Science.gov

Sample records for klebsiella oxytoca bacteria

  1. Magnetic properties of biomineral particles produced by bacteria Klebsiella oxytoca

    NASA Astrophysics Data System (ADS)

    Raĭkher, Yu. L.; Stepanov, V. I.; Stolyar, S. V.; Ladygina, V. P.; Balaev, D. A.; Ishchenko, L. A.; Balasoiu, M.

    2010-02-01

    Ferrihydrite nanoparticles (2-5 nm in size) produced by bacteria Klebsiella oxytoca in the course of biomineralization of iron salt solutions from a natural medium exhibit unique magnetic properties: they are characterized by both the antiferromagnetic order inherent in a bulk ferrihydrite and the spontaneous magnetic moment due to the decompensation of spins in sublattices of a nanoparticle. The magnetic susceptibility enhanced by the superantiferromagnetism effect and the magnetic moment independent of the magnetic field provide the possibility of magnetically controlling these natural objects. This has opened up the possibilities for their use in nanomedicine and bioengineering. The results obtained from measurements of the magnetic properties of the ferrihydrite produced by Klebsiella oxytoca in its two main crystalline modifications are reported, and the data obtained are analyzed theoretically. This has made it possible to determine numerical values of the magnetic parameters of real biomineral nanoparticles.

  2. Characterization of bio-synthesized nanoparticles produced by Klebsiella oxytoca

    NASA Astrophysics Data System (ADS)

    Anghel, L.; Balasoiu, M.; Ishchenko, L. A.; Stolyar, S. V.; Kurkin, T. S.; Rogachev, A. V.; Kuklin, A. I.; Kovalev, Yu S.; Raikher, Yu L.; Iskhakov, R. S.; Duca, G.

    2012-03-01

    Structural and morphological properties of biogenic ferrihydrite nanoparticles produced by bacteria Klebsiella oxytoca are investigated. The stability of water dispersions of biomineral particles produced by Klebsiella oxytoca was monitored by UV-Vis spectroscopy. Their chemical composition was determined by FT-IR spectroscopy. The vibrational spectra of biogenic ferrihydrite nanoparticles revealed typical absorption peaks of exopolysaccharides. Morphological analysis based on Raman spectroscopy indicated the presence of exopolysaccharides on the surface as well as inside the pores of the ferrihydrite nanoparticles. Structural investigations of ultrasonic assisted samples of different concentration of water dispersed particles were performed using small angle X-ray scattering analysis. Model calculations and fitting procedures revealed scattering objects of an elongated shape with 6.73±0.16 nm radius of gyration.

  3. Chronic pneumonia due to Klebsiella oxytoca mimicking pulmonary tuberculosis.

    PubMed

    Gera, Kamal; Roshan, Rahul; Varma-Basil, Mandira; Shah, Ashok

    2015-01-01

    Klebsiella species infrequently cause acute community acquired pneumonia (CAP). The chronic form of the disease caused by K. pneumoniae (Friedlander's bacillus) was occasionally seen in the pre-antibiotic era. K. oxytoca is a singularly uncommon cause of CAP. The chronic form of the disease caused by K. oxytoca has been documented only once before. A 50-year-old immunocompetent male smoker presented with haemoptysis for 12 months. Imaging demonstrated a cavitary lesion in the right upper lobe with emphysematous changes. Sputum stains and cultures for Mycobacterium tuberculosis were negative. However, three sputum samples for aerobic culture as well as bronchial aspirate cultured pure growth of K. oxytoca. A diagnosis of chronic pneumonia due to K. oxytoca was established and with appropriate therapy, the patient was largely asymptomatic. The remarkable clinical and radiological similarity to pulmonary tuberculosis can result in patients with chronic Klebsiella pneumonia erroneously receiving anti-tuberculous therapy. PMID:26379000

  4. Biotransformation of cyanide to methane and ammonia by Klebsiella oxytoca.

    PubMed

    Kao, C M; Liu, J K; Lou, H R; Lin, C S; Chen, S C

    2003-03-01

    Klebsiella oxytoca, isolated from cyanide-containing industrial wastewater, was shown to be able to biodegrade cyanide to non-toxic endproducts using cyanide as the sole nitrogen source. In this study, ammonia was one of the detected endproduct of cyanide biodegradation by the concentrated resting cells of K. oxytoca. Moreover, cyanide has been shown to be biotransformed to methane through the actions of concentrated resting cells. Biodegradation of cyanide by cell-free extracts was not observed, which might be due to the inactivation of nitrogenase (an oxygen-labial enzyme) caused by the oxygen exposure after cell disruption. Results show that the cyanide consumption by resting cells of K. oxytoca was induced when the pretreatment of these cells with cyanide was conducted. However, the cyanide-degrading capability of resting cells pretreated with ammonia was inhibited. The inhibition of cyanide degradation by resting cells of K. oxytoca was affected by the ammonia concentration. This might result from the suppression of nitrogenase activity of K. oxytoca by ammonia since nitrogenase was suggested to be the sole cyanide-degrading enzyme during the cyanide degradation process. Results from this study also show that the processes of cyanide biodegradation and ammonia production by resting cells occurred simultaneously. This suggests that the utilization of cyanide as nitrogen source by K. oxytoca might proceed using ammonia as an assimilatory substrate. PMID:12531712

  5. Isolation and characterization of an SDS-degrading Klebsiella oxytoca.

    PubMed

    Shukor, M Y; Husin, W S W; Rahman, M F A; Shamaan, N A; Syed, M A

    2009-01-01

    Sodium dodecyl sulfate (SDS) is one of the main components in the detergent and cosmetic industries. Its bioremediation by suitable microorganism has begun to receive greater attention as the amount of SDS usage increases to a point where treatment plants would not be able to cope with the increasing amount of SDS in wastewater. The purpose of this work was to isolate local SDS-degrading bacteria. Screening was carried out by the conventional enrichment-culture technique. Six SDS-degrading bacteria were isolated. Of these isolates, isolate S14 showed the highest degradation of SDS with 90% degradation after three days of incubation. Isolate S14 was tentatively identified as Klebsiella oxytoca strain DRY14 based on carbon utilization profiles using Biolog GN plates and partial 16S rDNA molecular phylogeny. SDS degradation by the bacterium was optimum at 37 degrees 0. Ammonium sulphate; at 2.0 g l(-1), was found to be the best nitrogen source for the growth of strain DRY14. Maximum growth on SDS was observed at pH 7.25. The strain exhibited optimum growth at SDS concentration of 2.0 g l(-1) and was completely inhibited at 10 g l(-1) SDS. At the tolerable initial concentration of 2.0 g l(-1), almost 80% of 2.0 g l(-1) SDS was degraded after 4 days of incubation concomitant with increase in cellular growth. The K(m(app) and V(max(app)) values calculated for the alkylsulfatase from this bacterium were 0.1 mM SDS and 1.07 micromol min(-1) mg(-1) protein, respectively. PMID:20112874

  6. Improvements In Ethanologenic Escherichia Coli and Klebsiella Oxytoca

    SciTech Connect

    Dr. David Nunn

    2010-09-30

    The current Verenium cellulosic ethanol process is based on the dilute-acid pretreatment of a biomass feedstock, followed by a two-stage fermentation of the pentose sugar-containing hydrolysate by a genetically modified ethanologenic Escherichia coli strain and a separate simultaneous saccharification-fermentation (SSF) of the cellulosic fraction by a genetically modified ethanologenic Klebsiella oxytoca strain and a fungal enzyme cocktail. In order to reduce unit operations and produce a fermentation beer with higher ethanol concentrations to reduce distillation costs, we have proposed to develop a simultaneous saccharification co-fermentation (SScF) process, where the fermentation of the pentose-containing hydrolysate and cellulosic fraction occurs within the same fermentation vessel. In order to accomplish this goal, improvements in the ethanologens must be made to address a number of issues that arise, including improved hydrolysate tolerance, co-fermentation of the pentose and hexose sugars and increased ethanol tolerance. Using a variety of approaches, including transcriptomics, strain adaptation, metagenomics and directed evolution, this work describes the efforts of a team of scientists from Verenium, University of Florida, Massachusetts Institute of Technology and Genomatica to improve the E. coli and K. oxytoca ethanologens to meet these requirements.

  7. Infective endocarditis caused by Klebsiella oxytoca in an intravenous drug user with cancer

    PubMed Central

    Hall, Connor; Hatch, Michael; Ayan, Mohamed; Winn, Richard

    2016-01-01

    Infective endocarditis caused by Klebsiella species is rare, with most isolates being K. pneumoniae. We report the case of a 24-year-old intravenous drug user with newly diagnosed seminoma who developed K. oxytoca endocarditis. In addition to having K. oxytoca isolated from blood culture, cultures of that species were obtained from a retroperitoneal metastasis found on original presentation.

  8. A case of testicular infarction from the complications of Klebsiella oxytoca induced acute epididymitis.

    PubMed

    Lee, Wonae; Park, Heeyoon; Lee, Gilho

    2016-04-01

    Herein, we reported a case of testicular infarction in a patient with Klebsiella oxytoca induced acute epididymitis. Acute left epididymitis progressed into testicular infarction requiring orchiectomy in spite of antibiotics treatment. Ordinary urine cultures did not reveal any specific organism, suggesting viable but noncultureable state. We amplified a bacterial 16S ribosomal subunit gene from the urine and orchiectomized samples, and we found K. oxytoca infections from both of them. PMID:26643901

  9. Modulation of mgrB gene expression as a source of colistin resistance in Klebsiella oxytoca.

    PubMed

    Jayol, Aurlie; Poirel, Laurent; Villegas, Maria-Virginia; Nordmann, Patrice

    2015-07-01

    Gene modifications in the PmrAB and PhoPQ two-component regulatory systems, as well as inactivation of the mgrB gene, are known to be causes of colistin resistance in Klebsiella pneumoniae. The objective of this study was to characterise the mechanism involved in colistin resistance in a Klebsiella oxytoca isolate. A K. oxytoca clinical isolate showing resistance to colistin was recovered in Cali, Colombia. The pmrA, pmrB, phoP, phoQ and mgrB genes were amplified and sequenced. Wild-type mgrB genes from K. pneumoniae and K. oxytoca were cloned, and corresponding recombinant plasmids were used for complementation assays. By analysing the mgrB gene of the K. oxytoca isolate and its flanking sequences, an insertion sequence (IS) of 1196bp was identified in its promoter region. The insertion was located between nucleotides -39 and -38 when referring to the start codon of the mgrB gene, thus negatively interfering with expression of the mgrB gene by modifying its promoter structure. This IS was very similar to ISKpn26 (99% nucleotide identity) belonging to the IS5 family. Complementation assays with mgrB genes from wild-type K. pneumoniae or K. oxytoca restored full susceptibility to colistin. In conclusion, here we identified the mechanism involved in colistin resistance in a K. oxytoca isolate. Modulation of mgrB gene expression was the key factor for this acquired resistance to colistin. PMID:25982250

  10. Hypersensitivity pneumonitis secondary to Klebsiella oxytoca. A new cause of humidifier lung.

    PubMed

    Kane, G C; Marx, J J; Prince, D S

    1993-08-01

    A 30-year-old woman developed recurrent episodes of fever, dyspnea, and nonproductive cough after repeated exposure to a home humidifier. The diagnosis of hypersensitivity pneumonitis was confirmed by detection of serum-binding antibodies at significant titer to Klebsiella oxytoca colonizing the humidifier water but not to other potential antigens. This represents a newly recognized cause of hypersensitivity pneumonitis related to exposure to K oxytoca contaminating a commercially available ultrasonic cold air home humidifier. The potential role for these frequently used home humidifier devices in unexplained pulmonary illness is emphasized. PMID:8339664

  11. Cytotoxic and Pathogenic Properties of Klebsiella oxytoca Isolated from Laboratory Animals

    PubMed Central

    Sarkar, Ujjal; Seneviratne, Uthpala; Park, Danny S.; Gamazon, Eric R.; Batchelder, Chara; Cheung, Cheryl; Buckley, Ellen M.; Taylor, Nancy S.; Shen, Zeli; Tannenbaum, Steven R.; Wishnok, John S.; Fox, James G.

    2014-01-01

    Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin production in animal isolates of K. oxytoca and its pathogenic properties have not been characterized. Furthermore, neither the identity of the toxin nor a complete repertoire of genes involved in K. oxytoca pathogenesis have been fully elucidated. Here, we showed that several animal isolates of K. oxytoca, including the clinical isolates, produced secreted products in bacterial culture supernatant that display cytotoxicity on HEp-2 and HeLa cells, indicating the ability to produce cytotoxin. Cytotoxin production appears to be regulated by the environment, and soy based product was found to have a strong toxin induction property. The toxin was identified, by liquid chromatography-mass spectrometry and NMR spectroscopy, as low molecular weight heat labile benzodiazepine, tilivalline, previously shown to cause cytotoxicity in several cell lines, including mouse L1210 leukemic cells. Genome sequencing and analyses of a cytotoxin positive K. oxytoca strain isolated from an abscess of a mouse, identified genes previously shown to promote pathogenesis in other enteric bacterial pathogens including ecotin, several genes encoding for type IV and type VI secretion systems, and proteins that show sequence similarity to known bacterial toxins including cholera toxin. To our knowledge, these results demonstrate for the first time, that animal isolates of K. oxytoca, produces a cytotoxin, and that cytotoxin production is under strict environmental regulation. We also confirmed tilivalline as the cytotoxin present in animal K. oxytoca strains. These findings, along with the discovery of a repertoire of genes with virulence potential, provide important insights into the pathogenesis of K. oxytoca. As a novel diagnostic tool, tilivalline may serve as a biomarker for K oxytoca-induced cytotoxicity in humans and animals through detection in various samples from food to diseased samples using LC-MS/MS. Induction of K. oxytoca cytotoxin by consumption of soy may be in part involved in the pathogenesis of gastrointestinal disease. PMID:25057966

  12. Recombinant Klebsiella oxytoca strains with improved efficiency in removal of high nitrate loads

    SciTech Connect

    Pinar, G.; Ramos, J.L.

    1998-12-01

    Klebsiella oxytoca CECT 4460 removes high nitrate loads from industrial wastewaters without accumulation of nitrite under optimal culture conditions; however, under nonoptimal conditions nitrite accumulates. This situation reflects an in vivo-limited functioning of nitrite reductase in this strain. As a way to overcome this limitation, an increase in the nitrite reductase gene dose in K. oxytoca CECT 4460 was considered. To achieve this, the authors cloned and transferred into this strain the Klebsiella pneumoniae nasB gene, which encodes assimilatory nitrite reductase. The delivery vector was either the wide-host-range plasmid pUPE2, in which the nasB gene is expressed from the Escherichia coli P{sub lac} promoter, or a mini-Tn5-Km vector, which upon random insertion in the host chromosome allowed expression of the nasB gene from an unidentified chromosomal host promoter. The effect of the increase in the dose of the nasB gene in K. oxytoca CECT 4460 on the accumulation of nitrite in the culture medium was tested in two recombinant strains. The results obtained showed that K. oxytoca CECT 4460 bearing pUPE2 accumulated 88% less nitrite than the wild-type strain, while the recombinant strain bearing the K. pneumoniae nasB gene in the host chromosome showed a 25% lower level of nitrite accumulation in the culture medium than that of the wild type.

  13. Contaminated handwashing sinks as the source of a clonal outbreak of KPC-2-producing Klebsiella oxytoca on a hematology ward.

    PubMed

    Leitner, Eva; Zarfel, Gernot; Luxner, Josefa; Herzog, Kathrin; Pekard-Amenitsch, Shiva; Hoenigl, Martin; Valentin, Thomas; Feierl, Gebhard; Grisold, Andrea J; Hgenauer, Christoph; Sill, Heinz; Krause, Robert; Zollner-Schwetz, Ines

    2015-01-01

    We investigated sinks as possible sources of a prolonged Klebsiella pneumonia carbapenemase (KPC)-producing Klebsiella oxytoca outbreak. Seven carbapenem-resistant K. oxytoca isolates were identified in sink drains in 4 patient rooms and in the medication room. Investigations for resistance genes and genetic relatedness of patient and environmental isolates revealed that all the isolates harbored the blaKPC-2 and blaTEM-1 genes and were genetically indistinguishable. We describe here a clonal outbreak caused by KPC-2-producing K. oxytoca, and handwashing sinks were a possible reservoir. PMID:25348541

  14. Contaminated Handwashing Sinks as the Source of a Clonal Outbreak of KPC-2-Producing Klebsiella oxytoca on a Hematology Ward

    PubMed Central

    Leitner, Eva; Zarfel, Gernot; Luxner, Josefa; Herzog, Kathrin; Pekard-Amenitsch, Shiva; Hoenigl, Martin; Valentin, Thomas; Feierl, Gebhard; Grisold, Andrea J.; Högenauer, Christoph; Sill, Heinz; Krause, Robert

    2014-01-01

    We investigated sinks as possible sources of a prolonged Klebsiella pneumonia carbapenemase (KPC)-producing Klebsiella oxytoca outbreak. Seven carbapenem-resistant K. oxytoca isolates were identified in sink drains in 4 patient rooms and in the medication room. Investigations for resistance genes and genetic relatedness of patient and environmental isolates revealed that all the isolates harbored the blaKPC-2 and blaTEM-1 genes and were genetically indistinguishable. We describe here a clonal outbreak caused by KPC-2-producing K. oxytoca, and handwashing sinks were a possible reservoir. PMID:25348541

  15. Draft Genome Sequences of Klebsiella oxytoca Isolates Originating from a Highly Contaminated Liquid Hand Soap Product

    PubMed Central

    Hammerl, J. A.; Lasch, P.; Nitsche, A.; Dabrowski, P. W.; Hahmann, H.; Wicke, A.; Kleta, S.; Dahouk, S. Al

    2015-01-01

    In 2013, contaminated liquid soap was detected by routine microbiological monitoring of consumer products through state health authorities. Because of its high load of Klebsiella oxytoca, the liquid soap was notified via the European Union Rapid Alert System for Dangerous Non-Food Products (EU-RAPEX) and recalled. Here, we present two draft genome sequences and a summary of their general features. PMID:26205867

  16. Characterization of Piperacillin/Tazobactam-Resistant Klebsiella oxytoca Recovered from a Nosocomial Outbreak

    PubMed Central

    Fujita, Ai; Kimura, Kouji; Yokoyama, Satoru; Jin, Wanchun; Wachino, Jun-ichi; Yamada, Keiko; Suematsu, Hiroyuki; Yamagishi, Yuka; Mikamo, Hiroshige; Arakawa, Yoshichika

    2015-01-01

    We characterized 12 clinical isolates of Klebsiella oxytoca with the extended-spectrum ?-lactamase (ESBL) phenotype (high minimum inhibitory concentration [MIC] values of ceftriaxone) recovered over 9 months at a university hospital in Japan. To determine the clonality of the isolates, we used pulsed-field gel electrophoresis (PFGE), multi-locus sequence typing (MLST), and PCR analyses to detect blaRBI, which encodes the ?-lactamase RbiA, OXY-2-4 with overproduce-type promoter. Moreover, we performed the isoelectric focusing (IEF) of ?-lactamases, and the determination of the MICs of ?-lactams including piperacillin/tazobactam for 12 clinical isolates and E. coli HB101 with pKOB23, which contains blaRBI, by the agar dilution method. Finally, we performed the initial screening and phenotypic confirmatory tests for ESBLs. Each of the 12 clinical isolates had an identical PFGE pulsotype and MLST sequence type (ST9). All 12 clinical isolates harbored identical blaRBI. The IEF revealed that the clinical isolate produced only one ?-lactamase. E. coli HB101 (pKOB23) and all 12 isolates demonstrated equally resistance to piperacillin/tazobactam (MICs, >128 ?g/ml). The phenotypic confirmatory test after the initial screening test for ESBLs can discriminate ?-lactamase RbiA-producing K. oxytoca from ?-lactamase CTX-M-producing K. oxytoca. Twelve clinical isolates of K. oxytoca, which were recovered from an outbreak at one university hospital, had identical genotypes and produced ?-lactamase RbiA that conferred resistance to piperacillin/tazobactam. In order to detect K. oxytoca isolates that produce RbiA to promote research concerning ?-lactamase RbiA-producing K. oxytoca, the phenotypic confirmatory test after the initial screening test for ESBLs would be useful. PMID:26539828

  17. A study of the prevalence of cytotoxic and non-cytotoxic Klebsiella oxytoca fecal colonization in two patient populations

    PubMed Central

    Smith, Stephen A; Campbell, Sarah J; Webster, Duncan; Curley, Michael; Leddin, Desmond; Forward, Kevin R

    2009-01-01

    BACKGROUND: Klebsiella oxytoca is a cause of antibiotic-associated hemorrhagic colitis. Few reports of the occurrence of K oxytoca within stool exist and there is no gold standard method for its isolation. METHODS: MacConkey agar was modified to culture K oxytoca. Ampicillin was added and adonitol was substituted for lactose. Rectal swabs from 200 patients being screened for vancomycin-resistant enterococci (VRE) and stool specimens from 429 patients who tested negative for Clostridium difficile cytotoxin were cultured. K oxytoca isolates were evaluated for cytotoxicity to HEp-2 cells. Available charts of K oxytoca-positive patients and a convenience sample of 93 K oxytoca-negative patients who underwent testing for C difficile cytotoxicity were reviewed retrospectively for documentation of bloody stool. RESULTS: K oxytoca was isolated from 14 of 200 patients (7.0%) being screened for VRE; only one of the 14 isolates (7.1%) was cytotoxic. The organism was isolated from 42 of 429 patients (9.8%) tested for C difficile cytotoxicity; 10 isolates (23.8%) were cytotoxic. Differences in isolation and cytotoxicity rates between groups were not statistically significant. Two of 13 (15.4%) K oxytoca-positive patients screened for VRE, three of 27 (11.1%) K oxytoca-positive patients tested for C difficile cytotoxicity, and 11 of 93 (11.8%) patients from the convenience sample had documented bloody stool. CONCLUSIONS: A medium that greatly facilitates isolation of K oxytoca was developed. Occurrence of K oxytoca colonization was similar in the two patient populations studied and isolation of cytotoxic K oxytoca was not usually associated with hematochezia. Current understanding of the occurrence and causality of antibiotic-associated hemorrhagic colitis is insufficient for clinical laboratories to begin culturing K oxytoca and testing for cytotoxicity. PMID:21119796

  18. Genome Sequence of Klebsiella oxytoca SA2, an Endophytic Nitrogen-Fixing Bacterium Isolated from the Pioneer Grass Psammochloa villosa.

    PubMed

    Chen, Mingyue; Lin, Li; Zhang, Yanming; Sun, Li; An, Qianli

    2013-01-01

    Klebsiella oxytoca strain SA2 is an endophytic nitrogen-fixing bacterium isolated from the pioneer grass Psammochloa villosa, which grows in the moving sand dunes of Ordos Plateau, China. The SA2 genome sequence provides the genetic background for understanding its endophytic lifestyle and survival in association with grass in nitrogen-poor environments. PMID:23950120

  19. Epidemiology of Klebsiella oxytoca-associated diarrhea detected by Simmons citrate agar supplemented with inositol, tryptophan, and bile salts.

    PubMed

    Cheng, Vincent C C; Yam, Wing-Cheong; Tsang, Lee-Lee; Yau, Miranda C Y; Siu, Gilman K H; Wong, Sally C Y; Chan, Jasper F W; To, Kelvin K W; Tse, Herman; Hung, Ivan F N; Tai, Josepha W M; Ho, Pak-Leung; Yuen, Kwok-Yung

    2012-05-01

    We studied the clinical and epidemiological characteristics of Klebsiella oxytoca-associated diarrhea in hospitalized patients in Hong Kong. Between 1 November 2009 and 30 April 2011, all inositol-fermenting colonies found on Simmons citrate agar supplemented with inositol, tryptophan, and bile salts (SCITB agar) used for the culturing of diarrheal stool samples were screened by a spot indole test for K. oxytoca. The overall sensitivity of SCITB agar plus the spot indole test (93.3%) for the detection of K. oxytoca in stool samples was superior to that of MacConkey agar (63.3%), while the specificities were 100% and 60.4%, respectively. The former achieved a 23-fold reduction in the workload and cost of subsequent standard biochemical identifications. Cytotoxin production and the clonality of K. oxytoca were determined by a cell culture cytotoxicity neutralization assay using HEp-2 cells and pulsed-field gel electrophoresis (PFGE), respectively. Of 5,581 stool samples from 3,537 patients, K. oxytoca was cultured from 117/5,581 (2.1%) stool samples from 104/3,537 (2.9%) patients. Seventy-six of 104 (73.1%) patients with K. oxytoca had no copathogens in their diarrheal stool samples. Twenty-four (31.6%) of 76 patients carried cytotoxin-producing strains, which were significantly associated with antibiotic therapy after hospital admission (50% versus 21.2%; P = 0.01). Health care-associated diarrhea was found in 44 (42%) of 104 patients with K. oxytoca, but there was no epidemiological linkage suggestive of a nosocomial outbreak, and PFGE showed a diverse pattern. None of the patients with cytotoxin-producing K. oxytoca developed antibiotic-associated hemorrhagic colitis, suggesting that K. oxytoca can cause a mild disease manifesting as uncomplicated antibiotic-associated diarrhea with winter seasonality. PMID:22357507

  20. Intracellular azo decolorization is coupled with aerobic respiration by a Klebsiella oxytoca strain.

    PubMed

    Yu, Lei; Zhang, Xiao-Yu; Xie, Tian; Hu, Jin-Mei; Wang, Shi; Li, Wen-Wei

    2015-03-01

    Reduction of azo dye methyl red coupled with aerobic respiration by growing cultures of Klebsiella oxytoca GS-4-08 was investigated. In liquid media containing dye and 0.6% glucose in a mineral salts base, 100mgl(-1) of the dye are completely removed in 3h under shaking conditions. The dye cannot be aerobically decolorized by strain GS-4-08 without extra carbon sources, indicating a co-metabolism process. Higher initial dye concentration prolonged the lag phase of the cell growth, but final cell concentrations of each batches reached a same level with range from 6.3 to 7.6mgl(-1) after the dye adaption period. This strain showed stronger dye tolerance and decolorization ability than many reported strains. Furthermore, a new intracellular oxygen-insensitive azoreductase was isolated from this strain, and the specific activity of enzyme was 0.846 and 0.633Umg(-1) protein in the presence of NADH and NADPH, respectively. N,N dimethyl-p-phenylenediamine and anthranilic acid were stoichiometrically released from MR dye, indicating the breakage of azo bonds accounts for the intracellular decolorization. Combining the characteristics of azoreductase, the stoichiometry of EMP, and TCA cycle, the electron transfer chain theory of aerobic respiration, and the possible mechanism of aerobic respiration coupled with azo reduction by K. oxytoca GS-4-08 are proposed. This study is expected to provide a sound theoretical basis for the development of the K. oxytoca strain in aerobic process for azo dye containing wastewaters. PMID:25343980

  1. The role of nitrogenase in a cyanide-degrading Klebsiella oxytoca strain.

    PubMed

    Liu, J K; Liu, C H; Lin, C S

    1997-04-01

    It is well known that the major function of nitrogenase is to fix atmospheric nitrogen. However, cyanide can also serve as a subtrate for nitrogenase and can be reduced to CH4 and NH4+. A cyanide-degrading Klebsiella oxytoca strain was isolated from cyanide contaminated water. This isolate was also found to have a nitrogen-fixation capability. Nitrogenase activities in this organism could be induced by KCN. However, there was no significant difference of the induction effect between 1 mM KCN and 5 mM KCN. It was found that the cyanide-degrading ability of this isolate could be inhibited by multicopy hybrid pGR112 nif-containing plasmids. Comparing the wild type K. oxytoca strain with the pGR112 plasmid transformed strain, a typical diauxic growth of the wild type strain was observed in a medium containing NH4Cl and KCN. Although the nif plasmid transformed strain also exhibited diauxic growth in the same medium, a much longer second lag phase was noted. In addition, methane, the nitrogenase reduction end product of cyanide, could be detected on cyanide-containing growth cultures. Ammonium chloride, a repressor of nitrogenase gene expression, was consumed prior to KCN in both strains. Again, the degradation of KCN in the pGR112 transformed strain occurred only under loose control of the nitrogenase gene. These findings strongly suggest that nitrogenase may be the sole cyanide-degrading enzyme in this organism. PMID:9276965

  2. Conversion of xylan to ethanol by ethanologenic strains of Escherichia coli and Klebsiella oxytoca

    SciTech Connect

    Burchhardt, G.; Ingram, L.O. )

    1992-04-01

    A two-stage process was evaluated for the fermentation of polymeric feedstocks to ethanol by a single, genetically engineered microorganism. The truncated xylanase gene (xynZ) from the thermophilic bacterium Clostridium thermocellum was fused with the N terminus of lacZ to eliminate secretory signals. This hybrid gene was expressed at high levels in ethanologenic strains of Escherichia coli KO11 and Klebsiella oxytoca M5A1(pLOI555). Large amounts of xylanase (25 to 93 mU/mg of cell protein) accumulated as intracellular products during ethanol production. Cells containing xylanase for saccharification. After cooling, the hydrolysate was fermented to ethanol with the same organism (30C), thereby replenishing the supply of xylanase for a subsequent saccharification. Recombinant E. coli metabolized only xylose, while recombinant K. oxytoca M5A1 metabolized xylose, xylobiose, and xylotriose but not xylotetrose. Derivatives of this latter organism produced large amounts of intracellular xylosidase, and the organism is presumed to transport both xylobiose and xylotriose for intracellular hydrolysis. By using recombinant M5A1, approximately 34% of the maximal theoretical yield of ethanol was obtained from xylan by this two-stage process. The yield appeared to be limited by the digestability of commercial xylan rather than by a lack of sufficient xylanase or by ethanol toxicity. In general form, this two-stage process, which uses a single, genetically engineered microorganism, should be applicable for the production of useful chemicals from a wide range of biomass polymers.

  3. Metabolic engineering of Klebsiella oxytoca M5A1 for ethanol production from xylose and glucose

    SciTech Connect

    Ohta, Kazuyoshi; Beall, D.S.; Mejia, J.P.; Shanmugam, K.T.; Ingram, L.O. )

    1991-10-01

    The efficient diversion of pyruvate from normal fermentative pathways to ethanol production in Klebsiella oxytoca M5A1 requires the expression of Zymomanas mobilis genes encoding both pyruvate decarboxylase and alcohol dehydrogenase. Final ethanol concentrations obtained with the best recombinant, strain M5A1 (pLOI555), were in excess of 40 g/liter with an efficiency of 0.48 g of ethanol (xylose) and 0.50 g of ethanol (glucose) per g of sugar, as compared with a theoretical maximum of 0.51 of ethanol per g of sugar. The maximal volumetric productivity per hour for both sugars was 2.0 g/liter. This volumetric productivity with xylose is almost twice that previously obtained with ethanologenic Escherichia coli. Succinate was also produced as a minor product during fermentation.

  4. Genetic control of nitrate assimilation in Klebsiella oxytoca. Final technical report

    SciTech Connect

    Stewart, Valley J.

    2001-04-01

    Some microorganisms can use nitrate as the sole source of nitrogen for biosynthesis. This project focused on the bacterium Klebsiella oxytoca, an enterobacterium found in soil and water. Mutagenesis and molecular cloning identified the nasFEDCBA operon encoding enzymes for the uptake and reduction of nitrate and nitrite to ammonium, and the adjacent nasR regulatory gene. Analysis of nasF operon expression revealed that transcription is activated by the Ntr (general nitrogen regulation ) system in response to nitrogen limitation. Transcription antitermination control in response to nitrate and nitrite is mediated by the NasR protein. Additional work established that the NasR protein is an RNA-binding protein that interacts with nasF operon leader RNA to control transcription readthrough.

  5. Optimization of 2,3-butanediol production by Klebsiella oxytoca through oxygen transfer rate control

    SciTech Connect

    Beronio, P.B. Jr. . Amoco Research Center); Tsao, G.T. . Lab. of Renewable Resources Engineering)

    1993-12-01

    Production of 2,3-butanediol by Klebsiella oxytoca is influenced by the degree of oxygen limitation. During batch culture studies, two phases of growth are observed: energy-coupled growth, during which cell growth and oxygen supply are coupled; and, energy-uncoupled growth, which arises when the degree of oxygen limitation reaches a critical value. Optimal 2,3-butanediol productivity occurs during the energy-coupled growth phase. In this article, a control system which maintains the batch culture at a constant level of oxygen limitation in the energy-coupled growth regime has been designed. Control, which involves feedback control on the oxygen transfer coefficient, is achieved by continually increasing the partial pressure of oxygen in the feed gas, which in turn continually increases the oxygen transfer rate. Control has resulted in a balanced state of growth, a repression of ethanol formation, and an increase in 2,3-butanediol productivity of 18%.

  6. Final Technical Report: Genetic Control of Nitrogen Assimilation in Klebsiella oxytoca.

    SciTech Connect

    Valley Stewart

    2007-03-07

    Klebsiella oxytoca, an enterobacterium closely related to Escherichia coli and amenable to molecular genetic analysis, is a long-established model organism for studies of bacterial nitrogen assimilation. Our work concerned utilization of purines, nitrogen-rich compounds that are widespread in the biosphere. This project began with our observation that molybdenum cofactor (chlorate-resistant) mutants can use (hypo)xanthine as sole nitrogen source (Garzón et al., J. Bacteriol. 174:6298, 1992). Since xanthine dehydrogenase is a molybdoenzyme, Klebsiella must use an alternate route for (hypo)xanthine catabolsim. We identified and characterized a cluster of 22 genes that encode the enzymes, permeases and regulators for utilizing hypoxanthine and xanthine as sole nitrogen source. (Hypoxanthine and xanthine arise from deamination of adenine and guanine, respectively.) Growth and complementation tests with insertion mutants, combined with protein sequence comparisons, allow us to assign probable functions for the products of these genes and to deduce the overall pathway. We present genetic evidence that the first two enzymes for the Klebsiella purine utilization pathway have been recruited from pathways involved in catabolism of aromatic compounds. The first, HxaAB enzyme catalyzing (hypo)xanthine oxidation, is related to well-studied aromatic ring hydroxylating oxygenases such as phthalate dioxygenase. The second, HxbA enzyme catalyzing urate hydroxylation, is related to single-component monooxygenases. Thus, the Klebsiella purine utilization pathway has likely experienced non-orthologous gene displacement, substituting these oxygenases for the conventional enzymes, xanthine dehydrogenase and uricase. We also present evidence that transcription of the hxaAB operon is subject to dual regulation: global general nitrogen regulation (Ntr) through an unknown mechanism, and (hypo)xanthine induction mediated by a LysR-type activator.

  7. First Description of KPC-2-Producing Klebsiella oxytoca Isolated from a Pediatric Patient with Nosocomial Pneumonia in Venezuela

    PubMed Central

    Labrador, Indira

    2014-01-01

    During the last decade, carbapenem resistance has emerged among clinical isolates of the Enterobacteriaceae family. This has been increasingly attributed to the production of β-lactamases capable of hydrolyzing carbapenems. Among these enzymes, Klebsiella pneumoniae carbapenemases (KPCs) are the most frequently and clinically significant class-A carbapenemases. In this report, we describe the first nosocomial KPC-2-producing K. oxytoca isolated from a pediatric patient with pneumonia admitted to the intensive care unit at The Andes University Hospital, Mérida, Venezuela. This strain was resistant to several antibiotics including imipenem, ertapenem, and meropenem but remained susceptible to ciprofloxacin, colistin, and tigecycline. Conjugation assays demonstrated the transferability of all resistance determinants, except aminoglycosides. The isolate LMM-SA26 carried a ~21 kb conjugative plasmid that harbored the blaKPC-2, blaCTX-M-8, and blaTEM-15 genes. Although carbapenem resistance in the Enterobacteriaceae is still unusual in Venezuela, KPCs have a great potential to spread due to their localization on mobile genetic elements. Therefore, rapid detection of KPC-carrying bacteria with phenotypic and confirmatory molecular tests is essential to establish therapeutic options and effective control measures. PMID:25405043

  8. Biosynthesis of Indole-3-Acetic Acid by New Klebsiella oxytoca Free and Immobilized Cells on Inorganic Matrices

    PubMed Central

    Celloto, Valria R.; Oliveira, Arildo J. B.; Gonalves, Jos E.; Watanabe, Ceclia S. F.; Matioli, Graciette; Gonalves, Regina A. C.

    2012-01-01

    While many natural and synthetic compounds exhibit auxin-like activity in bioassays, indole-3-acetic acid (IAA) is recognized as the key auxin in most plants. IAA has been implicated in almost all aspects of plant growth and development and a large array of bacteria have been reported to enhance plant growth. Cells of Klebsiella oxytoca isolated from the rhizosphere of Aspidosperma polyneuron and immobilized by adsorption on different inorganic matrices were used for IAA production. The matrices were prepared by the sol-gel method and the silica-titanium was the most suitable matrix for effective immobilization. In operational stability assays, IAA production was maintained after four cycles of production, obtaining 42.80 2.03??g?mL?1 of IAA in the third cycle, which corresponds to a 54% increase in production in relation to the first cycle, whereas free cells began losing activity after the first cycle. After 90 days of storage at 4C the immobilized cells showed the slight reduction of IAA production without significant loss of activity. PMID:22623901

  9. The pKO2 linear plasmid prophage of Klebsiella oxytoca.

    PubMed

    Casjens, Sherwood R; Gilcrease, Eddie B; Huang, Wai Mun; Bunny, Kim L; Pedulla, Marisa L; Ford, Michael E; Houtz, Jennifer M; Hatfull, Graham F; Hendrix, Roger W

    2004-03-01

    Temperate bacteriophages with plasmid prophages are uncommon in nature, and of these only phages N15 and PY54 are known to have a linear plasmid prophage with closed hairpin telomeres. We report here the complete nucleotide sequence of the 51,601-bp Klebsiella oxytoca linear plasmid pKO2, and we demonstrate experimentally that it is also a prophage. We call this bacteriophage phiKO2. An analysis of the 64 predicted phiKO2 genes indicate that it is a fairly close relative of phage N15; they share a mosaic relationship that is typical of different members of double-stranded DNA tailed-phage groups. Although the head, tail shaft, and lysis genes are not recognizably homologous between these phages, other genes such as the plasmid partitioning, replicase, prophage repressor, and protelomerase genes (and their putative targets) are so similar that we predict that they must have nearly identical DNA binding specificities. The phiKO2 virion is unusual in that its phage lambda-like tails have an exceptionally long (3,433 amino acids) central tip tail fiber protein. The phiKO2 genome also carries putative homologues of bacterial dinI and umuD genes, both of which are involved in the host SOS response. We show that these divergently transcribed genes are regulated by LexA protein binding to a single target site that overlaps both promoters. PMID:14996813

  10. Fermentation of crystalline cellulose to ethanol by Klebsiella oxytoca containing chromosomally integrated zymomonas mobilis genes

    SciTech Connect

    Doran, J.B.; Ingram, L.O.

    1993-09-01

    Complete enzymatic hydrolysis of cellulose to glucose is generally required for efficient fermentation to ethanol. This hydrolysis requires endoglucanase, exoglucanase, and cellobiase. The Gram-negative bacterium, Klebsiella oxytoca, contains the native ability to transport and metabolize cellobiose, minimizing the need for extracellular cellobiase. Strain P2 is a recombinant derivative in which the Zymomonas mobilis pdc and adhB genes have been integrated into the chromosome and expressed, directing the metabolism of pyruvate to ethanol. This organism has been evaluated in simultaneous saccharification and fermentation (SSF) experiments to determine optimal conditions and limits of performance. The temperature was varied between 32 and 40{degree}C over a pH range of 5.0-5.8 with 100 g/L crystalline cellulose (Sigmacell 50, Sigma Chemical Company, St. Louis, MO) as the substrate and commercial cellulase (Spezyme CE, South San Francisco, CA). A broad optimum for SSF was observed, with a pH of 5.2-5.5 and temperatures of 32-35{degree}C, which allowed the production of over 44 g of ethanol/L (81-86% of the maximum theoretical yield). Although the rate of ethanol production increased with cellulase, diminishing improvements were observed at enzyme loadings above 10 filter paper units/g of cellulose. 34 refs., 5 figs., 2 tabs.

  11. Effects of nano zero-valent iron on Klebsiella oxytoca and stress response.

    PubMed

    Sacc, Maria Ludovica; Fajardo, Carmen; Nande, Mar; Martn, Margarita

    2013-11-01

    Nano zero-valent iron (NZVI) is a new option for contaminated soil and groundwater treatment, despite little is known on their impact on environmental microorganisms. Klebsiella oxytoca K5 strain, isolated from the NZVI-treated soil, was used to investigate the bacterial, phenotypical and molecular response to commercial NZVI exposure. Cytotoxicity assays at three NZVI concentrations (1, 5 and 10mgmL(-1)) suggested a negligible bacteriostatic effect and the lack of bactericidal effect. Structural changes were analysed by electronic microscopy. Scanning electron microscopy revealed the presence of NZVI around some bacterial cells, but no apparent morphological changes were seen. NZVI attachment to the cell surface was confirmed by transmission electron microscopy, although most of them were not affected. A proteomic approach (two-dimensional electrophoresis, matrix-assisted laser desorption ionization time-of-flight mass spectrometry) was used to investigate NZVI impact. For the first time to our knowledge, results revealed that exposure of a soil bacterium to NZVI resulted in the overproduction of tryptophanase, associated with oxidative stress response. K5 may set up an adaptative stress response involving indole as a signal molecule to inform the bacterial population about environmental changes. These findings would improve knowledge on the molecular mechanisms underlying bacterial response to NZVI exposure. PMID:23893265

  12. Stereochemically specific proton transfer in decarboxylation of 4-hydroxycinnamic acids by 4-hydroxycinnamate decarboxylase from Klebsiella oxytoca.

    PubMed

    Hashidoko, Y; Tahara, S

    1998-11-15

    The stereochemical specificity in the decarboxylation of E-4-hydroxycinnamic acid catalyzed by E-4-hydroxycinnamate decarboxylase (4-HCD) of Klebsiella oxytoca was investigated. Unlike the pyrolytic decarboxylation of 8-deuterated E-4-hydroxycinnamic acid to yield an equimolecular mixture of 8-Z- and 8-E-deuterated 4-hydroxystyrenes, treating 8-deuterated E-4-hydroxycinnamic acid with the enzyme in H2O-based buffer yielded 8-Z-deuterated 4-hydroxystyrene selectively. The specific E-orientation in catalysis and the substrate specificity requiring 4-OH in the substrates suggest that decarboxylation by K. oxytoca 4-HCD occurs via a para-quinone methide intermediate. Stereoselective protonation and the liberation of CO2 by an intermediary molecule are most likely the key reaction steps in the stereochemical specificity of the newly incorporated hydrogen. PMID:9808764

  13. Cloning, Characterization, and Functional Expression of the Klebsiella oxytoca Xylodextrin Utilization Operon (xynTB) in Escherichia coli†

    PubMed Central

    Qian, Yilei; Yomano, L. P.; Preston, J. F.; Aldrich, H. C.; Ingram, L. O.

    2003-01-01

    Escherichia coli is being developed as a biocatalyst for bulk chemical production from inexpensive carbohydrates derived from lignocellulose. Potential substrates include the soluble xylodextrins (xyloside, xylooligosaccharide) and xylobiose that are produced by treatments designed to expose cellulose for subsequent enzymatic hydrolysis. Adjacent genes encoding xylobiose uptake and hydrolysis were cloned from Klebsiella oxytoca M5A1 and are functionally expressed in ethanologenic E. coli. The xylosidase encoded by xynB contains the COG3507 domain characteristic of glycosyl hydrolase family 43. The xynT gene encodes a membrane protein containing the MelB domain (COG2211) found in Na+/melibiose symporters and related proteins. These two genes form a bicistronic operon that appears to be regulated by xylose (XylR) and by catabolite repression in both K. oxytoca and recombinant E. coli. Homologs of this operon were found in Klebsiella pneumoniae, Lactobacillus lactis, E. coli, Clostridium acetobutylicum, and Bacillus subtilis based on sequence comparisons. Based on similarities in protein sequence, the xynTB genes in K. oxytoca appear to have originated from a gram-positive ancestor related to L. lactis. Functional expression of xynB allowed ethanologenic E. coli to metabolize xylodextrins (xylosides) containing up to six xylose residues without the addition of enzyme supplements. 4-O-methylglucuronic acid substitutions at the nonreducing termini of soluble xylodextrins blocked further degradation by the XynB xylosidase. The rate of xylodextrin utilization by recombinant E. coli was increased when a full-length xynT gene was included with xynB, consistent with xynT functioning as a symport. Hydrolysis rates were inversely related to xylodextrin chain length, with xylobiose as the preferred substrate. Xylodextrins were utilized more rapidly by recombinant E. coli than K. oxytoca M5A1 (the source of xynT and xynB). XynB exhibited weak arabinosidase activity, 3% that of xylosidase. PMID:14532050

  14. Genome-scale reconstruction and in silico analysis of Klebsiella oxytoca for 2,3-butanediol production

    PubMed Central

    2013-01-01

    Background Klebsiella oxytoca, a Gram-negative, rod-shaped, and facultative anaerobic bacterium, is one of the most promising 2,3-butanediol (2,3-BD) producers. In order to improve the metabolic performance of K. oxytoca as an efficient biofactory, it is necessary to assess its metabolic characteristics with a system-wide scope, and to optimize the metabolic pathways at a systems level. Provision of the complete genome sequence of K. oxytoca enabled the construction of genome-scale metabolic model of K. oxytoca and its in silico analyses. Results The genome-scale metabolic model of K. oxytoca was constructed using the annotated genome with biochemical and physiological information. The stoichiometric model, KoxGSC1457, is composed of 1,457 reactions and 1,099 metabolites. The model was further refined by applying biomass composition equations and comparing in silico results with experimental data based on constraints-based flux analyses. Then, the model was applied to in silico analyses to understand the properties of K. oxytoca and also to improve its capabilities for 2,3-BD production according to genetic and environmental perturbations. Firstly, in silico analysis, which tested the effect of augmenting the metabolic flux pool of 2,3-BD precursors, elucidated that increasing the pyruvate pool is primarily important for 2,3-BD synthesis. Secondly, we performed in silico single gene knockout simulation for 2,3-BD overproduction, and investigated the changes of the in silico flux solution space of a ldhA gene knockout mutant in comparison with that of the wild-type strain. Finally, the KoxGSC1457 model was used to optimize the oxygen levels during fermentation for 2,3-BD production. Conclusions The genome-scale metabolic model, KoxGSC1457, constructed in this study successfully investigated metabolic characteristics of K. oxytoca at systems level. The KoxGSC1457 model could be employed as an useful tool to analyze its metabolic capabilities, to predict its physiological responses according to environmental and genetic perturbations, and to design metabolic engineering strategies to improve its metabolic performance. PMID:23432904

  15. Influence of carbon source on nitrate removal by nitrate-tolerant Klebsiella oxytoca CECT 4460 in batch and chemostat cultures

    SciTech Connect

    Pinar, G.; Ramos, J.L.; Kovarova, K.; Egli, T.

    1998-08-01

    The nitrate-tolerant organism Klebsiella oxytoca CECT-4460 tolerates nitrate at concentrations up to 1 M and is used to treat wastewater with high nitrate loads in industrial wastewater treatment plants. The authors studied the influence of the C source (glycerol or sucrose or both) on the growth rate and the efficiency of nitrate removal under laboratory conditions. With sucrose as the sole C source the maximum specific growth rate was 0.3 h{sup {minus}1}, whereas with glycerol it was 0.45 h{sup {minus}1}. In batch cultures K. oxytoca cells grown on sucrose or glycerol were able to immediately use sucrose as a sole C source, suggesting that sucrose uptake and metabolism were constitutive. In contrast, glycerol uptake occurred preferentially in glycerol-grown cells. Independent of the preculture conditions, when sucrose and glycerol were added simultaneously to batch cultures, the sucrose was used first, and once the supply of sucrose was exhausted, the glycerol was consumed. Utilization of nitrate as an N source occurred without nitrite of ammonium accumulation when glycerol was used, but nitrite accumulated when sucrose was used. In chemostat cultures K. oxytoca CECT 4460 efficiently removed nitrate without accumulation of nitrite or ammonium when sucrose, glycerol, or mixtures of these two C sources were used. The growth yields and the efficiencies of C and N utilization were determined at different growth rates in chemostat cultures. Regardless of the C source, yield carbon (Y{sub C}) ranged between 1.3 and 1.0 g (dry weight) per g of sucrose C or glycerol C consumed. Regardless of the specific growth rate and the C source, yield nitrogen (Y{sub N}) ranged from 17.2 to 12.5 g (dry weight) per g of nitrate N consumed.

  16. Metabolic profiling of Klebsiella oxytoca: evaluation of methods for extraction of intracellular metabolites using UPLC/Q-TOF-MS.

    PubMed

    Park, Changhun; Yun, Seokhun; Lee, Sang Yup; Park, Kyungmoon; Lee, Jinwon

    2012-06-01

    The global pool of intracellular metabolites is a reflection of all the metabolic functions of an organism. In the absence of in situ methods capable of directly measuring metabolite pools, intracellular metabolite measurements need to be performed after an extraction procedure. In this study, we evaluated the optimization of technologies for generation of a global metabolomics profile for intracellular metabolites in Klebsiella oxytoca. Intracellular metabolites of K. oxytoca were extracted at the early stationary phase using six different common extraction procedures, including cold methanol, boiling ethanol, methanol/chloroform combinations, hot water, potassium hydroxide, and perchloric acid. The metabolites were subsequently collected for further analysis, and intracellular metabolite concentration profiles were generated using ultra-performance liquid chromatography/quadrupole time-of-flight mass spectrometry. During analysis, the stability of metabolites extracted using cold methanol was clearly higher than that obtained by other extraction methods. For the majority of metabolites, extracts generated in this manner exhibited the greatest recovery, with high reproducibility. Therefore, the use of cold ethanol was the best extraction method for attaining a metabolic profile. However, in another parallel extraction method, perchloric acid may also be required to maximize the range of metabolites recovered, particularly to extract glucose 1-phosphate and NADPH. PMID:22555499

  17. Production of 2,3-butanediol from pretreated corn cob by Klebsiella oxytoca in the presence of fungal cellulase

    SciTech Connect

    Cao, Ningjun; Xia Youkun; Gong, Cheng, S.; Tsao, G.T.

    1997-12-31

    A simple and effective method of treatment of lignocellulosic material was used for the preparation of corn cob for the production of 2,3-butane-diol by Klebsiella oxytoca ATCC 8724 in a simultaneous saccharification and fermentation process. During the treatment, lignin, and alkaline extractives were solubilized and separated from cellulose and hemicellulose fractions by dilute ammonia (10%) steeping. Hemicellulose was then hydrolyzed by dilute hydrochloric acid (1%, w/v) hydrolysis at 100{degrees}C at atmospheric pressure and separated from cellulose fraction. The remaining solid, with 90% of cellulose, was then used as the substrate. A butane-diol concentration of 25 g/L and an ethanol concentration of 7 g/L were produced by K. oxytoca from 80 g/L of corn cob cellulose with a cellulose dosage of 8.5 IFPU/g corn cob cellulose after 72 h of SSF. With only dilute acid hydrolysis, a butanediol production rate of 0.21 g/L/h was obtained that is much lower than the case in which corn cob was treated with ammonia steeping prior to acid hydrolysis. The butanediol production rate for the latter was 0.36 g/L/h. 26 refs., 5 figs., 1 tab.

  18. Fermentation of starch by Klebsiella oxytoca P2, containing plasmids with {alpha}-amylase and pullulanase genes

    SciTech Connect

    Santos, V.L. dos; Araujo, E.F.; Barros, E.G. de; Guimaraes, W.V.

    1999-12-20

    Klebsiella oxytoca P2(pC46), an ethanol-producing recombinant, has been evaluated in fermentation of maltose and starch. The maximum ethanol produced by P2(pC46) was 0.34 g ethanol/g maltose and 0.38, 0.40, or 0.36 g ethanol/g starch in fermentation of 1, 2, or 4% starch, representing 68, 71, and 64% the theoretical yield. The pC46 plasmid transformed to cells of K. oxytoca P2 reduced the ethanol production from maltose and starch. In fermentation of starch after its digestion at 60 C for 24 h, in two-step fermentation, the time for maximum ethanol production was reduced to 12--24 h and the theoretical yield was around 90%. The increase in starch concentration resulted in lower {alpha}-amylase activity but in higher pullulanase activity. The high activity and thermostability of the amylolytic enzymes from this transformant suggest that it has a potential for amylolytic enzymes source.

  19. Effects of Tween 80 on the removal, sorption and biodegradation of pyrene by Klebsiella oxytoca PYR-1.

    PubMed

    Zhang, Dong; Zhu, Lizhong

    2012-05-01

    The sorption and biodegradation of pyrene by Klebsiella oxytoca PYR-1 (PYR-1) in the presence of nonionic surfactant Tween 80 were investigated toward a better understanding that how surfactants can affect biodegradation of hydrophobic organic compounds. The results indicated that Tween 80 can promote the removal, sorption and biodegradation of pyrene depending on the surfactant concentration, of which the most significant promotion of biodegradation was achieved at critical micelle concentration of Tween 80 with an improvement of 22.4%. A highly positive correlation (P<0.0001) was observed between the biodegradation and sorption of pyrene with the presence of Tween 80. Biosorption experiments showed the same trends as biodegradation and further illustrated the improved biodegradation of pyrene was mainly due to surfactant-facilitated sorption. The regularly changes of cell surface hydrophobicity suggested formation of more hydrophobic surface caused by surfactant sorption lead to stimulation of pyrene sorption. PMID:22361056

  20. Crystal structure of a novel two domain GH78 family α-rhamnosidase from Klebsiella oxytoca with rhamnose bound

    PubMed Central

    O’Neill, Ellis C; Stevenson, Clare E M; Paterson, Michael J; Rejzek, Martin; Chauvin, Anne-Laure; Lawson, David M; Field, Robert A

    2015-01-01

    The crystal structure of the GH78 family α-rhamnosidase from Klebsiella oxytoca (KoRha) has been determined at 2.7 Å resolution with rhamnose bound in the active site of the catalytic domain. Curiously, the putative catalytic acid, Asp 222, is preceded by an unusual non-proline cis-peptide bond which helps to project the carboxyl group into the active centre. This KoRha homodimeric structure is significantly smaller than those of the other previously determined GH78 structures. Nevertheless, the enzyme displays α-rhamnosidase activity when assayed in vitro, suggesting that the additional structural domains found in the related enzymes are dispensible for function. Proteins 2015; 83:1742–1749. © 2015 The Authors. Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc. PMID:25846411

  1. Improved O2-tolerance in variants of a H2-evolving [NiFe]-hydrogenase from Klebsiella oxytoca HP1.

    PubMed

    Huang, Gang-Feng; Wu, Xiao-Bing; Bai, Li-Ping; Liu, Ke; Jiang, Li-Jing; Long, Min-Nan; Chen, Qing-Xi

    2015-04-01

    In this study, we investigated the mechanism of O2 tolerance of Klebsiella oxytoca HP1 H2-evolving hydrogenase 3 (KHyd3) by mutational analysis and three-dimensional structure modeling. Results revealed that certain surface amino acid residues of KHyd3 large subunit, in particular those at the outer entrance of the gas channel, have a visible effect on its oxygen tolerance. Additionally, solution pH, immobilization and O2 partial pressure also affect KHyd3 O2-tolerance to some extent. We propose that the extent of KHyd3 O2-tolerance is determined by a balance between the rate of O2 access to the active center through gas channels and the deoxidation rate of the oxidized active center. Based on our findings, two higher O2-tolerant KHyd3 mutations G300E and G300M were developed. PMID:25747389

  2. Genotypes of Klebsiella oxytoca Isolates from Patients with Nosocomial Pneumonia Are Distinct from Those of Isolates from Patients with Antibiotic-Associated Hemorrhagic Colitis

    PubMed Central

    Herzog, Kathrin A. T.; Schneditz, Georg; Leitner, Eva; Feierl, Gebhard; Hoffmann, Karl Martin; Zollner-Schwetz, Ines; Krause, Robert; Gorkiewicz, Gregor

    2014-01-01

    Klebsiella oxytoca acts as a pathobiont in the dysbiotic human intestinal microbiota, causing antibiotic-associated hemorrhagic colitis (AAHC), but it also infects other organs, resulting in pneumonia and urinary tract and skin infections. The virulence of K. oxytoca is still poorly understood. The production of a specific cytotoxin has been linked to AAHC pathogenesis. To investigate the clonal relationships of K. oxytoca with regard to clinical origin and virulence attributes, we established a multilocus sequence typing (MLST) method and analyzed 74 clinical K. oxytoca isolates from asymptomatic carriers and patients with AAHC, respiratory infections, and other infections. The isolates were phenotypically characterized, typed, and compared phylogenetically based on the sequences of seven housekeeping genes. MLST analysis yielded 60 sequence types, 12 of which were represented by more than one isolate. The phylogenetic tree distinguished clusters of K. oxytoca isolates between patients with AAHC and those with respiratory infections. Toxin-positive and -negative strains were observed within one sequence type. Our findings indicate that AAHC isolates share a genetic background. Interestingly, K. oxytoca isolates from nosocomial pneumonia showed a different genetic clustering, suggesting that these strains do not originate from the intestines or that they are specialized for respiratory tract colonization. Our results further indicate a polyphyletic origin and possible horizontal transfer of the genes involved in K. oxytoca cytotoxin production. This work provides evidence that K. oxytoca isolates colonizing the two main clinically relevant habitats (lower gastrointestinal [GI] tract and respiratory tract) of the human host are genetically distinct. Applications of this MLST analysis should help clarify the sources of nosocomial infections. PMID:24599976

  3. XAS analysis of iron and palladium bonded to a polysaccharide produced anaerobically by a strain of Klebsiella oxytoca.

    PubMed

    Ar?on, Iztok; Paganelli, Stefano; Piccolo, Oreste; Gallo, Michele; Vogel-Miku, Katarina; Baldi, Franco

    2015-09-01

    Klebsiella oxytoca BAS-10 ferments citrate to acetic acid and CO2, and secretes a specific exopolysaccharide (EPS), which is able to bind different metallic species. These biomaterials may be used for different biotechnological purposes, including applications as innovative green biogenerated catalysts. In production of biogenerated Pd species, the Fe(III) as ferric citrate is added to anaerobic culture of K.?oxytoca BAS-10, in the presence of palladium species, to increase the EPS secretion and improve Pd-EPS yield. In this process, bi-metallic (FePd-EPS) biomaterials were produced for the first time. The morphology of bi-metallic EPS, and the chemical state of the two metals in the FePd-EPS, are investigated by transmission electron microscopy, Fourier transform infra-red spectroscopy, micro-X-ray fluorescence, and X-ray absorption spectroscopy methods (XANES and EXAFS), and compared with mono-metallic Pd-EPS and Fe-EPS complexes. Iron in FePd-EPS is in the mineralized form of iron oxides/hydroxides, predominantly in the form of Fe(3+), with a small amount of Fe(2+) in the structure, most probably a mixture of different nano-crystalline iron oxides and hydroxides, as in mono-metallic Fe-EPS. Palladium is found as Pd(0) in the form of metallic nanoparticles with face-centred cubic structure in both bi-metallic (FePd-EPS) and mono-metallic (Pd-EPS) species. In bi-metallic species, Pd and Fe nanoparticles agglomerate in larger clusters, but they remain spatially separated. The catalytic ability of bi-metallic species (FePd-EPS) in a hydrodechlorination reaction is improved in comparison with mono-metallic Pd-EPS. PMID:26289273

  4. Influence of Carbon Source on Nitrate Removal by Nitrate-Tolerant Klebsiella oxytoca CECT 4460 in Batch and Chemostat Cultures

    PubMed Central

    Piar, Guadalupe; Kovrov, Karin; Egli, Thomas; Ramos, Juan L.

    1998-01-01

    The nitrate-tolerant organism Klebsiella oxytoca CECT 4460 tolerates nitrate at concentrations up to 1 M and is used to treat wastewater with high nitrate loads in industrial wastewater treatment plants. We studied the influence of the C source (glycerol or sucrose or both) on the growth rate and the efficiency of nitrate removal under laboratory conditions. With sucrose as the sole C source the maximum specific growth rate was 0.3 h?1, whereas with glycerol it was 0.45 h?1. In batch cultures K. oxytoca cells grown on sucrose or glycerol were able to immediately use sucrose as a sole C source, suggesting that sucrose uptake and metabolism were constitutive. In contrast, glycerol uptake occurred preferentially in glycerol-grown cells. Independent of the preculture conditions, when sucrose and glycerol were added simultaneously to batch cultures, the sucrose was used first, and once the supply of sucrose was exhausted, the glycerol was consumed. Utilization of nitrate as an N source occurred without nitrite or ammonium accumulation when glycerol was used, but nitrite accumulated when sucrose was used. In chemostat cultures K. oxytoca CECT 4460 efficiently removed nitrate without accumulation of nitrate or ammonium when sucrose, glycerol, or mixtures of these two C sources were used. The growth yields and the efficiencies of C and N utilization were determined at different growth rates in chemostat cultures. Regardless of the C source, yield carbon (YC) ranged between 1.3 and 1.0 g (dry weight) per g of sucrose C or glycerol C consumed. Regardless of the specific growth rate and the C source, yield nitrogen (YN) ranged from 17.2 to 12.5 g (dry weight) per g of nitrate N consumed. In contrast to batch cultures, in continuous cultures glycerol and sucrose were utilized simultaneously, although the specific rate of sucrose consumption was higher than the specific rate of glycerol consumption. In continuous cultures double-nutrient-limited growth appeared with respect to the C/N ratio of the feed medium and the dilution rate, so that for a C/N ratio between 10 and 30 and a growth rate of 0.1 h?1 the process led to simultaneous and efficient removal of the C and N sources used. At a growth rate of 0.2 h?1 the zone of double limitation was between 8 and 11. This suggests that the regimen of double limitation is influenced by the C/N ratio and the growth rate. The results of these experiments were validated by pulse assays. PMID:9687459

  5. Removal of nitrate from industrial wastewaters in a pilot plant by nitrate-tolerant Klebsiella oxytoca CECT 4460 and Arthrobacter globiformis CECT 4500

    SciTech Connect

    Pinar, G.; Ramos, J.L.; Oliva, J.M.; Sanchez-Barbero, L.; Calvo, V.

