate that this approach can distinguish between Akt and Rps6kb1, two kinases that share the same linear consensus motif

  7. Mnk kinase pathway: Cellular functions and biological outcomes.

    PubMed

    Joshi, Sonali; Platanias, Leonidas C

    2014-08-26

    The mitogen-activated protein kinase (MAPK) interacting protein kinases 1 and 2 (Mnk1 and Mnk2) play important roles in controlling signals involved in mRNA translation. In addition to the MAPKs (p38 or Erk), multiple studies suggest that the Mnk kinases can be regulated by other known kinases such as Pak2 and/or other unidentified kinases by phosphorylation of residues distinct from the sites phosphorylated by the MAPKs. Several studies have established multiple Mnk protein targets, including PSF, heterogenous nuclear ribonucleoprotein A1, Sprouty 2 and have lead to the identification of distinct biological functions and substrate specificity for the Mnk kinases. In this review we discuss the pathways regulating the Mnk kinases, their known substrates as well as the functional consequences of engagement of pathways controlled by Mnk kinases. These kinases play an important role in mRNA translation via their regulation of eukaryotic initiation factor 4E (eIF4E) and their functions have important implications in tumor biology as well as the regulation of drug resistance to anti-oncogenic therapies. Other studies have identified a role for the Mnk kinases in cap-independent mRNA translation, suggesting that the Mnk kinases can exert important functional effects independently of the phosphorylation of eIF4E. The role of Mnk kinases in inflammation and inflammation-induced malignancies is also discussed. PMID:25225600

  8. The Roles of Protein Kinases in Learning and Memory

    ERIC Educational Resources Information Center

    Giese, Karl Peter; Mizuno, Keiko

    2013-01-01

    In the adult mammalian brain, more than 250 protein kinases are expressed, but only a few of these kinases are currently known to enable learning and memory. Based on this information it appears that learning and memory-related kinases either impact on synaptic transmission by altering ion channel properties or ion channel density, or regulate…

  9. Problem-Solving Test: "In Vitro" Protein Kinase A Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Phosphorylation of proteins by protein kinases is an important mechanism in the regulation of protein activity. Among hundreds of protein kinases present in human cells, PKA, the first kinase discovered, belongs to the most important and best characterized group of these enzymes. The author presents an experiment that analyzes the "in vitro"…

  10. Mitogen-activated protein kinase cascades in Vitis vinifera

    PubMed Central

    Çakır, Birsen; Kılıçkaya, Ozan

    2015-01-01

    Protein phosphorylation is one of the most important mechanisms to control cellular functions in response to external and endogenous signals. Mitogen-activated protein kinases (MAPK) are universal signaling molecules in eukaryotes that mediate the intracellular transmission of extracellular signals resulting in the induction of appropriate cellular responses. MAPK cascades are composed of four protein kinase modules: MAPKKK kinases (MAPKKKKs), MAPKK kinases (MAPKKKs), MAPK kinases (MAPKKs), and MAPKs. In plants, MAPKs are activated in response to abiotic stresses, wounding, and hormones, and during plant pathogen interactions and cell division. In this report, we performed a complete inventory of MAPK cascades genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with MAPK, MAPK kinases, MAPK kinase kinases and MAPK kinase kinase kinase kinase members of Arabidopsis thaliana, we revealed the existence of 14 MAPKs, 5 MAPKKs, 62 MAPKKKs, and 7 MAPKKKKs in Vitis vinifera. We identified orthologs of V. vinifera putative MAPKs in different species, and ESTs corresponding to members of MAPK cascades in various tissues. This work represents the first complete inventory of MAPK cascades in V. vinifera and could help elucidate the biological and physiological functions of these proteins in V. vinifera. PMID:26257761

  11. Identification of Protein Kinase Substrates by the Kinase-Interacting Substrate Screening (KISS) Approach.

    PubMed

    Amano, Mutsuki; Nishioka, Tomoki; Yura, Yoshimitsu; Kaibuchi, Kozo

    2016-01-01

    Identifying the substrates of protein kinases to understand their modes of action has been undertaken by various approaches and remains an ongoing challenge. Phosphoproteomic technologies have accelerated the accumulation of data concerning protein phosphorylation and have uncovered vast numbers of phosphorylation sites in vivo. In this unit, a novel in vitro screening approach for protein kinase substrates is presented, based on protein-protein interaction and mass spectrometry-based phosphoproteomic technology. © 2016 by John Wiley & Sons, Inc. PMID:27580705

  12. Protein kinase CK2 and protein kinase D are associated with the COP9 signalosome

    PubMed Central

    Uhle, Stefan; Medalia, Ohad; Waldron, Richard; Dumdey, Renate; Henklein, Peter; Bech-Otschir, Dawadschargal; Huang, Xiaohua; Berse, Matthias; Sperling, Joseph; Schade, Rüdiger; Dubiel, Wolfgang

    2003-01-01

    The COP9 signalosome (CSN) purified from human erythrocytes possesses kinase activity that phosphoryl ates proteins such as c-Jun and p53 with consequence for their ubiquitin (Ub)-dependent degradation. Here we show that protein kinase CK2 (CK2) and protein kinase D (PKD) co-purify with CSN. Immunoprecipi tation and far-western blots reveal that CK2 and PKD are in fact associated with CSN. As indicated by electron microscopy with gold-labeled ATP, at least 10% of CSN particles are associated with kinases. Kinase activity, most likely due to CK2 and PKD, co-immuno precipitates with CSN from HeLa cells. CK2 binds to ΔCSN3(111–403) and CSN7, whereas PKD interacts with full-length CSN3. CK2 phosphorylates CSN2 and CSN7, and PKD modifies CSN7. Both CK2 and PKD phosphorylate c-Jun as well as p53. CK2 phosphoryl ates Thr155, which targets p53 to degradation by the Ub system. Curcumin, emodin, DRB and resveratrol block CSN-associated kinases and induce degradation of c-Jun in HeLa cells. Curcumin treatment results in elevated amounts of c-Jun–Ub conjugates. We conclude that CK2 and PKD are recruited by CSN in order to regulate Ub conjugate formation. PMID:12628923

  13. Kinases and kinase signaling pathways: potential therapeutic targets in Parkinson's disease.

    PubMed

    Wang, Gang; Pan, Jing; Chen, Sheng-Di

    2012-08-01

    Complex molecular mechanisms underlying the pathogenesis of Parkinson's disease (PD) are gradually being elucidated. Accumulating genetic evidence implicates dysfunction of kinase activities and phosphorylation pathways in the pathogenesis of PD. Causative and risk gene products associated with PD include protein kinases (such as PINK1, LRRK2 and GAK) and proteins related phosphorylation signaling pathways (such as SNCA, DJ-1). PINK1, LRRK2 and several PD gene products have been associated with mitogen-activated protein (MAP) and protein kinase B (AKT) kinase signaling pathways. C-Jun N-terminal kinase (JNK), extracellular signal-regulated kinases (ERK) and p38, signaling pathways downstream of MAP, are particularly important in PD. JNK and p38 play an integral role in neuronal death. Targeting JNK or p38 signaling may offer an effective therapy for PD. Inhibitors of the ERK signaling pathway, which plays an important role in the development of l-DOPA-induced dyskinesia (LID), have been shown to attenuate this condition in animal models. In this review, we summarize experimental evidence gathered over the last decade on the role of PINK1, LRRK2 and GAK and their related phosphorylation signaling pathways (JNK, ERK, p38 and PI3K/AKT) in PD. It is speculated that improvement or modulation of these signaling pathways will reveal potential therapeutic targets for attenuation of the cardinal symptoms and motor complications in patients with PD in the future. PMID:22709943

  14. Comprehensive kinase profile of pacritinib, a nonmyelosuppressive Janus kinase 2 inhibitor

    PubMed Central

    Singer, Jack W; Al-Fayoumi, Suliman; Ma, Haiching; Komrokji, Rami S; Mesa, Ruben; Verstovsek, Srdan

    2016-01-01

    Pacritinib, potent inhibitor of Janus kinase 2 (JAK2), JAK2V617F, and fms-like receptor tyrosine kinase 3, is in Phase III development in myelofibrosis. Among type 1 inhibitors, pacritinib shows a lack of myelosuppression at doses that both inhibit JAK2/signal transducer and activator of transcription 3 pathway and demonstrate clinical efficacy. To elucidate these mechanisms and identify other disease targets, a kinome analysis screened 439 recombinant kinases at 100 nM pacritinib concentration. For kinases with >50% inhibition, pacritinib was titrated from 1 to 100 nM. JAK2, JAK2V617F, FLT3, colony-stimulating factor 1 receptor, and interleukin-1 receptor-associated kinase 1 achieved half-maximal inhibitory concentrations <50 nM. Pacritinib did not inhibit JAK1 (82% control at 100 nM). Lack of myelosuppression may stem from inhibiting JAK2 without affecting JAK1 and reducing hematopoietic inhibitory cytokines by suppressing interleukin-1 receptor-associated kinase 1 or colony-stimulating factor 1 receptor. The pacritinib kinome suggests therapeutic utility in acute myeloid leukemia, myelodysplastic syndrome, chronic myelomonocytic leukemia, solid tumors, and inflammatory conditions. PMID:27574472

  15. Comprehensive kinase profile of pacritinib, a nonmyelosuppressive Janus kinase 2 inhibitor.

    PubMed

    Singer, Jack W; Al-Fayoumi, Suliman; Ma, Haiching; Komrokji, Rami S; Mesa, Ruben; Verstovsek, Srdan

    2016-01-01

    Pacritinib, potent inhibitor of Janus kinase 2 (JAK2), JAK2V617F, and fms-like receptor tyrosine kinase 3, is in Phase III development in myelofibrosis. Among type 1 inhibitors, pacritinib shows a lack of myelosuppression at doses that both inhibit JAK2/signal transducer and activator of transcription 3 pathway and demonstrate clinical efficacy. To elucidate these mechanisms and identify other disease targets, a kinome analysis screened 439 recombinant kinases at 100 nM pacritinib concentration. For kinases with >50% inhibition, pacritinib was titrated from 1 to 100 nM. JAK2, JAK2V617F, FLT3, colony-stimulating factor 1 receptor, and interleukin-1 receptor-associated kinase 1 achieved half-maximal inhibitory concentrations <50 nM. Pacritinib did not inhibit JAK1 (82% control at 100 nM). Lack of myelosuppression may stem from inhibiting JAK2 without affecting JAK1 and reducing hematopoietic inhibitory cytokines by suppressing interleukin-1 receptor-associated kinase 1 or colony-stimulating factor 1 receptor. The pacritinib kinome suggests therapeutic utility in acute myeloid leukemia, myelodysplastic syndrome, chronic myelomonocytic leukemia, solid tumors, and inflammatory conditions. PMID:27574472

  16. A Novel Mode of Protein Kinase Inhibition Exploiting Hydrophobic Motifs of Autoinhibited Kinases

    SciTech Connect

    S Eathiraj; R Palma; M Hirschi; E Volckova; E Nakuci; J Castro; C Chen; T Chan; D France; M Ashwell

    2011-12-31

    Protein kinase inhibitors with enhanced selectivity can be designed by optimizing binding interactions with less conserved inactive conformations because such inhibitors will be less likely to compete with ATP for binding and therefore may be less impacted by high intracellular concentrations of ATP. Analysis of the ATP-binding cleft in a number of inactive protein kinases, particularly in the autoinhibited conformation, led to the identification of a previously undisclosed non-polar region in this cleft. This ATP-incompatible hydrophobic region is distinct from the previously characterized hydrophobic allosteric back pocket, as well as the main pocket. Generalized hypothetical models of inactive kinases were constructed and, for the work described here, we selected the fibroblast growth factor receptor (FGFR) tyrosine kinase family as a case study. Initial optimization of a FGFR2 inhibitor identified from a library of commercial compounds was guided using structural information from the model. We describe the inhibitory characteristics of this compound in biophysical, biochemical, and cell-based assays, and have characterized the binding mode using x-ray crystallographic studies. The results demonstrate, as expected, that these inhibitors prevent activation of the autoinhibited conformation, retain full inhibitory potency in the presence of physiological concentrations of ATP, and have favorable inhibitory activity in cancer cells. Given the widespread regulation of kinases by autoinhibitory mechanisms, the approach described herein provides a new paradigm for the discovery of inhibitors by targeting inactive conformations of protein kinases.

  17. Asymmetric Tyrosine Kinase Arrangements in Activation or Autophosphorylation of Receptor Tyrosine Kinases

    SciTech Connect

    J Bae; J Schlessinger

    2011-12-31

    Receptor tyrosine kinases (RTKs) play important roles in the control of many cellular processes including cell proliferation, cell adhesion, angiogenesis, and apoptosis. Ligand-induced dimerization of RTKs leads to autophosphorylation and activation of RTKs. Structural studies have shown that while isolated ectodomains of several RTKs form symmetric dimers the isolated cytoplasmic kinase domains of epidermal growth factor receptor (EGFR) and fibroblast growth factor receptor (FGFR) form asymmetric dimers during their activation. Binding of one kinase molecule of EGFR to a second kinase molecule asymmetrically leads to stimulation of kinase activity and enhanced autophosphorylation. Furthermore, the structures of the kinase domain of FGFR1 and FGFR2 reveal the formation of asymmetric interfaces in the processes of autophosphorylation at their specific phosphotyrosine (pY) sites. Disruption of asymmetric dimer interface of EGFR leads to reduction in enzymatic activity and drastic reduction of autophosphorylation of FGFRs in ligandstimulated live cells. These studies demonstrate that asymmetric dimer formation is as a common phenomenon critical for activation and autophosphorylation of RTKs.

  18. Activation of S6 kinase in human neutrophils by calcium pyrophosphate dihydrate crystals: protein kinase C-dependent and phosphatidylinositol-3-kinase-independent pathways.

    PubMed Central

    Tudan, C; Jackson, J K; Charlton, L; Pelech, S L; Sahl, B; Burt, H M

    1998-01-01

    Phosphatidylinositol 3-kinase (PI 3-kinase) has been shown previously to be a central enzyme in crystal-induced neutrophil activation. Since activation of the 70 kDa S6 kinase (p70S6K) has been shown to be dependent on PI 3-kinase activation in mammalian cells, and since the former is a key enzyme in the transmission of signals to the cell nucleus, activation of p70(S6K) was investigated in crystal-stimulated neutrophils. Cytosolic fractions from calcium pyrophosphate dihydrate (CPPD)-crystal-activated neutrophils were separated by Mono Q chromatography and analysed for phosphotransferase activity using a range of substrates and probed by Western analysis using antibodies to p70(S6K) and mitogen-activated protein kinase (MAP kinase). CPPD crystals induced a robust, transient activation (peak activity at 2 min) of p70(S6K) that was fully inhibited by pretreatment with rapamycin. This is the first report of the activation of p70(S6K) in neutrophil signal transduction pathways induced by an agonist. This crystal-induced activation of p70(S6K) could also be inhibited by a protein kinase C (PKC) inhibitor (Compound 3), but not by the PI 3-kinase inhibitor wortmannin. CPPD crystals also activated the ERK1 and ERK2 forms of MAP kinase (wortmannin insensitive), PKC (Compound 3 sensitive) and protein kinase B (wortmannin sensitive) in neutrophils. These data suggest that activation of p70(S6K) may proceed through a PI 3-kinase- and protein kinase B-independent but PKC-dependent pathway in crystal-activated neutrophils. PMID:9531494

  19. Evaluation of Kinase Activity Profiling Using Chemical Proteomics.

    PubMed

    Ruprecht, Benjamin; Zecha, Jana; Heinzlmeir, Stephanie; Médard, Guillaume; Lemeer, Simone; Kuster, Bernhard

    2015-12-18

    Protein kinases are important mediators of intracellular signaling and are reversibly activated by phosphorylation. Immobilized kinase inhibitors can be used to enrich these often low-abundance proteins, to identify targets of kinase inhibitors, or to probe their selectivity. It has been suggested that the binding of kinases to affinity beads reflects a kinase's activation status, a concept that is under considerable debate. To assess the merits of the idea, we performed a series of experiments including quantitative phosphoproteomics and purification of kinases by single or mixed affinity matrices from signaling activated or resting cancer cells. The data show that mixed affinity beads largely bind kinases independent of their activation status, and experiments using individual immobilized kinase inhibitors show mixed results in terms of preference for binding the active or inactive conformation. Taken together, activity- or conformation-dependent binding to such affinity resins depends (i) on the kinase, (ii) on the affinity probe, and (iii) on the activation status of the lysate or cell. As a result, great caution should be exercised when inferring kinase activity from such binding data. The results also suggest that assaying kinase activity using binding data is restricted to a limited number of well-chosen cases. PMID:26378887

  20. Identification of four plastid-localized protein kinases.

    PubMed

    Richter, Andreas S; Gartmann, Hans; Fechler, Mona; Rödiger, Anja; Baginsky, Sacha; Grimm, Bernhard

    2016-06-01

    In chloroplasts, protein phosphorylation regulates important processes, including metabolism, photosynthesis, gene expression, and signaling. Because the hitherto known plastid protein kinases represent only a fraction of existing kinases, we aimed at the identification of novel plastid-localized protein kinases that potentially phosphorylate enzymes of the tetrapyrrole biosynthesis (TBS) pathway. We screened publicly available databases for proteins annotated as putative protein kinase family proteins with predicted chloroplast localization. Additionally, we analyzed chloroplast fractions which were separated by sucrose density gradient centrifugation by mass spectrometry. We identified four new candidates for protein kinases, which were confirmed to be plastid localized by expression of GFP-fusion proteins in tobacco leaves. A phosphorylation assay with the purified kinases confirmed the protein kinase activity for two of them. PMID:27214872

  1. Human UMP-CMP kinase 2, a novel nucleoside monophosphate kinase localized in mitochondria.

    PubMed

    Xu, Yunjian; Johansson, Magnus; Karlsson, Anna

    2008-01-18

    Enzyme deficiency in the salvage pathway of deoxyribonucleotide synthesis in mitochondria can cause mtDNA depletion syndromes. We have identified a human mitochondrial UMP-CMP kinase (UMP-CMPK, cytidylate kinase; EC 2.7.4.14), designated as UMP-CMP kinase 2 (UMP-CMPK2). The C-terminal domain of this 449-amino acid protein contains all consensus motifs of a nucleoside monophosphate kinase. Phylogenetic analysis showed that UMP-CMPK2 belonged to a novel nucleoside monophosphate kinase family, which was closer to thymidylate kinase than to cytosolic UMP-CMP kinase. Subcellular localization with green fluorescent protein fusion proteins illustrated that UMP-CMPK2 was localized in the mitochondria of HeLa cells and that the mitochondrial targeting signal was included in the N-terminal 22 amino acids. The enzyme was able to phosphorylate dUMP, dCMP, CMP, and UMP with ATP as phosphate donor, but the kinetic properties were different compared with the cytosolic UMP-CMPK. Its efficacy to convert dUMP was highest, followed by dCMP, whereas CMP and UMP were the poorest substrates. It also phosphorylated the monophosphate forms of the nucleoside analogs ddC, dFdC, araC, BVDU, and FdUrd, which suggests that UMP-CMPK2 may be involved in mtDNA depletion caused by long term treatment with ddC or other pyrimidine analogs. UMP-CMPK2 mRNA expression was exclusively detected in chronic myelogenous leukemia K-562 and lymphoblastic leukemia MOLT-4 among eight studied cancer cell lines. Particular high expression in leukemia cells, dominant expression in bone marrow, and tight correlation with macrophage activation and inflammatory response suggest that UMP-CMPK2 may have other functions in addition to the supply of substrates for mtDNA synthesis. PMID:17999954

  2. The selectivity of protein kinase inhibitors: a further update

    PubMed Central

    Bain, Jenny; Plater, Lorna; Elliott, Matt; Shpiro, Natalia; Hastie, C. James; Mclauchlan, Hilary; Klevernic, Iva; Arthur, J. Simon C.; Alessi, Dario R.; Cohen, Philip

    2007-01-01

    The specificities of 65 compounds reported to be relatively specific inhibitors of protein kinases have been profiled against a panel of 70–80 protein kinases. On the basis of this information, the effects of compounds that we have studied in cells and other data in the literature, we recommend the use of the following small-molecule inhibitors: SB 203580/SB202190 and BIRB 0796 to be used in parallel to assess the physiological roles of p38 MAPK (mitogen-activated protein kinase) isoforms, PI-103 and wortmannin to be used in parallel to inhibit phosphatidylinositol (phosphoinositide) 3-kinases, PP1 or PP2 to be used in parallel with Src-I1 (Src inhibitor-1) to inhibit Src family members; PD 184352 or PD 0325901 to inhibit MKK1 (MAPK kinase-1) or MKK1 plus MKK5, Akt-I-1/2 to inhibit the activation of PKB (protein kinase B/Akt), rapamycin to inhibit TORC1 [mTOR (mammalian target of rapamycin)–raptor (regulatory associated protein of mTOR) complex], CT 99021 to inhibit GSK3 (glycogen synthase kinase 3), BI-D1870 and SL0101 or FMK (fluoromethylketone) to be used in parallel to inhibit RSK (ribosomal S6 kinase), D4476 to inhibit CK1 (casein kinase 1), VX680 to inhibit Aurora kinases, and roscovitine as a pan-CDK (cyclin-dependent kinase) inhibitor. We have also identified harmine as a potent and specific inhibitor of DYRK1A (dual-specificity tyrosine-phosphorylated and -regulated kinase 1A) in vitro. The results have further emphasized the need for considerable caution in using small-molecule inhibitors of protein kinases to assess the physiological roles of these enzymes. Despite being used widely, many of the compounds that we analysed were too non-specific for useful conclusions to be made, other than to exclude the involvement of particular protein kinases in cellular processes. PMID:17850214

  3. WNK Kinases, Renal Ion Transport and Hypertension

    PubMed Central

    San-Cristobal, Pedro; de los Heros, Paola; Ponce-Coria, José; Moreno, Erika; Gamba, Gerardo

    2008-01-01

    Two members of a recently discovered family of protein kinases are the cause of an inherited disease known as pseudohypoaldosteronism type II (PHAII). These patients exhibit arterial hypertension together with hyperkalemia and metabolic acidosis. This is a mirror image of Gitelman disease that is due to inactivating mutations of the SLC12A3 gene that encodes the thiazide-sensitive Na+: Cl− cotransporter. The uncovered genes causing PHAII encode for serine/threonine kinases known as WNK1 and WNK4. Physiological and biochemical studies have revealed that WNK1 and WNK4 modulate the activity of several transport pathways of the aldosterone-sensitive distal nephron, thus increasing our understanding of how diverse renal ion transport proteins are coordinated to regulate normal blood pressure levels. Observations discussed in the present work place WNK1 and WNK4 as genes involved in the genesis of essential hypertension and as potential targets for the development of antihypertensive drugs. PMID:18547946

  4. Phosphatidylinositol 4-kinases: Function, structure, and inhibition

    SciTech Connect

    Boura, Evzen Nencka, Radim

    2015-10-01

    The phosphatidylinositol 4-kinases (PI4Ks) synthesize phosphatidylinositol 4-phosphate (PI4P), a key member of the phosphoinositide family. PI4P defines the membranes of Golgi and trans-Golgi network (TGN) and regulates trafficking to and from the Golgi. Humans have two type II PI4Ks (α and β) and two type III enzymes (α and β). Recently, the crystal structures were solved for both type II and type III kinase revealing atomic details of their function. Importantly, the type III PI4Ks are hijacked by +RNA viruses to create so-called membranous web, an extensively phosphorylated and modified membrane system dedicated to their replication. Therefore, selective and potent inhibitors of PI4Ks have been developed as potential antiviral agents. Here we focus on the structure and function of PI4Ks and their potential in human medicine.

  5. The Ror receptor tyrosine kinase family.

    PubMed

    Forrester, W C

    2002-01-01

    Receptor tyrosine kinases (RTKs) participate in numerous developmental decisions. Ror RTKs are a family of orphan receptors that are related to muscle specific kinase (MuSK) and Trk neurotrophin receptors. MuSK assembles acetylcholine receptors at the neuromuscular junction, and Trk receptors function in the developing nervous system (reviewed in [3-5]). Rors have been identified in nematodes, insects and mammals. Recent studies have begun to shed light on Ror function during development. In most species, Rors are expressed in many tissue types during development. Analyses of mutants that are defective in the single nematode Ror demonstrate a role in cell migration and in orienting cell polarity. Mice lacking one of the two Ror gene products display defects in bone and heart formation. Similarly, two different human bone development disorders, dominant brachydactyly B and recessive Robinow syndrome, result from mutations in one of the human Ror genes. PMID:11846036

  6. Osmotic stress signaling via protein kinases.

    PubMed

    Fujii, Hiroaki; Zhu, Jian-Kang

    2012-10-01

    Plants face various kinds of environmental stresses, including drought, salinity, and low temperature, which cause osmotic stress. An understanding of the plant signaling pathways that respond to osmotic stress is important for both basic biology and agriculture. In this review, we summarize recent investigations concerning the SNF1-related protein kinase (SnRK) 2 kinase family, which play central roles in osmotic stress responses. SnRK2s are activated by osmotic stress, and a mutant lacking SnRK2s is hypersensitive to osmotic stress. Many questions remain about the signaling pathway upstream and downstream of SnRK2s. Because some SnRK2s also functions in the abscisic acid (ABA) signaling pathway, which has recently been well clarified, study of SnRK2s in ABA signaling can provide clues regarding their roles in osmotic stress signaling. PMID:22828864

  7. SUMOylation regulates the SNF1 protein kinase

    PubMed Central

    Simpson-Lavy, Kobi J.; Johnston, Mark

    2013-01-01

    The AMP-activated protein kinase (AMPK) is a major stress sensor of mammalian cells. AMPK’s homolog in the yeast Saccharomyces cerevisiae, the SNF1 protein kinase, is a central regulator of carbon metabolism that inhibits the Snf3/Rgt2-Rgt1 glucose sensing pathway and activates genes involved in respiration. We present evidence that glucose induces modification of the Snf1 catalytic subunt of SNF1 with the small ubiquitin-like modifier protein SUMO, catalyzed by the SUMO (E3) ligase Mms21. Our results suggest that SUMOylation of Snf1 inhibits its function in two ways: by interaction of SUMO attached to lysine 549 with a SUMO-interacting sequence motif located near the active site of Snf1, and by targeting Snf1 for destruction via the Slx5-Slx8 (SUMO-directed) ubiquitin ligase. These findings reveal another way SNF1 function is regulated in response to carbon source. PMID:24108357

  8. Primary structure of maize chloroplast adenylate kinase.

    PubMed

    Schiltz, E; Burger, S; Grafmüller, R; Deppert, W R; Haehnel, W; Wagner, E

    1994-06-15

    This paper describes the sequence of adenylate kinase (Mg-ATP+AMP<-->Mg-ADP+ADP) from maize chloroplasts. This light-inducible enzyme is important for efficient CO2 fixation in the C4 cycle, by removing and recycling AMP produced in the reversible pyruvate phosphate dikinase reaction. The complete sequence was determined by analyzing peptides from cleavages with trypsin, AspN protease and CNBr and subcleavage of a major CNBr peptide with chymotrypsin. N-terminal Edman degradation and carboxypeptidase digestion established the terminal residues. Electrospray mass spectrometry confirmed the final sequence of 222 residues (M(r) = 24867) including one cysteine and one tryptophan. The sequence shows this enzyme to be a long-variant-type adenylate kinase, the nearest relatives being adenylate kinases from Enterobacteriaceae. Alignment of the sequence with the adenylate kinase from Escherichia coli reveals 44% identical residues. Since the E. coli structure has been published recently at 0.19-nm resolution with the inhibitor adenosine(5')pentaphospho(5')adenosine (Ap5A) [Müller, C. W. & Schulz, G. E. (1992) J. Mol. Biol. 224, 159-177], catalytically essential residues could be compared and were found to be mostly conserved. Surprisingly, in the nucleotide-binding Gly-rich loop Gly-Xaa-Pro-Gly-Xaa-Gly-Lys the middle Gly is replaced by Ala. This is, however, compensated by an Ile-->Val exchange in the nearest spatial neighborhood. A Thr-->Ala exchange explains the unusual tolerance of the enzyme for pyrimidine nucleotides in the acceptor site. PMID:8026505

  9. Approach to asymptomatic creatine kinase elevation

    PubMed Central

    MOGHADAM-KIA, SIAMAK; ODDIS, CHESTER V.; AGGARWAL, ROHIT

    2016-01-01

    How to manage a patient who has an elevated serum creatine kinase (CK) level but no or insignificant muscle-related signs and symptoms is a clinical conundrum. The authors provide a systematic approach, including repeat testing after a period of rest, defining higher thresholds over which pursuing a diagnosis is worthwhile, and evaluating for a variety of nonneuromuscular causes. They also outline a workup for neuromuscular causes. PMID:26760521

  10. Physiological roles of the pantothenate kinases

    PubMed Central

    Dansie, Lorraine E.; Reeves, Stacy; Miller, Karen; Zano, Stephen P.; Frank, Matthew; Pate, Caroline; Wang, Jina; Jackowski, Suzanne

    2016-01-01

    CoA (coenzyme A) is an essential cofactor that is involved in many metabolic processes. CoA is derived from pantothenate in five biosynthetic reactions. The CoA biosynthetic pathway is regulated by PanKs (pantothenate kinases) and four active isoforms are expressed in mammals. The critical physiological functions of the PanKs are revealed by systematic deletion of the Pank genes in mice. PMID:25109998

  11. Association of Common Genetic Variants in Mitogen-activated Protein Kinase Kinase Kinase Kinase 4 with Type 2 Diabetes Mellitus in a Chinese Han Population

    PubMed Central

    Li, Ting-Ting; Qiao, Hong; Tong, Hui-Xin; Zhuang, Tian-Wei; Wang, Tong-Tong

    2016-01-01

    Background: A study has identified several novel susceptibility variants of the mitogen-activated protein kinase kinase kinase kinase 4 (MAP4K4) gene for type 2 diabetes mellitus (T2DM) within the German population. Among the variants, five single nucleotide polymorphisms (SNPs) of MAP4K4 (rs1003376, rs11674694, rs2236935, rs2236936, and rs6543087) showed significant association with T2DM or diabetes-related quantitative traits. We aimed to evaluate whether common SNPs in the MAP4K4 gene were associated with T2DM in the Chinese population. Methods: Five candidate SNPs were genotyped in 996 patients newly diagnosed with T2DM and in 976 control subjects, using the SNPscan™ method. All subjects were recruited from the Second Affiliated Hospital, Harbin Medical University from October 2010 to September 2013. We evaluated the T2DM risk conferred by individual SNPs and haplotypes using logistic analysis, and the association between the five SNPs and metabolic traits in the subgroups. Results: Of the five variants, SNP rs2236935T/C was significantly associated with T2DM in this study population (odds ratio = 1.293; 95% confidence interval: 1.034–1.619, P = 0.025). In addition, among the controls, rs1003376 was significantly associated with an increased body mass index (P = 0.045) and homeostatic model assessment-insulin resistance (P = 0.037). Conclusions: MAP4K4 gene is associated with T2DM in a Chinese Han population, and MAP4K4 gene variants may contribute to the risk toward the development of T2DM. PMID:27174326

  12. Molecular Imaging of the ATM Kinase Activity

    SciTech Connect

    Williams, Terence M.; Nyati, Shyam; Ross, Brian D.; Rehemtulla, Alnawaz

    2013-08-01

    Purpose: Ataxia telangiectasia mutated (ATM) is a serine/threonine kinase critical to the cellular DNA-damage response, including from DNA double-strand breaks. ATM activation results in the initiation of a complex cascade of events including DNA damage repair, cell cycle checkpoint control, and survival. We sought to create a bioluminescent reporter that dynamically and noninvasively measures ATM kinase activity in living cells and subjects. Methods and Materials: Using the split luciferase technology, we constructed a hybrid cDNA, ATM-reporter (ATMR), coding for a protein that quantitatively reports on changes in ATM kinase activity through changes in bioluminescence. Results: Treatment of ATMR-expressing cells with ATM inhibitors resulted in a dose-dependent increase in bioluminescence activity. In contrast, induction of ATM kinase activity upon irradiation resulted in a decrease in reporter activity that correlated with ATM and Chk2 activation by immunoblotting in a time-dependent fashion. Nuclear targeting improved ATMR sensitivity to both ATM inhibitors and radiation, whereas a mutant ATMR (lacking the target phosphorylation site) displayed a muted response. Treatment with ATM inhibitors and small interfering (si)RNA-targeted knockdown of ATM confirm the specificity of the reporter. Using reporter expressing xenografted tumors demonstrated the ability of ATMR to report in ATM activity in mouse models that correlated in a time-dependent fashion with changes in Chk2 activity. Conclusions: We describe the development and validation of a novel, specific, noninvasive bioluminescent reporter that enables monitoring of ATM activity in real time, in vitro and in vivo. Potential applications of this reporter include the identification and development of novel ATM inhibitors or ATM-interacting partners through high-throughput screens and in vivo pharmacokinetic/pharmacodynamic studies of ATM inhibitors in preclinical models.