    1998-06-05

    Two strains, a gram-negative bacterium Klebsiella oxytoca CECT 4460 and a gram-positive, mycelium-forming bacterium Arthrobacter globiformis CECT 4500, tolerant to up to 1 M nitrate, were isolated from the grounds of a munitions factory. Under strict aerobic conditions and with appropriate C-sources, growth of these bacteria took place when the nitrate concentration in the medium was below 150 mM. Optimal growth conditions regarding the culture medium composition for the biological removal of nitrate were established in batch cultures. Then, the system was scaled up to a 40-L pilot plant and operated under continuous conditions in a factory with direct waste streams from dinitroethylene glycol production after appropriate dilution with nontreated groundwaters. The level of nitrate in the effluent was below 0.5% of the initial N-load. Nitrite and ammonium were undetectable and the level of the C-source in the effluent was below 50 mg per L. On the basis of these results, the authors conclude that the system worked on site satisfactorily.

  6. Antimicrobial activity of essential oils of cultivated oregano (Origanum vulgare), sage (Salvia officinalis), and thyme (Thymus vulgaris) against clinical isolates of Escherichia coli, Klebsiella oxytoca, and Klebsiella pneumoniae

    PubMed Central

    Fournomiti, Maria; Kimbaris, Athanasios; Mantzourani, Ioanna; Plessas, Stavros; Theodoridou, Irene; Papaemmanouil, Virginia; Kapsiotis, Ioannis; Panopoulou, Maria; Stavropoulou, Elisavet; Bezirtzoglou, Eugenia E.; Alexopoulos, Athanasios

    2015-01-01

    Background Oregano (Origanum vulgare), sage (Salvia officinalis), and thyme (Thymus vulgaris) are aromatic plants with ornamental, culinary, and phytotherapeutic use all over the world. In Europe, they are traditionally used in the southern countries, particularly in the Mediterranean region. The antimicrobial activities of the essential oils (EOs) derived from those plants have captured the attention of scientists as they could be used as alternatives to the increasing resistance of traditional antibiotics against pathogen infections. Therefore, significant interest in the cultivation of various aromatic and medicinal plants is recorded during the last years. However, to gain a proper and marketable chemotype various factors during the cultivation should be considered as the geographical morphology, climatic, and farming conditions. In this frame, we have studied the antimicrobial efficiency of the EOs from oregano, sage, and thyme cultivated under different conditions in a region of NE Greece in comparison to the data available in literature. Methods Plants were purchased from a certified supplier, planted, and cultivated in an experimental field under different conditions and harvested after 9 months. EOs were extracted by using a Clevenger apparatus and tested for their antibacterial properties (Minimum inhibitory concentration – MIC) against clinical isolates of multidrug resistant Escherichia coli (n=27), Klebsiella oxytoca (n=7), and Klebsiella pneumoniae (n=16) strains by using the broth microdilution assay. Results Our results showed that the most sensitive organism was K. oxytoca with a mean value of MIC of 0.9 µg/mL for oregano EOs and 8.1 µg/mL for thyme. The second most sensitive strain was K. pneumoniae with mean MIC values of 9.5 µg/mL for thyme and 73.5 µg/mL for oregano EOs. E. coli strains were among the most resistant to EOs antimicrobial action as the observed MICs were 24.8–28.6 µg/mL for thyme and above 125 µg/mL for thyme and sage. Most efficient were the EOs from thyme followed by those of oregano. Conclusions With MIC values above 150 µg/mL, sage EOs did not show any antibacterial efficiency against the majority of the strains. However, no significant differences were observed concerning the antimicrobial action of all EOs originating from irrigated versus non-irrigated cultivated aromatic plants. PMID:25881620

  7. Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar

    NASA Astrophysics Data System (ADS)

    Moeis, Maelita R.; Berlian, Liska; Suhandono, Sony; Prima, Alex; Komalawati, Eli; Kristianti, Tati

    2014-03-01

    Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5α. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation 325RLDRD329 and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNA sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.

  8. Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar

    SciTech Connect

    Moeis, Maelita R. Berlian, Liska Suhandono, Sony Prima, Alex Komalawati, Eli Kristianti, Tati

    2014-03-24

    Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5α. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation {sup 325}RLDRD{sup 329} and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNA sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.

  9. Wastewater drainage system as an occult reservoir in a protracted clonal outbreak due to metallo-?-lactamase-producing Klebsiella oxytoca.

    PubMed

    Vergara-Lpez, S; Domnguez, M C; Conejo, M C; Pascual, ; Rodrguez-Bao, J

    2013-11-01

    We describe the epidemiology of a protracted nosocomial clonal outbreak due to multidrug-resistant IMP-8 producing Klebsiella oxytoca (MDRKO) that was finally eradicated by removing an environmental reservoir. The outbreak occurred in the ICU of a Spanish hospital from March 2009 to November 2011 and evolved over four waves. Forty-two patients were affected. First basic (active surveillance, contact precautions and reinforcement of surface cleaning) and later additional control measures (nurse cohorting and establishment of a minimum patient/nurse ratio) were implemented. Screening of ICU staff was repeatedly negative. Initial environmental cultures, including dry surfaces, were also negative. The above measures temporarily controlled cross-transmission but failed to eradicate the epidemic MDRKO strain that reappeared two weeks after the last colonized patients in waves 2 and 3 had been discharged. Therefore, an occult environmental reservoir was suspected. Samples from the drainpipes and traps of a sink were positive; removal of the sink reduced the rate number but did not stop new cases that clustered in a cubicle whose horizontal drainage system was connected with the eliminated sink. The elimination of the horizontal drainage system finally eradicated the outbreak. In conclusion, damp environmental reservoirs (mainly sink drains, traps and the horizontal drainage system) could explain why standard cross-transmission control measures failed to control the outbreak; such reservoirs should be considered even when environmental cultures of surfaces are negative. PMID:23829434

  10. Polysaccharide-based silver nanoparticles synthesized by Klebsiella oxytoca DSM 29614 cause DNA fragmentation in E. coli cells.

    PubMed

    Baldi, Franco; Daniele, Salvatore; Gallo, Michele; Paganelli, Stefano; Battistel, Dario; Piccolo, Oreste; Faleri, Claudia; Puglia, Anna Maria; Gallo, Giuseppe

    2016-04-01

    Silver nanoparticles (AgNPs), embedded into a specific exopolysaccharide (EPS), were produced by Klebsiella oxytoca DSM 29614 by adding AgNO3 to the cultures during exponential growth phase. In particular, under aerobic or anaerobic conditions, two types of silver nanoparticles, named AgNPs-EPS(aer) and the AgNPs-EPS(anaer), were produced respectively. The effects on bacterial cells was demonstrated by using Escherichia coli K12 and Kocuria rhizophila ATCC 9341 (ex Micrococcus luteus) as Gram-negative and Gram-positive tester strains, respectively. The best antimicrobial activity was observed for AgNPs-EPS(aer), in terms of minimum inhibitory concentrations and minimum bactericidal concentrations. Observations by transmission electron microscopy showed that the cell morphology of both tester strains changed during the exposition to AgNPs-EPS(aer). In particular, an electron-dense wrapped filament was observed in E. coli cytoplasm after 3 h of AgNPs-EPS(aer) exposition, apparently due to silver accumulation in DNA, and both E. coli and K. rhizophila cells were lysed after 18 h of exposure to AgNPs-EPS(aer). The DNA breakage in E. coli cells was confirmed by the comparison of 3-D fluorescence spectra fingerprints of DNA. Finally the accumulation of silver on DNA of E. coli was confirmed directly by a significant Ag(+) release from DNA, using the scanning electrochemical microscopy and the voltammetric determinations. PMID:26886276

  11. Enhanced 2,3-Butanediol Production by Optimizing Fermentation Conditions and Engineering Klebsiella oxytoca M1 through Overexpression of Acetoin Reductase

    PubMed Central

    Cho, Sukhyeong; Kim, Taeyeon; Woo, Han Min; Lee, Jinwon; Kim, Yunje; Um, Youngsoon

    2015-01-01

    Microbial production of 2,3-butanediol (2,3-BDO) has been attracting increasing interest because of its high value and various industrial applications. In this study, high production of 2,3-BDO using a previously isolated bacterium Klebsiella oxytoca M1 was carried out by optimizing fermentation conditions and overexpressing acetoin reductase (AR). Supplying complex nitrogen sources and using NaOH as a neutralizing agent were found to enhance specific production and yield of 2,3-BDO. In fed-batch fermentations, 2,3-BDO production increased with the agitation speed (109.6 g/L at 300 rpm vs. 118.5 g/L at 400 rpm) along with significantly reduced formation of by-product, but the yield at 400 rpm was lower than that at 300 rpm (0.40 g/g vs. 0.34 g/g) due to acetoin accumulation at 400 rpm. Because AR catalyzing both acetoin reduction and 2,3-BDO oxidation in K. oxytoca M1 revealed more than 8-fold higher reduction activity than oxidation activity, the engineered K. oxytoca M1 overexpressing the budC encoding AR was used in fed-batch fermentation. Finally, acetoin accumulation was significantly reduced by 43% and enhancement of 2,3-BDO concentration (142.5 g/L), yield (0.42 g/g) and productivity (1.47 g/L/h) was achieved compared to performance with the parent strain. This is by far the highest titer of 2,3-BDO achieved by K. oxytoca strains. This notable result could be obtained by finding favorable fermentation conditions for 2,3-BDO production as well as by utilizing the distinct characteristic of AR in K. oxytoca M1 revealing the nature of reductase. PMID:26368397

  12. [Profiles of the utilization of 20 amino acids as the only source of nitrogen and carbon in bacteria of the genera Klebsiella, Enterobacter, Serratia, Escherichia].

    PubMed

    Sivolodskiĭ, E P

    2005-01-01

    The profiles of the utilization of 20 protein amino acids in 118 Klebsiella pneumoniae sub- sp. pneumoniae, K. oxytoca, K. planticola, K. mobilis, Enterobacter cloacae, Serratia marscescens, S. liquefaciens, Escherichia coli strains isolated from clinical material were studied. The utilization of amino acids was determined on minimal saline agar containing amino acid as the only source of nitrogen and carbon; the results were evaluated after 72-hour incubation at 37 degrees C. 17 profiles of amino-acid utilization were thus determined, most of them genus-specific in enterobacteria: Klebsiella (profiles No. 1--6, 9, 10), Enterobacter (No. 11--13), Serratia (No. 14--16), Escherichia (No. 17). The full coincidence of amino-acid utilization profiles in bacteria of K. mobilis (No. 1, 6) and K. pneumoniae subsp. pneumoniae with out of such profiles in bacteria of the genera Enterobacter, Serratia, Escherichia was established, which confirmed that K. mobilis (formerly Enterobacter aerogenes) belonged to the genus Klebsiella. PMID:16279526

  13. Adaptative biochemical pathways and regulatory networks in Klebsiella oxytoca BAS-10 producing a biotechnologically relevant exopolysaccharide during Fe(III)-citrate fermentation

    PubMed Central

    2012-01-01

    Background A bacterial strain previously isolated from pyrite mine drainage and named BAS-10 was tentatively identified as Klebsiella oxytoca. Unlikely other enterobacteria, BAS-10 is able to grow on Fe(III)-citrate as sole carbon and energy source, yielding acetic acid and CO2 coupled with Fe(III) reduction to Fe(II) and showing unusual physiological characteristics. In fact, under this growth condition, BAS-10 produces an exopolysaccharide (EPS) having a high rhamnose content and metal-binding properties, whose biotechnological applications were proven as very relevant. Results Further phylogenetic analysis, based on 16S rDNA sequence, definitively confirmed that BAS-10 belongs to K. oxytoca species. In order to rationalize the biochemical peculiarities of this unusual enterobacteriun, combined 2D-Differential Gel Electrophoresis (2D-DIGE) analysis and mass spectrometry procedures were used to investigate its proteomic changes: i) under aerobic or anaerobic cultivation with Fe(III)-citrate as sole carbon source; ii) under anaerobic cultivations using Na(I)-citrate or Fe(III)-citrate as sole carbon source. Combining data from these differential studies peculiar levels of outer membrane proteins, key regulatory factors of carbon and nitrogen metabolism and enzymes involved in TCA cycle and sugar biosynthesis or required for citrate fermentation and stress response during anaerobic growth on Fe(III)-citrate were revealed. The protein differential regulation seems to ensure efficient cell growth coupled with EPS production by adapting metabolic and biochemical processes in order to face iron toxicity and to optimize energy production. Conclusion Differential proteomics provided insights on the molecular mechanisms necessary for anaeorobic utilization of Fe(III)-citrate in a biotechnologically promising enterobacteriun, also revealing genes that can be targeted for the rational design of high-yielding EPS producer strains. PMID:23176641

  14. Influence of blocking of 2,3-butanediol pathway on glycerol metabolism for 1,3-propanediol production by Klebsiella oxytoca.

    PubMed

    Zhang, Gang; Yang, Guang; Wang, Xu; Guo, Qingjuan; Li, Ying; Li, Jilun

    2012-09-01

    Glycerol metabolism is a typical biological oxidoreductive reaction. 1,3-Propanediol (1,3-PD) is the final product of the reductive branch, while acetate, succinate, lactate, 2,3-butanediol (2,3-BD), and ethanol were produced in the oxidative branch. 2,3-BD, which has similar properties of high boiling point and water solubility with 1,3-PD, not only contests the carbon flow and NADH with 1,3-PD but also serves as an obstacle for obtaining high purity 1,3-PD in downstream processes. In this study, a 2,3-BD pathway-deficient mutant of Klebsiella oxytoca ZG36 was constructed by knocking out the budA gene of the wild-type strain M5al. The results of fed-batch fermentation by ZG36 indicated that the glycerol flux and the distribution of metabolites were altered in the K. oxytoca when the 2,3-BD pathway was blocked. No 2,3-BD was produced, and the activity of ?-acetolactate decarboxylase (?-ALDC) can not be detected in the fermentation processes. The indexes of the 1,3-PD titer, the conversion from glycerol to 1,3-PD, and the productivity per cell dry weight (CDW) increased by 42%, 62%, and 46%, respectively, compared with the M5al, and the yield of the byproducts also increased obviously. The assay of the enzyme activities in the oxidative branch and the reductive branch of the glycerol metabolism, as well as the intracellular redox state, exposited the results logically. PMID:21915590

  15. Saccharification and fermentation of sugar cane bagasse by Klebsiella oxytoca P2 containing chromosomally integrated genes encoding the Zymomonas mobilis ethanol pathway

    SciTech Connect

    Doran, J.B.; Aldrich, H.C.; Ingram, L.O. . Dept. of Microbiology and Cell Science)

    1994-06-20

    Pretreatment of sugar cane bagasse is essential for a simultaneous saccharification and fermentation (SSF) process which uses recombinant Klebsiella oxytoca strain P2 and Genencor Spezyme CE. Strain P2 has been genetically engineered to express Zymomonas mobilis genes encoding the ethanol pathway and retains the native ability to transport and metabolize cellobiose (minimizing the need for extracellular cellobiase). In SSF studies with this organism, both the rate of ethanol production and ethanol yield were limited by saccharification at 10 and 20 filter paper units (FPU) g[sup [minus]1] acid-treated bagasse. Dilute slurries of biomass were converted to ethanol more efficiently (over 72% of theoretical yield) in simple batch fermentations than slurries containing high solids, albeit with the production of lower levels of ethanol. With high solids (i.e., 160 g acid-treated bagasse L[sup [minus]1]), a combination of 20 FPU cellulase g[sup [minus]1] bagasse, preincubation under saccharification conditions, and additional grinding (to reduce particle size) were required to produce ca. 40 g ethanol L[sup [minus]1]. Alternatively, almost 40 g ethanol L[sup [minus]1] was produced with 10 FPU cellulase g[sup [minus]1] bagasse by incorporating a second saccharification step (no further enzyme addition) followed by a second inoculation and short fermentation. In this way, a theoretical ethanol yield of over 70% was achieved with the production of 20 g ethanol 800 FPU[sup [minus]1] of commercial cellulase.

  16. On-line monitoring of bioreactions of Bacillus polymyxa and Klebsiella oxytoca by membrane introduction tandem mass spectrometry with flow injection analysis sampling

    SciTech Connect

    Hayward, M.J.; Kotiaho, Tapio; Lister, A.K.; Cooks, R.G.; Austin, G.D.; Narayan, Ramani; Tsao, G.T. )

    1990-09-01

    Membrane introduction mass spectrometry with flow injection analysis sampling has been utilized for on-line monitoring of the major products and the volatile metabolites of fermentation of the Bacillus polymyxa and Klebsiella oxytoca organisms. A flow injection sampling system was used to rapidly deliver fermentation broth or an external standard to the mass spectrometer. Analyte introduction occurred via a direct insertion membrane probe in which the aqueous solutions flowed past a membrane located within the ion source of the mass spectrometer. For both organisms, concentrations of the liquid-phase products acetic acid, acetoin, 2,3-butanediol, and ethanol, were monitored as a function of time after permeation through the membrane and ionization by chemical ionization. Tandem mass spectrometry confirmed that these measurements were made without interference. Off-line gas chromatography was utilized to test the accuracy of these measurements, and excellent agreement was found. The use of tandem mass spectrometry has allowed the detection of additional compounds that were previously not known to be present in measurable amounts.

  17. Metabolic Changes in Klebsiella oxytoca in Response to Low Oxidoreduction Potential, as Revealed by Comparative Proteomic Profiling Integrated with Flux Balance Analysis

    PubMed Central

    Zhu, Yan; Li, Dan; Bao, Guanhui; Wang, Shaohua; Mao, Shaoming; Song, Jiangning; Li, Yin

    2014-01-01

    Oxidoreduction potential (ORP) is an important physiological parameter for biochemical production in anaerobic or microaerobic processes. However, the effect of ORP on cellular physiology remains largely unknown, which hampers the design of engineering strategies targeting proteins associated with ORP response. Here we characterized the effect of altering ORP in a 1,3-propanediol producer, Klebsiella oxytoca, by comparative proteomic profiling combined with flux balance analysis. Decreasing the extracellular ORP from −150 to −240 mV retarded cell growth and enhanced 1,3-propanediol production. Comparative proteomic analysis identified 61 differentially expressed proteins, mainly involved in carbohydrate catabolism, cellular constituent biosynthesis, and reductive stress response. A hypothetical oxidoreductase (HOR) that catalyzes 1,3-propanediol production was markedly upregulated, while proteins involved in biomass precursor synthesis were downregulated. As revealed by subsequent flux balance analysis, low ORP induced a metabolic shift from glycerol oxidation to reduction and rebalancing of redox and energy metabolism. From the integrated protein expression profiles and flux distributions, we can construct a rational analytic framework that elucidates how (facultative) anaerobes respond to extracellular ORP changes. PMID:24584239

  18. Fuel ethanol production from mixed office paper using recombinant Klebsiella oxytoca P2 containing the Zymomonas mobilis ethanol pathway

    SciTech Connect

    Ingram, L.O.; Brooks, T.A.

    1995-12-01

    Mixed Office Waste Paper (MOWP) is an excellent substrate for repulsing or for conversion into fuel ethanol. We have developed a recombinant strain of K. oxytoca which ferments cellobiose and cellotriose to ethanol at near theoretical yield (pH 5-5.2, 35{degrees}C), eliminating the need for external {beta}-glucosidase. This organism was tested with commercial fungal cellulose in optimized simultaneous saccharification and fermentation experiments using autoclaved MOWP and dilute acid hydrolyzed-MOWT (hydrolyzes hemicellulose and starch) as substrates. Essentially identical rates and yields were obtained with both substrates on a dry weight basis, although initial mixing was easier after acid pretreatment. Under optimal conditions, 5 % ethanol (v/v) was produced in 72 h with low levels of cellulose (5 FPU cellulose average/g paper) during 4 successive fermentations in which cellulose enzymes were recycled. The estimated yield for this process is 0.42 g ethanol/gram dry wt of paper, 538 liters ethanol/ metric ton, 125 gallons/U.S. ton. An adaptation of this process may also be useful as a treatment for sludges from paper recycling.

  19. Hexavalent molybdenum reduction to mo-blue by a sodium-dodecyl-sulfate-degrading Klebsiella oxytoca strain DRY14.

    PubMed

    Halmi, M I E; Zuhainis, S W; Yusof, M T; Shaharuddin, N A; Helmi, W; Shukor, Y; Syed, M A; Ahmad, S A

    2013-01-01

    Bacteria with the ability to tolerate, remove, and/or degrade several xenobiotics simultaneously are urgently needed for remediation of polluted sites. A previously isolated bacterium with sodium dodecyl sulfate- (SDS-) degrading capacity was found to be able to reduce molybdenum to the nontoxic molybdenum blue. The optimal pH, carbon source, molybdate concentration, and temperature supporting molybdate reduction were pH 7.0, glucose at 1.5% (w/v), between 25 and 30?mM, and 25C, respectively. The optimum phosphate concentration for molybdate reduction was 5?mM. The Mo-blue produced exhibits an absorption spectrum with a maximum peak at 865 nm and a shoulder at 700?nm. None of the respiratory inhibitors tested showed any inhibition to the molybdenum-reducing activity suggesting that the electron transport system of this bacterium is not the site of molybdenum reduction. Chromium, cadmium, silver, copper, mercury, and lead caused approximately 77, 65, 77, 89, 80, and 80% inhibition of the molybdenum-reducing activity, respectively. Ferrous and stannous ions markedly increased the activity of molybdenum-reducing activity in this bacterium. The maximum tolerable concentration of SDS as a cocontaminant was 3?g/L. The characteristics of this bacterium make it a suitable candidate for molybdenum bioremediation of sites cocontaminated with detergent pollutant. PMID:24383052

  20. Hexavalent Molybdenum Reduction to Mo-Blue by a Sodium-Dodecyl-Sulfate-Degrading Klebsiella oxytoca Strain DRY14

    PubMed Central

    Halmi, M. I. E.; Zuhainis, S. W.; Yusof, M. T.; Shaharuddin, N. A.; Helmi, W.; Shukor, Y.; Syed, M. A.; Ahmad, S. A.

    2013-01-01

    Bacteria with the ability to tolerate, remove, and/or degrade several xenobiotics simultaneously are urgently needed for remediation of polluted sites. A previously isolated bacterium with sodium dodecyl sulfate- (SDS-) degrading capacity was found to be able to reduce molybdenum to the nontoxic molybdenum blue. The optimal pH, carbon source, molybdate concentration, and temperature supporting molybdate reduction were pH 7.0, glucose at 1.5% (w/v), between 25 and 30?mM, and 25C, respectively. The optimum phosphate concentration for molybdate reduction was 5?mM. The Mo-blue produced exhibits an absorption spectrum with a maximum peak at 865 nm and a shoulder at 700?nm. None of the respiratory inhibitors tested showed any inhibition to the molybdenum-reducing activity suggesting that the electron transport system of this bacterium is not the site of molybdenum reduction. Chromium, cadmium, silver, copper, mercury, and lead caused approximately 77, 65, 77, 89, 80, and 80% inhibition of the molybdenum-reducing activity, respectively. Ferrous and stannous ions markedly increased the activity of molybdenum-reducing activity in this bacterium. The maximum tolerable concentration of SDS as a cocontaminant was 3?g/L. The characteristics of this bacterium make it a suitable candidate for molybdenum bioremediation of sites cocontaminated with detergent pollutant. PMID:24383052

  1. ENUMERATION, TRANSPORT AND SURVIVAL OF BACTERIA ATTACHED TO GRANULAR ACTIVITATED CARBON IN DRINKING WATER

    EPA Science Inventory

    The surfaces of granular activated carbon (GAC), sand, and anthracite particles were found to be populated to the same levels with heterotrophic plate count (HPC) bacteria. GAC supported a greater number of Klebsiella oxytoca than the other two filter media. In a study of operati...

  2. EFFECTS OF VELOCITY ON THE TRANSPORT OF TWO BACTERIA THROUGH SATURATED SAND. GROUND WATER.

    EPA Science Inventory

    Transport of the bacteria Klebsiella oxytoca and Burkholderia cepacia G4PR1 (G4PR1) was investigated in column experiments conducted under conditions that allowed us to quantify sorption under a range of ground water velocities. Column experiments (33 mm I.D. X 114 mm long colu...

  3. Multi Drug Resistant Klebsiella Isolates in Burn Patients: A Comparative Study

    PubMed Central

    Prakash, S. Kirshna; Siddiqui, Oves

    2015-01-01

    Introduction Infections are the most common complications in the burn patients admitted to the hospitals leading to high morbidity and mortality. Klebsiella is one of the most frequently isolated bacteria from burn wounds. Materials and Methods We studied antimicrobial susceptibility patterns of Klebsiella isolates from burn patients. In this cross- sectional study wound swabs from 1294 patients hospitalized in burnward were collected for bacteriological examination. Antibiotic sensitivity testing of Klebsiella isolates was done by modified Stokes disc diffusion method. Results Out of 883 isolates from 1294 patients 195 were found to be Klebsiella spp. Based on the biochemical properties 153 isolates were Klebsiella pneumoniae, 37 were Klebsiella oxytoca and 5 were others species. In our study we found that 54% of the Klebsiella isolates were multidrug resistant as they were resistant to at least one antibiotic of three or more different groups of antibiotics. [Table/Fig-1]: Isolation of different organism in burn wound infection Bacteria Number Percentage (%) Acinetobacter 70 7.92 Citrobacter 9 1.01 E. coli 125 14.15 Enterobacter 8 0.9 Klebsiella 195 22.08 Morganella 1 0.1 Proteus 71 8.04 Providentia 15 1.6 Pseudomonas 248 28.08 Staphylococcus 141 15.96 Total 883 99.84 Conclusion Rate of isolation of Klebsiella as well as its resistance for commonly used antibiotics is increasing over the time. PMID:26500905

  4. Protective effect of Klebsiella bacteria on lawn grasses under conditions of soil salinization

    NASA Astrophysics Data System (ADS)

    Emtsev, V. T.; Sokolova, A. Ya.; Selitskaya, O. V.

    2010-07-01

    The protective effect of the inoculation of lawn grasses grown under conditions of soil salinization with bacteria of the Klebsiella genus ( K. planticola and K. pneumoniae) was demonstrated. It was found that K. pneumoniae improves the plant growth under conditions of a high concentration of sodium chloride. It was also shown that the inoculation of lawn grasses with these bacteria optimizes the morphophysiological parameters of the plants and increases the number of mitoses in the apical parts of the roots, which leads to a less significant decrease in the mitotic index under the impact of salinization. The capacity of K. planticola to penetrate into the plants may favor the activation of protective mechanisms improving the immunological status of the plants and, hence, their tolerance to salinization.

  5. Efficient reduction of the formation of by-products and improvement of production yield of 2,3-butanediol by a combined deletion of alcohol dehydrogenase, acetate kinase-phosphotransacetylase, and lactate dehydrogenase genes in metabolically engineered Klebsiella oxytoca in mineral salts medium.

    PubMed

    Jantama, Kaemwich; Polyiam, Pattharasedthi; Khunnonkwao, Panwana; Chan, Sitha; Sangproo, Maytawadee; Khor, Kirin; Jantama, Sirima Suvarnakuta; Kanchanatawee, Sunthorn

    2015-07-01

    Klebsiella oxytoca KMS005 (?adhE?ackA-pta?ldhA) was metabolically engineered to improve 2,3-butanediol (BDO) yield. Elimination of alcohol dehydrogenase E (adhE), acetate kinase A-phosphotransacetylase (ackA-pta), and lactate dehydrogenase A (ldhA) enzymes allowed BDO production as a primary pathway for NADH re-oxidation, and significantly reduced by-products. KMS005 was screened for the efficient glucose utilization by metabolic evolution. KMS005-73T improved BDO production at a concentration of 23.50.5 g/L with yield of 0.460.02 g/g in mineral salts medium containing 50 g/L glucose in a shake flask. KMS005-73T also exhibited BDO yields of about 0.40-0.42 g/g from sugarcane molasses, cassava starch, and maltodextrin. During fed-batch fermentation, KMS005-73T produced BDO at a concentration, yield, and overall and specific productivities of 117.44.5 g/L, 0.490.02 g/g, 1.200.05 g/Lh, and 27.21.1 g/gCDW, respectively. No acetoin, lactate, and formate were detected, and only trace amounts of acetate and ethanol were formed. The strain also produced the least by-products and the highest BDO yield among other Klebsiella strains previously developed. PMID:25895450

  6. Plugging of a model rock system by using starved bacteria. [Klebsiella pneumoniae

    SciTech Connect

    MacLeod, F.A.; Lappin-Scott, H.M.; Costerton, J.W.

    1988-06-01

    The effects of starvation on bacterial penetration through artificial rock cores were examined. Klebsiella pneumoniae was starved in a simple salts solution for a duration of up to 4 weeks. These cell suspensions were injected into sintered glass bead cores, and the resulting reductions in core permeabilities were recorded. Vegetative cell cultures of K. pneumoniae grown in a sodium citrate medium were injected into other, similar cores, and the reductions in core permeabilities were recorded. The starved cell suspensions did not completely block the core pores, whereas the vegetative cultures reduced core permeability to less than 1%. Scanning electron microscopy of core section infiltrated with either vegetative or starved cells showed that the former produced shallow skin plugs and copious amounts of glycocalyx at the inlet face, whereas the latter produced very little glycocalyx and the cells were distributed evenly throughout the length of the core. The use of a DNA assay to produce a cell distribution profile showed that, compared with the vegetative cells, starved bacteria were able to penetrate deeper into the cores. This was due to the smaller size of the cells and the reduction in biofilm production. This ability of starved bacteria to penetrate further into cores than the normal-size vegetative cells can be usefully applied to selective plugging for enhanced oil recovery. To further test the suitability of starved cells for use in selective plugging, the activities of starved cells present within cores were monitored before and after nutrient stimulation. Our data indicate that with nutrient stimulation, the starved cells lose their metabolic dormancy and produce reductions in core permeability due to cell growth and polymer production.

  7. Vaccination with Klebsiella pneumoniae-derived extracellular vesicles protects against bacteria-induced lethality via both humoral and cellular immunity

    PubMed Central

    Lee, Won-Hee; Choi, Hyun-Il; Hong, Sung-Wook; Kim, Kwang-sun; Gho, Yong Song; Jeon, Seong Gyu

    2015-01-01

    The emergence of multidrug-resistant Klebsiella pneumoniae highlights the need to develop preventive measures to ameliorate Klebsiella infections. Bacteria-derived extracellular vesicles (EVs) are spherical nanometer-sized proteolipids enriched with outer membrane proteins. Gram-negative bacteria-derived EVs have gained interest for use as nonliving complex vaccines. In the present study, we evaluated whether K. pneumoniae-derived EVs confer protection against bacteria-induced lethality. K. pneumoniae-derived EVs isolated from in vitro bacterial culture supernatants induced innate immunity, including the upregulation of co-stimulatory molecule expression and proinflammatory mediator production. EV vaccination via the intraperitoneal route elicited EV-reactive antibodies and interferon-gamma-producing T-cell responses. Three vaccinations with the EVs prevented bacteria-induced lethality. As verified by sera and splenocytes adoptive transfer, the protective effect of EV vaccination was dependent on both humoral and cellular immunity. Taken together, these findings suggest that K. pneumoniae-derived EVs are a novel vaccine candidate against K. pneumoniae infections. PMID:26358222

  8. Enterotoxigenic intestinal bacteria in tropical sprue. IV. Effect of linoleic acid on growth interrelationships of Lactobacillus acidophilus and Klebsiella pneumoniae.

    PubMed Central

    Mickelson, M J; Klipstein, F A

    1975-01-01

    The factors responsible for colonization of the small intestine by enterotoxigenic coliform bacteria in Puerto Ricans with tropical sprue are unknown, but epidemiological observations have suggested that they may be related to an increased dietary intake of long-chain unsaturated fatty acids, particularly linoleic acid, which is known to exert an inhibitory effect on the growth of gram-positive organisms that normally comprise the flora of the small intestine. We have examined, by using a glucose-limited continuous-culture system, what effect this fatty acid exerts on the growth relationships of enteric gram-positive and coliform bacteria. In this system, colonization by an invading strain of Klebsiella pneumoniae was prevented by the presence of an established culture of Lactobacillus acidophilus, principally by virtue of a lowered pH of the medium that was incompatible with Klebsiella growth. However, when the population density of L. acidophilus was reduced by the presence of a sufficient concentration of linoleic acid, the invading K. pneumoniae successfully colonized the system and, once established, suppressed the growth of L. acidophilus. These observations indicate that, under the conditions of our chemostat, gram-positive enteric bacteria suppress coliform growth and that this effect is reversible by the presence of linoleic acid. It remains to be established, however, what pertinence these in vitro observations have to conditions within the intestinal tract of persons living in the tropics. PMID:811564

  9. Enterotoxigenic intestinal bacteria in tropical sprue. IV. Effect of linoleic acid on growth interrelationships of Lactobacillus acidophilus and Klebsiella pneumoniae.

    PubMed

    Mickelson, M J; Klipstein, F A

    1975-11-01

    The factors responsible for colonization of the small intestine by enterotoxigenic coliform bacteria in Puerto Ricans with tropical sprue are unknown, but epidemiological observations have suggested that they may be related to an increased dietary intake of long-chain unsaturated fatty acids, particularly linoleic acid, which is known to exert an inhibitory effect on the growth of gram-positive organisms that normally comprise the flora of the small intestine. We have examined, by using a glucose-limited continuous-culture system, what effect this fatty acid exerts on the growth relationships of enteric gram-positive and coliform bacteria. In this system, colonization by an invading strain of Klebsiella pneumoniae was prevented by the presence of an established culture of Lactobacillus acidophilus, principally by virtue of a lowered pH of the medium that was incompatible with Klebsiella growth. However, when the population density of L. acidophilus was reduced by the presence of a sufficient concentration of linoleic acid, the invading K. pneumoniae successfully colonized the system and, once established, suppressed the growth of L. acidophilus. These observations indicate that, under the conditions of our chemostat, gram-positive enteric bacteria suppress coliform growth and that this effect is reversible by the presence of linoleic acid. It remains to be established, however, what pertinence these in vitro observations have to conditions within the intestinal tract of persons living in the tropics. PMID:811564

  10. [Increase of metallo-beta-lactamase producing bacteria positive cases including Klebsiella pneumoniae in a Japanese university hospital].

    PubMed

    Sugimoto, Takamichi; Kimura, Satoshi; Nakama, Emiko; Chen, Gelin; Fukuchi, Kunihiko

    2010-06-01

    The clinical characteristics of the metallo-beta-lactamase (MBL) producing bacteria were investigated in a Japanese university hospital with 661 beds. In total, 34 cases (38 strains) were isolated from March 2006 to October 2007. No MBL-producing strain was detected until then. We screened for MBL using Arakawa's method because it detects MBL-producing bacteria more sensitively than conventional methods. Anti-biotic resistant genes were analyzed in 24 MBL producing bacteria positive cases detected from September 2007 to August 2008. Either bla(IMP-1) or bla(IMP-11) was detected in all cases. Age distribution of the MBL producing bacteria positive cases had two peaks, infant age (under five-years-old) and senior age (over seventies). All cases have underlying diseases, such as diabetes mellitus, malignant tumor, granulocytopenia, and/or using steroids. Twenty-one strains were detected from postoperative cases. MBL carrier rate in total clinically isolated Klebsiella pneumoniae strains was 2.6%. As far as we know, this number is the highest among reports in Japanese hospitals. The clinical manifestation of K. pneumoniae as pathogen was identified in only two cases (5%). In 24 cases (82%), MBL-producing bacteria were identified as bystanders. Though infection cases by MBL-producing bacteria especially by K. pneumoniae have not been frequently observed, we should carefully watch their numbers because the bacteria transfer resistant genes among their flora. PMID:20662265

  11. Preparation and characterization of vanadia-titania mixed oxide for immobilization of Serratia rubidaea CCT 5732 and Klebsiella marcescens bacteria

    SciTech Connect

    Saragiotto Colpini, Leda Maria Correia Goncalves, Regina A.; Goncalves, Jose Eduardo; Maieru Macedo Costa, Creusa

    2008-08-04

    Vanadia-titania mixed oxide was synthesized by sol-gel method and characterized by several techniques. Texturally, it is formed by mesopores and presents high-specific surface area and controlled porosity. Scanning electron microscopy revealed that vanadium is homogeneously distributed in the material. Structurally, it was possible to identify characteristic V=O stretching bands by IR. The analysis of X-ray diffraction showed that the material, particularly vanadium, is highly dispersed. Application experiments were carried out through the immobilization of Serratia rubidae CCT 5732 and Klebsiella marcescens bacteria by adsorption on the surface of mixed oxide. The micrographies revealed that the bacteria were adsorbed on the entire support, with average surface densities of 8.55 x 10{sup 11} cells/m{sup 2} (Serratia rubidae CCT 5732) and 3.40 x 10{sup 11} cells/m{sup 2} (K. marcescens)

  12. Bacteria cell properties and grain size impact on bacteria transport and deposition in porous media.

    PubMed

    Bai, Hongjuan; Cochet, Nelly; Pauss, Andr; Lamy, Edvina

    2016-03-01

    The simultaneous role of bacteria cell properties and porous media grain size on bacteria transport and deposition behavior was investigated in this study. Transport column experiments and numerical HYDRUS-1D simulations of three bacteria with different cell properties (Escherichia coli, Klebsiella oxytoca, and Rhodococcus rhodochrous) were carried out on two sandy media with different grain sizes, under saturated steady state flow conditions. Each bacterium was characterized by cell size and shape, cell motility, electrophoretic mobility, zeta potential, hydrophobicity and potential of interaction with the sand surface. Cell characteristics affected bacteria transport behavior in the fine sand, but similar bacteria breakthroughs and retardation factors observed in the coarse sand, indicated that bacteria transport was more depended on grain size than on bacteria cell properties. Retention decreased with increasing hydrophobicity and increased with increasing electrophoretic mobility of bacteria for both sand. The increasing sand grain size resulted in a decrease of bacteria retention, except for the motile E. coli, indicating that retention of this strain was more dependent on cell motility than on the sand grain size. Bacteria deposition coefficients obtained from numerical simulations of the retention profiles indicated that straining was an important mechanism affecting bacteria deposition of E. coli and Klebsiella sp., in the fine sand, but the attachment had the same importance as straining for R. rhodochrous. The results obtained in the coarse sand did not permit to discriminate the predominant mechanism of bacteria deposition and the relative implication of bacteria cell properties of this process. PMID:26705829

  13. The study of Nickel Resistant Bacteria (NiRB) isolated from wastewaters polluted with different industrial sources

    PubMed Central

    2014-01-01

    Background Pollution due to the heavy metals is a problem that may have negative consequences on the hydrosphere. One of the best procedures in removing the toxic metals from the environment is using metal resistant bacteria. Results In the present study eight nickel resistant bacteria were isolated from industrial wastewaters. Three of them were selected as the most resistant based on their Maximum tolerable concentration (8, 16 and 24mM Ni2+). Their identification was done according to morphological, biochemical characteristics and 16SrDNA gene sequencing and they were identified as Cupriavidus sp ATHA3, Klebsiella oxytoca ATHA6 and Methylobacterium sp ATHA7. The accession numbers assigned to ATHA3, ATHA6 and ATHA7 strains are JX120152, JX196648 and JX457333 respectively. The Growth rate of the most resistant isolate, Klebsiella oxytoca strain ATHA6, in the presence of Ni2+ and the reduction in Ni2+ concentration was revealed that K oxytoca ATHA6 could decrease 83mg/mL of nickel from the medium after 3 days. Conclusion It can be concluded that the identified Ni resistant bacteria could be valuable for the bioremediation of Ni polluted waste water and sewage. PMID:24475932

  14. Influence of Asellus aquaticus on Escherichia coli, Klebsiella pneumoniae, Campylobacter jejuni and naturally occurring heterotrophic bacteria in drinking water.

    PubMed

    Christensen, Sarah C B; Nissen, Erling; Arvin, Erik; Albrechtsen, Hans-Jrgen

    2012-10-15

    Water lice, Asellus aquaticus (isopoda), frequently occur in drinking water distribution systems where they are a nuisance to consumers and water utilities. Whether they are solely an aesthetic problem or also affect the microbial water quality is a matter of interest. We studied the influence of A. aquaticus on microbial water quality in non-chlorinated drinking water in controlled laboratory experiments. Pure cultures of the indicator organisms Escherichia coli and Klebsiella pneumoniae and the pathogen Campylobacter jejuni as well as naturally occurring heterotrophic drinking water bacteria (measured as heterotrophic plate counts, HPC) were investigated in microcosms at 7 C, containing non-sterilised drinking water, drinking water sediment and A. aquaticus collected from a non-chlorinated ground water based drinking water supply system. Concentrations of E. coli, K. pneumoniae and C. jejuni decreased over time, following a first order decay with half lives of 5.3, 18.4 and 1.3 days, respectively. A. aquaticus did not affect survival of indicators and pathogens substantially whereas HPC were influenced by presence of dead A. aquaticus. Growth rates increased with an average of 48% for bacteria grown on R-2A agar and an average of 83% for bacteria grown on yeast extract agar when dead A. aquaticus were present compared to no and living A. aquaticus present. A. aquaticus associated E. coli, K. pneumoniae and C. jejuni were measured (up to 25 per living and 500 per dead A. aquaticus) and so were A. aquaticus associated heterotrophic bacteria (>1.8*10(4) CFU per living and >6*10(4) CFU per dead A. aquaticus). A. aquaticus did not serve as an optimised habitat that increased survival of indicators and pathogens, since A. aquaticus associated E. coli, K. pneumoniae and C. jejuni were only measured as long as the bacteria were also present in the water and sediment. PMID:22884244

  15. Cultivable endophytic bacteria from leaf bases of Agave tequilana and their role as plant growth promoters.

    PubMed

    Martínez-Rodríguez, Julia del C; De la Mora-Amutio, Marcela; Plascencia-Correa, Luis A; Audelo-Regalado, Esmeralda; Guardado, Francisco R; Hernández-Sánchez, Elías; Peña-Ramírez, Yuri J; Escalante, Adelfo; Beltrán-García, Miguel J; Ogura, Tetsuya

    2014-01-01

    Agave tequilana Weber var. 'Azul' is grown for the production of tequila, inulin and syrup. Diverse bacteria inhabit plant tissues and play a crucial role for plant health and growth. In this study culturable endophytic bacteria were extracted from leaf bases of 100 healthy Agave tequilana plants. In plant tissue bacteria occurred at mean population densities of 3 million CFU/g of fresh plant tissue. Three hundred endophytic strains were isolated and 16s rDNA sequences grouped the bacteria into eight different taxa that shared high homology with other known sequences. Bacterial endophytes were identified as Acinectobacter sp., A. baumanii, A. bereziniae, Cronobacter sakazakii, Enterobacter hormaechei, Bacillus sp. Klebsiella oxytoca, Pseudomonas sp., Enterococcus casseliflavus, Leuconostoc mesenteroides subsp. mesenteroides and Gluconobacter oxydans. Isolates were confirmed to be plant growth promoting bacteria (PGPB) by their capacities for nitrogen fixation, auxin production, phosphate solubilization, or antagonism against Fusarium oxysporum AC132. E. casseliflavus JM47 and K. oxytoca JM26 secreted the highest concentrations of IAA. The endophyte Acinectobacter sp. JM58 exhibited the maximum values for nitrogen fixation and phosphate solubilization index (PSI). Inhibition of fungi was found in Pseudomonas sp. JM9p and K. oxytoca JM26. Bacterial endophytes show promise for use as bio-inoculants for agave cultivation. Use of endophytes to enhance cultivation of agave may be particularly important for plants produced by micropropagation techniques, where native endophytes may have been lost. PMID:25763038

  16. Cultivable endophytic bacteria from leaf bases of Agave tequilana and their role as plant growth promoters

    PubMed Central

    Martínez-Rodríguez, Julia del C.; la Mora-Amutio, Marcela De; Plascencia-Correa, Luis A.; Audelo-Regalado, Esmeralda; Guardado, Francisco R.; Hernández-Sánchez, Elías; Peña-Ramírez, Yuri J.; Escalante, Adelfo; Beltrán-García, Miguel J.; Ogura, Tetsuya

    2014-01-01

    Agave tequilana Weber var. ‘Azul’ is grown for the production of tequila, inulin and syrup. Diverse bacteria inhabit plant tissues and play a crucial role for plant health and growth. In this study culturable endophytic bacteria were extracted from leaf bases of 100 healthy Agave tequilana plants. In plant tissue bacteria occurred at mean population densities of 3 million CFU/g of fresh plant tissue. Three hundred endophytic strains were isolated and 16s rDNA sequences grouped the bacteria into eight different taxa that shared high homology with other known sequences. Bacterial endophytes were identified as Acinectobacter sp., A. baumanii, A. bereziniae, Cronobacter sakazakii, Enterobacter hormaechei, Bacillus sp. Klebsiella oxytoca, Pseudomonas sp., Enterococcus casseliflavus, Leuconostoc mesenteroides subsp. mesenteroides and Gluconobacter oxydans. Isolates were confirmed to be plant growth promoting bacteria (PGPB) by their capacities for nitrogen fixation, auxin production, phosphate solubilization, or antagonism against Fusarium oxysporum AC132. E. casseliflavus JM47 and K. oxytoca JM26 secreted the highest concentrations of IAA. The endophyte Acinectobacter sp. JM58 exhibited the maximum values for nitrogen fixation and phosphate solubilization index (PSI). Inhibition of fungi was found in Pseudomonas sp. JM9p and K. oxytoca JM26. Bacterial endophytes show promise for use as bio-inoculants for agave cultivation. Use of endophytes to enhance cultivation of agave may be particularly important for plants produced by micropropagation techniques, where native endophytes may have been lost. PMID:25763038

  17. Abiotic process for Fe(II) oxidation and green rust mineralization driven by a heterotrophic nitrate reducing bacteria (Klebsiella mobilis).

    PubMed

    Etique, Marjorie; Jorand, Frdric P A; Zegeye, Asfaw; Grgoire, Brian; Despas, Christelle; Ruby, Christian

    2014-04-01

    Green rusts (GRs) are mixed Fe(II)-Fe(III) hydroxides with a high reactivity toward organic and inorganic pollutants. GRs can be produced from ferric reducing or ferrous oxidizing bacterial activities. In this study, we investigated the capability of Klebsiella mobilis to produce iron minerals in the presence of nitrate and ferrous iron. This bacterium is well-known to reduce nitrate using an organic carbon source as electron donor but is unable to enzymatically oxidize Fe(II) species. During incubation, GR formation occurred as a secondary iron mineral precipitating on cell surfaces, resulting from Fe(II) oxidation by nitrite produced via bacterial respiration of nitrate. For the first time, we demonstrate GR formation by indirect microbial oxidation of Fe(II) (i.e., a combination of biotic/abiotic processes). These results therefore suggest that nitrate-reducing bacteria can potentially contribute to the formation of GR in natural environments. In addition, the chemical reduction of nitrite to ammonium by GR is observed, which gradually turns the GR into the end-product goethite. The nitrogen mass-balance clearly demonstrates that the total amount of ammonium produced corresponds to the quantity of bioreduced nitrate. These findings demonstrate how the activity of nitrate-reducing bacteria in ferrous environments may provide a direct link between the biogeochemical cycles of nitrogen and iron. PMID:24605878

  18. Fermentation of polysaccharides by Klebsiella and other facultative bacilli

    SciTech Connect

    Ochuba, G.U.; Von Riesen, V.L.

    1980-05-01

    Fermentations of 10 polysaccharides by species of the family Enterobacteriaceae were examined. Algin, guar, karaya, xanthan, and xylan were not fermented by any of the strains tested. Most of the activity was found in the tribe Klebsielleae. Klebseilla oxytoca fermented amylopectin (97% of the strains studied), carrageenan (100%), inulin (68%), polypectate (100%), and tragacanth (100%). Klebsiella pneumoniae fermented amylopectin (91%), carrageenan (100%), and tragacanth (86%). Carraggeenan was also fermented by Enterobacter aerogenes (100%), Enterobacter agglomerans (63%), Enterobacter cloacae (95%), and pectobacterium (38%). pectobacterium shared polypectate fermentation (100%) with K. oxytoca. With one exception, Serratia strains were negative on all polysaccharides. These results, along with other evidence, indicate that (i) the genus Klebsiella is biochemically the most versatile genus of the tribe, (ii) because of its distinct characteristics, K. oxytoca warrants species designation separate from K. pneumoniae, and (iii) some food additives generally considered indigestible can be metabolized by a few species of facultative bacilli, whereas others appear to be resistant.

  19. Phosphate solubilizing and indole-3-acetic acid producing bacteria from the soil of Garhwal Himalaya aimed to improve the growth of rice.

    PubMed

    Gusain, Yogendra Singh; Kamal, Ranveer; Mehta, C M; Singh, U S; Sharma, A K

    2015-01-01

    In the present study, soil bacteria from rainfed agriculture field of Garhwal Himalaya, just prior to sowing of summer crop, were isolated and initially tested for solubilization of inorganic phosphate, production of indole acetic acid (IAA) and siderophore. Two bacterial isolates, having efficient P- solubilizing activity in solid medium, were identified using 16S rRNA sequence analysis as Pseudomonas koreensis strainYB1 Arthrobacter nitroguajacolicus strainYB3 and three bacterial isolates, producing high amount of IAA in liquid medium, were identified as Klebsiella oxytoca strainYB2 and two strain of Arthrobacter nitroguajacolicus, strainYB4 and YB5, respectively. In culture medium supplemented with L-Tryptophan, Klebsiella oxytoca produced high amount of IAA (337.44 ?g l(-1)). The selected five bacterial strains were further tested for tricalcium phosphate (TCP) solubilizing abilities at three different incubation temperature viz., 4 degrees C, 10 degrees C and 28 degrees C, under in vitro conditions. At 28 degrees C, three bacterial strains Pseudomonas koreensis, Arthrobacter nitroguajacolicus strainYB4 and Klebsiella oxytoca solubilized the phosphate efficiently. At 10 degrees C only two strains, Pseudomonas koreensis and Arthrobacter nitroguajacolicus strainYB4 solubilized phosphate efficiently as compared to other strains. These five bacterial strains were tested for nitrogen, catalase activity, starch and cellulose hydrolysis as well as growth promotion activity on rice, under controlled conditions. All the five bacterial strains efficiently increased the biomass and phosphorus uptake in Swama and Swarna sub1 varieties of rice. PMID:26536808

  20. Low Diversity Bacterial Community and the Trapping Activity of Metabolites from Cultivable Bacteria Species in the Female Reproductive System of the Oriental Fruit Fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae)

    PubMed Central

    Shi, Zhanghong; Wang, Lili; Zhang, Hongyu

    2012-01-01

    Our goal was to identify the bacteria inhabiting the reproductive system of the female oriental fruit fly, Bactrocera dorsalis (Hendel), and evaluate the chemotaxis of B. dorsalis to the metabolites produced by the bacteria. Based on 16S rRNA-based polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE), 18 operational taxonomic units (OTUs) were assigned to the five bacterial classes Betaproteobacteria, Alphaproteobacteria, Gammaproteobacteria, Bacilli and Actinobacteria. Nine OTUs were assigned to Gammaproteobacteria, which was the most highly represented class. Enterobacteriaceae constituted the dominant family, and within this family, three genera and five species were identified, including Enterobacter sakazakii, Klebsiella oxytoca, Klebsiella pneumoniae, Raoultella terrigena and Enterobacter amnigenus. In this set, the first two species were the dominant components, and the latter three species were the minor ones. Finally, we found that the metabolites produced by R. terrigena, K. oxytoca and K. pneumoniae were attractive to the B. dorsalis adults, and in field studies, B. dorsalis adults were most attracted to K. oxytoca. Collectively, our results suggest that the female reproductive system plays an important role in the transfer of enterobacteria from the gut to fruit. Our data may prompt the development of a female-targeted population control strategy for this fly. PMID:22754363

  1. Low diversity bacterial community and the trapping activity of metabolites from cultivable bacteria species in the female reproductive system of the Oriental fruit fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae).

    PubMed

    Shi, Zhanghong; Wang, Lili; Zhang, Hongyu

    2012-01-01

    Our goal was to identify the bacteria inhabiting the reproductive system of the female oriental fruit fly, Bactrocera dorsalis (Hendel), and evaluate the chemotaxis of B. dorsalis to the metabolites produced by the bacteria. Based on 16S rRNA-based polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE), 18 operational taxonomic units (OTUs) were assigned to the five bacterial classes Betaproteobacteria, Alphaproteobacteria, Gammaproteobacteria, Bacilli and Actinobacteria. Nine OTUs were assigned to Gammaproteobacteria, which was the most highly represented class. Enterobacteriaceae constituted the dominant family, and within this family, three genera and five species were identified, including Enterobacter sakazakii, Klebsiella oxytoca, Klebsiella pneumoniae, Raoultella terrigena and Enterobacter amnigenus. In this set, the first two species were the dominant components, and the latter three species were the minor ones. Finally, we found that the metabolites produced by R. terrigena, K. oxytoca and K. pneumoniae were attractive to the B. dorsalis adults, and in field studies, B. dorsalis adults were most attracted to K. oxytoca. Collectively, our results suggest that the female reproductive system plays an important role in the transfer of enterobacteria from the gut to fruit. Our data may prompt the development of a female-targeted population control strategy for this fly. PMID:22754363

  2. Surveillance of multidrug resistant uropathogenic bacteria in hospitalized patients in Indian

    PubMed Central

    Mishra, Monali Priyadarsini; Debata, Nagen Kumar; Padhy, Rabindra Nath

    2013-01-01

    Objective To record surveillance, antibiotic resistance of uropathogens of hospitalized patients over a period of 18 months. Methods Urine samples from wards and cabins were used for isolating urinary tract infection (UTI)-causing bacteria that were cultured on suitable selective media and identified by biochemical tests; and their antibiograms were ascertained by Kirby-Bauer's disc diffusion method, in each 6-month interval of the study period, using 18 antibiotics of five different classes. Results From wards and cabins, 1?245 samples were collected, from which 996 strains of bacteria belonging to 11 species were isolated, during April 2011 to September 2012. Two Gram-positive, Staphylococcus aureus (S. aureus) and Enterococcus faecalis (E. faecalis), and nine Gram-negative bacteria, Acinetobacter baumannii, Citrobacter sp., Escherichia coli, Enterobacter aerogenes, Klebsiella pneumoniae, Klebsiella oxytoca, Proteus mirabilis, Proteus vulgaris and Pseudomonas aeruginosa were isolated. Both S. aureus and E. faecalis were vancomycin resistant, and resistant-strains of all pathogens increased in each 6-month period of study. Particularly, all Gram-negatives were resistant to nitrofurantoin and co-trimoxazole, the most preferred antibiotics of empiric therapy for UTI. Conclusions Antibiograms of 11 UTI-causing bacteria recorded in this study indicated moderately higher numbers of strains resistant to each antibiotic studied, generating the fear of precipitating fervent episodes in public health particularly with bacteria, Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae and S. aureus. Moreover, vancomycin resistance in strains of S. aureus and E. faecalis is a matter of concern. PMID:23620859

  3. Bacteria on housefly eggs, Musca domestica, suppress fungal growth in chicken manure through nutrient depletion or antifungal metabolites

    NASA Astrophysics Data System (ADS)

    Lam, Kevin; Thu, Kelsie; Tsang, Michelle; Moore, Margo; Gries, Gerhard

    2009-09-01

    Female houseflies, Musca domestica (Diptera: Muscidae), lay their eggs in ephemeral resources such as animal manure. Hatching larvae compete for essential nutrients with fungi that also colonize such resources. Both the well-known antagonistic relationship between bacteria and fungi and the consistent presence of the bacterium Klebsiella oxytoca on housefly eggs led us to hypothesize (1) that K. oxytoca, and possibly other bacteria on housefly eggs, help curtail the growth of fungal resource competitors and (2) that such fungi indeed adversely affect the development of housefly larvae. Bacteria washed from housefly eggs significantly reduced the growth of fungi in chicken manure. Nineteen bacterial strains and ten fungal strains were isolated from housefly eggs or chicken manure, respectively. Co-culturing each of all the possible bacterium-fungus pairs revealed that the bacteria as a group, but no single bacterium, significantly suppressed the growth of all fungal strains tested. The bacteria's adverse effect on fungi is due to resource nutrient depletion and/or the release of antifungal chemicals. Well-established fungi in resources significantly reduced the number of larval offspring that completed development to adult flies.

  4. Macrophage migration inhibitory factor deficiency is associated with impaired killing of gram-negative bacteria by macrophages and increased susceptibility to Klebsiella pneumoniae sepsis.

    PubMed

    Roger, Thierry; Delaloye, Julie; Chanson, Anne-Laure; Giddey, Marlyse; Le Roy, Didier; Calandra, Thierry

    2013-01-15

    The cytokine macrophage migration inhibitory factor (MIF) is an important component of the early proinflammatory response of the innate immune system. However, the antimicrobial defense mechanisms mediated by MIF remain fairly mysterious. In the present study, we examined whether MIF controls bacterial uptake and clearance by professional phagocytes, using wild-type and MIF-deficient macrophages. MIF deficiency did not affect bacterial phagocytosis, but it strongly impaired the killing of gram-negative bacteria by macrophages and host defenses against gram-negative bacterial infection, as shown by increased mortality in a Klebsiella pneumonia model. Consistent with MIF's regulatory role of Toll-like 4 expression in macrophages, MIF-deficient cells stimulated with lipopolysaccharide or Escherichia coli exhibited reduced nuclear factor ?B activity and tumor necrosis factor (TNF) production. Addition of recombinant MIF or TNF corrected the killing defect of MIF-deficient macrophages. Together, these data show that MIF is a key mediator of host responses against gram-negative bacteria, acting in part via a modulation of bacterial killing by macrophages. PMID:23125447

  5. [Antibiotic resistance rates of extended spectrum beta-lactamase producing Escherichia coli and Klebsiella spp. strains isolated from urinary tract infections in a private hospital].

    PubMed

    Akyar, I?in

    2008-10-01

    The aim of this study was to detect the antibiotic resistance rates of extended spectrum beta-lactamase (ESBL) producing Escherichia coli and Klebsiella spp. strains isolated from urinary tract infections (UTIs) in Private Acibadem Hospital, Istanbul, Turkey. A total of 1100 E. coli and 356 Klebsiella spp. strains isolated from 17.028 urine cultures which were processed between October 2006 and August 2007 in the clinical laboratory, were included to the study. Identification of bacteria and antibiotic susceptibility tests were performed by Phoenix (Becton Dickinson, USA) automated system. Of E. coli strains 12% (n= 132) were found positive for ESBL, while this rate was 12% (n= 41) for Klebsiella spp. strains (38 K.pneumoniae, 3 K. oxytoca). The resistance rates of ESBL producing E. coli and Klebsiello spp. strains were found as follows respectively; 3% and 2.4% for amikacin, 3% and 85.4% for nitrofurantoin, 0% and 4.9% for fosfomycin, 5.3% and 100% for cefoxitin, 21.2% and 58.5% for piperacilin/tazobactam, 34.8% and 41.5% for gentamicin, 68.9% and 58% for trimethoprim/sulfamethoxazole (TMP-SMX), 75.9% and 56.1% for tobramycin, 80.3% and 21.9% for ciprofloxacin and norfloxacin. All of the ESBL positive E. coli and Klebsiella spp. strains were resistant to ampicilin, aztreonam, cefazolin, cefepime, ceftazidime, ceftriaxone and cefuroxime-sodium; while all of the ESBL positive E. coli and Klebsiella spp. strains were sensitive to imipenem and meropenem. The rates of resistance obtained in this study were higher than the rates obtained in other studies performed in our country. This could be attributed to the different antibiotic use policies of different centers or to more frequent use of antibiotics by the patients applied to private hospitals, owing to their higher socioeconomical status and easier attainment of antibiotics without prescription. PMID:19149097

  6. Metabolic engineering of bacteria for ethanol production

    SciTech Connect

    Ingram, L.O.; Gomez, P.F.; Lai, X.; Moniruzzaman, M.; Wood, B.E.; Yomano, L.P.; York, S.W.

    1998-04-20

    Technologies are available which will allow the conversion of lignocellulose into fuel ethanol using genetically engineered bacteria. Assembling these into a cost-effective process remains a challenge. The authors` work has focused primarily on the genetic engineering of enteric bacteria using a portable ethanol production pathway. Genes encoding Zymomonas mobilis pyruvate decarboxylase and alcohol dehydrogenase have been integrated into the chromosome of Escherichia coli B to produce strain KO11 for the fermentation of hemicellulose-derived syrups. This organism can efficiently ferment all hexose and pentose sugars present in the polymers of hemicellulose. Klebsiella oxytoca M5A1 has been genetically engineered in a similar manner to produce strain P2 for ethanol production from cellulose. This organism has the native ability to ferment cellobiose and cellotriose, eliminating the need for one class of cellulase enzymes. The optimal pH for cellulose fermentation with this organism is near that of fungal cellulases. The general approach for the genetic engineering of new biocatalysts has been most successful with enteric bacteria thus far. However, this approach may also prove useful with gram-positive bacteria which have other important traits for lignocellulose conversion. Many opportunities remain for further improvements in the biomass to ethanol processes.