  13. Conservation and early expression of zebrafish tyrosine kinases support the utility of zebrafish as a model for tyrosine kinase biology.

    PubMed

    Challa, Anil Kumar; Chatti, Kiranam

    2013-09-01

    Tyrosine kinases have significant roles in cell growth, apoptosis, development, and disease. To explore the use of zebrafish as a vertebrate model for tyrosine kinase signaling and to better understand their roles, we have identified all of the tyrosine kinases encoded in the zebrafish genome and quantified RNA expression of selected tyrosine kinases during early development. Using profile hidden Markov model analysis, we identified 122 zebrafish tyrosine kinase genes and proposed unambiguous gene names where needed. We found them to be organized into 39 nonreceptor and 83 receptor type, and 30 families consistent with human tyrosine kinase family assignments. We found five human tyrosine kinase genes (epha1, bmx, fgr, srm, and insrr) with no identifiable zebrafish ortholog, and one zebrafish gene (yrk) with no identifiable human ortholog. We also found that receptor tyrosine kinase genes were duplicated more often than nonreceptor tyrosine kinase genes in zebrafish. We profiled expression levels of 30 tyrosine kinases representing all families using direct digital detection at different stages during the first 24 hours of development. The profiling experiments clearly indicate regulated expression of tyrosine kinases in the zebrafish, suggesting their role during early embryonic development. In summary, our study has resulted in the first comprehensive description of the zebrafish tyrosine kinome. PMID:23234507

  14. Conservation and Early Expression of Zebrafish Tyrosine Kinases Support the Utility of Zebrafish as a Model for Tyrosine Kinase Biology

    PubMed Central

    Challa, Anil Kumar

    2013-01-01

    Abstract Tyrosine kinases have significant roles in cell growth, apoptosis, development, and disease. To explore the use of zebrafish as a vertebrate model for tyrosine kinase signaling and to better understand their roles, we have identified all of the tyrosine kinases encoded in the zebrafish genome and quantified RNA expression of selected tyrosine kinases during early development. Using profile hidden Markov model analysis, we identified 122 zebrafish tyrosine kinase genes and proposed unambiguous gene names where needed. We found them to be organized into 39 nonreceptor and 83 receptor type, and 30 families consistent with human tyrosine kinase family assignments. We found five human tyrosine kinase genes (epha1, bmx, fgr, srm, and insrr) with no identifiable zebrafish ortholog, and one zebrafish gene (yrk) with no identifiable human ortholog. We also found that receptor tyrosine kinase genes were duplicated more often than nonreceptor tyrosine kinase genes in zebrafish. We profiled expression levels of 30 tyrosine kinases representing all families using direct digital detection at different stages during the first 24 hours of development. The profiling experiments clearly indicate regulated expression of tyrosine kinases in the zebrafish, suggesting their role during early embryonic development. In summary, our study has resulted in the first comprehensive description of the zebrafish tyrosine kinome. PMID:23234507

  15. Diacylglycerol Kinase Inhibition and Vascular Function.

    PubMed

    Choi, Hyehun; Allahdadi, Kyan J; Tostes, Rita C A; Webb, R Clinton

    2009-01-01

    Diacylglycerol kinases (DGKs), a family of lipid kinases, convert diacylglycerol (DG) to phosphatidic acid (PA). Acting as a second messenger, DG activates protein kinase C (PKC). PA, a signaling lipid, regulates diverse functions involved in physiological responses. Since DGK modulates two lipid second messengers, DG and PA, regulation of DGK could induce related cellular responses. Currently, there are 10 mammalian isoforms of DGK that are categorized into five groups based on their structural features. These diverse isoforms of DGK are considered to activate distinct cellular functions according to extracellular stimuli. Each DGK isoform is thought to play various roles inside the cell, depending on its subcellular localization (nuclear, ER, Golgi complex or cytoplasm). In vascular smooth muscle, vasoconstrictors such as angiotensin II, endothelin-1 and norepinephrine stimulate contraction by increasing inositol trisphosphate (IP(3)), calcium, DG and PKC activity. Inhibition of DGK could increase DG availability and decrease PA levels, as well as alter intracellular responses, including calcium-mediated and PKC-mediated vascular contraction. The purpose of this review is to demonstrate a role of DGK in vascular function. Selective inhibition of DGK isoforms may represent a novel therapeutic approach in vascular dysfunction. PMID:21547002

  16. Protein kinases as drug targets in cancer.

    PubMed

    Arslan, Mehmet Alper; Kutuk, Ozgur; Basaga, Huveyda

    2006-11-01

    Identification of the key roles of protein kinases in signaling pathways leading to development of cancer has caused pharmacological interest to concentrate extensively on targeted therapies as a more specific and effective way for blockade of cancer progression. This review will mainly focus on inhibitors targeting these key components of cellular signaling by employing a technology-based point of view with respect to ATP- and non-ATP-competitive small molecule inhibitors and monoclonal antibodies of selected protein kinases, particularly, mammalian target of rapamycin (mTOR), BCR-ABL, MEK, p38 MAPK, EGFR PDGFR, VEGFR, HER2 and Raf. Inhibitors of the heat shock protein Hsp90 are also included in a separate section, as this protein plays an essential role for the maturation/proper activation of cancer-related protein kinases. In the following review, the molecular details of the mode of action of these inhibitors as well as the emergence of drug resistance encountered in several cases are discussed in light of the structural, molecular and clinical studies conducted so far. PMID:17100568

  17. Creatine kinase in ischemic and inflammatory disorders.

    PubMed

    Kitzenberg, David; Colgan, Sean P; Glover, Louise E

    2016-12-01

    The creatine/phosphocreatine pathway plays a conserved and central role in energy metabolism. Compartmentalization of specific creatine kinase enzymes permits buffering of local high energy phosphates in a thermodynamically favorable manner, enabling both rapid energy storage and energy transfer within the cell. Augmentation of this metabolic pathway by nutritional creatine supplementation has been shown to elicit beneficial effects in a number of diverse pathologies, particularly those that incur tissue ischemia, hypoxia or oxidative stress. In these settings, creatine and phosphocreatine prevent depletion of intracellular ATP and internal acidification, enhance post-ischemic recovery of protein synthesis and promote free radical scavenging and stabilization of cellular membranes. The creatine kinase energy system is itself further regulated by hypoxic signaling, highlighting the existence of endogenous mechanisms in mammals that can enhance creatine metabolism during oxygen deprivation to promote tissue resolution and homeostasis. Here, we review recent insights into the creatine kinase pathway, and provide rationale for dietary creatine supplementation in human ischemic and inflammatory pathologies. PMID:27527620

  18. Phosphatidylinositol kinase activities in Trypanosoma cruzi epimastigotes.

    PubMed

    Gimenez, Alba Marina; Gesumaría, María Celeste; Schoijet, Alejandra C; Alonso, Guillermo D; Flawiá, Mirtha M; Racagni, Graciela E; Machado, Estela E

    2015-01-01

    Phosphatidylinositol (PtdIns) metabolism through phosphatidylinositol kinase (PIKs) activities plays a central role in different signaling pathways. In Trypanosoma cruzi, causative agent of Chagas disease, PIKs have been proposed as target for drug design in order to combat this pathogen. In this work, we studied the classes of PI4K, PIPK and PI3K that could participate in signaling pathways in T. cruzi epimastigote forms. For this reason, we analyzed their enzymatic parameters and detailed responses to avowed kinase inhibitors (adenosine, sodium deoxycholate, wortmannin and LY294002) and activators (Ca(2+), phosphatidic acid, spermine and heparin). Our results suggest the presence and activity of a class III PI4K, a class I PIPK, a class III PI3K previously described (TcVps34) and a class I PI3K. Class I PI3K enzyme, here named TcPI3K, was cloned and expressed in a bacterial system, and their product was tested for kinase activity. The possible participation of TcPI3K in central cellular events of the parasite is also discussed. PMID:26493613

  19. Varicella-Zoster Virus Open Reading Frame 66 Protein Kinase and Its Relationship to Alphaherpesvirus US3 Kinases

    PubMed Central

    Erazo, Angela

    2014-01-01

    The varicella-zoster virus (VZV) open reading frame (ORF) 66 encodes a basophilic kinase orthologous to the US3 protein kinases found in all alphaherpesviruses. This review summarizes current information on the ORF66 kinase, and outlines apparent differences from other US3 kinases, as well as some of the conserved functions. One critical difference is the VZV ORF66 kinase targeting of the major regulatory VZV IE62 protein to control its nuclear import and assembly into the VZV virion, which is so far unprecedented in the alphaherpesviruses. However, ORF66 targets some cellular targets which are also targeted by US3 kinases of other herpesviruses, including the histone deacetylase-1 and 2 proteins, pathways that lead to changes in actin dynamics, and the targeting of substrates of protein kinase A, including the nuclear matrix protein matrin 3. PMID:20186610

  20. Characterization of irreversible kinase inhibitors by directly detecting covalent bond formation: a tool for dissecting kinase drug resistance.

    PubMed

    Klüter, Sabine; Simard, Jeffrey R; Rode, Haridas B; Grütter, Christian; Pawar, Vijaykumar; Raaijmakers, Hans C A; Barf, Tjeerd A; Rabiller, Matthias; van Otterlo, Willem A L; Rauh, Daniel

    2010-12-10

    Targeting protein kinases in cancer therapy with irreversible small-molecule inhibitors is moving to the forefront of kinase-inhibitor research and is thought to be an effective means of overcoming mutation-associated drug resistance in epidermal growth factor receptor kinase (EGFR). We generated a detection technique that allows direct measurements of covalent bond formation without relying on kinase activity, thereby allowing the straightforward investigation of the influence of steric clashes on covalent inhibitors in different resistant kinase mutants. The obtained results are discussed together with structural biology and biochemical studies of catalytic activity in both wild-type and gatekeeper mutated kinase variants to draw conclusions about the impact of steric hindrance and increased catalytic activity in drug-resistant kinase variants. PMID:21080395

  1. Cl- Channels in CF: Lack of Activation by Protein Kinase C and cAMP-Dependent Protein Kinase

    NASA Astrophysics Data System (ADS)

    Hwang, Tzyh-Chang; Lu, Luo; Zeitlin, Pamela L.; Gruenert, Dieter C.; Huganir, Richard; Guggino, William B.

    1989-06-01

    Secretory chloride channels can be activated by adenosine 3',5'-monophosphate (cAMP)-dependent protein kinase in normal airway epithelial cells but not in cells from individuals with cystic fibrosis (CF). In excised, inside-out patches of apical membrane of normal human airway cells and airway cells from three patients with CF, the chloride channels exhibited a characteristic outwardly rectifying current-voltage relation and depolarization-induced activation. Channels from normal tissues were activated by both cAMP-dependent protein kinase and protein kinase C. However, chloride channels from CF patients could not be activated by either kinase. Thus, gating of normal epithelial chloride channels is regulated by both cAMP-dependent protein kinase and protein kinase C, and regulation by both kinases is defective in CF.

  2. Cellular trafficking of the IL-1RI-associated kinase-1 requires intact kinase activity

    SciTech Connect

    Boel, Gaby-Fleur . E-mail: boel@mail.dife.de; Jurrmann, Nadine; Brigelius-Flohe, Regina

    2005-06-24

    Upon stimulation of cells with interleukin-1 (IL-1) the IL-1 receptor type I (IL-1RI) associated kinase-1 (IRAK-1) transiently associates to and dissociates from the IL-1RI and thereafter translocates into the nucleus. Here we show that nuclear translocation of IRAK-1 depends on its kinase activity since translocation was not observed in EL-4 cells overexpressing a kinase negative IRAK-1 mutant (EL-4{sup IRAK-1-K239S}). IRAK-1 itself, an endogenous substrate with an apparent molecular weight of 24 kDa (p24), and exogenous substrates like histone and myelin basic protein are phosphorylated by nuclear located IRAK-1. Phosphorylation of p24 cannot be detected in EL-4{sup IRAK-1-K239S} cells. IL-1-dependent recruitment of IRAK-1 to the IL-1RI and subsequent phosphorylation of IRAK-1 is a prerequisite for nuclear translocation of IRAK-1. It is therefore concluded that intracellular localization of IRAK-1 depends on its kinase activity and that IRAK-1 may also function as a kinase in the nucleus as shown by a new putative endogenous substrate.

  3. Pyruvate Kinase M2 Regulates Gene Transcription by Acting as A Protein Kinase

    PubMed Central

    Gao, Xueliang; Wang, Haizhen; Jenny, J. Yang; Liu, Xiaowei; Liu, Zhi-Ren

    2012-01-01

    Summary Pyruvate kinase isoform M2 (PKM2) is a glycolysis enzyme catalyzing conversion of phosphoenolpyruvate (PEP) to pyruvate with transferring a phosphate from PEP to ADP. We report here that PKM2 localizes to the cell nucleus. The levels of nuclear PKM2 correlate with cell proliferation. PKM2 activates transcription of MEK5 by phosphorylating stat3 at Y705. In vitro phosphorylation assays show that PKM2 is a protein kinase using PEP as phosphate donor. ADP competes with the protein substrate binding, indicating that the substrate may bind to the ADP site of PKM2. Our experiments suggest that PKM2 dimer is an active protein kinase, while the tetramer is an active pyruvate kinase. Expression a PKM2 mutant that exists as a dimer promotes cell proliferation, indicating that protein kinase activity of PKM2 plays a role in promoting cell proliferation. Our study reveals an important link between metabolism alteration and gene expression during tumor transformation and progression. PMID:22306293

  4. FGF and stress regulate CREB and ATF-1 via a pathway involving p38 MAP kinase and MAPKAP kinase-2.

    PubMed Central

    Tan, Y; Rouse, J; Zhang, A; Cariati, S; Cohen, P; Comb, M J

    1996-01-01

    Fibroblast growth factor (FGF) activates a protein kinase cascade in SK-N-MC cells that regulates gene expression at a cyclic-AMP response element (CRE) by stimulating the transcriptional activity of CREB. The activation of CREB is prevented by a dominant negative mutant of Ras and triggered via the same site (Ser133) that becomes phosphorylated in response to cyclic AMP and Ca2+. However, the effect of FGF is not mediated by cyclic AMP-dependent protein kinase, TPA-sensitive isoforms of protein kinase-C, p70S6K or p90rsk (all of which phosphorylate CREB at Ser133 in vitro). Instead, we identify the FGF-stimulated CREB kinase as MAP kinase-activated protein (MAPKAP) kinase-2, an enzyme that lies immediately downstream of p38 MAP kinase, in a pathway that is also stimulated by cellular stresses. We show that MAPKAP kinase-2 phosphorylates CREB at Ser133 in vitro, that the FGF- or stress-induced activation of MAPKAP kinase-2 and phosphorylation of CREB and ATF-1 are prevented by similar concentrations of the specific p38 MAP kinase inhibitor SB 203580, and that MAPKAP kinase-2 is the only detectable SB 203580-sensitive CREB kinase in SK-N-MC cell extracts. We also show that transfection of RK/p38 MAP kinase in SK-N-MC cells, but not transfection of p44 MAP kinase, activates Gal4-CREB-dependent transcription via Ser133. These findings identify a new growth factor and stress-activated signaling pathway that regulates gene expression at the CRE. Images PMID:8887554

  5. Protein Kinases: Emerging Therapeutic Targets in Chronic Lymphocytic Leukemia

    PubMed Central

    Balakrishnan, Kumudha; Gandhi, Varsha

    2014-01-01

    Introduction Although protein kinases are primary targets for inhibition in hematological malignancies, until recently their contribution to chronic lymphocytic leukemia (CLL) was poorly understood. Insights into B cell receptor (BCR) signaling and its role in regulating key cellular functions have shed light on candidate protein kinases that are aberrantly activated in CLL. In this regard, protein kinases are now considered as potential drug targets in CLL. Area covered This review has covered signaling pathways and associated protein kinases in CLL and the kinase inhibitors currently available in preclinical and clinical investigations. Individual protein kinases that are abnormally active in CLL and the functional consequences of their inhibition are discussed. Expert opinion A growing body of evidence suggests that protein kinases are druggable targets for patients with CLL. The emergence of novel and bio-available kinase inhibitors and their promising clinical activity in CLL underscore the oncogenic role of kinases in leukemogenesis. Further investigations directed towards their role as single agents or in combinations may provide insight into understanding the substantial role of kinase mediated signal transduction pathways and their inhibition in B- CLL. PMID:22409342

  6. Mitogen activated protein kinase at the nuclear pore complex

    PubMed Central

    Faustino, Randolph S; Maddaford, Thane G; Pierce, Grant N

    2011-01-01

    Abstract Mitogen activated protein (MAP) kinases control eukaryotic proliferation, and import of kinases into the nucleus through the nuclear pore complex (NPC) can influence gene expression to affect cellular growth, cell viability and homeostatic function. The NPC is a critical regulatory checkpoint for nucleocytoplasmic traffic that regulates gene expression and cell growth, and MAP kinases may be physically associated with the NPC to modulate transport. In the present study, highly enriched NPC fractions were isolated and investigated for associated kinases and/or activity. Endogenous kinase activity was identified within the NPC fraction, which phosphorylated a 30 kD nuclear pore protein. Phosphomodification of this nucleoporin, here termed Nup30, was inhibited by apigenin and PD-98059, two MAP kinase antagonists as well as with SB-202190, a pharmacological blocker of p38. Furthermore, high throughput profiling of enriched NPCs revealed constitutive presence of all members of the MAP kinase family, extracellular regulated kinases (ERK), p38 and Jun N-terminal kinase. The NPC thus contains a spectrum of associated MAP kinases that suggests an intimate role for ERK and p38 in regulation of nuclear pore function. PMID:20497490

  7. Mechanism of inhibition of Raf-1 by protein kinase A.

    PubMed Central

    Häfner, S; Adler, H S; Mischak, H; Janosch, P; Heidecker, G; Wolfman, A; Pippig, S; Lohse, M; Ueffing, M; Kolch, W

    1994-01-01

    The cytoplasmic Raf-1 kinase is essential for mitogenic signalling by growth factors, which couple to tyrosine kinases, and by tumor-promoting phorbol esters such as 12-O-tetradecanoylphorbol-13-acetate, which activate protein kinase C (PKC). Signalling by the Raf-1 kinase can be blocked by activation of the cyclic AMP (cAMP)-dependent protein kinase A (PKA). The molecular mechanism of this inhibition is not precisely known but has been suggested to involve attenuation of Raf-1 binding to Ras. Using purified proteins, we show that in addition to weakening the interaction of Raf-1 with Ras, PKA can inhibit Raf-1 function directly via phosphorylation of the Raf-1 kinase domain. Phosphorylation by PKA interferes with the activation of Raf-1 by either PKC alpha or the tyrosine kinase Lck and even can downregulate the kinase activity of Raf-1 previously activated by PKC alpha or amino-terminal truncation. This type of inhibition can be dissociated from the ability of Raf-1 to associate with Ras, since (i) the isolated Raf-1 kinase domain, which lacks the Ras binding domain, is still susceptible to inhibition by PKA, (ii) phosphorylation of Raf-1 by PKC alpha alleviates the PKA-induced reduction of Ras binding but does not prevent the downregulation of Raf-1 kinase activity by PKA and (iii) cAMP agonists antagonize transformation by v-Raf, which is Ras independent. Images PMID:7935389

  8. Protein kinase A signalling in Schistosoma mansoni cercariae and schistosomules.

    PubMed

    Hirst, Natasha L; Lawton, Scott P; Walker, Anthony J

    2016-06-01

    Cyclic AMP (cAMP)-dependent protein kinase/protein kinase A regulates multiple processes in eukaryotes by phosphorylating diverse cellular substrates, including metabolic and signalling enzymes, ion channels and transcription factors. Here we provide insight into protein kinase A signalling in cercariae and 24h in vitro cultured somules of the blood parasite, Schistosoma mansoni, which causes human intestinal schistosomiasis. Functional mapping of activated protein kinase A using anti-phospho protein kinase A antibodies and confocal laser scanning microscopy revealed activated protein kinase A in the central and peripheral nervous system, oral-tip sensory papillae, oesophagus and excretory system of intact cercariae. Cultured 24h somules, which biologically represent the skin-resident stage of the parasite, exhibited similar activation patterns in oesophageal and nerve tissues but also displayed striking activation at the tegument and activation in a region resembling the germinal 'stem' cell cluster. The adenylyl cyclase activator, forskolin, stimulated somule protein kinase A activation and produced a hyperkinesia phenotype. The biogenic amines, serotonin and dopamine known to be present in skin also induced protein kinase A activation in somules, whereas neuropeptide Y or [Leu(31),Pro(34)]-neuropeptide Y attenuated protein kinase A activation. However, neuropeptide Y did not block the forskolin-induced somule hyperkinesia. Bioinformatic investigation of potential protein associations revealed 193 medium confidence and 59 high confidence protein kinase A interacting partners in S. mansoni, many of which possess putative protein kinase A phosphorylation sites. These data provide valuable insight into the intricacies of protein kinase A signalling in S. mansoni and a framework for further physiological investigations into the roles of protein kinase A in schistosomes, particularly in the context of interactions between the parasite and the host. PMID:26777870

  9. Mechanism of dual specificity kinase activity of DYRK1A.

    PubMed

    Walte, Agnes; Rüben, Katharina; Birner-Gruenberger, Ruth; Preisinger, Christian; Bamberg-Lemper, Simone; Hilz, Nikolaus; Bracher, Franz; Becker, Walter

    2013-09-01

    The function of many protein kinases is controlled by the phosphorylation of a critical tyrosine residue in the activation loop. Dual specificity tyrosine-phosphorylation-regulated kinases (DYRKs) autophosphorylate on this tyrosine residue but phosphorylate substrates on aliphatic amino acids. This study addresses the mechanism of dual specificity kinase activity in DYRK1A and related kinases. Tyrosine autophosphorylation of DYRK1A occurred rapidly during in vitro translation and did not depend on the non-catalytic domains or other proteins. Expression in bacteria as well as in mammalian cells revealed that tyrosine kinase activity of DYRK1A is not restricted to the co-translational autophosphorylation in the activation loop. Moreover, mature DYRK1A was still capable of tyrosine autophosphorylation. Point mutants of DYRK1A and DYRK2 lacking the activation loop tyrosine showed enhanced tyrosine kinase activity. A series of structurally diverse DYRK1A inhibitors was used to pharmacologically distinguish different conformational states of the catalytic domain that are hypothesized to account for the dual specificity kinase activity. All tested compounds inhibited substrate phosphorylation with higher potency than autophosphorylation but none of the tested inhibitors differentially inhibited threonine and tyrosine kinase activity. Finally, the related cyclin-dependent kinase-like kinases (CLKs), which lack the activation loop tyrosine, autophosphorylated on tyrosine both in vitro and in living cells. We propose a model of DYRK autoactivation in which tyrosine autophosphorylation in the activation loop stabilizes a conformation of the catalytic domain with enhanced serine/threonine kinase activity without disabling tyrosine phosphorylation. The mechanism of dual specificity kinase activity probably applies to related serine/threonine kinases that depend on tyrosine autophosphorylation for maturation. PMID:23809146

  10. Mitogen-Activated Protein Kinases and Mitogen Kinase Phosphatase 1: A Critical Interplay in Macrophage Biology

    PubMed Central

    Lloberas, Jorge; Valverde-Estrella, Lorena; Tur, Juan; Vico, Tania; Celada, Antonio

    2016-01-01

    Macrophages are necessary in multiple processes during the immune response or inflammation. This review emphasizes the critical role of the mitogen-activated protein kinases (MAPKs) and mitogen kinase phosphatase-1 (MKP-1) in the functional activities of macrophages. While the phosphorylation of MAPKs is required for macrophage activation or proliferation, MKP-1 dephosphorylates these kinases, thus playing a balancing role in the control of macrophage behavior. MKP-1 is a nuclear-localized dual-specificity phosphatase whose expression is regulated at multiple levels, including at the transcriptional and post-transcriptional level. The regulatory role of MKP-1 in the interplay between MAPK phosphorylation/dephosphorylation makes this molecule a critical regulator of macrophage biology and inflammation. PMID:27446931

  11. Netrin requires focal adhesion kinase and Src family kinases for axon outgrowth and attraction

    PubMed Central

    Liu, Guofa; Beggs, Hilary; Jürgensen, Claudia; Park, Hwan-Tae; Tang, Hao; Gorski, Jessica; Jones, Kevin R; Reichardt, Louis F; Wu, Jane; Rao, Yi

    2008-01-01

    Although netrins are an important family of neuronal guidance proteins, intracellular mechanisms that mediate netrin function are not well understood. Here we show that netrin-1 induces tyrosine phosphorylation of proteins including focal adhesion kinase (FAK) and the Src family kinase Fyn. Blockers of Src family kinases inhibited FAK phosphorylation and axon outgrowth and attraction by netrin. Dominant-negative FAK and Fyn mutants inhibited the attractive turning response to netrin. Axon outgrowth and attraction induced by netrin-1 were significantly reduced in neurons lacking the FAK gene. Our results show the biochemical and functional links between netrin, a prototypical neuronal guidance cue, and FAK, a central player in intracellular signaling that is crucial for cell migration. PMID:15494732

  12. Ribosomal S6 Kinase Cooperates with Casein Kinase 2 to Modulate the Drosophila Circadian Molecular Oscillator

    PubMed Central

    Akten, Bikem; Tangredi, Michelle M.; Jauch, Eike; Roberts, Mary A.; Ng, Fanny; Raabe, Thomas; Jackson, F. Rob

    2009-01-01

    There is a universal requirement for post-translational regulatory mechanisms in circadian clock systems. Previous work in Drosophila has identified several kinases, phosphatases and an E3 ligase that are critical for determining the nuclear translocation and/or stability of clock proteins. The present study evaluated the function of p90 ribosomal S6 kinase (RSK) in the Drosophila circadian system. In mammals, RSK1 is a light- and clock-regulated kinase known to be activated by the MAPK pathway, but there is no direct evidence that it functions as a component of the circadian system. Here, we show that Drosophila S6KII RNA displays rhythms in abundance, indicative of circadian control. Importantly, an S6KII null mutant exhibits a short-period circadian phenotype that can be rescued by expression of the wild-type gene in clock neurons, indicating a role for S6KII in the molecular oscillator. Peak PER clock protein expression is elevated in the mutant, indicative of enhanced stability, whereas per mRNA level is decreased, consistent with enhanced feedback repression. Gene reporter assays show that decreased S6KII is associated with increased PER repression. Surprisingly, we demonstrate a physical interaction between S6KII and the Casein Kinase 2 regulatory subunit (CK2β), suggesting a functional relationship between the two kinases. In support of such a relationship, there are genetic interactions between S6KII and CK2 mutations, in vivo, which indicate that CK2 activity is required for S6KII action. We propose that the two kinases cooperate within clock neurons to fine-tune circadian period, improving the precision of the clock mechanism. PMID:19144847

  13. Mitogen-activated protein kinase kinase kinase 1 (MAP3K1) integrates developmental signals for eyelid closure

    PubMed Central

    Geh, Esmond; Meng, Qinghang; Mongan, Maureen; Wang, Jingcai; Takatori, Atsushi; Zheng, Yi; Puga, Alvaro; Lang, Richard A.; Xia, Ying

    2011-01-01

    Developmental eyelid closure is an evolutionarily conserved morphogenetic event requiring proliferation, differentiation, cytoskeleton reorganization, and migration of epithelial cells at the tip of the developing eyelid. Many signaling events take place during eyelid closure, but how the signals converge to regulate the morphogenetic process remains an open and intriguing question. Here we show that mitogen-activated protein kinase kinase kinase 1 (MAP3K1) highly expressed in the developing eyelid epithelium, forms with c-Jun, a regulatory axis that orchestrates morphogenesis by integrating two different networks of eyelid closure signals. A TGF-α/EGFR-RhoA module initiates one of these networks by inducing c-Jun expression which, in a phosphorylation-independent manner, binds to the Map3k1 promoter and causes an increase in MAP3K1 expression. RhoA knockout in the ocular surface epithelium disturbs this network by decreasing MAP3K1 expression, and causes delayed eyelid closure in Map3k1 hemizygotes. The second network is initiated by the enzymatic activity of MAP3K1, which phosphorylates and activates a JNK-c-Jun module, leading to AP-1 transactivation and induction of its downstream genes, such as Pai-1. MAP3K1 inactivation reduces AP-1 activity and PAI-1 expression both in cells and developing eyelids. MAP3K1 is therefore the nexus of an intracrine regulatory loop connecting the TGF-α/EGFR/RhoA-c-Jun and JNK-c-Jun-AP-1 pathways in developmental eyelid closure. PMID:21969564

  14. The secret life of kinases: functions beyond catalysis

    PubMed Central

    2011-01-01

    Protein phosphorylation participates in the regulation of all fundamental biological processes, and protein kinases have been intensively studied. However, while the focus was on catalytic activities, accumulating evidence suggests that non-catalytic properties of protein kinases are essential, and in some cases even sufficient for their functions. These non-catalytic functions include the scaffolding of protein complexes, the competition for protein interactions, allosteric effects on other enzymes, subcellular targeting, and DNA binding. This rich repertoire often is used to coordinate phosphorylation events and enhance the specificity of substrate phosphorylation, but also can adopt functions that do not rely on kinase activity. Here, we discuss such kinase independent functions of protein and lipid kinases focussing on kinases that play a role in the regulation of cell proliferation, differentiation, apoptosis, and motility. PMID:22035226

  15. High quality, small molecule-activity datasets for kinase research.

    PubMed

    Sharma, Rajan; Schürer, Stephan C; Muskal, Steven M

    2016-01-01

    Kinases regulate cell growth, movement, and death. Deregulated kinase activity is a frequent cause of disease. The therapeutic potential of kinase inhibitors has led to large amounts of published structure activity relationship (SAR) data. Bioactivity databases such as the Kinase Knowledgebase (KKB), WOMBAT, GOSTAR, and ChEMBL provide researchers with quantitative data characterizing the activity of compounds across many biological assays. The KKB, for example, contains over 1.8M kinase structure-activity data points reported in peer-reviewed journals and patents. In the spirit of fostering methods development and validation worldwide, we have extracted and have made available from the KKB 258K structure activity data points and 76K associated unique chemical structures across eight kinase targets. These data are freely available for download within this data note. PMID:27429748

  16. An essential role of phosphatidylinositol 3-kinase in myogenic differentiation

    PubMed Central

    Jiang, Bing-Hua; Zheng, Jenny Z.; Vogt, Peter K.