  7. [Resistance to fluoroquinolone among Klebsiella spp strains producing extended-spectrum betalactamases isolated from urine].

    PubMed

    Tlamani, Z; Ellaia, K; Benomar, A; Kabbaj, H; Alaoui, Ae; Seffar, M

    2009-01-01

    The aim of the study was to assess the frequency of resistance to fluoroquinolones in extended-spectrum beta-lactamase (ESBLs) Klebsiella spp isolated from urines of consulting and hospitalized patients in Rabat Specialities Hospital. A retrospective survey was made over 3 years (2006-2008). Two hundred ant fifty three patients presented with confirmed urinary tractus infection (UTI). Klebsiella spp was the etiologic agent in 28% (72/253) of reported UTI. Among them, 86% of Klebsiella pneumoniae and 14% of Klebsiella oxytoca. The frequency of Klebsiella spp resistance to fluoroquinolones was 33% and to third generation cephalosporins was 35%. Thirteen Klebsiella spp strains were producing extended-spectrum beta-lactamase witch corresponds to 18% of all the klebsiella. The extended-spectrum beta-lactamase strains with resistance to fluoroquinolones were 85% (11/13) or 15 % of all klebsiella (11/72). None of those strains was resistant to imipenem. In conclusions resistance of enterobacteries such as Klebsiella spp to fluoroquinolones is becoming worrying among consulting and hospitalized patients. Eleven strains multiresistant (ESBL + resistance to fluoroquinolones), isolated probably because of plasmids carrying genes of ESBL and fluoroquinolones resistances. This increasingly frequent resistance mechanism should lead to a more careful use of first line fluoroquinolones for UTI. PMID:19789127

  8. Alimentary Tract Bacteria Isolated and Identified with API-20E and Molecular Cloning Techniques from Australian Tropical Fruit Flies, Bactrocera cacuminata and B. tryoni

    PubMed Central

    Thaochan, N.; Drew, R. A. I.; Hughes, J. M.; Vijaysegaran, S.; Chinajariyawong, A.

    2010-01-01

    Bacteria were isolated from the crop and midgut of field collected Bactrocera cacuminata (Hering) and Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). Two methods were used, firstly isolation onto two types of bacteriological culture media (PYEA and TSA) and identification using the API-20E diagnostic kit, and secondly, analysis of samples using the 16S rRNA gene molecular diagnostic method. Using the API-20E method, 10 genera and 17 species of bacteria in the family Enterobacteriaceae were identified from cultures growing on the nutrient agar. The dominant species in both the crop and midgut were Citrobacter freundii, Enterobacter cloacae and Klebsiella oxytoca. Providencia rettgeri, Klebsiella pneumoniae ssp ozaenae and Serratia marcescens were isolated from B. tryoni only. Using the molecular cloning technique that is based on 16S rRNA gene sequences, five bacteria classes were dignosed Alpha-, Beta-, Gamma- and Delta- Proteobacteria and Firmicutes including five families, Leuconostocaceae, Enterococcaceae, Acetobacteriaceae, Comamonadaceae and Enterobacteriaceae. The bacteria affiliated with Firmicutes were found mainly in the crop while the Gammaproteobacteria, especially the family Enterobacteriaceae, was dominant in the midgut. This paper presents results from the first known application of molecular cloning techniques to study bacteria within tephritid species and the first record of Firmicutes bacteria in these flies. PMID:20883132

  9. Carbapenemase-producing Enterobacteriaceae in a tertiary hospital in Madrid, Spain: high percentage of colistin resistance among VIM-1-producing Klebsiella pneumoniae ST11 isolates.

    PubMed

    Pena, Irene; Picazo, Juan J; Rodrguez-Avial, Carmen; Rodrguez-Avial, Iciar

    2014-05-01

    Here we describe the carbapenemase genes, genetic relatedness and antimicrobial susceptibility data of 123 carbapenemase-producing Enterobacteriaceae (CPE) clinical isolates recovered from 2010 to 2012, comprising Klebsiella pneumoniae (n = 79), Klebsiella oxytoca (n = 13), Serratia marcescens (n = 14), Enterobacter cloacae (n = 12), Enterobacter asburiae (n = 4) and Enterobacter aerogenes (n = 1). VIM-1 was the most common carbapenemase (n = 101) followed by KPC-2 (n = 19), OXA-48 (n = 2) and IMP-22 (n = 1). Among the K. pneumoniae isolates, nine sequence types (STs) were identified but two clones were dominant: ST11 (54/79) containing mainly VIM-1-producing isolates; and ST101 (13/79) constituted by KPC-2-producing strains. Pulsed-field gel electrophoresis (PFGE) showed a higher genetic diversity among the remaining Enterobacteriaceae. Amikacin and fosfomycin were the most active agents with 82.9% and 80.5% susceptibility, respectively. Non-susceptibility to tigecycline was detected in 36.5% of strains. Overall, colistin resistance was 24.7% and was as high as 47% in Enterobacter spp. An increase in colistin resistance from 13.5% to 31.7% was observed among K. pneumoniae isolates during the study period. Resistance was focused on ST11 since 83.3% of colistin-resistant strains belonged to this clone. The high level of colistin resistance observed in this study is worrying with respect to the already limited therapeutic options for infections caused by multidrug-resistant Gram-negative bacteria. PMID:24657043

  10. Production of 2,3-butanediol by Klebsiella oxytoca from various sugars in microalgal hydrolysate.

    PubMed

    Kim, Yong Jae; Joo, Hyun Woo; Park, Juyi; Kim, Duk-Ki; Jeong, Ki Jun; Chang, Yong Keun

    2015-11-01

    A new fermentation process using a mixed sugar medium is proposed in this study for 2,3-butanediol (2,3-BDO) production. The medium contained seven different monosugars known to be present in Nannochloropsis oceanica hydrolysate. The performance of each sugar when existing alone or together with glucose was evaluated. All the sugars except fucose were successfully metabolized for 2,3-BDO production. A 2,3-BDO yield of 0.31g/g was achieved with the mixed sugar medium, which was very close to that with the glucose-only medium. However, the 2,3-BDO productivity (0.28 g L(-1) h(-1) ) was found to be about 30% lower than that with glucose, implying, as expected, the existence of glucose repression on the uptake of other sugars. Strain development is in need to remove such negative effect of glucose for improved process efficiency. Fucose with the lowest uptake rate and no contribution to 2,3-BDO production can be a high value-added byproduct, once recovered and purified. 2015 American Institute of Chemical Engineers Biotechnol. Prog., 31:1669-1675, 2015. PMID:26400837

  11. Prevalence of contagious and environmental mastitis-causing bacteria in bulk tank milk and its relationships with milking practices of dairy cattle herds in São Miguel Island (Azores).

    PubMed

    Azevedo, Carla; Pacheco, Diana; Soares, Luísa; Romão, Ricardo; Moitoso, Mónica; Maldonado, Jaime; Guix, Roger; Simões, João

    2016-02-01

    This study aimed to assess the degree of contamination of bulk tank milk (BTM) by Staphylococcus spp. and coliform bacteria and to identify major milking practices that help perpetuate them in dairy cattle herds in São Miguel Island. In July 2014, BTM was sampled and a survey concerning local milking practices was conducted on 100 herds. Semi quantitative multiplex polymerase chain reaction detected coagulase-negative staphylococci, Escherichia coli, Staphylococcus aureus, and other coliform bacteria (Klebsiella oxytoca, Klebsiella pneumoniae, and Serratia marcescens) in 100, 75, 59, and 35 % of BTM, respectively. According to multivariable univariate models, on herds not using hot water for cleaning the milking machine and teat liners, there was at least 3.4 more odds (P < 0.01) to have S. aureus or coliform bacteria contamination in BTM. The likelihood of finding S. aureus in BTM was higher (P < 0.001) on herds without high hygiene during milking, when milking mastitic cows at the end, on abrupt cessation of milking at dry-off, and official milk control implementation. The glove use also favored (odds ratio (OR) 5.8; P < 0.01) the detection of coliform bacteria in BTM. Poor milking practices identified in this study should be avoided in order to decrease S. aureus and coliform bacteria contamination of BTM. Other factors associated with milk quality in São Miguel Island also should be further investigated. PMID:26719295

  12. Antimicrobial and Herbal Drug Resistance in Enteric Bacteria Isolated from Faecal Droppings of Common House Lizard/Gecko (Hemidactylus frenatus).

    PubMed

    Singh, Bhoj R; Singh, Vidya; Ebibeni, N; Singh, Raj K

    2013-01-01

    From 194 faecal dropping samples of common house geckos collected from offices (60), houses (88), integrated farm units (IFS,18) and hostels, guest houses, and dining rooms of different canteen/mess (HGM, 28), 326 bacterial isolates of enteric bacteria belonging to 17 genera and 34 species were detected. Escherichia coli were the most frequently (39) isolated followed by Citrobacter freundii (33), Klebsiella pneumonia (27), Salmonella indica (12), Enterobacter gergoviae (12), and Ent. agglomerans (11). Other important bacteria isolated from gecko droppings were Listonella damsela (2), Raoultella terrigena (3), S. salamae (2), S. houtenae (3), Edwardsiella tarda (4), Edwardsiella hoshinae (1), and Klebsiella oxytoca (2). Of the 223 isolates tested for antimicrobial drug sensitivity, 27 (12.1%) had multiple drug resistance (MDR). None of the salmonellae or edwardsiellae had MDR however, MDR strains were significantly more common among Escherichia spp. (P = 1.9 10(-5)) and isolates from IFS units (P = 3.58 10(-23)). The most effective herbal drug, Ageratum conyzoides extract, inhibited growth of only 27.8% of strains tested followed by ethanolic extract of Zanthoxylum rhetsa (13.9%), eucalyptus oil (5.4%), patchouli oil (5.4%), lemongrass oil (3.6%), and sandalwood oil (3.1%), and Artemisia vulgaris essential oil (3.1%). PMID:24223595

  13. The antigens contributing to the serological cross-reactions of Proteus antisera with Klebsiella representatives.

    PubMed

    Palusiak, Agata

    2015-03-01

    Proteus sp. and Klebsiella sp. mainly cause infections of the urinary and respiratory tracts or wounds in humans. The representatives of both genera produce virulence factors like lipopolysaccharide (LPS) or outer membrane proteins (OMPs) having much in common in the structures and/or functions. To check how far this similarity is revealed in the serological cross-reactivity, the bacterial masses of 24 tested Klebsiella sp. strains were tested in ELISA with polyclonal rabbit antisera specific to the representatives of 79 Proteus O serogroups. The strongest reacting systems were selected to Western blot, where the majority of Klebsiella masses reacted in a way characteristic for electrophoretic patterns of proteins. The strongest reactions were obtained for proteins of near 67 and 40 kDa and 12.5 kDa. Mass spectrometry analysis of the proteins samples of one Proteus sp. and one Klebsiella sp. strain showed the GroEL like protein of a sequence GI number 2980926 to be similar for both strains. In Western blot some Klebsiella sp. masses reacted similarly to the homologous Proteus LPSs. The LPS contribution in the observed reactions of the high molecular-mass LPS species was confirmed for Klebsiella oxytoca 0.062. PMID:25510650

  14. Efficacy of surface disinfectant cleaners against emerging highly resistant gram-negative bacteria

    PubMed Central

    2014-01-01

    Background Worldwide, the emergence of multidrug-resistant gram-negative bacteria is a clinical problem. Surface disinfectant cleaners (SDCs) that are effective against these bacteria are needed for use in high risk areas around patients and on multi-touch surfaces. We determined the efficacy of several SDCs against clinically relevant bacterial species with and without common types of multidrug resistance. Methods Bacteria species used were ATCC strains; clinical isolates classified as antibiotic-susceptible; and multi-resistant clinical isolates from Klebsiella oxytoca, Klebsiella pneumoniae, and Serratia marcescens (all OXA-48 and KPC-2); Acinetobacter baumannii (OXA-23); Pseudomonas aeruginosa (VIM-1); and Achromobacter xylosoxidans (ATCC strain). Experiments were carried out according to EN 13727:2012 in quadruplicate under dirty conditions. The five evaluated SDCs were based on alcohol and an amphoteric substance (AAS), an oxygen-releaser (OR), surface-active substances (SAS), or surface-active-substances plus aldehydes (SASA; two formulations). Bactericidal concentrations of SDCs were determined at two different contact times. Efficacy was defined as a log10???5 reduction in bacterial cell count. Results SDCs based on AAS, OR, and SAS were effective against all six species irrespective of the degree of multi-resistance. The SASA formulations were effective against the bacteria irrespective of degree of multi-resistance except for one of the four P. aeruginosa isolates (VIM-1). We found no general correlation between SDC efficacy and degree of antibiotic resistance. Conclusions SDCs were generally effective against gram-negative bacteria with and without multidrug resistance. SDCs are therefore suitable for surface disinfection in the immediate proximity of patients. Single bacterial isolates, however, might have reduced susceptibility to selected biocidal agents. PMID:24885029

  15. Isolation and characterization of polymeric galloyl-ester-degrading bacteria from a tannery discharge place.

    PubMed

    Franco, A R; Calheiros, C S C; Pacheco, C C; De Marco, P; Manaia, C M; Castro, P M L

    2005-11-01

    The culturable bacteria colonizing the rhizosphere of plants growing in the area of discharge of a tannery effluent were characterized. Relative proportions of aerobic, denitrifying, and sulfate-reducing bacteria were determined in the rhizosphere of Typha latifolia, Canna indica, and Phragmites australis. Aerobic bacteria were observed to be the most abundant group in the rhizosphere, and plant type did not seem to influence the abundance of the bacterial types analyzed. To isolate bacteria able to degrade polyphenols used in the tannery industry, enrichments were conducted under different conditions. Bacterial cultures were enriched with individual polyphenols (tannins Tara, Quebracho, or Mimosa) or with an undefined mixture of tannins present in the tannery effluent as carbon source. Cultures enriched with the effluent or Tara tannin were able to degrade tannic acid. Six bacterial isolates purified from these mixed cultures were able to use tannic acid as a sole carbon source in axenic culture. On the basis of 16S ribosomal DNA sequence analysis, these isolates were closely related to organisms belonging to the taxa Serratia, Stenotrophomonas maltophilia, Klebsiella oxytoca, Herbaspirillum chlorophenolicum, and Pseudomonas putida. PMID:16341641

  16. Carbapenemase-producing Klebsiella pneumoniae

    PubMed Central

    Deresinski, Stan

    2014-01-01

    The continuing emergence of infections due to multidrug resistant bacteria is a serious public health problem. Klebsiella pneumoniae, which commonly acquires resistance encoded on mobile genetic elements, including ones that encode carbapenemases, is a prime example. K. pneumoniae carrying such genetic material, including both blaKPC and genes encoding metallo-?-lactamases, have spread globally. Many carbapenemase-producing K. pneumoniae are resistant to multiple antibiotic classes beyond ?-lactams, including tetracyclines, aminoglycosides, and fluoroquinolones. The optimal treatment, if any, for infections due to these organisms is unclear but, paradoxically, appears to often require the inclusion of an optimally administered carbapenem. PMID:25343037

  17. Potential virulence of Klebsiella sp. isolates from enteral diets

    PubMed Central

    Pereira, S.C.L.; Vanetti, M.C.D.

    2015-01-01

    We aimed to evaluate the potential virulence of Klebsiella isolates from enteral diets in hospitals, to support nosocomial infection control measures, especially among critical-care patients. Phenotypic determination of virulence factors, such as capsular expression on the external membrane, production of aerobactin siderophore, synthesis of capsular polysaccharide, hemolytic and phospholipase activity, and resistance to antibiotics, which are used therapeutically, were investigated in strains of Klebsiella pneumoniae and K. oxytoca. Modular industrialized enteral diets (30 samples) as used in two public hospitals were analyzed, and Klebsiella isolates were obtained from six (20%) of them. The hypermucoviscous phenotype was observed in one of the K. pneumoniae isolates (6.7%). Capsular serotypes K1 to K6 were present, namely K5 and K4. Under the conditions of this study, no aerobactin production, hemolytic activity or lecithinase activity was observed in the isolates. All isolates were resistant to amoxicillin and ampicillin and sensitive to cefetamet, imipenem, chloramphenicol, gentamicin and sulfamethoxazole-trimethoprim. Most K. pneumoniae isolates (6/7, 85.7%) from hospital B presented with a higher frequency of resistance to the antibiotics tested in this study, and multiple resistance to at least four antibiotics (3/8; 37.5%) compared with isolates from Hospital A. The variations observed in the antibiotic resistance profiles allowed us to classify the Klebsiella isolates as eight antibiotypes. No production of broad-spectrum β-lactamases was observed among the isolates. Our data favor the hypothesis that Klebsiella isolates from enteral diets are potential pathogens for nosocomial infections. PMID:26176307

  18. Klebsiella pneumoniae survives within macrophages by avoiding delivery to lysosomes.

    PubMed

    Cano, Victoria; March, Catalina; Insua, Jose Luis; Aguil, Nacho; Llobet, Enrique; Moranta, David; Regueiro, Vernica; Brennan, Gerard P; Milln-Lou, Maria Isabel; Martn, Carlos; Garmendia, Junkal; Bengoechea, Jos A

    2015-11-01

    Klebsiella pneumoniae is an important cause of community-acquired and nosocomial pneumonia. Evidence indicates that Klebsiella might be able to persist intracellularly within a vacuolar compartment. This study was designed to investigate the interaction between Klebsiella and macrophages. Engulfment of K.?pneumoniae was dependent on host cytoskeleton, cell plasma membrane lipid rafts and the activation of phosphoinositide 3-kinase (PI3K). Microscopy studies revealed that K.?pneumoniae resides within a vacuolar compartment, the Klebsiella-containing vacuole (KCV), which traffics within vacuoles associated with the endocytic pathway. In contrast to UV-killed bacteria, the majority of live bacteria did not co-localize with markers of the lysosomal compartment. Our data suggest that K.?pneumoniae triggers a programmed cell death in macrophages displaying features of apoptosis. Our efforts to identify the mechanism(s) whereby K.?pneumoniae prevents the fusion of the lysosomes to the KCV uncovered the central role of the PI3K-Akt-Rab14 axis to control the phagosome maturation. Our data revealed that the capsule is dispensable for Klebsiella intracellular survival if bacteria were not opsonized. Furthermore, the environment found by Klebsiella within the KCV triggered the down-regulation of the expression of cps. Altogether, this study proves evidence that K.?pneumoniae survives killing by macrophages by manipulating phagosome maturation that may contribute to Klebsiella pathogenesis. PMID:26045209

  19. SUSCEPTIBILITY OF CHEMOSTAT-GROWN 'YERSINIA ENTEROCOLITICA' AND 'KLEBSIELLA PNEUMONIAE' TO CHLORINE DIOXIDE

    EPA Science Inventory

    The resistance of bacteria to antimicrobial agents could be influenced by growth environment. The susceptibility of two enteric bacteria, Yersinia enterocolitica and Klebsiella pneumoniae, to chlorine dioxide was investigated. These organisms were grown in a defined medium in a c...

  20. Effects of some metallic compounds on Klebsiella

    SciTech Connect

    Wong, S.H.

    1988-04-01

    Many industrial and waste disposal practices unconsciously pollute the environment by adding excess heavy metals to it. Although reports show an inconsistency in the toxic levels of heavy metals such as zinc, nickel, cadmium, mercury and silvery between microbial groups, the toxic effects of the metals on microorganisms have been well documented. Little is known of the differential effects these metals have on coliform K. pneumoniae and K. oxytoca. These bacteria are widely recognized as antibiotic resistant opportunistic pathogens. Besides, they are able to fix dinitrogen. In this study, these metals were found to affect these organisms in a variety of concentrations. Such effect could affect the total coliform count in water, dinitrogen fixation, and removable of nitrate in soil and water.

  1. Effects of some metallic compounds on Klebsiella

    SciTech Connect

    Wong, S.H. )

    1988-05-01

    Many industrial and waste disposal practices unconsciously pollute the environment by adding excess heavy metals to it. Although reports show an inconsistency in the toxic levels of heavy metals such as zinc, nickel, cadmium, mercury and silver between microbial groups, the toxic effects of the metals on microorganisms have been well documented. Little is known of the differential effects these metals have on coliform K. pneumoniae and K. oxytoca. These bacteria are widely recognized as antibiotic resistant opportunistic pathogens ubiquitously distributed in environments. Besides, they are able to fix dinitrogen. In this study, these metals were found to affect these organisms in a variety of concentrations. Such effect could affect the total coliform count in water, dinitrogen fixation, and removable of nitrate in soil and water.

  2. Somatic Serogroups, Capsular Types, and Species of Fecal Klebsiella in Patients with Ankylosing Spondylitis

    PubMed Central

    Toivanen, Paavo; Hansen, Dennis S.; Mestre, Francisca; Lehtonen, Leena; Vaahtovuo, Jussi; Vehma, Mari; Mttnen, Timo; Saario, Riitta; Luukkainen, Reijo; Nissil, Martti

    1999-01-01

    The purpose of the present study was to find out whether patients with ankylosing spondylitis (AS) carry fecal Klebsiella strains that belong to serotypes or species specific for AS. Somatic serotypes (O groups), capsular (K) serotypes, and biochemically identified species were determined for fecal klebsiellae isolated from 187 AS patients and 195 control patients. The controls were patients with fibromyalgia or rheumatoid arthritis. The 638 isolates of Klebsiella that were obtained represented 161 strains; 81 from AS patients and 80 from the controls. The average number of Klebsiella strains per patient was 1.7 for the AS group and 1.5 for the control group. The most common O group was O1, which was observed for isolates from 23 of 187 AS patients and 24 of 195 control patients. Next in frequency was group O2, which was observed for isolates from 17 AS patients and 15 control patients. Regarding the K serotypes, 59 different types were identified, revealing a heterogeneous representation of Klebsiella strains, without a predominance of any serotype. By biochemical identification, Klebsiella pneumoniae was the most frequently occurring species, being found in 45 AS patients and 45 control patients. Next in the frequency was K. oxytoca, which was observed in 26 AS patients and in 29 control patients. K. planticola and K. terrigena occurred in only a minority of patients. Altogether, when analyzed either separately or simultaneously according to O groups, K serotypes, and biochemically identified species, no evidence of the existence of AS-specific Klebsiella strains was obtained. These findings do not indicate participation of Klebsiella in the etiopathogenesis of AS. PMID:10449457

  3. Empirical prediction and validation of antibacterial inhibitory effects of various plant essential oils on common pathogenic bacteria.

    PubMed

    Akdemir Evrendilek, Gulsun

    2015-06-01

    In this study, fractional compound composition, antioxidant capacity, and phenolic substance content of 14 plant essential oils-anise (Pimpinella anisum), bay leaves (Laurus nobilis), cinnamon bark (Cinnamomum verum), clove (Eugenia caryophyllata), fennel (Foeniculum vulgare), hop (Humulus lupulus), Istanbul oregano (Origanum vulgare subsp. hirtum), Izmir oregano (Origanum onites), mint (Mentha piperita), myrtus (Myrtus communis), orange peel (Citrus sinensis), sage (Salvia officinalis), thyme (Thymbra spicata), and Turkish oregano (Origanum minutiflorum)--were related to inhibition of 10 bacteria through multiple linear or non-linear (M(N)LR) models-four Gram-positive bacteria of Listeria innocua, coagulase-negative staphylococci, Staphylococcus aureus, and Bacillus subtilis, and six Gram-negative bacteria of Yersinia enterocolitica, Salmonella Enteritidis, Salmonella Typhimurium, Proteus mirabilis, Escherichia coli O157:H7, and Klebsiella oxytoca. A total of 65 compounds with different antioxidant capacity, phenolic substance content and antibacterial properties were detected with 14 plant essential oils. The best-fit M(N)LR models indicated that relative to anise essential oil, the essential oils of oreganos, cinnamon, and thyme had consistently high inhibitory effects, while orange peel essential oil had consistently a low inhibitory effect. Regression analysis indicated that beta-bisabolene (Turkish and Istanbul oreganos), and terpinolene (thyme) were found to be the most inhibitory compounds regardless of the bacteria type tested. PMID:25764982

  4. Method for differentiating Klebsiella planticola and Klebsiella terrigena from other Klebsiella species.

    PubMed Central

    Monnet, D; Freney, J

    1994-01-01

    Conventional methods usually fail to identify Klebsiella planticola and Klebsiella terrigena, which represent up to 19% of clinical Klebsiella isolates. By combining four carbon substrate assimilation tests and two conventional tests, the method identified these species with a specificity and a sensitivity of 100%. Overall, sensitivity for Klebsiella identification was 94.7%. PMID:8027329

  5. Nickel-Resistant Bacteria from Anthropogenically Nickel-Polluted and Naturally Nickel-Percolated Ecosystems

    PubMed Central

    Stoppel, R.; Schlegel, H. G.

    1995-01-01

    DNA fragments harboring the nickel resistance determinants from bacteria isolated from anthropogenically polluted ecosystems in Europe and Zaire were compared with those harboring the nickel resistance determinants from bacteria isolated from naturally nickel-percolated soils from New Caledonia by DNA-DNA hybridization. The biotinylated DNA probes were derived from the previously described Alcaligenes eutrophus CH34, Alcaligenes xylosoxidans 31A, Alcaligenes denitrificans 4a-2, and Klebsiella oxytoca CCUG 15788 and four new nickel resistance-determining fragments cloned from strains isolated from soils under nickel-hyperaccumulating trees. Nine probes were hybridized with endonuclease-cleaved plasmid and total DNA samples from 56 nickel-resistant strains. Some of the New Caledonian strains were tentatively identified as Acinetobacter, Pseudomonas mendocina, Comamonas, Hafnia alvei, Burkholderia, Arthrobacter aurescens, and Arthrobacter ramosus strains. The DNA of most strains showed homologies to one or several of the following nickel resistance determinants: the cnr and ncc operons of the strains A. eutrophus CH34 and A. xylosoxidans 31A, respectively, the nre operon of strain 31A, and the nickel resistance determinants of K. oxytoca. On the basis of their hybridization reactions the nickel resistance determinants of the strains could be assigned to four groups: (i) cnr/ncc type, (ii) cnr/ncc/nre type, (iii) K. oxytoca type, and (iv) others. The majority of the strains were assigned to the known groups. Among the strains from Belgium and Zaire, exclusively the cnr/ncc and the cnr/ncc/nre types were found. Among the New Caledonian strains all four types were represented. Homologies to the nre operon were found only in combination with the cnr/ncc operon. The homologies to the cnr/ncc operon were the most abundant and were detected alone or together with homologies to the nre operon. Only the DNA of the strains isolated from soil in Scotland and the United States and that of five of the New Caledonian strains did not show any detectable homologies to any of our probes. The nickel resistance fragment isolated from Burkholderia strain 32W-2 was studied in some detail. This 15-kb BamHI fragment conferred resistance to 1 to 5 mM NiCl(inf2) to Escherichia coli and resistance to up to 25 mM NiCl(inf2) to A. eutrophus. It showed strong homologies to both the cnr/ncc operon and the nre operon and conferred strictly regulated (inducible) nickel resistance to A. eutrophus. PMID:16535048

  6. Klebsiella spp. as Nosocomial Pathogens: Epidemiology, Taxonomy, Typing Methods, and Pathogenicity Factors

    PubMed Central

    Podschun, R.; Ullmann, U.

    1998-01-01

    Bacteria belonging to the genus Klebsiella frequently cause human nosocomial infections. In particular, the medically most important Klebsiella species, Klebsiella pneumoniae, accounts for a significant proportion of hospital-acquired urinary tract infections, pneumonia, septicemias, and soft tissue infections. The principal pathogenic reservoirs for transmission of Klebsiella are the gastrointestinal tract and the hands of hospital personnel. Because of their ability to spread rapidly in the hospital environment, these bacteria tend to cause nosocomial outbreaks. Hospital outbreaks of multidrug-resistant Klebsiella spp., especially those in neonatal wards, are often caused by new types of strains, the so-called extended-spectrum-β-lactamase (ESBL) producers. The incidence of ESBL-producing strains among clinical Klebsiella isolates has been steadily increasing over the past years. The resulting limitations on the therapeutic options demand new measures for the management of Klebsiella hospital infections. While the different typing methods are useful epidemiological tools for infection control, recent findings about Klebsiella virulence factors have provided new insights into the pathogenic strategies of these bacteria. Klebsiella pathogenicity factors such as capsules or lipopolysaccharides are presently considered to be promising candidates for vaccination efforts that may serve as immunological infection control measures. PMID:9767057

  7. [Four cases of Klebsiella pneumonia].

    PubMed

    Tsukadaira, Akihiro; Okubo, Yoshio; Kobayashi, Takashi; Wakamatsu, Toshihide; Sasabayashi, Mari; Hotta, Junichi; Tsushima, Kenji; Takashi, Shuji; Yamazaki, Yoshitaka; Yamaguchi, Shinji; Hanaoka, Masayuki; Koizumi, Tomonobu; Fujimoto, Keisaku; Horie, Siro; Kubo, Keishi

    2002-06-01

    Typical Klebsiella pneumonia with mucous sputum is known as an opportunistic nosocomial infection. However, computed tomographic study of limiting in Klebsiella pneumonia is rare. We report three types of chest computed tomography (CT) findings for Klebsiella pneumonia. Case 1 shows typical lobar pneumonia (Friedlander pneumonia), Cases 2 and 3 show acute bronchopneumonia with subclinical aspiration, and Case 4, chronic Klebsiella pneumonia with typical cavitary lung abscesses. Of these four cases of Klebsiella pneumonia, three developed in the right lung, as determined radiologically, but esophagogastroduodenoscopy indicated that the lesions of Case 3 had developed in the left lingula and upper lobe. PMID:12325342

  8. Antimicrobial Effect of the Triterpene 3?,6?,16?-Trihydroxylup-20(29)-ene on Planktonic Cells and Biofilms from Gram Positive and Gram Negative Bacteria

    PubMed Central

    Evaristo, Francisco Flvio Vasconcelos; Albuquerque, Maria Rose Jane R.; dos Santos, Hlcio Silva; Bandeira, Paulo Nogueira; vila, Fbio do Nascimento; da Silva, Bruno Rocha; Vasconcelos, Ariana Azevedo; Rabelo, rica de Menezes; Nascimento-Neto, Luiz Gonzaga; Arruda, Francisco Vassiliepe Sousa; Vasconcelos, Mayron Alves; Carneiro, Victor Alves; Cavada, Benildo Sousa; Teixeira, Edson Holanda

    2014-01-01

    This study evaluated the antimicrobial effect of 3?,6?,16?-trihydroxylup-20(29)-ene (CLF1), a triterpene isolated from Combretum leprosum Mart., in inhibiting the planktonic growth and biofilms of Gram positive bacteria Streptococcus mutans and S. mitis. The antimicrobial activity was assessed by determining the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC). The antibiofilm potential was determined by quantifying total biomass and enumerating biofilm-entrapped viable bacteria. In addition, the acute toxicity of CLF1 on Artemia sp. nauplii was also determined. The results showed that CLF1 was able in inhibiting the growth of S. mutans and S. mitis with MIC and MBC of 7.8??g/mL and 15.6??g/mL, respectively. CLF1 was highly effective on biofilms of both bacteria. Only 7.8??g/mL CLF1 was enough to inhibit by 97% and 90% biomass production of S. mutans and S. mitis, respectively. On the other hand, such effects were not evident on Gram negative Pseudomonas aeruginosa and Klebsiella oxytoca. The toxicity tests showed that the LC50 of CLF1 was 98.19??g/mL. Therefore, CLF1 isolated from C. leprosum may constitute an important natural agent for the development of new therapies for caries and other infectious diseases caused by S. mutans and S. mitis. PMID:25093179

  9. Epidemiological study of klebsiella infection in the special care baby unit of a London hospital

    PubMed Central

    Riser, EVE; Noone, Paul; Howard, Frances M

    1980-01-01

    Of the babies admitted to the Special Care Baby Unit of the Royal Free Hospital over 20 months, 102% were infected or colonised by klebsiella. The fluorescent antibody technique was used to identify epidemics caused by three strains: capsular type 8 K. aerogenes, type 68 K. oxytoca, or type 13 K. aerogenes, each of which was predominant at a different time, exhibited a difference in virulence, and showed a predilection for different sites of infection. Intestinal colonisation was frequently followed by the presence of sepsis in other sites by the same capsular type. Antibiotic administration led to a higher incidence of klebsiella infection, while the widespread use of compounds containing hexachlorophane could have contributed to skin colonisation and infection by klebsiella. An environmental survey indicated that 1% Hycolin failed to disinfect the incubators, that the babies were the reservoirs of the organisms, and that transmission was due to inadequate hand-washing of nurses and mothers. The mothers were found to have been uninformed of hygienic techniques. They were observed in various practices which could have contributed to the spread of the organism, including contaminating communal areas and handling babies other than their own. It has been recommended that the mothers of premature infants be instructed in the hygienic measures required in dealing with this susceptible population and that the nursing and medical staff be more strict in their own observance of these procedures. PMID:7400339

  10. Effect of algae and plant lectins on planktonic growth and biofilm formation in clinically relevant bacteria and yeasts.

    PubMed

    Vasconcelos, Mayron Alves; Arruda, Francisco Vassiliepe Sousa; Carneiro, Victor Alves; Silva, Helton Colares; Nascimento, Kyria Santiago; Sampaio, Alexandre Holanda; Cavada, Benildo; Teixeira, Edson Holanda; Henriques, Mariana; Pereira, Maria Olivia

    2014-01-01

    This study aimed to evaluate the abilities of plant and algae lectins to inhibit planktonic growth and biofilm formation in bacteria and yeasts. Initially, ten lectins were tested on Staphylococcus epidermidis, Staphylococcus aureus, Klebsiella oxytoca, Pseudomonas aeruginosa, Candida albicans, and C. tropicalis at concentrations of 31.25 to 250  μ g/mL. The lectins from Cratylia floribunda (CFL), Vatairea macrocarpa (VML), Bauhinia bauhinioides (BBL), Bryothamnion seaforthii (BSL), and Hypnea musciformis (HML) showed activities against at least one microorganism. Biofilm formation in the presence of the lectins was also evaluated; after 24 h of incubation with the lectins, the biofilms were analyzed by quantifying the biomass (by crystal violet staining) and by enumerating the viable cells (colony-forming units). The lectins reduced the biofilm biomass and/or the number of viable cells to differing degrees depending on the microorganism tested, demonstrating the different characteristics of the lectins. These findings indicate that the lectins tested in this study may be natural alternative antimicrobial agents; however, further studies are required to better elucidate the functional use of these proteins. PMID:24982871

  11. Rapid Identification of Gram-Negative Bacteria with and without CTX-M Extended-Spectrum β-Lactamase from Positive Blood Culture Bottles by PCR Followed by Microchip Gel Electrophoresis▿

    PubMed Central

    Fujita, Shin-ichi; Yosizaki, Kentaro; Ogushi, Thikako; Uechi, Kouhei; Takemori, Yukiko; Senda, Yasuko

    2011-01-01

    We evaluated the usefulness of PCR analysis of the 16S-23S rRNA gene internal transcribed spacer (ITS) and the CTX-M extended-spectrum β-lactamase (ESBL) followed by microchip gel electrophoresis (MGE) for direct identification and CTX-M detection of Gram-negative bacteria (GNB) from positive blood culture bottles. Of 251 GNB isolated from blood cultures containing a single bacterium, 225 (90%) were correctly identified at the species level directly from positive blood culture bottles by comparing the ITS-PCR patterns of the sample strain with those of the control strains. There were no cases of incorrect identification. Limitations encountered included the inability to detect mixed cultures (four bottles) as well as some species (Enterobacter species and Klebsiella oxytoca) demonstrating identical ITS-PCR patterns. A total of 109 ESBL-producing isolates from various clinical materials obtained between January 2005 and December 2008 were examined for blaCTX-M, blaSHV, and blaTEM genes by PCR and sequences of PCR products. CTX-M ESBL was detected in 105 isolates, and SHV ESBL was detected in two isolates. The remaining two isolates (K. oxytoca) were shown to harbor blaOXY. Twenty (19%) of 104 Escherichia coli isolates from blood cultures were suspected to produce ESBL by the combination disk method, and these isolates were shown to harbor CTX-M ESBL by PCR-MGE. The results were obtained within 1.5 h at a calculated cost of $6.50 per specimen. In conclusion, simultaneous detection of ITS length polymorphisms and blaCTX-M by single PCR followed by MGE is useful for rapid, cost-effective, and reliable species-level identification of CTX-M ESBL-producing GNB responsible for bloodstream infections. PMID:21289149

  12. Duodenal-Mucosal Bacteria Associated with Celiac Disease in Children

    PubMed Central

    Sánchez, Ester; Donat, Ester; Ribes-Koninckx, Carmen; Fernández-Murga, Maria Leonor

    2013-01-01

    Celiac disease (CD) is an immune-mediated enteropathy triggered by the ingestion of cereal gluten proteins. This disorder is associated with imbalances in the gut microbiota composition that could be involved in the pathogenesis of CD. The aim of this study was to characterize the composition and diversity of the cultivable duodenal mucosa-associated bacteria of CD patients and control children. Duodenal biopsy specimens from patients with active disease on a gluten-containing diet (n = 32), patients with nonactive disease after adherence to a gluten-free diet (n = 17), and controls (n = 8) were homogenized and plated on plate count agar, Wilkins-Chalgren agar, brain heart agar, or yeast, Casitone, and fatty acid agar. The isolates were identified by partial 16S rRNA gene sequencing. Renyi diversity profiles showed the highest diversity values for active CD patients, followed by nonactive CD patients and control individuals. Members of the phylum Proteobacteria were more abundant in patients with active CD than in the other child groups, while those of the phylum Firmicutes were less abundant. Members of the families Enterobacteriaceae and Staphylococcaceae, particularly the species Klebsiella oxytoca, Staphylococcus epidermidis, and Staphylococcus pasteuri, were more abundant in patients with active disease than in controls. In contrast, members of the family Streptococcaceae were less abundant in patients with active CD than in controls. Furthermore, isolates of the Streptococcus anginosus and Streptococcus mutans groups were more abundant in controls than in both CD patient groups, regardless of inflammatory status. The findings indicated that the disease is associated with the overgrowth of possible pathobionts that exclude symbionts or commensals that are characteristic of the healthy small intestinal microbiota. PMID:23835180

  13. Duodenal-mucosal bacteria associated with celiac disease in children.

    PubMed

    Snchez, Ester; Donat, Ester; Ribes-Koninckx, Carmen; Fernndez-Murga, Maria Leonor; Sanz, Yolanda

    2013-09-01

    Celiac disease (CD) is an immune-mediated enteropathy triggered by the ingestion of cereal gluten proteins. This disorder is associated with imbalances in the gut microbiota composition that could be involved in the pathogenesis of CD. The aim of this study was to characterize the composition and diversity of the cultivable duodenal mucosa-associated bacteria of CD patients and control children. Duodenal biopsy specimens from patients with active disease on a gluten-containing diet (n = 32), patients with nonactive disease after adherence to a gluten-free diet (n = 17), and controls (n = 8) were homogenized and plated on plate count agar, Wilkins-Chalgren agar, brain heart agar, or yeast, Casitone, and fatty acid agar. The isolates were identified by partial 16S rRNA gene sequencing. Renyi diversity profiles showed the highest diversity values for active CD patients, followed by nonactive CD patients and control individuals. Members of the phylum Proteobacteria were more abundant in patients with active CD than in the other child groups, while those of the phylum Firmicutes were less abundant. Members of the families Enterobacteriaceae and Staphylococcaceae, particularly the species Klebsiella oxytoca, Staphylococcus epidermidis, and Staphylococcus pasteuri, were more abundant in patients with active disease than in controls. In contrast, members of the family Streptococcaceae were less abundant in patients with active CD than in controls. Furthermore, isolates of the Streptococcus anginosus and Streptococcus mutans groups were more abundant in controls than in both CD patient groups, regardless of inflammatory status. The findings indicated that the disease is associated with the overgrowth of possible pathobionts that exclude symbionts or commensals that are characteristic of the healthy small intestinal microbiota. PMID:23835180

  14. Transposition of IS1397 in the family Enterobacteriaceae and first characterization of ISKpn1, a new insertion sequence associated with Klebsiella pneumoniae palindromic units.

    PubMed

    Wilde, C; Bachellier, S; Hofnung, M; Clément, J M

    2001-08-01

    IS1397 and ISKpn1 are IS3 family members which are specifically inserted into the loop of palindromic units (PUs). IS1397 is shown to transpose into PUs with sequences close or identical to the Escherichia coli consensus, even in other enterobacteria (Salmonella enterica serovar Typhimurium, Klebsiella pneumoniae, and Klebsiella oxytoca). Moreover, we show that homologous intergenic regions containing PUs constitute IS1397 transpositional hot spots, despite bacterial interspersed mosaic element structures that differ among the three species. ISKpn1, described here for the first time, is specific for PUs from K. pneumoniae, in which we discovered it. A sequence comparison between the two insertion sequences allowed us to define a motif possibly accounting for their specificity. PMID:11443073

  15. Transposition of IS1397 in the Family Enterobacteriaceae and First Characterization of ISKpn1, a New Insertion Sequence Associated with Klebsiella pneumoniae Palindromic Units

    PubMed Central

    Wilde, Caroline; Bachellier, Sophie; Hofnung, Maurice; Clément, Jean-Marie

    2001-01-01

    IS1397 and ISKpn1 are IS3 family members which are specifically inserted into the loop of palindromic units (PUs). IS1397 is shown to transpose into PUs with sequences close or identical to the Escherichia coli consensus, even in other enterobacteria (Salmonella enterica serovar Typhimurium, Klebsiella pneumoniae, and Klebsiella oxytoca). Moreover, we show that homologous intergenic regions containing PUs constitute IS1397 transpositional hot spots, despite bacterial interspersed mosaic element structures that differ among the three species. ISKpn1, described here for the first time, is specific for PUs from K. pneumoniae, in which we discovered it. A sequence comparison between the two insertion sequences allowed us to define a motif possibly accounting for their specificity. PMID:11443073

  16. EPIDEMIOLOGICAL STUDY OF 'KLEBSIELLA PNEUMONIAE' AMONG PULP AND PAPER MILL WORKERS

    EPA Science Inventory

    This one-year study measured fecal coliform and Klebsiella bacteria densities in several of Wisconsin's pulp and paper mill processing wash waters, treated waters, and waters receiving pulp and paper mill effluent discharge. The isolation of fecal coliform bacteria ranged from as...

  17. In-vivo study of the nuclear quadrupole interaction of99Mo (?- 99)Tc in nitrogenase of Klebsiella pneumoniaein nitrogenase of Klebsiella pneumoniae

    NASA Astrophysics Data System (ADS)

    Mottner, P.; Lerf, A.; Ni, X.; Butz, T.; Erfkamp, J.; Mller, A.

    1990-08-01

    We report on the first TDPAC-measurements of the nuclear quadrupole interaction (NQI) of (NQI) of99Mo(?-)99Tc in the nitrogenase of the bacteria Klebsiella pneumoniae. Because nitrogenase is the only Mo-containing enzyme in Klebsiella pneumoniae under the chosen conditions, no further isolation of this enzyme was necessary. The majority of the incorporated99Mo is subjected to a well defined NQI with ?=365(7) Mrad/s, ?=1 and a reorientational correlation time of ?co???10nsec and is attributed to the active site of the FeMo cofactor. During sample preparation we noted a pronounced affinity of the bacteria to99mTc.

  18. Rapid identification of carbapenemase genes in gram-negative bacteria with an oligonucleotide microarray-based assay.

    PubMed

    Braun, Sascha D; Monecke, Stefan; Thrmer, Alexander; Ruppelt, Antje; Makarewicz, Oliwia; Pletz, Mathias; Rei?ig, Annett; Slickers, Peter; Ehricht, Ralf

    2014-01-01

    Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well as selected extended (ESBL) and narrow spectrum (NSBL) beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13), blaGIM (2/2), blaKPC (27/27), blaNDM (5/5), blaIMP-2/4/7/8/13/14/15/16/31 (10/10), blaOXA-23 (12/13), blaOXA-40-group (7/7), blaOXA-48-group (32/33), blaOXA-51 (1/1) and blaOXA-58 (1/1). Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16), blaOXA-2 (4/4), blaOXA-9 (33/33), OXA-10 (3/3), blaOXA-51 (25/25), blaOXA-58 (2/2), CTX-M1/M15 (17/17) and blaVIM (1/1)]. In direct comparison to phenotypical identification obtained by VITEK or MALDI-TOF systems, 114 of 117 (97.4%) isolates, including Acinetobacter baumannii (28/28), Enterobacter spec. (5/5), Escherichia coli (4/4), Klebsiella pneumoniae (62/63), Klebsiella oxytoca (0/2), Pseudomonas aeruginosa (12/12), Citrobacter freundii (1/1) and Citrobacter braakii (2/2), were correctly identified by a panel of species specific probes. This assay might be easily extended, adapted and transferred to point of care platforms enabling fast surveillance, rapid detection and appropriate early treatment of infections caused by multiresistant Gram-negative bacteria. PMID:25068267

  19. Hypervirulent (hypermucoviscous) Klebsiella pneumoniae

    PubMed Central

    Shon, Alyssa S.; Bajwa, Rajinder P.S.; Russo, Thomas A.

    2013-01-01

    A new hypervirulent (hypermucoviscous) variant of Klebsiella pneumoniae has emerged. First described in the Asian Pacific Rim, it now increasingly recognized in Western countries. Defining clinical features are the ability to cause serious, life-threatening community-acquired infection in younger healthy hosts, including liver abscess, pneumonia, meningitis and endophthalmitis and the ability to metastatically spread, an unusual feature for enteric Gram-negative bacilli in the non-immunocompromised. Despite infecting a healthier population, significant morbidity and mortality occurs. Although epidemiologic features are still being defined, colonization, particularly intestinal colonization, appears to be a critical step leading to infection. However the route of entry remains unclear. The majority of cases described to date are in Asians, raising the issue of a genetic predisposition vs. geospecific strain acquisition. The traits that enhance its virulence when compared with “classical” K. pneumoniae are the ability to more efficiently acquire iron and perhaps an increase in capsule production, which confers the hypermucoviscous phenotype. An objective diagnostic test suitable for routine use in the clinical microbiology laboratory is needed. If/when these strains become increasingly resistant to antimicrobials, we will be faced with a frightening clinical scenario. PMID:23302790

  20. Enrichment and identification of cellulolytic bacteria from the gastrointestinal tract of Giant African snail, Achatina fulica.

    PubMed

    Pawar, Kiran D; Dar, Mudasir A; Rajput, Bharati P; Kulkarni, Girish J

    2015-02-01

    The cellulolytic bacterial community structure in gastrointestinal (GI) tract of Achatina fulica was studied using culture-independent and -dependent methods by enrichment in carboxymethyl cellulose (CMC). Culture-dependent method indicated that GI tract of snail was dominated by Enterobacteriaceae members. When tested for cellulase activities, all isolates obtained by culture-dependent method showed both or either of CMCase or avicelase activity. Isolate identified as Citrobacter freundii showed highest CMCase and medium avicelase activity. Sequencing of clones from the 16S rRNA gene clone library identified ten operational taxonomic units (OTUs), which were affiliated to Enterobacteriaceae of phylum Gammaproteobacteria. Of these ten OTUs, eight OTUs closely matched with Enterobacter and Klebsiella genera. The most abundant OTU allied to Klebsiella oxytoca accounted for 70 % of the total sequences. The members of Klebsiella and Enterobacter were observed by both methods indicating their dominance among the cellulolytic bacterial community in the GI tract of the snail. PMID:25432338

  1. Occurrence of yeasts, enterococci and other enteric bacteria in subgingival biofilm of HIV-positive patients with chronic gingivitis and necrotizing periodontitis

    PubMed Central

    Gaetti-Jardim Jnior, Elerson; Nakano, Viviane; Wahasugui, Thais C.; Cabral, Ftima C.; Gamba, Rosa; Avila-Campos, Mario Julio

    2008-01-01

    The purpose of this study was to determine the prevalence of enteric bacteria and yeasts in biofilm of 80 HIV-positive patients with plaque-associated gingivitis or necrotizing periodontitis. Patients were subjected to extra, intra oral and radiographic examinations. The oral hygiene, bleeding on probing, gingival conditions, and attachment loss were evaluated. Clinical specimens were collected from gingival crevices or periodontal pockets, transferred to VMGA III, diluted and transferred to Sabouraud Dextrose agar with 100 ?g/ml of chloramphenicol, peptone water, EVA broth, EMB agar, SS agar, Bile esculin agar and Brilliant green agar. Isolation of yeasts was carried out at room temperature, for 3-7 days; and for the isolation of enteric microorganisms plates were incubated at 37C, for 24-48 h. The yeasts identification was performed according to the carbon and nitrogen assimilation, fermentation of carbohydrates and germ tube formation. Bacteria were identified according to their colonial and cellular morphologies and biochemical tests. Yeasts were identified as Candida albicans and its occurrence was more common in patients with CD4+ below 200/mm3 and was affected by the extension of periodontal involvement (P = 0.0345). Enteric bacteria recovered from clinical specimens were identified as Enterobacter sakazakii, Enterobacter cloacae, Serratia liquefaciens, Klebsiella oxytoca and Enterococcus sp. Enterobacteriaceae and enterococci were detected in 32.5% of clinical samples from patients with necrotizing periodontitis. In conclusion, non-oral pathogenic bacteria and C. albicans were more prevalent in periodontal sites of HIV-positive patients with necrotizing periodontitis and chronic gingivitis. PMID:24031212

  2. Chronic Klebsiella pneumonia: a rare manifestation of Klebsiella pneumonia

    PubMed Central

    Thungtitigul, Poungrat; Suwatanapongched, Thitiporn

    2015-01-01

    K. pneumoniae can present as two forms of community-acquired pneumonia, acute and chronic. Although acute pneumonia may turn into necrotizing pneumonia, which results in a prolonged clinical course, it often has a rapidly progressive clinical course. In contrast, chronic Klebsiella pneumonia runs a protracted indolent course that mimics other chronic pulmonary infections and malignancies. Herein, we present two cases of chronic Klebsiella pneumonia. The diagnosis was made by microorganism identification, as well as absence of other potential causes. Clinical and radiographic findings improved after a prolonged course of antibiotic therapy. PMID:26543615

  3. Chronic Klebsiella pneumonia: a rare manifestation of Klebsiella pneumonia.

    PubMed

    Boonsarngsuk, Viboon; Thungtitigul, Poungrat; Suwatanapongched, Thitiporn

    2015-09-01

    K. pneumoniae can present as two forms of community-acquired pneumonia, acute and chronic. Although acute pneumonia may turn into necrotizing pneumonia, which results in a prolonged clinical course, it often has a rapidly progressive clinical course. In contrast, chronic Klebsiella pneumonia runs a protracted indolent course that mimics other chronic pulmonary infections and malignancies. Herein, we present two cases of chronic Klebsiella pneumonia. The diagnosis was made by microorganism identification, as well as absence of other potential causes. Clinical and radiographic findings improved after a prolonged course of antibiotic therapy. PMID:26543615

  4. Epidemiology and Virulence of Klebsiella pneumoniae.

    PubMed

    Clegg, Steven; Murphy, Caitlin N

    2016-02-01

    Strains of Klebsiella pneumoniae are frequently opportunistic pathogens implicated in urinary tract and catheter-associated urinary-tract infections of hospitalized patients and compromised individuals. Infections are particularly difficult to treat since most clinical isolates exhibit resistance to several antibiotics leading to treatment failure and the possibility of systemic dissemination. Infections of medical devices such as urinary catheters is a major site of K. pneumoniae infections and has been suggested to involve the formation of biofilms on these surfaces. Over the last decade there has been an increase in research activity designed to investigate the pathogenesis of K. pneumoniae in the urinary tract. These investigations have begun to define the bacterial factors that contribute to growth and biofilm formation. Several virulence factors have been demonstrated to mediate K. pneumoniae infectivity and include, but are most likely not limited to, adherence factors, capsule production, lipopolysaccharide presence, and siderophore activity. The development of both in vitro and in vivo models of infection will lead to further elucidation of the molecular pathogenesis of K. pneumoniae. As for most opportunistic infections, the role of host factors as well as bacterial traits are crucial in determining the outcome of infections. In addition, multidrug-resistant strains of these bacteria have become a serious problem in the treatment of Klebsiella infections and novel strategies to prevent and inhibit bacterial growth need to be developed. Overall, the frequency, significance, and morbidity associated with K. pneumoniae urinary tract infections have increased over many years. The emergence of these bacteria as sources of antibiotic resistance and pathogens of the urinary tract present a challenging problem for the clinician in terms of management and treatment of individuals. PMID:26999397

  5. Deciphering tissue-induced Klebsiella pneumoniae lipid A structure.

    PubMed

    Llobet, Enrique; Martnez-Moliner, Vernica; Moranta, David; Dahlstrm, Kthe M; Regueiro, Vernica; Toms, Anna; Cano, Victoria; Prez-Gutirrez, Camino; Frank, Christian G; Fernndez-Carrasco, Helena; Insua, Jos Luis; Salminen, Tiina A; Garmendia, Junkal; Bengoechea, Jos A

    2015-11-17

    The outcome of an infection depends on host recognition of the pathogen, hence leading to the activation of signaling pathways controlling defense responses. A long-held belief is that the modification of the lipid A moiety of the lipopolysaccharide could help Gram-negative pathogens to evade innate immunity. However, direct evidence that this happens in vivo is lacking. Here we report the lipid A expressed in the tissues of infected mice by the human pathogen Klebsiella pneumoniae. Our findings demonstrate that Klebsiella remodels its lipid A in a tissue-dependent manner. Lipid A species found in the lungs are consistent with a 2-hydroxyacyl-modified lipid A dependent on the PhoPQ-regulated oxygenase LpxO. The in vivo lipid A pattern is lost in minimally passaged bacteria isolated from the tissues. LpxO-dependent modification reduces the activation of inflammatory responses and mediates resistance to antimicrobial peptides. An lpxO mutant is attenuated in vivo thereby highlighting the importance of this lipid A modification in Klebsiella infection biology. Colistin, one of the last options to treat multidrug-resistant Klebsiella infections, triggers the in vivo lipid A pattern. Moreover, colistin-resistant isolates already express the in vivo lipid A pattern. In these isolates, LpxO-dependent lipid A modification mediates resistance to colistin. Deciphering the lipid A expressed in vivo opens the possibility of designing novel therapeutics targeting the enzymes responsible for the in vivo lipid A pattern. PMID:26578797

  6. Bacteriocine typing of Klebsiella spp

    PubMed Central

    Hall, Felicity A.

    1971-01-01

    One hundred and six strains of Klebsiella spp were examined for their ability to produce bacteriocine. Nine of these, together with one strain from the National Collection of Type Cultures, were selected and used to type Klebsiella strains from various sources. Strains were typed by testing their sensitivity to bacteriocines produced by the standard set of 10 strains. Eight hundred strains were tested and 77% of these were typable and could be divided into a relatively large number of groups, some of which occurred consistently more frequently than others. This simple method has been shown to have some value in epidemiological investigations. PMID:5167107

  7. Population dynamics of bacteria associated with different strains of the pine wood nematode Bursaphelenchus xylophilus after inoculation in maritime pine (Pinus pinaster).

    PubMed

    Roriz, Mariana; Santos, Carla; Vasconcelos, Marta W

    2011-08-01

    For a long time it was thought that Bursaphelenchus xylophilus was the only agent of the pine wilt disease. Recently, it was discovered that there are bacteria associated with the nematodes that contribute to the pathogenesis of this disease, mainly through the release of toxins that promote the death of the pines. Among the species most commonly found, are bacteria belonging to the Bacillus, Pantoea, Pseudomonas and Xanthomonas genera. The main objective of this work was to study the effect of inoculation of maritime pine (Pinus pinaster) with four different nematode isolates, in the bacterial population of nematodes and trees, at different stages of disease progression. The monitoring of progression of disease symptoms was also recorded. Also, the identification of bacteria isolated from the xylem of trees and the surface of nematodes was performed by classical identification methods, by the API20E identification system and by sequencing of bacterial DNA. The results showed that for the symptoms progression, the most striking difference was observed for the pines inoculated with the avirulent isolate, C14-5, which led to a slower and less severe aggravation of symptoms than in pines inoculated with the virulent isolates. In general, it was found that bacterial population, inside the tree, increased with disease progression. A superior bacterial quantity was isolated from pines inoculated with the nematode isolates HF and 20, and, comparatively, few bacteria were isolated from pines inoculated with the avirulent isolate. The identification system API20E was insufficient in the identification of bacterial species; Enterobacter cloacae species was identified in 79% of the isolated bacterial colonies and seven of these colonies could not be identified by this method. Molecular identification methods, through bacterial DNA sequencing, allowed a more reliable identification: eleven different bacterial species within the Bacillus, Citrobacter, Enterobacter, Escherichia, Klebsiella, Paenibacillus, Pantoea and Terribacillus genera were identified. General bacterial diversity increased with the progression of the disease. Bacillus spp. were predominant at the earlier stage of disease progression and Klebsiella oxytoca at the later stages. Furthermore, bacterial species isolated from the surface of nematodes were similar to those isolated from the xylem of pines. In the present work new bacterial species were identified which have never been reported before in this type of study and may be associated with their geographical origin (Portugal). P. pinaster, the pine species used in this study, was different from those commonly grown in Japan and China. Furthermore, it was the first time that bacteria were isolated and identified from an avirulent pine wood nematode isolate. PMID:21570967

  8. Endophthalmitis caused by Klebsiella species

    PubMed Central

    Sridhar, Jayanth; Flynn, Harry W.; Kuriyan, Ajay E.; Dubovy, Sander; Miller, Darlene

    2014-01-01

    Purpose To report the clinical presentation, antibiotic sensitivities, treatment strategies, and visual outcomes associated with endophthalmitis caused by Klebsiella species. Methods A non-comparative consecutive case series. Microbiology database records were retrospectively reviewed for all patients with endophthalmitis caused by Klebsiella species from 1990 to 2012 at a large university referral center. The corresponding clinical records were then reviewed to evaluate the endophthalmitis clinical features and treatment outcomes. Results Seven patients were identified. Clinical settings included endogenous (n=3), post-traumatic (n=2), trabeculectomy bleb-associated (n=1), and post-penetrating keratoplasty (n=1). Five patients presented with hypopyon. Presenting visual acuity ranged from 20/60 to light perception in non-endogenous cases and 1/200 to light perception in endogenous cases. Klebsiella was sensitive to aminoglycosides, 3rd generation cephalosporins, and 2nd and 3rd generation fluoroquinolones in all cases. Initial treatment strategies were vitreous tap and injection (n=4), pars plana vitrectomy with intravitreal antibiotics (n=2), and anterior chamber tap and injection (n=1). All three endogenous cases later underwent enucleation or evisceration. In non-endogenous cases, final visual acuity was 20/70 or better in all four patients. Conclusions Endophthalmitis caused by Klebsiella species is associated with poor visual outcomes. Endogenous cases had high rates of enucleation or evisceration. PMID:24801652

  9. Prevalence and Antimicrobial Susceptibility Patterns of Bacteria from Milkmen and Cows with Clinical Mastitis in and around Kampala, Uganda

    PubMed Central

    Kateete, David Patrick; Kabugo, Usuf; Baluku, Hannington; Nyakarahuka, Luke; Kyobe, Samuel; Okee, Moses; Najjuka, Christine Florence; Joloba, Moses Lutaakome

    2013-01-01

    Background Identification of pathogens associated with bovine mastitis is helpful in treatment and management decisions. However, such data from sub-Saharan Africa is scarce. Here we describe the distribution and antimicrobial susceptibility patterns of bacteria from cows with clinical mastitis in Kampala, Uganda. Due to high concern of zoonotic infections, isolates from milkmen are also described. Methodology/Principal Findings Ninety seven milk samples from cows with clinical mastitis and 31 nasal swabs from milkmen were collected (one sample per cow/human). Fifty eight (60%) Gram-positive isolates namely Staphylococci (21), Enterococci (16), Streptococci (13), Lactococci (5), Micrococci (2) and Arcanobacteria (1) were detected in cows; only one grew Staphylococcus aureus. Furthermore, 24 (25%) coliforms namely Escherichia coli (12), Klebsiella oxytoca (5), Proteus vulgaris (2), Serratia (2), Citrobacter (1), Cedecea (1) and Leclercia (1) were identified. From humans, 24 Gram-positive bacteria grew, of which 11 were Staphylococci (35%) including four Staphylococcus aureus. Upon susceptibility testing, methicillin-resistant coagulase-negative staphylococci (CoNS) were prevalent; 57%, 12/21 in cows and 64%, 7/11 in humans. However, methicillin-resistant Staphylococcus aureus was not detected. Furthermore, methicillin and vancomycin resistant CoNS were detected in cows (Staphylococcus hominis, Staphylococcus lugdunensis) and humans (Staphylococcus scuiri). Also, vancomycin and daptomycin resistant Enterococci (Enterococcus faecalis and Enterococcus faecium, respectively) were detected in cows. Coliforms were less resistant with three pan-susceptible isolates. However, multidrug resistant Klebsiella, Proteus, Serratia, Cedecea, and Citrobacter were detected. Lastly, similar species grew from human and bovine samples but on genotyping, the isolates were found to be different. Interestingly, human and bovine Staphylococcus aureus were genetically similar (spa-CC435, spa-type t645 corresponding to ST121) but with different susceptibility patterns. Conclusions/Significance CoNS, Enterococci, Streptococci, and Escherichia coli are the predominant pathogens associated with clinical bovine-mastitis in Kampala, Uganda. Multidrug resistant bacteria are also prevalent. While similar species occurred in humans and cows, transmission was not detected. PMID:23667611

  10. [Amperometric enzyme immunosensor for determination of Klebsiella pneumoniae antigen].