    1998-01-01

    The oncogene p3k, coding for a constitutively active form of phosphatidylinositol 3-kinase (PI 3-kinase; EC 2.7.1.137), strongly enhances myogenic differentiation in cultures of chicken-embryo myoblasts. It increases the size of the myotubes and induces elevated levels of the muscle-specific proteins MyoD, myosin heavy chain, creatine kinase, and desmin. Inhibition of PI 3-kinase activity with LY294002 or with dominant-negative mutants of PI 3-kinase interferes with myogenic differentiation and with the induction of muscle-specific genes. PI 3-kinase is therefore an upstream mediator for the expression of the muscle-specific genes and is both necessary and rate-limiting for the process of myogenesis. PMID:9826674

  17. Kinase active Misshapen regulates Notch signaling in Drosophila melanogaster.

    PubMed

    Mishra, Abhinava K; Sachan, Nalani; Mutsuddi, Mousumi; Mukherjee, Ashim

    2015-11-15

    Notch signaling pathway represents a principal cellular communication system that plays a pivotal role during development of metazoans. Drosophila misshapen (msn) encodes a protein kinase, which is related to the budding yeast Ste20p (sterile 20 protein) kinase. In a genetic screen, using candidate gene approach to identify novel kinases involved in Notch signaling, we identified msn as a novel regulator of Notch signaling. Data presented here suggest that overexpression of kinase active form of Msn exhibits phenotypes similar to Notch loss-of-function condition and msn genetically interacts with components of Notch signaling pathway. Kinase active form of Msn associates with Notch receptor and regulate its signaling activity. We further show that kinase active Misshapen leads to accumulation of membrane-tethered form of Notch. Moreover, activated Msn also depletes Armadillo and DE-Cadherin from adherens junctions. Thus, this study provides a yet unknown mode of regulation of Notch signaling by Misshapen. PMID:26431585

  18. High quality, small molecule-activity datasets for kinase research

    PubMed Central

    Sharma, Rajan; Schürer, Stephan C.; Muskal, Steven M.

    2016-01-01

    Kinases regulate cell growth, movement, and death. Deregulated kinase activity is a frequent cause of disease. The therapeutic potential of kinase inhibitors has led to large amounts of published structure activity relationship (SAR) data. Bioactivity databases such as the Kinase Knowledgebase (KKB), WOMBAT, GOSTAR, and ChEMBL provide researchers with quantitative data characterizing the activity of compounds across many biological assays. The KKB, for example, contains over 1.8M kinase structure-activity data points reported in peer-reviewed journals and patents. In the spirit of fostering methods development and validation worldwide, we have extracted and have made available from the KKB 258K structure activity data points and 76K associated unique chemical structures across eight kinase targets. These data are freely available for download within this data note. PMID:27429748

  19. Bioorthogonal Chemical Activation of Kinases in Living Systems

    PubMed Central

    2016-01-01

    Selective manipulation of protein kinases under living conditions is highly desirable yet extremely challenging, particularly in a gain-of-function fashion. Here we employ our recently developed bioorthogonal cleavage reaction as a general strategy for intracellular activation of individual kinases. Site-specific incorporation of trans-cyclooctene-caged lysine in place of the conserved catalytic lysine, in conjunction with the cleavage partner dimethyl-tetrazine, allowed efficient lysine decaging with the kinase activity chemically rescued in living systems. PMID:27280167

  20. Plant protein kinase substrates identification using protein microarrays.

    PubMed

    Ma, Shisong; Dinesh-Kumar, Savithramma P

    2015-01-01

    Protein kinases regulate signaling pathways by phosphorylating their targets. They play critical roles in plant signaling networks. Although many important protein kinases have been identified in plants, their substrates are largely unknown. We have developed and produced plant protein microarrays with more than 15,000 purified plant proteins. Here, we describe a detailed protocol to use these microarrays to identify plant protein kinase substrates via in vitro phosphorylation assays on these arrays. PMID:25930701

  1. RAF protein-serine/threonine kinases: Structure and regulation

    SciTech Connect

    Roskoski, Robert

    2010-08-27

    Research highlights: {yields} The formation of unique side-to-side RAF dimers is required for full kinase activity. {yields} RAF kinase inhibitors block MEK activation in cells containing oncogenic B-RAF. {yields} RAF kinase inhibitors can lead to the paradoxical increase in RAF kinase activity. -- Abstract: A-RAF, B-RAF, and C-RAF are a family of three protein-serine/threonine kinases that participate in the RAS-RAF-MEK-ERK signal transduction cascade. This cascade participates in the regulation of a large variety of processes including apoptosis, cell cycle progression, differentiation, proliferation, and transformation to the cancerous state. RAS mutations occur in 15-30% of all human cancers, and B-RAF mutations occur in 30-60% of melanomas, 30-50% of thyroid cancers, and 5-20% of colorectal cancers. Activation of the RAF kinases requires their interaction with RAS-GTP along with dephosphorylation and also phosphorylation by SRC family protein-tyrosine kinases and other protein-serine/threonine kinases. The formation of unique side-to-side RAF dimers is required for full kinase activity. RAF kinase inhibitors are effective in blocking MEK1/2 and ERK1/2 activation in cells containing the oncogenic B-RAF Val600Glu activating mutation. RAF kinase inhibitors lead to the paradoxical increase in RAF kinase activity in cells containing wild-type B-RAF and wild-type or activated mutant RAS. C-RAF plays a key role in this paradoxical increase in downstream MEK-ERK activation.

  2. Discovery of a Potent And Selective Aurora Kinase Inhibitor

    SciTech Connect

    Oslob, J.D.; Romanowski, M.J.; Allen, D.A.; Baskaran, S.; Bui, M.; Elling, R.A.; Flanagan, W.M.; Fung, A.D.; Hanan, E.J.; Harris, S.; Heumann, S.A.; Hoch, U.; Jacobs, J.W.; Lam, J.; Lawrence, C.E.; McDowell, R.S.; Nannini, M.A.; Shen, W.; Silverman, J.A.; Sopko, M.M.; Tangonan, B.T.

    2009-05-21

    This communication describes the discovery of a novel series of Aurora kinase inhibitors. Key SAR and critical binding elements are discussed. Some of the more advanced analogues potently inhibit cellular proliferation and induce phenotypes consistent with Aurora kinase inhibition. In particular, compound 21 (SNS-314) is a potent and selective Aurora kinase inhibitor that exhibits significant activity in pre-clinical in vivo tumor models.

  3. Protein kinases are potential targets to treat inflammatory bowel disease

    PubMed Central

    Yang, Lei; Yan, Yutao

    2014-01-01

    Protein kinases play a crucial role in the pathogenesis of inflammatory bowel disease (IBD), the two main forms of which are ulcerative colitis and Crohn’s disease. In this article, we will review the mechanisms of involvement of protein kinases in the pathogenesis of and intervention against IBD, in terms of their effects on genetics, microbiota, mucous layer and tight junction, and the potential of protein kinases as therapeutic targets against IBD. PMID:25374761

  4. Phosphatidylinositol 3-kinase is required for integrin-stimulated AKT and Raf-1/mitogen-activated protein kinase pathway activation.

    PubMed Central

    King, W G; Mattaliano, M D; Chan, T O; Tsichlis, P N; Brugge, J S

    1997-01-01

    Cell attachment to fibronectin stimulates the integrin-dependent interaction of p85-associated phosphatidylinositol (PI) 3-kinase with integrin-dependent focal adhesion kinase (FAK) as well as activation of the Ras/mitogen-activated protein (MAP) kinase pathway. However, it is not known if this PI 3-kinase-FAK interaction increases the synthesis of the 3-phosphorylated phosphoinositides (3-PPIs) or what role, if any, is played by activated PI 3-kinase in integrin signaling. We demonstrate here the integrin-dependent accumulation of the PI 3-kinase products, PI 3,4-bisphosphate [PI(3,4)P2] and PI(3,4,5)P3, as well as activation of AKT kinase, a serine/threonine kinase that can be stimulated by binding of PI(3,4)P2. The PI 3-kinase inhibitors wortmannin and LY294002 significantly decreased the integrin-induced accumulation of the 3-PPIs and activation of AKT kinase, without having significant effects on the levels of PI(4,5)P2 or tyrosine phosphorylation of paxillin. These inhibitors also reduced cell adhesion/spreading onto fibronectin but had no effect on attachment to polylysine. Interestingly, integrin-mediated Erk-2, Mek-1, and Raf-1 activation, but not Ras-GTP loading, was inhibited at least 80% by wortmannin and LY294002. In support of the pharmacologic results, fibronectin activation of Erk-2 and AKT kinases was completely inhibited by overexpression of a dominant interfering p85 subunit of PI 3-kinase. We conclude that integrin-mediated adhesion to fibronectin results in the accumulation of the PI 3-kinase products PI(3,4)P2 and PI(3,4,5)P3 as well as the PI 3-kinase-dependent activation of the kinases Raf-1, Mek-1, Erk-2, and AKT and that PI 3-kinase may function upstream of Raf-1 but downstream of Ras in integrin activation of Erk-2 MAP and AKT kinases. PMID:9234699

  5. Pyruvate kinase M2 at a glance

    PubMed Central

    Yang, Weiwei; Lu, Zhimin

    2015-01-01

    Reprogrammed metabolism is a key feature of cancer cells. The pyruvate kinase M2 (PKM2) isoform, which is commonly upregulated in many human cancers, has been recently shown to play a crucial role in metabolism reprogramming, gene transcription and cell cycle progression. In this Cell Science at a glance article and accompanying poster, we provide a brief overview of recent advances in understanding the mechanisms underlying the regulation of PKM2 expression, enzymatic activity, metabolic functions and subcellular location. We highlight the instrumental role of the non-metabolic functions of PKM2 in tumorigenesis and evaluate the potential to target PKM2 for cancer treatment. PMID:25770102

  6. Myopathy and parkinsonism in phosphoglycerate kinase deficiency.

    PubMed

    Sotiriou, Evangelia; Greene, Paul; Krishna, Sindu; Hirano, Michio; DiMauro, Salvatore

    2010-05-01

    A 25-year-old man with exertional myoglobinuria had no evidence of hemolytic anemia, but he had severe parkinsonism that was responsive to levodopa. Phosphoglycerate kinase (PGK) activity was markedly decreased in muscle, and molecular analysis of the PGK1 gene identified the p.T378P mutation that was recently reported in a patient with isolated myopathy. This case reinforces the concept that PGK deficiency is a clinically heterogeneous disorder and raises the question of a relationship between PGK deficiency and idiopathic juvenile Parkinson disease. PMID:20151463

  7. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    SciTech Connect

    Knecht, Wolfgang; Mikkelsen, Nils Egil; Clausen, Anders Ranegaard; Willer, Mette; Gojkovic, Zoran

    2009-05-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 A resolution structure of Dm-dNK in complex with gemcitabine shows that the residues Tyr70 and Arg105 play a crucial role in the firm positioning of gemcitabine by extra interactions made by the fluoride atoms. This explains why gemcitabine is a good substrate for Dm-dNK.

  8. Structural and mechanistic insights into Mps1 kinase activation

    SciTech Connect

    Wang, Wei; Yang, Yuting; Gao, Yuefeng; Xu, Quanbin; Wang, Feng; Zhu, Songcheng; Old, William; Resing, Katheryn; Ahn, Natalie; Lei, Ming; Liu, Xuedong

    2010-11-05

    Mps1 is one of the several essential kinases whose activation is required for robust mitotic spindle checkpoint signalling. The activity of Mps1 is tightly regulated and increases dramatically during mitosis or in response to spindle damage. To understand the molecular mechanism underlying Mps1 regulation, we determined the crystal structure of the kinase domain of Mps1. The 2.7-{angstrom}-resolution crystal structure shows that the Mps1 kinase domain adopts a unique inactive conformation. Intramolecular interactions between the key Glu residue in the {alpha}C helix of the N-terminal lobe and the backbone amides in the catalytic loop lock the kinase in the inactive conformation. Autophosphorylation appears to be a priming event for kinase activation. We identified Mps1 autophosphorylation sites in the activation and the P+1 loops. Whereas activation loop autophosphorylation enhances kinase activity, autophosphorylation at the P+1 loop (T686) is associated with the active kinase. Mutation of T686 autophosphorylation site impairs both autophosphorylation and transphosphorylation. Furthermore, we demonstrated that phosphorylation of T676 may be a priming event for phosphorylation at T686. Finally, we identified two critical lysine residues in the loop between helices {alpha}EF and {alpha}F that are essential for substrate recruitment and maintaining high levels of kinase activity. Our studies reveal critical biochemical mechanisms for Mps1 kinase regulation.

  9. In Vitro Characterization of Derrone as an Aurora Kinase Inhibitor.

    PubMed

    Hoang, Nhung Thi My; Phuong, Thuong Thien; Nguyen, Trang Thi Nhu; Tran, Yen Thi Hai; Nguyen, Anh Thi Ngoc; Nguyen, Thanh Lai; Bui, Khanh Thi Van

    2016-06-01

    Among mitotic kinases, Aurora kinases are the most widely studied, since their expression is restricted to mitosis. They play a key role in chromosome segregation and cell polyploidy. Aurora kinases are important therapeutic targets, and several research groups have directed their efforts toward the identification of kinase inhibitors. The aim of this study is to screen and characterize Aurora kinase inhibitors from natural substances extracted from plants that are used in the Vietnamese pharmacopoeia. We have characterized in vitro Derrone, extracted from Erythrina orientalis L. MURR, as a novel Aurora kinase inhibitor. This compound exhibited an ability to inhibit the phosphorylation of histone H3 at ser10 both in kinase assay and at the cellular level. The compound was more effective against Aurora kinase B, with a lower IC50 value as compared to Aurora A. Moreover, it impaired the mitotic spindle checkpoint and led to endoreduplication in cancer cells, a phenomenon caused by an Aurora B inhibitor. Interestingly, using the xCelligence system and real-time cell analysis (RTCA) software, we set up a comparison of cell proliferation profiles between cancer cells treated with Derrone and VX680-a well-known Aurora kinase inhibitor-and we found that these profiles exhibited considerable similarity in cell morphology, growth, and death. Additionally, Derrone significantly inhibited the formation and growth of MCF7 tumor spheroids. PMID:26983907

  10. Cytoskeletal protein kinases: titin and its relations in mechanosensing.

    PubMed

    Gautel, Mathias

    2011-07-01

    Titin, the giant elastic ruler protein of striated muscle sarcomeres, contains a catalytic kinase domain related to a family of intrasterically regulated protein kinases. The most extensively studied member of this branch of the human kinome is the Ca(2+)-calmodulin (CaM)-regulated myosin light-chain kinases (MLCK). However, not all kinases of the MLCK branch are functional MLCKs, and about half lack a CaM binding site in their C-terminal autoinhibitory tail (AI). A unifying feature is their association with the cytoskeleton, mostly via actin and myosin filaments. Titin kinase, similar to its invertebrate analogue twitchin kinase and likely other "MLCKs", is not Ca(2+)-calmodulin-activated. Recently, local protein unfolding of the C-terminal AI has emerged as a common mechanism in the activation of CaM kinases. Single-molecule data suggested that opening of the TK active site could also be achieved by mechanical unfolding of the AI. Mechanical modulation of catalytic activity might thus allow cytoskeletal signalling proteins to act as mechanosensors, creating feedback mechanisms between cytoskeletal tension and tension generation or cellular remodelling. Similar to other MLCK-like kinases like DRAK2 and DAPK1, TK is linked to protein turnover regulation via the autophagy/lysosomal system, suggesting the MLCK-like kinases have common functions beyond contraction regulation. PMID:21416260

  11. Diversity, classification and function of the plant protein kinase superfamily

    PubMed Central

    Lehti-Shiu, Melissa D.; Shiu, Shin-Han

    2012-01-01

    Eukaryotic protein kinases belong to a large superfamily with hundreds to thousands of copies and are components of essentially all cellular functions. The goals of this study are to classify protein kinases from 25 plant species and to assess their evolutionary history in conjunction with consideration of their molecular functions. The protein kinase superfamily has expanded in the flowering plant lineage, in part through recent duplications. As a result, the flowering plant protein kinase repertoire, or kinome, is in general significantly larger than other eukaryotes, ranging in size from 600 to 2500 members. This large variation in kinome size is mainly due to the expansion and contraction of a few families, particularly the receptor-like kinase/Pelle family. A number of protein kinases reside in highly conserved, low copy number families and often play broadly conserved regulatory roles in metabolism and cell division, although functions of plant homologues have often diverged from their metazoan counterparts. Members of expanded plant kinase families often have roles in plant-specific processes and some may have contributed to adaptive evolution. Nonetheless, non-adaptive explanations, such as kinase duplicate subfunctionalization and insufficient time for pseudogenization, may also contribute to the large number of seemingly functional protein kinases in plants. PMID:22889912

  12. Gene looping facilitates TFIIH kinase-mediated termination of transcription

    PubMed Central

    Medler, Scott; Ansari, Athar

    2015-01-01

    TFIIH is a general transcription factor with kinase and helicase activities. The kinase activity resides in the Kin28 subunit of TFIIH. The role of Kin28 kinase in the early steps of transcription is well established. Here we report a novel role of Kin28 in the termination of transcription. We show that RNAPII reads through a termination signal upon kinase inhibition. Furthermore, the recruitment of termination factors towards the 3′ end of a gene was compromised in the kinase mutant, thus confirming the termination defect. A concomitant decrease in crosslinking of termination factors near the 5′ end of genes was also observed in the kinase-defective mutant. Simultaneous presence of termination factors towards both the ends of a gene is indicative of gene looping; while the loss of termination factor occupancy from the distal ends suggest the abolition of a looped gene conformation. Accordingly, CCC analysis revealed that the looped architecture of genes was severely compromised in the Kin28 kinase mutant. In a looping defective sua7-1 mutant, even the enzymatically active Kin28 kinase could not rescue the termination defect. These results strongly suggest a crucial role of Kin28 kinase-dependent gene looping in the termination of transcription in budding yeast. PMID:26286112

  13. 21 CFR 862.1650 - Pyruvate kinase test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862... to pyruvate kinase deficiency or of acute leukemias. (b) Classification. Class I (general...

  14. 21 CFR 862.1650 - Pyruvate kinase test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862... to pyruvate kinase deficiency or of acute leukemias. (b) Classification. Class I (general...

  15. 21 CFR 862.1650 - Pyruvate kinase test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862... to pyruvate kinase deficiency or of acute leukemias. (b) Classification. Class I (general...

  16. 21 CFR 862.1650 - Pyruvate kinase test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862... to pyruvate kinase deficiency or of acute leukemias. (b) Classification. Class I (general...

  17. Liver specific pyruvate kinase in pheasants Phasianus colchicus.

    PubMed

    Guderley, H; Jacques, L

    1987-01-01

    While in chickens, the existence of a liver form of pyruvate kinase is controversial, the liver form of pyruvate kinase in pheasants, murres and puffins is electrophoretically distinct from that in muscle, brain, kidney, lung and small intestine. Although the forms in lungs, muscle, heart, brain and small intestine could not be reliably separated by electrophoresis, the functional characteristics of the lung and muscle forms of pyruvate kinase in the pheasant are distinct and can be classified as K and M isozymes respectively. Our data suggest that these birds possess at least three distinct isozymes of pyruvate kinase. PMID:3609446

  18. Tyrosine Kinase Inhibition: An Approach to Drug Development

    NASA Astrophysics Data System (ADS)

    Levitzki, Alexander; Gazit, Aviv

    1995-03-01

    Protein tyrosine kinases (PTKs) regulate cell proliferation, cell differentiation, and signaling processes in the cells of the immune system. Uncontrolled signaling from receptor tyrosine kinases and intracellular tyrosine kinases can lead to inflammatory responses and to diseases such as cancer, atherosclerosis, and psoriasis. Thus, inhibitors that block the activity of tyrosine kinases and the signaling pathways they activate may provide a useful basis for drug development. This article summarizes recent progress in the development of PTK inhibitors and demonstrates their potential use in the treatment of disease.

  19. Nuclear localization of Lyn tyrosine kinase mediated by inhibition of its kinase activity

    SciTech Connect

    Ikeda, Kikuko; Nakayama, Yuji; Togashi, Yuuki; Obata, Yuuki; Kuga, Takahisa; Kasahara, Kousuke; Fukumoto, Yasunori; Yamaguchi, Naoto

    2008-11-01

    Src-family kinases, cytoplasmic enzymes that participate in various signaling events, are found at not only the plasma membrane but also subcellular compartments, such as the nucleus, the Golgi apparatus and late endosomes/lysosomes. Lyn, a member of the Src-family kinases, is known to play a role in DNA damage response and cell cycle control in the nucleus. However, it is still unclear how the localization of Lyn to the nucleus is regulated. Here, we investigated the mechanism of the distribution of Lyn between the cytoplasm and the nucleus in epitheloid HeLa cells and hematopoietic THP-1 cells. Lyn was definitely detected in purified nuclei by immunofluorescence and immunoblotting analyses. Nuclear accumulation of Lyn was enhanced upon treatment of cells with leptomycin B (LMB), an inhibitor of Crm1-mediated nuclear export. Moreover, Lyn mutants lacking the sites for lipid modification were highly accumulated in the nucleus upon LMB treatment. Intriguingly, inhibition of the kinase activity of Lyn by SU6656, Csk overexpression, or point mutation in the ATP-binding site induced an increase in nuclear Lyn levels. These results suggest that Lyn being imported into and rapidly exported from the nucleus preferentially accumulates in the nucleus by inhibition of the kinase activity and lipid modification.

  20. Some implications of receptor kinase signaling pathway for development of multitargeted kinase inhibitors.

    PubMed

    Mitrasinovic, Petar M

    2013-03-01

    Epidermal growth factor receptors (EGFRs) belong to the ErbB family of receptor tyrosine kinases (TKs). Based on the role of EGFR signaling pathway in malignant progression of various types of tumors, a growing interest in the use of EGFR-TK inhibitors as probes for molecular imaging of EGFR-overexpressing tumors via positron emission tomography (PET) and single photon emission computed tomography (SPECT) is being notable. On one side, such noninvasive and repetitive monitoring of the activity of EGFR at the kinase level is intended to provide a direct measure of EGFR occupancy and inhibition by EGFR-targeting drugs. On the other side, all oncologic imaging tracers are molecularly targeted radiopharmaceuticals, which are strongly dependent on the tumor biochemistry including increased metabolism, hyperproliferation, angiogenesis, hypoxia, apoptosis, and specific tumor biomarkers (tumor specific antigens and tumor-specific receptors). The present article is an attempt to reconcile these two vital standpoints influencing the choice of appropriate radiolabeled agents for PET and SPECT imaging aimed to support the development of a new generation of multi-targeted kinase inhibitors in the time ahead, because the routine accomplishment of drug selectivity for particular protein kinases is a substantial challenge. PMID:23278847

  1. Glycogen Synthase Kinase 3β Interaction Protein Functions as an A-kinase Anchoring Protein*

    PubMed Central

    Hundsrucker, Christian; Skroblin, Philipp; Christian, Frank; Zenn, Hans-Michael; Popara, Viola; Joshi, Mangesh; Eichhorst, Jenny; Wiesner, Burkhard; Herberg, Friedrich W.; Reif, Bernd; Rosenthal, Walter; Klussmann, Enno

    2010-01-01

    A-kinase anchoring proteins (AKAPs) include a family of scaffolding proteins that target protein kinase A (PKA) and other signaling proteins to cellular compartments and thereby confine the activities of the associated proteins to distinct regions within cells. AKAPs bind PKA directly. The interaction is mediated by the dimerization and docking domain of regulatory subunits of PKA and the PKA-binding domain of AKAPs. Analysis of the interactions between the dimerization and docking domain and various PKA-binding domains yielded a generalized motif allowing the identification of AKAPs. Our bioinformatics and peptide array screening approaches based on this signature motif identified GSKIP (glycogen synthase kinase 3β interaction protein) as an AKAP. GSKIP directly interacts with PKA and GSK3β (glycogen synthase kinase 3β). It is widely expressed and facilitates phosphorylation and thus inactivation of GSK3β by PKA. GSKIP contains the evolutionarily conserved domain of unknown function 727. We show here that this domain of GSKIP and its vertebrate orthologues binds both PKA and GSK3β and thereby provides a mechanism for the integration of PKA and GSK3β signaling pathways. PMID:20007971

  2. Protein kinase Cδ regulates vaccinia-related kinase 1 in DNA damage–induced apoptosis

    PubMed Central

    Park, Choon-Ho; Choi, Bo-Hwa; Jeong, Min-Woo; Kim, Sangjune; Kim, Wanil; Song, Yun Seon; Kim, Kyong-Tai

    2011-01-01

    Vaccinia-related kinase 1 (VRK1) is a novel serine/threonine kinase that plays an important role in cell proliferation. However, little is known about the upstream regulators of VRK1 activity. Here we provide evidence for a role of protein kinase Cδ (PKCδ) in the regulation of murine VRK1. We show that PKCδ interacts with VRK1, phosphorylates the Ser-355 residue in the putative regulatory region, and negatively regulates its kinase activity in vitro. Intriguingly, PKCδ-induced cell death was facilitated by phosphorylation of VRK1 when cells were exposed to a DNA-damaging agent. In addition, p53 played a critical role in the regulation of DNA damage–induced cell death accompanied by PKCδ-mediated modulation of VRK1. In p53-deficient cells, PKCδ-mediated phosphorylation of VRK1 had no effect on cell viability. However, cells overexpressing p53 exhibited significant reduction of cell viability when cotransfected with both VRK1 and PKCδ. Taken together, these results indicate that PKCδ regulates phosphorylation and down-regulation of VRK1, thereby contributing to cell cycle arrest and apoptotic cell death in a p53-dependent manner. PMID:21346188

  3. The early evolution of the phosphagen kinases--insights from choanoflagellate and poriferan arginine kinases.

    PubMed

    Conejo, Maria; Bertin, Matt; Pomponi, Shirley A; Ellington, W Ross

    2008-01-01

    Arginine kinase (AK) is a member of a large family of phosphoryl transfer enzymes called phosphagen (guanidino) kinases. AKs are present in certain protozoans, sponges, cnidarians, and both lophotrochozoan and ecdysozoan protostomes. Another phosphagen kinase, creatine kinase (CK), is found in sponges, cnidarians, and both deuterostome and protostome groups but does not appear to be present in protozoans. To probe the early evolution of phosphagen kinases, we have amplified the cDNAs for AKs from three choanoflagellates and from the hexactinellid sponge Aphrocallistes beatrix and the demosponges Suberites fuscus and Microciona prolifera. Phylogenetic analysis using maximum likelihood of these choanoflagellate and sponge AKs with other AK sequences revealed that the AK from the choanoflagellate Monosiga brevicollis clusters with the AK from the glass sponge Aphrocallistes and is part of a larger cluster containing AKs from the demosponges Suberites and Microciona as well as basal and protostome invertebrates. In contrast, AKs from Codonosiga gracilis and Monosiga ovata form a distinct cluster apart from all other AK sequences. tBLASTn searches of the recently released M. brevicollis genome database showed that this species has three unique AK genes-one virtually identical to the M. brevicollis cDNA and the other two showing great similarity to C. gracilis and M. ovata AKs. Three distinct AK genes are likely present in choanoflagellates. Two of these AKs display extensive similarity to both CKs and an AK from sponges. Previous work has shown CK evolved from an AK-like ancestor prior to the divergence of sponges. The present results provide evidence suggesting that the initial gene duplication event(s) leading to the CK lineage may have occurred before the divergence of the choanoflagellate and animal lineages. PMID:18064398

  4. Protein-tyrosine phosphorylation interaction network in Bacillus subtilis reveals new substrates, kinase activators and kinase cross-talk

    PubMed Central

    Shi, Lei; Pigeonneau, Nathalie; Ventroux, Magali; Derouiche, Abderahmane; Bidnenko, Vladimir; Mijakovic, Ivan; Noirot-Gros, Marie-Françoise

    2014-01-01

    Signal transduction in eukaryotes is generally transmitted through phosphorylation cascades that involve a complex interplay of transmembrane receptors, protein kinases, phosphatases and their targets. Our previous work indicated that bacterial protein-tyrosine kinases and phosphatases may exhibit similar properties, since they act on many different substrates. To capture the complexity of this phosphorylation-based network, we performed a comprehensive interactome study focused on the protein-tyrosine kinases and phosphatases in the model bacterium Bacillus subtilis. The resulting network identified many potential new substrates of kinases and phosphatases, some of which were experimentally validated. Our study highlighted the role of tyrosine and serine/threonine kinases and phosphatases in DNA metabolism, transcriptional control and cell division. This interaction network reveals significant crosstalk among different classes of kinases. We found that tyrosine kinases can bind to several modulators, transmembrane or cytosolic, consistent with a branching of signaling pathways. Most particularly, we found that the division site regulator MinD can form a complex with the tyrosine kinase PtkA and modulate its activity in vitro. In vivo, it acts as a scaffold protein which anchors the kinase at the cell pole. This network highlighted a role of tyrosine phosphorylation in the spatial regulation of the Z-ring during cytokinesis. PMID:25374563

  5. Structures of human Bruton's tyrosine kinase in active and inactive conformations suggest a mechanism of activation for TEC family kinases

    SciTech Connect

    Marcotte, Douglas J.; Liu, Yu-Ting; Arduini, Robert M.; Hession, Catherine A.; Miatkowski, Konrad; Wildes, Craig P.; Cullen, Patrick F.; Hong, Victor; Hopkins, Brian T.; Mertsching, Elisabeth; Jenkins, Tracy J.; Romanowski, Michael J.; Baker, Darren P.; Silvian, Laura F.