    PubMed

    Safina, G R; Mediantseva, E P; Vaniagina, O N; Glushko, N I; Budnikov, G K

    2005-01-01

    An amperometric enzyme immunosensor for detecting the bacterial antigen Klebsiella pneumoniae has been developed. The biosensing part of this analytical device consists of cholinesterase and antibodies to Klebsiella pneumoniae co-immobilized into the cellulose nitrate membrane. The conditions of immunosensor functioning (ratio of enzyme and antibodies, substrate concentration, pH of working buffer solution) were chosen. The sensor with antibodies in dilution 1:20 demonstrated the best analytical characteristics. Working concentrations were ranged from 1 x 10(-9) to 1 x 10(-3) mg/ml, the detection limit was 5 x 10(-10) mg/ml. The cross-reactivity of used antibodies to antigens of bacteria, causing similar diseases was evaluated. The conditions of immunosensor reuse by regeneration of its biosensing part were chosen. The developed immunosensor was probed on blood sera of patients suffering from urea tract diseases. PMID:15945356

  11. Complete Genome Sequence of a Klebsiella pneumoniae Strain Isolated from a Known Cotton Insect Boll Vector

    PubMed Central

    Forray, Marissa M.; Bell, Alois A.

    2014-01-01

    Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K.pneumoniae 5-1. This data provides guidance to study the bases of cotton pathogenesis by bacteria associated with vectors. PMID:25146146

  12. Thermotolerant non-fecal source Klebsiella pneumoniae: validity of the fecal coliform test in recreational waters.

    PubMed Central

    Caplenas, N R; Kanarek, M S

    1984-01-01

    Wisconsin pulp and paper mill processing plants were evaluated for fecal coliform and total Klebsiella (i.e., thermotolerant and thermointolerant) bacterial concentrations. Using the standard fecal coliform test, up to 90 per cent of non-fecal source thermotolerant K. pneumoniae was falsely identified as fecal source bacteria. Since there is a lack of specificity in the currently used standard for fecal coliform evaluation, a more reliable health risk assessment for fecal coliform bacteria is recommended. PMID:6388365

  13. Outbreak of Klebsiella pneumoniae Carbapenemase-2-Producing K. pneumoniae Sequence Type 11 in Taiwan in 2011

    PubMed Central

    Lee, Chun-Ming; Liao, Chun-Hsing; Lee, Wen-Sen; Liu, Yung-Ching; Hsueh, Po-Ren

    2012-01-01

    From June to September 2011, a total of 305 ertapenem-nonsusceptible Enterobacteriaceae isolates (MICs of ertapenem ? 1 ?g/ml) were collected from 11 hospitals in different parts of Taiwan. The MICs of 12 antimicrobial agents against these isolates were determined using the broth microdilution method, and genes for carbapenemases were detected using PCR. Genotypes of isolates possessing carbapenemase genes were identified by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing. The ertapenem-nonsusceptible Enterobacteriaceae isolates included Klebsiella pneumoniae (n = 219), Escherichia coli (n = 64), Enterobacter cloacae (n = 15), and other species (n = 7). Seven (2.3%) of the ertapenem-nonsusceptible Enterobacteriaceae isolates exhibited colistin MICs of >4 ?g/ml, and 24 (7.9%) were not susceptible to tigecycline (MICs > 2 ?g/ml). A total of 29 (9.5%) isolates carried genes encoding carbapenemases, namely, K. pneumoniae carbapenemase-2 (KPC-2) in 16 (7.3%) isolates of K. pneumoniae (KPC-2-KP) and IMP-8 in 5 (2.3%) isolates of K. pneumoniae, 5 (33.3%) isolates of E. cloacae, 1 isolate of E. coli, 1 isolate of Klebsiella oxytoca, and one isolate of Citrobacter freundii. The 16 KPC-2-KP isolates were isolated from patients at four different hospitals in northern Taiwan. All 16 of the KPC-2-KP isolates were susceptible to amikacin and colistin and had a similar pulsotype (pulsotype 1) and the same sequence type (sequence type 11). Infections due to KPC-2-KP mainly occurred in severely ill patients in the intensive care unit (n = 14, 88%). Four patients with infections due to KPC-2-KP died within 14 days of hospitalization. The findings are the first to demonstrate intrahospital and interhospital dissemination of KPC-2-KP in northern Taiwan. PMID:22802253

  14. Klebsiella pneumoniae triggers a cytotoxic effect on airway epithelial cells

    PubMed Central

    2009-01-01

    Background Klebsiella pneumoniae is a capsulated Gram negative bacterial pathogen and a frequent cause of nosocomial infections. Despite its clinical relevance, little is known about the features of the interaction between K. pneumoniae and lung epithelial cells on a cellular level, neither about the role of capsule polysaccharide, one of its best characterised virulence factors, in this interaction. Results The interaction between Klebsiella pneumoniae and cultured airway epithelial cells was analysed. K. pneumoniae infection triggered cytotoxicity, evident by cell rounding and detachment from the substrate. This effect required the presence of live bacteria and of capsule polysaccharide, since it was observed with isolates expressing different amounts of capsule and/or different serotypes but not with non-capsulated bacteria. Cytotoxicity was analysed by lactate dehydrogenase and formazan measurements, ethidium bromide uptake and analysis of DNA integrity, obtaining consistent and complementary results. Moreover, cytotoxicity of non-capsulated strains was restored by addition of purified capsule during infection. While a non-capsulated strain was avirulent in a mouse infection model, capsulated K. pneumoniae isolates displayed different degrees of virulence. Conclusion Our observations allocate a novel role to K. pneumoniae capsule in promotion of cytotoxicity. Although this effect is likely to be associated with virulence, strains expressing different capsule levels were not equally virulent. This fact suggests the existence of other bacterial requirements for virulence, together with capsule polysaccharide. PMID:19650888

  15. Klebsiella pneumoniae inoculants for enhancing plant growth

    SciTech Connect

    Triplett, Eric W.; Kaeppler, Shawn M.; Chelius, Marisa K.

    2008-07-01

    A biological inoculant for enhancing the growth of plants is disclosed. The inoculant includes the bacterial strains Herbaspirillum seropedicae 2A, Pantoea agglomerans P101, Pantoea agglomerans P102, Klebsiella pneumoniae 342, Klebsiella pneumoniae zmvsy, Herbaspirillum seropedicae Z152, Gluconacetobacter diazotrophicus PA15, with or without a carrier. The inoculant also includes strains of the bacterium Pantoea agglomerans and K. pneumoniae which are able to enhance the growth of cereal grasses. Also disclosed are the novel bacterial strains Herbaspirillum seropedicae 2A, Pantoea agglomerans P101 and P102, and Klebsiella pneumoniae 342 and zmvsy.

  16. Stability Analysis in a Model of 1,2-dichloroethane Biodegradation by Klebsiella Oxytoca va 8391Immobilized on Granulated Activated Carbon

    NASA Astrophysics Data System (ADS)

    Borisov, M.; Dimitrova, N.

    2011-11-01

    We consider an ecological model for biodegradation of toxic substances in aquatic and atmospheric biotic systems. The model, which is described by a nonlinear system of four ordinary differential equations, is known to be experimentally validated. We compute the equilibrium points of the model and study their asymptotic stability. The Maple package BifTools is used to calculate one- and two-parameter bifurcations of the equilibrium points.

  17. Klebsiella pneumoniae Liver Abscess and Metastatic Endophthalmitis

    PubMed Central

    Wells, Jason T.; Lewis, Catherine R.; Danner, Omar K.; Wilson, Kenneth L.; Matthews, L. Ray

    2015-01-01

    Introduction. Klebsiella pneumoniae is a well-known cause of liver abscess. Higher rates of liver abscess associated with Klebsiella pneumoniae are seen in Taiwan. Metastatic endophthalmitis is a common complication associated with a poor prognosis despite aggressive therapy. Case Report. We report a case of a 67-year-old Korean female with Klebsiella pneumoniae liver abscess. The patient developed metastatic endophthalmitis and ultimately succumbed to her disease despite aggressive medical and surgical treatment. Conclusion. Dissemination of Klebsiella pneumoniae is associated with significant morbidity and mortality. Liver abscesses preferably should be treated with percutaneous drainage, but surgical treatment is needed in some cases. Metastatic spread to the eye is a common complication that must be treated aggressively with intravenous antibiotics and surgical intervention if necessary. PMID:26788530

  18. Analysis of eight out genes in a cluster required for pectic enzyme secretion by Erwinia chrysanthemi: sequence comparison with secretion genes from other gram-negative bacteria.

    PubMed Central

    Lindeberg, M; Collmer, A

    1992-01-01

    Many extracellular proteins produced by Erwinia chrysanthemi require the out gene products for transport across the outer membrane. In a previous report (S. Y. He, M. Lindeberg, A. K. Chatterjee, and A. Collmer, Proc. Natl. Acad. Sci. USA 88:1079-1083, 1991) cosmid pCPP2006, sufficient for secretion of Erwinia chrysanthemi extracellular proteins by Escherichia coli, was partially sequenced, revealing four out genes sharing high homology with pulH through pulK from Klebsiella oxytoca. The nucleotide sequence of eight additional out genes reveals homology with pulC through pulG, pulL, pulM, pulO, and other genes involved in secretion by various gram-negative bacteria. Although signal sequences and hydrophobic regions are generally conserved between Pul and Out proteins, four out genes contain unique inserts, a pulN homolog is not present, and outO appears to be transcribed separately from outC through outM. The sequenced region was subcloned, and an additional 7.6-kb region upstream was identified as being required for secretion in E. coli. out gene homologs were found on Erwinia carotovora cosmid clone pAKC651 but were not detected in E. coli. The outC-through-outM operon is weakly induced by polygalacturonic acid and strongly expressed in the early stationary phase. The out and pul genes are highly similar in sequence, hydropathic properties, and overall arrangement but differ in both transcriptional organization and the nature of their induction. Images PMID:1429461

  19. [Detection of bla(CTX-M) beta-lactamase genes in extended-spectrum beta-lactamase producing gram-negative bacteria].

    PubMed

    Bayraktar, Banu; Toksoy, Buket; Bulut, Emin

    2010-04-01

    Widespread production of CTX-M type extended-spectrum beta-lactamases (ESBL) in Enterobacteriaceae strains which are resistant to extended-spectrum cephalosporins is the most remarkable example for rapid and global spread of plasmid mediated antimicrobial resistance in bacteria. Consecutive 200 ESBL producing Enterobacteriaceae strains out of 1640 isolates that were obtained from clinical samples (167 urine, 11 wound, 7 bronchoalveolar lavage, 3 peritoneal fluid, 2 cerebrospinal fluid, 2 biopsy, 2 tracheal aspirate, 2 conjunctiva, 1 abscess, 1 catheter) between February to July 2009 in our laboratory were included to this study. Among the 200 ESBL positive isolates 141 (70.5%) were Escherichia coli, 51 (26%) were Klebsiella pneumoniae, 5 (2.5%) were Enterobacter spp. and one of each (0.5%) Citrobacter freundii, Klebsiella oxytoca and Proteus mirabilis. ESBL positivity was 11% among the 123 community-acquired strains and 13% among the 77 hospital acquired strains, the statistical difference being insignificant (p > 0.05). The prevalence of bla(CTX-M) beta-lactamase genes were detected by multiplex polymerase chain reaction with the use of two general primer sets: CTX-MA1 and CTX-MA2 primers for the amplification of CTX-M-1, CTX-M-2 and CTX-M-9 enzymes group, and CTX825-F and CTX825-R primers for the amplification of CTX-M-8 and CTX-M-25 enzymes group. bla(CTX-M) genes were detected in 167 out of 200 strains (83.5%). CTX-M production rates in community and hospital acquired strains were found as 86.2% and 79.2%, respectively and no statistically significant difference was detected (p > 0.05). CTX-M producing strains were either E. coli (n = 132) or Klebsiella spp. (n = 35) and were expressing one of the enzymes from CTX-M-1, CTX-M-2 or CTX-M-9 groups. No strains carrying CTX-M-8 or CTX-M-25 group enzymes were detected. CTX-M production rates in ESBL producing E. coli strains in community and hospital were found as 92.5% and 95.7%, respectively, whereas the same rates for ESBL producing Klebsiella spp. strains were 67.8% and 66.7%. The difference between the CTX-M production rates of community and hospital acquired strains was not statistically significant (p > 0.05). In conclusion, CTX-M prevalence was found high in ESBL producing strains of both E. coli and Klebsiella spp. Since bla(CTX-M) gene acquisition usually results in the emergence of multiple drug-resistant Enterobacteriaceae strains, screening for CTX-M type ESBL production in the laboratory has an important impact on monitoring the resistant strains which have endemic potential. PMID:20549952

  20. A simple method for extracting C-phycocyanin from Spirulina platensis using Klebsiella pneumoniae.

    PubMed

    Zhu, Y; Chen, X B; Wang, K B; Li, Y X; Bai, K Z; Kuang, T Y; Ji, H B

    2007-02-01

    C-phycocyanin (C-PC) was extracted from fresh Spirulina platensis by deploying a species of non-pathogenic nitrogen-fixing bacteria, namely, Klebsiella pneumoniae. The algal slurry was neither washed nor centrifuged; the bacterial culture was poured into the slurry, the vessel sealed, and crude C-PC extracted after about 24 h. The extraction was clean and efficient, and the purity and concentration of C-PC proved to be of adequate quality. PMID:17013600

  1. Environmental persistence of OXA-48-producing Klebsiella pneumoniae in a French intensive care unit.

    PubMed

    Pantel, Alix; Richaud-Morel, Brigitte; Cazaban, Michel; Bouziges, Nicole; Sotto, Albert; Lavigne, Jean-Philippe

    2016-03-01

    The spread of carbapenemase-producing Gram-negative rods is an emerging global problem. This study describes the epidemiologic features of an outbreak caused by an environmental reservoir of OXA-48-producing Klebsiella pneumoniae caused by persistence of the bacteria during 20 months in an intensive care unit in France. This report emphasizes the importance of early environmental screening to interrupt the transmission of carbapenemase-producingEnterobacteriaceae. PMID:26521704

  2. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases

    PubMed Central

    Munoz-Price, L Silvia; Poirel, Laurent; Bonomo, Robert A; Schwaber, Mitchell J; Daikos, George L; Cormican, Martin; Cornaglia, Giuseppe; Garau, Javier; Gniadkowski, Marek; Hayden, Mary K; Kumarasamy, Karthikeyan; Livermore, David M; Maya, Juan J; Nordmann, Patrice; Patel, Jean B; Paterson, David L; Pitout, Johann; Villegas, Maria Virginia; Wang, Hui; Woodford, Neil; Quinn, John P

    2015-01-01

    Klebsiella pneumoniae carbapenemases (KPCs) were originally identified in the USA in 1996. Since then, these versatile β-lactamases have spread internationally among Gram-negative bacteria, especially K pneumoniae, although their precise epidemiology is diverse across countries and regions. The mortality described among patients infected with organisms positive for KPC is high, perhaps as a result of the limited antibiotic options remaining (often colistin, tigecycline, or aminoglycosides). Triple drug combinations using colistin, tigecycline, and imipenem have recently been associated with improved survival among patients with bacteraemia. In this Review, we summarise the epidemiology of KPCs across continents, and discuss issues around detection, present antibiotic options and those in development, treatment outcome and mortality, and infection control. In view of the limitations of present treatments and the paucity of new drugs in the pipeline, infection control must be our primary defence for now. PMID:23969216

  3. Biochemical and Structural Characterization of a Ureidoglycine Aminotransferase in the Klebsiella pneumoniae Uric Acid Catabolic Pathway

    SciTech Connect

    French, Jarrod B.; Ealick, Steven E.

    2010-09-03

    Many plants, fungi, and bacteria catabolize allantoin as a mechanism for nitrogen assimilation. Recent reports have shown that in plants and some bacteria the product of hydrolysis of allantoin by allantoinase is the unstable intermediate ureidoglycine. While this molecule can spontaneously decay, genetic analysis of some bacterial genomes indicates that an aminotransferase may be present in the pathway. Here we present evidence that Klebsiella pneumoniae HpxJ is an aminotransferase that preferentially converts ureidoglycine and an {alpha}-keto acid into oxalurate and the corresponding amino acid. We determined the crystal structure of HpxJ, allowing us to present an explanation for substrate specificity.

  4. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Klebsiella spp. serological reagents. 866.3340... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a) Identification. Klebsiella spp. serological reagents are devices...

  5. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Klebsiella spp. serological reagents. 866.3340... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a) Identification. Klebsiella spp. serological reagents are devices...

  6. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Klebsiella spp. serological reagents. 866.3340... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a) Identification. Klebsiella spp. serological reagents are devices...

  7. Spontaneous spondylodiscitis caused by Klebsiella pneumoniae.

    PubMed

    Kouroussis, C; Georgoulias, V; Souglakos, J; Simvoulakis, E; Karabekios, S; Samonis, G

    1999-01-01

    A rare case of spontaneous spondylodiscitis caused by Klebsiella pneumoniae in a 55-year-old man who presented with thoracolumbar pain is described. Increased erythrocyte sedimentation rate and C-reactive protein level were pertinent laboratory findings. Computed tomography revealed a paravertebral mass and destruction of the 10th and 11th vertebrae. Magnetic resonance imaging (MRI) showed spondylodiscitis in the same area. Culture of a biopsy sample from the mass grew Klebsiella pneumoniae, while histological examination confirmed the inflammation. A combination of ceftazidime, amikacin and ciprofloxacin resulted in disappearance of the pain. Two months later, MRI showed substantial improvement of the lesions. PMID:10624600

  8. Frequency of Klebsiella pneumoniae carbapenemase (KPC) and non-KPC-producing Klebsiella contamination of Healthcare workers and the environment

    PubMed Central

    Rock, Clare; Thom, Kerri A.; Masnick, Max; Johnson, J. Kristie; Harris, Anthony D.; Morgan, Daniel J

    2014-01-01

    We examined contamination of healthcare worker (HCW) gown and gloves after caring for patients with Klebsiella Producing Carbapenemase-producing and non-KPC-producing Klebsiella as a proxy for horizontal transmission. Contamination rate with Klebsiella is similar to MRSA and VRE, with 14% (31/220) of HCW-patient interactions resulting in contamination of gloves and gowns. PMID:24602950

  9. Primary Klebsiella identification with MacConkey-inositol-carbenicillin agar.

    PubMed Central

    Bagley, S T; Seidler, R J

    1978-01-01

    MacConkey-inositol-carbenicillin agar has successfully been used as a primary selective medium for Klebsiella enumeration. With pure cultures, nearly 100% recovery of Klebsiella was observed by membrane filtration. With environmental samples using membrane filtration, 95% of typical pink- to red-colored colonies were verified as Klebsiella, as opposed to only 1% of yellow background colonies. Recovery of Klebsiella on MacConkey-inositol-carbenicillin agar was as good or better than on mEndo agar LES (Difco Laboratories). Recovery and percent colony confirmation with MacConkey-inositol-carbenicillin agar were greater than for other proposed Klebsiella selective media. PMID:365108

  10. No carbapenem resistance in pneumonia caused by Klebsiella species.

    PubMed

    Yayan, Josef; Ghebremedhin, Beniam; Rasche, Kurt

    2015-02-01

    Klebsiella species are a common cause of community- and nosocomial-acquired pneumonia. Antibiotic resistance to the class of carbapenem in patients with pneumonia caused by Klebsiella species is unusual. New studies report carbapenem resistance in patients with pneumonia caused by Klebsiella species.This article examines, retrospectively, antibiotic resistance in patients with community- and nosocomial-acquired pneumonia caused by Klebsiella species.The data of all patients with community- and nosocomial-acquired pneumonia caused by Klebsiella species were collected from the hospital charts at the HELIOS Clinic, Witten/Herdecke University, Wuppertal, Germany, within the study period 2004 to 2014. An antibiogram was created from all of the study patients with pneumonia caused by Klebsiella species. Sensitivity and resistance profiles were performed for the different antibiotics that have been consistently used in the treatment of patients with pneumonia caused by Klebsiella species. All demographic, clinical, and laboratory data of all of the patients with pneumonia caused by Klebsiella species were collected from the patients' records.During the study period of January 1, 2004, to August 12, 2014, 149 patients were identified with community- and nosocomial-acquired pneumonia affected by Klebsiella species. These patients had a mean age of 70.6??13 (107 [71.8%, 95% CI 64.6%-79%] men and 42 [28.2%, 95% CI 21%-35.4%] women). In all of the patients with pneumonia caused by Klebsiella species, there was resistance to ampicillin (P?Klebsiella species (75.3%) also showed resistance to piperacillin (P?Klebsiella species showed resistance to imipenem or meropenem (P?Klebsiella species. PMID:25674753

  11. No Carbapenem Resistance in Pneumonia Caused by Klebsiella Species

    PubMed Central

    Yayan, Josef; Ghebremedhin, Beniam; Rasche, Kurt

    2015-01-01

    Abstract Klebsiella species are a common cause of community- and nosocomial-acquired pneumonia. Antibiotic resistance to the class of carbapenem in patients with pneumonia caused by Klebsiella species is unusual. New studies report carbapenem resistance in patients with pneumonia caused by Klebsiella species. This article examines, retrospectively, antibiotic resistance in patients with community- and nosocomial-acquired pneumonia caused by Klebsiella species. The data of all patients with community- and nosocomial-acquired pneumonia caused by Klebsiella species were collected from the hospital charts at the HELIOS Clinic, Witten/Herdecke University, Wuppertal, Germany, within the study period 2004 to 2014. An antibiogram was created from all of the study patients with pneumonia caused by Klebsiella species. Sensitivity and resistance profiles were performed for the different antibiotics that have been consistently used in the treatment of patients with pneumonia caused by Klebsiella species. All demographic, clinical, and laboratory data of all of the patients with pneumonia caused by Klebsiella species were collected from the patients records. During the study period of January 1, 2004, to August 12, 2014, 149 patients were identified with community- and nosocomial-acquired pneumonia affected by Klebsiella species. These patients had a mean age of 70.6??13 (107 [71.8%, 95% CI 64.6%79%] men and 42 [28.2%, 95% CI 21%35.4%] women). In all of the patients with pneumonia caused by Klebsiella species, there was resistance to ampicillin (P?Klebsiella species (75.3%) also showed resistance to piperacillin (P?Klebsiella species showed resistance to imipenem or meropenem (P?Klebsiella species. PMID:25674753

  12. Klebsiella pneumoniae in orange juice concentrate.

    PubMed Central

    Fuentes, F A; Hazen, T C; Lpez-Torres, A J; Rechani, P

    1985-01-01

    Fecal coliform-positive, capsule-forming Klebsiella pneumoniae cells were observed in high densities (10(4) to 10(8) CFU/100 ml) in two commercial batches of frozen orange juice concentrate at a cannery in Puerto Rico. Contamination of both lots was gross and included off colors and odors. Isolates of K. pneumoniae from these concentrates revealed growth at 4, 25, and 34 degrees C with generation times from 0.39 to 1.84 h. PMID:3893321

  13. Klebsiella pneumoniae in orange juice concentrate.

    PubMed

    Fuentes, F A; Hazen, T C; Lpez-Torres, A J; Rechani, P

    1985-06-01

    Fecal coliform-positive, capsule-forming Klebsiella pneumoniae cells were observed in high densities (10(4) to 10(8) CFU/100 ml) in two commercial batches of frozen orange juice concentrate at a cannery in Puerto Rico. Contamination of both lots was gross and included off colors and odors. Isolates of K. pneumoniae from these concentrates revealed growth at 4, 25, and 34 degrees C with generation times from 0.39 to 1.84 h. PMID:3893321

  14. [Construction of polyhydroxybutyrate pathway in Klebsiella pneumoniae].

    PubMed

    Guo, Xiaochen; Liu, Hongjuan; Wang, Yanping; Zhang, Jian'an; Liu, Dehua

    2013-10-01

    1,3-propanediol production with the byproduct of biodiesel production is important to increase the economic benefit of biodiesel industry. Accumulation of 3-hydroxypropionaldehyde is one of the key problems in the 1,3-propanediol fermentation process, leading to the cell death and the fermentation abnormal ceasing. Different from the traditional way of reducing the accumulation of the 3-hydroxypropionaldehyde, we introduced the polyhydroxybutyrate pathway into the Klebsiella pneumoniae for the first time to enhance the tolerance of K. pneumoniae to 3-hydroxypropionaldehyde, at the same time, to improve the 1,3-propanediol production. Plasmid pDK containing phbC, phbA, phbB gene was constructed and transformed into K. pneumoniae successfully. PHB was detected in the engineered K. pneumoniae after IPTG induction and its content enhanced with the IPTG concentration increasing. The optimized IPTG concentration was 0.5 mmol/L. The constructed K. pneumoniae could produce 1,3-propanediol normally, at the same time accumulate polyhydroxybutyrate. With the constructed strain, the fermentation proceeds normally with the initial glucose was 70 g/L which the wild type strain stopped growing and the fermentation was ceasing; 1,3-propanediol concentration and yield reached 31.3 g/L and 43.9% at 72 h. Our work is helpful for the deep understanding of 1,3-propanediol metabolic mechanism of Klebsiella pneumoniae, and also provides a new way for strain optimization of Klebsiella pneumoniae. PMID:24432665

  15. Plasmid-Mediated Antibiotic Resistance and Virulence in Gram-negatives: the Klebsiella pneumoniae Paradigm

    PubMed Central

    Ramirez, Maria S.; Traglia, German M.; Lin, David L.; Tran, Tung; Tolmasky, Marcelo E.

    2015-01-01

    Summary Plasmids harbor genes coding for specific functions including virulence factors and antibiotic resistance that permit bacteria to survive the hostile environment found in the host and resist treatment. Together with other genetic elements such as integrons and transposons, and using a variety of mechanisms, plasmids participate in the dissemination of these traits resulting in the virtual elimination of barriers among different kinds of bacteria. In this article we review the current information about physiology and role in virulence and antibiotic resistance of plasmids from the gram-negative opportunistic pathogen Klebsiella pneumoniae. This bacterium has acquired multidrug resistance and is the causative agent of serious communityand hospital-acquired infections. It is also included in the recently defined ESKAPE group of bacteria that cause most of US hospital infections. PMID:25705573

  16. Fermentation of D-xylose to ethanol by genetically modified Klebsiella planticola

    SciTech Connect

    Tolan, J.S.; Finn, R.K.

    1987-09-01

    D-Xylose is a plentiful pentose sugar derived from agricultural or forest residues. Enteric bacteria such as Klebsiella spp. ferment D-xylose to form mixed acids and butanediol in addition to ethanol. Thus, the ethanol yield is normally low. This report describes the fermentation of D-xylose by Klebsiella planticola ATCC 33531 bearing multicopy plasmids containing the pdc gene inserted from Zymomonas mobilis. Expression of the gene markedly increased the yield of ethanol to 1.3 mol/mol of xylose, or 25.1 g/liter. Concurrently, there were significant decreases in the yields of formate, acetate, lactate, and butanediol. Transconjugant Klebsiella spp. grew almost as fast as the wild type and tolerated up to 4% ethanol. The plasmid was retained by the cells during at least one batch culture, even in the absence of selective pressure by antibiotics to maintain the plasmid. Ethanol production was 31.6 g/liter from 79.6 g of mixed substrate per liter chosen to simulate hydrolyzed hemicellulose. The physiology of the wild-type of K. planticola is described in more detail than in the original report of its isolation.

  17. Instant Typing Is Essential to Detect Transmission of Extended-Spectrum Beta-Lactamase-Producing Klebsiella Species

    PubMed Central

    Voor in 't holt, Anne F.; Severin, Juliëtte A.; Goessens, Wil H. F.; te Witt, René; Vos, Margreet C.

    2015-01-01

    Background Infections with multidrug-resistant (MDR) microorganisms are an increasing threat to hospitalized patients. Although rapid typing of MDR microorganisms is required to apply targeted prevention measures, technical barriers often prevent this. We aimed to assess whether extended-spectrum beta-lactamase (ESBL)-producing Klebsiella species are transmitted between patients and whether routine, rapid typing is needed. Methods For 43 months, the clonality of all ESBL-producing Klebsiella isolates from patients admitted to Erasmus MC University Medical Center in Rotterdam, the Netherlands was assessed with Raman spectroscopy. A cluster was defined as n ≥2 patients who had identical isolates. Primary patients were the first patients in each cluster. Secondary patients were those identified with an isolate clonally related to the isolate of the primary patient. Results Isolates from 132 patients were analyzed. We identified 17 clusters, with 17 primary and 56 secondary patients. Fifty-nine patients had a unique isolate. Patients (n = 15) in four out of the 17 clusters were epidemiologically related. Ten of these 15 patients developed an infection. Conclusions Clonal outbreaks of ESBL-producing Klebsiella species were detected in our hospital. Theoretically, after Raman spectroscopy had detected a cluster of n ≥2, six infections in secondary patients could have been prevented. These findings demonstrate that spread of ESBL-producing Klebsiella species occurs, even in a non-outbreak setting, and underscore the need for routine rapid typing of these MDR bacteria. PMID:26317428

  18. OCCURRENCE, SIGNIFICANCE, AND DETECTION OF 'KLEBSIELLA' IN WATER SYSTEMS

    EPA Science Inventory

    Widespread occurrences of Klebsiella in water distribution networks have resulted in much discussion about the organism's effect on public health and about action that should be taken when Klebsiella is detected in public water supplies. Results obtained during development and te...

  19. Unusual presentation of primary klebsiella meningitis: successful treatment with cefotaxime.

    PubMed Central

    Sandyk, R.; Brennan, M. J.

    1983-01-01

    A man who presented with lumbar backache subsequently developed signs of meningitis. The causative organism was proved to be Klebsiella pneumoniae. Despite treatment with chloramphenicol and amikacin, the condition progressed until cefotaxime was added to the treatment regimen. The patient made a good recovery. This is the first report of the use of cefotaxime in klebsiella meningitis. PMID:6306628

  20. Normal anti-Klebsiella lymphocytotoxicity in ankylosing spondylitis

    SciTech Connect

    Kinsella, T.D.; Fritzler, M.J.; Lewkonia, R.M.

    1986-03-01

    We compared in vitro lymphocytotoxicity (LCT) of peripheral blood lymphocytes (PBL), obtained from patients with ankylosing spondylitis (AS) and normal controls (NC). Assays were performed with antibacterial antisera prepared from AS- and NC-derived Klebsiella and coliforms Escherichia coli. LCT assessed by eosin staining was not significantly different in PBL of 12 AS patients and 28 controls when reacted with 3 Klebsiella and 1 E coli antisera. LCT assessed by /sup 51/Cr release was not significantly different for PBL of 20 age- and sex-matched pairs of AS patients and NC when reacted with 3 Klebsiella and 1 E coli antisera. Similarly, LCT-/sup 51/Cr of PBL of 15 matched AS and NC pairs was not significantly different for anti-K21, a serotype putatively implicated in Klebsiella-HLA-B27 antigenic cross-reactivity. Our results do not support the notion of molecular mimicry between Klebsiella and B27 in the pathogenesis of primary AS.

  1. Description of Klebsiella quasipneumoniae sp. nov., isolated from human infections, with two subspecies, Klebsiella quasipneumoniae subsp. quasipneumoniae subsp. nov. and Klebsiella quasipneumoniae subsp. similipneumoniae subsp. nov., and demonstration that Klebsiella singaporensis is a junior heterotypic synonym of Klebsiella variicola.

    PubMed

    Brisse, Sylvain; Passet, Virginie; Grimont, Patrick A D

    2014-09-01

    Strains previously classified as members of Klebsiella pneumoniae phylogroups KpI, KpII-A, KpII-B and KpIII were characterized by 16S rRNA (rrs) gene sequencing, multilocus sequence analysis based on rpoB, fusA, gapA, gyrA and leuS genes, average nucleotide identity and biochemical characteristics. Phylogenetic analysis demonstrated that KpI and KpIII corresponded to K. pneumoniae and Klebsiella variicola, respectively, whereas KpII-A and KpII-B formed two well-demarcated sequence clusters distinct from other members of the genus Klebsiella. Average nucleotide identity between KpII-A and KpII-B was 96.4?%, whereas values lower than 94?% were obtained for both groups when compared with K. pneumoniae and K. variicola. Biochemical properties differentiated KpII-A, KpII-B, K. pneumoniae and K. variicola, with acid production from adonitol and l-sorbose and ability to use 3-phenylproprionate, 5-keto-d-gluconate and tricarballylic acid as sole carbon sources being particularly useful. Based on their genetic and phenotypic characteristics, we propose the names Klebsiella quasipneumoniae subsp. quasipneumoniae subsp. nov. and K. quasipneumoniae subsp. similipneumoniae subsp. nov. for strains of KpII-A and KpII-B, respectively. The type strain of K. quasipneumoniae sp. nov. and of K. quasipneumoniae subsp. quasipneumoniae subsp. nov. is 01A030(T) (?=?SB11(T)?=?CIP 110771(T)?=?DSM 28211(T)). The type strain of K. quasipneumoniae subsp. similipneumoniae subsp. nov. is 07A044(T) (?=?SB30(T)?=?CIP 110770(T)?=?DSM 28212(T)). Both strains were isolated from human blood cultures. This work also showed that Klebsiella singaporensis is a junior heterotypic synonym of K. variicola. PMID:24958762

  2. Antibiotic resistance among coliform bacteria isolated from carcasses of commercially slaughtered chickens.

    PubMed

    Turtura, G C; Massa, S; Ghazvinizadeh, H

    1990-12-01

    A total of 322 coliform bacteria Escherichia coli, Enterobacter spp., Citrobacter spp., Klebsiella spp. and Serratia spp., were isolated from 50 carcasses of commercially slaughtered chickens. Their resistance to ampicillin, tetracycline, gentamicin, chloramphenicol, cephalotine, cotrimoxazole, nalidixic acid and nitrofurantoin, were determined. The most commonly found resistance was to tetracycline followed by cephalotine, cotrimoxazole and nalidixic acid. A large percentage of E. coli (41%) and Klebsiella spp. (38%) showed multiple antibiotic resistance. PMID:2282290

  3. Translocatable resistance to mercuric and phenylmercuric ions in soil bacteria

    SciTech Connect

    Radford, A.J.; Oliver, J.; Kelly, W.J.; Reaney, D.C.

    1981-08-01

    Of a sample of 42 grams-negative Hg-resistant bacteria, three (a Pseudomonas fluorescens, a Klebsiella sp. and a Citrobacter sp.) contained translocatable elements conferring resistance to Hgbj (all three) and to Hgbj and phenylmercuric acetate (P. fluorescens). The discovery of transposable phenylmercuric acetate resistance extends the range of known resistance ''transposons'' from heavy metals and antibiotics to organometallic compounds.

  4. Effects of prevalent freshwater chemical contaminants on in vitro growth of Escherichia coli and Klebsiella pneumoniae.

    PubMed

    Higgins, James; Hohn, Christina

    2008-03-01

    Many surface and ground waters in the continental US are contaminated with a variety of chemical pollutants, which are usually present in concentrations in the ppm and ppb range. The effects of these pollutants on coliform bacteria, which are prominent members of the aquatic flora, are poorly understood. Using a microtiter plate assay, isolates of Escherichia coli (from chicken intestine and fresh water), and an isolate of Klebsiella pneumoniae (from bovine milk) were exposed to varying concentrations of common pollutants over a 24 h period. The herbicides/pesticides simazine, atrazine, and diazinon; the VOCs trichloroethene and MTBE; the estrogens estradiol and estrone; and caffeine, all failed to inhibit bacterial growth at ppm levels. Only ethylene glycol, and the herbicide 2,4-D, significantly inhibited bacterial growth compared to controls. These results suggest that the replication of coliform bacteria in fresh waters is not adversely impacted by many common pollutants. PMID:17681655

  5. Genomic and Functional Characterization of qnr-Encoding Plasmids from Municipal Wastewater Biosolid Klebsiella pneumoniae Isolates.

    PubMed

    Kaplan, Ella; Sela, Noa; Doron-Faigenboim, Adi; Navon-Venezia, Shiri; Jurkevitch, Edouard; Cytryn, Eddie

    2015-01-01

    Municipal wastewater treatment facilities are considered to be "hotspots" for antibiotic resistance, since they conjoin high densities of environmental and fecal bacteria with selective pressure in the form of sub-therapeutic concentrations of antibiotics. Discharged effluents and biosolids from these facilities can disseminate antibiotic resistant genes to terrestrial and aquatic environments, potentially contributing to the increasing global trend in antibiotic resistance. This phenomenon is especially pertinent when resistance genes are associated with mobile genetic elements such as conjugative plasmids, which can be transferred between bacterial phyla. Fluoroquinolones are among the most abundant antibiotic compounds detected in wastewater treatment facilities, especially in biosolids, where due to their hydrophobic properties they accumulate to concentrations that may exceed 40 mg/L. Although fluoroquinolone resistance is traditionally associated with mutations in the gyrA/topoisomerase IV genes, there is increasing evidence of plasmid-mediated quinolone resistance, which is primarily encoded on qnr genes. In this study, we sequenced seven qnr-harboring plasmids from a diverse collection of Klebsiella strains, isolated from dewatered biosolids from a large wastewater treatment facility in Israel. One of the plasmids, termed pKPSH-11XL was a large (185.4 kbp), multi-drug resistance, IncF-type plasmid that harbored qnrB and 10 additional antibiotic resistance genes that conferred resistance to five different antibiotic families. It was highly similar to the pKPN3-like plasmid family that has been detected in multidrug resistant clinical Klebsiella isolates. In contrast, the six additional plasmids were much smaller (7-9 Kbp) and harbored a qnrS -type gene. These plasmids were highly similar to each other and closely resembled pGNB2, a plasmid isolated from a German wastewater treatment facility. Comparative genome analyses of pKPSH-11XL and other pKPN3-like plasmids concomitant to phylogenetic analysis of housekeeping genes from host Klebsiella strains, revealed that these plasmids are limited to a predominantly human-associated sub-clade of Klebsiella, suggesting that their host range is very narrow. Conversely, the pGNB2-like plasmids had a much broader host range and appeared to be associated with Klebsiella residing in natural environments. This study suggests that: (A) qnrB-harboring multidrug-resistant pKPN3-like plasmids can endure the rigorous wastewater treatment process and may therefore be disseminated to downstream environments; and (B) that small qnrS-harboring pGNB2-like plasmids are ubiquitous in wastewater treatment facilities and are most likely environmental in origin. PMID:26696974

  6. Genomic and Functional Characterization of qnr-Encoding Plasmids from Municipal Wastewater Biosolid Klebsiella pneumoniae Isolates

    PubMed Central

    Kaplan, Ella; Sela, Noa; Doron-Faigenboim, Adi; Navon-Venezia, Shiri; Jurkevitch, Edouard; Cytryn, Eddie

    2015-01-01

    Municipal wastewater treatment facilities are considered to be “hotspots” for antibiotic resistance, since they conjoin high densities of environmental and fecal bacteria with selective pressure in the form of sub-therapeutic concentrations of antibiotics. Discharged effluents and biosolids from these facilities can disseminate antibiotic resistant genes to terrestrial and aquatic environments, potentially contributing to the increasing global trend in antibiotic resistance. This phenomenon is especially pertinent when resistance genes are associated with mobile genetic elements such as conjugative plasmids, which can be transferred between bacterial phyla. Fluoroquinolones are among the most abundant antibiotic compounds detected in wastewater treatment facilities, especially in biosolids, where due to their hydrophobic properties they accumulate to concentrations that may exceed 40 mg/L. Although fluoroquinolone resistance is traditionally associated with mutations in the gyrA/topoisomerase IV genes, there is increasing evidence of plasmid-mediated quinolone resistance, which is primarily encoded on qnr genes. In this study, we sequenced seven qnr-harboring plasmids from a diverse collection of Klebsiella strains, isolated from dewatered biosolids from a large wastewater treatment facility in Israel. One of the plasmids, termed pKPSH-11XL was a large (185.4 kbp), multi-drug resistance, IncF-type plasmid that harbored qnrB and 10 additional antibiotic resistance genes that conferred resistance to five different antibiotic families. It was highly similar to the pKPN3-like plasmid family that has been detected in multidrug resistant clinical Klebsiella isolates. In contrast, the six additional plasmids were much smaller (7–9 Kbp) and harbored a qnrS -type gene. These plasmids were highly similar to each other and closely resembled pGNB2, a plasmid isolated from a German wastewater treatment facility. Comparative genome analyses of pKPSH-11XL and other pKPN3-like plasmids concomitant to phylogenetic analysis of housekeeping genes from host Klebsiella strains, revealed that these plasmids are limited to a predominantly human-associated sub-clade of Klebsiella, suggesting that their host range is very narrow. Conversely, the pGNB2-like plasmids had a much broader host range and appeared to be associated with Klebsiella residing in natural environments. This study suggests that: (A) qnrB-harboring multidrug-resistant pKPN3-like plasmids can endure the rigorous wastewater treatment process and may therefore be disseminated to downstream environments; and (B) that small qnrS-harboring pGNB2-like plasmids are ubiquitous in wastewater treatment facilities and are most likely environmental in origin. PMID:26696974

  7. Confronting carbapenemase-producing Klebsiella pneumoniae.

    PubMed

    Markogiannakis, Antonis; Tzouvelekis, Leonidas S; Psichogiou, Mina; Petinaki, Efi; Daikos, George L

    2013-09-01

    The ongoing spread of carbapenemase-producing (CP) multidrug-resistant enterobacteria, primarily Klebsiella pneumoniae, has undoubtedly caused a public health crisis of unprecedented dimensions. The scientific community has been struggling with these highly problematic nosocomial pathogens for more than a decade. Faced with the current situation, one cannot help but wish we could have done better, earlier. However, significant steps have been and are currently being made towards a better understanding of transmission routes of CP microorganisms and in designing strategies that could effectively curb this devastating epidemic. Most importantly, the systematic evaluation of accumulating experimental and clinical data has paved the way to a more rational management of CP-infected patients. In addition, systematic efforts of the industry have led to the development of novel antibacterial agents that are active against CP strains and expected to be introduced to clinical practice in the immediate future. PMID:24020742

  8. Two distinct sensing pathways allow recognition of Klebsiella pneumoniae by Dictyostelium amoebae

    PubMed Central

    Lima, Wanessa C; Balestrino, Damien; Forestier, Christiane; Cosson, Pierre

    2013-01-01

    Summary Recognition of bacteria by metazoans is mediated by receptors that recognize different types of microorganisms and elicit specific cellular responses. The soil amoebae Dictyostelium discoideum feeds upon a variable mixture of environmental bacteria, and it is expected to recognize and adapt to various food sources. To date, however, no bacteria-sensing mechanisms have been described. In this study, we isolated a Dictyostelium mutant (fspA KO) unable to grow in the presence of non-capsulated Klebsiella pneumoniae bacteria, but growing as efficiently as wild-type cells in the presence of other bacteria, such as Bacillus subtilis. fspA KO cells were also unable to respond to K. pneumoniae and more specifically to bacterially secreted folate in a chemokinetic assay, while they responded readily to B. subtilis. Remarkably, both WT and fspA KO cells were able to grow in the presence of capsulated LM21 K. pneumoniae, and responded to purified capsule, indicating that capsule recognition may represent an alternative, FspA-independent mechanism for K. pneumoniae sensing. When LM21 capsule synthesis genes were deleted, growth and chemokinetic response were lost for fspA KO cells, but not for WT cells. Altogether, these results indicate that Dictyostelium amoebae use specific recognition mechanisms to respond to different K. pneumoniae elements. PMID:24128258

  9. Binding to and Opsonophagocytic Activity of O-Antigen-Specific Monoclonal Antibodies against Encapsulated and Nonencapsulated Klebsiella pneumoniae Serotype O1 Strains

    PubMed Central

    Held, Thomas K.; Jendrike, Nina R. M.; Rukavina, Tomislav; Podschun, Rainer; Trautmann, Matthias

    2000-01-01

    The high mortality of nosocomial infections caused by Klebsiella spp. has acted as a stimulus to develop immunotherapeutic approaches targeted against surface molecules of these bacteria. Since O-antigen-specific antibodies may add to the protective effect of K antisera, we tested the functional and binding capacity of O-antigen-specific monoclonal antibodies (MAbs) raised against different Klebsiella O antigens. The MAbs tested were specific for the O-polysaccharide partial antigens d-galactan II (MAb Ru-O1), d-galactan I (MAb IV/4-5), or core oligosaccharide (MAb V/9-5) of the Klebsiella serogroup O1 antigen. In enzyme-linked immunosorbent assay binding experiments, we found that all MAbs recognized their epitopes on intact capsule-free bacteria; however, binding to encapsulated wild-type strains belonging to different K-antigen serotypes was significantly reduced. The K2 antigen acted as the strongest penetration barrier, while the K7 and K21 antigens allowed some, though diminished, antibody binding. In vitro phagocytic killing experiments showed that MAb Ru-O1 possessed significant opsonizing activity for nonencapsulated O1 serogroup strains and also, to a much lesser extent, for encapsulated strains belonging to the O1:K7 and O1:K21 serotypes. MAbs or antisera specific for the d-galactan II antigen may thus be the most promising agents for further efforts to develop a second-generation Klebsiella hyperimmune globulin comprising both K- and O-antigen specificities. PMID:10768923

  10. Extended-spectrum-beta-lactamases, AmpC beta-lactamases and plasmid mediated quinolone resistance in klebsiella spp. from companion animals in Italy.

    PubMed

    Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

    2014-01-01

    We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6')-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6')-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6')-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission between pets and humans, especially at household level. PMID:24595207

  11. Extended-Spectrum-Beta-Lactamases, AmpC Beta-Lactamases and Plasmid Mediated Quinolone Resistance in Klebsiella spp. from Companion Animals in Italy

    PubMed Central

    Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S.; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

    2014-01-01

    We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6′)-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6′)-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6′)-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission between pets and humans, especially at household level. PMID:24595207

  12. Klebsiella pneumoniae Infection: A Virulent Cause of Visual Loss

    PubMed Central

    Soon, Wai Cheong; Pouncey, Anna; Ashley, Elizabeth; Bowen, Elizabeth Frances

    2014-01-01

    Bacterial endophthalmitis is endogenous in 2–6% of cases and is frequently misdiagnosed initially. Klebsiella pneumoniae is being increasingly recognised as an aggressive causative organism, and it is particularly prevalent in Asian populations. We describe the case of a 71-year-old female of Southeast Asian origin with type 2 diabetes mellitus who presented with visual loss secondary to bacterial endophthalmitis and concomitant cerebral abscesses. Imaging revealed the probable primary source of infection to be a liver abscess. She developed retinal detachment and subsequently underwent an evisceration of her right eye. A Klebsiella spp. was identified from the eye tissue by 16S rRNA amplification. Klebsiella pneumoniae endophthalmitis has a characteristic disease phenotype and a particularly aggressive course with poor visual outcomes observed in most cases. This case highlights the risks of metastatic infection including bacterial endophthalmitis in association with Klebsiella infection. PMID:25606041

  13. A mimicry of melioidosis by Klebsiella ozaenae infection.

    PubMed

    Ng, T H; How, S H; Kuan, Y C; Adzura; Aziz, A A; Fauzi, A R

    2009-12-01

    Klebsiella ozaenae is a Gram negative bacillus. It has been described as a colonizer of oral and nasopharyngeal mucosa and is a cause of atrophic rhinitis. Klebsiella ozaenae has seldom been isolated from serious infections. However, several reports have stated that Klebsiella ozaenae may cause invasive infections and even mortality. We report a 55-year-old man with Klebsiella ozaenae infection causing abscesses involving the right eye and left kidney and possibly also in the brain, lungs and prostate. The isolates were sensitive to ceftazidime, ciprofloxacin, chloramphenicol, gentamicin and sulfamethoxazole-trimethoprim but resistant to ampicillin. He responded well to 4 weeks of i.v. ceftazidime and i.v. amoxycillin-clavulanic acid. To our knowledge, such a multiorgan infection has not been reported previously for this organism. PMID:20514860

  14. 'KLEBSIELLA' DENSITIES IN WATERS RECEIVING WOOD PULP EFFLUENTS

    EPA Science Inventory

    Surface waters receiving pulp mill effluents were examined for the presence of total coliforms, fecal coliforms, and Salmonella species. Fecal coliforms were biochemically identified as belonging to the Escherichia, Klebsiella or Enterobacter genera. Sixty percent of the isolates...

  15. CHARACTERISTICS OF KLEBSIELLA FROM TEXTILE FINISHING PLANT EFFLUENTS

    EPA Science Inventory

    Klebsiella strains are found in abnormally high numbers in a stream receiving wastewater from a textile finishing plant. Representative strains are randomly selected to determine biochemical, serotype, and virulence patterns. All strains conform to the commonly accepted biochemic...

  16. Acriflavine violet red bile agar for the isolation of Klebsiella.

    PubMed

    Fung, D Y; Niemiec, M

    1977-10-01

    A medium for the isolation and detection of Klebsiella is described. It contains 0.06% Acriflavine in Violet Red Bile agar (Difco). Klebsiella appeared as 5 to 7 mm mucoid (24 h at 37 degrees C) golden-yellow colonies. Pseudomonas aeruginosa and Enterobacter spp. appeared as small, brown to dark brown colonies. Escherichia coli as well as many other gram negative organisms and gram positive organisms did not grow on this medium. PMID:334697

  17. Clinical and microbiological characteristics of tigecycline non-susceptible Klebsiella pneumoniae bacteremia in Taiwan

    PubMed Central

    2014-01-01

    Background Resistance among Klebsiella pneumoniae to most antibiotics is on the rise. Tigecycline has been considered as one of the few therapeutic options available to treat multidrug-resistant bacteria. We investigated the clinical and microbiological characteristics of tigecycline non-susceptible K. pneumoniae bacteremia. Methods Adult patients with tigecycline non-susceptible K. pneumoniae bacteremia at a medical center in Taiwan over a 3-year period were enrolled. K. pneumoniae isolates were identified by the E-test using criteria set by the US Food and Drug Administration (FDA). Data on the clinical features of patients were collected from medical records. Genes for ?-lactamases, antimicrobial susceptibilities and pulsed-field gel electrophoresis (PFGE) results were determined for all isolates. Results Of 36 patients, 27 had nosocomial bacteremia. Overall 28-day mortality was 38.9%. The MIC50 and MIC90 of tigecycline were 6 and 8mg/L, respectively. No carbapenemase was detected among the 36 isolates. Twenty isolates carried extended spectrum ?-lactamases and/or DHA-1 genes. No major cluster of isolates was found among the 36 isolates by PFGE. Intensive care unit onset of tigecycline non-susceptible Klebsiella pneumoniae bacteremia was the only independent risk factor for 28-day mortality. Conclusions The high mortality of patients with tigecycline non-susceptible K. pneumoniae bacteremia may suggest a critical problem. Further study to identify the possible risk factors for its development and further investigation of this type of bacteremia is necessary. PMID:24380631

  18. Genomic identification of nitrogen-fixing Klebsiella variicola, K. pneumoniae and K. quasipneumoniae.

    PubMed

    Chen, Mingyue; Li, Yuanyuan; Li, Shuying; Tang, Lie; Zheng, Jingwu; An, Qianli

    2016-01-01

    It was difficult to differentiate Klebsiella pneumoniae, K. quasipneumoniae and K. variicola by biochemical and phenotypic tests. Genomics increase the resolution and credibility of taxonomy for closely-related species. Here, we obtained the complete genome sequence of the K. variicola type strain DSM 15968(T) (=F2R9(T) ). The genome of the type strain is a circular chromosome of 5,521,203?bp with 57.56% GC content. From 540 Klebsiella strains whose genomes had been publicly available as at 3 March 2015, we identified 21 strains belonging to K. variicola and 8 strains belonging to K. quasipneumoniae based on the genome average nucleotide identities (ANI). All the K. variicola strains, one K. pneumoniae strain and five K. quasipneumoniae strains contained nitrogen-fixing genes. A phylogenomic analysis showed clear species demarcations for these nitrogen-fixing bacteria. In accordance with the key biochemical characteristics of K. variicola, the idnO gene encoding 5-keto-D-gluconate 5-reductase for utilization of 5-keto-D-gluconate and the sorCDFBAME operon for catabolism of L-sorbose were present whereas the rbtRDKT operon for catabolism of adonitol was absent in the genomes of K. variicola strains. Therefore, the genomic analyses supported the ANI-based species delineation; the genome sequence of the K. variicola type strain provides the reference genome for genomic identification of K. variicola, which is a nitrogen-fixing species. PMID:26471769

  19. Biofilm formation and Klebsiella pneumoniae liver abscess

    PubMed Central

    Fierer, Joshua

    2012-01-01

    Klebsiella pneumoniae liver abscess is an emerging infectious disease. This syndrome was unknown before the late 1980s when it was first recognized in Taiwan. Over the next two decades it increased in prevalence in Taiwan and was reported from other nations of East Asia. It was then that the rest of the world became aware of this interesting new syndrome. The disease is no longer confined to East Asia, and is now an emerging infection in North America and Europe. How did this come about? We now understand some of the genetic changes that turn commensal E. coli into extra-intestinal pathogens. K pneumoniae is another member of the Enterobacteriaceae that is usually normal flora in the gut, but we know relatively little about how it evolved into an invasive pathogen capable of causing abscesses in normal livers. The phenotype of the liver-invasive strains is hyperviscosity of the polysaccharide capsules, but while the gene that determines that property is required it is not sufficient to create the pathogen, and more research is needed to discover the other virulence genes, and thus to potentially target them therapeutically. PMID:22561156

  20. Perianal Abscess and Proctitis by Klebsiella pneumoniae

    PubMed Central

    Jeong, Woo Shin; Choi, Sung Youn; Jeong, Eun Haeng; Bang, Ki Bae; Park, Seung Sik; Lee, Dae Sung; Park, Dong Il

    2015-01-01

    Klebsiella pneumoniae (K. pneumoniae) can at times cause invasive infections, especially in patients with diabetes mellitus and a history of alcohol abuse. A 61-year-old man with diabetes mellitus and a history of alcohol abuse presented with abdominal and anal pain for two weeks. After admission, he underwent sigmoidoscopy, which revealed multiple ulcerations with yellowish exudate in the rectum and sigmoid colon. The patient was treated with ciprofloxacin and metronidazole. After one week, follow up sigmoidoscopy was performed owing to sustained fever and diarrhea. The lesions were aggravated and seemed webbed in appearance because of damage to the rectal mucosa. Abdominal computed tomography and rectal magnetic resonance imaging were performed, and showed a perianal and perirectal abscess. The patient underwent laparoscopic sigmoid colostomy and perirectal abscess incision and drainage. Extended-spectrum beta-lactamase-producing K. pneumoniae was identified in pus culture. The antibiotics were switched to ertapenem. He improved after surgery and was discharged. K. pneumoniae can cause rapid invasive infection in patients with diabetes and a history of alcohol abuse. We report the first rare case of proctitis and perianal abscess caused by invasive K. pneumoniae infection. PMID:25691848

  1. Outbreak of NDM-1-producing Klebsiella pneumoniae causing neonatal infection in a teaching hospital in mainland China.

    PubMed

    Zhang, XiaoYu; Li, XianPing; Wang, Min; Yue, HeJia; Li, PengLing; Liu, YaPing; Cao, Wei; Yao, DongMei; Liu, Li; Zhou, XiaoLan; Zheng, Rong; Bo, Tao

    2015-07-01

    The emergence and spread of bacteria carrying the bla(NDM-1) gene has become a worldwide concern. Here, we report eight cases of Klebsiella pneumoniae with bla(NDM-1) in the neonatal ward of a teaching hospital in mainland China. Multilocus sequence typing showed that seven isolates were clonally related and confirmed them as sequence type 17 (ST17). One isolate belonged to ST433. These findings suggest continuous spread of bla(NDM-1) in mainland China and emphasize the need for intensive surveillance and precautions. PMID:25941224

  2. Outbreak of NDM-1-Producing Klebsiella pneumoniae Causing Neonatal Infection in a Teaching Hospital in Mainland China

    PubMed Central

    Zhang, XiaoYu; Li, XianPing; Yue, HeJia; Li, PengLing; Liu, YaPing; Cao, Wei; Yao, DongMei; Liu, Li; Zhou, XiaoLan; Zheng, Rong; Bo, Tao

    2015-01-01

    The emergence and spread of bacteria carrying the blaNDM-1 gene has become a worldwide concern. Here, we report eight cases of Klebsiella pneumoniae with blaNDM-1 in the neonatal ward of a teaching hospital in mainland China. Multilocus sequence typing showed that seven isolates were clonally related and confirmed them as sequence type 17 (ST17). One isolate belonged to ST433. These findings suggest continuous spread of blaNDM-1 in mainland China and emphasize the need for intensive surveillance and precautions. PMID:25941224

  3. [Update on outbreaks reported from neonatal intensive care units: Serratia marcescens, Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa].

    PubMed

    Kraus-Haas, Martina; Mielke, Martin; Simon, Arne

    2015-03-01

    In terms of the unique risk profile, the clinical course of nosocomial infections, and the most prevalent bacterial pathogens, literature on outbreaks of potentially pathogenic bacteria on neonatal intensive care units (NICUs) needs to be analyzed separately from reports derived from other intensive care units. With the purpose of updating important information for those involved in outbreak management and fostering preventive efforts, this article summarizes the results of a systematic literature analysis, referring to an earlier publication by Gastmeier et al. This review focuses on NICU outbreaks caused by Serratia marcescens, Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa. PMID:25665889

  4. The significance of bacteriocin typing of Klebsiella strans.

    PubMed

    Israil, A M

    1981-01-01

    Out of three different methods used for bacteriocin sensitivity typing of Klebsiella strains, the "scarpe and streak" method was the most appropriate tool for its routine use in epidemiologic studies. The method is quite simple, reliable and does not imply any special requirements. Out of 533 Klebsiella strains tested by our set of seven bacteriocins 453 (85%) strains proved to be typable and 100 (15%) nontypable. The number of strains typable by bacteriocins was higher than of those typable by phages. In 14 of 19 outbreaks, the predominance of 1-2 distinct patterns of bacteriocin sensitivity was observed. Two large geographical areas have been delineated by two predominant distinct bacteriocin types of Klebsiella strains, each being observed in a high number of outbreaks as well as in sporadic cases belonging to the same area. Although it was not possible to establish any clear correlation between the pattern of bacteriocin sensitivity and the lysotype or serotype of the strains, The present findings offer strong reason to allow recommendation of the bacteriocin sensitivity pattern as a marker of high epidemiologic significance in monitoring Klebsiella cross-infections. Medical and auxiliary workers could play the role of reservoir to Klebsiella strains and for this reason the hospital personnel has to follow carefully strict procedures for ensuring a valid protection of patients especially when coming into direct contact with neonates, infants and debilitated patients. PMID:7198362

  5. Protective effect of antilipopolysaccharide monoclonal antibody in experimental Klebsiella infection.

    PubMed Central

    Rukavina, T; Tcac, B; Susa, M; Jendrike, N; Jonjc, S; Lucin, P; Marre, R; Dorc, M; Trautmann, M

    1997-01-01

    An O-antigen-specific murine monoclonal antibody (MAb) directed against an immunodominant epitope expressed on Klebsiella O1, O6, and O8 lipopolysaccharides (LPS) was examined with respect to its binding to nonencapsulated and encapsulated bacterial cells and its ability to protect against lethal murine Klebsiella sepsis. While the MAb (clone Ru-O1, mouse immunoglobulin G2b) bound well to nonencapsulated organisms of the O1 serogroup, binding was significantly, but not completely, abolished by the presence of the K2 capsule. In a model of experimental Klebsiella peritonitis and sepsis induced by a virulent O1:K2 serogroup strain, higher doses of anti-LPS MAb Ru-O1 than of a previously described anticapsular MAb specific for the K2 capsular polysaccharide were needed to provide protection. However, high-dose (40 microg/g of body weight) pretreatment with anti-LPS MAb Ru-O1 significantly reduced bacterial dissemination to various organs as well as macroscopic and histologic pulmonary alterations. Thus, since the number of Klebsiella capsular antigens occurring in clinical material is too large to be completely "covered" by a K-antigen-specific hyperimmunoglobulin preparation, O-antigen-specific antibodies may supplement K-antigen-specific immunoprophylaxis and -therapy of clinical Klebsiella infection. PMID:9125558

  6. Neutral red-mediated microbial electrosynthesis by Escherichia coli, Klebsiella pneumoniae, and Zymomonas mobilis.

    PubMed

    Harrington, Timothy D; Mohamed, Abdelrhman; Tran, Vi N; Biria, Saeid; Gargouri, Mahmoud; Park, Jeong-Jin; Gang, David R; Beyenal, Haluk

    2015-11-01

    The aim of this work was to compare the effects of electrosynthesis on different bacterial species. The effects of neutral red-mediated electrosynthesis on the metabolite profiles of three microorganisms: Escherichia coli, Klebsiella pneumoniae, and Zymomonas mobilis, were measured and compared and contrasted. A statistically comprehensive analysis of neutral red-mediated electrosynthesis is presented using the analysis of end-product profiles, current delivered, and changes in cellular protein expression. K. pneumoniae displayed the most dramatic response to electrosynthesis of the three bacteria, producing 93% more ethanol and 76% more lactate vs. control fermentation with no neutral red and no electron delivery. Z. mobilis showed no response to electrosynthesis except elevated acetate titers. Stoichiometric comparison showed that NAD(+) reduction by neutral red could not account for changes in metabolites during electrosynthesis. Neutral red-mediated electrosynthesis was shown to have multifarious effects on the three species. PMID:26096579

  7. Tracking a hospital outbreak of carbapenem-resistant Klebsiella pneumoniae with whole-genome sequencing.

    PubMed

    Snitkin, Evan S; Zelazny, Adrian M; Thomas, Pamela J; Stock, Frida; Henderson, David K; Palmore, Tara N; Segre, Julia A

    2012-08-22

    The Gram-negative bacteria Klebsiella pneumoniae is a major cause of nosocomial infections, primarily among immunocompromised patients. The emergence of strains resistant to carbapenems has left few treatment options, making infection containment critical. In 2011, the U.S. National Institutes of Health Clinical Center experienced an outbreak of carbapenem-resistant K. pneumoniae that affected 18 patients, 11 of whom died. Whole-genome sequencing was performed on K. pneumoniae isolates to gain insight into why the outbreak progressed despite early implementation of infection control procedures. Integrated genomic and epidemiological analysis traced the outbreak to three independent transmissions from a single patient who was discharged 3 weeks before the next case became clinically apparent. Additional genomic comparisons provided evidence for unexpected transmission routes, with subsequent mining of epidemiological data pointing to possible explanations for these transmissions. Our analysis demonstrates that integration of genomic and epidemiological data can yield actionable insights and facilitate the control of nosocomial transmission. PMID:22914622

  8. Pulmonary Gangrene Due to Rhizopus spp., Staphylococcus aureus, Klebsiella pneumoniae and Probable Sarcina Organisms.

    PubMed

    Chougule, Abhijit; Muthu, Valliappan; Bal, Amanjit; Rudramurthy, Shivaprakash M; Dhooria, Sahajal; Das, Ashim; Singh, Harkant

    2015-08-01

    Pulmonary gangrene is a life-threatening condition, which represents the fulminant end of the infectious lung diseases usually caused by polymicrobial infection. Aerobic and anaerobic bacteria act synergistically to produce massive tissue necrosis which might be augmented by the angioinvasive nature of fungi like Mucor. We report a successfully treated case of pulmonary gangrene in a poorly controlled diabetic patient, which was associated with polymicrobial infection. It was caused by Rhizopus spp., Staphylococcus aureus, Klebsiella pneumoniae and unusual anaerobic organism Sarcina. This is the first report describing the presence of Sarcina organisms in a case of pulmonary gangrene. Adequate glycemic control, treatment of coexisting polymicrobial infection and prompt antifungal therapy along with surgical intervention were useful in the index patient. This case also highlights the effectiveness of combined medical and surgical intervention in a case of pulmonary gangrene. PMID:26022794

  9. 'KLEBSIELLA' OCCURRENCE, SIGNIFICANCE AND DETECTION IN WATER SYSTEMS: A PROGRESS REPORT

    EPA Science Inventory

    Frequent occurrence of Klebsiella in coliform colonization problems found in water supply distribution has prompted the development of a new medium (m-Kleb agar) for specific detection. The medium has excellent differential characteristics, and an average 94% Klebsiella recovery ...