    2010-11-15

    Bruton's tyrosine kinase (BTK), a member of the TEC family of kinases, plays a crucial role in B-cell maturation and mast cell activation. Although the structures of the unphosphorylated mouse BTK kinase domain and the unphosphorylated and phosphorylated kinase domains of human ITK are known, understanding the kinase selectivity profiles of BTK inhibitors has been hampered by the lack of availability of a high resolution, ligand-bound BTK structure. Here, we report the crystal structures of the human BTK kinase domain bound to either Dasatinib (BMS-354825) at 1.9 {angstrom} resolution or to 4-amino-5-(4-phenoxyphenyl)-7H-pyrrolospyrimidin- 7-yl-cyclopentane at 1.6 {angstrom} resolution. This data provides information relevant to the development of small molecule inhibitors targeting BTK and the TEC family of nonreceptor tyrosine kinases. Analysis of the structural differences between the TEC and Src families of kinases near the Trp-Glu-Ile motif in the N-terminal region of the kinase domain suggests a mechanism of regulation of the TEC family members.

  6. Rho-associated kinase, a novel serine/threonine kinase, as a putative target for small GTP binding protein Rho.

    PubMed Central

    Matsui, T; Amano, M; Yamamoto, T; Chihara, K; Nakafuku, M; Ito, M; Nakano, T; Okawa, K; Iwamatsu, A; Kaibuchi, K

    1996-01-01

    The small GTP binding protein Rho is implicated in cytoskeletal responses to extracellular signals such as lysophosphatidic acid to form stress fibers and focal contacts. Here we have purified a Rho-interacting protein with a molecular mass of approximately 164 kDa (p164) from bovine brain. This protein bound to GTPgammaS (a non-hydrolyzable GTP analog).RhoA but not to GDP.RhoA or GTPgammaS.RhoA with a mutation in the effector domain (RhoAA37).p164 had a kinase activity which was specifically stimulated by GTPgammaS.RhoA. We obtained the cDNA encoding p164 on the basis of its partial amino acid sequences and named it Rho-associated kinase (Rho-kinase). Rho-kinase has a catalytic domain in the N-terminal portion, a coiled coil domain in the middle portion and a zinc finger-like motif in the C-terminal portion. The catalytic domain shares 72% sequence homology with that of myotonic dystrophy kinase and the coiled coil domain contains a Rho-interacting interface. When COS7 cells were cotransfected with Rho-kinase and activated RhoA, some Rho-kinase was recruited to membranes. Thus it is likely that Rho-kinase is a putative target serine/threonine kinase for Rho and serves as a mediator of the Rho-dependent signaling pathway. Images PMID:8641286

  7. Virtual Target Screening: Validation Using Kinase Inhibitors

    PubMed Central

    Santiago, Daniel N.; Pevzner, Yuri; Durand, Ashley A.; Tran, MinhPhuong; Scheerer, Rachel R.; Daniel, Kenyon; Sung, Shen-Shu; Woodcock, H. Lee; Guida, Wayne C.; Brooks, Wesley H.

    2012-01-01

    Computational methods involving virtual screening could potentially be employed to discover new biomolecular targets for an individual molecule of interest (MOI). However, existing scoring functions may not accurately differentiate proteins to which the MOI binds from a larger set of macromolecules in a protein structural database. An MOI will most likely have varying degrees of predicted binding affinities to many protein targets. However, correctly interpreting a docking score as a hit for the MOI docked to any individual protein can be problematic. In our method, which we term “Virtual Target Screening (VTS)”, a set of small drug-like molecules are docked against each structure in the protein library to produce benchmark statistics. This calibration provides a reference for each protein so that hits can be identified for an MOI. VTS can then be used as tool for: drug repositioning (repurposing), specificity and toxicity testing, identifying potential metabolites, probing protein structures for allosteric sites, and testing focused libraries (collection of MOIs with similar chemotypes) for selectivity. To validate our VTS method, twenty kinase inhibitors were docked to a collection of calibrated protein structures. Here we report our results where VTS predicted protein kinases as hits in preference to other proteins in our database. Concurrently, a graphical interface for VTS was developed. PMID:22747098

  8. Mechanism of Focal Adhesion Kinase Mechanosensing.

    PubMed

    Zhou, Jing; Aponte-Santamaría, Camilo; Sturm, Sebastian; Bullerjahn, Jakob Tómas; Bronowska, Agnieszka; Gräter, Frauke

    2015-11-01

    Mechanosensing at focal adhesions regulates vital cellular processes. Here, we present results from molecular dynamics (MD) and mechano-biochemical network simulations that suggest a direct role of Focal Adhesion Kinase (FAK) as a mechano-sensor. Tensile forces, propagating from the membrane through the PIP2 binding site of the FERM domain and from the cytoskeleton-anchored FAT domain, activate FAK by unlocking its central phosphorylation site (Tyr576/577) from the autoinhibitory FERM domain. Varying loading rates, pulling directions, and membrane PIP2 concentrations corroborate the specific opening of the FERM-kinase domain interface, due to its remarkably lower mechanical stability compared to the individual alpha-helical domains and the PIP2-FERM link. Analyzing downstream signaling networks provides further evidence for an intrinsic mechano-signaling role of FAK in broadcasting force signals through Ras to the nucleus. This distinguishes FAK from hitherto identified focal adhesion mechano-responsive molecules, allowing a new interpretation of cell stretching experiments. PMID:26544178

  9. Targeting Axl and Mer kinases in cancer.

    PubMed

    Verma, Anupam; Warner, Steven L; Vankayalapati, Hariprasad; Bearss, David J; Sharma, Sunil

    2011-10-01

    Receptor tyrosine kinases (RTK) are cell-surface transmembrane receptors that contain regulated kinase activity within their cytoplasmic domain and play an important role in signal transduction in both normal and malignant cells. The mammalian TAM RTK family includes 3 closely related members: Tyro-3, Axl, and Mer. Overexpression or ectopic expression of the TAM receptors has been detected in a wide array of human cancers. Growth arrest-specific gene 6 has been identified as the major ligand for these TAM RTKs, and its binding to the receptors has been shown to promote proliferation and survival of cancer cells in vitro. Abnormal expression and activation of Axl or Mer can provide a survival advantage for certain cancer cells. Inhibition of Axl and Mer may enhance the sensitivity of cancer cells to cytotoxic agents and would potentially be a therapeutic strategy to target cancer cells. This review elucidates the role of Axl and Mer in normal cellular function and their role in oncogenesis. In addition, we review the potential to inhibit these RTKs for the development of therapeutic targets in treatment of cancer. PMID:21933973

  10. Targeting the Pim kinases in multiple myeloma

    PubMed Central

    Keane, N A; Reidy, M; Natoni, A; Raab, M S; O'Dwyer, M

    2015-01-01

    Multiple myeloma (MM) is a plasma cell malignancy that remains incurable. Novel treatment strategies to improve survival are urgently required. The Pims are a small family of serine/threonine kinases with increased expression across the hematological malignancies. Pim-2 shows highest expression in MM and constitutes a promising therapeutic target. It is upregulated by the bone marrow microenvironment to mediate proliferation and promote MM survival. Pim-2 also has a key role in the bone destruction typically seen in MM. Additional putative roles of the Pim kinases in MM include trafficking of malignant cells, promoting oncogenic signaling in the hypoxic bone marrow microenvironment and mediating resistance to therapy. A number of Pim inhibitors are now under development with lead compounds entering the clinic. The ATP-competitive Pim inhibitor LGH447 has recently been reported to have single agent activity in MM. It is anticipated that Pim inhibition will be of clinical benefit in combination with standard treatments and/or with novel drugs targeting other survival pathways in MM. PMID:26186558

  11. Mechanism of Focal Adhesion Kinase Mechanosensing

    PubMed Central

    Sturm, Sebastian; Bullerjahn, Jakob Tómas; Bronowska, Agnieszka; Gräter, Frauke

    2015-01-01

    Mechanosensing at focal adhesions regulates vital cellular processes. Here, we present results from molecular dynamics (MD) and mechano-biochemical network simulations that suggest a direct role of Focal Adhesion Kinase (FAK) as a mechano-sensor. Tensile forces, propagating from the membrane through the PIP2 binding site of the FERM domain and from the cytoskeleton-anchored FAT domain, activate FAK by unlocking its central phosphorylation site (Tyr576/577) from the autoinhibitory FERM domain. Varying loading rates, pulling directions, and membrane PIP2 concentrations corroborate the specific opening of the FERM-kinase domain interface, due to its remarkably lower mechanical stability compared to the individual alpha-helical domains and the PIP2-FERM link. Analyzing downstream signaling networks provides further evidence for an intrinsic mechano-signaling role of FAK in broadcasting force signals through Ras to the nucleus. This distinguishes FAK from hitherto identified focal adhesion mechano-responsive molecules, allowing a new interpretation of cell stretching experiments. PMID:26544178

  12. Mechanism of regulation of receptor histidine kinases.

    PubMed

    Ferris, Hedda U; Dunin-Horkawicz, Stanislaw; Hornig, Nora; Hulko, Michael; Martin, Jörg; Schultz, Joachim E; Zeth, Kornelius; Lupas, Andrei N; Coles, Murray

    2012-01-11

    Bacterial transmembrane receptors regulate an intracellular catalytic output in response to extracellular sensory input. To investigate the conformational changes that relay the regulatory signal, we have studied the HAMP domain, a ubiquitous intracellular module connecting input to output domains. HAMP forms a parallel, dimeric, four-helical coiled coil, and rational substitutions in our model domain (Af1503 HAMP) induce a transition in its interhelical packing, characterized by axial rotation of all four helices (the gearbox signaling model). We now illustrate how these conformational changes are propagated to a downstream domain by fusing Af1503 HAMP variants to the DHp domain of EnvZ, a bacterial histidine kinase. Structures of wild-type and mutant constructs are correlated with ligand response in vivo, clearly associating them with distinct signaling states. We propose that altered recognition of the catalytic domain by DHp, rather than a shift in position of the phospho-accepting histidine, forms the basis for regulation of kinase activity. PMID:22244755

  13. Janus kinase inhibitors for rheumatoid arthritis.

    PubMed

    Yamaoka, Kunihiro

    2016-06-01

    Treatment of autoimmune diseases, such as rheumatoid arthritis (RA), has advanced substantially over the past decade with the development of biologics targeting inflammatory cytokines. Recent progress in treating RA has been achieved with janus kinase (JAK) inhibitors (Jakinibs), an orally available disease-modifying anti-rheumatic drug targeting the intracellular kinase JAK and with similar efficacy to biologics. The first Jakinib approved for RA was tofacitinib, which exerted superiority to methotrexate and non-inferiority to tumor necrosis factor (TNF) inhibitors. In recent years, the Jakinib baricitinib has demonstrated superiority to both methotrexate and a TNF inhibitor, adalimumab. Given these promising findings, Jakinibs are expected to represent the next generation compounds for treating RA, and a number of Jakinibs are currently in clinical trials. Jakinibs can differ substantially in their selectivity against JAKs; tofacitinib and baricitinib target multiple JAKs, whereas the most recently developed Jakinibs target only a single JAK. The influence of Jakinib selectivity on efficacy and side effects is of great interest, requiring further careful observation. PMID:26994322

  14. Coated vesicles contain a phosphatidylinositol kinase.

    PubMed

    Campbell, C R; Fishman, J B; Fine, R E

    1985-09-15

    When coated vesicles (CVs) are incubated with [gamma-32P]ATP, radioactivity is rapidly incorporated into a compound identified by thin layer chromatography as phosphatidylinositol 4-phosphate. This activity has been identified in CVs isolated from bovine brain as well as from rat liver and chick embryo skeletal muscle. Phosphatidylinositol (PI) kinase is not separated from CVs during agarose electrophoresis, which produces CVs of greater than 95% purity, indicating that the activity present does not derive from contamination. The specific activity of these highly purified CVs was demonstrated to be approximately twice that of synaptic plasma membranes, further ruling out contamination from this source. The PI kinase remains associated with the vesicle upon removal of clathrin and its associated proteins and is solubilized by nonionic detergents, suggesting it is an integral membrane protein. We have been unable to demonstrate the formation of significant amounts of phosphatidylinositol 4,5-bisphosphate in any of our CV preparations. In the presence of exogenous PI, activity is stimulated, with maximal phosphorylation occurring at 0.1 mM. The enzyme appears to be maximally stimulated by 200 mM MgCl2 and 1 mM ATP and is most active at pH 7.25. Calculations indicate that, under optimal conditions, approximately 25 molecules of PIP are produced per CV within 60 s, suggesting that these structures may play an important role in cellular PI metabolism. PMID:2863269

  15. Identification of the regulatory autophosphorylation site of autophosphorylation-dependent protein kinase (auto-kinase). Evidence that auto-kinase belongs to a member of the p21-activated kinase family.

    PubMed Central

    Yu, J S; Chen, W J; Ni, M H; Chan, W H; Yang, S D

    1998-01-01

    Autophosphorylation-dependent protein kinase (auto-kinase) was identified from pig brain and liver on the basis of its unique autophosphorylation/activation property [Yang, Fong, Yu and Liu (1987) J. Biol. Chem. 262, 7034-7040; Yang, Chang and Soderling (1987) J. Biol. Chem. 262, 9421-9427]. Its substrate consensus sequence motif was determined as being -R-X-(X)-S*/T*-X3-S/T-. To characterize auto-kinase further, we partly sequenced the kinase purified from pig liver. The N-terminal sequence (VDGGAKTSDKQKKKAXMTDE) and two internal peptide sequences (EKLRTIV and LQNPEK/ILTP/FI) of auto-kinase were obtained. These sequences identify auto-kinase as a C-terminal catalytic fragment of p21-activated protein kinase 2 (PAK2 or gamma-PAK) lacking its N-terminal regulatory region. Auto-kinase can be recognized by an antibody raised against the C-terminal peptide of human PAK2 by immunoblotting. Furthermore the autophosphorylation site sequence of auto-kinase was successfully predicted on the basis of its substrate consensus sequence motif and the known PAK2 sequence, and was further demonstrated to be RST(P)MVGTPYWMAPEVVTR by phosphoamino acid analysis, manual Edman degradation and phosphopeptide mapping via the help of phosphorylation site analysis of a synthetic peptide corresponding to the sequence of PAK2 from residues 396 to 418. During the activation process, auto-kinase autophosphorylates mainly on a single threonine residue Thr402 (according to the sequence numbering of human PAK2). In addition, a phospho-specific antibody against a synthetic phosphopeptide containing this identified sequence was generated and shown to be able to differentially recognize the activated auto-kinase autophosphorylated at Thr402 but not the non-phosphorylated/inactive auto-kinase. Immunoblot analysis with this phospho-specific antibody further revealed that the change in phosphorylation level of Thr402 of auto-kinase was well correlated with the activity change of the kinase during both

  16. Identification and functional analysis of mitogen-activated protein kinase kinase kinase (MAPKKK) genes in canola (Brassica napus L.)

    PubMed Central

    Sun, Yun; Wang, Chen; Yang, Bo; Jiang, Yuan-Qing

    2014-01-01

    Mitogen-activated protein kinase (MAPK) signalling cascades, consisting of three types of reversibly phosphorylated kinases (MAPKKK, MAPKK, and MAPK), are involved in important processes including plant immunity and hormone responses. The MAPKKKs comprise the largest family in the MAPK cascades, yet only a few of these genes have been associated with physiological functions, even in the model plant Arabidopsis thaliana. Canola (Brassica napus L.) is one of the most important oilseed crops in China and worldwide. To explore MAPKKK functions in biotic and abiotic stress responses in canola, 66 MAPKKK genes were identified and 28 of them were cloned. Phylogenetic analysis of these canola MAPKKKs with homologous genes from representative species classified them into three groups (A–C), comprising four MAPKKKs, seven ZIKs, and 17 Raf genes. A further 15 interaction pairs between these MAPKKKs and the downstream BnaMKKs were identified through a yeast two-hybrid assay. The interactions were further validated through bimolecular fluorescence complementation (BiFC) analysis. In addition, by quantitative real-time reverse transcription–PCR, it was further observed that some of these BnaMAPKKK genes were regulated by different hormone stimuli, abiotic stresses, or fungal pathogen treatments. Interestingly, two novel BnaMAPKKK genes, BnaMAPKKK18 and BnaMAPKKK19, which could elicit hypersensitive response (HR)-like cell death when transiently expressed in Nicotiana benthamiana leaves, were successfully identified. Moreover, it was found that BnaMAPKKK19 probably mediated cell death through BnaMKK9. Overall, the present work has laid the foundation for further characterization of this important MAPKKK gene family in canola. PMID:24604738

  17. Identification and functional analysis of mitogen-activated protein kinase kinase kinase (MAPKKK) genes in canola (Brassica napus L.).

    PubMed

    Sun, Yun; Wang, Chen; Yang, Bo; Wu, Feifei; Hao, Xueyu; Liang, Wanwan; Niu, Fangfang; Yan, Jingli; Zhang, Hanfeng; Wang, Boya; Deyholos, Michael K; Jiang, Yuan-Qing

    2014-05-01

    Mitogen-activated protein kinase (MAPK) signalling cascades, consisting of three types of reversibly phosphorylated kinases (MAPKKK, MAPKK, and MAPK), are involved in important processes including plant immunity and hormone responses. The MAPKKKs comprise the largest family in the MAPK cascades, yet only a few of these genes have been associated with physiological functions, even in the model plant Arabidopsis thaliana. Canola (Brassica napus L.) is one of the most important oilseed crops in China and worldwide. To explore MAPKKK functions in biotic and abiotic stress responses in canola, 66 MAPKKK genes were identified and 28 of them were cloned. Phylogenetic analysis of these canola MAPKKKs with homologous genes from representative species classified them into three groups (A-C), comprising four MAPKKKs, seven ZIKs, and 17 Raf genes. A further 15 interaction pairs between these MAPKKKs and the downstream BnaMKKs were identified through a yeast two-hybrid assay. The interactions were further validated through bimolecular fluorescence complementation (BiFC) analysis. In addition, by quantitative real-time reverse transcription-PCR, it was further observed that some of these BnaMAPKKK genes were regulated by different hormone stimuli, abiotic stresses, or fungal pathogen treatments. Interestingly, two novel BnaMAPKKK genes, BnaMAPKKK18 and BnaMAPKKK19, which could elicit hypersensitive response (HR)-like cell death when transiently expressed in Nicotiana benthamiana leaves, were successfully identified. Moreover, it was found that BnaMAPKKK19 probably mediated cell death through BnaMKK9. Overall, the present work has laid the foundation for further characterization of this important MAPKKK gene family in canola. PMID:24604738

  18. Kinase-mediated quasi-dimers of EGFR

    PubMed Central

    Bublil, Erez M.; Pines, Gur; Patel, Gargi; Fruhwirth, Gilbert; Ng, Tony; Yarden, Yosef

    2010-01-01

    Ligand-induced dimerization of the epidermal growth factor receptor (ErbB-1/EGFR) involves conformational changes that expose an extracellular dimerization interface. Subsequent alterations within the cytoplasmic kinase domain, which culminate in tyrosine phosphorylation, are less understood. Our study addressed this question by using two strategies: a chimeric receptor approach employed ErbB-3, whose defective kinase domain was replaced by the respective part of EGFR. The implanted full-length kinase, unlike its subdomains, conferred dimerization and catalysis. The data infer that the kinase function of EGFR is restrained by the carboxyl tail; once grafted distally to the ectopic tail of ErbB-3, the kinase domain acquires quasi-dimerization and activation. In an attempt to alternatively refold the cytoplasmic tail, our other approach employed kinase inhibitors. Biophysical measurements and covalent cross-linking analyses showed that inhibitors targeting the active conformation of EGFR, in contrast to a compound recognizing the inactive conformation, induce quasi-dimers in a manner similar to the chimeric ErbB-3 molecule. Collectively, these observations unveil kinase domain-mediated quasi-dimers, which are regulated by an autoinhibitory carboxyl tail. On the basis of these observations, we propose that quasi-dimers precede formation of ligand-induced, fully active dimers, which are stabilized by both extracellular and intracellular receptor-receptor interactions.—Bublil, E. M., Pines, G., Patel, G., Fruhwirth, G., Ng, T., Yosef Yarden. Kinase-mediated quasi-dimers of EGFR. PMID:20682838

  19. Lack of stereospecificity of suid pseudorabies virus thymidine kinase.

    PubMed Central

    Maga, G; Verri, A; Bonizzi, L; Ponti, W; Poli, G; Garbesi, A; Niccolai, D; Spadari, S; Focher, F

    1993-01-01

    We have partially purified suid pseudorabies virus (PRV) thymidine kinase from infected thymidine kinase- mouse cells, and cytosolic swine thymidine kinase from lymphatic glands, and we have found that PRV thymidine kinase, unlike the host enzyme, shows no stereospecificity for D- and L-beta-nucleosides. In vitro, unnatural L-enantiomers, except L-deoxycytidine, function as specific inhibitors for the viral enzyme in the order: L-thymidine >> L-deoxyguanosine > L-deoxyuridine > L-deoxyadenosine. Contrary to human and swine thymidine kinases and like herpes simplex virus-1 and -2 thymidine kinases, PRV thymidine kinase phosphorylates both the natural (D-) and the unnatural (L-) thymidine enantiomers to their corresponding monophosphates with comparable efficiency. The kinetic parameters Vmax/Km for D- and L-thymidine are 3.7 and 2.3 respectively. Our results demonstrate that the lack of stereospecificity might be a common feature of the thymidine kinases that are encoded by human and animal herpes viruses. These observations could lead to the development of a novel class of antiviral drugs. PMID:8396911

  20. Lack of stereospecificity of suid pseudorabies virus thymidine kinase.

    PubMed

    Maga, G; Verri, A; Bonizzi, L; Ponti, W; Poli, G; Garbesi, A; Niccolai, D; Spadari, S; Focher, F

    1993-09-01

    We have partially purified suid pseudorabies virus (PRV) thymidine kinase from infected thymidine kinase- mouse cells, and cytosolic swine thymidine kinase from lymphatic glands, and we have found that PRV thymidine kinase, unlike the host enzyme, shows no stereospecificity for D- and L-beta-nucleosides. In vitro, unnatural L-enantiomers, except L-deoxycytidine, function as specific inhibitors for the viral enzyme in the order: L-thymidine > L-deoxyguanosine > L-deoxyuridine > L-deoxyadenosine. Contrary to human and swine thymidine kinases and like herpes simplex virus-1 and -2 thymidine kinases, PRV thymidine kinase phosphorylates both the natural (D-) and the unnatural (L-) thymidine enantiomers to their corresponding monophosphates with comparable efficiency. The kinetic parameters Vmax/Km for D- and L-thymidine are 3.7 and 2.3 respectively. Our results demonstrate that the lack of stereospecificity might be a common feature of the thymidine kinases that are encoded by human and animal herpes viruses. These observations could lead to the development of a novel class of antiviral drugs. PMID:8396911

  1. Allosteric activation of apicomplexan calcium-dependent protein kinases.

    PubMed

    Ingram, Jessica R; Knockenhauer, Kevin E; Markus, Benedikt M; Mandelbaum, Joseph; Ramek, Alexander; Shan, Yibing; Shaw, David E; Schwartz, Thomas U; Ploegh, Hidde L; Lourido, Sebastian

    2015-09-01

    Calcium-dependent protein kinases (CDPKs) comprise the major group of Ca2+-regulated kinases in plants and protists. It has long been assumed that CDPKs are activated, like other Ca2+-regulated kinases, by derepression of the kinase domain (KD). However, we found that removal of the autoinhibitory domain from Toxoplasma gondii CDPK1 is not sufficient for kinase activation. From a library of heavy chain-only antibody fragments (VHHs), we isolated an antibody (1B7) that binds TgCDPK1 in a conformation-dependent manner and potently inhibits it. We uncovered the molecular basis for this inhibition by solving the crystal structure of the complex and simulating, through molecular dynamics, the effects of 1B7-kinase interactions. In contrast to other Ca2+-regulated kinases, the regulatory domain of TgCDPK1 plays a dual role, inhibiting or activating the kinase in response to changes in Ca2+ concentrations. We propose that the regulatory domain of TgCDPK1 acts as a molecular splint to stabilize the otherwise inactive KD. This dependence on allosteric stabilization reveals a novel susceptibility in this important class of parasite enzymes. PMID:26305940

  2. Allosteric activation of apicomplexan calcium-dependent protein kinases

    PubMed Central

    Ingram, Jessica R.; Knockenhauer, Kevin E.; Markus, Benedikt M.; Mandelbaum, Joseph; Ramek, Alexander; Shan, Yibing; Shaw, David E.; Schwartz, Thomas U.; Ploegh, Hidde L.; Lourido, Sebastian

    2015-01-01

    Calcium-dependent protein kinases (CDPKs) comprise the major group of Ca2+-regulated kinases in plants and protists. It has long been assumed that CDPKs are activated, like other Ca2+-regulated kinases, by derepression of the kinase domain (KD). However, we found that removal of the autoinhibitory domain from Toxoplasma gondii CDPK1 is not sufficient for kinase activation. From a library of heavy chain-only antibody fragments (VHHs), we isolated an antibody (1B7) that binds TgCDPK1 in a conformation-dependent manner and potently inhibits it. We uncovered the molecular basis for this inhibition by solving the crystal structure of the complex and simulating, through molecular dynamics, the effects of 1B7–kinase interactions. In contrast to other Ca2+-regulated kinases, the regulatory domain of TgCDPK1 plays a dual role, inhibiting or activating the kinase in response to changes in Ca2+ concentrations. We propose that the regulatory domain of TgCDPK1 acts as a molecular splint to stabilize the otherwise inactive KD. This dependence on allosteric stabilization reveals a novel susceptibility in this important class of parasite enzymes. PMID:26305940

  3. Purine inhibitors of protein kinases, G proteins and polymerases

    DOEpatents

    Gray, Nathanael S.; Schultz, Peter; Kim, Sung-Hou; Meijer, Laurent

    2001-07-03

    The present invention relates to purine analogs that inhibit, inter alia, protein kinases, G-proteins and polymerases. In addition, the present invention relates to methods of using such purine analogs to inhibit protein kinases, G-proteins, polymerases and other cellular processes and to treat cellular proliferative diseases.

  4. The Potential Role of Aurora Kinase Inhibitors in Haematological Malignancies

    PubMed Central

    Farag, Sherif S.

    2011-01-01

    Summary Aurora kinases play an important role in the control of the cell cycle and have been implicated in tumourigenesis in a number of cancers. Among the haematological malignancies, overexpression of Aurora kinases has been reported in acute myeloid leukaemia, chronic myeloid leukaemia, acute lymphoblastic leukaemia, multiple myeloma, aggressive non-Hodgkin lymphoma and Hodgkin lymphoma. A large number of Aurora kinase inhibitors are currently in different stages of clinical development. In addition to varying in their selectivity for the different Aurora kinases, some also have activity directed at other cellular kinases involved in important molecular pathways in cancer cells. This review summarizes the biology of Aurora kinases and discusses why they may be good therapeutic targets in different haematological cancers. We describe preclinical data that has served as the rationale for investigating Aurora kinase inhibitors in different haematological malignancies, and summarize published results from early phase clinical trials. While the anti-tumour effects of Aurora kinase inhibitors appear promising, we highlight important issues for future clinical research and suggest that the optimal use of these inhibitors is likely to be in combination with cytotoxic agents already in use for the treatment of various haematological cancers. PMID:21980926

  5. Phosphoinositide 3-kinase: the key switch mechanism in insulin signalling.

    PubMed Central

    Shepherd, P R; Withers, D J; Siddle, K

    1998-01-01

    Insulin plays a key role in regulating a wide range of cellular processes. However, until recently little was known about the signalling pathways that are involved in linking the insulin receptor with downstream responses. It is now apparent that the activation of class 1a phosphoinositide 3-kinase (PI 3-kinase) is necessary and in some cases sufficient to elicit many of insulin's effects on glucose and lipid metabolism. The lipid products of PI 3-kinase act as both membrane anchors and allosteric regulators, serving to localize and activate downstream enzymes and their protein substrates. One of the major ways these lipid products of PI 3-kinase act in insulin signalling is by binding to pleckstrin homology (PH) domains of phosphoinositide-dependent protein kinase (PDK) and protein kinase B (PKB) and in the process regulating the phosphorylation of PKB by PDK. Using mechanisms such as this, PI 3-kinase is able to act as a molecular switch to regulate the activity of serine/threonine-specific kinase cascades important in mediating insulin's effects on endpoint responses. PMID:9677303

  6. Activation of AMP-kinase by Policosanol Requires Peroxisomal Metabolism

    PubMed Central

    Banerjee, Subhashis; Ghoshal, Sarbani

    2011-01-01

    Policosanol, a well-defined mixture of very long chain primary alcohols that is available as a nutraceutical product, has been reported to lower blood cholesterol levels. The present studies demonstrate that policosanol promotes the phosphorylation of AMP-kinase and HMG-CoA reductase in hepatoma cells and in mouse liver after intragastric administration, providing a possible means by which policosanol might lower blood cholesterol levels. Treatment of hepatoma cells with policosanol produced a 2.5-fold or greater increase in the phosphorylation of AMP-kinase and HMG-CoA reductase, and increased the phosphorylation of Ca++/calmodulin-dependent kinase kinase (CaMKK), an upstream AMP-kinase kinase. Intra-gastric administration of policosanol to mice similarly increased the phosphorylation of hepatic HMG-CoA reductase and AMP-kinase by greater than 2-fold. siRNA-mediated suppression of fatty aldehyde dehydrogenase, fatty acyl-CoA synthetase 4, and acyl-CoA acetyltransferase expression in hepatoma cells prevented the phosphorylation of AMP-kinase and HMG-CoA reductase by policosanol, indicating that metabolism of these very long chain alcohols to activated fatty acids is necessary for the suppression of cholesterol synthesis, presumably by increasing cellular AMP levels. Subsequent peroxisomal β-oxidation probably augments this effect. PMID:21359855

  7. Leishmania Infection Engages Non-Receptor Protein Kinases Differentially to Persist in Infected Hosts

    PubMed Central

    Zhang, Naixin; Kima, Peter E.

    2016-01-01

    Protein kinases play important roles in the regulation of cellular activities. In cells infected by pathogens, there is an increasing appreciation that dysregulated expression of protein kinases promotes the success of intracellular infections. In Leishmania-infected cells, expression and activation of protein kinases, such as the mitogen-activated protein kinases, kinases in the PI3-kinase signaling pathway, and kinases in the NF-κB-signaling pathway, are modulated in some manner. Several recent reviews have discussed our current understanding of the roles of these kinases in Leishmania infections. Apart from the kinases in the pathways enumerated above, there are other host cell protein kinases that are activated during the Leishmania infection of mammalian cells whose roles also appear to be significant. This review discusses recent observations on the Abl family of protein kinases and the protein kinase regulated by RNA in Leishmania infections. PMID:27148265

  8. In silico design of protein kinase inhibitors: successes and failures.

    PubMed

    Dubinina, Galina G; Chupryna, Oleksandr O; Platonov, Maxim O; Borisko, Petro O; Ostrovska, Galina V; Tolmachov, Andriy O; Shtil, Alexander A

    2007-03-01

    Protein kinases are among the most exploited targets in modern drug discovery due to key roles these enzymes play in human diseases including cancer. The in silico approach, an important part of rational design of protein kinase inhibitors, is founded on vast information about 3D structures of these enzymes. This review summarizes general structural features of the kinase inhibitors and the studies applied toward a large scale chemical database for virtual screening. Analyzed are the ways of validating the modern docking tools and their combinations with different scoring functions. In particular, we discuss the kinase flexibility as a reason for failures of the docking procedure. Finally, evidence is provided for the main patterns of kinase-inhibitor interactions and creation of the hinge-region-directed 2D filters. PMID:17348826

  9. Activation Domain-dependent Degradation of Somatic Wee1 Kinase*

    PubMed Central

    Owens, Laura; Simanski, Scott; Squire, Christopher; Smith, Anthony; Cartzendafner, Jeff; Cavett, Valerie; Caldwell Busby, Jennifer; Sato, Trey; Ayad, Nagi G.

    2010-01-01

    Cell cycle progression is dependent upon coordinate regulation of kinase and proteolytic pathways. Inhibitors of cell cycle transitions are degraded to allow progression into the subsequent cell cycle phase. For example, the tyrosine kinase and Cdk1 inhibitor Wee1 is degraded during G2 and mitosis to allow mitotic progression. Previous studies suggested that the N terminus of Wee1 directs Wee1 destruction. Using a chemical mutagenesis strategy, we report that multiple regions of Wee1 control its destruction. Most notably, we find that the activation domain of the Wee1 kinase is also required for its degradation. Mutations in this domain inhibit Wee1 degradation in somatic cell extracts and in cells without affecting the overall Wee1 structure or kinase activity. More broadly, these findings suggest that kinase activation domains may be previously unappreciated sites of recognition by the ubiquitin proteasome pathway. PMID:20038582

  10. Feedback Regulation of Kinase Signaling Pathways by AREs and GREs

    PubMed Central

    Vlasova-St. Louis, Irina; Bohjanen, Paul R.

    2016-01-01

    In response to environmental signals, kinases phosphorylate numerous proteins, including RNA-binding proteins such as the AU-rich element (ARE) binding proteins, and the GU-rich element (GRE) binding proteins. Posttranslational modifications of these proteins lead to a significant changes in the abundance of target mRNAs, and affect gene expression during cellular activation, proliferation, and stress responses. In this review, we summarize the effect of phosphorylation on the function of ARE-binding proteins ZFP36 and ELAVL1 and the GRE-binding protein CELF1. The networks of target mRNAs that these proteins bind and regulate include transcripts encoding kinases and kinase signaling pathways (KSP) components. Thus, kinase signaling pathways are involved in feedback regulation, whereby kinases regulate RNA-binding proteins that subsequently regulate mRNA stability of ARE- or GRE-containing transcripts that encode components of KSP. PMID:26821046

  11. Feedback Regulation of Kinase Signaling Pathways by AREs and GREs.

    PubMed

    Vlasova-St Louis, Irina; Bohjanen, Paul R

    2016-01-01

    In response to environmental signals, kinases phosphorylate numerous proteins, including RNA-binding proteins such as the AU-rich element (ARE) binding proteins, and the GU-rich element (GRE) binding proteins. Posttranslational modifications of these proteins lead to a significant changes in the abundance of target mRNAs, and affect gene expression during cellular activation, proliferation, and stress responses. In this review, we summarize the effect of phosphorylation on the function of ARE-binding proteins ZFP36 and ELAVL1 and the GRE-binding protein CELF1. The networks of target mRNAs that these proteins bind and regulate include transcripts encoding kinases and kinase signaling pathways (KSP) components. Thus, kinase signaling pathways are involved in feedback regulation, whereby kinases regulate RNA-binding proteins that subsequently regulate mRNA stability of ARE- or GRE-containing transcripts that encode components of KSP. PMID:26821046

  12. An X-ray structural study of pyruvate dehydrogenase kinase: A eukaryotic serine kinase with a prokaryotic histidine-kinase fold

    NASA Astrophysics Data System (ADS)

    Steussy, Calvin Nicklaus, Jr.

    2001-07-01

    Pyruvate Dehydrogenase Kinase is an enzyme that controls the flow of glucose through the eukaryotic cell and contributes to the pathology of diabetes mellitus. Early work on this kinase demonstrated that it has an amino acid sequence much like bacterial histidine kinases, but an activity similar to that of modern serine/threonine kinases. This project utilized the techniques of X-ray crystallography to determine molecular structure of pyruvate dehydrogenase kinase, isozyme 2. The structure was phased using selenium substituted for sulfur in methionine residues, and data at multiple wavelengths was collected at the National Synchrotron Light Source, Brookhaven National Laboratories. PDK 2 was found to fold into a two-domain monomer that forms a dimer through two beta sheets in the C-terminal domain. The N-terminal domain is an alpha-helical bundle while the C-terminal domain is an alpha/beta sandwich. The fold of the C-terminal domain is very similar to that of the prokaryotic histidine kinases, indicating that they share a common ancestor. The catalytic mechanism, however, has evolved to use general base catalysis to activate the serine substrate, rather than the direct nucleophilic attack by the imidazole sidechain used in the prokaryotic kinases. Thus, the structure of the protein echoes its prokaryotic ancestor, while the chemical mechanism has adapted to a serine substrate. The electrostatic surface of PDK2 leads to the suggestion that the lipoyl domain of the pyruvate dehydrogenase kinase, an important associated structure, may bind in the cleft formed between the N- and C-terminal domains. In addition, a network of hydrogen bonds directly connects the nucleotide binding pocket to the dimer interface, suggesting that there may be some interaction between dimer formation and ATP binding or ADP release.

  13. The molecular basis of targeting protein kinases in cancer therapeutics.

    PubMed

    Tsai, Chung-Jung; Nussinov, Ruth

    2013-08-01

    In this paper, we provide an overview of targeted anticancer therapies with small molecule kinase inhibitors. First, we discuss why a single constitutively active kinase emanating from a variety of aberrant genetic alterations is capable of transforming a normal cell, leading it to acquire the hallmarks of a cancer cell. To draw attention to the fact that kinase inhibition in targeted cancer therapeutics differs from conventional cytotoxic chemotherapy, we exploit a conceptual framework explaining why suppressed kinase activity will selectively kill only the so-called oncogene 'addicted' cancer cell, while sparing the healthy cell. Second, we introduce the protein kinase superfamily in light of its common active conformation with precisely positioned structural elements, and the diversified auto-inhibitory conformations among the kinase families. Understanding the detailed activation mechanism of individual kinases is essential to relate the observed oncogenic alterations to the elevated constitutively active state, to identify the mechanism of consequent drug resistance, and to guide the development of the next-generation inhibitors. To clarify the vital importance of structural guidelines in studies of oncogenesis, we explain how somatic mutations in EGFR result in kinase constitutive activation. Third, in addition to the common theme of secondary (acquired) mutations that prevent drug binding from blocking a signaling pathway which is hijacked by the aberrant activated kinase, we discuss scenarios of drug resistance and relapse by compensating lesions that bypass the inactivated pathway in a vertical or horizontal fashion. Collectively, these suggest that the future challenge of cancer therapy with small molecule kinase inhibitors will rely on the discovery of distinct combinations of optimized drugs to target individual subtypes of different cancers. PMID:23651790

  14. Peptide biosensors for the electrochemical measurement of protein kinase activity.

    PubMed

    Kerman, Kagan; Song, Haifeng; Duncan, James S; Litchfield, David W; Kraatz, Heinz-Bernhard

    2008-12-15

    The kinase activities are elucidated using the novel redox-active cosubstrate adenosine 5'-[gamma-ferrocene] triphosphate (Fc-ATP), which enables the kinase-catalyzed transfer of a redox active gamma-phosphate-Fc to a hydroxyamino acid. In this report, a versatile electrochemical biosensor is developed for monitoring the activity and inhibition of a serine/threonine kinase, casein kinase 2 (CK2), and protein tyrosine kinases, Abl1-T315I and HER2, in buffered solutions and in cell lysates. The method is based on the labeling of a specific phosphorylation event with Fc, followed by electrochemical detection. The electrochemical response obtained from the "ferrocenylated" peptides enables monitoring the activity of the kinase and its substrate, as well as the inhibition of small molecule inhibitors on protein phosphorylation. Kinetic information was extracted from the electrochemical measurements for the determination of K(m) and V(m) values, which were in agreement with those previously reported. Kinase reactions were also performed in the presence of well-defined inhibitors of CK2, 4,5,6,7-tetrabromo-2-azabenzimidazole, 2-dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole, and E-3-(2,3,4,5-tetrabromophenyl)acrylic acid as well as the nonspecific kinase inhibitors, staurosporine and N-benzoylstaurosporine. On the basis of the dependency of the Fc signal on inhibitor concentration, K(i) of the inhibitors was estimated, which were also in agreement with the literature values. The performance of the biosensor was optimized including the kinase reaction, incubation with Fc-ATP, and the small molecule inhibitors. Peptide modified electrochemical biosensors are promising candidates for cost-effective in vitro kinase activity and inhibitor screening assays. PMID:18989981

  15. IκB Kinase ε Is an NFATc1 Kinase that Inhibits T Cell Immune Response.

    PubMed

    Zhang, Junjie; Feng, Hao; Zhao, Jun; Feldman, Emily R; Chen, Si-Yi; Yuan, Weiming; Huang, Canhua; Akbari, Omid; Tibbetts, Scott A; Feng, Pinghui

    2016-07-12

    Activation of nuclear factor of activated T cells (NFAT) is crucial for immune responses. IKKε is an IκB kinase (IKK)-related kinase, and the function of IKKε remains obscure in T cells, despite its abundant expression. We report that IKKε inhibits NFAT activation and T cell responses by promoting NFATc1 phosphorylation. During T cell activation, IKKε was transiently activated to phosphorylate NFATc1. Loss of IKKε elevated T cell antitumor and antiviral immunity and, therefore, reduced tumor development and persistent viral infection. IKKε was activated in CD8(+) T cells of mice bearing melanoma or persistently infected with a model herpesvirus. These results collectively show that IKKε promotes NFATc1 phosphorylation and inhibits T cell responses, identifying IKKε as a crucial negative regulator of T cell activation and a potential target for immunotherapy. PMID:27346349

  16. Small-molecule inhibitors of IκB kinase (IKK) and IKK-related kinases.

    PubMed

    Llona-Minguez, Sabin; Baiget, Jessica; Mackay, Simon P

    2013-07-01

    The transcription factors NF-κB and IFN control important signaling cascades and mediate the expression of a number of important pro-inflammatory cytokines, adhesion molecules, growth factors and anti-apoptotic survival proteins. IκB kinase (IKK) and IKK-related kinases (IKKε and TBK1) are key regulators of these biological pathways and, as such, modulators of these enzymes may be useful in the treatment of inflammatory diseases and cancer. We have reviewed the most recent IKK patent literature (2008-2012), added publications of interest overlooked in previous patent reviews and identified all the players involved in small-molecule inhibitors of the IKKs. This will provide the reader with a decisive summary of the IKK arena, a field that has reached maturity over a decade of research. PMID:24237125

  17. Receptor tyrosine kinase targeting in multicellular spheroids.

    PubMed

    Breslin, Susan; O'Driscoll, Lorraine

    2015-01-01

    While growing cells as a monolayer is the traditional method for cell culture, the incorporation of multicellular spheroids into experimental design is becoming increasingly popular. This is due to the understanding that cells grown as spheroids tend to replicate the in vivo situation more reliably than monolayer cells. Thus, the use of multicellular spheroids may be more clinically relevant than monolayer cell cultures. Here, we describe methods for multicellular 3D spheroid generation that may be used to provide samples for receptor tyrosine kinase (and other protein) detection. Methods described include the forced-floating poly-HEMA method, the hanging-drop method, and the use of ECM to form multicellular 3D spheroids. PMID:25319898

  18. Phosphoinositide 3-kinases-a historical perspective.

    PubMed

    Toker, Alex

    2012-01-01

    The phosphoinositide 3-kinase (PI 3-K) signal relay pathway represents arguably one of the most intensely studied mechanisms by which extracellular signals elicit cellular responses through the generation of second messengers that are associated with cell growth and transformation. This chapter reviews the many landmark discoveries in the PI 3-K signaling pathway in biology and disease, from the identification of a novel phosphoinositide kinase activity associated with transforming oncogenes in the 1980s, to the identification of oncogenic mutations in the catalytic subunit of PI 3-K in the mid 2000s. Two and a half decades of intense research have provided clear evidence that the PI 3-K pathway controls virtually all aspects of normal cellular physiology, and that deregulation of one or more proteins that regulate or transduce the PI 3-K signal ultimately leads to human pathology. The most recent efforts have focused on the development of specific PI 3-K inhibitors that are currently being evaluated in clinical trials for a range of disease states.This chapter is devoted to a historical review of the landmark findings in the PI 3-K from its relatively humble beginnings in the early to mid 1980s up until the present day. When considering the key findings in the history of PI 3-K, it is essential to recognize the landmark studies by Lowell and Mabel Hokin in the 1950s who were the first to describe that extracellular agonists such as acetylcholine could stimulate the incorporation of radiolabeled phosphate into phospholipids (Hokin and Hokin 1953). Their work initiated an entirely new field of lipid signaling, and subsequent studies in the 1970s by Michell and Lapetina who linked phosphoinositide turnover to membrane-associated receptors that initiate intracellular calcium mobilization (Lapetina and Michell 1973). Later studies revealed that the phospholipase-mediated breakdown of the same minor membrane phospholipids such as PtdIns-4,5-P(2) (phosphatidylinositol-4

  19. Protein kinase C, an elusive therapeutic target?

    PubMed Central

    Mochly-Rosen, Daria; Das, Kanad; Grimes, Kevin V

    2013-01-01

    Preface Protein kinase C (PKC) has been a tantalizing target for drug discovery ever since it was first identified as the receptor for the tumor promoter phorbol ester in 19821. Although initial therapeutic efforts focused on cancer, additional diseases, including diabetic complications, heart failure, myocardial infarction, pain and bipolar disease were targeted as researchers developed a better understanding of the roles that PKC’s eight conventional and novel isozymes play in health and disease. Unfortunately, both academic and pharmaceutical efforts have yet to result in the approval of a single new drug that specifically targets PKC. Why does PKC remain an elusive drug target? This review will provide a short account of some of the efforts, challenges and opportunities in developing PKC modulators to address unmet clinical needs. PMID:23197040

  20. Structural investigation of protein kinase C inhibitors

    NASA Technical Reports Server (NTRS)

    Barak, D.; Shibata, M.; Rein, R.

    1991-01-01

    The phospholipid and Ca2+ dependent protein kinase (PKC) plays an essential role in a variety of cellular events. Inhibition of PKC was shown to arrest growth in tumor cell cultures making it a target for possible antitumor therapy. Calphostins are potent inhibitors of PKC with high affinity for the enzyme regulatory site. Structural characteristics of calphostins, which confer the inhibitory activity, are investigated by comparing their optimized structures with the existing models for PKC activation. The resulting model of inhibitory activity assumes interaction with two out of the three electrostatic interaction sites postulated for activators. The model shows two sites of hydrophobic interaction and enables the inhibitory activity of gossypol to be accounted for.

  1. Animal models of antimuscle specific kinase myasthenia

    PubMed Central

    Richman, David P.; Nishi, Kayoko; Ferns, Michael J.; Schnier, Joachim; Pytel, Peter; Maselli, Ricardo A.; Agius, Mark A.

    2014-01-01

    Antimuscle specific kinase (anti-MuSK) myasthenia (AMM) differs from antiacetylcholine receptor myasthenia gravis in exhibiting more focal muscle involvement (neck, shoulder, facial, and bulbar muscles) with wasting of the involved, primarily axial, muscles. AMM is not associated with thymic hyperplasia and responds poorly to anticholinesterase treatment. Animal models of AMM have been induced in rabbits, mice, and rats by immunization with purified xenogeneic MuSK ectodomain, and by passive transfer of large quantities of purified serum IgG from AMM patients into mice. The models have confirmed the pathogenic role of the MuSK antibodies in AMM and have demonstrated the involvement of both the presynaptic and postsynaptic components of the neuromuscular junction. The observations in this human disease and its animal models demonstrate the role of MuSK not only in the formation of this synapse but also in its maintenance. PMID:23252909

  2. Leukemic cell creatine kinase and its isoenzymes.

    PubMed

    Fang, S R; Yao, E G; Wei, S Z; Fan, H; Dong, Z R

    1989-06-01

    Using malachite green single agent coloration and acetate membrane electrophoresis, we studied the cellular creatine kinase (CK) activity and its isoenzymes in 7 normal controls and 26 leukemia patients. The leukemic cellular CK activity was 12.62 +/- 4.86 u/mg protein, 2.2 times higher than the normal value (5.73 +/- 2.66 u/mg protein, p less than 0.05). Only 2 of 5 normal leukocyte samples showed '+' CK isoenzyme MM. 22 leukemia patients had CK isoenzyme. CK-BB appeared mainly in acute granulocytic leukemic, and CK-MM mainly in other types. CK-MB was also found in 6 patients. The recurrence of CK-BB may indicate atavism, and the enhanced anaerobic glycolysis and the accelerated energetic turnover may be on of the metabolic characteristics of leukemic cell. PMID:2512061

  3. Tyrosine kinase inhibitors and the thyroid.

    PubMed

    Sherman, Steven I

    2009-12-01

    Protein tyrosine kinase inhibitors (TKIs) have emerged as significant targets for novel cancer therapies. For patients with differentiated or medullary carcinomas unresponsive to conventional treatments, multiple novel therapies primarily targeting angiogenesis have entered clinical trials. Partial response rates up to 30% have been reported in single-agent studies, but prolonged disease stabilisation is more commonly seen. The most successful agents target the vascular endothelial growth factor receptors. Sorafenib and sunitinib have had promising preliminary results reported and are being used selectively for patients who do not qualify for clinical trials. Treatment for patients with metastatic or advanced thyroid carcinoma now emphasises clinical trial opportunities for novel agents with considerable promise. Adverse effects on thyroid function and thyroid hormone metabolism have also been seen with several TKIs, necessitating prospective thyroid function testing for all patients starting therapy. PMID:19942148

  4. Antibodies directed against receptor tyrosine kinases

    PubMed Central

    FAUVEL, Bénédicte; Yasri, Aziz

    2014-01-01

    Approximately 30 therapeutic monoclonal antibodies have already been approved for cancers and inflammatory diseases, and monoclonal antibodies continue to be one of the fastest growing classes of therapeutic molecules. Because aberrant signaling by receptor tyrosine kinases (RTKs) is a commonly observed factor in cancer, most of the subclasses of RTKs are being extensively studied as potential targets for treating malignancies. The first two RTKs that have been targeted by antibody therapy, with five currently marketed antibodies, are the growth factor receptors EGFR and HER2. However, due to systemic side effects, refractory patients and the development of drug resistance, these treatments are being challenged by emerging therapeutics. This review examines current monoclonal antibody therapies against RTKs. After an analysis of agents that have already been approved, we present an analysis of antibodies in clinical development that target RTKs. Finally, we highlight promising RTKs that are emerging as new oncological targets for antibody-based therapy. PMID:24859229

  5. Complexity of Receptor Tyrosine Kinase Signal Processing

    PubMed Central

    Volinsky, Natalia; Kholodenko, Boris N.

    2013-01-01

    Our knowledge of molecular mechanisms of receptor tyrosine kinase (RTK) signaling advances with ever-increasing pace. Yet our understanding of how the spatiotemporal dynamics of RTK signaling control specific cellular outcomes has lagged behind. Systems-centered experimental and computational approaches can help reveal how overlapping networks of signal transducers downstream of RTKs orchestrate specific cell-fate decisions. We discuss how RTK network regulatory structures, which involve the immediate posttranslational and delayed transcriptional controls by multiple feed forward and feedback loops together with pathway cross talk, adapt cells to the combinatorial variety of external cues and conditions. This intricate network circuitry endows cells with emerging capabilities for RTK signal processing and decoding. We illustrate how mathematical modeling facilitates our understanding of RTK network behaviors by unraveling specific systems properties, including bistability, oscillations, excitable responses, and generation of intricate landscapes of signaling activities. PMID:23906711

  6. The extended protein kinase C superfamily.

    PubMed Central

    Mellor, H; Parker, P J

    1998-01-01

    Members of the mammalian protein kinase C (PKC) superfamily play key regulatory roles in a multitude of cellular processes, ranging from control of fundamental cell autonomous activities, such as proliferation, to more organismal functions, such as memory. However, understanding of mammalian PKC signalling systems is complicated by the large number of family members. Significant progress has been made through studies based on comparative analysis, which have defined a number of regulatory elements in PKCs which confer specific location and activation signals to each isotype. Further studies on simple organisms have shown that PKC signalling paradigms are conserved through evolution from yeast to humans, underscoring the importance of this family in cellular signalling and giving novel insights into PKC function in complex mammalian systems. PMID:9601053

  7. A Quantitative Mass Spectrometry-based Approach for Identifying Protein Kinase-Clients and Quantifying Kinase Activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Homo sapiens and Arabidopsis thaliana genomes are believed to encode >500 and >1,000 protein kinases, respectively. Despite this abundance, few bona fide kinase-client relationships have been described in detail. Mass spectrometry (MS)-based approaches have been integral to the large-scale mapp...

  8. Transphosphorylation of E. coli proteins during production of recombinant protein kinases provides a robust system to characterize kinase specificity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protein kinase specificity is of fundamental importance to pathway regulation and signal transduction. Here, we report a convenient system to monitor the activity and specificity of recombinant protein kinases expressed in E.coli. We apply this to the study of the cytoplasmic domain of the plant rec...

  9. Human protein kinase CK2 genes.

    PubMed

    Wirkner, U; Voss, H; Lichter, P; Pyerin, W

    1994-01-01

    We have analyzed the genomic structure of human protein kinase CK2. Of the presumably four genes, the gene encoding the regulatory subunit beta and a processed (pseudo)gene of the catalytic subunit alpha have been characterized completely. In addition, a 18.9 kb-long central part of the gene encoding the catalytic subunit alpha has been characterized. The subunit beta gene spans 4.2 kb and is composed of seven exons. Its promoter region shows several features of a "housekeeping gene" and shares common features with the promoter of the regulatory subunit of cAMP-dependent protein kinase. Conforming to the genomic structure, the beta gene transcripts form a band around 1.1 kb. The central part of the subunit alpha gene contains eight exons comprising bases 102 to 824 of the translated region. Within the introns, 16 Alu repeats were identified, some of which arranged in tandems. The structure of both human CK2 coding genes, alpha and beta, is highly conserved. Several introns are located at corresponding positions in the respective genes of the nematode Caenorhabditis elegans. The processed alpha (pseudo)gene has a complete open reading frame and is 99% homologous to the coding region of the CK2 alpha cDNA. Although the gene has a promoter-like upstream region, no transcript could be identified so far. The genomic clones were used for localization in the human genome. The beta gene was mapped to locus 6p21, the alpha gene to locus 20p13 and the alpha (pseudo)gene to locus 11p15. There is no evidence for additional alpha or beta loci in the human genome. PMID:7735323

  10. Combined Cancer Immunotherapy Against Aurora Kinase A.

    PubMed

    Kaštánková, Iva; Poláková, Ingrid; Dušková, Martina; Šmahel, Michal

    2016-05-01

    Aurora kinase A (AURKA) is a centrosomal protein that is overexpressed in a number of human malignancies and can contribute to tumor progression. As we used this protein as a target of DNA immunization, we increased its immunogenicity by the addition of the PADRE helper epitope and decreased its potential oncogenicity by mutagenesis of the kinase domain. For in vitro analysis of induced immune responses in mice, we identified the Aurka220-228 nonapeptide representing an H-2K epitope. As DNA vaccination against the Aurka self-antigen by a gene gun did not show any antitumor effect, we combined DNA immunization with anti-CD25 treatment that depletes mainly regulatory T cells. Whereas 1 anti-CD25 dose injected before DNA vaccination did not enhance the activation of Aurka-specific splenocytes, 3 doses administered on days of immunizations augmented about 10-fold immunity against Aurka. However, an opposite effect was found for antitumor immunity-only 1 anti-CD25 dose combined with DNA vaccination reduced tumor growth. Moreover, the administration of 3 doses of anti-CD25 antibody alone accelerated tumor growth. Analysis of tumor-infiltrating cells showed that 3 anti-CD25 doses not only efficiently depleted regulatory T cells but also activated helper T cells and CD3CD25 cells. Next, we found that blockade of the PD-1 receptor initiated 1 week after the first immunization was necessary for significant inhibition of tumor growth with therapeutic DNA vaccination against Aurka combined with depletion of CD25 cells. Our results suggest that combined cancer immunotherapy should be carefully evaluated to achieve the optimal antitumor effect. PMID:27070447

  11. Anaplastic lymphoma kinase status in rhabdomyosarcomas.

    PubMed

    Yoshida, Akihiko; Shibata, Tatsuhiro; Wakai, Susumu; Ushiku, Tetsuo; Tsuta, Koji; Fukayama, Masashi; Makimoto, Atsushi; Furuta, Koh; Tsuda, Hitoshi

    2013-06-01

    Rhabdomyosarcoma is a rare soft tissue sarcoma that typically affects children, adolescents, and young adults. Despite treatment via a multidisciplinary approach, the prognosis of advance-stage rhabdomyosarcomas remains poor, and a new treatment strategy is needed. Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase that is a potential target for specific inhibitors. In this study, we investigated 116 rhabdomyosarcomas using a polymer-based ALK immunostaining method and correlated the results with clinicopathological parameters. In addition, we examined ALK status using dual-color fluorescence in situ hybridization, PCR, and sequencing. In immunohistochemical analysis, ALK was detected in 2 (6%) of 33 embryonal rhabdomyosarcomas, 42 (69%) of 61 alveolar rhabdomyosarcomas, and 0 (0%) of 22 other subtypes, including pleomorphic, adult-spindle-cell/sclerosing, and epithelioid variants. Compared with ALK-negative alveolar rhabdomyosarcomas, ALK-positive ones are presented with metastatic spread more frequently and showed a greater extent of myogenin reactivity. Overall survival was not associated with ALK expression. FOXO1 rearrangement was significantly associated with ALK immunoreactivity. The median ALK copy number was greater in ALK-positive tumors than in ALK-negative tumors. Most (93%) cases tested showed no selective increase in the ALK gene dosage. ALK selective amplification and low-level selective gain were noted in one and three cases, respectively. Further, a high-polysomy pattern (≥4 ALK copies in ≥40% of cells) was observed in seven cases. A significant increase in the ALK copy number was exclusive to the ALK-immunopositive cohort, but it was uncommon, accounting for only 30% of the 37 ALK-positive rhabdomyosarcomas. ALK gene rearrangement was not observed in either cohort, while an ALK somatic mutation (I1277T) was found in one ALK-negative embryonal case. Although it remains controversial whether ALK expression without gene rearrangement

  12. Conformational Dynamics and Allostery in Pyruvate Kinase.

    PubMed

    Donovan, Katherine A; Zhu, Shaolong; Liuni, Peter; Peng, Fen; Kessans, Sarah A; Wilson, Derek J; Dobson, Renwick C J

    2016-04-22

    Pyruvate kinase catalyzes the final step in glycolysis and is allosterically regulated to control flux through the pathway. Two models are proposed to explain how Escherichia coli pyruvate kinase type 1 is allosterically regulated: the "domain rotation model" suggests that both the domains within the monomer and the monomers within the tetramer reorient with respect to one another; the "rigid body reorientation model" proposes only a reorientation of the monomers within the tetramer causing rigidification of the active site. To test these hypotheses and elucidate the conformational and dynamic changes that drive allostery, we performed time-resolved electrospray ionization mass spectrometry coupled to hydrogen-deuterium exchange studies followed by mutagenic analysis to test the activation mechanism. Global exchange experiments, supported by thermostability studies, demonstrate that fructose 1,6-bisphosphate binding to the allosteric domain causes a shift toward a globally more dynamic ensemble of conformations. Mapping deuterium exchange to peptides within the enzyme highlight site-specific regions with altered conformational dynamics, many of which increase in conformational flexibility. Based upon these and mutagenic studies, we propose an allosteric mechanism whereby the binding of fructose 1,6-bisphosphate destabilizes an α-helix that bridges the allosteric and active site domains within the monomeric unit. This destabilizes the β-strands within the (β/α)8-barrel domain and the linked active site loops that are responsible for substrate binding. Our data are consistent with the domain rotation model but inconsistent with the rigid body reorientation model given the increased flexibility at the interdomain interface, and we can for the first time explain how fructose 1,6-bisphosphate affects the active site. PMID:26879751

  13. Photoinduced structural changes to protein kinase A

    NASA Astrophysics Data System (ADS)

    Rozinek, Sarah C.; Thomas, Robert J.; Brancaleon, Lorenzo

    2014-03-01

    The importance of porphyrins in organisms is underscored by the ubiquitous biological and biochemical functions that are mediated by these compounds and by their potential biomedical and biotechnological applications. Protoporphyrin IX (PPIX) is the precursor to heme and has biomedical applications such as its use as a photosensitizer in phototherapy and photodetection of cancer. Among other applications, our group has demonstrated that low-irradiance exposure to laser irradiation of PPIX, Fe-PPIX, or meso-tetrakis (4-sulfonatophenyl) porphyrin (TSPP) non-covalently docked to a protein causes conformational changes in the polypeptide. Such approach can have remarkable consequences in the study of protein structure/function relationship and can be used to prompt non-native protein properties. Therefore we have investigated protein kinase A (PKA), a more relevant protein model towards the photo-treatment of cancer. PKA's enzymatic functions are regulated by the presence of cyclic adenosine monophosphate for intracellular signal transduction involved in, among other things, stimulation of transcription, tumorigenesis in Carney complex and migration of breast carcinoma cells. Since phosphorylation is a necessary step in some cancers and inflammatory diseases, inhibiting the protein kinase, and therefore phosphorylation, may serve to treat these diseases. Changes in absorption, steady-state fluorescence, and fluorescence lifetime indicate: 1) both TSPP and PPIX non-covalently bind to PKA where they maintain photoreactivity; 2) absorptive photoproduct formation occurs only when PKA is bound to TSPP and irradiated; and 3) PKA undergoes secondary structural changes after irradiation with either porphyrin bound. These photoinduced changes could affect the protein's enzymatic and signaling capabilities.