  10. Mapping the Evolution of Hypervirulent Klebsiella pneumoniae

    PubMed Central

    Roe, Chandler C.; Stegger, Marc; Stahlhut, Steen G.; Hansen, Dennis S.; Engelthaler, David M.; Andersen, Paal S.; Driebe, Elizabeth M.; Keim, Paul; Krogfelt, Karen A.

    2015-01-01

    ABSTRACT Highly invasive, community-acquired Klebsiella pneumoniae infections have recently emerged, resulting in pyogenic liver abscesses. These infections are caused by hypervirulent K.pneumoniae (hvKP) isolates primarily of capsule serotype K1 or K2. Hypervirulent K1 isolates belong to clonal complex 23 (CC23), indicating that this clonal lineage has a specific genetic background conferring hypervirulence. Here, we apply whole-genome sequencing to a collection of K.pneumoniae isolates to characterize the phylogenetic background of hvKP isolates with an emphasis on CC23. Most of the hvKP isolates belonged to CC23 and grouped into a distinct monophyletic clade, revealing that CC23 is a unique clonal lineage, clearly distinct from nonhypervirulent strains. Separate phylogenetic analyses of the CC23 isolates indicated that the CC23 lineage evolved recently by clonal expansion from a single common ancestor. Limited grouping according to geographical origin was observed, suggesting that CC23 has spread globally through multiple international transmissions. Conversely, hypervirulent K2 strains clustered in genetically unrelated groups. Strikingly, homologues of a large virulence plasmid were detected in all hvKP clonal lineages, indicating a key role in K.pneumoniae hypervirulence. The plasmid encodes two siderophores, aerobactin and salmochelin, and RmpA (regulator of the mucoid phenotype); all these factors were found to be restricted to hvKP isolates. Genomic comparisons revealed additional factors specifically associated with CC23. These included a distinct variant of a genomic island encoding yersiniabactin, colibactin, and microcin E492. Furthermore, additional novel genomic regions unique to CC23 were revealed which may also be involved in the increased virulence of this important clonal lineage. PMID:26199326

  11. Metabolism of Melamine by Klebsiella terragena.

    PubMed

    Shelton, D R; Karns, J S; McCarty, G W; Durham, D R

    1997-07-01

    Experiments were conducted to determine the pathway of melamine metabolism by Klebsiella terragena (strain DRS-1) and the effect of added NH(inf4)(sup+) on the rates and extent of melamine metabolism. In the absence of added NH(inf4)(sup+), 1 mM melamine was metabolized concomitantly with growth. Ammeline, ammelide, cyanuric acid, and NH(inf4)(sup+) accumulated transiently in the culture medium to maximal concentrations of 0.012 mM, 0.39 mM, trace levels, and 0.61 mM, respectively. In separate incubations, in which cells were grown on either ammeline or ammelide (in the absence of NH(inf4)(sup+)), ammeline was metabolized without a lag while ammelide metabolism was observed only after 3 h. In the presence of 6 mM added NH(inf4)(sup+) (enriched with 5% (sup15)N), ammeline, ammelide, and cyanuric acid accumulated transiently to maximal concentrations of 0.002 mM, 0.47 mM, and trace levels, respectively, indicating that the added NH(inf4)(sup+) had little effect on the relative rates of triazine metabolism. These data suggest that the primary mode of melamine metabolism by K. terragena is hydrolytic, resulting in successive deaminations of the triazine ring. Use of (sup15)N-enriched NH(inf4)(sup+) allowed estimates of rates of triazine-N mineralization and assimilation of NH(inf4)(sup+)-N versus triazine-N into biomass. A decrease in the percent (sup15)N in the external NH(inf4)(sup+) pool, in conjunction with the accumulation of ammelide and/or triazine-derived NH(inf4)(sup+) in the culture medium, suggests that the initial reactions in the melamine metabolic pathway may occur outside the cytoplasmic membrane. PMID:16535652

  12. Metabolism of Melamine by Klebsiella terragena

    PubMed Central

    Shelton, D. R.; Karns, J. S.; Mccarty, G. W.; Durham, D. R.

    1997-01-01

    Experiments were conducted to determine the pathway of melamine metabolism by Klebsiella terragena (strain DRS-1) and the effect of added NH(inf4)(sup+) on the rates and extent of melamine metabolism. In the absence of added NH(inf4)(sup+), 1 mM melamine was metabolized concomitantly with growth. Ammeline, ammelide, cyanuric acid, and NH(inf4)(sup+) accumulated transiently in the culture medium to maximal concentrations of 0.012 mM, 0.39 mM, trace levels, and 0.61 mM, respectively. In separate incubations, in which cells were grown on either ammeline or ammelide (in the absence of NH(inf4)(sup+)), ammeline was metabolized without a lag while ammelide metabolism was observed only after 3 h. In the presence of 6 mM added NH(inf4)(sup+) (enriched with 5% (sup15)N), ammeline, ammelide, and cyanuric acid accumulated transiently to maximal concentrations of 0.002 mM, 0.47 mM, and trace levels, respectively, indicating that the added NH(inf4)(sup+) had little effect on the relative rates of triazine metabolism. These data suggest that the primary mode of melamine metabolism by K. terragena is hydrolytic, resulting in successive deaminations of the triazine ring. Use of (sup15)N-enriched NH(inf4)(sup+) allowed estimates of rates of triazine-N mineralization and assimilation of NH(inf4)(sup+)-N versus triazine-N into biomass. A decrease in the percent (sup15)N in the external NH(inf4)(sup+) pool, in conjunction with the accumulation of ammelide and/or triazine-derived NH(inf4)(sup+) in the culture medium, suggests that the initial reactions in the melamine metabolic pathway may occur outside the cytoplasmic membrane. PMID:16535652

  13. Capsule and Fimbria Interaction in Klebsiella pneumoniae

    PubMed Central

    Schembri, Mark A.; Blom, Jens; Krogfelt, Karen A.; Klemm, Per

    2005-01-01

    The capsular polysaccharide and type 1 fimbriae are two of the major surface-located virulence properties associated with the pathogenesis of Klebsiella pneumoniae. The capsule is an elaborate polysaccharide matrix that encases the entire cell surface and provides resistance against many host defense mechanisms. In contrast, type 1 fimbriae are thin adhesive thread-like surface organelles that can extend beyond the capsular matrix and mediate d-mannose-sensitive adhesion to host epithelial cells. These fimbriae are archetypical and consist of a major building block protein (FimA) that comprises the bulk of the organelle and a tip-located adhesin (FimH). It is assumed that the extended major-subunit protein structure permits the FimH adhesin to function independently of the presence of a capsule. In this study, we have employed a defined set of K. pneumoniae capsulated and noncapsulated strains to show that the function of type 1 fimbriae is actually impeded by the concomitant expression of a polysaccharide capsule. Capsule expression had significant effects on two parameters commonly used to define FimH function, namely, yeast cell agglutination and biofilm formation. Our data suggest that this effect is not due to transcriptional/translational changes in fimbrial gene/protein expression but rather the result of direct physical interference. This was further demonstrated by the fact that we could restore fimbrial function by inhibiting capsule synthesis. It remains to be determined whether the expression of these very different surface components occurs simply via random events of phase variation or in a coordinated manner in response to specific environmental cues. PMID:16040975

  14. Anti-Biofilm Activity: A Function of Klebsiella pneumoniae Capsular Polysaccharide

    PubMed Central

    Dos Santos Goncalves, Marina; Delattre, Cédric; Balestrino, Damien; Charbonnel, Nicolas; Elboutachfaiti, Redouan; Wadouachi, Anne; Badel, Stéphanie; Bernardi, Thierry; Michaud, Philippe; Forestier, Christiane

    2014-01-01

    Competition and cooperation phenomena occur within highly interactive biofilm communities and several non-biocides molecules produced by microorganisms have been described as impairing biofilm formation. In this study, we investigated the anti-biofilm capacities of an ubiquitous and biofilm producing bacterium, Klebsiella pneumoniae. Cell-free supernatant from K. pneumoniae planktonic cultures showed anti-biofilm effects on most Gram positive bacteria tested but also encompassed some Gram negative bacilli. The anti-biofilm non-bactericidal activity was further investigated on Staphylococcus epidermidis, by determining the biofilm biomass, microscopic observations and agglutination measurement through a magnetic bead-mediated agglutination test. Cell-free extracts from K. pneumoniae biofilm (supernatant and acellular matrix) also showed an influence, although to a lesser extend. Chemical analyses indicated that the active molecule was a high molecular weight polysaccharide composed of five monosaccharides: galactose, glucose, rhamnose, glucuronic acid and glucosamine and the main following sugar linkage residues [→2)-α-l-Rhap-(1→]; [→4)-α-l-Rhap-(1→]; [α-d-Galp-(1→]; [→2,3)-α-d-Galp-(1→]; [→3)-β-d-Galp-(1→] and, [→4)-β-d-GlcAp-(1→]. Characterization of this molecule indicated that this component was more likely capsular polysaccharide (CPS) and precoating of abiotic surfaces with CPS extracts from different serotypes impaired the bacteria-surface interactions. Thus the CPS of Klebsiella would exhibit a pleiotropic activity during biofilm formation, both stimulating the initial adhesion and maturation steps as previously described, but also repelling potential competitors. PMID:24932475

  15. Anti-biofilm activity: a function of Klebsiella pneumoniae capsular polysaccharide.

    PubMed

    Goncalves, Marina Dos Santos; Delattre, Cédric; Balestrino, Damien; Charbonnel, Nicolas; Elboutachfaiti, Redouan; Wadouachi, Anne; Badel, Stéphanie; Bernardi, Thierry; Michaud, Philippe; Forestier, Christiane

    2014-01-01

    Competition and cooperation phenomena occur within highly interactive biofilm communities and several non-biocides molecules produced by microorganisms have been described as impairing biofilm formation. In this study, we investigated the anti-biofilm capacities of an ubiquitous and biofilm producing bacterium, Klebsiella pneumoniae. Cell-free supernatant from K. pneumoniae planktonic cultures showed anti-biofilm effects on most Gram positive bacteria tested but also encompassed some Gram negative bacilli. The anti-biofilm non-bactericidal activity was further investigated on Staphylococcus epidermidis, by determining the biofilm biomass, microscopic observations and agglutination measurement through a magnetic bead-mediated agglutination test. Cell-free extracts from K. pneumoniae biofilm (supernatant and acellular matrix) also showed an influence, although to a lesser extend. Chemical analyses indicated that the active molecule was a high molecular weight polysaccharide composed of five monosaccharides: galactose, glucose, rhamnose, glucuronic acid and glucosamine and the main following sugar linkage residues [→ 2)-α-L-Rhap-(1 →]; [→ 4)-α-L-Rhap-(1 →]; [α-D-Galp-(1 →]; [→ 2,3)-α-D-Galp-(1 →]; [→ 3)-β-D-Galp-(1 →] and, [→ 4)-β-D-GlcAp-(1 →]. Characterization of this molecule indicated that this component was more likely capsular polysaccharide (CPS) and precoating of abiotic surfaces with CPS extracts from different serotypes impaired the bacteria-surface interactions. Thus the CPS of Klebsiella would exhibit a pleiotropic activity during biofilm formation, both stimulating the initial adhesion and maturation steps as previously described, but also repelling potential competitors. PMID:24932475

  16. Analysis of the Networks Controlling the Antimicrobial-Peptide-Dependent Induction of Klebsiella pneumoniae Virulence Factors ?

    PubMed Central

    Llobet, Enrique; Campos, Miguel A.; Gimnez, Paloma; Moranta, David; Bengoechea, Jos A.

    2011-01-01

    Antimicrobial peptides (APs) impose a threat to the survival of pathogens, and it is reasonable to postulate that bacteria have developed strategies to counteract them. Polymyxins are becoming the last resort to treat infections caused by multidrug-resistant Gram-negative bacteria and, similar to APs, they interact with the anionic lipopolysaccharide. Given that polymyxins and APs share the initial target, it is possible that bacterial defense mechanisms against polymyxins will be also effective against host APs. We sought to determine whether exposure to polymyxin will increase Klebsiella pneumoniae resistance to host APs. Indeed, exposure of K. pneumoniae to polymyxin induces cross-resistance not only to polymyxin itself but also to APs present in the airways. Polymyxin treatment upregulates the expression of the capsule polysaccharide operon and the loci required to modify the lipid A with aminoarabinose and palmitate with a concomitant increase in capsule and lipid A species containing such modifications. Moreover, these surface changes contribute to APs resistance and also to polymyxin-induced cross-resistance to APs. Bacterial loads of lipid A mutants in trachea and lungs of intranasally infected mice were lower than those of wild-type strain. PhoPQ, PmrAB, and the Rcs system govern polymyxin-induced transcriptional changes, and there is a cross talk between PhoPQ and the Rcs system. Our findings support the notion that Klebsiella activates a defense program against APs that is controlled by three signaling systems. Therapeutic strategies directed to prevent the activation of this program could be a new approach worth exploring to facilitate the clearance of the pathogen from the airways. PMID:21708987

  17. Persistence of nasal colonization with human pathogenic bacteria and associated antimicrobial resistance in the German general population

    PubMed Central

    Köck, R.; Werner, P.; Friedrich, A.W.; Fegeler, C.; Becker, K.; Bindewald, O.; Bui, T.T.; Eckhoff, C.; Epping, R.; Kähmann, L.; Meurer, M.; Steger, J.; von Auenmüller, L.

    2015-01-01

    The nares represent an important bacterial reservoir for endogenous infections. This study aimed to assess the prevalence of nasal colonization by different important pathogens, the associated antimicrobial susceptibility and risk factors. We performed a prospective cohort study among 1878 nonhospitalized volunteers recruited from the general population in Germany. Participants provided nasal swabs at three time points (each separated by 4–6 months). Staphylococcus aureus, Enterobacteriaceae and important nonfermenters were cultured and subjected to susceptibility testing. Factors potentially influencing bacterial colonization patterns were assessed. The overall prevalence of S. aureus, Enterobacteriaceae and nonfermenters was 41.0, 33.4 and 3.7%, respectively. Thirteen participants (0.7%) were colonized with methicillin-resistant S. aureus. Enterobacteriaceae were mostly (>99%) susceptible against ciprofloxacin and carbapenems (100%). Extended-spectrum β-lactamase–producing isolates were not detected among Klebsiella oxytoca, Klebsiella pneumoniae and Escherichia coli. Several lifestyle- and health-related factors (e.g. household size, travel, livestock density of the residential area or occupational livestock contact, atopic dermatitis, antidepressant or anti-infective drugs) were associated with colonization by different microorganisms. This study unexpectedly demonstrated high nasal colonization rates with Enterobacteriaceae in the German general population, but rates of antibiotic resistance were low. Methicillin-resistant S. aureus carriage was rare but highly associated with occupational livestock contact. PMID:26862431

  18. Persistence of nasal colonization with human pathogenic bacteria and associated antimicrobial resistance in the German general population.

    PubMed

    Kck, R; Werner, P; Friedrich, A W; Fegeler, C; Becker, K

    2016-01-01

    The nares represent an important bacterial reservoir for endogenous infections. This study aimed to assess the prevalence of nasal colonization by different important pathogens, the associated antimicrobial susceptibility and risk factors. We performed a prospective cohort study among 1878 nonhospitalized volunteers recruited from the general population in Germany. Participants provided nasal swabs at three time points (each separated by 4-6 months). Staphylococcus aureus, Enterobacteriaceae and important nonfermenters were cultured and subjected to susceptibility testing. Factors potentially influencing bacterial colonization patterns were assessed. The overall prevalence of S.aureus, Enterobacteriaceae and nonfermenters was 41.0, 33.4 and 3.7%, respectively. Thirteen participants (0.7%) were colonized with methicillin-resistant S.aureus. Enterobacteriaceae were mostly (>99%) susceptible against ciprofloxacin and carbapenems (100%). Extended-spectrum ?-lactamase-producing isolates were not detected among Klebsiella oxytoca, Klebsiella pneumoniae and Escherichia coli. Several lifestyle- and health-related factors (e.g. household size, travel, livestock density of the residential area or occupational livestock contact, atopic dermatitis, antidepressant or anti-infective drugs) were associated with colonization by different microorganisms. This study unexpectedly demonstrated high nasal colonization rates with Enterobacteriaceae in the German general population, but rates of antibiotic resistance were low. Methicillin-resistant S.aureus carriage was rare but highly associated with occupational livestock contact. PMID:26862431

  19. Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates.

    PubMed

    Hou, Xiang-hua; Song, Xiu-yu; Ma, Xiao-bo; Zhang, Shi-yang; Zhang, Jia-qin

    2015-01-01

    Klebsiella pneumoniae is an important cause of healthcare-associated infections worldwide. Selective pressure, the extensive use of antibiotics, and the conjugational transmission of antibiotic resistance genes across bacterial species and genera facilitate the emergence of multidrug-resistant (MDR) K. pneumoniae. Here, we examined the occurrence, phenotypes and genetic features of MDR K. pneumoniae isolated from patients in intensive care units (ICUs) at the First Affiliated Hospital of Xiamen University in Xiamen, China, from January to December 2011. Thirty-eight MDR K. pneumoniae strains were collected. These MDR K. pneumoniae isolates possessed at least seven antibiotic resistance determinants, which contribute to the high-level resistance of these bacteria to aminoglycosides, macrolides, quinolones and ?-lactams. Among these isolates, 24 strains were extended-spectrum ?-lactamase (ESBL) producers, 2 strains were AmpC producers, and 12 strains were both ESBL and AmpC producers. The 38 MDR isolates also contained class I (28/38) and class II integrons (10/38). All 28 class I-positive isolates contained aacC1, aacC4, orfX, orfX' and aadA1 genes. ?-lactam resistance was conferred through bla SHV (22/38), bla TEM (10/38), and bla CTX-M (7/38). The highly conserved bla KPC-2 (37/38) and bla OXA-23(1/38) alleles were responsible for carbapenem resistance, and a gyrAsite mutation (27/38) and the plasmid-mediated qnrB gene (13/38) were responsible for quinolone resistance. Repetitive-sequence-based PCR (REP-PCR) fingerprinting of these MDR strains revealed the presence of five groups and sixteen patterns. The MDR strains from unrelated groups showed different drug resistance patterns; however, some homologous strains also showed different drug resistance profiles. Therefore, REP-PCR-based analyses can provide information to evaluate the epidemic status of nosocomial infection caused by MDR K. pneumoniae; however, this test lacks the power to discriminate some isolates. Thus, we propose that both genotyping and REP-PCR typing should be used to distinguish genetic groups beyond the species level. PMID:26413058

  20. Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates

    PubMed Central

    Hou, Xiang-hua; Song, Xiu-yu; Ma, Xiao-bo; Zhang, Shi-yang; Zhang, Jia-qin

    2015-01-01

    Klebsiella pneumoniae is an important cause of healthcare-associated infections worldwide. Selective pressure, the extensive use of antibiotics, and the conjugational transmission of antibiotic resistance genes across bacterial species and genera facilitate the emergence of multidrug-resistant (MDR) K. pneumoniae. Here, we examined the occurrence, phenotypes and genetic features of MDR K. pneumoniae isolated from patients in intensive care units (ICUs) at the First Affiliated Hospital of Xiamen University in Xiamen, China, from January to December 2011. Thirty-eight MDR K. pneumoniae strains were collected. These MDR K. pneumoniae isolates possessed at least seven antibiotic resistance determinants, which contribute to the high-level resistance of these bacteria to aminoglycosides, macrolides, quinolones and β-lactams. Among these isolates, 24 strains were extended-spectrum β-lactamase (ESBL) producers, 2 strains were AmpC producers, and 12 strains were both ESBL and AmpC producers. The 38 MDR isolates also contained class I (28/38) and class II integrons (10/38). All 28 class I-positive isolates contained aacC1, aacC4, orfX, orfX’ and aadA1 genes. β-lactam resistance was conferred through bla SHV (22/38), bla TEM (10/38), and bla CTX-M (7/38). The highly conserved bla KPC-2 (37/38) and bla OXA-23(1/38) alleles were responsible for carbapenem resistance, and a gyrAsite mutation (27/38) and the plasmid-mediated qnrB gene (13/38) were responsible for quinolone resistance. Repetitive-sequence-based PCR (REP-PCR) fingerprinting of these MDR strains revealed the presence of five groups and sixteen patterns. The MDR strains from unrelated groups showed different drug resistance patterns; however, some homologous strains also showed different drug resistance profiles. Therefore, REP-PCR-based analyses can provide information to evaluate the epidemic status of nosocomial infection caused by MDR K. pneumoniae; however, this test lacks the power to discriminate some isolates. Thus, we propose that both genotyping and REP-PCR typing should be used to distinguish genetic groups beyond the species level. PMID:26413058

  1. A Second Outer-Core Region in Klebsiella pneumoniae Lipopolysaccharide

    PubMed Central

    Regu, Miguel; Izquierdo, Luis; Fresno, Sandra; Piqu, Nria; Corsaro, Maria Michela; Naldi, Teresa; De Castro, Cristina; Waidelich, Dietmar; Merino, Susana; Toms, Juan M.

    2005-01-01

    Up to now only one major type of core oligosaccharide has been found in the lipopolysaccharide of all Klebsiella pneumoniae strains analyzed. Applying a different screening approach, we identified a novel Klebsiella pneumoniae core (type 2). Both Klebsiella core types share the same inner core and the outer-core-proximal disaccharide, GlcN-(1,4)-GalA, but they differ in the GlcN substituents. In core type 2, the GlcpN residue is substituted at the O-4 position by the disaccharide ?-Glcp(1-6)-?-Glcp(1, while in core type 1 the GlcpN residue is substituted at the O-6 position by either the disaccharide ?-Hep(1-4)-?-Kdo(2 or a Kdo residue (Kdo is 3-deoxy-d-manno-octulosonic acid). This difference correlates with the presence of a three-gene region in the corresponding core biosynthetic clusters. Engineering of both core types by interchanging this specific region allowed studying the effect on virulence. The replacement of Klebsiella core type 1 in a highly type 2 virulent strain (52145) induces lower virulence than core type 2 in a murine infection model. PMID:15937181

  2. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Klebsiella spp. serological reagents. 866.3340 Section 866.3340 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340...

  3. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Klebsiella spp. serological reagents. 866.3340 Section 866.3340 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340...

  4. Genome Sequences of Five Clinical Isolates of Klebsiella pneumoniae.

    PubMed

    Lopez, L Letti; Rusconi, Brigida; Gildersleeve, Heidi; Qi, Chao; McLaughlin, Milena; Scheetz, Marc H; Seshu, J; Eppinger, Mark

    2016-01-01

    Klebsiella pneumoniae is a nosocomial pathogen of emerging importance and displays resistance to broad-spectrum antibiotics, such as carbapenems. Here, we report the genome sequences of five clinical K. pneumoniae isolates, four of which are carbapenem resistant. Carbapenem resistance is conferred by hydrolyzing class A β-lactamases found adjacent to transposases. PMID:26966211

  5. Genome Sequences of Five Clinical Isolates of Klebsiella pneumoniae

    PubMed Central

    Lopez, L. Letti; Rusconi, Brigida; Gildersleeve, Heidi; Qi, Chao; McLaughlin, Milena; Seshu, J.

    2016-01-01

    Klebsiella pneumoniae is a nosocomial pathogen of emerging importance and displays resistance to broad-spectrum antibiotics, such as carbapenems. Here, we report the genome sequences of five clinical K. pneumoniae isolates, four of which are carbapenem resistant. Carbapenem resistance is conferred by hydrolyzing class A β-lactamases found adjacent to transposases. PMID:26966211

  6. DUOX2 promotes the elimination of the Klebsiella pneumoniae strainK5 from T24 cells through the reactive oxygen species pathway.

    PubMed

    Lu, Huixia; Wu, Qi; Yang, Huijun

    2015-08-01

    Dual oxidase 2 (DUOX2) plays a major role in host defense in intestinal and airway epithelial cells through the reactive oxygen species (ROS) pathway. Klebsiella pneumoniae is a uropathogen that causes urinary tract infections. It is not known whether DUOX2 plays a role in host defense in bladder cancer epithelial cells. It is also not known whether Klebsiella pneumoniae invades T24 human bladder carcinoma cells and whether DUOX2 plays a role in eliminating the Klebsiella pneumoniae strain K5 through the ROS pathway in T24 cells. Thus, in the present study, we aimed to investigate the infectious capability of the Klebsiella pneumoniae K5 strain and the immunity-promoting capability of DUOX2 in T24 cells. We quantified the number of viable intracellular bacteria using the plate count method. DUOX2 expression was evaluated by western blot analysis and reverse transcription-quantitative PCR (RT-qPCR) following treatment with or without multiple cytokines, phorbol 12-myristate 13-acetate (PMA), muramyl dipeptide (MDP), N-acetylmuramyl-D-alanyl-D-isoglutamine (MDP-DD), H2O2 inhibitor, catalase (CAT), the nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) oxidase inhibitor, diphenyleneiodonium (DPI), or siRNA targeting DUOX2 (siDUOX2). The levels of ROS in the T24 cells infected with the K5 strain were examined following treatment with DPI, CAT or siDUOX2. Our results revealed that DUOX2 expression increased and the number of viable intracellular bacteria decreased in the T24 cells following infection with the K4 bacteria. Treatment with the cytokines and MDP and PMA also induced DUOX2 expression and decreased the number of viable intracellular bacteria. The levels of ROS also increased following treatment with the cytokines and MDP and PMA. However, when the cells were treated with the inhibitors (DPI or CAT), these effects were all reversed. Our data demonstrated that DUOX2 played an important role in innate immunity against bacterial cytoinvasion through the ROS pathway in T24 cells. Our findings also provide insight into the protection of uroepithelial cells from Klebsiella pneumoniae K5 bacterial cytoinvasion, and thus lay the foundation for the development of novel therapies for urinary tract infections. PMID:26046128

  7. [Viable non-culturable bacteria].

    PubMed

    Năşcuţiu, Alexandra-Maria

    2010-01-01

    Viable but non-culturable cells (VBNC) are defined as live bacteria, but which do not either grow or divide. Such bacteria cannot be cultivated on conventional media (they do not form colonies on solid media, they do not change broth appearance), but their existence can be proved using other methods. The switch to the VBNC stage has been described and documented for several bacterial species: Vibrio spp. (cholerae, vulnificus and other species), Escherichia coli (including EHEC), Campylobacter jejuni, Helicobacter pylori, Salmonella spp., Listeria monocytogenes, Yersinia enterocolytica, Shigella spp., Klebsiella spp., Enterobacter spp., Cronobacter spp., Staphylococcus aureus, Providencia spp., Morganella spp., Pseudomonas spp., Mycobacterium tuberculosis, Enterococcus spp. The capacity of both Gram-positive and Gram-negative bacteria to enter the VBNC stage started to concern microbiologists in the field of food industry (food and water safety) and pharmaceutical industry. Many studies have shown that processes meant to achieve bactericidal effects can favour bacterial switch to VBNC. Viable but non-culturable stage is reversible. Concerns are due to the capacity of VBNC, especially of potentially pathogen cells, to switch to the infectious stage once in the host organism. PMID:21038700

  8. Rapid Induction of High-Level Carbapenem Resistance in Heteroresistant KPC-Producing Klebsiella pneumoniae

    PubMed Central

    Adams-Sapper, Sheila; Nolen, Shantell; Donzelli, Grace Fox; Lal, Mallika; Chen, Kunihiko; Justo da Silva, Livia Helena; Moreira, Beatriz M.

    2015-01-01

    Enterobacteriaceae strains producing the Klebsiella pneumoniae carbapenemase (KPC) have disseminated worldwide, causing an urgent threat to public health. KPC-producing strains often exhibit low-level carbapenem resistance, which may be missed by automated clinical detection systems. In this study, eight Klebsiella pneumoniae strains with heterogeneous resistance to imipenem were used to elucidate the factors leading from imipenem susceptibility to high-level resistance as defined by clinical laboratory testing standards. Time-kill analysis with an inoculum as low as 3 × 106 CFU/ml and concentrations of imipenem 8- and 16-fold higher than the MIC resulted in the initial killing of 99.9% of the population. However, full recovery of the population occurred by 20 h of incubation in the same drug concentrations. Population profiles showed that recovery was mediated by a heteroresistant subpopulation at a frequency of 2 × 10−7 to 3 × 10−6. Samples selected 2 h after exposure to imipenem were as susceptible as the unexposed parental strain and produced the major outer membrane porin OmpK36. However, between 4 to 8 h after exposure, OmpK36 became absent, and the imipenem MIC increased at least 32-fold. Individual colonies isolated from cultures after 20 h of exposure revealed both susceptible and resistant subpopulations. Once induced, however, the high-level imipenem resistance was maintained, and OmpK36 remained unexpressed even without continued carbapenem exposure. This study demonstrates the essential coordination between blaKPC and ompK36 expression mediating high-level imipenem resistance from a population of bacteria that initially exhibits a carbapenem-susceptibility phenotype. PMID:25801565

  9. The use of bacteria in conformance control - Initial studies

    SciTech Connect

    MacLeod, F.A.; Lappin-Scott, H.M.; Cusack, F.; Costerton, J.W.

    1988-05-01

    Bacteria respond to nutrient starvation by reducing in size to form ultramicrobacteria (UMB) less than 0.3 ..mu..m in diameter. Work in the authors' laboratory has established that two bacteria, Klebsiella pneumoniae and a Psuedomonas species, isolated from oilwell waters decreased in size when deprived of nutrients. Subsequent restoration of nutrients resulted in the resuscitation of the UMB and they returned to normal size. When injected into model rock cores, the UMB penetrated deeper than the full-sized bacteria. Higher counts of bacteria and carbohydrate production were found around the core inlet with the full-sized bacteria. However, the UMB were located throughout the entire core. This work demonstrates that UMB may provide a new selective plugging technique by virtue of their superior penetration properties throughout solid matrices.

  10. Inhibiting biofilm formation by Klebsiella pneumoniae B5055 using an iron antagonizing molecule and a bacteriophage

    PubMed Central

    2013-01-01

    Background Success of biofilm dwelling bacteria in causing persistent and chronic infections is attributed to their resistance towards antibiotics and immune defences. Free iron is critical for the growth of biofilm associated bacteria. Therefore in the present study, the effect of limiting iron levels by addition of divalent Co[II] ions in combination with a bacteriophage was used for preventing/disrupting Klebsiella pneumoniae biofilms. Results A significantly higher reduction (p < 0.005) in bacterial numbers in the younger as well as older biofilms treated with Co[II] and depolymerase producing phage in combination was observed in comparison to when either of the agents was used alone. The role of phage borne depolymerase was confirmed, as an insignificant eradication of biofilm by non-depolymerase producing bacteriophage in combination with cobalt ions was observed. The results of viable count were further confirmed by visual examination of biofilms. Conclusion From the study it can be concluded, that iron antagonizing molecules and bacteriophages can be used as adjunct therapy for preventing biofilm development. PMID:23889975

  11. Effect of Klebsiella pneumoniae enterotoxin on intestinal transport in the rat.

    PubMed Central

    Klipstein, F A; Horowitz, I R; Engert, R F; Schnenk, E A

    1975-01-01

    The effects on intestinal transport of either a semipurified preparation of enterotoxin elaborated by Klebsiella pneumoniae or similaryly prepared control material were tested by marker perfusion studies in the small intestine of rats. At a concentration of 2 mg/ml, the enterotoxin produced net secretion of water, Na, and Cl in both jejunal and ileal segments; HCO3 transport was not affected. Net secretion was evident within 30 min after intorduction of the toxin and was maximal after 90 min. The addition of 56 mM glucose to the enterotoxin-containing perfusion fluid resulted in reversal of water and Na transport to net absorption in both intestinal segments. The enterotoxin also produced a significant depression of xylose absorption in both the jejunum and ileum but did not affect the absorption of either glucose or L-leucine. Intestinal structure was not altered after perfusion of the toxin but insillation of approximately one-quarter of the total perfusion dose into a ligated jejunal loop for 18 h produced fluid secretion and structural abnormalities. These observations confirm the fact that other species of coliform bacteria in addition to tescherichia coli are capable of elaborating an enterotoxin. Such species commonly contaminate the small intestine of persons with tropical sprue and it is suggested that chronic exposure of the intestinal mucosa to the enterotoxin elaborated by these bacteria may be a factor in the pathogenesis of intestinal abnormalities in thid disorder. Images PMID:169297

  12. Metabolic Response to Klebsiella pneumoniae Infection in an Experimental Rat Model

    PubMed Central

    Dong, Fangcong; Wang, Bin; Zhang, Lulu; Tang, Huiru; Li, Jieshou; Wang, Yulan

    2012-01-01

    Bacteremia, the presence of viable bacteria in the blood stream, is often associated with several clinical conditions. Bacteremia can lead to multiple organ failure if managed incorrectly, which makes providing suitable nutritional support vital for reducing bacteremia-associated mortality. In order to provide such information, we investigated the metabolic consequences of a Klebsiella pneumoniae (K. pneumoniae) infection in vivo by employing a combination of 1H nuclear magnetic resonance spectroscopy and multivariate data analysis. K. pneumoniae was intravenously infused in rats; urine and plasma samples were collected at different time intervals. We found that K. pneumoniae-induced bacteremia stimulated glycolysis and the tricarboxylic acid cycle and also promoted oxidation of fatty acids and creatine phosphate to facilitate the energy-demanding host response. In addition, K. pneumoniae bacteremia also induced anti-endotoxin, anti-inflammatory and anti-oxidization responses in the host. Furthermore, bacteremia could cause a disturbance in the gut microbiotal functions as suggested by alterations in a range of amines and bacteria-host co-metabolites. Our results suggest that supplementation with glucose and a high-fat and choline-rich diet could ameliorate the burdens associated with bacteremia. Our research provides underlying pathological processes of bacteremia and a better understanding of the clinical and biochemical manifestations of bacteremia. PMID:23226457

  13. Free versus liposome-encapsulated muramyl tripeptide phosphatidylethanolamide in treatment of experimental Klebsiella pneumoniae infection.

    PubMed Central

    Melissen, P M; van Vianen, W; Rijsbergen, Y; Bakker-Woudenberg, I A

    1992-01-01

    The effect of free and liposome-encapsulated muramyl tripeptide phosphatidylethanolamide (MTPPE) on resistance to Klebsiella pneumoniae infection in mice was investigated. It was shown that administration of MTPPE, at 24 h before bacterial inoculation, led to a dose-dependent antibacterial resistance in terms of increased clearance of bacteria from the blood and bacterial killing in various organs. The lowest effective dose of MTPPE was 50 micrograms per mouse. Administration of liposome-encapsulated MTPPE was also effective at a dose of 25 micrograms per mouse. The time of administration of both free and liposome-encapsulated MTPPE, with respect to the appearance of bacteria in the blood, was very important and indicated that repeated administration is necessary to obtain protection for a prolonged period. In view of the toxicity of MTPPE, it was an important observation that repeated administration of MTPPE in the liposome-encapsulated form also produced antibacterial resistance. Administration of free and liposome-encapsulated MTPPE resulted in increased numbers of granulocytes, monocytes, and lymphocytes in the blood of uninfected mice and prevented leukopenia in infected mice. PMID:1729201

  14. Hessian Fly-Associated Bacteria: Transmission, Essentiality, and Composition

    PubMed Central

    Bansal, Raman; Hulbert, Scot; Schemerhorn, Brandi; Reese, John C.; Whitworth, R. Jeff; Stuart, Jeffrey J.; Chen, Ming-Shun

    2011-01-01

    Plant-feeding insects have been recently found to use microbes to manipulate host plant physiology and morphology. Gall midges are one of the largest groups of insects that manipulate host plants extensively. Hessian fly (HF, Mayetiola destructor) is an important pest of wheat and a model system for studying gall midges. To examine the role of bacteria in parasitism, a systematic analysis of bacteria associated with HF was performed for the first time. Diverse bacteria were found in different developmental HF stages. Fluorescent in situ hybridization detected a bacteriocyte-like structure in developing eggs. Bacterial DNA was also detected in eggs by PCR using primers targeted to different bacterial groups. These results indicated that HF hosted different types of bacteria that were maternally transmitted to the next generation. Eliminating bacteria from the insect with antibiotics resulted in high mortality of HF larvae, indicating that symbiotic bacteria are essential for the insect to survive on wheat seedlings. A preliminary survey identified various types of bacteria associated with different HF stages, including the genera Enterobacter, Pantoea, Stenotrophomonas, Pseudomonas, Bacillus, Ochrobactrum, Acinetobacter, Alcaligenes, Nitrosomonas, Arcanobacterium, Microbacterium, Paenibacillus, and Klebsiella. Similar bacteria were also found specifically in HF-infested susceptible wheat, suggesting that HF larvae had either transmitted bacteria into plant tissue or brought secondary infection of bacteria to the wheat host. The bacteria associated with wheat seedlings may play an essential role in the wheat-HF interaction. PMID:21858016

  15. Hessian fly-associated bacteria: transmission, essentiality, and composition.

    PubMed

    Bansal, Raman; Hulbert, Scot; Schemerhorn, Brandi; Reese, John C; Whitworth, R Jeff; Stuart, Jeffrey J; Chen, Ming-Shun

    2011-01-01

    Plant-feeding insects have been recently found to use microbes to manipulate host plant physiology and morphology. Gall midges are one of the largest groups of insects that manipulate host plants extensively. Hessian fly (HF, Mayetiola destructor) is an important pest of wheat and a model system for studying gall midges. To examine the role of bacteria in parasitism, a systematic analysis of bacteria associated with HF was performed for the first time. Diverse bacteria were found in different developmental HF stages. Fluorescent in situ hybridization detected a bacteriocyte-like structure in developing eggs. Bacterial DNA was also detected in eggs by PCR using primers targeted to different bacterial groups. These results indicated that HF hosted different types of bacteria that were maternally transmitted to the next generation. Eliminating bacteria from the insect with antibiotics resulted in high mortality of HF larvae, indicating that symbiotic bacteria are essential for the insect to survive on wheat seedlings. A preliminary survey identified various types of bacteria associated with different HF stages, including the genera Enterobacter, Pantoea, Stenotrophomonas, Pseudomonas, Bacillus, Ochrobactrum, Acinetobacter, Alcaligenes, Nitrosomonas, Arcanobacterium, Microbacterium, Paenibacillus, and Klebsiella. Similar bacteria were also found specifically in HF-infested susceptible wheat, suggesting that HF larvae had either transmitted bacteria into plant tissue or brought secondary infection of bacteria to the wheat host. The bacteria associated with wheat seedlings may play an essential role in the wheat-HF interaction. PMID:21858016

  16. Bioflocculant produced by Klebsiella sp. MYC and its application in the treatment of oil-field produced water

    NASA Astrophysics Data System (ADS)

    Yue, Lixi; Ma, Chunling; Chi, Zhenming

    2006-10-01

    Seventy-nine strains of bioflocculant-producing bacteria were isolated from 3 activated sludge samples. Among them, strain MYC was found to have the highest and stable flocculating rate for both kaolin clay suspension and oil-field produced water. The bacterial strain was identified as Klebsiella sp. MYC according to its morphological and biochemical characteristics and 16SrDNA sequence. The optimal medium for bioflocculant production by this bacterial strain was composed of cane sugar 20gL-1 KH2PO4 2g L-1, K2HPO45gL-1, (NH4)2SO4 0.2gL-1, urea 0.5 gL-1 and yeast extract 0.5 gL-1, the initial pH being 5.5. When the suspension of kaolin clay was treated with 0.5% of Klebsiella sp. MYC culture broth, the flocculating rate reached more than 90.0% in the presence of 500mgL1 CaCl2, while the flocculating rate for oil-field produced water was near 80.0% in a pH range of 7.0-9.0 with the separation of oil and suspended particles from the oil-field produced water under similar conditions. The environment-friendly nature of the bioflocculant and high flocculating rate of the strain make the bioflocculant produced by Klebsiella sp. MYC an attractive bioflocculant in oil-field produced water treatment.

  17. Bacteriocins as tools in analysis of nosocomial Klebsiella pneumoniae infections.

    PubMed

    Bauernfeind, A; Petermller, C; Schneider, R

    1981-07-01

    Epidemiological analysis of isolates from nosocomial infections caused by Klebsiella pneumoniae was improved by the use of bacteriocins in addition to capsular serotyping. Screening for bacteriocins produced by 77 reference strains for capsular serotyping identified 39 strains, and 8 of these strains were selected as a typing set. Using this set, we found that 241 to 259 (91%) nonepidemic clinical isolates of K. pneumoniae were inhibited by one or more of the eight producers. Of the most frequent bacteriocin type there were 31 examples (12%). High reproducibility of typing patterns (83.3%) and easy practicability of typing were achieved with a streak-and-point method avoiding the use of suspensions of bacteriocins and the risk of instability. The Klebsiella bacteriocins were active also on Enterobacter and Shigella species and on Escherichia coli strains, but were ineffective on other Enterobacteriacae. PMID:6790566

  18. KPC-producing Klebsiella pneumoniae, finally targeting Turkey.

    PubMed

    Labarca, J; Poirel, L; Ozdamar, M; Turkogl, S; Hakko, E; Nordmann, P

    2014-03-01

    We report here the first identification of the worldwide spread of Klebsiella pneumoniae carbapenemase-2-producing and carbapenem-resistant K.pneumoniae clone ST258 in Turkey, a country where the distantly-related carbapenemase OXA-48 is known to be endemic. Worryingly, this isolate was also resistant to colistin, now considered to be the last-resort antibiotic for carbapenem-resistant isolates. PMID:25356342

  19. KPC-producing Klebsiella pneumoniae, finally targeting Turkey

    PubMed Central

    Labarca, J; Poirel, L; zdamar, M; Turkogl, S; Hakko, E; Nordmann, P

    2014-01-01

    We report here the first identification of the worldwide spread of Klebsiella pneumoniae carbapenemase-2-producing and carbapenem-resistant K.pneumoniae clone ST258 in Turkey, a country where the distantly-related carbapenemase OXA-48 is known to be endemic. Worryingly, this isolate was also resistant to colistin, now considered to be the last-resort antibiotic for carbapenem-resistant isolates. PMID:25356342

  20. Immunological properties of purified Klebsiella pneumoniae heat-stable enterotoxin.

    PubMed Central

    Klipstein, F A; Engert, R F; Houghten, R A

    1983-01-01

    Klebsiella pneumoniae heat-stable enterotoxin was purified to apparent homogenicity by the same techniques used to purify Escherichia coli heat-stable enterotoxin. The two toxins had the same potency in the suckling mouse assay and showed immunological cross-reactivity in enzyme-linked immunosorbent assay, neutralization of secretory activity by specific hyperimmune antisera, and protection against active challenge in rats immunized with a vaccine containing synthetically produced E. coli heat-stable enterotoxin. PMID:6358035

  1. Draft Genome Sequences of Klebsiella variicola Plant Isolates

    PubMed Central

    Martnez-Romero, Esperanza; Silva-Sanchez, Jess; Barrios, Humberto; Rodrguez-Medina, Nadia; Martnez-Barnetche, Jess; Tllez-Sosa, Juan; Gmez-Barreto, Rosa Elena

    2015-01-01

    Three endophytic Klebsiella variicola isolatesT29A, 3, and 6A2, obtained from sugar cane stem, maize shoots, and banana leaves, respectivelywere used for whole-genome sequencing. Here, we report the draft genome sequences of circular chromosomes and plasmids. The genomes contain plant colonization and cellulases genes. This study will help toward understanding the genomic basis of K.variicola interaction with plant hosts. PMID:26358599

  2. Draft Genome Sequences of Klebsiella variicola Plant Isolates.

    PubMed

    Martnez-Romero, Esperanza; Silva-Sanchez, Jess; Barrios, Humberto; Rodrguez-Medina, Nadia; Martnez-Barnetche, Jess; Tllez-Sosa, Juan; Gmez-Barreto, Rosa Elena; Garza-Ramos, Ulises

    2015-01-01

    Three endophytic Klebsiella variicola isolates-T29A, 3, and 6A2, obtained from sugar cane stem, maize shoots, and banana leaves, respectively-were used for whole-genome sequencing. Here, we report the draft genome sequences of circular chromosomes and plasmids. The genomes contain plant colonization and cellulases genes. This study will help toward understanding the genomic basis of K.variicola interaction with plant hosts. PMID:26358599

  3. Isolation and characterization of Klebsiella pneumoniae unencapsulated mutants

    SciTech Connect

    Benedi, V.J.; Ciurana, B.; Tomas, J.M.

    1989-01-01

    Klebsiella pneumoniae mutants were obtained after UV irradiation and negative selection with anticapsular serum. Unencapsulation, rather than expression of a structurally altered capsule, was found in the mutants. The mutant strains showed no alterations in their outer membrane proteins and lipopolysaccharide, and a great similarity with the wild type in the properties tested (serum resistance, antimicrobial sensitivity, and lipopolysaccharide-specific bacteriophage sensitivity), with the exception of a higher cell surface hydrophobicity and resistance to bacteriophage FC3-9.

  4. Enumeration of Klebsiella spp. in cold water by using MacConkey-inositol-potassium tellurite medium.

    PubMed Central

    Dutka, B J; Jones, K; Bailey, H

    1987-01-01

    MacConkey-inositol-potassium tellurite agar was field tested for its ability to selectively enumerate Klebsiella species from the waters of the Saint John River Basin, which include fresh and marine waters. Water temperature varied from 1 to 6 degrees C during the survey period. Results of the study indicated that 77% of the typical colonies on MacConkey-inositol-potassium tellurite medium were Klebsiella species, but the total Klebsiella population enumerated was greatly underestimated. PMID:3662512

  5. Identification of Klebsiella Pneumoniae Genes Uniquely Expressed in a Strain Virulent Using a Murine Model of Bacterial Pneumonia

    PubMed Central

    Lau, Helen Y.; Clegg, Steven; Moore, Thomas A.

    2007-01-01

    Klebsiella pneumoniae is a gram negative bacterium of significant clinical importance. This study examines the differential pulmonary host anti-bacterial responses towards two clinical isolates of K. pneumoniae. Intratracheal inoculation with 7104 CFU of strain 43816 induced 100% mortality in C57BL/6J mice within 5 days post infection, whereas infection with 5105 CFU of strain IA565 resulted in 100% survival. Infection with strain 43816 resulted in significant pulmonary and peripheral blood bacterial burden and induction of the chemokines MIP-2, KC and MCP-1 by 24 hours post infection. In contrast, IA565-infected mice displayed basal chemokine levels and no detectable bacteria by 24 hours post inoculation were isolated from lungs or peripheral blood. These data indicate an apparent lack of pathogenicity of strain IA565. Since little is known about Klebsiella-specific virulence genes, we have utilized PCR-based genomic DNA and cDNA suppressive subtractive hybridization and identified nine DNA sequences unique to a pathogenic strain of K. pneumoniae 43816. These sequences were highly homologous to enteric bacterial genes regulating iron uptake, fimbrial-mediated adhesion, energy production and conversion, transcriptional regulation, signal transduction, restriction endonuclease activity, and membrane transport. PMID:17369011

  6. Cofactor engineering through heterologous expression of an NADH oxidase and its impact on metabolic flux redistribution in Klebsiella pneumoniae

    PubMed Central

    2013-01-01

    Background Acetoin is an important bio-based platform chemical. However, it is usually existed as a minor byproduct of 2,3-butanediol fermentation in bacteria. Results The present study reports introducing an exogenous NAD+ regeneration sysytem into a 2,3-butanediol producing strain Klebsiella pneumoniae to increse the accumulation of acetoin. Batch fermentation suggested that heterologous expression of the NADH oxidase in K. pneumoniae resulted in large decreases in the intracellular NADH concentration (1.4 fold) and NADH/NAD+ ratio (2.0 fold). Metabolic flux analysis revealed that fluxes to acetoin and acetic acid were enhanced, whereas, production of lactic acid and ethanol were decreased, with the accumualation of 2,3-butanediol nearly unaltered. By fed-batch culture of the recombinant, the highest reported acetoin production level (25.9 g/L) by Klebsiella species was obtained. Conclusions The present study indicates that microbial production of acetoin could be improved by decreasing the intracellular NADH/NAD+ ratio in K. pneumoniae. It demonstrated that the cofactor engineering method, which is by manipulating the level of intracellular cofactors to redirect cellular metabolism, could be employed to achieve a high efficiency of producing the NAD+-dependent microbial metabolite. PMID:23351660

  7. Ankylosing spondylitis, HLA-B27, and Klebsiella: a study of lymphocyte reactivity of anti-Klebsiella sera.

    PubMed Central

    Singh, B; Milton, J D; Woodrow, J C

    1986-01-01

    Twenty three anti-Klebsiella antisera were tested for their cytotoxic activity and four for their binding capacity for peripheral blood lymphocytes (PBL) from patients with HLA-B27 positive ankylosing spondylitis (AS+B27+) and from B27 positive (AS-B27+) and B27 negative (AS-B27-) healthy individuals. None of the antisera showed specific activity against PBL from any particular group. The antisera tested included two anti-Klebsiella K43 sera provided by an Australian group, who have reported them to be specifically cytotoxic for AS+B27+ PBL, four antisera raised against a Klebsiella K43 strain provided by this group, and an antiserum from another group, who have reported it as having increased binding capacity for AS+B27+ and AS-B27+ PBL compared with AS-B27- PBL. The results of other workers who have attempted to reproduce the results of either group are reviewed and the possible reasons for the repeated failure to confirm the reported findings are discussed. PMID:3485408

  8. Klebsiella sp. strain C2A isolated from olive oil mill waste is able to tolerate and degrade tannic acid in very high concentrations.

    PubMed

    Pepi, Milva; Cappelli, Serena; Hachicho, Nancy; Perra, Guido; Renzi, Monia; Tarabelli, Alessandro; Altieri, Roberto; Esposito, Alessandro; Focardi, Silvano E; Heipieper, Hermann J

    2013-06-01

    Four bacterial strains capable of growing in the presence of tannic acid as sole carbon and energy source were isolated from olive mill waste mixtures. 16S rRNA gene sequencing assigned them to the genus Klebsiella. The most efficient strain, Klebsiella sp. strain C2A, was able to degrade 3.5gL(-1) tannic acid within 35h with synthesizing gallic acid as main product. The capability of Klebsiella sp. strain C2A to produce tannase was evidenced at high concentrations of tannic acid up to 50gL(-1) . The bacteria adapted to the toxicity of tannic acids by an increase in the membrane lipid fatty acids degree of saturation, especially in the presence of concentrations higher than 20gL(-1) . The highly tolerant and adaptable bacterial strain characterized in this study could be used in bioremediation processes of wastes rich in polyphenols such as those derived from olive mills, winery or tanneries. PMID:23521025

  9. pH and water content of Pseudomonas aeruginosa- and Klebsiella pneumoniae-Colonized Perineal Skin of Men with spinal cord injuries.

    PubMed Central

    Montgomerie, J Z; Schick, D G; Gilmore, D S; Graham, I E

    1983-01-01

    Men with spinal cord injuries have a high incidence of Pseudomonas aeruginosa colonization of the perineum. Studies were carried out to determine whether colonization with Pseudomonas aeruginosa or Klebsiella pneumoniae is associated with changes in the pH or surface moisture of the perineal skin. Increased skin moisture correlated with a higher pH (P less than 0.01). In patients using the external urinary collection system, the pH was significantly higher on the perineum of patients colonized with P. aeruginosa or K. pneumoniae than on the perineum of patients not colonized with these bacteria. There was no correlation between moisture and colonization. PMID:6415099

  10. Methanotrophic bacteria.

    PubMed Central

    Hanson, R S; Hanson, T E

    1996-01-01

    Methane-utilizing bacteria (methanotrophs) are a diverse group of gram-negative bacteria that are related to other members of the Proteobacteria. These bacteria are classified into three groups based on the pathways used for assimilation of formaldehyde, the major source of cell carbon, and other physiological and morphological features. The type I and type X methanotrophs are found within the gamma subdivision of the Proteobacteria and employ the ribulose monophosphate pathway for formaldehyde assimilation, whereas type II methanotrophs, which employ the serine pathway for formaldehyde assimilation, form a coherent cluster within the beta subdivision of the Proteobacteria. Methanotrophic bacteria are ubiquitous. The growth of type II bacteria appears to be favored in environments that contain relatively high levels of methane, low levels of dissolved oxygen, and limiting concentrations of combined nitrogen and/or copper. Type I methanotrophs appear to be dominant in environments in which methane is limiting and combined nitrogen and copper levels are relatively high. These bacteria serve as biofilters for the oxidation of methane produced in anaerobic environments, and when oxygen is present in soils, atmospheric methane is oxidized. Their activities in nature are greatly influenced by agricultural practices and other human activities. Recent evidence indicates that naturally occurring, uncultured methanotrophs represent new genera. Methanotrophs that are capable of oxidizing methane at atmospheric levels exhibit methane oxidation kinetics different from those of methanotrophs available in pure cultures. A limited number of methanotrophs have the genetic capacity to synthesize a soluble methane monooxygenase which catalyzes the rapid oxidation of environmental pollutants including trichloroethylene. PMID:8801441

  11. CTX-M-Type Extended-Spectrum ?-Lactamase-Producing Klebsiella pneumoniae Isolated from Cases of Bovine Mastitis in Japan

    PubMed Central

    SAISHU, Nobukazu; OZAKI, Hiroichi; MURASE, Toshiyuki

    2014-01-01

    ABSTRACT Three Klebsiella pneumoniae isolates producing extended-spectrum beta-lactamase (ESBL) were obtained from three dairy cows with clinical mastitis in two farms in western Japan. Two of the 3 isolates from cows in different farms were able to transfer plasmids carrying the blaCTX-M-2 gene to Escherichia coli recipient. Pulsed-field gel electrophoresis (PFGE) patterns of the 2 isolates were different from each other, although restricted-fragment patterns of the two conjugative plasmids were similar to each other. Additionally, PCR-based replicon typing revealed that both the plasmids belonged to type Inc.T. These results suggest that ESBL-encoding genes can be distributed in bacteria on dairy farms through the plasmids. PMID:24784438

  12. A New Klebsiella planticola Strain (Cd-1) Grows Anaerobically at High Cadmium Concentrations and Precipitates Cadmium Sulfide

    PubMed Central

    Sharma, Pramod K.; Balkwill, David L.; Frenkel, Anatoly; Vairavamurthy, Murthy A.

    2000-01-01

    Heavy metal resistance by bacteria is a topic of much importance to the bioremediation of contaminated soils and sediments. We report here the isolation of a highly cadmium-resistant Klebsiella planticola strain, Cd-1, from reducing salt marsh sediments. The strain grows in up to 15 mM CdCl2 under a wide range of NaCl concentrations and at acidic or neutral pH. In growth medium amended with thiosulfate, it precipitated significant amounts of cadmium sulfide (CdS), as confirmed by x-absorption spectroscopy. In comparison with various other strains tested, Cd-1 is superior for precipitating CdS in cultures containing thiosulfate. Thus, our results suggest that Cd-1 is a good candidate for the accelerated bioremediation of systems contaminated by high levels of cadmium. PMID:10877810

  13. Antibiofilm efficacy of silver nanoparticles against biofilm of extended spectrum β-lactamase isolates of Escherichia coli and Klebsiella pneumoniae

    NASA Astrophysics Data System (ADS)

    Ansari, Mohammad Azam; Khan, Haris M.; Khan, Aijaz A.; Cameotra, Swaranjit Singh; Pal, Ruchita

    2014-10-01

    The ability of bacteria to develop antibiotic resistance and colonize abiotic surfaces by forming biofilms is a major cause of medical implant-associated infections and results in prolonged hospitalization periods and patient mortality. Different approaches have been used for preventing biofilm-related infections in health care settings. Many of these methods have their own demerits that include chemical-based complications; emergent antibiotic-resistant strains, and so on. Silver nanoparticles (AgNPs) are renowned for their influential antimicrobial activity. We demonstrate the biofilm formation by extended spectrum β-lactamases-producing Escherichia coli and Klebsiella spp. by direct visualization applying tissue culture plate, tube, and Congo red agar methods. Double fluorescent staining for confocal laser scanning microscopy (CLSM) consisted of propidium iodide staining to detect bacterial cells and concanavalin A-fluorescein isothiocyanate staining to detect the exopolysaccharides matrix were used. Scanning electron microscopy observations clearly indicate that AgNPs reduced the surface coverage by E. coli and Klebsiella spp. thus prevent the biofilm formations. Double-staining technique using CLSM provides the visual evidence that AgNPs arrested the bacterial growth and prevent the exopolysaccharides formation. The AgNPs-coated surfaces effectively restricted biofilm formation of the tested bacteria. In our study, we could demonstrate the complete antibiofilm activity AgNPs at a concentration as low as 50 μg/ml. Our findings suggested that AgNPs can be exploited towards the development of potential antibacterial coatings for various biomedical and environmental applications. These formulations can be used for the treatment of drug-resistant bacterial infections caused by biofilms, at much lower nanosilver loading with higher efficiency.

  14. Deep transcriptome profiling of clinical Klebsiella pneumoniae isolates reveals strain and sequence type-specific adaptation.

    PubMed

    Bruchmann, Sebastian; Muthukumarasamy, Uthayakumar; Pohl, Sarah; Preusse, Matthias; Bielecka, Agata; Nicolai, Tanja; Hamann, Isabell; Hillert, Roger; Kola, Axel; Gastmeier, Petra; Eckweiler, Denitsa; Häussler, Susanne

    2015-11-01

    Health-care-associated infections by multi-drug-resistant bacteria constitute one of the greatest challenges to modern medicine. Bacterial pathogens devise various mechanisms to withstand the activity of a wide range of antimicrobial compounds, among which the acquisition of carbapenemases is one of the most concerning. In Klebsiella pneumoniae, the dissemination of the K. pneumoniae carbapenemase is tightly connected to the global spread of certain clonal lineages. Although antibiotic resistance is a key driver for the global distribution of epidemic high-risk clones, there seem to be other adaptive traits that may explain their success. Here, we exploited the power of deep transcriptome profiling (RNA-seq) to shed light on the transcriptomic landscape of 37 clinical K. pneumoniae isolates of diverse phylogenetic origins. We identified a large set of 3346 genes which was expressed in all isolates. While the core-transcriptome profiles varied substantially between groups of different sequence types, they were more homogenous among isolates of the same sequence type. We furthermore linked the detailed information on differentially expressed genes with the clinically relevant phenotypes of biofilm formation and bacterial virulence. This allowed for the identification of a diminished expression of biofilm-specific genes within the low biofilm producing ST258 isolates as a sequence type-specific trait. PMID:26261087

  15. Reduction of capsular polysaccharide production in Klebsiella pneumoniae by sodium salicylate.

    PubMed Central

    Domenico, P; Schwartz, S; Cunha, B A

    1989-01-01

    Heavily encapsulated Klebsiella pneumoniae (serotypes 1 and 2) was cultured in the presence of sodium salicylate. The addition of salicylate (2 to 30 micrograms/ml) progressively decreased the amount of capsular polysaccharide produced by all strains without significantly inhibiting cell growth. Further addition of salicylate (50 to 200 micrograms/ml) was progressively inhibitory to cell growth and decreased the production of polysaccharide only slightly. The optimal concentration of salicylate that could reduce the polysaccharide production of heavily encapsulated, virulent strains by 50% or more was 30 micrograms/ml. Mutants of these bacteria that produced less capsule were affected by salicylate to a lesser degree. All concentrations of salicylate tested were physiologically achievable in humans and within the therapeutic range of aspirin. The addition of calcium and magnesium partially reversed the effects of salicylate on polysaccharide production. Chelating agents, particularly EGTA [ethylene-bis(oxyethylenenitrile)tetraacetic acid], reduce capsule production as salicylate did. Thus, the chelation of calcium and magnesium by salicylate could account, at least in part, for the reduction of capsule. Optical density measurements allowed for rapid monitoring of capsule production in various culture media because a large part of culture turbidity was apparently due to the capsule. Decreased production of the primary K. pneumoniae virulence factor with salicylate may have therapeutic potential. PMID:2680983

  16. Emergence of Klebsiella pneumoniae clinical isolates producing KPC-2 carbapenemase in Cuba

    PubMed Central

    Quiñones, D; Hart, M; Espinosa, F; Garcia, S; Carmona, Y; Ghosh, S; Urushibara, N; Kawaguchiya, M; Kobayashi, N

    2014-01-01

    The emergence of Klebsiella pneumoniae producing carbapenemase (KPC) has now become a global concern. As a part of a nationwide multicentre surveillance study in Cuba, three K. pneumoniae clinical isolates resistant to carbapenems were detected for a 1-month period (September to October 2011). PCR and sequence analysis revealed that the three strains harboured blaKPC-2. They showed resistance or intermediate susceptibility to expanded-spectrum cephalosporins, other β-lactams, a β-lactam/β-lactamase inhibitor combination, and gentamicin. Two strains were susceptible only to colistin, whereas the other strain showing colistin resistance was susceptible to fluoroquinolones. These blaKPC-2-positive K. pneumoniae strains were classified into ST1271 (CC29), a novel clone harbouring blaKPC-2, and were revealed to be genetically identical by PCR-based DNA fingerprinting. The three patients infected with the KPC-producing K. pneumoniae had common risk factors, and had no overseas travel experience outside Cuba, suggesting local acquisition of the resistant pathogen. This is the first report of a KPC-producing K. pneumoniae in Cuba. Although detection of KPC in Enterobacteriaceae is still rare in Cuba, our finding indicated that KPC-producing bacteria are a global concern and highlighted the need to identify these microorganisms in clinical laboratories. PMID:25356357

  17. Comparison of the malA regions of Escherichia coli and Klebsiella pneumoniae.

    PubMed Central

    Bloch, M A; Raibaud, O

    1986-01-01

    Using the mini-Mu-duction technique, we cloned the malA regions from Escherichia coli K-12 and Klebsiella pneumoniae. A comparison of the structures of the cloned DNAs indicated that the malT, malP, and malQ genes, encoding the transcriptional activator of the maltose regulon, maltodextrin phosphorylase, and amylomaltase, respectively, are similarly organized in both species; malP and malQ constitute an operon divergent from the malT gene. We sequenced 1,200 nucleotides encompassing the beginnings of the malT and malP genes, their promoters, and the intergenic region. The DNA sequences from the two species were very different; the levels of homology ranged from 28 to 80%, depending on the region. The sequences of the coding regions and of elements known to be important for the functions of these two promoters in E. coli were well conserved between the two bacteria, whereas the sequence of the malT-malP intergenic region had totally diverged. Images PMID:2946664

  18. Inactivation of the virulence factors from 2,3-butanediol-producing Klebsiella pneumoniae.

    PubMed

    Huynh, Duyen Thi Ngoc; Kim, Ah-Young; Seol, In-Hye; Jung, Samuel; Lim, Min-Cheol; Lee, Jeong-A; Jo, Mi-Rae; Choi, Soo-Jin; Kim, Borim; Lee, Jinwon; Kim, Wooki; Kim, Young-Rok

    2015-11-01

    The microbiological production of 2,3-butanediol (2,3-BDO) has attracted considerable attention as an alternative way to produce high-value chemicals from renewable sources. Among the number of 2,3-BDO-producing microorganisms, Klebsiella pneumoniae has been studied most extensively and is known to produce large quantity of 2,3-BDO from a range of substrates. On the other hand, the pathogenic characteristics of the bacteria have limited its industrial applications. In this study, two major virulence traits, outer core LPS and fimbriae, were removed through homologous recombination from 2,3-BDO-producing K. pneumoniae 2242 to expand its uses to the industrial scale. The K. pneumoniae 2242 ?wabG mutant strain was found to have an impaired capsule, which significantly reduced its ability to bind to the mucous layer and evade the phagocytic activity of macrophage. The association with the human ileocecal epithelial cell, HCT-8, and the bladder epithelial cell, T-24, was also reduced dramatically in the K. pneumoniae 2242 ?fimA mutant strain that was devoid of fimbriae. However, the growth rate and production yield for 2,3-BDO were unaffected. The K. pneumoniae strains developed in this study, which are devoid of the major virulence factors, have a high potential for the efficient and sustainable production of 2,3-BDO. PMID:26239074

  19. Molecular dissection of the evolution of carbapenem-resistant multilocus sequence type 258 Klebsiella pneumoniae

    PubMed Central

    DeLeo, Frank R.; Chen, Liang; Porcella, Stephen F.; Martens, Craig A.; Kobayashi, Scott D.; Porter, Adeline R.; Chavda, Kalyan D.; Jacobs, Michael R.; Mathema, Barun; Olsen, Randall J.; Bonomo, Robert A.; Musser, James M.; Kreiswirth, Barry N.

    2014-01-01

    Infections caused by drug-resistant bacteria are a major problem worldwide. Carbapenem-resistant Klebsiella pneumoniae, most notably isolates classified as multilocus sequence type (ST) 258, have emerged as an important cause of hospital deaths. ST258 isolates are predominantly multidrug resistant, and therefore infections caused by them are difficult to treat. It is not known why the ST258 lineage is the most prevalent cause of multidrug-resistant K. pneumoniae infections in the United States and other countries. Here we tested the hypothesis that carbapenem-resistant ST258 K. pneumoniae is a single genetic clone that has disseminated worldwide. We sequenced to closure the genomes of two ST258 clinical isolates and used these genomes as references for comparative genome sequencing of 83 additional clinical isolates recovered from patients at diverse geographic locations worldwide. Phylogenetic analysis of the SNPs in the core genome of these isolates revealed that ST258 K. pneumoniae organisms are two distinct genetic clades. This unexpected finding disproves the single-clone hypothesis. Notably, genetic differentiation between the two clades results from an ?215-kb region of divergence that includes genes involved in capsule polysaccharide biosynthesis. The region of divergence appears to be a hotspot for DNA recombination events, and we suggest that this region has contributed to the success of ST258 K. pneumoniae. Our findings will accelerate research on novel diagnostic, therapeutic, and vaccine strategies designed to prevent and/or treat infections caused by multidrug resistant K. pneumoniae. PMID:24639510

  20. Klebsiella pneumoniae subsp. pneumoniae–bacteriophage combination from the caecal effluent of a healthy woman

    PubMed Central

    Neve, Horst; Heller, Knut J.; Turton, Jane F.; Mahony, Jennifer; Sanderson, Jeremy D.; Hudspith, Barry; Gibson, Glenn R.; McCartney, Anne L.

    2015-01-01

    A sample of caecal effluent was obtained from a female patient who had undergone a routine colonoscopic examination. Bacteria were isolated anaerobically from the sample, and screened against the remaining filtered caecal effluent in an attempt to isolate bacteriophages (phages). A lytic phage, named KLPN1, was isolated on a strain identified as Klebsiella pneumoniae subsp. pneumoniae (capsular type K2, rmpA+). This Siphoviridae phage presents a rosette-like tail tip and exhibits depolymerase activity, as demonstrated by the formation of plaque-surrounding haloes that increased in size over the course of incubation. When screened against a panel of clinical isolates of K. pneumoniae subsp. pneumoniae, phage KLPN1 was shown to infect and lyse capsular type K2 strains, though it did not exhibit depolymerase activity on such hosts. The genome of KLPN1 was determined to be 49,037 bp (50.53 %GC) in length, encompassing 73 predicted ORFs, of which 23 represented genes associated with structure, host recognition, packaging, DNA replication and cell lysis. On the basis of sequence analyses, phages KLPN1 (GenBank: KR262148) and 1513 (a member of the family Siphoviridae, GenBank: KP658157) were found to be two new members of the genus “Kp36likevirus.” PMID:26246963

  1. Growth and heavy metal removal by Klebsiella aerogenes at different pH and temperature

    SciTech Connect

    Al-Shahwani, M.F.; Jazrawi, S.F.; Al-Rawi, E.H.; Ayar, N.S.

    1984-01-01

    A strain of Klebsiella aerogenes isolated from Rustamiyah Station for treatment of wastewater was examined for its ability to grow in a media supplemented with maximum tolerance concentrations of Pb/sup + +/, Zn/sup + +/, Ni/sup + +/, and Cd/sup + +/, separately, at different temperatures and initial pH. The results indicated that at 28/sup 0/C during the first 24 hr, Pb/sup + +/ and Ni/sup + +/ had no effect on the growth of the bacteria, while the presence of Zn/sup + +/ and Cd/sup + +/ decreased the cell count. The growth reached a maximum level after the second day and started to decrease gradually. The bacterial count at 37/sup 0/C was less than that at 28/sup 0/C. No bacterial multiplication occurred at 44/sup 0/C. There was little difference between heavy metal removal at 28 and 37/sup 0/C. At 44/sup 0/C, little removal took place. In general, slightly acidic or neutral medium was better for both bacterial growth and metal removal.

  2. Crystal structures of Klebsiella pneumoniae pantothenate kinase in complex with N-substituted pantothenamides.

    PubMed

    Li, Buren; Tempel, Wolfram; Smil, David; Bolshan, Yuri; Schapira, Matthieu; Park, Hee-Won

    2013-08-01

    N-Substituted pantothenamides are derivatives of pantothenate, the precursor in the biosynthesis of the essential metabolic cofactor coenzyme A (CoA). These compounds are substrates of pantothenate kinase (PanK) in the first step of CoA biosynthesis and possess antimicrobial activity against various pathogenic bacteria. Here we solved the crystal structure of the Klebsiella pneumoniae PanK (KpPanK) in complex with N-pentylpantothenamide (N5-Pan) to understand the molecular basis of its antimicrobial activity. The structure reveals a polar pocket interacting with the pantothenate moiety of N5-Pan and an aromatic pocket loosely protecting the pentyl tail, suggesting that the introduction of an aromatic ring to a new pantothenamide may enhance the compound's affinity to KpPanK. To test this idea, we synthesized N-pyridin-3-ylmethylpantothenamide (Np-Pan) and solved its co-crystal structure with KpPanK. The structure reveals two alternat conformations of the aromatic ring of Np-Pan bound at the aromatic pocket, providing the basis for further improvement of pantothenamide binding to KpPanK. PMID:23553820

  3. Role of Lung Epithelial Cells in Defense against Klebsiella pneumoniae Pneumonia

    PubMed Central

    Corts, Guadalupe; lvarez, Dolores; Saus, Carles; Albert, Sebastin

    2002-01-01

    The airway epithelium represents a primary site for the entry of pathogenic bacteria into the lungs. It has been suggested for many respiratory pathogens, including Klebsiella pneumoniae, that adhesion and invasion of the lung epithelial cells is an early stage of the pneumonia process. We observed that poorly encapsulated K. pneumoniae clinical isolates and an isogenic unencapsulated mutant invaded lung epithelial cells more efficiently than highly encapsulated strains independent of the K type. By contrast, the unencapsulated mutant was completely avirulent in a mouse model of pneumonia, unlike the wild-type strain, which produced pneumonia and systemic infection. Furthermore, the unencapsulated mutant bound more epithelially produced complement component C3 than the wild-type strain. Our results show that lung epithelial cells play a key role as a host defense mechanism against K. pneumoniae pneumonia, using two different strategies: (i) ingestion and control of the microorganisms and (ii) opsonization of the microorganisms. Capsular polysaccharide avoids both mechanisms and enhances the virulence of K. pneumoniae. PMID:11854185

  4. Citrate uptake in membrane vesicles of Klebsiella aerogenes.

    PubMed Central

    Johnson, C L; Cha, Y A; Stern, J R

    1975-01-01

    In whole cells of Klebsiella aerogenes grown anaerobically on citrate as sole carbon source, citrate uptake is followed by rapid catabolism of the substrate via the inducible citrate fermentation pathway. Membrane vesicles prepared from such cells take up citrate but do not catabolize it. Vesicles process d-lactate dehydrogenase and the Na+-requiring oxalacetate decarboxylase. Citrate is taken up in the presence of Na+, and other monovalent cations, such as NH4+, Rb+, Cs+, or K+, do not substitute for Na+. Li+ appears to act synergistically with Na+. Citrate uptake is inhibited by N-2, cyanide, azide, sulfhydryl reagents, dinitrophenol, fluorcitrate, and hydroxycitrate. PMID:1112775

  5. Modulation of respiratory dendritic cells during Klebsiella pneumonia infection

    PubMed Central

    2013-01-01

    Background Klebsiella pneumoniae is a leading cause of severe hospital-acquired respiratory tract infections and death but little is known regarding the modulation of respiratory dendritic cell (DC) subsets. Plasmacytoid DC (pDC) are specialized type 1 interferon producing cells and considered to be classical mediators of antiviral immunity. Method By using multiparameter flow cytometry analysis we have analysed the modulation of respiratory DC subsets after intratracheal Klebsiella pneumonia infection. Results Data indicate that pDCs and MoDC were markedly elevated in the post acute pneumonia phase when compared to mock-infected controls. Analysis of draining mediastinal lymph nodes revealed a rapid increase of activated CD103+ DC, CD11b+ DC and MoDC within 48h post infection. Lung pDC identification during bacterial pneumonia was confirmed by extended phenotyping for 120G8, mPDCA-1 and Siglec-H expression and by demonstration of high Interferon-alpha producing capacity after cell sorting. Cytokine expression analysis of ex vivo-sorted respiratory DC subpopulations from infected animals revealed elevated Interferon-alpha in pDC, elevated IFN-gamma, IL-4 and IL-13 in CD103+ DC and IL-19 and IL-12p35 in CD11b+ DC subsets in comparison to CD11c+ MHC-class IIlow cells indicating distinct functional roles. Antigen-specific naive CD4+ T cell stimulatory capacity of purified respiratory DC subsets was analysed in a model system with purified ovalbumin T cell receptor transgenic naive CD4+ responder T cells and respiratory DC subsets, pulsed with ovalbumin and matured with Klebsiella pneumoniae lysate. CD103+ DC and CD11b+ DC subsets represented the most potent naive CD4+ T helper cell activators. Conclusion These results provide novel insight into the activation of respiratory DC subsets during Klebsiella pneumonia infection. The detection of increased respiratory pDC numbers in bacterial pneumonia may indicate possible novel pDC functions with respect to lung repair and regeneration. PMID:24044871

  6. Effect of a Metalloantibiotic Produced by Pseudomonas aeruginosa on Klebsiella pneumoniae Carbapenemase (KPC)-producing K. pneumoniae.

    PubMed

    Kerbauy, Gilselena; Vivan, Ana C P; Simes, Glenda C; Simionato, Ane S; Pelisson, Marsileni; Vespero, Eliana C; Costa, Silvia F; de J Andrade, Celia G T; Barbieri, Daiane M; Mello, Joo C P; Morey, Alexandre T; Yamauchi, Lucy M; Yamada-Ogatta, Sueli F; de Oliveira, Admilton G; Andrade, Galdino

    2016-01-01

    Multidrug-resistant organisms (MDRO) are a great problem in hospitals, where thousands of people are infected daily, with the occurrence of high mortality rates, especially in infections caused by Klebsiella pneumoniae carbapenemase-producing K. pneumoniae (KPC-producing Kpn). The challenge is to find new compounds that can control KPC producing-Kpn infections. The aim of this study was to evaluate the antibiotic activity of the F3d fraction produced by the Pseudomonas aeruginosa LV strain against clinical isolates of KPC-producing Kpn. The results showed that the minimum inhibitory concentration of F3d (62.5 g mL(-1)), containing an organic metallic compound, killed planktonic cells of KPC-producing Kpn strains after 30 min of incubation. At the same concentration, this fraction also showed an inhibitory effect against biofilm of these bacteria after 24 h of incubation. Treatment with the F3d fraction caused pronounced morphological alterations in both planktonic and biofilm cells of the bacteria. The inhibitory effect of the F3d fraction seems to be more selective for the bacteria than the host cells, indicating its potential in the development of new drugs for the treatment of infections caused by KPC-producing Kpn and other MDRO. PMID:26891742

  7. Intrathecal administration of colistin for meningitis due to New Delhi metallo-β-lactamase 1(NDM-1)-producing Klebsiella pneumoniae.

    PubMed

    Inamasu, Joji; Ishikawa, Kiyohito; Oheda, Motoki; Nakae, Shunsuke; Hirose, Yuichi; Yoshida, Shunji

    2016-03-01

    Infection by bacteria carrying New Delhi metallo-β-lactamase 1 (NDM-1) is becoming a global health problem. We report a case of meningitis caused by NDM-1-producing Klebsiella pneumoniae, for which intrathecal administration of colistin was curative. A previously healthy 38-year-old Japanese man, who lived in Hyderabad, India, suddenly collapsed and was brought to a local hospital. He was diagnosed with subarachnoid hemorrhage and underwent emergency surgery which included partial skull removal. Approximately 1 month after surgery, he was repatriated to Japan and was admitted to our institution with information that he had been treated for multi-drug resistant Acinetobacter infection with colistin. A week after admission, he developed aspiration pneumonia due to NDM-1-producing K. pneumoniae, which was successfully treated by intravenous (IV) administration of colistin. Subsequently, he underwent a surgical procedure to repair his skull defect. He developed high-grade fever and altered mental status on postoperative day 2. NDM-1-producing K. pneumoniae was identified in the cerebrospinal fluid, establishing the diagnosis of meningitis. Although IV colistin was only partially effective, intrathecal colistin (10 mg daily by lumbar puncture for 14 days) successfully eradicated the meningitis. Because of economic globalization, NDM-1-producing bacteria may be brought to Japan by those who are repatriated after sustaining critical illnesses and being treated in foreign countries. This report may provide useful information on the treatment of central nervous system infection by NDM-1-producing bacteria. PMID:26683242

  8. R-plasmid-encoded adhesive factor in Klebsiella pneumoniae strains responsible for human nosocomial infections.

    PubMed Central

    Darfeuille-Michaud, A; Jallat, C; Aubel, D; Sirot, D; Rich, C; Sirot, J; Joly, B

    1992-01-01

    Klebsiella pneumoniae strains involved in hospital outbreaks of nosocomial infections, such as suppurative lesions, bacteremia, and septicemia, were resistant to multiple antibiotics including broad-spectrum cephalosporins. Epidemiologic investigations revealed that the reservoir for these K. pneumoniae strains was the gastrointestinal tracts of the patients. The study of the adherence ability of the strains reported here showed that these bacteria adhered to the microvilli of the Caco-2 cell line. This adhesion was mediated by a nonfimbrial protein with a molecular mass of 29,000 Da designated CF29K. Pretreatment of bacteria with antibodies raised against CF29K or Caco-2 cells with purified CF29K prevented the adhesion of K. pneumoniae strains to Caco-2 cells. CF29K immunologically cross-reacted with the CS31A surface protein of Escherichia coli strains involved in septicemia in calves. Genes encoding CF29K were located on a high-molecular-weight conjugative R plasmid, which transferred to E. coli K-12. Transconjugants expressed a large amount of CF29K protein and adhered to the brush border of Caco-2 cells. These findings show that K. pneumoniae strains were able to colonize the human intestinal tract through a plasmid-encoded 29,000-Da surface protein. Hybridization experiments indicated that the gene encoding resistance to broad-spectrum cephalosporins by the production of CAZ-1 enzyme and the gene encoding the adhesive property to intestinal cells were both located on a 20- to 22-kb EcoRI restriction DNA fragment. Genes encoding aerobactin and the ferric aerobactin receptor were also found on this R plasmid. Images PMID:1345909

  9. Susceptibility of Austrian Clinical Klebsiella and Enterobacter Isolates Linked to Patient-Related Data

    PubMed Central

    Badura, Alexandra; Pregartner, Gudrun; Holzer, Judith C.; Feierl, Gebhard; Grisold, Andrea J.

    2016-01-01

    The aim of the study was to analyze the antimicrobial susceptibility of Austrian clinical Klebsiella sp. and Enterobacter sp. isolates linked to patient-related data over a time period from 1998 to 2014. The main findings of this study were (i) a marked difference of antibiotic susceptibility rates between different infection sites for both Klebsiella sp. and Enterobacter sp., (ii) significantly greater percentages of resistant isolates among both Klebsiella sp. and Enterobacter sp. in male patients compared to female patients and (iii) significantly greater percentages of resistant isolates among both Klebsiella sp. and Enterobacter sp. from hospital-derived samples compared to samples from the community. In conclusion, our statistical data analysis clearly indicated a strong association of patient-related data and Klebsiella sp. and Enterobacter sp. susceptibility profiles. PMID:26903953

  10. Tolerance of Anaerobic Bacteria to Chlorinated Solvents

    PubMed Central

    Koenig, Joanna C.; Groissmeier, Kathrin D.; Manefield, Mike J.

    2014-01-01

    The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515

  11. Tolerance of anaerobic bacteria to chlorinated solvents.

    PubMed

    Koenig, Joanna C; Groissmeier, Kathrin D; Manefield, Mike J

    2014-01-01

    The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515

  12. Endocarditis Due to Rare and Fastidious Bacteria

    PubMed Central

    Brouqui, P.; Raoult, D.

    2001-01-01

    The etiologic diagnosis of infective endocarditis is easily made in the presence of continuous bacteremia with gram-positive cocci. However, the blood culture may contain a bacterium rarely associated with endocarditis, such as Lactobacillus spp., Klebsiella spp., or nontoxigenic Corynebacterium, Salmonella, Gemella, Campylobacter, Aeromonas, Yersinia, Nocardia, Pasteurella, Listeria, or Erysipelothrix spp., that requires further investigation to establish the relationship with endocarditis, or the blood culture may be uninformative despite a supportive clinical evaluation. In the latter case, the etiologic agents are either fastidious extracellular or intracellular bacteria. Fastidious extracellular bacteria such as Abiotrophia, HACEK group bacteria, Clostridium, Brucella, Legionella, Mycobacterium, and Bartonella spp. need supplemented media, prolonged incubation time, and special culture conditions. Intracellular bacteria such as Coxiella burnetii cannot be isolated routinely. The two most prevalent etiologic agents of culture-negative endocarditis are C. burnetti and Bartonella spp. Their diagnosis is usually carried out serologically. A systemic pathologic examination of excised heart valves including periodic acid-Schiff (PAS) staining and molecular methods has allowed the identification of Whipple's bacillus endocarditis. Pathologic examination of the valve using special staining, such as Warthin-Starry, Gimenez, and PAS, and broad-spectrum PCR should be performed systematically when no etiologic diagnosis is evident through routine laboratory evaluation. PMID:11148009

  13. Epidemiology and Outcome of Klebsiella Species Bloodstream Infection: A Population-Based Study

    PubMed Central

    Al-Hasan, Majdi N.; Lahr, Brian D.; Eckel-Passow, Jeanette E.; Baddour, Larry M.

    2010-01-01

    OBJECTIVE: To determine incidence rate, seasonal variation, and short- and long-term outcomes of Klebsiella species bloodstream infection (BSI) in a population-based setting. PATIENTS AND METHODS: We identified 127 unique patients in Olmsted County, Minnesota, from January 1, 1998, to December 31, 2007, who had Klebsiella spp BSI. Multivariable Poisson regression was used to examine temporal change and seasonal variation in incidence rate, and Cox proportional hazards regression was used to determine predictors of mortality. RESULTS: The age-adjusted incidence rate of Klebsiella spp BSI per 100,000 person-years was 15.4 (95% confidence interval [CI], 11.6-19.2) in men and 9.4 (95% CI, 7.0-11.8) in women. There was no linear increase in incidence rate of Klebsiella spp BSI during the study period (P=.55). The incidence rate of Klebsiella spp BSI increased at quadratic rate with age (P=.005). No significant difference was noted in incidence rate of Klebsiella spp BSI during the warmest 4 months compared to the rest of the year (incidence rate ratio, 0.97; 95% CI, 0.66-1.38; P=.95). The overall 28-day and 1-year all-cause mortality rates of Klebsiella spp BSI were 14% (95% CI, 9%-22%) and 35% (95% CI, 27%-44%), respectively. Respiratory source of BSI was associated with a higher 28-day mortality (hazard ratio, 4.90; 95% CI, 1.73-13.84; P=.003). CONCLUSION: The incidence rate of Klebsiella spp BSI increased with age. There was no temporal change or seasonal variation in incidence rate of Klebsiella spp BSI during the past decade. The 28-day all-cause mortality rate of Klebsiella spp BSI was relatively low; however, a respiratory source of BSI was associated with a poorer outcome. PMID:20118389

  14. Bacteria Counter

    NASA Technical Reports Server (NTRS)

    1981-01-01

    Science Applications, Inc.'s ATP Photometer makes a rapid and accurate count of the bacteria in a body fluid sample. Instrument provides information on the presence and quantity of bacteria by measuring the amount of light emitted by the reaction between two substances. Substances are ATP adenosine triphosphate and luciferase. The reactants are applied to a human body sample and the ATP Photometer observes the intensity of the light emitted displaying its findings in a numerical output. Total time lapse is usually less than 10 minutes, which represents a significant time savings in comparison of other techniques. Other applications are measuring organisms in fresh and ocean waters, determining bacterial contamination of foodstuffs, biological process control in the beverage industry, and in assay of activated sewage sludge.

  15. Mannose-inhibitable adhesins and T3-T7 receptors of Klebsiella pneumoniae inhibit phagocytosis and intracellular killing by human polymorphonuclear leukocytes.

    PubMed Central

    Pruzzo, C; Debbia, E; Satta, G

    1982-01-01

    It has recently been shown that Klebsiella pneumoniae strains adhere to human epithelial cells and that adherence is mediated by mannose-inhibitable adhesins which are also receptors for coliphages T3 and T7. We have now found that Klebsiella strain K59, which adheres to human epithelial cells and carries the receptors for coliphages T3 and T7, adheres to human polymorphonuclear leukocytes (PMN) at 4 degrees C. Strains KRTT1 and KRTT2, which are spontaneous mutants unable to adsorb coliphages T3 and T7 and adhere to human epithelial cells, at this temperature did not adhere to PMN. Adherence of K59 cells to PMN at 4 degrees C was inhibited by D-mannose, by UV-inactivated T7 phages, and by pepsin-digested anti-K59 antibodies absorbed with KRTT1 cells. At 37 degrees C the number of PMN with KRTT bacteria associated was fourfold higher than at 4 degrees C. On the contrary, the number of PMN with K59 bacteria associated at this temperature was fourfold lower than at 4 degrees C. Phagocytosis and intracellular killing experiments performed at 37 degrees C showed that KRTT1 and KRTT2 were phagocytized and killed at a higher rate than K59. After blocking of the mannose-inhibitable adhesins and T3-T7 receptors (MIAT) by D-mannose, UV-inactivated bacteriophage T7, or specific antibodies, K59 cells became more sensitive to phagocytosis and intracellular killing at 37 degrees C. K59 cells lysogenic for prophage AP3 were approximately as sensitive to phagocytosis and intracellular killing by human PMN as strains KRTT1 and KRTT2. Unencapsulated Klebsiella strains isolated from clinical specimens were found to carry MIAT most often. Four such strains were found much more resistant to phagocytosis and intracellular killing than their spontaneous mutants resistant to bacteriophages T3 and T7. PMID:7047402

  16. Nitrogen fixation by immobilized NIF derepressed Klebsiella pneumoniae cells

    SciTech Connect

    Venkatasubramanian, K.; Toda, Y.

    1980-01-01

    In vitro production of ammonia through biological means poses a number of challenges. The organisms should be able to accumulate considerable concentrations of ammonia in the medium. Secondly, nonphotosynthetic organisms must be supplied with high-energy substrates to carry out the fixation reaction. Thirdly, the organisms must be kept in a viable state to produce ammonia over long periods of time. In this article, preliminary results on the production of ammonia by a mutant strain of Klebsiella pneumoniae in continuous reactor systems are discussed. Continuous production of ammonia becomes feasible through the immobilization of the whole microbial cells and then through the use of the resulting catalyst system in a flow-through reactor. The rationale for immobilizing microbial cells and the advantages of such an approach over traditional fermentation processes are briefly described as they relate to the microbial production of ammonia. The microbial cells can be immobilized in such a way that their viability is still maintained in the immobilized state. This, in turn, obviates addition of cofactors, which is often an expensive step associated with immobilized multi-enzyme systems. Reconstituted bovine-hide collagen as the carrier matrix for fixing the cells was the carrier of choice for our work on immobilized Klebsiella cells. Polyacrylamide gels were examined as an alternate carrier matrix but results from this were found to be inferior to those collagen immobilized cell system.

  17. Expansion of ESBL-producing Klebsiella pneumoniae in hospitalized patients: a successful story of international clones (ST15, ST147, ST336) and epidemic plasmids (IncR, IncFIIK).

    PubMed

    Rodrigues, Carla; Machado, Elisabete; Ramos, Helena; Peixe, Luísa; Novais, Ângela

    2014-11-01

    The aim of this study was to characterize by a multi-level approach extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae isolates other than E. coli from Portuguese hospitals. Eighty-eight ESBL-producing clinical isolates (69 Klebsiella pneumoniae, 13 Enterobacter cloacae complex, 3 Klebsiella oxytoca, 1 Enterobacter asburiae, 1 Proteus mirabilis and 1 Serratia marcescens) recovered from hospitals located in the North (A) or Centre (B, C) regions during two time periods (2006-7 and 2010) were analyzed. Standard methods were used for bacterial identification, antibiotic susceptibility testing, ESBL characterization, clonal (PFGE, MLST) and plasmid (S1-PFGE, I-CeuI-PFGE, replicon typing, hybridization) analysis. Isolates produced mostly CTX-M-15 (47%) or SHV-12 (30%), and less frequently other SHV- (15%; SHV-2, -5, -28, -55, -106) or TEM- (9%; TEM-10, -24, -199)-types, with marked local and temporal variations. The increase of CTX-M-15 and diverse SHV ESBL-types observed in Hospital A was associated with the amplification of multidrug-resistant (MDR) K. pneumoniae epidemic clones (ST15, ST147, ST336). SHV-12 and TEM-type ESBLs were mostly identified in diverse isolates of different Enterobacteriaceae species in Hospitals B and C in 2006-7. Particular plasmid types were linked to blaCTX-M-15 (IncR or non-typeable plasmids), blaSHV-12 (IncR or IncHI2), blaSHV-28/-55/-106 (IncFIIK1 or IncFIIK5), blaTEM-10 (IncL/M) or blaTEM-24 (IncA/C), mostly in epidemic clones. In our country, the amplification of CTX-M-15 and diverse SHV-type ESBL among non-E. coli Enterobacteriaceae is linked to international MDR K. pneumoniae clones (ST15, ST147, ST336) and plasmid types (IncR, IncFIIK). Furthermore, we highlight the potential of IncFIIK plasmids (here firstly associated with blaSHV-2/-28/-55/-106) to disseminate as antibiotic resistance plasmids. PMID:25190354

  18. Chemical composition and antibacterial activity of Lavandula coronopifolia essential oil against antibiotic-resistant bacteria.

    PubMed

    Ait Said, L; Zahlane, K; Ghalbane, I; El Messoussi, S; Romane, A; Cavaleiro, C; Salgueiro, L

    2015-01-01

    The aim of this study was to analyse the composition of the essential oil (EO) of Lavandula coronopifolia from Morocco and to evaluate its in vitro antibacterial activity against antibiotic-resistant bacteria isolated from clinical infections. The antimicrobial activity was assessed by a broth micro-well dilution method using multiresistant clinical isolates of 11 pathogenic bacteria: Klebsiella pneumoniae subsp. pneumoniae, Klebsiella ornithinolytica, Escherichia coli, Enterobacter cloacae, Enterobacter aerogenes, Providencia rettgeri, Citrobacter freundii, Hafnia alvei, Salmonella spp., Acinetobacter baumannii and methicillin-resistant Staphylococcus aureus. The main compounds of the oil were carvacrol (48.9%), E-caryophyllene (10.8%) and caryophyllene oxide (7.7%). The oil showed activity against all tested strains with minimal inhibitory concentration (MIC) values ranging between 1% and 4%. For most of the strains, the MIC value was equivalent to the minimal bactericidal concentration value, indicating a clear bactericidal effect of L. coronopifolia EO. PMID:25174508

  19. Molecular Epidemiology of Two Klebsiella pneumoniae Mastitis Outbreaks on a Dairy Farm in New York State?

    PubMed Central

    Munoz, Marcos A.; Welcome, Francis L.; Schukken, Ynte H.; Zadoks, Ruth N.

    2007-01-01

    Klebsiella spp. have become an important cause of clinical mastitis in dairy cows in New York State. We describe the occurrence of two Klebsiella mastitis outbreaks on a single dairy farm. Klebsiella isolates from milk, feces, and environmental sources were compared using random amplified polymorphic DNA (RAPD)-PCR typing. The first mastitis outbreak was caused by a single strain of Klebsiella pneumoniae, RAPD type A, which was detected in milk from eight cows. RAPD type A was also isolated from the rubber liners of milking machine units after milking of infected cows and from bedding in the outbreak pen. Predominance of a single strain could indicate contagious transmission of the organism or exposure of multiple cows to an environmental point source. No new cases with RAPD type A were observed after implementation of intervention measures that targeted the prevention of transmission via the milking machine as well as improvement of environmental hygiene. A second outbreak of Klebsiella mastitis that occurred several weeks later was caused by multiple RAPD types, which rules out contagious transmission and indicates opportunistic infections originating from the environment. The diversity of Klebsiella strains as quantified with Simpson's index of discrimination was significantly higher for isolates from fecal, feed, and water samples than for isolates from milk samples. Several isolates from bedding material that had the phenotypic appearance of Klebsiella spp. were identified as being Raoultella planticola and Raoultella terrigena based on rpoB sequencing. PMID:17928424

  20. Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences

    PubMed Central

    Motalleb, Gholamreza

    2014-01-01

    Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organisms transcriptome is related to its cellular proteome. PMID:24551820

  1. Introduction of bacteriophage Mu into bacteria of various genera and intergeneric gene transfer by RP4::Mu.

    PubMed

    Murooka, Y; Takizawa, N; Harada, T

    1981-01-01

    The host range of coliphage Mu was greatly expanded to various genera of gram-negative bacteria by using the hybrid plasmic RP4::Mu cts, which is temperature sensitive and which confers resistance to ampicillin, kanamycin, and tetracycline. These drug resistance genes were transferred from Escherichia coli to members of the general Klebsiella, Enterobacter, Citrobacter, Salmonella, Proteus, Erwinia, Serratia, Alcaligenes, Agrobacterium, Rhizobium, Pseudomonas, Acetobacter, and Bacillus. Mu phage was produced by thermal induction from the lysogens of all these drug-resistant bacteria except Bacillus. Mu phage and RP4 or the RP4::Mu plasmid were used to create intergeneric recombinant strains by transfer of some genes, including the arylsulfatase gene, between Klebsiella aerogenes and E. coli. Thus, genetic analysis and intergeneric gene transfer are possible in these RP4::Mu-sensitive bacteria. PMID:6450749

  2. Klebsiella pneumoniae liver abscess in an immunocompetent child

    PubMed Central

    Kwon, Jang-Mi; Shim, Jae Won; Kim, Deok Soo; Shim, Jung Yeon; Park, Moon Soo

    2013-01-01

    Klebsiella pneumoniae has emerged as a leading pathogen that causes pyogenic liver abscesses (PLAs) in Korea. K. pneumoniae liver abscess (KLA) is potentially life threatening, and the diagnosis is difficult. In developed countries, PLA is rarely observed in children and is frequently associated with disorders of granulocyte function and previous abdominal infection. We observed a case of KLA in a healthy 12-year-old boy. To our knowledge, this is the first reported case of KLA in an immunocompetent child without an underlying disease in Korea. The patient was treated with percutaneous catheter drainage and antibiotics. The catheter was placed in the intrahepatic abscess for 3 weeks and parenteral antibiotics (ceftriaxone and amikacin) were administered for 4 weeks, followed by oral antibiotics (cefixime) for 2 weeks. We reported this case to raise awareness of KLA in immunocompetent children among physicians, and to review the diagnosis, risk factors, potential complications, and appropriate treatment of KLA. PMID:24223603

  3. Molybdenum accumulation and storage in Klebsiella pneumoniae and Azotobacter vinelandii.

    PubMed Central

    Pienkos, P T; Brill, W J

    1981-01-01

    In Klebsiella pneumoniae, Mo accumulation appeared to be coregulated with nitrogenase synthesis. O2 and NH+4, which repressed nitrogenase synthesis, also prevented Mo accumulation. In Azotobacter vinelandii, Mo accumulation did not appear to be regulated Mo was accumulated to levels much higher than those seen in K. pneumoniae even when nitrogenase synthesis was repressed. Accumulated Mo was bound mainly to a Mo storage protein, and it could act as a supply for the Mo needed in component I synthesis when extracellular Mo had been exhausted. When A. vinelandii was grown in the presence of WO2-(4) rather than MoO2-(4), it synthesized a W-containing analog of the Mo storage protein. The Mo storage protein was purified from both NH+4 and N2-grown cells of A. vinelandii and found to be a tetramer of two pairs of different subunits binding a minimum of 15 atoms of Mo per tetramer. Images PMID:7007348

  4. Carbapenemase-producing Klebsiella pneumoniae: molecular and genetic decoding

    PubMed Central

    Chen, Liang; Mathema, Barun; Chavda, Kalyan D.; DeLeo, Frank R.; Bonomo, Robert A.; Kreiswirth, Barry N.

    2015-01-01

    Klebsiella pneumoniae carbapenemases (KPCs) were first identified in 1996 in the USA. Since then, regional outbreaks of KPC-producing K. pneumoniae have occurred in the USA, and have spread internationally. Dissemination of blaKPC involves both horizontal transfer of blaKPC genes and plasmids, and clonal spread. Of epidemiological significance, the international spread of KPC-producing K. pneumoniae is primarily associated with a single multilocus sequence type (ST), ST258, and its related variants. However, the molecular factors contributing to the success of ST258 largely remain unclear. Here, we review the recent progresses in understanding KPC-producing K. pneumoniae that is contributing to our knowledge of plasmid and genome composition and structure among the KPC epidemic clone, and identify possible factors that influence its epidemiological success. PMID:25304194

  5. Stepwise evolution of pandrug-resistance in Klebsiella pneumoniae

    PubMed Central

    Zowawi, Hosam M.; Forde, Brian M.; Alfaresi, Mubarak; Alzarouni, Abdulqadir; Farahat, Yasser; Chong, Teik-Min; Yin, Wai-Fong; Chan, Kok-Gan; Li, Jian; Schembri, Mark A.; Beatson, Scott A.; Paterson, David L.

    2015-01-01

    Carbapenem resistant Enterobacteriaceae (CRE) pose an urgent risk to global human health. CRE that are non-susceptible to all commercially available antibiotics threaten to return us to the pre-antibiotic era. Using Single Molecule Real Time (SMRT) sequencing we determined the complete genome of a pandrug-resistant Klebsiella pneumoniae isolate, representing the first complete genome sequence of CRE resistant to all commercially available antibiotics. The precise location of acquired antibiotic resistance elements, including mobile elements carrying genes for the OXA-181 carbapenemase, were defined. Intriguingly, we identified three chromosomal copies of an ISEcp1-blaOXA-181 mobile element, one of which has disrupted the mgrB regulatory gene, accounting for resistance to colistin. Our findings provide the first description of pandrug-resistant CRE at the genomic level, and reveal the critical role of mobile resistance elements in accelerating the emergence of resistance to other last resort antibiotics. PMID:26478520

  6. Molecular epidemiology of OXA-48-producing Klebsiella pneumoniae in France.

    PubMed

    Liapis, E; Pantel, A; Robert, J; Nicolas-Chanoine, M-H; Cavali, L; van der Mee-Marquet, N; de Champs, C; Aissa, N; Eloy, C; Blanc, V; Guyeux, C; Hocquet, D; Lavigne, J-P; Bertrand, X

    2014-12-01

    We characterized 53 OXA-48-producing Klebsiella pneumoniae (OXA-48-Kp) isolated between 2011 and 2013 in 21 French hospitals. All the isolates were genotyped using MLST and PFGE and the population structure of the species was determined by a nucleotide-based analysis of the entire K.pneumoniae MLST database. Most of the OXA-48-Kp isolates also produced CTX-M-15 and remained susceptible to imipenem and meropenem. The isolates were distributed into 20 STs, of which five were dominant (ST15, ST101, ST147, ST395 and ST405). All the OXA-48-Kp clustered in the major clade of K.pneumoniae KpI. PMID:24942039

  7. Stepwise evolution of pandrug-resistance in Klebsiella pneumoniae.

    PubMed

    Zowawi, Hosam M; Forde, Brian M; Alfaresi, Mubarak; Alzarouni, Abdulqadir; Farahat, Yasser; Chong, Teik-Min; Yin, Wai-Fong; Chan, Kok-Gan; Li, Jian; Schembri, Mark A; Beatson, Scott A; Paterson, David L

    2015-01-01

    Carbapenem resistant Enterobacteriaceae (CRE) pose an urgent risk to global human health. CRE that are non-susceptible to all commercially available antibiotics threaten to return us to the pre-antibiotic era. Using Single Molecule Real Time (SMRT) sequencing we determined the complete genome of a pandrug-resistant Klebsiella pneumoniae isolate, representing the first complete genome sequence of CRE resistant to all commercially available antibiotics. The precise location of acquired antibiotic resistance elements, including mobile elements carrying genes for the OXA-181 carbapenemase, were defined. Intriguingly, we identified three chromosomal copies of an ISEcp1-bla(OXA-181) mobile element, one of which has disrupted the mgrB regulatory gene, accounting for resistance to colistin. Our findings provide the first description of pandrug-resistant CRE at the genomic level, and reveal the critical role of mobile resistance elements in accelerating the emergence of resistance to other last resort antibiotics. PMID:26478520

  8. Metabolism of benzonitrile and butyronitrile by Klebsiella pneumoniae

    SciTech Connect

    Nawaz, M.S.; Heinze, T.M.; Cerniglia, C.E. )

    1992-01-01

    A strain of Klebsiella pneumoniae that used aliphatic nitriles as the sole source of nitrogen was adapted to benzonitrile as the sole source of carbon and nitrogen. Gas chromatographic and mass spectral analyses of culture filtrates indicated that K. pneumoniae metabolized 8.4 mM benzonitrile to 4.0 mM benzoic acid and 2.7 mM ammonia. In addition, butyronitrile was metabolized to butyramide and ammonia. The isolate also degraded mixtures of benzonitrile and aliphatic nitriles. Cell extracts contained nitrile hydratase and amidase activities. The enzyme activities were higher with butyronitrile and butyramide than with benzonitrile and benzamide, and amidase activities were twofold higher than nitrile hydratase activities. K. pneumoniae appears promising for the bioremediation of sites contaminated with aliphatic and aromatic nitriles.

  9. Antibiotic Resistance Related to Biofilm Formation in Klebsiella pneumoniae

    PubMed Central

    Vuotto, Claudia; Longo, Francesca; Balice, Maria Pia; Donelli, Gianfranco; Varaldo, Pietro E.

    2014-01-01

    The Gram-negative opportunistic pathogen, Klebsiella pneumoniae, is responsible for causing a spectrum of community-acquired and nosocomial infections and typically infects patients with indwelling medical devices, especially urinary catheters, on which this microorganism is able to grow as a biofilm. The increasingly frequent acquisition of antibiotic resistance by K. pneumoniae strains has given rise to a global spread of this multidrug-resistant pathogen, mostly at the hospital level. This scenario is exacerbated when it is noted that intrinsic resistance to antimicrobial agents dramatically increases when K. pneumoniae strains grow as a biofilm. This review will summarize the findings about the antibiotic resistance related to biofilm formation in K. pneumoniae. PMID:25438022

  10. Complete Genome Sequence of Klebsiella pneumoniae Phage JD001

    PubMed Central

    Cui, Zelin; Shen, Wenbin; Wang, Zheng; Zhang, Haotian; Me, Rao; Wang, Yanchun; Zeng, Lingbin; Zhu, Yongzhang; Qin, Jinhong

    2012-01-01

    Klebsiella pneumoniae is a member of the family Enterobacteriaceae, opportunistic pathogens that are among the eight most prevalent infectious agents in hospitals. The emergence of multidrug-resistant strains of K. pneumoniae has became a public health problem globally. To develop an effective antimicrobial agent, we isolated a bacteriophage, named JD001, from seawater and sequenced its genome. Comparative genome analysis of phage JD001 with other K. pneumoniae bacteriophages revealed that phage JD001 has little similarity to previously published K. pneumoniae phages KP15, KP32, KP34, and phiKO2. Here we announce the complete genome sequence of JD001 and report major findings from the genomic analysis. PMID:23166250

  11. Correlation between antimicrobial resistance and virulence in Klebsiella pneumoniae.

    PubMed

    Hennequin, C; Robin, F

    2016-03-01

    Klebsiella pneumoniae is responsible for a wide range of infections, including urinary tract infections, pneumonia, bacteremia, and liver abscesses. In addition to susceptible clinical isolates involved in nosocomial infections, multidrug-resistant (MDR) and hypervirulent (hvKP) strains have evolved separately in distinct clonal groups. The rapid geographic spread of these isolates is of particular concern. However, we still know little about the virulence of K. pneumoniae except for hvKP, whose secrets are beginning to be revealed. The treatment of K. pneumoniae infections is threatened by the emergence of antimicrobial resistance. The dissemination of resistance is associated with genetic mobile elements, such as plasmids that may also carry virulence determinants. A proficient pathogen should be virulent, resistant to antibiotics, and epidemic. However, the interplay between resistance and virulence is poorly understood. Here, we review current knowledge on the topic. PMID:26718943

  12. [Molecular epidemiology of carbapenem-resistant Klebsiella pneumoniae strains isolated between 2004-2007 in Ankara University Hospital, Turkey].

    PubMed

    Us, Ebru; Tekeli, Alper; Arikan Akan, Ozay; Dolapci, I?tar; Sahin, Fikret; Karahan, Zeynep Ceren

    2010-01-01

    The prevalence of carbapenem-resistant gram-negative bacteria in the hospital setting is in an increasing trend worldwide. Since most of the carbapenem-resistant Enterobacteriaceae are resistant to all antimicrobial agents except polymyxins and tigecycline, the emergence of carbapenem resistance in Klebsiella pneumoniae strains requires careful monitoring. This study was conducted to analyse the epidemiological relatedness between the carbapenem-resistant isolates of K. pneumoniae collected from different wards (intensive-care, surgery, hematology, neurology, internal medicine, emergency services) of Ankara University Hospital. A total of 26 carbapenem-resistant K. pneumoniae isolates (13 blood, 6 urine, 2 bronchoalveolar lavage, 1 abscess, 1 tissue, 1 catheter tip, 1 drainage fluid, 1 tracheal lavage fluid) were identified and antibiotic susceptibility tests were performed with API 20E System or VITEK 2 Compact (Bio-Merieux, France) at the Central Laboratories of Ankara University Hospital between February 2004 and April 2007. MICs of imipenem and meropenem were also confirmed using E-test (AB Biodisk, Sweden). The clonal relationship between the isolates was studied by pulsed-field gel electrophoresis (PFGE). After digestion of total genomic DNA with restriction endonuclease Xbal, the 26 isolates generated 7 PFGE profiles. PFGE pattern B consisting of different antibiotic susceptibility profile was seen only in 2006. Carbapenem-sensitive strains isolated at the same time from the same wards which carbapenem-resistant isolates were recovered, generated different PFGE patterns. The predominant carbapenem-resistant isolates in our hospital were found clonally related. Interhospital transmission of carbapenem-resistant K. pneumoniae strains which have a particular epidemic potential, is likely to occur during patient transfer between wards. It is likely that intensive efforts, similar to those used to control vancomycin resistant enterococci, are needed to identify and control the spread of resistant Klebsiella species. Therefore, active surveillance and strict infection control measures for this multidrug-resistant microorganism should be implemented at local and national basis. PMID:20455393

  13. Characterization of RarA, a Novel AraC Family Multidrug Resistance Regulator in Klebsiella pneumoniae

    PubMed Central

    Veleba, Mark; Higgins, Paul G.; Gonzalez, Gerardo; Seifert, Harald

    2012-01-01

    Transcriptional regulators, such as SoxS, RamA, MarA, and Rob, which upregulate the AcrAB efflux pump, have been shown to be associated with multidrug resistance in clinically relevant Gram-negative bacteria. In addition to the multidrug resistance phenotype, these regulators have also been shown to play a role in the cellular metabolism and possibly the virulence potential of microbial cells. As such, the increased expression of these proteins is likely to cause pleiotropic phenotypes. Klebsiella pneumoniae is a major nosocomial pathogen which can express the SoxS, MarA, Rob, and RamA proteins, and the accompanying paper shows that the increased transcription of ramA is associated with tigecycline resistance (M. Veleba and T. Schneiders, Antimicrob. Agents Chemother. 56:44664467, 2012). Bioinformatic analyses of the available Klebsiella genome sequences show that an additional AraC-type regulator is encoded chromosomally. In this work, we characterize this novel AraC-type regulator, hereby called RarA (Regulator of antibiotic resistance A), which is encoded in K. pneumoniae, Enterobacter sp. 638, Serratia proteamaculans 568, and Enterobacter cloacae. We show that the overexpression of rarA results in a multidrug resistance phenotype which requires a functional AcrAB efflux pump but is independent of the other AraC regulators. Quantitative real-time PCR experiments show that rarA (MGH 78578 KPN_02968) and its neighboring efflux pump operon oqxAB (KPN_02969_02970) are consistently upregulated in clinical isolates collected from various geographical locations (Chile, Turkey, and Germany). Our results suggest that rarA overexpression upregulates the oqxAB efflux pump. Additionally, it appears that oqxR, encoding a GntR-type regulator adjacent to the oqxAB operon, is able to downregulate the expression of the oqxAB efflux pump, where OqxR complementation resulted in reductions to olaquindox MICs. PMID:22644028

  14. Photodynamic inactivation of Klebsiella pneumoniae biofilms and planktonic cells by 5-aminolevulinic acid and 5-aminolevulinic acid methyl ester.

    PubMed

    Liu, Chengcheng; Zhou, Yingli; Wang, Li; Han, Lei; Lei, Jin'e; Ishaq, Hafiz Muhammad; Nair, Sean P; Xu, Jiru

    2016-04-01

    The treatment of Klebsiella pneumoniae, particularly extended-spectrum β-lactamase (ESBL)-producing K. pneumoniae, is currently a great challenge. Photodynamic antimicrobial chemotherapy is a promising approach for killing antibiotic-resistant bacteria. The aim of this study was to evaluate the capacity of 5-aminolevulinic acid (5-ALA) and its derivative 5-ALA methyl ester (MAL) in the presence of white light to cause photodynamic inactivation (PDI) of K. pneumoniae planktonic and biofilm cells. In the presence of white light, 5-ALA and MAL inactivated planktonic cells in a concentration-dependent manner. Biofilms were also sensitive to 5-ALA and MAL-mediated PDI. The mechanisms by which 5-ALA and MAL caused PDI of ESBL-producing K. pneumonia were also investigated. Exposure of K. pneumonia to light in the presence of either 5-ALA or MAL induced cleavage of genomic DNA and the rapid release of intracellular biopolymers. Intensely denatured cytoplasmic contents and aggregated ribosomes were also detected by transmission electron microscopy. Scanning electron microscopy showed that PDI of biofilms caused aggregated bacteria to detach and that the bacterial cell envelope was damaged. This study provides insights into 5-ALA and MAL-mediated PDI of ESBL-producing K. pneumoniae. PMID:26886586

  15. Cell-wall-inhibiting antibiotic combinations with activity against multidrug-resistant Klebsiella pneumoniae and Escherichia coli.

    PubMed

    Hickman, R A; Hughes, D; Cars, T; Malmberg, C; Cars, O

    2014-04-01

    The increasing prevalence of hospital and community-acquired infections caused by multidrug-resistant (MDR) bacterial pathogens is rapidly limiting the options for effective antibiotic therapy. Systematic studies on combinations of already available antibiotics that could provide an effective treatment against MDR bacteria are needed. We tested combinations of antibiotics that target one important physiological function (peptidoglycan synthesis) at several steps, and studied Enterobacteriaceae (Klebsiella pneumoniae and Escherichia coli) for which multidrug resistance associated with ESBL-producing plasmids has become a major problem. To measure the effectiveness of antibiotics alone and in combination, we used checkerboard assays, static antibiotic concentration time-kill assays, and an improved in-vitro kinetic model that simulates human pharmacokinetics of multiple simultaneously administered antibiotics. The target strains included an MDR K. pneumoniae isolate responsible for a recent major hospital outbreak. A double combination (fosfomycin and aztreonam) and a triple combination (fosfomycin, aztreonam and mecillinam) were both highly effective in reducing bacterial populations in all assays, including the in vitro kinetic model. These combinations were effective even though each of the MDR strains was resistant to aztreonam alone. Our results provide an initial validation of the potential usefulness of a combination of antibiotics targeting peptidoglycan synthesis in the treatment of MDR Gram-negative bacteria. We suggest that a combination of fosfomycin with aztreonam could become a useful treatment option for such infections and should be further studied. PMID:24118201

  16. Legionella pneumophila Persists within Biofilms Formed by Klebsiella pneumoniae, Flavobacterium sp., and Pseudomonas fluorescens under Dynamic Flow Conditions

    PubMed Central

    Stewart, Catherine R.; Muthye, Viraj; Cianciotto, Nicholas P.

    2012-01-01

    Legionella pneumophila, the agent of Legionnaires' disease pneumonia, is transmitted to humans following the inhalation of contaminated water droplets. In aquatic systems, L. pneumophila survives much of time within multi-organismal biofilms. Therefore, we examined the ability of L. pneumophila (clinical isolate 130b) to persist within biofilms formed by various types of aquatic bacteria, using a bioreactor with flow, steel surfaces, and low-nutrient conditions. L. pneumophila was able to intercalate into and persist within a biofilm formed by Klebsiella pneumoniae, Flavobacterium sp. or Pseudomonas fluorescens. The levels of L. pneumophila within these biofilms were as much as 4104 CFU per cm2 of steel coupon and lasted for at least 12 days. These data document that K. pneumoniae, Flavobacterium sp., and P. fluorescens can promote the presence of L. pneumophila in dynamic biofilms. In contrast to these results, L. pneumophila 130b did not persist within a biofilm formed by Pseudomonas aeruginosa, confirming that some bacteria are permissive for Legionella colonization whereas others are antagonistic. In addition to colonizing certain mono-species biofilms, L. pneumophila 130b persisted within a two-species biofilm formed by K. pneumoniae and Flavobacterium sp. Interestingly, the legionellae were also able to colonize a two-species biofilm formed by K. pneumoniae and P. aeruginosa, demonstrating that a species that is permissive for L. pneumophila can override the inhibitory effect(s) of a non-permissive species. PMID:23185637

  17. Distinct but Spatially Overlapping Intestinal Niches for Vancomycin-Resistant Enterococcus faecium and Carbapenem-Resistant Klebsiella pneumoniae

    PubMed Central

    Caballero, Silvia; Carter, Rebecca; Ke, Xu; Sušac, Bože; Leiner, Ingrid M.; Kim, Grace J.; Miller, Liza; Ling, Lilan; Manova, Katia; Pamer, Eric G.

    2015-01-01

    Antibiotic resistance among enterococci and γ-proteobacteria is an increasing problem in healthcare settings. Dense colonization of the gut by antibiotic-resistant bacteria facilitates their spread between patients and also leads to bloodstream and other systemic infections. Antibiotic-mediated destruction of the intestinal microbiota and consequent loss of colonization resistance are critical factors leading to persistence and spread of antibiotic-resistant bacteria. The mechanisms underlying microbiota-mediated colonization resistance remain incompletely defined and are likely distinct for different antibiotic-resistant bacterial species. It is unclear whether enterococci or γ-proteobacteria, upon expanding to high density in the gut, confer colonization resistance against competing bacterial species. Herein, we demonstrate that dense intestinal colonization with vancomycin-resistant Enterococcus faecium (VRE) does not reduce in vivo growth of carbapenem-resistant Klebsiella pneumoniae. Reciprocally, K. pneumoniae does not impair intestinal colonization by VRE. In contrast, transplantation of a diverse fecal microbiota eliminates both VRE and K. pneumoniae from the gut. Fluorescence in situ hybridization demonstrates that VRE and K. pneumoniae localize to the same regions in the colon but differ with respect to stimulation and invasion of the colonic mucus layer. While VRE and K. pneumoniae occupy the same three-dimensional space within the gut lumen, their independent growth and persistence in the gut suggests that they reside in distinct niches that satisfy their specific in vivo metabolic needs. PMID:26334306

  18. Oncocin Onc72 is efficacious against antibiotic-susceptible Klebsiella pneumoniae ATCC 43816 in a murine thigh infection model.

    PubMed

    Knappe, Daniel; Adermann, Knut; Hoffmann, Ralf

    2015-11-01

    Oncocins and apidaecins are short proline-rich antimicrobial peptides (PrAMPs) representing novel antibiotic drug lead compounds that kill bacteria after internalization and inhibition of intracellular targets (e.g. 70S ribosome and DnaK). Oncocin Onc72 is highly active against Gram-negative bacteria in vitro and in vivo protecting mice in systemic infection models with Escherichia coli and KPC-producing Klebsiella pneumoniae. Here we studied its efficacy in a murine thigh infection model using meropenem as antibiotic comparator that had a 44-fold higher molar in vitro activity than Onc72. Male CD1 mice were rendered neutropenic using cyclophosphamide for four days before intramuscular infection with K. pneumoniae ATCC 43816. After 75?min oncocin Onc72 or the antibiotic comparator meropenem were administered subcutaneously with 100?mg (43?mol) and 25?mg (65?mol) per kg of body weight, respectively, six times every 75?min. Onc72 and meropenem administered subcutaneously reduced the thigh tissue burden of K. pneumoniae ATCC 43816 in neutropenic mice significantly by 4.14 and 4.65 a log10 cfu/g, respectively. The bacterial counts were ?0.5 and ?1 log10 below the pre-treatment burden, respectively, indicating bactericidal effects for both compounds. Thus, Onc72 was as efficacious as meropenem in vivo despite its much lower in vitro activity determined according to CLSI standard antimicrobial activity tests. 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 104:707-711, 2015. PMID:25968331

  19. A Common Flanking Region in Promiscuous Plasmids Encoding blaNDM-1 in Klebsiella pneumoniae Isolated in Singapore.

    PubMed

    Chen, Ying-Tsong; Siu, L Kristopher; Tsai, Yu-Kuo; Lin, Fu-Mei; Koh, Tse Hsien; Chen, Jiun-Han

    2016-03-01

    Bacteria encoding the New Delhi metallo-β-lactamase gene (blaNDM-1) are regarded as superbugs for their resistance to multiple antibiotics. Plasmids encoding blaNDM-1 have been observed to be spreading among gram-negative bacteria around the world. Previous studies have demonstrated that multiple modifications of blaNDM-1-harboring plasmids might contribute to the spread of the gene. In this study, we analyzed blaNDM-1-encoding plasmids from two Klebsiella pneumoniae isolates, DU7433 and DU1301, found to be unrelated by pulsed field gel electrophoresis and multilocus sequencing typing (DU7433: ST14 and DU1301: ST11), and compared them with previously published plasmids. Although strains DU1301, DU7433, and previously published strain DU43320 carried unrelated plasmids, their transconjugants exhibited similar antimicrobial resistance profiles. Transconjugants lacked the resistance to aztreonam, ciprofloxacin, gentamicin, tetracycline, and trimethoprim/sulfamethoxazole when compared with the corresponding clinical isolates. Plasmids pTR1 from DU1301 and pTR2 from DU7433 had completely different plasmid backbones except a short conserved region of blaNDM-1 and ble flanked with truncated or nontruncated ISAba125 and trpF. The presence of this common region among known blaNDM-1-carrying plasmids implies that the dissemination of blaNDM-1 may be facilitated by mobilization of this conserved immediate region among different plasmids. Control measures should be strictly enforced whenever increasing incidences of epidemiological unrelated strains were identified. PMID:26308279

  20. Presence of Nitrogen Fixing Klebsiella pneumoniae in the gut of the Formosan Subterranean Termite (Coptotermes formosanus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A gram-negative facultative anaerobic enteric bacterium, Klebsiella pneumoniae was isolated from the hindgut of the Formosan subterranean termite (FST). It was characterized using, Fatty acid methyl ester (FAME) analysis, BIOLOG assay, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-...

  1. Identification of Outer Membrane and Exoproteins of Carbapenem-Resistant Multilocus Sequence Type 258 Klebsiella pneumoniae

    PubMed Central

    Brinkworth, Amanda J.; Hammer, Carl H.; Olano, L. Renee; Kobayashi, Scott D.; Chen, Liang; Kreiswirth, Barry N.; DeLeo, Frank R.