  14. Glucose kinases from Streptomyces peucetius var. caesius.

    PubMed

    Ruiz-Villafán, Beatriz; Rodríguez-Sanoja, Romina; Aguilar-Osorio, Guillermo; Gosset, Guillermo; Sanchez, Sergio

    2014-07-01

    Glucose kinases (Glks) are enzymes of the glycolytic pathway involved in glucose phosphorylation. These enzymes can use various phosphoryl donors such as ATP, ADP, and polyphosphate. In several streptomycetes, ATP-glucose kinase (ATP-Glk) has been widely studied and regarded as the main glucose phosphorylating enzyme and is likely a regulatory protein in carbon catabolite repression. In cell extracts from the doxorubicin overproducing strain Streptomyces peucetius var. caesius, grown in glucose, a polyphosphate-dependent Glk (Pp-Glk) was detected by zymogram. Maximum activity was observed during the stationary growth phase (48 h) of cells grown in 100 mM glucose. No activity was detected when 20 mM glutamate was used as the only carbon source, supporting a role for glucose in inducing this enzyme. Contrary to wild-type strains of Streptomyces coelicolor, Streptomyces lividans, and Streptomyces thermocarboxydus K-155, S. peucetius var. caesius produced 1.8 times more Pp-Glk than ATP-Glk. In addition, this microorganism produced five and four times more Pp-Glk and anthracyclines, respectively, than its wild-type S. peucetius parent strain, supporting a role for this enzyme in antibiotic production in the overproducer strain. A cloned 726-bp DNA fragment from S. peucetius var. caesius encoded a putative Pp-Glk, with amino acid identities between 83 and 87 % to orthologous sequences from the above-cited streptomycetes. The cloned fragment showed the polyphosphate-binding sequences GXDIGGXXIK, TXGTGIGSA, and KEX(4)SWXXWA. Sequences for the Zn-binding motif were not detected in this fragment, suggesting that Pp-Glk is not related to the Glk ROK family of proteins. PMID:24687748

  15. Phosphorylation of Human Choline Kinase Beta by Protein Kinase A: Its Impact on Activity and Inhibition

    PubMed Central

    Chang, Ching Ching; Few, Ling Ling; Konrad, Manfred; See Too, Wei Cun

    2016-01-01

    Choline kinase beta (CKβ) is one of the CK isozymes involved in the biosynthesis of phosphatidylcholine. CKβ is important for normal mitochondrial function and muscle development as the lack of the ckβ gene in human and mice results in the development of muscular dystrophy. In contrast, CKα is implicated in tumorigenesis and has been extensively studied as an anticancer target. Phosphorylation of human CKα was found to regulate the enzyme’s activity and its subcellular location. This study provides evidence for CKβ phosphorylation by protein kinase A (PKA). In vitro phosphorylation of CKβ by PKA was first detected by phosphoprotein staining, as well as by in-gel kinase assays. The phosphorylating kinase was identified as PKA by Western blotting. CKβ phosphorylation by MCF-7 cell lysate was inhibited by a PKA-specific inhibitor peptide, and the intracellular phosphorylation of CKβ was shown to be regulated by the level of cyclic adenosine monophosphate (cAMP), a PKA activator. Phosphorylation sites were located on CKβ residues serine-39 and serine-40 as determined by mass spectrometry and site-directed mutagenesis. Phosphorylation increased the catalytic efficiencies for the substrates choline and ATP about 2-fold, without affecting ethanolamine phosphorylation, and the S39D/S40D CKβ phosphorylation mimic behaved kinetically very similar. Remarkably, phosphorylation drastically increased the sensitivity of CKβ to hemicholinium-3 (HC-3) inhibition by about 30-fold. These findings suggest that CKβ, in concert with CKα, and depending on its phosphorylation status, might play a critical role as a druggable target in carcinogenesis. PMID:27149373

  16. Protein-tyrosine Phosphatase and Kinase Specificity in Regulation of SRC and Breast Tumor Kinase* ♦

    PubMed Central

    Fan, Gaofeng; Aleem, Saadat; Yang, Ming; Miller, W. Todd; Tonks, Nicholas K.

    2015-01-01

    Despite significant evidence to the contrary, the view that phosphatases are “nonspecific” still pervades the field. Systems biology approaches to defining how signal transduction pathways are integrated at the level of whole organisms also often downplay the contribution of phosphatases, defining them as “erasers” that serve merely to restore the system to its basal state. Here, we present a study that counteracts the idea of “nonspecific phosphatases.” We have characterized two structurally similar and functionally related kinases, BRK and SRC, which are regulated by combinations of activating autophosphorylation and inhibitory C-terminal sites of tyrosine phosphorylation. We demonstrated specificity at the level of the kinases in that SRMS phosphorylated the C terminus of BRK, but not SRC; in contrast, CSK is the kinase responsible for C-terminal phosphorylation of SRC, but not BRK. For the phosphatases, we observed that RNAi-mediated suppression of PTP1B resulted in opposing effects on the activity of BRK and SRC and have defined the mechanisms underlying this specificity. PTP1B inhibited BRK by directly dephosphorylating the Tyr-342 autophosphorylation site. In contrast, PTP1B potentiated SRC activity, but not by dephosphorylating SRC itself directly; instead, PTP1B regulated the interaction between CBP/PAG and CSK. SRC associated with, and phosphorylated, the transmembrane protein CBP/PAG at Tyr-317, resulting in CSK recruitment. We identified PAG as a substrate of PTP1B, and dephosphorylation abolished recruitment of the inhibitory kinase CSK. Overall, these findings illustrate how the combinatorial effects of PTKs and PTPs may be integrated to regulate signaling, with both classes of enzymes displaying exquisite specificity. PMID:25897081

  17. Arginine kinase shows nucleoside diphosphate kinase-like activity toward deoxythymidine diphosphate.

    PubMed

    Lopez-Zavala, Alonso A; Sotelo-Mundo, Rogerio R; Hernandez-Flores, Jose M; Lugo-Sanchez, Maria E; Sugich-Miranda, Rocio; Garcia-Orozco, Karina D

    2016-06-01

    Arginine kinase (AK) (ATP: L-arginine phosphotransferase, E.C. 2.7.3.3) catalyzes the reversible transfer of ATP γ-phosphate group to L-arginine to synthetize phospho-arginine as a high-energy storage. Previous studies suggest additional roles for AK in cellular processes. Since AK is found only in invertebrates and it is homologous to creatine kinase from vertebrates, the objective of this work was to demonstrate nucleoside diphosphate kinase-like activity for shrimp AK. For this, AK from marine shrimp Litopenaeus vannamei (LvAK) was purified and its activity was assayed for phosphorylation of TDP using ATP as phosphate donor. Moreover, by using high-pressure liquid chromatography (HPLC) the phosphate transfer reaction was followed. Also, LvAK tryptophan fluorescence emission changes were detected by dTDP titration, suggesting that the hydrophobic environment of Trp 221, which is located in the top of the active site, is perturbed upon dTDP binding. The kinetic constants for both substrates Arg and dTDP were calculated by isothermal titration calorimetry (ITC). Besides, docking calculations suggested that dTDP could bind LvAK in the same cavity where ATP bind, and LvAK basic residues (Arg124, 126 and 309) stabilize the dTDP phosphate groups and the pyrimidine base interact with His284 and Ser122. These results suggest that LvAK bind and phosphorylate dTDP being ATP the phosphate donor, thus describing a novel alternate nucleoside diphosphate kinase-like activity for this enzyme. PMID:27072556

  18. Venus Kinase Receptors: Prospects in Signaling and Biological Functions of These Invertebrate Kinases

    PubMed Central

    Dissous, Colette; Morel, Marion; Vanderstraete, Mathieu

    2014-01-01

    Venus kinase receptors (VKRs) form a family of invertebrate receptor tyrosine kinases (RTKs) initially discovered in the parasitic platyhelminth Schistosoma mansoni. VKRs are single transmembrane receptors that contain an extracellular venus fly trap structure similar to the ligand-binding domain of G protein-coupled receptors of class C, and an intracellular tyrosine kinase domain close to that of insulin receptors. VKRs are found in a large variety of invertebrates from cnidarians to echinoderms and are highly expressed in larval stages and in gonads, suggesting a role of these proteins in embryonic and larval development as well as in reproduction. VKR gene silencing could demonstrate the function of these receptors in oogenesis as well as in spermatogenesis in S. mansoni. VKRs are activated by amino acids and are highly responsive to arginine. As many other RTKs, they form dimers when activated by ligands and induce intracellular pathways involved in protein synthesis and cellular growth, such as MAPK and PI3K/Akt/S6K pathways. VKRs are not present in vertebrates or in some invertebrate species. Questions remain open about the origin of this little-known RTK family in evolution and its role in emergence and specialization of Metazoa. What is the meaning of maintenance or loss of VKR in some phyla or species in terms of development and physiological functions? The presence of VKRs in invertebrates of economical and medical importance, such as pests, vectors of pathogens, and platyhelminth parasites, and the implication of these RTKs in gametogenesis and reproduction processes are valuable reasons to consider VKRs as interesting targets in new programs for eradication/control of pests and infectious diseases, with the main advantage in the case of parasite targeting that VKR counterparts are absent from the vertebrate host kinase panel. PMID:24860549

  19. Venus kinase receptors: prospects in signaling and biological functions of these invertebrate kinases.

    PubMed

    Dissous, Colette; Morel, Marion; Vanderstraete, Mathieu

    2014-01-01

    Venus kinase receptors (VKRs) form a family of invertebrate receptor tyrosine kinases (RTKs) initially discovered in the parasitic platyhelminth Schistosoma mansoni. VKRs are single transmembrane receptors that contain an extracellular venus fly trap structure similar to the ligand-binding domain of G protein-coupled receptors of class C, and an intracellular tyrosine kinase domain close to that of insulin receptors. VKRs are found in a large variety of invertebrates from cnidarians to echinoderms and are highly expressed in larval stages and in gonads, suggesting a role of these proteins in embryonic and larval development as well as in reproduction. VKR gene silencing could demonstrate the function of these receptors in oogenesis as well as in spermatogenesis in S. mansoni. VKRs are activated by amino acids and are highly responsive to arginine. As many other RTKs, they form dimers when activated by ligands and induce intracellular pathways involved in protein synthesis and cellular growth, such as MAPK and PI3K/Akt/S6K pathways. VKRs are not present in vertebrates or in some invertebrate species. Questions remain open about the origin of this little-known RTK family in evolution and its role in emergence and specialization of Metazoa. What is the meaning of maintenance or loss of VKR in some phyla or species in terms of development and physiological functions? The presence of VKRs in invertebrates of economical and medical importance, such as pests, vectors of pathogens, and platyhelminth parasites, and the implication of these RTKs in gametogenesis and reproduction processes are valuable reasons to consider VKRs as interesting targets in new programs for eradication/control of pests and infectious diseases, with the main advantage in the case of parasite targeting that VKR counterparts are absent from the vertebrate host kinase panel. PMID:24860549

  20. DIRECT MODULATION OF THE PROTEIN KINASE A CATALYTIC SUBUNIT α BY GROWTH FACTOR RECEPTOR TYROSINE KINASES

    PubMed Central

    Caldwell, George B.; Howe, Alan K.; Nickl, Christian K.; Dostmann, Wolfgang R.; Ballif, Bryan A.; Deming, Paula B.

    2011-01-01

    The cyclic-AMP-dependent protein kinase A (PKA) regulates processes such as cell proliferation and migration following activation of growth factor receptor tyrosine kinases (RTKs), yet the signaling mechanisms that link PKA with growth factor receptors remain largely undefined. Here we report that RTKs can directly modulate the function of the catalytic subunit of PKA (PKA-C) through post-translational modification. In vitro kinase assays revealed that both the epidermal growth factor and platelet derived growth factor receptors (EGFR and PDGFR, respectively) tyrosine phosphorylate PKA-C. Mass spectrometry identified tyrosine 330 (Y330) as a receptor-mediated phosphorylation site and mutation of Y330 to phenylalanine (Y330F) all but abolished the RTK-mediated phosphorylation of PKA-C in vitro. Y330 resides within a conserved region at the C-terminal tail of PKA-C that allosterically regulates enzymatic activity. Therefore, the effect of phosphorylation at Y330 on the activity of PKA-C was investigated. The Km for a peptide substrate was markedly decreased when PKA-C subunits were tyrosine phosphorylated by the receptors as compared to un-phosphorylated controls. Importantly, tyrosine-phosphorylated PKA-C subunits were detected in cells stimulated with EGF, PDGF and FGF2 and in fibroblasts undergoing PDGF-mediated chemotaxis. These results demonstrate a direct, functional interaction between RTKs and PKA-C and identify tyrosine phosphorylation as a novel mechansim for regulating PKA activity. PMID:21866565

  1. Glycogen synthase kinase 3β suppresses polyglutamine aggregation by inhibiting Vaccinia-related kinase 2 activity

    PubMed Central

    Lee, Eunju; Ryu, Hye Guk; Kim, Sangjune; Lee, Dohyun; Jeong, Young-Hun; Kim, Kyong-Tai

    2016-01-01

    Huntington’s disease (HD) is a neurodegenerative disorder caused by an abnormal expansion of polyglutamine repeats in the N-terminal of huntingtin. The amount of aggregate-prone protein is controlled by various mechanisms, including molecular chaperones. Vaccinia-related kinase 2 (VRK2) is known to negatively regulate chaperonin TRiC, and VRK2-facilitated degradation of TRiC increases polyQ protein aggregation, which is involved in HD. We found that VRK2 activity was negatively controlled by glycogen synthase kinase 3β (GSK3β). GSK3β directly bound to VRK2 and inhibited the catalytic activity of VRK2 in a kinase activity-independent manner. Furthermore, GSK3β increased the stability of TRiC and decreased the formation of HttQ103-GFP aggregates by inhibiting VRK2. These results indicate that GSK3β signaling may be a regulatory mechanism of HD progression and suggest targets for further therapeutic trials for HD. PMID:27377031

  2. Aurora Kinases and Potential Medical Applications of Aurora Kinase Inhibitors: A Review

    PubMed Central

    Gavriilidis, Paschalis; Giakoustidis, Alexandros; Giakoustidis, Dimitrios

    2015-01-01

    Aurora kinases (AKs) represent a novel group of serine/threonine kinases. They were originally described in 1995 by David Glover in the course of studies of mutant alleles characterized with unusual spindle pole configuration in Drosophila melanogaster. Thus far, three AKs A, B, and C have been discovered in human healthy and neoplastic cells. Each one locates in different subcellular locations and they are all nuclear proteins. AKs are playing an essential role in mitotic events such as monitoring of the mitotic checkpoint, creation of bipolar mitotic spindle and alignment of centrosomes on it, also regulating centrosome separation, bio-orientation of chromosomes and cytokinesis. Any inactivation of them can have catastrophic consequences on mitotic events of spindle formation, alignment of centrosomes and cytokinesis, resulting in apoptosis. Overexpression of AKs has been detected in diverse solid and hematological cancers and has been linked with a dismal prognosis. After discovery and identification of the first aurora kinase inhibitor (AKI) ZM447439 as a potential drug for targeted therapy in cancer treatment, approximately 30 AKIs have been introduced in cancer treatment. PMID:26345296

  3. Tank binding kinase 1 is a centrosome-associated kinase necessary for microtubule dynamics and mitosis

    PubMed Central

    Pillai, Smitha; Nguyen, Jonathan; Johnson, Joseph; Haura, Eric; Coppola, Domenico; Chellappan, Srikumar

    2015-01-01

    TANK Binding Kinase 1 (TBK1) is a non-canonical IκB kinase that contributes to KRAS-driven lung cancer. Here we report that TBK1 plays essential roles in mammalian cell division. Specifically, levels of active phospho-TBK1 increase during mitosis and localize to centrosomes, mitotic spindles and midbody, and selective inhibition or silencing of TBK1 triggers defects in spindle assembly and prevents mitotic progression. TBK1 binds to the centrosomal protein CEP170 and to the mitotic apparatus protein NuMA, and both CEP170 and NuMA are TBK1 substrates. Further, TBK1 is necessary for CEP170 centrosomal localization and binding to the microtubule depolymerase Kif2b, and for NuMA binding to dynein. Finally, selective disruption of the TBK1–CEP170 complex augments microtubule stability and triggers defects in mitosis, suggesting that TBK1 functions as a mitotic kinase necessary for microtubule dynamics and mitosis. PMID:26656453

  4. Diacylglycerol kinase regulation of protein kinase D during oxidative stress-induced intestinal cell injury

    SciTech Connect

    Song Jun; Li Jing; Mourot, Joshua M.; Mark Evers, B.; Chung, Dai H.

    2008-10-17

    We recently demonstrated that protein kinase D (PKD) exerts a protective function during oxidative stress-induced intestinal epithelial cell injury; however, the exact role of DAG kinase (DGK){zeta}, an isoform expressed in intestine, during this process is unknown. We sought to determine the role of DGK during oxidative stress-induced intestinal cell injury and whether DGK acts as an upstream regulator of PKD. Inhibition of DGK with R59022 compound or DGK{zeta} siRNA transfection decreased H{sub 2}O{sub 2}-induced RIE-1 cell apoptosis as measured by DNA fragmentation and increased PKD phosphorylation. Overexpression of kinase-dead DGK{zeta} also significantly increased PKD phosphorylation. Additionally, endogenous nuclear DGK{zeta} rapidly translocated to the cytoplasm following H{sub 2}O{sub 2} treatment. Our findings demonstrate that DGK is involved in the regulation of oxidative stress-induced intestinal cell injury. PKD activation is induced by DGK{zeta}, suggesting DGK is an upstream regulator of oxidative stress-induced activation of the PKD signaling pathway in intestinal epithelial cells.

  5. Maternal embryonic leucine zipper kinase: key kinase for stem cell phenotype in glioma and other cancers.

    PubMed

    Ganguly, Ranjit; Hong, Christopher S; Smith, Luke G F; Kornblum, Harley I; Nakano, Ichiro

    2014-06-01

    Maternal embryonic leucine zipper kinase (MELK) is a member of the snf1/AMPK family of protein serine/threonine kinases that has recently gained significant attention in the stem cell and cancer biology field. Recent studies suggest that activation of this kinase is tightly associated with extended survival and accelerated proliferation of cancer stem cells (CSC) in various organs. Overexpression of MELK has been noted in various cancers, including colon, breast, ovaries, pancreas, prostate, and brain, making the inhibition of MELK an attractive therapeutic strategy for a variety of cancers. In the experimental cancer models, depletion of MELK by RNA interference or small molecule inhibitors induces apoptotic cell death of CSCs derived from glioblastoma multiforme and breast cancer, both in vitro and in vivo. Mechanism of action of MELK includes, yet may not be restricted to, direct binding and activation of the oncogenic transcription factors c-JUN and FOXM1 in cancer cells but not in the normal counterparts. Following these preclinical studies, the phase I clinical trial for advanced cancers with OTSSP167 started in 2013, as the first-in-class MELK inhibitor. This review summarizes the current molecular understanding of MELK and the recent preclinical studies about MELK as a cancer therapeutic target. PMID:24795222

  6. Protein kinase C mediates platelet secretion and thrombus formation through protein kinase D2

    PubMed Central

    Konopatskaya, Olga; Matthews, Sharon A.; Harper, Matthew T.; Gilio, Karen; Cosemans, Judith M. E. M.; Williams, Christopher M.; Navarro, Maria N.; Carter, Deborah A.; Heemskerk, Johan W. M.; Leitges, Michael; Cantrell, Doreen; Poole, Alastair W.

    2016-01-01

    Platelets are highly specialized blood cells critically involved in hemostasis and thrombosis. Members of the protein kinase C (PKC) family have established roles in regulating platelet function and thrombosis, but the molecular mechanisms are not clearly understood. In particular, the conventional PKC isoform, PKCα, is a major regulator of platelet granule secretion, but the molecular pathway from PKCα to secretion is not defined. Protein kinase D (PKD) is a family of 3 kinases activated by PKC, which may represent a step in the PKC signaling pathway to secretion. In the present study, we show that PKD2 is the sole PKD member regulated downstream of PKC in platelets, and that the conventional, but not novel, PKC isoforms provide the upstream signal. Platelets from a gene knock-in mouse in which 2 key phosphorylation sites in PKD2 have been mutated (Ser707Ala/Ser711Ala) show a significant reduction in agonist-induced dense granule secretion, but not in α-granule secretion. This deficiency in dense granule release was responsible for a reduced platelet aggregation and a marked reduction in thrombus formation. Our results show that in the molecular pathway to secretion, PKD2 is a key component of the PKC-mediated pathway to platelet activation and thrombus formation through its selective regulation of dense granule secretion. PMID:21527521

  7. Glycogen synthase kinase 3β suppresses polyglutamine aggregation by inhibiting Vaccinia-related kinase 2 activity.

    PubMed

    Lee, Eunju; Ryu, Hye Guk; Kim, Sangjune; Lee, Dohyun; Jeong, Young-Hun; Kim, Kyong-Tai

    2016-01-01

    Huntington's disease (HD) is a neurodegenerative disorder caused by an abnormal expansion of polyglutamine repeats in the N-terminal of huntingtin. The amount of aggregate-prone protein is controlled by various mechanisms, including molecular chaperones. Vaccinia-related kinase 2 (VRK2) is known to negatively regulate chaperonin TRiC, and VRK2-facilitated degradation of TRiC increases polyQ protein aggregation, which is involved in HD. We found that VRK2 activity was negatively controlled by glycogen synthase kinase 3β (GSK3β). GSK3β directly bound to VRK2 and inhibited the catalytic activity of VRK2 in a kinase activity-independent manner. Furthermore, GSK3β increased the stability of TRiC and decreased the formation of HttQ103-GFP aggregates by inhibiting VRK2. These results indicate that GSK3β signaling may be a regulatory mechanism of HD progression and suggest targets for further therapeutic trials for HD. PMID:27377031

  8. Phosphoinositide 3-kinase enhancer (PIKE) in the brain: is it simply a phosphoinositide 3-kinase/Akt enhancer?

    PubMed Central

    Chan, Chi Bun; Ye, Keqiang

    2013-01-01

    Since its discovery in 2000, phosphoinositide 3-kinase enhancer (PIKE) has been recognized as a class of GTPase that controls the enzymatic activities of phosphoinositide 3-kinase (PI3K) and Akt in the central nervous system (CNS). However, recent studies suggest that PIKEs are not only enhancers to PI3K/Akt but also modulators to other kinases including insulin receptor tyrosine kinase and focal adhesion kinases. Moreover, they regulate transcription factors such as signal transducer and activator of transcription and nuclear factor κB. Indeed, PIKE proteins participate in multiple cellular processes including control of cell survival, brain development, memory formation, gene transcription, and metabolism. In this review, we have summarized the functions of PIKE proteins in CNS and discussed their potential implications in various neurological disorders. PMID:22499674

  9. Growth inhibition of human lung adenocarcinoma cells by antibodies against epidermal growth factor receptor and by ganglioside GM3: involvement of receptor-directed protein tyrosine phosphatase(s).

    PubMed Central

    Suarez Pestana, E.; Greiser, U.; Sánchez, B.; Fernández, L. E.; Lage, A.; Perez, R.; Böhmer, F. D.

    1997-01-01

    Growth of the EGF receptor-expressing non-small-cell lung carcinoma cell line H125 seems to be at least partially driven by autocrine activation of the resident EGF receptors. Thus, the possibility of an EGF receptor-directed antiproliferative treatment was investigated in vitro using a monoclonal antibody (alpha EGFR ior egf/r3) against the human EGF receptor and gangliosides which are known to possess antiproliferative and anti-tyrosine kinase activity. The moderate growth-inhibitory effect of alpha EGFR ior egf/r3 was strongly potentiated by the addition of monosialoganglioside GM3. Likewise, the combination of alpha EGFR ior egf/r3 and GM3 inhibited EGF receptor autophosphorylation activity in H125 cells more strongly than either agent alone. A synergistic inhibition of EGF receptor autophosphorylation by alpha EGFR ior egf/r3 and GM3 was also observed in the human epidermoid carcinoma cell line A431. In both cell lines, the inhibition of EGF receptor autophosphorylation by GM3 was prevented by pretreatment of the cells with pervanadate, a potent inhibitor of protein tyrosine phosphatases (PTPases). Also, GM3 accelerated EGF receptor dephosphorylation in isolated A431 cell membranes. These findings indicate that GM3 has the capacity to activate EGF receptor-directed PTPase activity and suggest a novel possible mechanism for the regulation of cellular PTPases. Images Figure 5 Figure 6 PMID:9010029

  10. Requirement for the Kinase Activity of Human DNA-Dependent Protein Kinase Catalytic Subunit in DNA Strand Break Rejoining

    PubMed Central

    Kurimasa, Akihiro; Kumano, Satoshi; Boubnov, Nikolai V.; Story, Michael D.; Tung, Chang-Shung; Peterson, Scott R.; Chen, David J.

    1999-01-01

    The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an enormous, 470-kDa protein serine/threonine kinase that has homology with members of the phosphatidylinositol (PI) 3-kinase superfamily. This protein contributes to the repair of DNA double-strand breaks (DSBs) by assembling broken ends of DNA molecules in combination with the DNA-binding factors Ku70 and Ku80. It may also serve as a molecular scaffold for recruiting DNA repair factors to DNA strand breaks. This study attempts to better define the role of protein kinase activity in the repair of DNA DSBs. We constructed a contiguous 14-kb human DNA-PKcs cDNA and demonstrated that it can complement the DNA DSB repair defects of two mutant cell lines known to be deficient in DNA-PKcs (M059J and V3). We then created deletion and site-directed mutations within the conserved PI 3-kinase domain of the DNA-PKcs gene to test the importance of protein kinase activity for DSB rejoining. These DNA-PKcs mutant constructs are able to express the protein but fail to complement the DNA DSB or V(D)J recombination defects of DNA-PKcs mutant cells. These results indicate that the protein kinase activity of DNA-PKcs is essential for the rejoining of DNA DSBs in mammalian cells. We have also determined a model structure for the DNA-PKcs kinase domain based on comparisons to the crystallographic structure of a cyclic AMP-dependent protein kinase. This structure gives some insight into which amino acid residues are crucial for the kinase activity in DNA-PKcs. PMID:10207111

  11. A protein kinase screen of Neurospora crassa mutant strains reveals that the SNF1 protein kinase promotes glycogen synthase phosphorylation.

    PubMed

    Candido, Thiago De Souza; Gonçalves, Rodrigo Duarte; Felício, Ana Paula; Freitas, Fernanda Zanolli; Cupertino, Fernanda Barbosa; De Carvalho, Ana Carolina Gomes Vieira; Bertolini, Maria Célia

    2014-12-15

    Glycogen functions as a carbohydrate reserve in a variety of organisms and its metabolism is highly regulated. The activities of glycogen synthase and glycogen phosphorylase, the rate-limiting enzymes of the synthesis and degradation processes, respectively, are regulated by allosteric modulation and reversible phosphorylation. To identify the protein kinases affecting glycogen metabolism in Neurospora crassa, we performed a screen of 84 serine/threonine kinase knockout strains. We identified multiple kinases that have already been described as controlling glycogen metabolism in different organisms, such as NcSNF1, NcPHO85, NcGSK3, NcPKA, PSK2 homologue and NcATG1. In addition, many hypothetical kinases have been implicated in the control of glycogen metabolism. Two kinases, NcIME-2 and NcNIMA, already functionally characterized but with no functions related to glycogen metabolism regulation, were also identified. Among the kinases identified, it is important to mention the role of NcSNF1. We showed in the present study that this kinase was implicated in glycogen synthase phosphorylation, as demonstrated by the higher levels of glycogen accumulated during growth, along with a higher glycogen synthase (GSN) ±glucose 6-phosphate activity ratio and a lesser set of phosphorylated GSN isoforms in strain Ncsnf1KO, when compared with the wild-type strain. The results led us to conclude that, in N. crassa, this kinase promotes phosphorylation of glycogen synthase either directly or indirectly, which is the opposite of what is described for Saccharomyces cerevisiae. The kinases also play a role in gene expression regulation, in that gdn, the gene encoding the debranching enzyme, was down-regulated by the proteins identified in the screen. Some kinases affected growth and development, suggesting a connection linking glycogen metabolism with cell growth and development. PMID:25253091

  12. Cell cycle regulation of a Xenopus Wee1-like kinase.

    PubMed Central

    Mueller, P R; Coleman, T R; Dunphy, W G

    1995-01-01

    Using a polymerase chain reaction-based strategy, we have isolated a gene encoding a Wee1-like kinase from Xenopus eggs. The recombinant Xenopus Wee1 protein efficiently phosphorylates Cdc2 exclusively on Tyr-15 in a cyclin-dependent manner. The addition of exogenous Wee1 protein to Xenopus cell cycle extracts results in a dose-dependent delay of mitotic initiation that is accompanied by enhanced tyrosine phosphorylation of Cdc2. The activity of the Wee1 protein is highly regulated during the cell cycle: the interphase, underphosphorylated form of Wee1 (68 kDa) phosphorylates Cdc2 very efficiently, whereas the mitotic, hyperphosphorylated version (75 kDa) is weakly active as a Cdc2-specific tyrosine kinase. The down-modulation of Wee1 at mitosis is directly attributable to phosphorylation, since dephosphorylation with protein phosphatase 2A restores its kinase activity. During interphase, the activity of this Wee1 homolog does not vary in response to the presence of unreplicated DNA. The mitosis-specific phosphorylation of Wee1 is due to at least two distinct kinases: the Cdc2 protein and another activity (kinase X) that may correspond to an MPM-2 epitope kinase. These studies indicate that the down-regulation of Wee1-like kinase activity at mitosis is a multistep process that occurs after other biochemical reactions have signaled the successful completion of S phase. Images PMID:7749193

  13. A novel nonreceptor tyrosine kinase, Srm: cloning and targeted disruption.

    PubMed Central

    Kohmura, N; Yagi, T; Tomooka, Y; Oyanagi, M; Kominami, R; Takeda, N; Chiba, J; Ikawa, Y; Aizawa, S

    1994-01-01

    We have isolated a novel nonreceptor tyrosine kinase, Srm, that maps to the distal end of chromosome 2. It has SH2, SH2', and SH3 domains and a tyrosine residue for autophosphorylation in the kinase domain but lacks an N-terminal glycine for myristylation and a C-terminal tyrosine which, when phosphorylated, suppresses kinase activity. These are structural features of the recently identified Tec family of nonreceptor tyrosine kinases. The Srm N-terminal unique domain, however, lacks the structural characteristics of the Tec family kinases, and the sequence similarity is highest to Src in the SH region. The expression of two transcripts is rather ubiquitous and changes according to tissue and developmental stage. Mutant mice were generated by gene targeting in embryonic stem cells but displayed no apparent phenotype as in mutant mice expressing Src family kinases. These results suggest that Srm constitutes a new family of nonreceptor tyrosine kinases that may be redundant in function. Images PMID:7935409

  14. Unconventional Functions of Mitotic Kinases in Kidney Tumorigenesis

    PubMed Central

    Hascoet, Pauline; Chesnel, Franck; Le Goff, Cathy; Le Goff, Xavier; Arlot-Bonnemains, Yannick

    2015-01-01

    Human tumors exhibit a variety of genetic alterations, including point mutations, translocations, gene amplifications and deletions, as well as aneuploid chromosome numbers. For carcinomas, aneuploidy is associated with poor patient outcome for a large variety of tumor types, including breast, colon, and renal cell carcinoma. The Renal cell carcinoma (RCC) is a heterogeneous carcinoma consisting of different histologic types. The clear renal cell carcinoma (ccRCC) is the most common subtype and represents 85% of the RCC. Central to the biology of the ccRCC is the loss of function of the Von Hippel–Lindau gene, but is also associated with genetic instability that could be caused by abrogation of the cell cycle mitotic spindle checkpoint and may involve the Aurora kinases, which regulate centrosome maturation. Aneuploidy can also result from the loss of cell–cell adhesion and apical–basal cell polarity that also may be regulated by the mitotic kinases (polo-like kinase 1, casein kinase 2, doublecortin-like kinase 1, and Aurora kinases). In this review, we describe the “non-mitotic” unconventional functions of these kinases in renal tumorigenesis. PMID:26579493

  15. Structure of the intact ATM/Tel1 kinase

    PubMed Central

    Wang, Xuejuan; Chu, Huanyu; Lv, Mengjuan; Zhang, Zhihui; Qiu, Shuwan; Liu, Haiyan; Shen, Xuetong; Wang, Weiwu; Cai, Gang

    2016-01-01

    The ataxia-telangiectasia mutated (ATM) protein is an apical kinase that orchestrates the multifaceted DNA-damage response. Normally, ATM kinase is in an inactive, homodimer form and is transformed into monomers upon activation. Besides a conserved kinase domain at the C terminus, ATM contains three other structural modules, referred to as FAT, FATC and N-terminal helical solenoid. Here we report the first cryo-EM structure of ATM kinase, which is an intact homodimeric ATM/Tel1 from Schizosaccharomyces pombe. We show that two monomers directly contact head-to-head through the FAT and kinase domains. The tandem N-terminal helical solenoid tightly packs against the FAT and kinase domains. The structure suggests that ATM/Tel1 dimer interface and the consecutive HEAT repeats inhibit the binding of kinase substrates and regulators by steric hindrance. Our study provides a structural framework for understanding the mechanisms of ATM/Tel1 regulation as well as the development of new therapeutic agents. PMID:27229179

  16. Discovery of selective RIO2 kinase small molecule ligand.

    PubMed

    Varin, Thibault; Godfrey, Alexander G; Masquelin, Thierry; Nicolaou, Christos A; Evans, David A; Vieth, Michal

    2015-10-01

    We report the discovery and initial optimization of diphenpyramide and several of its analogs as hRIO2 kinase ligands. One of these analogs is the most selective hRIO2 ligand reported to date. Diphenpyramide is a Cyclooxygenase 1 and 2 inhibitor that was used as an anti-inflammatory agent. The RIO2 kinase affinity of diphenpyramide was discovered by serendipity while profiling of 13 marketed drugs on a large 456 kinase assay panel. The inhibition values also suggested a relative selectivity of diphenpyramide for RIO2 against the other kinases in the panel. Subsequently three available and eight newly synthesized analogs were assayed, one of which showed a 10 fold increased hRIO2 binding affinity. Additionally, this compound shows significantly better selectivity over assayed kinases, when compared to currently known RIO2 inhibitors. As RIO2 is involved in the biosynthesis of the ribosome and cell cycle regulation, our selective ligand may be useful for the delineation of the biological role of this kinase. This article is part of a Special Issue entitled: Inhibitors of Protein Kinases. PMID:25891899

  17. LRRK2 and ubiquitination: implications for kinase inhibitor therapy

    PubMed Central

    Melrose, Heather L.

    2015-01-01

    Pathogenic mutations and risk variants in LRRK2 (leucine-rich repeat kinase 2) represent the most common genetic cause of familial and sporadic PD (Parkinson's disease). LRRK2 protein is widely expressed throughout the brain and the periphery. Structurally, LRRK2 contains several functional domains, including a dual enzymatic core consisting of a kinase and GTPase domain. Disease-linked variants are found in both these enzymatic domains as well as in the COR [C-terminal of ROC (Ras of complex proteins)] and WD40 protein–protein binding domain. The kinase domain is widely believed to be linked to toxicity, and thus the thrust of pharmaceutical effort has focused on developing LRRK2 kinase inhibitors. However, recent data have suggested that inhibition of LRRK2 activity results in reduced LRRK2 levels and peripheral side effects, which are similar to those observed in homozygous LRRK2-knockout and LRRK2 kinase-dead rodent models. In a recent issue of the Biochemical Journal, a study led by Nichols reveals that dephosphorylation of LRRK2 cellular phosphorylation sites (Ser910/Ser935/Ser955/Ser973) triggers its ubiquitination and subsequent degradation and thus may account for the loss of function phenotypes observed in peripheral tissues in LRRK2-knockout/kinase-dead or inhibitor-treated rodents and primates. Albeit negative from a kinase inhibitor standpoint, the data open new avenues for LRRK2 biology and therapeutic approaches to counteract LRRK2 toxicity. PMID:26341487

  18. Activation of Cytosolic Pyruvate Kinase by Polyethylene Glycol.

    PubMed Central

    Podesta, F. E.; Plaxton, W. C.

    1993-01-01

    Homogeneous cytosolic pyruvate kinase from endosperm of germinating castor oil (Ricinus communis L. cv Hale) seeds was potently activated by polyethylene glycol. The addition of 5% (w/v) polyethylene glycol to the pyruvate kinase reaction mixture caused a 2.6-fold increase in maximal velocity and 12.5- and 2-fold reductions in Km values for phosphoenolpyruvate and ADP, respectively. Glycerol, ethylene glycol, and bovine serum albumin also enhanced pyruvate kinase activity, albeit to a lesser extent than polyethylene glycol. The addition of 5% (w/v) polyethylene glycol to the elution buffer during high-performance gel filtration chromatography of purified cytosolic pyruvate kinase helped to stabilize the active heterotetrameric native structure of the enzyme. A higher degree of inhibition by MgATP, but lower sensitivity to the inhibitors 3-phosphoglycerate and fructose- 1,6-bisphosphate, was also observed in the presence of 5% (w/v) polyethylene glycol. It is concluded that (a) plant cytosolic pyruvate kinase activity and regulation, like that of other regulatory pyruvate kinases, is modified by extreme dilution in the assay medium, probably as a result of deaggregation of the native tetrameric enzyme, and (b) ATP is probably the major metabolic effector of germinating castor endosperm cytosolic pyruvate kinase in vivo. PMID:12231936

  19. Activation of Cytosolic Pyruvate Kinase by Polyethylene Glycol.

    PubMed

    Podesta, F. E.; Plaxton, W. C.

    1993-09-01

    Homogeneous cytosolic pyruvate kinase from endosperm of germinating castor oil (Ricinus communis L. cv Hale) seeds was potently activated by polyethylene glycol. The addition of 5% (w/v) polyethylene glycol to the pyruvate kinase reaction mixture caused a 2.6-fold increase in maximal velocity and 12.5- and 2-fold reductions in Km values for phosphoenolpyruvate and ADP, respectively. Glycerol, ethylene glycol, and bovine serum albumin also enhanced pyruvate kinase activity, albeit to a lesser extent than polyethylene glycol. The addition of 5% (w/v) polyethylene glycol to the elution buffer during high-performance gel filtration chromatography of purified cytosolic pyruvate kinase helped to stabilize the active heterotetrameric native structure of the enzyme. A higher degree of inhibition by MgATP, but lower sensitivity to the inhibitors 3-phosphoglycerate and fructose- 1,6-bisphosphate, was also observed in the presence of 5% (w/v) polyethylene glycol. It is concluded that (a) plant cytosolic pyruvate kinase activity and regulation, like that of other regulatory pyruvate kinases, is modified by extreme dilution in the assay medium, probably as a result of deaggregation of the native tetrameric enzyme, and (b) ATP is probably the major metabolic effector of germinating castor endosperm cytosolic pyruvate kinase in vivo. PMID:12231936

  20. Structure of the intact ATM/Tel1 kinase

    NASA Astrophysics Data System (ADS)

    Wang, Xuejuan; Chu, Huanyu; Lv, Mengjuan; Zhang, Zhihui; Qiu, Shuwan; Liu, Haiyan; Shen, Xuetong; Wang, Weiwu; Cai, Gang

    2016-05-01

    The ataxia-telangiectasia mutated (ATM) protein is an apical kinase that orchestrates the multifaceted DNA-damage response. Normally, ATM kinase is in an inactive, homodimer form and is transformed into monomers upon activation. Besides a conserved kinase domain at the C terminus, ATM contains three other structural modules, referred to as FAT, FATC and N-terminal helical solenoid. Here we report the first cryo-EM structure of ATM kinase, which is an intact homodimeric ATM/Tel1 from Schizosaccharomyces pombe. We show that two monomers directly contact head-to-head through the FAT and kinase domains. The tandem N-terminal helical solenoid tightly packs against the FAT and kinase domains. The structure suggests that ATM/Tel1 dimer interface and the consecutive HEAT repeats inhibit the binding of kinase substrates and regulators by steric hindrance. Our study provides a structural framework for understanding the mechanisms of ATM/Tel1 regulation as well as the development of new therapeutic agents.

  1. Indolinones as promising scaffold as kinase inhibitors: a review.

    PubMed

    Prakash, C R; Raja, S

    2012-02-01

    Kinases are probably the most important signaling enzymes, which represent about 20% of the druggable genome. Currently, more than 150 kinases are known. So, kinase inhibition therapy has become a very important area of drug research since most of our diseases are related to intra or intercellular signaling by kinases. Indole alkaloids are extensively studied for their biological activities in several pharmaceutical areas, including, for example, antitumor. Among this chemical family, indolinone displays very promising antitumor properties by inhibiting various kinase families. These small molecules have a low molecular weight and most of them bind to protein kinases competing with ATP for the ATP-binding site. This review focuses on the indolinone based drugs approved for the treatment of cancer, drugs under clinical trial and then chemical diversity of various synthetic analogues of indolinone and their metabolites as various kinase inhibitors. This review also focused on structural activity relationship (SAR), mechanisms of action and biological targets through which indolinone and its derivatives display their antitumor activity. PMID:22372601

  2. Structure of the intact ATM/Tel1 kinase.

    PubMed

    Wang, Xuejuan; Chu, Huanyu; Lv, Mengjuan; Zhang, Zhihui; Qiu, Shuwan; Liu, Haiyan; Shen, Xuetong; Wang, Weiwu; Cai, Gang

    2016-01-01

    The ataxia-telangiectasia mutated (ATM) protein is an apical kinase that orchestrates the multifaceted DNA-damage response. Normally, ATM kinase is in an inactive, homodimer form and is transformed into monomers upon activation. Besides a conserved kinase domain at the C terminus, ATM contains three other structural modules, referred to as FAT, FATC and N-terminal helical solenoid. Here we report the first cryo-EM structure of ATM kinase, which is an intact homodimeric ATM/Tel1 from Schizosaccharomyces pombe. We show that two monomers directly contact head-to-head through the FAT and kinase domains. The tandem N-terminal helical solenoid tightly packs against the FAT and kinase domains. The structure suggests that ATM/Tel1 dimer interface and the consecutive HEAT repeats inhibit the binding of kinase substrates and regulators by steric hindrance. Our study provides a structural framework for understanding the mechanisms of ATM/Tel1 regulation as well as the development of new therapeutic agents. PMID:27229179

  3. Mechanism of substrate specificity of phosphatidylinositol phosphate kinases.

    PubMed

    Muftuoglu, Yagmur; Xue, Yi; Gao, Xiang; Wu, Dianqing; Ha, Ya

    2016-08-01

    The phosphatidylinositol phosphate kinase (PIPK) family of enzymes is primarily responsible for converting singly phosphorylated phosphatidylinositol derivatives to phosphatidylinositol bisphosphates. As such, these kinases are central to many signaling and membrane trafficking processes in the eukaryotic cell. The three types of phosphatidylinositol phosphate kinases are homologous in sequence but differ in catalytic activities and biological functions. Type I and type II kinases generate phosphatidylinositol 4,5-bisphosphate from phosphatidylinositol 4-phosphate and phosphatidylinositol 5-phosphate, respectively, whereas the type III kinase produces phosphatidylinositol 3,5-bisphosphate from phosphatidylinositol 3-phosphate. Based on crystallographic analysis of the zebrafish type I kinase PIP5Kα, we identified a structural motif unique to the kinase family that serves to recognize the monophosphate on the substrate. Our data indicate that the complex pattern of substrate recognition and phosphorylation results from the interplay between the monophosphate binding site and the specificity loop: the specificity loop functions to recognize different orientations of the inositol ring, whereas residues flanking the phosphate binding Arg244 determine whether phosphatidylinositol 3-phosphate is exclusively bound and phosphorylated at the 5-position. This work provides a thorough picture of how PIPKs achieve their exquisite substrate specificity. PMID:27439870

  4. Variable intron/exon structure in the oligochaete lombricine kinase gene.

    PubMed

    Doumen, Chris

    2012-09-01

    Lombricine kinase is an annelid enzyme that belongs to the phosphagen kinase family of which creatine kinase and arginine kinase are the typical representatives. The enzymes play important roles in the cellular energy metabolism of animals. Biochemical, physiological and molecular information with respect to lombricine kinase is limited compared to other phosphagen kinases. This study presents data on the cDNA sequences of lombricine kinase from two smaller oligochaetes, Enchytraeus sp. and Stylaria sp. The deduced amino acid sequences are analyzed and compared with other selected phosphagen kinases. The intron/exon structure of the lombricine kinase gene was determined for these two species as well as two additional oligochaetes, Lumbriculus variegatus and Tubifex tubifex, and compared with available data for annelid phosphagen kinases. The data indicate the existence of a variable organization of the proposed 8-intron/9-exon gene structure. The results provide further insights in the evolution and position of these enzymes within the phosphagen kinase family. PMID:22705027

  5. Multiplexed tyrosine kinase activity detection in cancer cells using hydrogel immobilized substrate

    PubMed Central

    Powers, Alicia D.; Han, Wenquing; Liu, Bi; Palecek, Sean P.

    2013-01-01

    Kinases play a key role in cellular signaling, and the overactivation or overexpression of these kinases has been linked to a variety of cancers. Tyrosine kinase inhibitors treat the mechanism of these cancers by targeting the specific kinases that are overactive. Some patients, however, do not respond to these inhibitors or develop resistance to these inhibitors during treatment. Additionally, even within cancers of the same tissue type, different kinases may be overactive in different patients. For example, some lung cancers overexpress epidermal growth factor receptor (EGFR) and respond to EGFR inhibitors, while other lung cancers do not overexpress EGFR and receive no benefit from this treatment. Even among patients exhibiting EGFR overexpression, some do not respond to EGFR kinase inhibitors because other kinases, such as Met kinase, are also overactivated. Here we describe a quantitative and specific multiplexed microfluidic assay using a hydrogel immobilized substrate for measuring the kinase activity of Met and Abl kinase from cancer cells. We immobilized kinase specific substrates into macroporous hydrogel micropillars in microchannels. These microchannels were incubated with 6 µl of a kinase reaction solution containing cancer cell lysate and measured kinase activity via fluorescence detection of a phosphotyrosine antibody. We showed that the assay can specifically measure the activity of both Met and Abl kinase within one microchannel with potential to measure the activity of as many as 5 kinases within one microchannel. The assay also detected Met kinase inhibition from lysates of cancer cells grown in the Met kinase inhibitor PHA665752. PMID:23624904

  6. Rho kinase as a target for cerebral vascular disorders

    PubMed Central

    Bond, Lisa M; Sellers, James R; McKerracher, Lisa

    2015-01-01

    The development of novel pharmaceutical treatments for disorders of the cerebral vasculature is a serious unmet medical need. These vascular disorders are typified by a disruption in the delicate Rho signaling equilibrium within the blood vessel wall. In particular, Rho kinase overactivation in the smooth muscle and endothelial layers of the vessel wall results in cytoskeletal modifications that lead to reduced vascular integrity and abnormal vascular growth. Rho kinase is thus a promising target for the treatment of cerebral vascular disorders. Indeed, preclinical studies indicate that Rho kinase inhibition may reduce the formation/growth/rupture of both intracranial aneurysms and cerebral cavernous malformations. PMID:26062400

  7. Novel cinnoline-based inhibitors of LRRK2 kinase activity.

    PubMed

    Garofalo, Albert W; Adler, Marc; Aubele, Danielle L; Bowers, Simeon; Franzini, Maurizio; Goldbach, Erich; Lorentzen, Colin; Neitz, R Jeffrey; Probst, Gary D; Quinn, Kevin P; Santiago, Pam; Sham, Hing L; Tam, Danny; Truong, Anh P; Ye, Xiaocong M; Ren, Zhao

    2013-01-01

    Leucine rich repeat kinase 2 (LRRK2) has been implicated in the pathogenesis of Parkinson's disease (PD). Inhibition of LRRK2 kinase activity is a therapeutic approach that may lead to new treatments for PD. Herein we report the discovery of a series of cinnoline-3-carboxamides that are potent against both wild-type and mutant LRRK2 kinase activity in biochemical assays. These compounds are also shown to be potent inhibitors in a cellular assay and to have good to excellent CNS penetration. PMID:23219325

  8. Activation of protein kinase C induces mitogen-activated protein kinase dephosphorylation and pronucleus formation in rat oocytes.

    PubMed

    Lu, Qing; Smith, Gary D; Chen, Da-Yuan; Han, Zhi-Ming; Sun, Qing-Yuan

    2002-07-01

    Mammalian oocytes are arrested at metaphase of the second meiotic division (MII) before fertilization. When oocytes are stimulated by spermatozoa, they exit MII stage and complete meiosis. It has been suggested that an immediate increase in intracellular free calcium concentration and inactivation of maturation promoting factor (MPF) are required for oocyte activation. However, the underlying mechanism is still unclear. In the present study, we investigated the role of protein kinase C (PKC) and mitogen-activated protein (MAP) kinase, and their interplay in rat oocyte activation. We found that MAP kinase became dephosphorylated in correlation with pronucleus formation after fertilization. Protein kinase C activators, phorbol 12-myriatate 13-acetate (PMA) and 1,2-dioctanoyl-rac-glycerol (diC8), triggered dephosphorylation of MAP kinase and pronucleus formation in a dose-dependent and time-dependent manner. Dephosphorylation of MAP kinase was also correlated with pronucleus formation when oocytes were treated with PKC activators. Effects of PKC activators were abolished by the PKC inhibitors, calphostin C and staurosporine, as well as a protein phosphatase blocker, okadaic acid (OA). These results suggest that PKC activation may cause rat oocyte pronucleus formation via MAP kinase dephosphorylation, which is probably mediated by OA-sensitive protein phosphatases. We also provide evidence supporting the involvement of such a process in fertilization. PMID:12080000

  9. Quercetin: a pleiotropic kinase inhibitor against cancer.

    PubMed

    Russo, Gian Luigi; Russo, Maria; Spagnuolo, Carmela; Tedesco, Idolo; Bilotto, Stefania; Iannitti, Roberta; Palumbo, Rosanna

    2014-01-01

    Increased consumption of fruits and vegetables can represent an easy strategy to significantly reduce the incidence of cancer. From this observation, derived mostly from epidemiological data, the new field of chemoprevention has emerged in the primary and secondary prevention of cancer. Chemoprevention is defined as the use of natural or synthetic compounds able to stop, reverse, or delay the process of tumorigenesis in its early stages. A large number of phytochemicals are potentially capable of simultaneously inhibiting and modulating several key factors regulating cell proliferation in cancer cells. Quercetin is a flavonoid possessing potential chemopreventive properties. It is a functionally pleiotropic molecule, possessing multiple intracellular targets, affecting different cell signaling processes usually altered in cancer cells, with limited toxicity on normal cells. Simultaneously targeting multiple pathways may help to kill malignant cells and slow down the onset of drug resistance. Among the different substrates triggered by quercetin, we have reviewed the ability of the molecule to inhibit protein kinases involved in deregulated cell growth in cancer cells. PMID:24114481

  10. Therapeutic drug monitoring and tyrosine kinase inhibitors

    PubMed Central

    Herviou, Pauline; Thivat, Emilie; Richard, Damien; Roche, Lucie; Dohou, Joyce; Pouget, Mélanie; Eschalier, Alain; Durando, Xavier; Authier, Nicolas

    2016-01-01

    The therapeutic activity of drugs can be optimized by establishing an individualized dosage, based on the measurement of the drug concentration in the serum, particularly if the drugs are characterized by an inter-individual variation in pharmacokinetics that results in an under- or overexposure to treatment. In recent years, several tyrosine kinase inhibitors (TKIs) have been developed to block intracellular signaling pathways in tumor cells. These oral drugs are candidates for therapeutic drug monitoring (TDM) due to their high inter-individual variability for therapeutic and toxic effects. Following a literature search on PubMed, studies on TKIs and their pharmacokinetic characteristics, plasma quantification and inter-individual variability was studied. TDM is commonly used in various medical fields, including cardiology and psychiatry, but is not often applied in oncology. Plasma concentration monitoring has been thoroughly studied for imatinib, in order to evaluate the usefulness of TDM. The measurement of plasma concentration can be performed by various analytical techniques, with liquid chromatography-mass spectrometry being the reference method. This method is currently used to monitor the efficacy and tolerability of imatinib treatments. Although TDM is already being used for imatinib, additional studies are required in order to improve this practice with the inclusion of other TKIs. PMID:27446421

  11. Weekly oral alendronate in mevalonate kinase deficiency

    PubMed Central

    2013-01-01

    Background Mevalonate kinase deficiency (MKD) is caused by mutations in the MVK gene, encoding the second enzyme of mevalonate pathway, which results in subsequent shortage of downstream compounds, and starts in childhood with febrile attacks, skin, joint, and gastrointestinal symptoms, sometimes induced by vaccinations. Methods For a history of early-onset corticosteroid-induced reduction of bone mineral density in a 14-year-old boy with MKD, who also had presented three bone fractures, we administered weekly oral alendronate, a drug widely used in the management of osteoporosis and other high bone turnover diseases, which blocks mevalonate and halts the prenylation process. Results All of the patient’s MKD clinical and laboratory abnormalities were resolved after starting alendronate treatment. Conclusions This observation appears enigmatic, since alendronate should reinforce the metabolic block characterizing MKD, but is crucial because of the ultimate improvement shown by this patient. The anti-inflammatory properties of bisphosphonates are a new question for debate among physicians across various specialties, and requires further biochemical and clinical investigation. PMID:24360083

  12. Protein kinase inhibitors against malignant lymphoma

    PubMed Central

    D’Cruz, Osmond J; Uckun, Fatih M

    2013-01-01

    Introduction Tyrosine kinases (TKs) are intimately involved in multiple signal transduction pathways regulating survival, activation, proliferation and differentiation of lymphoid cells. Deregulation or overexpression of specific oncogenic TKs is implicated in maintaining the malignant phenotype in B-lineage lymphoid malignancies. Several novel targeted TK inhibitors (TKIs) have recently emerged as active in the treatment of relapsed or refractory B-cell lymphomas that inhibit critical signaling pathways, promote apoptotic mechanisms or modulate the tumor microenvironment. Areas covered In this review, the authors summarize the clinical outcomes of newer TKIs in various B-cell lymphomas from published and ongoing clinical studies and abstracts from major cancer and hematology conferences. Expert opinion Multiple clinical trials have demonstrated that robust antitumor activity can be obtained with TKIs directed toward specific oncogenic TKs that are genetically deregulated in various subtypes of B-cell lymphomas. Clinical success of targeting TKIs is dependent upon on identifying reliable molecular and clinical markers associated with select cohorts of patients. Further understanding of the signaling pathways should stimulate the identification of novel molecular targets and expand the development of new therapeutic options and individualized therapies. PMID:23496343

  13. [Determination of riboflavin kinase activity in yeast].