    2015-01-01

    Carbapenem-resistant Klebsiella pneumoniae strains have emerged as a cause of life-threatening infections in susceptible individuals (e.g., transplant recipients and critically ill patients). Strains classified as multilocus sequence type (ST) 258 are among the most prominent causes of carbapenem-resistant K. pneumoniae infections worldwide, but the basis for the success of this lineage remains incompletely determined. To gain a more comprehensive view of the molecules potentially involved in the success of ST258, we used a proteomics approach to identify surface-associated and culture supernatant proteins produced by ST258. Protein samples were prepared from varied culture conditions in vitro, and were analyzed by a combination of two-dimensional electrophoresis and liquid chromatography followed by tandem mass spectrometry (LC-MS/MS). We identified a total of 193 proteins in outer membrane preparations from bacteria cultured in Luria-Bertani broth (LB) or RPMI 1640 tissue culture media (RPMI). Compared with LB, several iron-acquisition proteins, including IutA, HmuR, HmuS, CirA, FepA, FitA, FoxA, FhuD, and YfeX, were more highly expressed in RPMI. Of the 177 proteins identified in spent media, only the fimbrial subunit, MrkA, was predicted to be extracellular, a finding that suggests few proteins (or a limited quantity) are freely secreted by ST258. Notably, we discovered 203 proteins not reported in previous K. pneumoniae proteome studies. In silico modeling of proteins with unknown function revealed several proteins with beta-barrel transmembrane structures typical of porins, as well as possible host-interacting proteins. Taken together, these findings contribute several new targets for the mechanistic study of drug-resistance and pathogenesis by ST258 K. pneumoniae isolates. PMID:25893665

  2. Interhospital spread of NDM-7-producing Klebsiella pneumoniae belonging to ST437 in Spain.

    PubMed

    Seara, Nieves; Oteo, Jesús; Carrillo, Raquel; Pérez-Blanco, Verónica; Mingorance, Jesús; Gómez-Gil, Rosa; Herruzo, Rafael; Pérez-Vázquez, María; Astray, Jenaro; García-Rodríguez, Julio; Ruiz-Velasco, Luis Moisés; Campos, José; de Burgos, Carmen; Ruiz-Carrascoso, Guillermo

    2015-08-01

    This study describes an interhospital spread of carbapenem-resistant Klebsiella pneumoniae (CRKP) producing NDM-7 carbapenemase that started in December 2013 in Madrid, Spain. NDM-7-producing CRKP were isolated from urine, rectal swabs or blood samples from seven patients admitted to three different hospitals (Hospital Universitario La Paz, Hospital de Cantoblanco and Hospital Central de la Cruz Roja). The isolates were resistant to all antimicrobials tested except colistin and fosfomycin. One blood isolate was susceptible to minocycline and tigecycline but was resistant to fosfomycin. All isolates were closely related by pulsed-field gel electrophoresis (PFGE) and DiversiLab(®) analysis and belonged to multilocus sequence typing (MLST) sequence type 437. In addition, blaNDM-7, blaTEM-1, blaCTX-M-15 and aac(3)-IIa were identified. Family contacts of the index case were negative for NDM-producing bacteria. The outbreak occurred in two separate waves and the cases associated with Hospital de Cantoblanco had been admitted to the same room. Environmental samples from the trap of a sink and a shower in this room were positive for NDM-7-producing CRKP. To our knowledge, this is the first reported worldwide outbreak of NDM-7-producing CRKP. No relationship with the Indian continent, the Balkans or the Middle East could be established. Frequent transfer of aged or chronically ill patients between the facilities involved may have favoured the spread of NDM-7-producing CRKP. The spread of the second wave in Hospital de Cantoblanco probably occurred as a result of transmission from an environmental reservoir. PMID:25982912

  3. Carriage rate of carbapenem-resistant Klebsiella pneumoniae in hospitalised patients during a national outbreak.

    PubMed

    Wiener-Well, Y; Rudensky, B; Yinnon, A M; Kopuit, P; Schlesinger, Y; Broide, E; Lachish, T; Raveh, D

    2010-04-01

    During a national outbreak of carbapenem-resistant Klebsiella pneumoniae (CRKP) in Israel, we conducted a point prevalence survey to determine the extent of asymptomatic carriage. Subsequently, a retrospective case-control study was done, comparing carriers of CRKP with non-carriers, in order to detect risk factors for carriage. Oral, perianal and rectal swabs were obtained from all hospitalised eligible and consenting patients. Selective media for carbapenem-resistant Gram-negative bacteria were used and pulsed-field gel electrophoresis (PFGE) helped to determine clonal source. Culture was obtained from 298 patients. Sixteen (5.4%) were carriers of CRKP, with a higher carriage rate in medical and surgical wards. Only 18% of carriers were treated with any carbapenem prior to the survey. Five of the 16 carriers had a positive clinical specimen for CRKP, hence a clinical infection versus asymptomatic carriage ratio of 1:3. The rectum was the most sensitive site sampled, detecting 15/16 carriers, and the overall sensitivity of the method was 94% with a negative predictive value of 99.6%. In a multivariate analysis of risk factors for CRKP carriage, three variables were significantly related to carriage state: diaper use, longer duration of hospital stay and vancomycin use. PFGE demonstrated that all 16 isolates were identical, confirming clonal origin. A point prevalence survey performed at a single medical centre during an outbreak of CRKP demonstrated a carriage rate of 5.4%. The clonal origin of these isolates suggests that strict adherence to isolation procedure may contain this outbreak. PMID:19783067

  4. Inhibition of Klebsiella ?-Lactamases (SHV-1 and KPC-2) by Avibactam: A Structural Study

    PubMed Central

    Papp-Wallace, Krisztina M.; Bonomo, Robert A.; van den Akker, Focco

    2015-01-01

    ?-Lactamase inhibition is an important clinical strategy in overcoming ?-lactamase-mediated resistance to ?-lactam antibiotics in Gram negative bacteria. A new ?-lactamase inhibitor, avibactam, is entering the clinical arena and promising to be a major step forward in our antibiotic armamentarium. Avibactam has remarkable broad-spectrum activity in being able to inhibit classes A, C, and some class D ?-lactamases. We present here structural investigations into class A ?-lactamase inhibition by avibactam as we report the crystal structures of SHV-1, the chromosomal penicillinase of Klebsiella pneumoniae, and KPC-2, an acquired carbapenemase found in the same pathogen, complexed with avibactam. The 1.80 KPC-2 and 1.42 resolution SHV-1 ?-lactamase avibactam complex structures reveal avibactam covalently bonded to the catalytic S70 residue. Analysis of the interactions and chair-shaped conformation of avibactam bound to the active sites of KPC-2 and SHV-1 provides structural insights into recently laboratory-generated amino acid substitutions that result in resistance to avibactam in KPC-2 and SHV-1. Furthermore, we observed several important differences in the interactions with amino acid residues, in particular that avibactam forms hydrogen bonds to S130 in KPC-2 but not in SHV-1, that can possibly explain some of the different kinetic constants of inhibition. Our observations provide a possible reason for the ability of KPC-2 ?-lactamase to slowly desulfate avibactam with a potential role for the stereochemistry around the N1 atom of avibactam and/or the presence of an active site water molecule that could aid in avibactam desulfation, an unexpected consequence of novel inhibition chemistry. PMID:26340563

  5. Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae

    PubMed Central

    Al-Marzooq, Farah; Mohd Yusof, Mohd Yasim; Tay, Sun Tee

    2015-01-01

    Infections caused by multidrug resistant Klebsiella pneumoniae have been increasingly reported in many parts of the world. A total of 93 Malaysian multidrug resistant K. pneumoniae isolated from patients attending to University of Malaya Medical Center, Kuala Lumpur, Malaysia from 2010-2012 were investigated for antibiotic resistance determinants including extended-spectrum beta-lactamases (ESBLs), aminoglycoside and trimethoprim/sulfamethoxazole resistance genes and plasmid replicons. CTX-M-15 (91.3%) was the predominant ESBL gene detected in this study. aacC2 gene (67.7%) was the most common gene detected in aminoglycoside-resistant isolates. Trimethoprim/sulfamethoxazole resistance (90.3%) was attributed to the presence of sul1 (53.8%) and dfrA (59.1%) genes in the isolates. Multiple plasmid replicons (1-4) were detected in 95.7% of the isolates. FIIK was the dominant replicon detected together with 13 other types of plasmid replicons. Conjugative plasmids (1-3 plasmids of ~3-100 kb) were obtained from 27 of 43 K. pneumoniae isolates. An ESBL gene (either CTX-M-15, CTX-M-3 or SHV-12) was detected from each transconjugant. Co-detection with at least one of other antibiotic resistance determinants [sul1, dfrA, aacC2, aac(6?)-Ib, aac(6?)-Ib-cr and qnrB] was noted in most conjugative plasmids. The transconjugants were resistant to multiple antibiotics including ?-lactams, gentamicin and cotrimoxazole, but not ciprofloxacin. This is the first study describing the characterization of plasmids circulating in Malaysian multidrug resistant K. pneumoniae isolates. The results of this study suggest the diffusion of highly diverse plasmids with multiple antibiotic resistance determinants among the Malaysian isolates. Effective infection control measures and antibiotic stewardship programs should be adopted to limit the spread of the multidrug resistant bacteria in healthcare settings. PMID:26203651

  6. Inhibition of Klebsiella β-Lactamases (SHV-1 and KPC-2) by Avibactam: A Structural Study.

    PubMed

    Krishnan, Nikhil P; Nguyen, Nhu Q; Papp-Wallace, Krisztina M; Bonomo, Robert A; van den Akker, Focco

    2015-01-01

    β-Lactamase inhibition is an important clinical strategy in overcoming β-lactamase-mediated resistance to β-lactam antibiotics in Gram negative bacteria. A new β-lactamase inhibitor, avibactam, is entering the clinical arena and promising to be a major step forward in our antibiotic armamentarium. Avibactam has remarkable broad-spectrum activity in being able to inhibit classes A, C, and some class D β-lactamases. We present here structural investigations into class A β-lactamase inhibition by avibactam as we report the crystal structures of SHV-1, the chromosomal penicillinase of Klebsiella pneumoniae, and KPC-2, an acquired carbapenemase found in the same pathogen, complexed with avibactam. The 1.80 Å KPC-2 and 1.42 Å resolution SHV-1 β-lactamase avibactam complex structures reveal avibactam covalently bonded to the catalytic S70 residue. Analysis of the interactions and chair-shaped conformation of avibactam bound to the active sites of KPC-2 and SHV-1 provides structural insights into recently laboratory-generated amino acid substitutions that result in resistance to avibactam in KPC-2 and SHV-1. Furthermore, we observed several important differences in the interactions with amino acid residues, in particular that avibactam forms hydrogen bonds to S130 in KPC-2 but not in SHV-1, that can possibly explain some of the different kinetic constants of inhibition. Our observations provide a possible reason for the ability of KPC-2 β-lactamase to slowly desulfate avibactam with a potential role for the stereochemistry around the N1 atom of avibactam and/or the presence of an active site water molecule that could aid in avibactam desulfation, an unexpected consequence of novel inhibition chemistry. PMID:26340563

  7. Characterization of Type 2 Quorum Sensing in Klebsiella pneumoniae and Relationship with Biofilm Formation

    PubMed Central

    Balestrino, Damien; Haagensen, Janus A. J.; Rich, Chantal; Forestier, Christiane

    2005-01-01

    Quorum sensing is a process by which bacteria communicate by using secreted chemical signaling molecules called autoinducers. Many bacterial species modulate the expression of a wide variety of physiological functions in response to changes in population density by this mechanism. In this study, the opportunistic pathogen Klebsiella pneumoniae was observed to secrete type 2 signaling molecules. A homologue of luxS, the gene required for AI-2 synthesis in Vibrio harveyi, was isolated from the K. pneumoniae genome. A V. harveyi bioassay showed the luxS functionality in K. pneumoniae and its ability to complement the luxS-negative phenotype of Escherichia coli DH5?. Autoinducer activity was detected in the supernatant, and maximum expression of specific messengers detected by quantitative reverse transcription-PCR analysis occurred during the late exponential phase. The highest levels of AI-2 were observed in minimal medium supplemented with glycerol. To determine the potential role of luxS in colonization processes, a K. pneumoniae luxS isogenic mutant was constructed and tested for its capacity to form biofilms in vitro on an abiotic surface and to colonize the intestinal tract in a murine model. No difference was observed in the level of intestinal colonization between the wild-type strain and the luxS mutant. Microscopic analysis of biofilm structures revealed that the luxS mutant was able to form a mature biofilm but with reduced capacities in the development of microcolonies, mostly in the early steps of biofilm formation. These data suggest that a LuxS-dependent signal plays a role in the early stages of biofilm formation by K. pneumoniae. PMID:15805533

  8. Acute-onset postoperative endophthalmitis caused by multidrug-resistant Klebsiella pneumoniae

    PubMed Central

    Sanghi, Shekhar; Pathengay, Avinash; Jindal, Animesh; Raval, Vishal; Nayak, Sameera; Sharma, Savitri; Bawdekar, Abhishek; Flynn, Harry W

    2014-01-01

    The purpose of this paper is to report outcomes of intravitreal imipenem in the treatment of multidrug-resistant Klebsiella-related postoperative endophthalmitis. This observational case series consists of three eyes from three patients seen between 2013 and 2014. Multidrug-resistant Klebsiella pneumoniae is characterized by a rapid, fulminant course and severe intraocular inflammation. Intravitreal imipenem may be used to treat such infection. PMID:25258505

  9. Colonization of the botanical environment by Klebsiella isolates of pathogenic origin.

    PubMed

    Knittel, M D; Seidler, R J; Eby, C; Cabe, L M

    1977-11-01

    Growth, survival, and pathogenicity of Klebsiella growing in and on environmental foci were examined. Total coliforms present in raw wastes from pulp mills were in excess of 10(5)/ml, and 60 to 80% were Klebsiella. Fecal coliform counts ranged from 10(1) to 10(5)/ml. Klebsiella isolates from industrial effluents and a variety of human and bovine mastitis origins multiplied in pulp waste and commonly exceeded 10(6) cells per ml. Pathogenic isolates also multiplied in dilute aqueous extracts of sawdust to comparable levels. Klebsiella strains from vegetable surfaces and human infections grew rapidly on the surfaces of potatoes and lettuce and exceeded 10(3) organisms per g of surface peel and leaf after a 24h incubation at room temperature. After 7 weeks on potatoes stored at 5 degrees C, some 10 to 30% of the day 1 Klebsiella counts were recoverable. Three Klebsiella isolates of pathogenic origin were passed 45 times through sterile pulp effluent (270 generations), and mean lethal dose levels in mice were periodically monitored. In two instances, a significant decrease in virulence was noted after 15 to 26 passes (90 to 156 generations). The third culture, of bovine mastitis origin, retained its original mean lethal dose value. Botanical milieu provided suitable habitats for the multiplication and colonization of Klebsiella isolates of disease origins in the same manner as indigenous isolates. Aquatic environments polluted with botanical material served as potential reservoirs for perpetuating the growth and spread of opportunistic Klebsiella pathogens that may ultimately colonize animals, humans, and aquatic organisms. PMID:337900

  10. Acute placental infection due to Klebsiella pneumoniae: report of a unique case.

    PubMed Central

    Sheikh, Salwa S; Amr, Samir S; Lage, Janice M

    2005-01-01

    A 40-year-old woman, gravida 9, with seven healthy children and a history of one abortion (p 7 + 1), presented at 18 weeks of gestation with fever and malodorous vaginal discharge. Ultrasound revealed a macerated fetus. The placenta showed acute chorioamnionitis and acute villitis with microabscess formation. Blood and vaginal cultures both grew Klebsiella pneumoniae. This is the first reported case in English literature of Klebsiella pneumoniae causing suppurative placentitis leading to fetal demise. PMID:16040328

  11. Pyogenic liver abscess and the emergence of Klebsiella as an etiology: a retrospective study

    PubMed Central

    Ali, Ahmad H; Smalligan, Roger D; Ahmed, Mashrafi; Khasawneh, Faisal A

    2014-01-01

    Objectives Pyogenic liver abscess (PLA) is a significant, though uncommon, cause of morbidity in the United States. Recently, Klebsiella has emerged as an important cause of PLA. We analyzed the clinical course, microbiology, and treatment outcomes of patients discharged with PLA. In addition, we sought to examine the incidence of and risk factors for Klebsiella liver abscess (KLA). Methods We reviewed the charts of patients who discharged with PLA from two teaching hospitals in West Texas between January 1, 2007 and December 31, 2011. Results We identified 49 cases of PLA. Abscess cultures were positive in 23 (48%) patients. The mean age of the cohort was 56 years (range: 2083 years). Sixty percent were male. The most frequent conditions associated with PLA were intra-abdominal infections (ten cases; 20%), diabetes mellitus (nine cases; 18%) and malignancy (nine cases; 18%). Klebsiella was the most commonly isolated species from the abscess cultures (seven cases; 30% of all positive abscess cultures). We used univariate and logistic regression analyses to identify the risk factors for KLA. Controlling for age, only malignancy was identified in our cohort as a risk factor for a Klebsiella liver abscess. The overall mortality was 2%. Conclusion Klebsiella is emerging as an important cause of liver abscesses. Malignancy may be an important risk factor for Klebsiella liver abscess. PMID:24379693

  12. A multiple antibiotic and serum resistant oligotrophic strain, Klebsiella pneumoniae MB45 having novel dfrA30, is sensitive to ZnO QDs

    PubMed Central

    2011-01-01

    Background The aim of this study was to describe a novel trimethoprim resistance gene cassette, designated dfrA30, within a class 1 integron in a facultatively oligotrophic, multiple antibiotic and human serum resistant test strain, MB45, in a population of oligotrophic bacteria isolated from the river Mahananda; and to test the efficiency of surface bound acetate on zinc oxide quantum dots (ZnO QDs) as bactericidal agent on MB45. Methods Diluted Luria broth/Agar (10-3) media was used to cultivate the oligotrophic bacteria from water sample. Multiple antibiotic resistant bacteria were selected by employing replica plate method. A rapid assay was performed to determine the sensitivity/resistance of the test strain to human serum. Variable region of class 1 integron was cloned, sequenced and the expression of gene coding for antibiotic resistance was done in Escherichia coli JM 109. Identity of culture was determined by biochemical phenotyping and 16S rRNA gene sequence analyses. A phylogenetic tree was constructed based on representative trimethoprim resistance-mediating DfrA proteins retrieved from GenBank. Growth kinetic studies for the strain MB45 were performed in presence of varied concentrations of ZnO QDs. Results and conclusions The facultatively oligotrophic strain, MB45, resistant to human serum and ten antibiotics trimethoprim, cotrimoxazole, ampicillin, gentamycin, netilmicin, tobramycin, chloramphenicol, cefotaxime, kanamycin and streptomycin, has been identified as a new strain of Klebsiella pneumoniae. A novel dfr gene, designated as dfrA30, found integrated in class 1 integron was responsible for resistance to trimethoprim in Klebsiella pneumoniae strain MB45. The growth of wild strain MB45 was 100% arrested at 500 mg/L concentration of ZnO QDs. To our knowledge this is the first report on application of ZnO quantum dots to kill multiple antibiotics and serum resistant K. pneumoniae strain. PMID:21595893

  13. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria

    PubMed Central

    Olaitan, Abiola O.; Morand, Serge; Rolain, Jean-Marc

    2014-01-01

    Polymyxins are polycationic antimicrobial peptides that are currently the last-resort antibiotics for the treatment of multidrug-resistant, Gram-negative bacterial infections. The reintroduction of polymyxins for antimicrobial therapy has been followed by an increase in reports of resistance among Gram-negative bacteria. Some bacteria, such as Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii, develop resistance to polymyxins in a process referred to as acquired resistance, whereas other bacteria, such as Proteus spp., Serratia spp., and Burkholderia spp., are naturally resistant to these drugs. Reports of polymyxin resistance in clinical isolates have recently increased, including acquired and intrinsically resistant pathogens. This increase is considered a serious issue, prompting concern due to the low number of currently available effective antibiotics. This review summarizes current knowledge concerning the different strategies bacteria employ to resist the activities of polymyxins. Gram-negative bacteria employ several strategies to protect themselves from polymyxin antibiotics (polymyxin B and colistin), including a variety of lipopolysaccharide (LPS) modifications, such as modifications of lipid A with phosphoethanolamine and 4-amino-4-deoxy-L-arabinose, in addition to the use of efflux pumps, the formation of capsules and overexpression of the outer membrane protein OprH, which are all effectively regulated at the molecular level. The increased understanding of these mechanisms is extremely vital and timely to facilitate studies of antimicrobial peptides and find new potential drugs targeting clinically relevant Gram-negative bacteria. PMID:25505462

  14. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria.

    PubMed

    Olaitan, Abiola O; Morand, Serge; Rolain, Jean-Marc

    2014-01-01

    Polymyxins are polycationic antimicrobial peptides that are currently the last-resort antibiotics for the treatment of multidrug-resistant, Gram-negative bacterial infections. The reintroduction of polymyxins for antimicrobial therapy has been followed by an increase in reports of resistance among Gram-negative bacteria. Some bacteria, such as Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii, develop resistance to polymyxins in a process referred to as acquired resistance, whereas other bacteria, such as Proteus spp., Serratia spp., and Burkholderia spp., are naturally resistant to these drugs. Reports of polymyxin resistance in clinical isolates have recently increased, including acquired and intrinsically resistant pathogens. This increase is considered a serious issue, prompting concern due to the low number of currently available effective antibiotics. This review summarizes current knowledge concerning the different strategies bacteria employ to resist the activities of polymyxins. Gram-negative bacteria employ several strategies to protect themselves from polymyxin antibiotics (polymyxin B and colistin), including a variety of lipopolysaccharide (LPS) modifications, such as modifications of lipid A with phosphoethanolamine and 4-amino-4-deoxy-L-arabinose, in addition to the use of efflux pumps, the formation of capsules and overexpression of the outer membrane protein OprH, which are all effectively regulated at the molecular level. The increased understanding of these mechanisms is extremely vital and timely to facilitate studies of antimicrobial peptides and find new potential drugs targeting clinically relevant Gram-negative bacteria. PMID:25505462

  15. Klebsiella pneumoniae related community-acquired acute lower respiratory infections in Cambodia: Clinical characteristics and treatment

    PubMed Central

    2012-01-01

    Background In many Asian countries, Klebsiella pneumoniae (KP) is the second pathogen responsible for community-acquired pneumonia. Yet, very little is known about KP etiology in ALRI in Cambodia, a country that has one of the weakest medical infrastructures in the region. We present here the first clinico-radiological description of KP community-acquired ALRI in hospitalized Cambodian patients. Methods Through ALRI surveillance in two provincial hospitals, KP was isolated from sputum and blood cultures, and identified by API20E gallery from patients ? 5 years-old with fever and respiratory symptoms onset ?14 days. Antibiotics susceptibility testing was provided systematically to clinicians when bacteria were isolated. We collected patients' clinical, radiological and microbiological data and their outcome 3 months after discharge. We also compared KP-related with other bacteria-related ALRI to determine risk factors for KP infection. Results From April 2007 to December 2009, 2315 ALRI patients ? 5 years-old were enrolled including 587 whose bacterial etiology could be assigned. Of these, 47 (8.0%) had KP infection; their median age was 55 years and 68.1% were females. Reported prior medication was high (42.5%). Patients' chest radiographs showed pneumonia (61.3% including 39% that were necrotizing), preexisting parenchyma lesions (29.5%) and pleural effusions alone (4.5%) and normal parenchyma (4.5%). Five patients had severe conditions on admission and one patient died during hospitalization. Of the 39 patients that were hospital discharged, 14 died including 12 within 1 month after discharge. Only 13 patients (28%) received an appropriate antibiotherapy. Extended-spectrum beta-lactamases (ESBL) - producing strains were found in 8 (17.0%) patients. Female gender (Odds ratio (OR) 2.1; p = 0.04) and diabetes mellitus (OR 3.1; p = 0.03) were independent risk factors for KP-related ALRI. Conclusions KP ALRI in Cambodia has high fatality rate, are more frequently found in women, and should be considered in diabetic patients. The extremely high frequency of ESBL-producing strains in the study is alarming in the context of uncontrolled antibiotic consumption and in absence of microbiology capacity in most public-sector hospitals. PMID:22233322

  16. Prevalence of Extended Spectrum β-lactamase-Producing Klebsiella pneumoniae in Clinical Isolates

    PubMed Central

    Ali Abdel Rahim, Khalid Abdalla; Ali Mohamed, Ahmed Mohamed

    2014-01-01

    Background: Extended spectrum β-lactamase (ESBL) are gram-negative bacteria that produce the enzyme, β-lactamase, which can break down commonly used antibiotics, such as penicillin and cephalosporins, making infections with ESBL producing bacteria more difficult to treat. Extended spectrum β-lactamase-producing Klebsiella pneumoniae were first reported in 1983 from Germany, and since then a steady increase in resistance against cephalosporins has been seen causing health problems. Objectives: The aim of this study was to determine the prevalence of ESBL in strains of K. pneumoniae isolated from different clinical samples. Patients and Methods: One hundred and thirty isolates of K. pneumoniae were isolated from different clinical specimens from King Khalid hospital, Hafr Elbatin, Kingdom Saudi Arabia. These isolates were then characterized, tested for antimicrobial susceptibility and screened for ESBL production by the MicroScan WalkAway-96 SI System. Extended spectrum β-lactamase production was confirmed by the phenotypic confirmatory disc diffusion test (PCDDT) and the double disc synergy test (DDST). Results: Overall, 76.9% (100) of the isolates were resistant to cefuroxime, cefepime and cefazolin, 69.23% (90) were resistant to cefotaxime, and 46.15% (60) were resistant to cefoxitin. Extended spectrum β-lactamase was detected in 53.8% (70) of K. pneumoniae as detected by the MicroScan “WalkAway-96” SI System and 50.07% (66) by PCDDT and 46.15% (60) by DDST. All K. pneumoniae isolates were resistant to ampicillin followed by both piperacillin and mezlocillin 92.30% (120). K. pneumoniae isolates showed high sensitivity to imipenem (15.38%) (20), followed by ertapenem, tetracycline, tigecycline pipracilline/tazobactam and amikacin (23.07%) (30). Conclusions: Our study showed that the prevalence of ESBL-producing K. pneumoniae at King Khalid Hospital was significantly high. Routine detection of ESBL-producing microorganisms is required by each of the laboratory standard detection methods to control the spread of these infections and allow a proper therapeutic strategy. For detection, the phenotypic confirmatory disc diffusion test is simple, sensitive and cost effective. However, there is a need for larger scale drug susceptibility surveillance. PMID:25774279

  17. Role of Antibiotic Penetration Limitation in Klebsiella pneumoniae Biofilm Resistance to Ampicillin and Ciprofloxacin

    PubMed Central

    Anderl, Jeff N.; Franklin, Michael J.; Stewart, Philip S.

    2000-01-01

    The penetration of two antibiotics, ampicillin and ciprofloxacin, through biofilms developed in an in vitro model system was investigated. The susceptibilities of biofilms and corresponding freely suspended bacteria to killing by the antibiotics were also measured. Biofilms of Klebsiella pneumoniae were developed on microporous membranes resting on agar nutrient medium. The susceptibilities of planktonic cultures and biofilms to 10 times the MIC were determined. Antibiotic penetration through biofilms was measured by assaying the concentration of antibiotic that diffused through the biofilm to an overlying filter disk. Parallel experiments were performed with a mutant K. pneumoniae strain in which ?-lactamase activity was eliminated. For wild-type K. pneumoniae grown in suspension culture, ampicillin and ciprofloxacin MICs were 500 and 0.18 ?g/ml, respectively. The log reductions in the number of CFU of planktonic wild-type bacteria after 4 h of treatment at 10 times the MIC were 4.43 0.33 and 4.14 0.33 for ampicillin and ciprofloxacin, respectively. Biofilms of the same strain were much less susceptible, yielding log reductions in the number of CFU of ?0.06 0.06 and 1.02 0.04 for ampicillin and ciprofloxacin, respectively, for the same treatment. The number of CFU in the biofilms after 24 h of antibiotic exposure was not statistically different from the number after 4 h of treatment. Ampicillin did not penetrate wild-type K. pneumoniae biofilms, whereas ciprofloxacin and a nonreactive tracer (chloride ion) penetrated the biofilms quickly. The concentration of ciprofloxacin reached the MIC throughout the biofilm within 20 min. Ampicillin penetrated biofilms formed by a ?-lactamase-deficient mutant. However, the biofilms formed by this mutant were resistant to ampicillin treatment, exhibiting a 0.18 0.07 log reduction in the number of CFU after 4 h of exposure and a 1.64 0.33 log reduction in the number of CFU after 24 h of exposure. Poor penetration contributed to wild-type biofilm resistance to ampicillin but not to ciprofloxacin. The increased resistance of the wild-type strain to ciprofloxacin and the mutant strain to ampicillin and ciprofloxacin could not be accounted for by antibiotic inactivation or slow diffusion since these antibiotics fully penetrated the biofilms. These results suggest that some other resistance mechanism is involved for both agents. PMID:10858336

  18. Cadmium-tolerant bacteria induce metal stress tolerance in cereals.

    PubMed

    Ahmad, Iftikhar; Akhtar, Muhammad Javed; Zahir, Zahir Ahmad; Naveed, Muhammad; Mitter, Birgit; Sessitsch, Angela

    2014-09-01

    Cadmium usually hampers plant growth, but bacterial inoculation may improve stress tolerance in plants to Cd by involving various mechanisms. The objective was to characterize and identify bacteria that improve plant growth under Cd stress and reduce Cd uptake. Cadmium-tolerant bacteria were isolated from rhizosphere soil, which was irrigated with tannery effluent, and six strains were selected as highly tolerant to Cd, showing minimum inhibitory concentration as 500 mg L(-1) or 4.45 mmol L(-1). These strains were identified by 16S rRNA gene analysis and functional analysis in regard to plant growth promotion characteristics. To determine their effect on cereal growth under Cd stress, seeds were inoculated with these strains individually and grown in soil contaminated with three Cd levels (0, 40 and 80 mg kg(-1)). Biomass production, relative water content (RWC), electrolyte leakage (ELL) and tissue Cd concentration were measured. Biomass of both cereals was inhibited strongly when exposed to Cd; however, bacterial inoculation significantly reduced the suppressive effect of Cd on cereal growth and physiology. The bacterial isolates belonged to the genera Klebsiella, Stenotrophomonas, Bacillus and Serratia. Maize was more sensitive than wheat to Cd. Klebsiella sp. strain CIK-502 had the most pronounced effects in promoting maize and wheat growth and lowering Cd uptake under Cd stress. PMID:24849374

  19. Characterization of Siphoviridae phage Z and studying its efficacy against multidrug-resistant Klebsiella pneumoniae planktonic cells and biofilm.

    PubMed

    Jamal, Muhsin; Hussain, Tahir; Das, Chythanya Rajanna; Andleeb, Saadia

    2015-04-01

    Biofilm has many serious consequences for public health and is a major virulence factor contributing to the chronicity of infections. The aim of the current study was to isolate and characterize a bacteriophage that inhibits multidrug-resistant Klebsiella pneumonia (M) in planktonic form as well as biofilm. This phage, designated bacteriophage Z, was isolated from wastewater. Its adsorption rate to its host bacterium was significantly enhanced by MgCl2 and CaCl2. It has a wide range of pH and heat stability. From its one-step growth, latent time and burst size were determined to be 24 min and about 320 virions per cell, respectively. As analysed by transmission electron microscopy, phage Z had an icosahedral head of width 7610 nm, length 9214 nm and icosahedron side 38 nm, and a non-contractile tail 20015 nm long and 14-29 nm wide. It belongs to the family Siphoviridae in the order Caudovirales. Six structural proteins ranging from 18 to 65 kDa in size were revealed by SDS-PAGE. The genome was found to comprise double-stranded DNA with an approximate size of 36 kb. Bacteria were grown in suspension and as biofilms to compare the susceptibility of both phenotypes to the phage lytic action. Phage Z was effective in reducing biofilm biomass after 24 and 48 h, showing more than twofold and threefold reduction, respectively. Biofilm cells and stationary-phase planktonic bacteria were killed at a lower rate than exponential-phase planktonic bacteria. PMID:25681321

  20. Phagocytic and chemiluminescent responses of mouse peritoneal macrophages to living and killed Salmonella typhimurium and other bacteria

    SciTech Connect

    Tomita, T.; Blumenstock, E.; Kanegasaki, S.

    1981-06-01

    In the presence of luminol, resident as well as thioglycolate-induced and immunized macrophages emitted chemiluminescence more efficiently when the cells were exposed to living Salmonella typhimurium than when they were exposed to the same bacterium killed by ultraviolet light or heat. This phenomenon was observed whether or not the bacterium was opsonized. The different response to living and killed bacteria was also found with Escherichia coli, Pseudomonas aeruginosa, Proteus morganii, and Enterobacter aerogenes, but not with Shigella sonnei, Klebsiella pneumoniae, and Propionibacterium acnes. The results suggest that macrophages respond better to living, motile bacteria than to nonmotile or killed bacteria. The experimental results obtained with motility mutants of S. typhimurium, E. coli, and P. aeruginosa confirm that macrophages exposed to the motile bacteria emit chemiluminescence more efficiently and ingest the motile bacteria at a much faster rate than the nonmotile bacteria.

  1. Back To Bacteria.

    ERIC Educational Resources Information Center

    Flannery, Maura C.

    1997-01-01

    Explores new research about bacteria. Discusses bacterial genomes, archaea, unusual environments, evolution, pathogens, bacterial movement, biofilms, bacteria in the body, and a bacterial obsession. Contains 29 references. (JRH)

  2. Magnetic bacteria against MIC

    SciTech Connect

    Javaherdashti, R.

    1997-12-01

    In this article, it is suggested to use the sensitivity of magnetotactic bacteria to changes of magnetic field direction and the natural ability of this bacteria in rapid growth during relatively short time intervals against corrosion-enhancing bacteria and especially sulfate-reducing bacteria. If colonies of sulfate-reducing bacteria could be packed among magnetotactic bacteria, then, by applying sufficiently powerful magnetic field (about 0.5 gauss), all of these bacteria (magnetic and non-magnetic) will be oriented towards an Anti-bacteria agent (oxygen or biocide). So, Microbiologically-Influenced Corrosion in the system would be controlled to a large extent.

  3. Structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae

    PubMed Central

    Michalska, Karolina; Cuff, Marianne E.; Tesar, Christine; Feldmann, Brian; Joachimiak, Andrzej

    2011-01-01

    In most organisms, efficient d-galactose utilization requires the highly conserved Leloir pathway that converts d-galactose to d-glucose 1-phosphate. However, in some bacterial and fungal species alternative routes of d-galactose assimilation have been identified. In the so-called De LeyDoudoroff pathway, d-galactose is metabolized into pyruvate and d-glyceraldehyde 3-phosphate in five consecutive reactions carried out by specific enzymes. The penultimate step in this pathway involves the phosphorylation of 2-oxo-3-deoxygalactonate to 2-oxo-3-deoxygalactonate 6-phosphate catalyzed by 2-oxo-3-deoxygalactonate kinase, with ATP serving as a phosphoryl-group donor. Here, a crystal structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae determined at 2.1? resolution is reported, the first structure of anenzyme from the De LeyDoudoroff pathway. Structural comparison indicates that the enzyme belongs to the ASKHA (acetate and sugar kinases/hsc70/actin) family of phosphotransferases. The protein is composed of two ?/? domains, each of which contains a core common to all family members. Additional elements introduced between conserved structural motifs define the unique features of 2-oxo-3-deoxygalactonate kinase and possibly determine the biological function of the protein. PMID:21795809

  4. Source and extent of Klebsiella pneumoniae in the paper industry.

    PubMed

    Caplenas, N R; Kanarek, M S; Dufour, A P

    1981-11-01

    Three pulp and paper mill processing plants were evaluated for fecal coliform and Klebsiella pneumoniae bacterial concentrations. Freshwater consumed by paper industries contained minimum detectable levels of K. pneumoniae, less than 10 organisms per 100 ml. Elevated concentrations of K. pneumoniae could be traced from early pulping stages to water processing reuse systems. Concentrations of K. pneumoniae (thermotolerant and thermointolerant) ranged from 40,000 organisms per 100 ml to an estimated 3 x 10(6) organisms per 100 ml. K. pneumoniae biotyping provided evidence for the selective growth and persistence of K. pneumoniae from the initial wood washing stages through to the final effluent discharge. Wastewater treatment had limited effects in reducing K. pneumoniae concentrations. K. pneumoniae levels ranged from 40 organisms per 100 ml to an estimated 10(6) organisms per 100 ml. The presence of K. pneumoniae in water indicates degraded water quality, and its significance with regard to human health effects has yet to be examined. PMID:7032419

  5. Structural and Mechanical Properties of Klebsiella pneumoniae Type 3 Fimbriae?

    PubMed Central

    Chen, Feng-Jung; Chan, Chia-Han; Huang, Ying-Jung; Liu, Kuo-Liang; Peng, Hwei-Ling; Chang, Hwan-You; Liou, Gunn-Guang; Yew, Tri-Rung; Liu, Cheng-Hsien; Hsu, Ken Y.; Hsu, Long

    2011-01-01

    This study investigated the structural and mechanical properties of Klebsiella pneumoniae type 3 fimbriae, which constitute a known virulence factor for the bacterium. Transmission electron microscopy and optical tweezers were used to understand the ability of the bacterium to survive flushes. An individual K. pneumoniae type 3 fimbria exhibited a helix-like structure with a pitch of 4.1 nm and a three-phase force-extension curve. The fimbria was first nonlinearly stretched with increasing force. Then, it started to uncoil and extended several micrometers at a fixed force of 66 4 pN (n = 22). Finally, the extension of the fimbria shifted to the third phase, with a characteristic force of 102 9 pN (n = 14) at the inflection point. Compared with the P fimbriae and type 1 fimbriae of uropathogenic Escherichia coli, K. pneumoniae type 3 fimbriae have a larger pitch in the helix-like structure and stronger uncoiling and characteristic forces. PMID:21239584

  6. Structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae

    SciTech Connect

    Michalska, Karolina; Cuff, Marianne E.; Tesar, Christine; Feldmann, Brian; Joachimiak, Andrzej

    2011-08-01

    The crystal structure of 2-oxo-3-deoxygalactonate kinase from the De Ley–Doudoroff pathway of galactose metabolism has been determined at 2.1 Å resolution. In most organisms, efficient d-galactose utilization requires the highly conserved Leloir pathway that converts d-galactose to d-glucose 1-phosphate. However, in some bacterial and fungal species alternative routes of d-galactose assimilation have been identified. In the so-called De Ley–Doudoroff pathway, d-galactose is metabolized into pyruvate and d-glyceraldehyde 3-phosphate in five consecutive reactions carried out by specific enzymes. The penultimate step in this pathway involves the phosphorylation of 2-oxo-3-deoxygalactonate to 2-oxo-3-deoxygalactonate 6-phosphate catalyzed by 2-oxo-3-deoxygalactonate kinase, with ATP serving as a phosphoryl-group donor. Here, a crystal structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae determined at 2.1 Å resolution is reported, the first structure of an enzyme from the De Ley–Doudoroff pathway. Structural comparison indicates that the enzyme belongs to the ASKHA (acetate and sugar kinases/hsc70/actin) family of phosphotransferases. The protein is composed of two α/β domains, each of which contains a core common to all family members. Additional elements introduced between conserved structural motifs define the unique features of 2-oxo-3-deoxygalactonate kinase and possibly determine the biological function of the protein.

  7. Klebsiella pneumoniae FimK Promotes Virulence in Murine Pneumonia.

    PubMed

    Rosen, David A; Hilliard, Julia K; Tiemann, Kristin M; Todd, Elizabeth M; Morley, S Celeste; Hunstad, David A

    2016-02-15

    Klebsiella pneumoniae, a chief cause of nosocomial pneumonia, is a versatile and commonly multidrug-resistant human pathogen for which further insight into pathogenesis is needed. We show that the pilus regulatory gene fimK promotes the virulence of K. pneumoniae strain TOP52 in murine pneumonia. This contrasts with the attenuating effect of fimK on urinary tract virulence, illustrating that a single factor may exert opposing effects on pathogenesis in distinct host niches. Loss of fimK in TOP52 pneumonia was associated with diminished lung bacterial burden, limited innate responses within the lung, and improved host survival. FimK expression was shown to promote serum resistance, capsule production, and protection from phagocytosis by host immune cells. Finally, while the widely used K. pneumoniae model strain 43816 produces rapid dissemination and death in mice, TOP52 caused largely localized pneumonia with limited lethality, thereby providing an alternative tool for studying K. pneumoniae pathogenesis and control within the lung. PMID:26347570

  8. CRYSTAL STRUCTURE ANALYSIS OF A PUTATIVE OXIDOREDUCTASE FROM KLEBSIELLA PNEUMONIAE

    SciTech Connect

    Baig, M.; Brown, A.; Eswaramoorthy, S.; Swaminathan, S.

    2009-01-01

    Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) at Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.

  9. Enhanced Utilization of Phosphonate and Phosphite by Klebsiella aerogenes

    PubMed Central

    Imazu, Kazuya; Tanaka, Shotaro; Kuroda, Akio; Anbe, Yuki; Kato, Junichi; Ohtake, Hisao

    1998-01-01

    Klebsiella aerogenes ATCC 9621 was able to utilize phosphonates (Pn), including aminoethylphosphonate, ethylphosphonate, methylphosphonate (MPn), and phosphonoacetate, and inorganic phosphite (Pt) as sole sources of phosphorus (P). The products of the phn gene cluster were absolutely required for Pn breakdown and Pt oxidation to inorganic phosphate (Pi) in this organism. To determine if K. aerogenes ATCC 9621 could be engineered to enhance the utilization of Pn and Pt, a multicopy plasmid, pBI05, which carried the entire phn gene cluster, was introduced into this strain. Despite the increased dosage of the phn genes, K. aerogenes ATCC 9621(pBI05) could utilize only up to 1.1-fold more Pn and Pt than did the control strain with the parent vector alone. These results suggested that Pi, which was generated from Pn and Pt, might limit further utilization of these P compounds. Consequently, to convert the resulting Pi to polyphosphate (polyP), the plasmid pKP28, which carried the K. aerogenes ppk gene (which encodes polyP kinase), was introduced into K. aerogenes ATCC 9621(pBI05). Overexpression of the ppk gene in K. aerogenes ATCC 9621(pBI05, pKP28) resulted in a 2.5-fold increase in Pt utilization over that of the control strain. This recombinant strain also accumulated approximately sixfold more P than did the control strain when the cells were grown with MPn as a sole source of P. PMID:9758795

  10. Source and extent of Klebsiella pneumoniae in the paper industry.

    PubMed Central

    Caplenas, N R; Kanarek, M S; Dufour, A P

    1981-01-01

    Three pulp and paper mill processing plants were evaluated for fecal coliform and Klebsiella pneumoniae bacterial concentrations. Freshwater consumed by paper industries contained minimum detectable levels of K. pneumoniae, less than 10 organisms per 100 ml. Elevated concentrations of K. pneumoniae could be traced from early pulping stages to water processing reuse systems. Concentrations of K. pneumoniae (thermotolerant and thermointolerant) ranged from 40,000 organisms per 100 ml to an estimated 3 x 10(6) organisms per 100 ml. K. pneumoniae biotyping provided evidence for the selective growth and persistence of K. pneumoniae from the initial wood washing stages through to the final effluent discharge. Wastewater treatment had limited effects in reducing K. pneumoniae concentrations. K. pneumoniae levels ranged from 40 organisms per 100 ml to an estimated 10(6) organisms per 100 ml. The presence of K. pneumoniae in water indicates degraded water quality, and its significance with regard to human health effects has yet to be examined. PMID:7032419

  11. Pneumonia and bacteremia in a golden-headed lion tamarin (Leontopithecus chrysomelas) caused by Klebsiella pneumoniae subsp. pneumoniae during a translocation program of free-ranging animals in Brazil.

    PubMed

    Bueno, Marina G; Iovine, Renata O; Torres, Luciana N; Catão-Dias, José L; Pissinatti, Alcides; Kierulff, Maria C M; Carvalho, Vania M

    2015-05-01

    Klebsiella pneumoniae is an important emerging pathogen in humans, particularly the invasive hypermucoviscosity (HMV) phenotype. In addition, the organism is an important public health concern because of nosocomial infections and antimicrobial resistance. Nonhuman primates in captivity are susceptible to Klebsiella, particularly when a stress factor is involved. Infections vary depending on the species but can cause significant morbidity and mortality in these animals. The objective of this study was to describe a case of bronchopneumonia and bacteremia caused by Klebsiella pneumoniae in a free-ranging golden-headed lion tamarin (Leontopithecus chrysomelas) caught and maintained in quarantine during a translocation program for conservation purposes. An adult male, that had showed emaciation and apathy, was clinically examined and, despite being provided supportive therapy, died 2 days after onset of clinical signs. At postmortem examination, generalized bilateral pneumonia and pericarditis were observed. Tissue samples were fixed in 10% formalin for histology, and pulmonary tissues and cardiac blood were collected for microbiologic diagnostic procedures. Bacteria that were shown to be HMV K. pneumoniae subsp. pneumoniae strains were isolated from the pulmonary fluids and cardiac blood in pure cultures. Severe bronchopneumonia was the main pathological finding. The consequences of the confirmed presence of the HMV phenotype of K. pneumoniae subsp. pneumoniae in this wildlife species for human, animal, and ecosystem health should be determined. These results demonstrate the importance of quarantine and potential pathogen screening during wildlife translocation procedures. PMID:25943130

  12. Ferric ammonium citrate decomposition--a taxonomic tool for gram-negative bacteria.

    PubMed

    Szentmihályi, A; Lányi, B

    1986-01-01

    The iron uptake test of Szabó and Vandra has been modified and used for the differentiation of Gram-negative bacteria. Nutrient agar containing 20 g per litre of ferric ammonium citrate was distributed into narrow tubes and solidified so as to form butts and slants. Considering the localization of the rusty-brown coloration produced after seeding and incubation, 2367 strains were classified into four groups. (1) Unchanged medium: Escherichia coli, Shigella spp., Yersinia spp., Hafnia alvei and Morganella morganii 100% each, Klebsiella spp., 50%, Enterobacter cloacae 37%, Proteus vulgaris 59%, Acinetobacter spp. 42%, Pseudomonas fluorescens 19%, some other bacteria 2-12%. (2) Rusty-brown slant, unchanged butt: Salmonella subgenera II, III and IV 98%, Citrobacter freundii 65%, E. cloacae 55%, P. vulgaris 41%, Proteus mirabilis 98%, Providencia rettgeri 100%, urease-negative Providencia 96%, Acinetobacter spp. 58%, Pseudomonas aeruginosa 100%, P. fluorescens 81%, UFP (unclassified fluorescent pseudomonads) 100%, other Pseudomonas spp. 55%. (3) Unchanged slant, brown butt: S. typhi 88%, Salmonella subgenus I 3%, Klebsiella spp. 31%, some other bacteria 2-3%. (4) Rusty-brown slant, brown butt: Salmonella subgenus I 75%, C. freundii 20%, Klebsiella spp. 12%, some other bacteria 1-5%. Colour reactions in ferric ammonium citrate agar are associated with the accumulation of ferric hydroxide: bacteria giving positive reactions on the slant took up as an average, 63 times more iron than those with negative test. The localization of colour reaction correlated partly with aerobic and anaerobic citrate utilization or decomposition in Simmons' minimal and in Kauffmann's peptone water medium. PMID:3529797

  13. Report on a transborder spread of carbapenemase-producing bacteria by a patient injured during Euromaidan, Ukraine

    PubMed Central

    Hrabák, J.; Študentová, V.; Adámková, V.; Šemberová, L.; Kabelíková, P.; Hedlová, D.; Čurdová, M.; Zemlickova, H.; Papagiannitsis, C.C.

    2015-01-01

    Spread of carbapenemase-producing bacteria has been described all over the world. This phenomenon may be accelerated by many factors, including wars and natural disasters. In this report, we described an NDM-1-producing Klebsiella pneumonia ST11 recovered from a patient injured during the Maidan revolution in Ukraine. To our knowledge, this is the first report of a carbapenemase-producing Enterobacteriaceae in Ukraine and one of several reports describing wound colonization/infection of humans injured during war. PMID:26594376

  14. Report on a transborder spread of carbapenemase-producing bacteria by a patient injured during Euromaidan, Ukraine.

    PubMed

    Hrabk, J; tudentov, V; Admkov, V; emberov, L; Kabelkov, P; Hedlov, D; ?urdov, M; Zemlickova, H; Papagiannitsis, C C

    2015-11-01

    Spread of carbapenemase-producing bacteria has been described all over the world. This phenomenon may be accelerated by many factors, including wars and natural disasters. In this report, we described an NDM-1-producing Klebsiella pneumonia ST11 recovered from a patient injured during the Maidan revolution in Ukraine. To our knowledge, this is the first report of a carbapenemase-producing Enterobacteriaceae in Ukraine and one of several reports describing wound colonization/infection of humans injured during war. PMID:26594376

  15. Bacteriocins active against multi-resistant gram negative bacteria implicated in nosocomial infections.

    PubMed

    Ghodhbane, Hanen; Elaidi, Sabrine; Sabatier, Jean-Marc; Achour, Sami; Benhmida, Jeannette; Regaya, Imed

    2015-01-01

    Multiresistant Gram-negative bacteria are the prime mover of nosocomial infections. Some are naturally resistant to antibiotics, their genetic makes them insensitive to certain families of antibiotics and they transmit these resistors to their offspring. Moreover, when bacteria are subjected to antibiotics, they eventually develop resistance against drugs to which they were previously sensitive. In recent years, many bacteriocins active against gram-negative bacteria have been identified proving their efficacy in treating infections. While further investigation remains necessary before the possibilities for bacteriocins in clinical practice can be described more fully, this review provides an overview of bacteriocins acting on the most common infectious gram negative bacteria (Klebsiella, Acinetobacter, Pseudomonas aeruginosa and E. coli). PMID:24853876

  16. Protein secretion in Pseudomonas aeruginosa: the xcpA gene encodes an integral inner membrane protein homologous to Klebsiella pneumoniae secretion function protein PulO.

    PubMed Central

    Bally, M; Ball, G; Badere, A; Lazdunski, A

    1991-01-01

    xcp mutations have pleiotropic effects on the secretion of proteins in Pseudomonas aeruginosa PAO. The nucleotide sequence of a 1.2-kb DNA fragment that complements the xcp-1 mutation has been determined. Sequence analysis shows the xcpA gene product to be a 31.8-kDa polypeptide, with a highly hydrophobic character. This is consistent with a localization in the cytoplasmic membrane in P. aeruginosa, determined after specific expression of the xcpA gene under control of the T7 phi 10 promoter. A very strong homology was found between XcpA and PulO, a membrane protein required for pullulanase secretion in Klebsiella pneumoniae. This suggests the existence of a signal sequence-dependent secretion process common to these two unrelated gram-negative bacteria. Images PMID:1898929

  17. Identification of antigenic proteins of the nosocomial pathogen Klebsiella pneumoniae.

    PubMed

    Hoppe, Sebastian; Bier, Frank F; von Nickisch-Rosenegk, Markus

    2014-01-01

    The continuous expansion of nosocomial infections around the globe has become a precarious situation. Key challenges include mounting dissemination of multiple resistances to antibiotics, the easy transmission and the growing mortality rates of hospital-acquired bacterial diseases. Thus, new ways to rapidly detect these infections are vital. Consequently, researchers around the globe pursue innovative approaches for point-of-care devices. In many cases the specific interaction of an antigen and a corresponding antibody is pivotal. However, the knowledge about suitable antigens is lacking. The aim of this study was to identify novel antigens as specific diagnostic markers. Additionally, these proteins might be aptly used for the generation of vaccines to improve current treatment options. Hence, a cDNA-based expression library was constructed and screened via microarrays to detect novel antigens of Klebsiella pneumoniae, a prominent agent of nosocomial infections well-known for its extensive antibiotics resistance, especially by extended-spectrum beta-lactamases (ESBL). After screening 1536 clones, 14 previously unknown immunogenic proteins were identified. Subsequently, each protein was expressed in full-length and its immunodominant character examined by ELISA and microarray analyses. Consequently, six proteins were selected for epitope mapping and three thereof possessed linear epitopes. After specificity analysis, homology survey and 3d structural modelling, one epitope sequence GAVVALSTTFA of KPN_00363, an ion channel protein, was identified harboring specificity for K. pneumoniae. The remaining epitopes showed ambiguous results regarding the specificity for K. pneumoniae. The approach adopted herein has been successfully utilized to discover novel antigens of Campylobacter jejuni and Salmonella enterica antigens before. Now, we have transferred this knowledge to the key nosocomial agent, K. pneumoniae. By identifying several novel antigens and their linear epitope sites, we have paved the way for crucial future research and applications including the design of point-of-care devices, vaccine development and serological screenings for a highly relevant nosocomial pathogen. PMID:25333280

  18. Epidemic Klebsiella pneumoniae ST258 Is a Hybrid Strain

    PubMed Central

    Chen, Liang; Mathema, Barun; Pitout, Johann D. D.; DeLeo, Frank R.

    2014-01-01

    ABSTRACT Carbapenem-resistant Enterobacteriaceae (CRE), especially Klebsiella pneumoniae carbapenemase (KPC)-producing K.pneumoniae, pose an urgent threat in health facilities in the United States and worldwide. K.pneumoniae isolates classified as sequence type 258 (ST258) by multilocus sequence typing are largely responsible for the global spread of KPC. A recent comparative genome study revealed that ST258 K.pneumoniae strains are two distinct genetic clades; however, the molecular origin of ST258 largely remains unknown, and our understanding of the evolution of the two genetic clades is incomplete. Here we compared the genetic structures and single-nucleotide polymorphism (SNP) distributions in the core genomes of strains from two ST258 clades and other STs (ST11, ST442, and ST42). We identified an ~1.1-Mbp region on ST258 genomes that is homogeneous to that of ST442, while the rest of the ST258 genome resembles that of ST11. Our results suggest ST258 is a hybrid clone80% of the genome originated from ST11-like strains and 20% from ST442-like strains. Meanwhile, we sequenced an ST42 strain that carries the same K-antigen-encoding capsule polysaccharide biosynthesis gene (cps) region as ST258 clade I strains. Comparison of the cps-harboring regions between the ST42 and ST258 strains (clades I and II) suggests the ST258 clade I strains evolved from a clade II strain as a result of cps region replacement. Our findings unravel the molecular evolution history of ST258 strains, an important first step toward the development of diagnostic, therapeutic, and vaccine strategies to combat infections caused by multidrug-resistant K.pneumoniae. PMID:24961694

  19. Emergence of OXA-48-Producing Klebsiella pneumoniae in Taiwan

    PubMed Central

    Ma, Ling; Wang, Jann-Tay; Wu, Tsu-Lan; Siu, L. Kristopher; Chuang, Yin-Ching; Lin, Jung-Chung; Lu, Min-Chi; Lu, Po-Liang

    2015-01-01

    The isolation of OXA-48-producing Enterobacteriaceae has increased dramatically in Mediterranean countries in the past 10 years, and has recently emerged in Asia. Between January 2012 and May 2014, a total of 760 carbapenem non-susceptible Klebsiella pneumoniae (CnSKP) isolates were collected during a Taiwan national surveillance. Carbapenemases were detected in 210 CnSKP isolates (27.6%), including 162 KPC-2 (n = 1), KPC-3, KPC-17, and NDM-1 (n = 1 each), OXA-48 (n = 4), IMP-8 (n = 18), and VIM-1 (n = 24). The four blaOXA-48 CnSKP isolates were detected in late 2013. Herein we report the emergence OXA-48-producing K. pneumoniae isolates in Taiwan. PFGE analysis revealed that the four isolates belonged to three different pulsotypes. Three isolates harboured blaCTX-M genes and belonged to MLST type ST11. In addition, the plasmids belonged to the incompatibility group, IncA/C. One isolate belonged to ST116 and the plasmid incompatibility group was non-typeable. The sequence upstream of the blaOXA-48 gene in all four isolates was identical to pKPOXA-48N1, a blaOXA-48-carrying plasmid. This is the first report of OXA-48-producing Enterobacteriaceae in Taiwan and the second report to identify blaOXA-48 on an IncA/C plasmid in K. pneumoniae. Given that three isolates belong to the same pandemic clone (ST11) and possess the IncA/C plasmid and similar plasmid digestion profile that indicated the role of clonal spread or plasmid for dissemination of blaOXA-48 gene, the emergence of OXA-48-producing K. pneumoniae in Taiwan is of great concern. PMID:26414183

  20. Purification and properties of Klebsiella pneumoniae heat-stable enterotoxin.

    PubMed Central

    Klipstein, F A; Engert, R F

    1976-01-01

    The enterotoxic material in cell-free growth preparations of Klebsiella pneumoniae serotype 5 was purified by sequential ultrafiltration and gel filtration (GF) procedures and the fractions were assayed for enterotoxic activity by determining their ability to induce in vivo net water secretion in the rat jejunum. Whole-cell lysates were inactive. Anaerobic broth culture conditions yielded a 10-fold increase in toxin production over aerobic conditions. Enterotoxic activity was absent in the UM-10 retentate of the broth filtrate but present in both the retentate and filtrate of the UM-2 membrane. GF of the two UM-2 ultrafiltration fractions through a Sephadex G-25 column yielded an active eluate, whose potency was increased by 10- or 200-fold, in or adjacent to the void volume. When subsequently passed through a G-50 column, these pools eluted at a Kav of between 0.4 and 0.6 and were further increased in potency by two- or fivefold. A second equally potent fraction was also recovered in the void volume of the G-50 eluate of the UM-2 filtrate; this may represent a polymer. Progressive purification by GF was associated with an increased protein and decreased carbohydrate content of the most active fractions. The most active G-50 eluate of the UM-2 retentate had a minimal effective enterotoxic dose of 5 mug/ml and that of the filtrate was less than 0.1 mug/ml. Heating the active GF eluates to 100 C for 30 min did not abolish enterotoxic activity and lowering the pH to 1 or incubation with either Pronase or trypsin had no effect on activity. These observations indicate that K. pneumoniae heat-stable enterotoxin is probably a single toxin with an apparent molecular weight in the range of 5,000. The elution characteristics during GF as well as the chemical composition of the most purified enterotoxin fractions indicate that the toxin is not associated with endotoxin. PMID:4375

  1. Properties of Klebsiella phage P13 and associated exopolysaccharide depolymerase

    NASA Astrophysics Data System (ADS)

    Liu, Yang; Li, Guiyang; Mo, Zhaolan; Chai, Zihan; Shang, Anqi; Mou, Haijin

    2013-11-01

    The bacteriophage P13 that infects Klebsiella serotype K13 contains a heat-stable depolymerase capable of effective degradation of exopolysaccharide (EPS) produced by this microorganism. In this study, the titer of phage P13, initially 2.0 × 107 pfu mL-1, was found increasing 20 min after infection and reached 5.0 × 109 pfu mL-1 in 60 min. Accordingly, the enzyme activity of depolymerase approached the maximum 60 min after infection. Treatment at 70°C for 30 min inactivated all the phage, but retained over 90% of the depolymerase activity. Addition of acetone into the crude phage lysate led to precipitation of the protein, with a marked increase in bacterial EPS degradation activity and a rapid drop in the titer of phage. After partial purification by acetone precipitation and ultrafiltration centrifugation, the enzyme was separated from the phage particles, showing two components with enzyme activity on Q-Sepharose Fast Flow. The soluble enzyme had an optimum degradation activity at 60°C and pH 6.5. Transmission electron microscopy demonstrated that the phage P13 particles were spherical with a diameter of 50 nm and a short stumpy tail. It was a doublestrand DNA virus consisting of a nucleic acid molecule of 45976 bp. This work provides an efficient purification operation including thermal treatment and ultrafiltration centrifugation, to dissociate depolymerase from phage particles. The characterization of phage P13 and associated EPS depolymerase is beneficial for further application of this enzyme.