    PubMed

    Shavlovsky, G M; Kashchenko, V E

    1975-01-01

    It is established that the main reason of the riboflavin kinase (RFK, EC 2.7.1.26) low specific activity in the cell-free extracts of the yeast Pichia guillermondii Wickerham ATCC 9058 is the presence of alkaline phosphatase (EC 3.1.3.1), effectively destructing flaven mononucleotide. By chromatography of the cell-free extracts of P. guillermondii on DEAE-Sephadex A-50, CM-Sphadex C-50, CM-cellulose, Sephadexes G-75 and G-100 RFK and alkaline phosphatase may be separated completely. Any of these procedures results in a several times increase of the RFK activity as compared with the initial preparation. One failed to obtain a similar effect by fractionation of the extracts with amminium sulphate and by hydroxylapatite chromatography. A simple method is developed for determining the activity of RFK in the cell-free extracts of yeast on the basis of negative adsorption of this enzyme on DEAE-Sephadex A-50. A selective inhibition of alkaline phosphatase by ions Be2+ and F- yields a less satisfactory result. The data are presented on the PFK activity of certain species of flavinogenic (Pichia guillermondii, Torulopsis camdida) and non-flavinogenic (Pichia ohmeri, Candida utilis, Saccharomyces cervisiae) yeast. PMID:174262

  14. Hybrid histidine kinases in pathogenic fungi.

    PubMed

    Defosse, Tatiana A; Sharma, Anupam; Mondal, Alok K; Dugé de Bernonville, Thomas; Latgé, Jean-Paul; Calderone, Richard; Giglioli-Guivarc'h, Nathalie; Courdavault, Vincent; Clastre, Marc; Papon, Nicolas

    2015-03-01

    Histidine kinases (HK) sense and transduce via phosphorylation events many intra- and extracellular signals in bacteria, archaea, slime moulds and plants. HK are also widespread in the fungal kingdom, but their precise roles in the regulation of physiological processes remain largely obscure. Expanding genomic resources have recently given the opportunity to identify uncharacterised HK family members in yeasts and moulds and now allow proposing a complex classification of Basidiomycota, Ascomycota and lower fungi HK. A growing number of genetic approaches have progressively provided new insight into the role of several groups of HK in prominent fungal pathogens. In particular, a series of studies have revealed that members of group III HK, which occur in the highest number of fungal species and contain a unique N-terminus region consisting of multiple HAMP domain repeats, regulate morphogenesis and virulence in various human, plant and insect pathogenic fungi. This research field is further supported by recent shape-function studies providing clear correlation between structural properties and signalling states in group III HK. Since HK are absent in mammals, these represent interesting fungal target for the discovery of new antifungal drugs. PMID:25560420

  15. Protein Kinase C Pharmacology: Refining the Toolbox

    PubMed Central

    Wu-Zhang, Alyssa X.; Newton, Alexandra C.

    2014-01-01

    SYNOPSIS Protein kinase C (PKC) has been in the limelight since the discovery three decades ago that it acts as a major receptor for the tumor-promoting phorbol esters. Phorbol esters, with their potent ability to activate two of the three classes of PKC isozymes, have remained the best pharmacological tool for directly modulating PKC activity. However, with the discovery of other phorbol ester-responsive proteins, the advent of various small-molecule and peptide modulators, and the need to distinguish isozyme-specific activity, the pharmacology of PKC has become increasingly complex. Not surprisingly, many of the compounds originally touted as direct modulators of PKC have subsequently been shown to hit many other cellular targets and, in some cases, not even directly modulate PKC. The complexities and reversals in PKC pharmacology have led to widespread confusion about the current status of the pharmacological tools available to control PKC activity. Here, we aim to clarify the cacophony in the literature regarding the current state of bona fide and discredited cellular PKC modulators, including activators, small-molecule inhibitors, and peptides, and also address the use of genetically-encoded reporters and of PKC mutants to measure the effects of these drugs on the spatiotemporal dynamics of signaling by specific isozymes. PMID:23662807

  16. Protein kinase A alterations in adrenocortical tumors.

    PubMed

    Espiard, S; Ragazzon, B; Bertherat, J

    2014-11-01

    Stimulation of the cAMP pathway by adrenocorticotropin (ACTH) is essential for adrenal cortex maintenance, glucocorticoid and adrenal androgens synthesis, and secretion. Various molecular and cellular alterations of the cAMP pathway have been observed in endocrine tumors. Protein kinase A (PKA) is a central key component of the cAMP pathway. Molecular alterations of PKA subunits have been observed in adrenocortical tumors. PKA molecular defects can be germline in hereditary disorders or somatic in sporadic tumors. Heterozygous germline inactivating mutations of the PKA regulatory subunit RIα gene (PRKAR1A) can be observed in patients with ACTH-independent Cushing's syndrome (CS) due to primary pigmented nodular adrenocortical disease (PPNAD). PRKAR1A is considered as a tumor suppressor gene. Interestingly, these mutations can also be observed as somatic alterations in sporadic cortisol-secreting adrenocortical adenomas. Germline gene duplication of the catalytic subunits Cα (PRKACA) has been observed in patients with PPNAD. Furthermore, exome sequencing revealed recently activating somatic mutations of PRKACA in about 40% of cortisol-secreting adrenocortical adenomas. In vitro and in vivo functional studies help in the progress to understand the mechanisms of adrenocortical tumors development due to PKA regulatory subunits alterations. All these alterations are observed in benign oversecreting tumors and are mimicking in some way cAMP pathway constitutive activation. On the long term, unraveling these alterations will open new strategies of pharmacological treatment targeting the cAMP pathway in adrenal tumors and cortisol-secretion disorders. PMID:25105543

  17. Regulation of Macropinocytosis by Diacylglycerol Kinase ζ

    PubMed Central

    Pomoransky, Julia L.; Parks, Robin J.; Trinkle-Mulcahy, Laura; Bell, John C.; Gee, Stephen H.

    2015-01-01

    Macropinosomes arise from the closure of plasma membrane ruffles to bring about the non-selective uptake of nutrients and solutes into cells. The morphological changes underlying ruffle formation and macropinosome biogenesis are driven by actin cytoskeleton rearrangements under the control of the Rho GTPase Rac1. We showed previously that Rac1 is activated by diacylglycerol kinase ζ (DGKζ), which phosphorylates diacylglycerol to yield phosphatidic acid. Here, we show DGKζ is required for optimal macropinocytosis induced by growth factor stimulation of mouse embryonic fibroblasts. Time-lapse imaging of live cells and quantitative analysis revealed DGKζ was associated with membrane ruffles and nascent macropinosomes. Macropinocytosis was attenuated in DGKζ-null cells, as determined by live imaging and vaccinia virus uptake experiments. Moreover, macropinosomes that did form in DGKζ-null cells were smaller than those found in wild type cells. Rescue of this defect required DGKζ catalytic activity, consistent with it also being required for Rac1 activation. A constitutively membrane bound DGKζ mutant substantially increased the size of macropinosomes and potentiated the effect of a constitutively active Rac1 mutant on macropinocytosis. Collectively, our results suggest DGKζ functions in concert with Rac1 to regulate macropinocytosis. PMID:26701304

  18. Distinct 1-monoacylglycerol and 2-monoacylglycerol kinase activities of diacylglycerol kinase isozymes.

    PubMed

    Sato, Yuriko; Murakami, Chiaki; Yamaki, Atsumi; Mizuno, Satoru; Sakai, Hiromichi; Sakane, Fumio

    2016-09-01

    Diacylglycerol kinase (DGK) consists of ten isozymes and is involved in a wide variety of patho-physiological events. However, the enzymological properties of DGKs have not been fully understood. In this study, we performed a comprehensive analysis on the 1-monoacylglycerol kinase (MGK) and 2-MGK activities of ten DGK isozymes. We revealed that type I (α, β and γ), type II (δ, η and κ) and type III (ε) DGKs have 7.9-19.2% 2-MGK activity compared to their DGK activities, whereas their 1-MGK activities were <3.0%. Both the 1-MGK and 2-MGK activities of the type IV DGKs (ζ and ι) were <1% relative to their DGK activities. Intriguingly, type V DGKθ has approximately 6% 1-MGK activity and <2% 2-MGK activity compared to its DGK activity. Purified DGKθ exhibited the same results, indicating that its 1-MGK activity is intrinsic. Therefore, DGK isozymes are categorized into three types with respect to their 1-MGK and 2-MGK activities: those having (1) 2-MGK activity relatively stronger than their 1-MGK activity (types I-III), (2) only negligible 1-MGK and 2-MGK activities (type IV), and (3) 1-MGK activity stronger than its 2-MGK activity (type V). The 1-MGK activity of DGKθ and the 2-MGK activity of DGKα were stronger than those of the acylglycerol kinase reported as 1-MGK and 2-MGK to date. The presence or absence of 1-MGK and 2-MGK activities may be essential to the patho-physiological functions of each DGK isozyme. PMID:27346717

  19. Toward the rational design of protein kinase casein kinase-2 inhibitors.

    PubMed

    Sarno, Stefania; Moro, Stefano; Meggio, Flavio; Zagotto, Giuseppe; Dal Ben, Diego; Ghisellini, Paola; Battistutta, Roberto; Zanotti, Giuseppe; Pinna, Lorenzo A

    2002-01-01

    Casein kinase-2 (CK2) probably is the most pleiotropic member of the protein kinase family, with more than 200 substrates known to date. Unlike the great majority of protein kinases, which are tightly regulated enzymes, CK2 is endowed with high constitutive activity, a feature that is suspected to underlie its oncogenic potential and possible implication in viral infections. This makes CK2 an attractive target for anti-neoplastic and antiviral drugs. Here, we present an overview of our present knowledge about CK2 inhibitors, with special reference to the information drawn from two recently solved crystal structures of CK2alpha in complex with emodin and with 4,5,6,7-tetrabromo-2-azabenzimidazole (TBB), this latter being the most specific CK2 inhibitor known to date. A comparison with a series of anthraquinone and xanthenone derivatives highlights the crucial relevance of the hydroxyl group at position 3 for inhibition by emodin, and discloses the possibility of increasing the inhibitory potency by placing an electron withdrawing group at position 5. We also present mutational data corroborating the relevance of two hydrophobic residues unique to CK2, Val66 and Ile174, for the interactions with emodin and TBB, but not with the flavonoid inhibitors quercetin and fisetin. In particular, the CK2alpha mutant V66A displays 27- and 11-fold higher IC(50) values with emodin and TBB, respectively, as compared with the wild-type, while the IC(50) value with quercetin is unchanged. The data presented pave the road toward the rational design of more potent and selective inhibitors of CK2 and the generation of CK2 mutants refractory to inhibition, useful to probe the implication of CK2 in specific cellular functions. PMID:12191608

  20. A Causal Gene for Seed Dormancy on Wheat Chromosome 4A Encodes a MAP Kinase Kinase.

    PubMed

    Torada, Atsushi; Koike, Michiya; Ogawa, Taiichi; Takenouchi, Yu; Tadamura, Kazuki; Wu, Jianzhong; Matsumoto, Takashi; Kawaura, Kanako; Ogihara, Yasunari

    2016-03-21

    Seed germination under the appropriate environmental conditions is important both for plant species survival and for successful agriculture. Seed dormancy, which controls germination time, is one of the adaptation mechanisms and domestication traits [1]. Seed dormancy is generally defined as the absence of germination of a viable seed under conditions that are favorable for germination [2]. The seed dormancy of cultivated plants has generally been reduced during domestication [3]. Bread wheat (Triticum aestivum L.) is one of the most widely grown crops in the world. Weak dormancy may be an advantage for the productivity due to uniform emergence and a disadvantage for the risks of pre-harvest sprouting (PHS), which decreases grain quality and yield [4]. A number of quantitative trait loci (QTLs) controlling natural variation of seed dormancy have been identified on various chromosomes [5]. A major QTL for seed dormancy has been consistently detected on chromosome 4A [6-13]. The QTL was designated as a major gene, Phs1, which could be precisely mapped within a 2.6 cM region [14]. Here, we identified a mitogen-activated protein kinase kinase 3 (MKK3) gene (designated TaMKK3-A) by a map-based approach as a candidate gene for the seed dormancy locus Phs1 on chromosome 4A in bread wheat. Complementation analysis showed that transformation of a dormant wheat cultivar with the TaMKK3-A allele from a nondormant cultivar clearly reduced seed dormancy. Cultivars differing in dormancy had a single nonsynonymous amino acid substitution in the kinase domain of the predicted MKK3 protein sequence, which may be associated with the length of seed dormancy. PMID:26948878

  1. Protein Kinase Cδ mediates the activation of Protein Kinase D2 in Platelets

    PubMed Central

    Bhavanasi, Dheeraj; Kim, Soochong; Goldfinger, Lawrence E.; Kunapuli, Satya P.

    2011-01-01

    Protein Kinase D (PKD) is a subfamily of serine/threonine specific family of kinases, comprised of PKD1, PKD2 and PKD3 (PKCμ, PKD2 and PKCν in humans). It is known that PKCs activate PKD, but the relative expression of isoforms of PKD or the specific PKC isoform/s responsible for its activation in platelets is not known. This study is aimed at investigating the pathway involved in activation of PKD in platelets. We show that PKD2 is the major isoform of PKD that is expressed in human as well as murine platelets but not PKD1 or PKD3. PKD2 activation induced by AYPGKF was abolished with a Gq inhibitor YM-254890, but was not affected by Y-27632, a RhoA/p160ROCK inhibitor, indicating that PKD2 activation is Gq-, but not G12/13-mediated Rho-kinase dependent. Calcium-mediated signals are also required for activation of PKD2 as dimethyl BAPTA inhibited its phosphorylation. GF109203X, a pan PKC inhibitor abolished PKD2 phosphorylation but Go6976, a classical PKC inhibitor had no effect suggesting that novel PKC isoforms are involved in PKD2 activation. Importantly, Rottlerin, a non-selective PKCδ inhibitor, inhibited AYPGKF-induced PKD2 activation in human platelets. Similarly, AYPGKF- and Convulxin-induced PKD2 phosphorylation was dramatically inhibited in PKCδ-deficient platelets, but not in PKCθ– or PKCε–deficient murine platelets compared to that of wild type platelets. Hence, we conclude that PKD2 is a common signaling target downstream of various agonist receptors in platelets and Gq-mediated signals along with calcium and novel PKC isoforms, in particular, PKCδ activate PKD2 in platelets. PMID:21736870

  2. Extending Thymidine Kinase Activity to the Catalytic Repertoire of Human Deoxycytidine Kinase

    SciTech Connect

    Hazra, Saugata; Sabini, Eliszbetta; Ort, Stephan; Konrad, Manfred; Lavie, Arnon

    2009-03-04

    Salvage of nucleosides in the cytosol of human cells is carried out by deoxycytidine kinase (dCK) and thymidine kinase 1 (TK1). Whereas TK1 is only responsible for thymidine phosphorylation, dCK is capable of converting dC, dA, and dG into their monophosphate forms. Using structural data on dCK, we predicted that select mutations at the active site would, in addition to making the enzyme faster, expand the catalytic repertoire of dCK to include thymidine. Specifically, we hypothesized that steric repulsion between the methyl group of the thymine base and Arg104 is the main factor preventing the phosphorylation of thymidine by wild-type dCK. Here we present kinetic data on several dCK variants where Arg104 has been replaced by select residues, all performed in combination with the mutation of Asp133 to an alanine. We show that several hydrophobic residues at position 104 endow dCK with thymidine kinase activity. Depending on the exact nature of the mutations, the enzyme's substrate preference is modified. The R104M-D133A double mutant is a pyrimidine-specific enzyme due to large K{sub m} values with purines. The crystal structure of the double mutant R104M-D133A in complex with the L-form of thymidine supplies a structural explanation for the ability of this variant to phosphorylate thymidine and thymidine analogs. The replacement of Arg104 by a smaller residue allows L-dT to bind deeper into the active site, making space for the C5-methyl group of the thymine base. The unique catalytic properties of several of the mutants make them good candidates for suicide-gene/protein-therapy applications.

  3. Mitogen-Activated Protein Kinase Kinase 3 Regulates Seed Dormancy in Barley.

    PubMed

    Nakamura, Shingo; Pourkheirandish, Mohammad; Morishige, Hiromi; Kubo, Yuta; Nakamura, Masako; Ichimura, Kazuya; Seo, Shigemi; Kanamori, Hiroyuki; Wu, Jianzhong; Ando, Tsuyu; Hensel, Goetz; Sameri, Mohammad; Stein, Nils; Sato, Kazuhiro; Matsumoto, Takashi; Yano, Masahiro; Komatsuda, Takao

    2016-03-21

    Seed dormancy has fundamental importance in plant survival and crop production; however, the mechanisms regulating dormancy remain unclear [1-3]. Seed dormancy levels generally decrease during domestication to ensure that crops successfully germinate in the field. However, reduction of seed dormancy can cause devastating losses in cereals like wheat (Triticum aestivum L.) and barley (Hordeum vulgare L.) due to pre-harvest sprouting, the germination of mature seed (grain) on the mother plant when rain occurs before harvest. Understanding the mechanisms of dormancy can facilitate breeding of crop varieties with the appropriate levels of seed dormancy [4-8]. Barley is a model crop [9, 10] and has two major seed dormancy quantitative trait loci (QTLs), SD1 and SD2, on chromosome 5H [11-19]. We detected a QTL designated Qsd2-AK at SD2 as the single major determinant explaining the difference in seed dormancy between the dormant cultivar "Azumamugi" (Az) and the non-dormant cultivar "Kanto Nakate Gold" (KNG). Using map-based cloning, we identified the causal gene for Qsd2-AK as Mitogen-activated Protein Kinase Kinase 3 (MKK3). The dormant Az allele of MKK3 is recessive; the N260T substitution in this allele decreases MKK3 kinase activity and appears to be causal for Qsd2-AK. The N260T substitution occurred in the immediate ancestor allele of the dormant allele, and the established dormant allele became prevalent in barley cultivars grown in East Asia, where the rainy season and harvest season often overlap. Our findings show fine-tuning of seed dormancy during domestication and provide key information for improving pre-harvest sprouting tolerance in barley and wheat. PMID:26948880

  4. Giant protein kinases: domain interactions and structural basis of autoregulation.

    PubMed Central

    Kobe, B; Heierhorst, J; Feil, S C; Parker, M W; Benian, G M; Weiss, K R; Kemp, B E

    1996-01-01

    The myosin-associated giant protein kinases twitchin and titin are composed predominantly of fibronectin- and immunoglobulin-like modules. We report the crystal structures of two autoinhibited twitchin kinase fragments, one from Aplysia and a larger fragment from Caenorhabditis elegans containing an additional C-terminal immunoglobulin-like domain. The structure of the longer fragment shows that the immunoglobulin domain contacts the protein kinase domain on the opposite side from the catalytic cleft, laterally exposing potential myosin binding residues. Together, the structures reveal the cooperative interactions between the autoregulatory region and the residues from the catalytic domain involved in protein substrate binding, ATP binding, catalysis and the activation loop, and explain the differences between the observed autoinhibitory mechanism and the one found in the structure of calmodulin-dependent kinase I. Images PMID:9003756

  5. Targeting protein kinases in central nervous system disorders

    PubMed Central

    Chico, Laura K.; Van Eldik, Linda J.; Watterson, D. Martin

    2010-01-01

    Protein kinases are a growing drug target class in disorders in peripheral tissues, but the development of kinase-targeted therapies for central nervous system (CNS) diseases remains a challenge, largely owing to issues associated specifically with CNS drug discovery. However, several candidate therapeutics that target CNS protein kinases are now in various stages of preclinical and clinical development. We review candidate compounds and discuss selected CNS protein kinases that are emerging as important therapeutic targets. In addition, we analyse trends in small-molecule properties that correlate with key challenges in CNS drug discovery, such as blood–brain barrier penetrance and cytochrome P450-mediated metabolism, and discuss the potential of future approaches that will integrate molecular-fragment expansion with pharmacoinformatics to address these challenges. PMID:19876042

  6. The energy landscape of adenylate kinase during catalysis

    PubMed Central

    Kerns, S. Jordan; Agafonov, Roman V.; Cho, Young-Jin; Pontiggia, Francesco; Otten, Renee; Pachov, Dimitar V.; Kutter, Steffen; Phung, Lien A.; Murphy, Padraig N.; Thai, Vu; Alber, Tom; Hagan, Michael F.; Kern, Dorothee

    2014-01-01

    Kinases perform phosphoryl-transfer reactions in milliseconds; without enzymes, these reactions would take about 8000 years under physiological conditions. Despite extensive studies, a comprehensive understanding of kinase energy landscapes, including both chemical and conformational steps, is lacking. Here we scrutinize the microscopic steps in the catalytic cycle of adenylate kinase, through a combination of NMR measurements during catalysis, pre-steady-state kinetics, MD simulations, and crystallography of active complexes. We find that the Mg2+ cofactor activates two distinct molecular events, phosphoryl transfer (>105-fold) and lid-opening (103-fold). In contrast, mutation of an essential active-site arginine decelerates phosphoryl transfer 103-fold without substantially affecting lid-opening. Our results highlight the importance of the entire energy landscape in catalysis and suggest that adenylate kinases have evolved to activate key processes simultaneously by precise placement of a single, charged and very abundant cofactor in a pre-organized active site. PMID:25580578

  7. Regulatory crosstalk by protein kinases on CFTR trafficking and activity

    NASA Astrophysics Data System (ADS)

    Farinha, Carlos Miguel; Swiatecka-Urban, Agnieszka; Brautigan, David; Jordan, Peter

    2016-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a member of the ATP binding cassette (ABC) transporter superfamily that functions as a cAMP-activated chloride ion channel in fluid-transporting epithelia. There is abundant evidence that CFTR activity (i.e. channel opening and closing) is regulated by protein kinases and phosphatases via phosphorylation and dephosphorylation. Here, we review recent evidence for the role of protein kinases in regulation of CFTR delivery to and retention in the plasma membrane. We review this information in a broader context of regulation of other transporters by protein kinases because the overall functional output of transporters involves the integrated control of both their number at the plasma membrane and their specific activity. While many details of the regulation of intracellular distribution of CFTR and other transporters remain to be elucidated, we hope that this review will motivate research providing new insights into how protein kinases control membrane transport to impact health and disease.

  8. Design and synthesis of novel selective anaplastic lymphoma kinase inhibitors.

    PubMed

    Michellys, Pierre-Yves; Chen, Bei; Jiang, Tao; Jin, Yunho; Lu, Wenshuo; Marsilje, Thomas H; Pei, Wei; Uno, Tetsuo; Zhu, Xuefeng; Wu, Baogen; Nguyen, Truc Ngoc; Bursulaya, Badry; Lee, Christian; Li, Nanxin; Kim, Sungjoon; Tuntland, Tove; Liu, Bo; Sun, Frank; Steffy, Auzon; Hood, Tami

    2016-02-01

    Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase belonging to the insulin receptor superfamily. Expression of ALK in normal human tissues is only found in a subset of neural cells, however it is involved in the genesis of several cancers through genetic aberrations involving translocation of the kinase domain with multiple fusion partners (e.g., NPM-ALK in anaplastic large cell lymphoma ALCL or EML4-ALK in non-small cell lung cancer) or activating mutations in the full-length receptor resulting in ligand-independent constitutive activation (e.g., neuroblastoma). Here we are reporting the discovery of novel and selective anaplastic lymphoma kinase inhibitors from specific modifications of the 2,4-diaminopyridine core present in TAE684 and LDK378. Synthesis, structure activity relationships (SAR), absorption, distribution, metabolism, and excretion (ADME) profile, and in vivo efficacy in a mouse xenograft model of anaplastic large cell lymphoma are described. PMID:26750252

  9. Clinical experience with aurora kinase inhibitors: a review.

    PubMed

    Boss, David S; Beijnen, Jos H; Schellens, Jan H M

    2009-08-01

    The aurora kinase family of serine/threonine kinases comprises three members, designated auroras A, B, and C. Auroras A and B are essential components of the mitotic pathway, ensuring proper chromosome assembly, formation of the mitotic spindle, and cytokinesis. The role of aurora C is less clear. Overexpression of aurora A and B has been observed in several tumor types, and has been linked with a poor prognosis of cancer patients. Several small molecules targeting aurora kinases A and B or both have been evaluated preclinically and in early phase I trials. In this review we aim to summarize the most recent advances in the development of aurora kinase inhibitors, with a focus on the clinical data. PMID:19684075

  10. OTSSP167 Abrogates Mitotic Checkpoint through Inhibiting Multiple Mitotic Kinases.

    PubMed

    Ji, Wenbin; Arnst, Christopher; Tipton, Aaron R; Bekier, Michael E; Taylor, William R; Yen, Tim J; Liu, Song-Tao

    2016-01-01

    OTSSP167 was recently characterized as a potent inhibitor for maternal embryonic leucine zipper kinase (MELK) and is currently tested in Phase I clinical trials for solid tumors that have not responded to other treatment. Here we report that OTSSP167 abrogates the mitotic checkpoint at concentrations used to inhibit MELK. The abrogation is not recapitulated by RNAi mediated silencing of MELK in cells. Although OTSSP167 indeed inhibits MELK, it exhibits off-target activity against Aurora B kinase in vitro and in cells. Furthermore, OTSSP167 inhibits BUB1 and Haspin kinases, reducing phosphorylation at histones H2AT120 and H3T3 and causing mislocalization of Aurora B and associated chromosomal passenger complex from the centromere/kinetochore. The results suggest that OTSSP167 may have additional mechanisms of action for cancer cell killing and caution the use of OTSSP167 as a MELK specific kinase inhibitor in biochemical and cellular assays. PMID:27082996

  11. OTSSP167 Abrogates Mitotic Checkpoint through Inhibiting Multiple Mitotic Kinases

    PubMed Central

    Tipton, Aaron R.; Bekier, Michael E.; Taylor, William R.; Yen, Tim J.; Liu, Song-Tao

    2016-01-01

    OTSSP167 was recently characterized as a potent inhibitor for maternal embryonic leucine zipper kinase (MELK) and is currently tested in Phase I clinical trials for solid tumors that have not responded to other treatment. Here we report that OTSSP167 abrogates the mitotic checkpoint at concentrations used to inhibit MELK. The abrogation is not recapitulated by RNAi mediated silencing of MELK in cells. Although OTSSP167 indeed inhibits MELK, it exhibits off-target activity against Aurora B kinase in vitro and in cells. Furthermore, OTSSP167 inhibits BUB1 and Haspin kinases, reducing phosphorylation at histones H2AT120 and H3T3 and causing mislocalization of Aurora B and associated chromosomal passenger complex from the centromere/kinetochore. The results suggest that OTSSP167 may have additional mechanisms of action for cancer cell killing and caution the use of OTSSP167 as a MELK specific kinase inhibitor in biochemical and cellular assays. PMID:27082996

  12. Regulatory Crosstalk by Protein Kinases on CFTR Trafficking and Activity

    PubMed Central

    Farinha, Carlos M.; Swiatecka-Urban, Agnieszka; Brautigan, David L.; Jordan, Peter

    2016-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a member of the ATP binding cassette (ABC) transporter superfamily that functions as a cAMP-activated chloride ion channel in fluid-transporting epithelia. There is abundant evidence that CFTR activity (i.e., channel opening and closing) is regulated by protein kinases and phosphatases via phosphorylation and dephosphorylation. Here, we review recent evidence for the role of protein kinases in regulation of CFTR delivery to and retention in the plasma membrane. We review this information in a broader context of regulation of other transporters by protein kinases because the overall functional output of transporters involves the integrated control of both their number at the plasma membrane and their specific activity. While many details of the regulation of intracellular distribution of CFTR and other transporters remain to be elucidated, we hope that this review will motivate research providing new insights into how protein kinases control membrane transport to impact health and disease. PMID:26835446

  13. Resolution of thylakoid polyphenol oxidase and a protein kinase

    SciTech Connect

    Race, H.L.; Davenport, J.W.; Hind, G.

    1995-12-31

    The predominant protein kinase activity in octylglucoside (OG) extracts of spinach thylakoids has been attributed to a 64-kDa protein, tp64. Recent work calls into question the relation between tp64 and protein kinase activity, which were fractionated apart using fluid phase IEF and hydroxylapatite chromatography. Hind et al. sequenced tp64 from the cDNA and showed it to be a polyphenol oxidase (PPO) homolog. Its transit peptide indicates a location for the mature protein within the thylakoid lumen, where there is presumably no ATP and where it is remote from the presumed kinase substrates: the stromally exposed regions of integral PS-II membrane proteins. Here the authors suggest that the kinase is a 64-kDa protein distinct from tp64.

  14. Predictive Models for Fast and Effective Profiling of Kinase Inhibitors.

    PubMed

    Bora, Alina; Avram, Sorin; Ciucanu, Ionel; Raica, Marius; Avram, Stefana

    2016-05-23

    In this study we developed two-dimensional pharmacophore-based random forest models for the effective profiling of kinase inhibitors. One hundred seven prediction models were developed to address distinct kinases spanning over all kinase groups. Rigorous external validation demonstrates excellent virtual screening and classification potential of the predictors and, more importantly, the capacity to prioritize novel chemical scaffolds in large chemical libraries. The models built upon more diverse and more potent compounds tend to exert the highest predictive power. The analysis of ColBioS-FlavRC (Collection of Bioselective Flavonoids and Related Compounds) highlighted several potentially promiscuous derivatives with undesirable selectivity against kinases. The prediction models can be downloaded from www.chembioinf.ro . PMID:27064988

  15. Regulation of mitochondrial protein import by cytosolic kinases.

    PubMed

    Schmidt, Oliver; Harbauer, Angelika B; Rao, Sanjana; Eyrich, Beate; Zahedi, René P; Stojanovski, Diana; Schönfisch, Birgit; Guiard, Bernard; Sickmann, Albert; Pfanner, Nikolaus; Meisinger, Chris

    2011-01-21

    Mitochondria import a large number of nuclear-encoded proteins via membrane-bound transport machineries; however, little is known about regulation of the preprotein translocases. We report that the main protein entry gate of mitochondria, the translocase of the outer membrane (TOM complex), is phosphorylated by cytosolic kinases-in particular, casein kinase 2 (CK2) and protein kinase A (PKA). CK2 promotes biogenesis of the TOM complex by phosphorylation of two key components, the receptor Tom22 and the import protein Mim1, which in turn are required for import of further Tom proteins. Inactivation of CK2 decreases the levels of the TOM complex and thus mitochondrial protein import. PKA phosphorylates Tom70 under nonrespiring conditions, thereby inhibiting its receptor activity and the import of mitochondrial metabolite carriers. We conclude that cytosolic kinases exert stimulatory and inhibitory effects on biogenesis and function of the TOM complex and thus regulate protein import into mitochondria. PMID:21215441

  16. Deletion of the phosphoinositide 3-Kinase p110(gamma) gene attenuates murine atherosclerosis

    Techno