  2. Hospital Readmissions in Patients With Carbapenem-Resistant Klebsiella pneumoniae.

    PubMed

    Messina, Julia A; Cober, Eric; Richter, Sandra S; Perez, Federico; Salata, Robert A; Kalayjian, Robert C; Watkins, Richard R; Scalera, Nikole M; Doi, Yohei; Kaye, Keith S; Evans, Scott; Bonomo, Robert A; Fowler, Vance G; van Duin, David

    2016-03-01

    BACKGROUND Various transmission routes contribute to spread of carbapenem-resistant Klebsiella pneumoniae (CRKP) in hospitalized patients. Patients with readmissions during which CRKP is again isolated ("CRKP readmission") potentially contribute to transmission of CRKP. OBJECTIVE To evaluate CRKP readmissions in the Consortium on Resistance against Carbapenems in K. pneumoniae (CRaCKLe). DESIGN Cohort study from December 24, 2011, through July 1, 2013. SETTING Multicenter consortium of acute care hospitals in the Great Lakes region. PATIENTS All patients who were discharged alive during the study period were included. Each patient was included only once at the time of the first CRKP-positive culture. METHODS All readmissions within 90 days of discharge from the index hospitalization during which CRKP was again found were analyzed. Risk factors for CRKP readmission were evaluated in multivariable models. RESULTS Fifty-six (20%) of 287 patients who were discharged alive had a CRKP readmission. History of malignancy was associated with CRKP readmission (adjusted odds ratio [adjusted OR], 3.00 [95% CI, 1.32-6.65], P<.01). During the index hospitalization, 160 patients (56%) received antibiotic treatment against CRKP; the choice of regimen was associated with CRKP readmission (P=.02). Receipt of tigecycline-based therapy (adjusted OR, 5.13 [95% CI, 1.72-17.44], using aminoglycoside-based therapy as a reference in those treated with anti-CRKP antibiotics) was associated with CRKP readmission. CONCLUSION Hospitalized patients with CRKP-specifically those with a history of malignancy-are at high risk of readmission with recurrent CRKP infection or colonization. Treatment during the index hospitalization with a tigecycline-based regimen increases this risk. Infect. Control Hosp. Epidemiol. 2016;37(3):281-288. PMID:26686227

  3. Identification of Antigenic Proteins of the Nosocomial Pathogen Klebsiella pneumoniae

    PubMed Central

    Hoppe, Sebastian; Bier, Frank F.; von Nickisch-Rosenegk, Markus

    2014-01-01

    The continuous expansion of nosocomial infections around the globe has become a precarious situation. Key challenges include mounting dissemination of multiple resistances to antibiotics, the easy transmission and the growing mortality rates of hospital-acquired bacterial diseases. Thus, new ways to rapidly detect these infections are vital. Consequently, researchers around the globe pursue innovative approaches for point-of-care devices. In many cases the specific interaction of an antigen and a corresponding antibody is pivotal. However, the knowledge about suitable antigens is lacking. The aim of this study was to identify novel antigens as specific diagnostic markers. Additionally, these proteins might be aptly used for the generation of vaccines to improve current treatment options. Hence, a cDNA-based expression library was constructed and screened via microarrays to detect novel antigens of Klebsiella pneumoniae, a prominent agent of nosocomial infections well-known for its extensive antibiotics resistance, especially by extended-spectrum beta-lactamases (ESBL). After screening 1536 clones, 14 previously unknown immunogenic proteins were identified. Subsequently, each protein was expressed in full-length and its immunodominant character examined by ELISA and microarray analyses. Consequently, six proteins were selected for epitope mapping and three thereof possessed linear epitopes. After specificity analysis, homology survey and 3d structural modelling, one epitope sequence GAVVALSTTFA of KPN_00363, an ion channel protein, was identified harboring specificity for K. pneumoniae. The remaining epitopes showed ambiguous results regarding the specificity for K. pneumoniae. The approach adopted herein has been successfully utilized to discover novel antigens of Campylobacter jejuni and Salmonella enterica antigens before. Now, we have transferred this knowledge to the key nosocomial agent, K. pneumoniae. By identifying several novel antigens and their linear epitope sites, we have paved the way for crucial future research and applications including the design of point-of-care devices, vaccine development and serological screenings for a highly relevant nosocomial pathogen. PMID:25333280

  4. Removal of bacteria from stallion semen by colloid centrifugation.

    PubMed

    Morrell, J M; Klein, C; Lundeheim, N; Erol, E; Troedsson, M H T

    2014-02-01

    Bacteria (environmental contaminants and occasionally potential pathogens) are found in most stallion ejaculates and may negatively affect sperm quality during storage. Since the use of antibiotics can lead to the development of resistance, an alternative means of microbial control is desirable. The removal of bacteria from stallion semen using Single Layer Centrifugation through Androcoll-E was investigated. Known doses of cultured bacteria were added to freshly collected ejaculates (15mL aliquots) before processing by Single Layer Centrifugation. The resulting sperm pellets and controls (not processed by Single Layer Centrifugation) were cultured and the bacteria identified. In experiment 1, doses of E. coli from 210(2) to 210(7) colony forming units were added to aliquots of semen. In experiment 2, Taylorella equigenitalis or a mix of E. coli, Klebsiella pneumoniae and Streptococcus equi subsp. zooepidemicus (approximately 710(6), 510(6), and 610(6)cfu, respectively) were added to 15mL aliquots of semen. In experiment 1, more than 90% of the bacteria were removed where loading doses were >10(4)cfu/mL. In experiment 2, varying proportions of different bacteria were removed, ranging from 68% for naturally occurring Corynebacterium spp. to >97% for added cultured E. coli. Thus, Single Layer Centrifugation can separate spermatozoa from many, but not all bacteria in stallion ejaculates and could be a useful alternative to adding antibiotics to semen extenders to control bacterial contamination. However, further research is needed to determine the effect of small numbers of bacteria on sperm quality. PMID:24485764

  5. Infected Hydatid Cysts Bacteria in Slaughtered Livestock and Their Effects on Protoscoleces Degeneration

    PubMed Central

    Fallah, Mohammad; Kavand, Abdollah; Yousefi Mashouf, Rasoul

    2014-01-01

    Background: The protoscoleces of fertile hydatid cysts are considered as major risks in surgery and producing secondary cysts if rupture the cyst during operation and, cause infecting the dogs with adult worm if eaten by this animal. Bacterial infection of the hydatid fluid can lead to sterilization of the cyst. Objectives: The aim of this study was to determine the bacterial infection rate of livestock hydatid cysts in Hamedan, Iran, and test the isolated bacteria effects on viable protoscoleces, in vitro. Materials and Methods: A total of 5709 slaughtered livestock were inspected to detect the presence of hydatid cysts. The hydatid fluid of all cysts was cultured separately to isolate and identify the bacteria. The effect of isolated bacteria was tested on viable protoscoleces in culture tubes, in vitro. The culture tubes were observed and examined under a light microscope every two hours for 24 hours, and then, after 36 and 48 hours. Results: Infected cysts were found in 74% of animals in Hamedan (46% were calcified and the bacteria was isolated from 52%) and 62% in Borujerd. The isolated bacteria in the infected cysts were as follows: Escherichia coli, E. blattae, Klebsiella pnoumoniae, Proteus mirabilis, Enterobacter aerogenes, coagulase-positive and coagulase-negative Staphylococci, Pseudomonas aeruginosa and Edwardsiella tarda. The protoscoleces incubated with the isolated bacteria totally degenerated, but 55% of the protoscoleces in the control groups were intact and viable even after one week. Conclusions: This study indicated a high percentage of cysts bacterial infections in two provinces of Iran. The common isolated bacteria were E. coli and Klebsiella. The isolated bacteria degenerated the protoscoleces during short-time incubation, in vitro. PMID:25371792

  6. Effects of the hindlimb-unloading model of spaceflight conditions on resistance of mice to infection with Klebsiella pneumoniae

    NASA Technical Reports Server (NTRS)

    Belay, Tesfaye; Aviles, Hernan; Vance, Monique; Fountain, Kimberly; Sonnenfeld, Gerald

    2002-01-01

    BACKGROUND: It has been well documented in several studies that many immunologic parameters are altered in experimental animals and human subjects who have flown in space. However, it is not fully known whether these immunologic changes could result in increased susceptibility to infection. Hindlimb (antiorthostatic) unloading of rodents has been used successfully to simulate some of the effects of spaceflight on physiologic systems. OBJECTIVE: The objective of this study was to determine the effect of hindlimb unloading on the outcome of Klebsiella pneumoniae infection in mice. METHODS: Hindlimb-unloaded, hindlimb-restrained, and control mice were intraperitoneally infected with one 50% lethal dose of K pneumoniae 2 days after suspension. Mortality and bacterial load in several organs were compared among the groups. RESULTS: Unloaded mice showed significantly increased mortality and reduced mean time to death compared with that seen in the control groups. Kinetics of bacterial growth with smaller infective doses revealed that control mice were able to clear bacteria from the organs after 30 hours. In contrast, unloaded mice had continued bacterial growth at the same time point. CONCLUSION: The results of this study suggest that hindlimb unloading might enhance the dissemination of K pneumoniae, leading to increased mortality. The complex physiologic changes observed during hindlimb unloading, including stress, have a key role in the pathophysiology of this infection.

  7. S-thanatin functionalized liposome potentially targeting on Klebsiella pneumoniae and its application in sepsis mouse model

    PubMed Central

    Fan, Xiaobo; Fan, Juxiang; Wang, Xiyong; Wu, Pengpeng; Wu, Guoqiu

    2015-01-01

    S-thanatin (Ts) was a short antimicrobial peptide with selective antibacterial activity. In this study, we aimed to design a drug carrier with specific bacterial targeting potential. The positively charged Ts was modified onto the liposome surface by linking Ts to the constituent lipids via a PEG linker. The benefits of this design were evaluated by preparing a series of liposomes and comparing their biological effects in vitro and in vivo. The particle size and Zeta potential of the constructed liposomes were measured with a Zetasizer Nano ZS system and a confocal laser scanning microscope. The in vitro drug delivery potential was evaluated by measuring the cellular uptake of encapsulated levofloxacin using HPLC. Ts-linked liposome or its conjugates with quantum dots favored bacterial cells, and increased the bacterial uptake of levofloxacin. In antimicrobial assays, the Ts and levofloxacin combination showed a synergistic effect, and Ts-LPs-LEV exhibited excellent activity against the quality control stain Klebsiella pneumoniae ATCC 700603 and restored the susceptibility of multidrug-resistant K. pneumoniae clinical isolates to levofloxacin in vitro. Furthermore, Ts-LPs-LEV markedly reduced the lethality rate of the septic shock and resulted in rapid bacterial clearance in mouse models receiving clinical multidrug resistant (MDR) isolates. These results suggest that the Ts-functionalized liposome may be a promising antibiotic delivery system for clinical infectious disorders caused by MDR bacteria, in particular the sepsis related diseases. PMID:26578959

  8. Histopathologic evaluation of lung and extrapulmonary tissues show sex differences in Klebsiella pneumoniae - infected mice under different exposure conditions

    PubMed Central

    Mikerov, Anatoly N; Cooper, Timothy K; Wang, Guirong; Hu, Sanmei; Umstead, Todd M; Phelps, David S; Floros, Joanna

    2011-01-01

    It has been shown that female mice with pneumonia have a survival advantage over males, but this is reversed if ozone exposure precedes infection. The purpose of this study was to investigate factors that underlie these observations, by studying histopathologic changes in lung and extrapulmonary (spleen and liver) tissues after ozone or filtered air (FA) exposure followed by pulmonary bacterial infection. Male and female wild type C57BL/6J mice were exposed to ozone or FA, then anesthetized and infected intratracheally with Klebsiella pneumoniae bacteria. Tissues (lung, spleen, and liver) were subjected to histopathologic analysis at 48 h post-infection. We found that after infection, 1) the severity of inflammation was higher, the affected area of the lung was larger, and spleen red pulp myelopoiesis was lower in ozone-exposed mice compared to FA-exposed animals in both sexes; 2) more pronounced extrapulmonary lesions (in liver and spleen) were observed in FA-exposed males compared to FA-exposed females; and 3) excessive lung inflammatory response was detected in ozone-exposed females compared to ozone-exposed males. We concluded that different risk factors contribute to the differential outcome of pneumonia between sexes in the presence or absence of ozone-induced oxidative stress. In specific, the excessive lung inflammation and higher risk for extrapulmonary lesions in ozone-exposed infected females and in FA-exposed infected males appear to play, respectively, a dominant role in the previously observed respective survival outcomes. PMID:21941609

  9. Extended spectrum beta-lactamase-producing Klebsiella pneumoniae chronic ambulatory peritoneal dialysis peritonitis treated successfully with polymyxin B.

    PubMed

    Parchuri, Suhba; Mohan, Sowjanya; Cunha, Burke A

    2005-01-01

    Peritonitis is not an infrequent complication of inpatients with chronic ambulatory peritoneal dialysis (CAPD). CAPD peritonitis may be related to the catheter or secondary to perforation of an intra-abdominal viscus. The most common organisms usually associated with CAPD peritonitis are Staphylococcus aureus and Staphylococcus epidermidis (coagulase-negative staphylococci). Rarely, aerobic gram-negative bacilli have been the causative agents of CAPD peritonitis. The treatment of CAPD peritonitis usually requires removal of the peritoneal catheter and treatment with parenteral antibiotics active against the causative pathogen. We report a case of CAPD-associated peritonitis caused by an extended spectrum beta-lactamase-producing strain of Klebsiella pneumoniae. The case presented had this strain of multidrug-resistant K. pneumoniae present in blood cultures and the peritoneal fluid. Extended spectrum beta-lactamase-producing bacteria, for example, K. pneumoniae, are multidrug-resistant and sensitive to few antibiotics. This isolate was intermediately sensitive to amikacin and meropenem, but the patient did not clinically improve on these 2 antibiotics. Polymyxin B therapy was initiated after lack of clinical improvement after dialysis catheter removal and 1 week of meropenem and amikacin therapy. The patient responded rapidly to therapy with polymyxin B. Polymyxin B has a unique mechanism of action on bacterial cells and is highly active against all multidrug-resistant gram-negative organisms except Proteus species and Serratia marcescens. No toxicity was observed during therapy. Polymyxin B is being used increasingly as a therapeutic alternative to multidrug-resistant gram-negative organisms. PMID:16157192

  10. Direct detection and genotyping of Klebsiella pneumoniae carbapenemases from urine by use of a new DNA microarray test.

    PubMed

    Peter, Harald; Berggrav, Kathrine; Thomas, Peter; Pfeifer, Yvonne; Witte, Wolfgang; Templeton, Kate; Bachmann, Till T

    2012-12-01

    Klebsiella pneumoniae carbapenemases (KPCs) are considered a serious threat to antibiotic therapy, as they confer resistance to carbapenems, which are used to treat extended-spectrum beta-lactamase (ESBL)-producing bacteria. Here, we describe the development and evaluation of a DNA microarray for the detection and genotyping of KPC genes (bla(KPC)) within a 5-h period. To test the whole assay procedure (DNA extraction plus a DNA microarray assay) directly from clinical specimens, we compared two commercial DNA extraction kits (the QIAprep Spin miniprep kit [Qiagen] and the urine bacterial DNA isolation kit [Norgen]) for the direct DNA extraction from urine samples (dilution series spiked in human urine). Reliable single nucleotide polymorphism (SNP) typing was demonstrated using 1 10(5) CFU/ml urine for Escherichia coli (Qiagen and Norgen) and 80 CFU/ml urine, on average, for K. pneumoniae (Norgen). This study presents, for the first time, the combination of a new KPC microarray with commercial sample preparation for detecting and genotyping microbial pathogens directly from clinical specimens; this paves the way toward tests providing epidemiological and diagnostic data, enabling better antimicrobial stewardship. PMID:23035190

  11. Degradation of the metal-cyano complex tetracyanonickelate(II) by cyanide-utilizing bacterial isolates. [Klebsiella; Pseudomonas putida

    SciTech Connect

    Silva-Avalos, J.; Richmond, M.G.; Nagappan, O.; Kunz, D.A. )

    1990-12-01

    Ten bacterial isolates capable of growth on tetracyanonickelate(II) {l brace}K{sub 2}(Ni(CN){sub 4}){r brace} (TCN) as the sole nitrogen source were isolated from soil, freshwater, and sewage sludge enrichments. Seven of the 10 were identified as pseudomonads, while the remaining 3 were classified as Klebsiella species. A detailed investigation of one isolate, Pseudomonas putide BCN3, revealed a rapid growth rate on TCN (generation time, 2 h), with substrate removal and growth occurring in parallel. In addition to TCN, all isolates were able to utilize KCN, although the latter was significantly more toxic; MICs ranged from 0.2 to 0.8 mM for KCN and {ge}50 mM for TCN. While growth occurred over a wide range of TCN concentrations (0.25 to 16 mM), degradation was most substantial under growth-limiting conditions and did not occur when ammonia was present. In addition, cells grown on TCN were found to accumulate nickel cyanide (Ni(CN){sub 2}) as a major biodegradation product. The results show that bacteria capable of growth on TCN can readily be isolated and that degradation (i) appears to parallel the capacity for growth on KCN, (ii) does not occur in the presence of ammonia, and (iii) proceeds via the formation of Ni(CN){sub 2} as a biological metabolite.

  12. Comparison of Biofilm and Attachment Mechanisms of a Phytopathological and Clinical Isolate of Klebsiella pneumoniae Subsp. pneumoniae

    PubMed Central

    Nicolau Korres, Adriana Marcia; Aquije, Gloria Maria de Farias V.; Buss, David S.; Ventura, Jose Aires; Fernandes, Patricia Machado Bueno; Fernandes, Antonio Alberto Ribeiro

    2013-01-01

    Some bacterial species can colonize humans and plants. It is almost impossible to prevent the contact of clinically pathogenic bacteria with food crops, and if they can persist there, they can reenter the human food chain and cause disease. On the leaf surface, microorganisms are exposed to a number of stress factors. It is unclear how they survive in such different environments. By increasing adhesion to diverse substrates, minimizing environmental differences, and providing protection against defence mechanisms, biofilms could provide part of the answer. Klebsiella pneumoniae subsp. pneumoniae is clinically important and also associated with fruit diseases, such as pineapple fruit collapse. We aimed to characterize biofilm formation and adhesion mechanisms of this species isolated from pineapple in comparison with a clinical isolate. No differences were found between the two isolates quantitatively or qualitatively. Both tested positive for capsule formation and were hydrophobic, but neither produced adherence fibres, which might account for their relatively weak adhesion compared to the positive control Staphylococcus epidermidis ATCC 35984. Both produced biofilms on glass and polystyrene, more consistently at 40C than 35C, confirmed by atomic force and high-vacuum scanning electron microscopy. Biofilm formation was maintained in an acidic environment, which may be relevant phytopathologically. PMID:24222755

  13. Direct Detection and Genotyping of Klebsiella pneumoniae Carbapenemases from Urine by Use of a New DNA Microarray Test

    PubMed Central

    Peter, Harald; Berggrav, Kathrine; Thomas, Peter; Pfeifer, Yvonne; Witte, Wolfgang; Templeton, Kate

    2012-01-01

    Klebsiella pneumoniae carbapenemases (KPCs) are considered a serious threat to antibiotic therapy, as they confer resistance to carbapenems, which are used to treat extended-spectrum beta-lactamase (ESBL)-producing bacteria. Here, we describe the development and evaluation of a DNA microarray for the detection and genotyping of KPC genes (blaKPC) within a 5-h period. To test the whole assay procedure (DNA extraction plus a DNA microarray assay) directly from clinical specimens, we compared two commercial DNA extraction kits (the QIAprep Spin miniprep kit [Qiagen] and the urine bacterial DNA isolation kit [Norgen]) for the direct DNA extraction from urine samples (dilution series spiked in human urine). Reliable single nucleotide polymorphism (SNP) typing was demonstrated using 1 105 CFU/ml urine for Escherichia coli (Qiagen and Norgen) and 80 CFU/ml urine, on average, for K. pneumoniae (Norgen). This study presents, for the first time, the combination of a new KPC microarray with commercial sample preparation for detecting and genotyping microbial pathogens directly from clinical specimens; this paves the way toward tests providing epidemiological and diagnostic data, enabling better antimicrobial stewardship. PMID:23035190

  14. Effect of antimicrobial peptides on colistin-susceptible and colistin-resistant strains of Klebsiella pneumoniae and Enterobacter asburiae.

    PubMed

    Kádár, Béla; Kocsis, Béla; Kristof, Katalin; Tóth, Ákos; Szabó, Dóra

    2015-12-01

    In this study susceptibility to different antimicrobial peptides was investigated on colistin-susceptible and colistin-resistant identical pulsotype strains of KPC-2 producing Klebsiella pneumoniae ST258 as well as colistin-susceptible and colistin-resistant Enterobacter asburiae strains isolated from clinical samples. In our test, bacteria were exposed to 50 mg/ml lactoferrin, lysozyme and protamine - cationic antimicrobial peptides belonging to innate immune system and having structural similarity to polymyxins - in separate reactions. After 18 hours incubation of colonies were counted. 40% of colistin-resistant K. pneumoniae strains and 97% of colistin-susceptible counterpart strains were lysed by protamine whereas 87% and 100% colony forming unit decrease by lysozyme was seen, respectively. In the case of colistin-resistant E. asburiae strains 1 log10 cell count increase were observed after treatment with lysozyme and 1.56 log10 after lactoferrin exposure compared to the initial number whereas the colistin-susceptible showed no relevant cell count increase. Our findings suggest that acquired colistin-resistance in Enterobacteriaceae is associated with tolerance against antimicrobial peptides. PMID:26689883

  15. The emergence of Klebsiella pneumoniae endogenous endophthalmitis in the USA: basic and clinical advances

    PubMed Central

    2013-01-01

    Endogenous endophthalmitis (EE) is a rare but devastating infection that occurs secondary to seeding of the intraocular cavity from an extraocular focus. Recent reports suggest the increasing prevalence and incidence of Klebsiella pneumoniae as a causative organism in Asian countries. Analysis of the largest cohorts published to date suggests that K. pneumoniae endogenous endophthalmitis (KPEE) is 10 to 15 times more prevalent than other causes of EE. The incidence of KPEE among patients with systemic Klebsiella infection appears to be >100-fold more common than other causes of EE. The exact reason for these observations is not clear, but a number of studies now suggest that Klebsiella serotypes K1 and K2 have virulence factors that enhance their survival in diabetic patients and increase their pathogenicity. Here, we report two cases of KPEE in the USA. We also review the recent clinical and basic science literature on the prevalence, incidence, and pathophysiology of this emerging and devastating infection. PMID:23514342

  16. Isolation of a salt tolerant pleomorphic Klebsiella strain from a case of diabetic periodontitis.

    PubMed

    Linke, H A; Sánchez-Cordero, S; Hoffman, H

    1980-01-01

    An unusual Klebsiella strain was isolated from a deep periodontal pocket of a diabetic patient. According to its biochemical reactions the new strain differed from Klebsiella pneumoniae and other described biotypes. In addition, the new isolate was very salt tolerant; in the presence of 7.5% sodium chloride the bacterium changed into a spirillum-like form, with highly pleomorphic filaments, and reverted immediately to the short rod form at lower sodium chloride concentrations or in the absence of sodium chloride. Optimum growth was observed in the presence of 2% sodium chloride. A wide range of carbohydrates was fermented with a large amount of gas production. It appears that the adaptation of the isolated Klebsiella strain to sodium chloride allows it to enter the ecological niche of periodontal lesions. PMID:7432188

  17. The Role of Klebsiella in Crohn's Disease with a Potential for the Use of Antimicrobial Measures

    PubMed Central

    Rashid, Taha; Ebringer, Alan; Wilson, Clyde

    2013-01-01

    There is a general consensus that Crohn's disease (CD) develops as the result of immune-mediated tissue damage triggered by infections with intestinal microbial agents. Based on the results of existing microbiological, molecular, and immunological studies, Klebsiella microbe seems to have a key role in the initiation and perpetuation of the pathological damage involving the gut and joint tissues in patients with CD. Six different gastroenterology centres in the UK have reported elevated levels of antibodies to Klebsiella in CD patients. There is a relationship between high intake of starch-containing diet, enhanced growth of gut microbes, and the production of pullulanases by Klebsiella. It is proposed that eradication of these microbes by the use of antibiotics and low starch diet, in addition to the currently used treatment, could help in alleviating or halting the disease process in CD. PMID:24223596

  18. Receptor for Advanced Glycation End Products (RAGE) Serves a Protective Role during Klebsiella pneumoniae - Induced Pneumonia

    PubMed Central

    Achouiti, Ahmed; de Vos, Alex F.; van ‘t Veer, Cornelis; Florquin, Sandrine; Tanck, Michael W.; Nawroth, Peter P.; Bierhaus, Angelika; van der Poll, Tom; van Zoelen, Marieke A. D.

    2016-01-01

    Klebsiella species is the second most commonly isolated gram-negative organism in sepsis and a frequent causative pathogen in pneumonia. The receptor for advanced glycation end products (RAGE) is expressed on different cell types and plays a key role in diverse inflammatory responses. We here aimed to investigate the role of RAGE in the host response to Klebsiella (K.) pneumoniae pneumonia and intransally inoculated rage gene deficient (RAGE-/-) and normal wild-type (Wt) mice with K. pneumoniae. Klebsiella pneumonia resulted in an increased pulmonary expression of RAGE. Furthermore, the high-affinity RAGE ligand high mobility group box-1 was upregulated during K. pneumoniae pneumonia. RAGE deficiency impaired host defense as reflected by a worsened survival, increased bacterial outgrowth and dissemination in RAGE-/- mice. RAGE-/- neutrophils showed a diminished phagocytosing capacity of live K. pneumoniae in vitro. Relative to Wt mice, RAGE-/- mice demonstrated similar lung inflammation, and slightly elevated—if any—cytokine and chemokine levels and unchanged hepatocellular injury. In addition, RAGE-/- mice displayed an unaltered response to intranasally instilled Klebsiella lipopolysaccharide (LPS) with respect to pulmonary cell recruitment and local release of cytokines and chemokines. These data suggest that (endogenous) RAGE protects against K. pneumoniae pneumonia. Also, they demonstrate that RAGE contributes to an effective antibacterial defense during K. pneumoniae pneumonia, at least partly via its participation in the phagocytic properties of professional granulocytes. Additionally, our results indicate that RAGE is not essential for the induction of a local and systemic inflammatory response to either intact Klebsiella or Klebsiella LPS. PMID:26824892

  19. Klebsiella pneumoniae induces an inflammatory response in an in vitro model of blood-retinal barrier.

    PubMed

    Motta, C; Salmeri, M; Anfuso, C D; Amodeo, A; Scalia, M; Toscano, M A; Giurdanella, G; Alberghina, M; Lupo, G

    2014-02-01

    Klebsiella pneumoniae has become an important pathogen in recent years. Although most cases of K. pneumoniae endogenous endophthalmitis occur via hematogenous spread, it is not yet clear which microbial and host factors are responsible for the ability of K. pneumoniae to cross the blood-retinal barrier (BRB). In the present study, we show that in an in vitro model of BRB based on coculturing primary bovine retinal endothelial cells (BREC) and primary bovine retinal pericytes (BRPC), K. pneumoniae infection determines changes of transendothelial electrical resistance (TEER) and permeability to sodium fluorescein. In the coculture model, bacteria are able to stimulate the enzyme activities of endothelial cytosolic and Ca(2+)-independent phospholipase A2s (cPLA2 and iPLA2). These results were confirmed by the incremental expression of cPLA2, iPLA2, cyclo-oxygenase-1 (COX1), and COX2 in BREC, as well as by cPLA2 phosphorylation. In supernatants of K. pneumoniae-stimulated cocultures, increases in prostaglandin E2 (PGE2), interleukin-6 (IL-6), IL-8, and vascular endothelial growth factor (VEGF) production were found. Incubation with K. pneumoniae in the presence of arachidonoyl trifluoromethyl ketone (AACOCF3) or bromoenol lactone (BEL) caused decreased PGE2 and VEGF release. Scanning electron microscopy and transmission electron microscopy images of BREC and BRPC showed adhesion of K. pneumoniae to the cells, but no invasion occurred. K. pneumoniae infection also produced reductions in pericyte numbers; transfection of BREC cocultured with BRPC and of human retinal endothelial cells (HREC) cocultured with human retinal pericytes (HRPC) with small interfering RNAs (siRNAs) targeted to cPLA2 and iPLA2 restored the pericyte numbers and the TEER and permeability values. Our results show the proinflammatory effect of K. pneumoniae on BREC, suggest a possible mechanism by which BREC and BRPC react to the K. pneumoniae infection, and may provide physicians and patients with new ways of fighting blinding diseases. PMID:24478098

  20. CXCL1 Regulates Pulmonary Host Defense to Klebsiella Infection via CXCL2 , CXCL5, NF-κB and MAPKs

    PubMed Central

    Cai, Shanshan; Batra, Sanjay; Lira, Sergio A.; Kolls, Jay K.; Jeyaseelan, Samithamby

    2010-01-01

    Pulmonary bacterial infections are a leading cause of death. Since the introduction of antibiotics, multidrug-resistant Klebsiella pneumoniae (Kp) became an escalating threat. Therefore, development of methods to augment antibacterial defense is warranted. Neutrophil recruitment is critical to clear bacteria and neutrophil migration in the lung requires the production of ELR+ CXC chemokines. Although lung specific CXCL1/KC transgene expression causes neutrophil-mediated clearance of Kp, the mechanisms underlying KC-mediated host defense against Kp have not been explored. Here we delineated the host defense functions of KC during pulmonary Kp infection using KC-/- mice. Our findings demonstrate that KC is important for expression of CXCL2/MIP-2 and CXCL5/LIX and activation of NF-κB, and MAPKs in the lung. Furthermore, KC-derived from both hematopoietic and resident cells contributes to host defense against Kp. Neutrophil depletion in mice prior to Kp infection reveals no differences in the production of MIP-2 and LIX or activation of NF-κB and MAPKs in the lung. Using murine bone marrow-derived (BMMs) and alveolar macrophages, we confirmed KC-mediated upregulation of MIP-2 and activation of NF-κB and MAPKs upon Kp infection. Moreover, neutralizing KC in BMMs prior to Kp challenge decreases bacteria-induced production of KC, MIP-2 and activation of NF-κB and MAPKs. These findings reveal the importance of KC produced by hematopoietic and resident cells in regulating pulmonary host defense against a bacterial pathogen via the activation of transcription factors and MAPKs as well as the expression of cell adhesion molecules and other neutrophil chemoattractants. PMID:20937845

  1. In Silico Analysis of Usher Encoding Genes in Klebsiella pneumoniae and Characterization of Their Role in Adhesion and Colonization

    PubMed Central

    Khater, Fida; Balestrino, Damien; Charbonnel, Nicolas; Dufayard, Jean François; Brisse, Sylvain; Forestier, Christiane

    2015-01-01

    Chaperone/usher (CU) assembly pathway is used by a wide range of Enterobacteriaceae to assemble adhesive surface structures called pili or fimbriae that play a role in bacteria-host cell interactions. In silico analysis revealed that the genome of Klebsiella pneumoniae LM21 harbors eight chromosomal CU loci belonging to γκп and ϭ clusters. Of these, only two correspond to previously described operons, namely type 1 and type 3-encoding operons. Isogenic usher deletion mutants of K. pneumoniae LM21 were constructed for each locus and their role in adhesion to animal (Intestine 407) and plant (Arabidopsis thaliana) cells, biofilm formation and murine intestinal colonization was investigated. Type 3 pili usher deleted mutant was impaired in all assays, whereas type 1 pili usher deleted mutant only showed attenuation in adhesion to plant cells and in intestinal colonization. The LM21ΔkpjC mutant was impaired in its capacity to adhere to Arabidopsis cells and to colonize the murine intestine, either alone or in co-inoculation experiments. Deletion of LM21kpgC induced a significant decrease in biofilm formation, in adhesion to animal cells and in colonization of the mice intestine. The LM21∆kpaC and LM21∆kpeC mutants were only attenuated in biofilm formation and the adhesion abilities to Arabidopsis cells, respectively. No clear in vitro or in vivo effect was observed for LM21∆kpbC and LM21∆kpdC mutants. The multiplicity of CU loci in K. pneumoniae genome and their specific adhesion pattern probably reflect the ability of the bacteria to adhere to different substrates in its diverse ecological niches. PMID:25751658

  2. Insights into the evolution of gene organization and multidrug resistance from Klebsiella pneumoniae plasmid pKF3-140.

    PubMed

    Bai, Jie; Liu, Qi; Yang, Yang; Wang, Junrong; Yang, Yanmei; Li, Jinsong; Li, Peizhen; Li, Xueying; Xi, Yali; Ying, Jun; Ren, Ping; Yang, Lei; Ni, Liyan; Wu, Jinyu; Bao, Qiyu; Zhou, Tieli

    2013-04-25

    Plasmid-mediated transfer of drug-resistance genes among various bacterial species is considered one of the most important mechanisms for the spread of multidrug resistance. To gain insights into the evolution of gene organization and antimicrobial resistance in clinical bacterial samples, a complete plasmid genome of Klebsiella pneumoniae pKF3-140 is determined, which has a circular chromosome of 147,416bp in length. Among the 203 predicted genes, 142 have function assignment and about 50 appear to be involved in plasmid replication, maintenance, conjugative transfer, iron acquisition and transport, and drug resistance. Extensive comparative genomic analyses revealed that pKF3-140 exhibits a rather low sequence similarity and structural conservation with other reported K. pneumoniae plasmids. In contrast, the overall organization of pKF3-140 is highly similar to Escherichia coli plasmids p1ESCUM and pUTI89, which indicates the possibility that K. pneumoniae pKF3-140 may have a potential origin in E. coli. Meanwhile, interestingly, several drug resistant genes show high similarity to the plasmid pU302L in Salmonella enterica serovar Typhimurium U302 strain G8430 and the plasmid pK245 in K. pneumoniae. This mosaic pattern of sequence similarities suggests that pKF3-140 might have arisen from E. coli and acquired the resistance genes from a variety of enteric bacteria and underscores the importance of a further understanding of horizontal gene transfer among enteric bacteria. PMID:23402892

  3. Klebsiella pneumonia: An unusual cause of ophthalmia neonatorum in a healthy newborn.

    PubMed

    Kumar, Jaya B; Silverstein, Evan; Wallace, David K

    2015-12-01

    Ophthalmia neonatorum is one of the most common infections during the neonatal period. Chlamydia trachomatis and Neisseria gonorrhoea must be ruled out, given their high virulence and systemic complications. We describe a case of ophthalmia neonatroum from Klebsiella pneumonia. Gram-negative organisms have been reported in hospital-acquired conjunctivitis (HAC), but we are unaware of any published reports of K. pneumonia conjunctivitis in an otherwise healthy full-term infant born in the United States who has received prophylaxis. It is important to promptly identify and treat Klebsiella conjunctivitis because it can lead to severe complications. PMID:26691043

  4. Inhibition of spoilage and food-borne pathogens by lactic acid bacteria isolated from fermenting tef (Eragrostis tef) dough.

    PubMed

    Nigatu, A; Gashe, B A

    1994-10-01

    A study was carried out at the Department of Biology, Addis Abeba University, in 1991 to determine the inhibitory potential of fermenting tef and the lactic acid bacteria isolated from fermenting tef dough on Salmonella spp., Pseudomonas aeruginosa, Klebsiella spp., Bacillus cereus and Staphylococcus aureus. The test bacteria grew in the fermenting tef uptill 30 hr or till the pH dropped to 4.7. Thereafter, growth was inhibited and decreases in population were apparent. The results showed that the spent media from all of the four lactic acid bacterial isolates, namely, Lactobacillus spp., Pediococcus spp., Leuconostoc spp. and Streptococcus spp. inhibited the test bacteria. Acidity on its own was not responsible for the inhibition of the test bacteria. The spent medium from Streptococcus spp. showed the best inhibitory activity amongst the lactic acid bacteria. PMID:7835350

  5. Bacteria isolated from amoebae/bacteria consortium

    DOEpatents

    Tyndall, R.L.

    1995-05-30

    New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

  6. Bacteria isolated from amoebae/bacteria consortium

    DOEpatents

    Tyndall, Richard L. (Clinton, TN)

    1995-01-01

    New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

  7. Gram-negative bacteria from the camel tick Hyalomma dromedarii (Ixodidae) and the chicken tick Argas persicus (Argasidae) and their antibiotic sensitivities.

    PubMed

    Montasser, Ashraf A

    2005-04-01

    A total of nine species of gram-negative bacteria were isolated from organs and haemolymph of the hard tick Hyalomma (Hyalomma) dromedarii and the soft tick Argas (Persicargas) persicus. Four species namely Serratia liquefaciens, Stenotrophomonas maltophilia, Klebsiella ornithinolytica and Aeromonas hydrophila were isolated from H. dromedarii and five species namely Rahnella aquatilis, Pseudomonas fluorescens, Enterobacter cloacae, Chryseomonas luteola and Chryseobacterium meningosepticum were isolated from A. persicus. Isolated bacteria were identified using the analytical profile index 20E. Disk diffusion test was carried out on all isolated bacteria to determine antibiotic sensitivity of chloramphenicol, amoxillin/clavulanic acid, neomycin, streptomycin, triplesulphur tetracycline and nitrofurantion. The results were discussed. PMID:15880998

  8. Fungi outcompete bacteria under increased uranium concentration in culture media.

    PubMed

    Mumtaz, Saqib; Streten-Joyce, Claire; Parry, David L; McGuinness, Keith A; Lu, Ping; Gibb, Karen S

    2013-06-01

    As a key part of water management at the Ranger Uranium Mine (Northern Territory, Australia), stockpile (ore and waste) runoff water was applied to natural woodland on the mine lease in accordance with regulatory requirements. Consequently, the soil in these Land Application Areas (LAAs) presents a range of uranium concentrations. Soil samples were collected from LAAs with different concentrations of uranium and extracts were plated onto LB media containing no (0 ppm), low (3 ppm), medium (250 ppm), high (600 ppm) and very high (1500 ppm) uranium concentrations. These concentrations were similar to the range of measured uranium concentrations in the LAAs soils. Bacteria grew on all plates except for the very high uranium concentrations, where only fungi were recovered. Identifications based on bacterial 16S rRNA sequence analysis showed that the dominant cultivable bacteria belonged to the genus Bacillus. Members of the genera Paenibacillus, Lysinibacillus, Klebsiella, Microbacterium and Chryseobacterium were also isolated from the LAAs soil samples. Fungi were identified by sequence analysis of the intergenic spacer region, and members of the genera Aspergillus, Cryptococcus, Penicillium and Curvularia were dominant on plates with very high uranium concentrations. Members of the Paecilomyces and Alternaria were also present but in lower numbers. These findings indicate that fungi can tolerate very high concentrations of uranium and are more resistant than bacteria. Bacteria and fungi isolated at the Ranger LAAs from soils with high concentrations of uranium may have uranium binding capability and hence the potential for uranium bioremediation. PMID:23416228

  9. Insect Antimicrobial Peptide Complexes Prevent Resistance Development in Bacteria

    PubMed Central

    Chernysh, Sergey; Gordya, Natalia; Suborova, Tatyana

    2015-01-01

    In recent decades much attention has been paid to antimicrobial peptides (AMPs) as natural antibiotics, which are presumably protected from resistance development in bacteria. However, experimental evolution studies have revealed prompt resistance increase in bacteria to any individual AMP tested. Here we demonstrate that naturally occurring compounds containing insect AMP complexes have clear advantage over individual peptide and small molecule antibiotics in respect of drug resistance development. As a model we have used the compounds isolated from bacteria challenged maggots of Calliphoridae flies. The compound isolated from blow fly Calliphora vicina was found to contain three distinct families of cell membrane disrupting/permeabilizing peptides (defensins, cecropins and diptericins), one family of proline rich peptides and several unknown antimicrobial substances. Resistance changes under long term selective pressure of the compound and reference antibiotics cefotaxime, meropenem and polymyxin B were tested using Escherichia coli, Klebsiella pneumonia and Acinetobacter baumannii clinical strains. All the strains readily developed resistance to the reference antibiotics, while no signs of resistance growth to the compound were registered. Similar results were obtained with the compounds isolated from 3 other fly species. The experiments revealed that natural compounds containing insect AMP complexes, in contrast to individual AMP and small molecule antibiotics, are well protected from resistance development in bacteria. Further progress in the research of natural AMP complexes may provide novel solutions to the drug resistance problem. PMID:26177023

  10. Antibiotic-producing bacteria from stag beetle mycangia.

    PubMed

    Miyashita, Atsushi; Hirai, Yuuki; Sekimizu, Kazuhisa; Kaito, Chikara

    2015-02-01

    The search for new antibiotics or antifungal agents is crucial for the chemotherapies of infectious diseases. The limited resource of soil bacteria makes it difficult to discover such new drug candidate. We, therefore, focused on another bacterial resource than soil bacteria, the microbial flora of insect species. In the present study, we isolated 40 strains of bacteria and fungi from the mycangia of three species of stag beetle, Dorcus hopei binodulosus, Dorcus rectus, and Dorcus titanus pilifer. We identified those species with their ribosomal DNA sequences, and revealed that Klebsiella spp. are the most frequent symbiont in the stag beetle mycangia. We examined whether these microorganisms produce antibiotics against a Gram-negative bacterium, Escherichia coli, a Gram-positive bacterium, Staphylococcus aureus, or a fungus, Cryptococcus neoformans. Culture supernatants from 33, 29, or 18 strains showed antimicrobial activity against E. coli, S. aureus, or C. neoformans, respectively. These findings suggest that bacteria present in the mycangia of stag beetles are useful resources for screening novel antibiotics. PMID:25639488

  11. Bleach vs. Bacteria

    MedlinePLUS

    ... Articles | Inside Life Science Home Page Bleach vs. Bacteria By Sharon Reynolds Posted April 2, 2014 Your ... hypochlorous acid to help kill invading microbes, including bacteria. Researchers funded by the National Institutes of Health ...

  12. Comparison of bacteria populations in clean and recycled sand used for bedding in dairy facilities.

    PubMed

    Kristula, M A; Rogers, W; Hogan, J S; Sabo, M

    2005-12-01

    Bedding samples were collected twice from commercial dairy free-stall facilities that used recycled sand and clean sand in both the summer and winter. Collection began on the day sand was taken from the pile (d 0) and placed in the free stalls, and continued for 5 to 7 additional days. The number of colonies per gram of bedding of gram-negative bacteria, coliforms, Streptococcus spp., and Klebsiella spp. were estimated for each sand sample as well as amounts of dry and organic matter. Clean sand (CS) and recycled sand (RS) had the same bacterial counts when compared at any sampling time. The mean counts of bacterial populations did vary over the course of the study in both CS and RS. There was a significant increase in bacterial counts from d 0 to d 1 for gram-negative bacteria, coliforms, and Streptococcus spp. in both winter and summer. Counts of gram-negative bacteria, coliforms, Klebsiella spp., and Streptococcus spp. did not differ from d 1 to 7 in the winter. Total counts of gram-negative bacteria did not differ from d 1 to 7 in the summer. On d 1 in the summer, coliform counts were lower than at d 5 to 7, and Klebsiella spp. counts were lower than on d 3 to 7. Streptococcus spp. counts were high on d 1 and were constant through d 7 in both winter and summer trials. The number of coliform and Klebsiella spp. in both CS and RS was below the threshold thought to cause mastitis during the sampling times. The number of Streptococcus spp. was high in both CS and RS during the sampling periods. Other management factors need to be identified to decrease the number of Streptococcus spp. in bedding. Recycled sand had a higher organic matter and lower dry matter compared with CS in winter and summer. The results for this study were obtained from multiple herd comparisons, and herd was a significant effect suggesting that different management systems influence the number and types of bacteria in both CS and RS. PMID:16291623

  13. CHAPTER IV-2 BACTERIA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Entomopathogenic bacteria provide an alternative to chemical pesticides used in insect control programs. Today, the principal microbial insecticides utilize spore forming bacteria or toxins produced by these bacteria as their active ingredients, either in formulations or by incorporation of toxin g...

  14. Phenotypic and Molecular Characterization of Multidrug Resistant Klebsiella pneumoniae Isolated from a University Teaching Hospital, China

    PubMed Central

    Liu, Helu; L, Dongyue; Liang, Hong; Dou, Yuhong

    2014-01-01

    The multidrug-resistant rate of Klebsiella pneumoniae has risen rapidly worldwide. To better understand the multidrug resistance situation and molecular characterization of Klebsiella pneumoniae, a total of 153 Klebsiella pneumoniae isolates were collected, and drug susceptibility test was performed to detect its susceptibility patterns to 13 kinds of antibiotics. Phenotypic tests for carbapenemases ESBLs and AmpC enzyme-producing strains were performed to detect the resistance phenotype of the isolates. Then PCR amplification and sequencing analysis were performed for the drug resistance determinants. The results showed that 63 strains harbored blaCTX-M gene, and 14 strains harbored blaDHA gene. Moreover, there were 5 strains carrying blaKPC gene, among which 4 strains carried blaCTX-M, blaDHA and blaKPC genes, and these 4 strains were also resistant to imipenem. Our data indicated that drug-resistant Klebsiella pneumoniae were highly prevalent in the hospital. Thus it is warranted that surveillance of epidemiology of those resistant isolates should be a cause for concern, and appropriate drugs should be chosen. PMID:24740167

  15. Neonatal Klebsiella Septicaemia in Ibadan: Implications for Neonatal Care in Developing Countries.

    ERIC Educational Resources Information Center

    Omokhodion, S. I.; And Others

    1993-01-01

    The antecedent events, clinical features, prevalence, and complications of neonatal Klebsiella septicaemia in 73 infants admitted to a special care baby unit in Nigeria are retrospectively reviewed and compared with those of 72 infants who had no risk factors for sepsis admitted to the same unit during the same period. A nosocomial acquisition of…

  16. Genomic Sequence of Klebsiella pneumoniae IIEMP-3, a Vitamin B12-Producing Strain from Indonesian Tempeh.

    PubMed

    Yulandi, Adi; Sugiokto, Febri Gunawan; Febrilina; Suwanto, Antonius

    2016-01-01

    Klebsiella pneumoniae strain IIEMP-3, isolated from Indonesian tempeh, is a vitamin B12-producing strain that exhibited a different genetic profile from pathogenic isolates. Here we report the draft genome sequence of strain IIEMP-3, which may provide insights on the nature of fermentation, nutrition, and immunological function of Indonesian tempeh. PMID:26950331

  17. Complete Genome Sequence of KPC-Producing Klebsiella pneumoniae Strain CAV1193

    PubMed Central

    Sebra, Robert; Kasarskis, Andrew; Deikus, Gintaras; Anson, Luke; Walker, A. Sarah; Peto, Tim E.; Crook, Derrick W.

    2016-01-01

    Carbapenem resistance in Klebsiella pneumoniae, frequently conferred by the blaKPC gene, is a major public health threat. We sequenced a blaKPC-containing strain of K.pneumoniae belonging to the emergent lineage ST941, in order to better understand the evolution of blaKPC within this species. PMID:26823590

  18. Complete Genome Sequence of Klebsiella pneumoniae Carbapenemase-Producing K. pneumoniae Siphophage Sushi.

    PubMed

    Nguyen, Dat T; Lessor, Lauren E; Cahill, Jesse L; Rasche, Eric S; Kuty Everett, Gabriel F

    2015-01-01

    Klebsiella pneumoniae is a Gram-negative bacterium in the family Enterobacteriaceae. It is associated with numerous nosocomial infections, including respiratory and urinary tract infections in humans. The following reports the complete genome sequence of K. pneumoniae carbapenemase-producing K.pneumoniae T1-like siphophage Sushi and describes its major features. PMID:26337889

  19. Liver Abscess Caused by Infection with Community-Acquired Klebsiella quasipneumoniae subsp. quasipneumoniae

    PubMed Central

    Breurec, Sebastien; Melot, Benedicte; Hoen, Bruno; Passet, Virginie; Schepers, Kinda; Bastian, Sylvaine

    2016-01-01

    We report a case of pyogenic liver abscess caused by community-acquired Klebsiella quasipneumoniae subsp. quasipneumoniae. The infecting isolate had 2 prominent features of hypervirulent K. pneumoniae strains: the capsular polysaccharide synthesis region for K1 serotype and the integrative and conjugative element ICEKp1, which encodes the virulence factors yersiniabactin, salmochelin, and RmpA. PMID:26890371

  20. Complete Genome Sequence of Klebsiella pneumoniae Carbapenemase-Producing K. pneumoniae Siphophage Sushi

    PubMed Central

    Nguyen, Dat T.; Lessor, Lauren E.; Cahill, Jesse L.; Rasche, Eric S.

    2015-01-01

    Klebsiella pneumoniae is a Gram-negative bacterium in the family Enterobacteriaceae. It is associated with numerous nosocomial infections, including respiratory and urinary tract infections in humans. The following reports the complete genome sequence of K. pneumoniae carbapenemase-producing K.pneumoniae T1-like siphophage Sushi and describes its major features. PMID:26337889

  1. Genome Sequences of Klebsiella variicola Isolates from Dairy Animals with Bovine Mastitis from Newfoundland, Canada

    PubMed Central

    Davidson, Fraser W.; Whitney, Hugh G.

    2015-01-01

    Klebsiella variicola was recently reported as an emerging and/or previously misidentified species associated with opportunistic infections in humans. Here, we report the draft genome sequences of K.variicola isolates from two animals with clinical mastitis from a dairy farm in Newfoundland, Canada. PMID:26358587

  2. Necrotizing Fasciitis Caused by Hypermucoviscous Klebsiella pneumoniae in a Filipino Female in North America

    PubMed Central

    Ng, Daniel; Frazee, Brad

    2015-01-01

    Necrotizing fasciitis caused by Klebsiella pneumoniae has been described in Southeast Asia, but has only recently begun to emerge in North America. The hypermucoviscous strain of K. pneumoniae is a particularly virulent strain known to cause devastatingly invasive infections, including necrotizing fasciitis. Here we present the first known case of necrotizing fasciitis caused by hypermucoviscous K. pneumoniae in North America. PMID:25671032

  3. Complete Genome Sequence of Klebsiella pneumoniae Carbapenemase-Producing K. pneumoniae Myophage Miro

    PubMed Central

    Mijalis, Eleni M.; Lessor, Lauren E.; Cahill, Jesse L.; Rasche, Eric S.

    2015-01-01

    Klebsiella pneumoniae is a Gram-negative pathogen frequently associated with antibiotic-resistant nosocomial infections. Bacteriophage therapy against K.pneumoniae may be possible to combat these infections. The following describes the complete genome sequence and key features of the pseudo-T-even K.pneumoniae carbapenemase (KPC)-producing K. pneumoniae myophage Miro. PMID:26430050

  4. Liver Abscess Caused by Infection with Community-Acquired Klebsiella quasipneumoniae subsp. quasipneumoniae.

    PubMed

    Breurec, Sebastien; Melot, Benedicte; Hoen, Bruno; Passet, Virginie; Schepers, Kinda; Bastian, Sylvaine; Brisse, Sylvain

    2016-03-01

    We report a case of pyogenic liver abscess caused by community-acquired Klebsiella quasipneumoniae subsp. quasipneumoniae. The infecting isolate had 2 prominent features of hypervirulent K. pneumoniae strains: the capsular polysaccharide synthesis region for K1 serotype and the integrative and conjugative element ICEKp1, which encodes the virulence factors yersiniabactin, salmochelin, and RmpA. PMID:26890371

  5. Liver Abscess Caused by magA+ Klebsiella pneumoniae in North America

    PubMed Central

    Fang, Ferric C.; Sandler, Netanya; Libby, Stephen J.

    2005-01-01

    Taiwan has witnessed an emerging syndrome of liver abscess caused by Klebsiella pneumoniae carrying the magA gene required for exopolysaccharide web biosynthesis. We report a patient transferred from Alaska to Washington State with a magA+ K. pneumoniae liver abscess and describe a simple approach for recognition of these hypervirulent strains. PMID:15695726

  6. Neonatal Klebsiella Septicaemia in Ibadan: Implications for Neonatal Care in Developing Countries.

    ERIC Educational Resources Information Center

    Omokhodion, S. I.; And Others

    1993-01-01

    The antecedent events, clinical features, prevalence, and complications of neonatal Klebsiella septicaemia in 73 infants admitted to a special care baby unit in Nigeria are retrospectively reviewed and compared with those of 72 infants who had no risk factors for sepsis admitted to the same unit during the same period. A nosocomial acquisition of

  7. Microbiological and Genetic Characterization of Carbapenem-Resistant Klebsiella pneumoniae Isolated From Pediatric Patients.

    PubMed

    Dara, Jasmeen S; Chen, Liang; Levi, Michael H; Kreiswirth, Barry N; Pellett Madan, Rebecca

    2014-03-01

    This manuscript reports the clinical, microbiological, and genetic characteristics of carbapenem-resistant K. pnuemoniae isolates from pediatric patients at a tertiary-care children's hospital. Although there is an extensive body of literature describing carbapenem-resistant Klebsiella infections in adults, pediatric data are comparatively limited. PMID:24567846

  8. Phenotypic and genotypic characterization of Klebsiella pneumonia recovered from nonhuman primates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Klebsiella pneumoniae is a zoonotic, Gram-negative member of the family Enterobacteriaceae and is the causative agent of nosocomial septicemic, pneumonic, and urinary tract infections. Recently, pathogenic strains of K. pneumoniae sharing a hypermucoviscosity (HMV) phenotype have been attributed to ...

  9. Complete genome sequence of a Klebsiella pneumoniae strain isolated from a known cotton insect boll vector

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the...

  10. THERMOTOLERANT NON-FECAL SOURCE 'KLEBSIELLA PNEUMONIAE': VALIDITY OF THE FECAL COLIFORM TEST IN RECREATIONAL WATERS

    EPA Science Inventory

    Wisconsin pulp and paper mill processing plants were evaluated for fecal coliform and total Klebsiella (i.e., thermotolerant and thermointolerant) bacterial concentrations. Using the standard fecal coliform test, up to 90 per cent of non-fecal source thermo-tolerant K. pneumoniae...

  11. Whole genome analysis of Klebsiella pneumoniae T2-1-1 from human oral cavity.

    PubMed

    Chan, Kok-Gan; Yin, Wai-Fong; Chan, Xin-Yue

    2016-03-01

    Klebsiella pneumoniae T2-1-1 was isolated from the human tongue debris and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession JAQL00000000. PMID:26981378

  12. Whole genome analysis of Klebsiella pneumoniae T2-1-1 from human oral cavity

    PubMed Central

    Chan, Kok-Gan; Yin, Wai-Fong; Chan, Xin-Yue

    2015-01-01

    Klebsiella pneumoniae T2-1-1 was isolated from the human tongue debris and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession JAQL00000000. PMID:26981378

  13. Genomic Sequence of Klebsiella pneumoniae IIEMP-3, a Vitamin B12-Producing Strain from Indonesian Tempeh

    PubMed Central

    Yulandi, Adi; Sugiokto, Febri Gunawan; Febrilina

    2016-01-01

    Klebsiella pneumoniae strain IIEMP-3, isolated from Indonesian tempeh, is a vitamin B12-producing strain that exhibited a different genetic profile from pathogenic isolates. Here we report the draft genome sequence of strain IIEMP-3, which may provide insights on the nature of fermentation, nutrition, and immunological function of Indonesian tempeh. PMID:26950331

  14. Draft Genome Sequence of a Klebsiella pneumoniae Carbapenemase-Positive Sequence Type 111 Pseudomonas aeruginosa Strain

    PubMed Central

    Dotson, Gabrielle A.; Dekker, John P.; Palmore, Tara N.; Segre, Julia A.

    2016-01-01

    Here, we report the draft genome sequence of a sequence type 111 Pseudomonas aeruginosa strain isolated in 2014 from a patient at the NIH Clinical Center. This P. aeruginosa strain exhibits pan-drug resistance and harbors the blaKPC-2 gene, encoding the Klebsiella pneumoniae carbapenemase enzyme, on a plasmid. PMID:26868386

  15. Suppurative peritonitis by Klebsiella pneumoniae in captive gold-handed tamarin (Saguinus midas midas).

    PubMed

    Guerra, Maria F L; Teixeira, Rodrigo H F; Ribeiro, Vanessa L; Cunha, Marcos P V; Oliveira, Maria G X; Davies, Yam M; Silva, Ketrin C; Silva, Ana P S; Lincopan, Nilton; Moreno, Andrea M; Knbl, Terezinha

    2016-02-01

    This report describes an outbreak of suppurative peritonitis caused by Klebsiella pneumoniae in an adult female of captive golden-handed tamarin (Saguinus midas midas). Two virulent and multidrug-resistant strains were isolated and classified through MLST as ST60 and ST1263. The microbiological diagnosis works as a support tool for preventive measures. PMID:26620445

  16. Draft Genome Sequence of a Klebsiella pneumoniae Carbapenemase-Positive Sequence Type 111 Pseudomonas aeruginosa Strain.

    PubMed

    Dotson, Gabrielle A; Dekker, John P; Palmore, Tara N; Segre, Julia A; Conlan, Sean

    2016-01-01

    Here, we report the draft genome sequence of a sequence type 111 Pseudomonas aeruginosa strain isolated in 2014 from a patient at the NIH Clinical Center. This P. aeruginosa strain exhibits pan-drug resistance and harbors the blaKPC-2 gene, encodingthe Klebsiella pneumoniae carbapenemase enzyme, on a plasmid. PMID:26868386

  17. Role of triggering receptor expressed on myeloid cells-1/3 in Klebsiella-derived pneumosepsis.

    PubMed

    Hommes, Tijmen J; Dessing, Mark C; Veer, Cornelis van 't; Florquin, Sandrine; Colonna, Marco; de Vos, Alex F; van der Poll, Tom

    2015-11-01

    Triggering receptor expressed on myeloid cells (TREM)-1 and -2 can affect Toll-like receptor-mediated activation of immune cells. Klebsiella pneumoniae is a common cause of pneumonia-derived sepsis. Here we studied the role of TREM-1/3 and TREM-2 in the host response during Klebsiella pneumonia. Macrophages lacking either TREM-1/3 or TREM-2 were tested for their responsiveness toward K. pneumoniae and for their capacity to internalize this pathogen in vitro. TREM-1/3- and TREM-2-deficient mice were infected with K. pneumoniae via the airways, and their responses were compared with those in wild-type mice. TREM-1/3-deficient macrophages produced lower cytokine levels upon exposure to K. pneumoniae, whereas TREM-2-deficient macrophages released higher cytokine concentrations. TREM-2-deficient, but not TREM-1/3-deficient, macrophages showed a reduced capacity to phagocytose K. pneumoniae. TREM-1/3-deficient mice showed an impaired host defense during Klebsiella pneumonia, as reflected by worsened survival and increased bacterial growth and dissemination. In contrast, TREM-2 deficiency did not affect disease outcome. Although TREM-1/3 and TREM-2 influence macrophage responsiveness to K. pneumoniae in vitro, only TREM-1/3 contribute to the host response during Klebsiella pneumonia in vivo, serving a protective role. PMID:25860078

  18. Outcomes and Risk Factors for Mortality among Patients Treated with Carbapenems for Klebsiella spp. Bacteremia

    PubMed Central

    Biehle, Lauren R.; Cottreau, Jessica M.; Thompson, David J.; Filipek, Rachel L.; O’Donnell, J. Nicholas; Lasco, Todd M.; Mahoney, Monica V.; Hirsch, Elizabeth B.

    2015-01-01

    Background Extensive dissemination of carbapenemase-producing Enterobacteriaceae has led to increased resistance among Klebsiella species. Carbapenems are used as a last resort against resistant pathogens, but carbapenemase production can lead to therapy failure. Identification of risk factors for mortality and assessment of current susceptibility breakpoints are valuable for improving patient outcomes. Aim The objective of this study was to evaluate outcomes and risk factors for mortality among patients treated with carbapenems for Klebsiella spp. bacteremia. Methods Patients hospitalized between 2006 and 2012 with blood cultures positive for Klebsiella spp. who received ≥ 48 hours of carbapenem treatment within 72 hours of positive culture were included in this retrospective study. Patient data were retrieved from electronic medical records. Multivariate logistic regression was used to identify risk factors for 30-day hospital mortality. Results One hundred seven patients were included. The mean patient age was 61.5 years and the median APACHE II score was 13 ± 6.2. Overall, 30-day hospital mortality was 9.3%. After adjusting for confounding variables, 30-day mortality was associated with baseline APACHE II score (OR, 1.17; 95% CI, 1.01–1.35; P = 0.03), length of stay prior to index culture (OR, 1.03; 95% CI, 1.00–1.06; P = 0.04), and carbapenem non-susceptible (imipenem or meropenem MIC > 1 mg/L) infection (OR, 9.08; 95% CI, 1.17–70.51; P = 0.04). Conclusions Baseline severity of illness and length of stay prior to culture were associated with 30-day mortality and should be considered when treating patients with Klebsiella bacteremia. These data support the change in carbapenem breakpoints for Klebsiella species. PMID:26618357

  19. Modeling Klebsiella pneumoniae Pathogenesis by Infection of the Wax Moth Galleria mellonella

    PubMed Central

    Insua, Jos Luis; Llobet, Enrique; Moranta, David; Prez-Gutirrez, Camino; Toms, Anna; Garmendia, Junkal

    2013-01-01

    The implementation of infection models that approximate human disease is essential for understanding pathogenesis at the molecular level and for testing new therapies before they are entered into clinical stages. Insects are increasingly being used as surrogate hosts because they share, with mammals, essential aspects of the innate immune response to infections. We examined whether the larva of the wax moth Galleria mellonella could be used as a host model to conceptually approximate Klebsiella pneumoniae-triggered pneumonia. We report that the G. mellonella model is capable of distinguishing between pathogenic and nonpathogenic Klebsiella strains. Moreover, K. pneumoniae infection of G. mellonella models some of the known features of Klebsiella-induced pneumonia, i.e., cell death associated with bacterial replication, avoidance of phagocytosis by phagocytes, and the attenuation of host defense responses, chiefly the production of antimicrobial factors. Similar to the case for the mouse pneumonia model, activation of innate responses improved G. mellonella survival against subsequent Klebsiella challenge. Virulence factors necessary in the mouse pneumonia model were also implicated in the Galleria model. We found that mutants lacking capsule polysaccharide, lipid A decorations, or the outer membrane proteins OmpA and OmpK36 were attenuated in Galleria. All mutants activated G. mellonella defensive responses. The Galleria model also allowed us to monitor Klebsiella gene expression. The expression levels of cps and the loci implicated in lipid A remodeling peaked during the first hours postinfection, in a PhoPQ- and PmrAB-governed process. Taken together, these results support the utility of G. mellonella as a surrogate host for assessing infections with K. pneumoniae. PMID:23836821

  20. Characterization of CTX-M-Type Extend-Spectrum ?-Lactamase Producing Klebsiella spp. in Kashan, Iran

    PubMed Central

    Afzali, Hasan; Firoozeh, Farzaneh; Amiri, Atena; Moniri, Rezvan; Zibaei, Mohammad

    2015-01-01

    Context: The CTX-M family consists of more than 50 ?-lactamases, which are grouped on the basis of sequences into five subtypes including CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9 and CTX-M-25. Objectives: The current study aimed to detect subtypes of CTX-M extended-spectrum ?-lactamases (ESBLs) among ESBL positive Klebsiella isolates from patients in Kashan, Iran. Materials and Methods: A total of 100 clinical isolates of Klebsiella were collected and the isolates, which showed resistance or reduced susceptibility to cefotaxime, ceftazidime and/or aztreonam by the disk diffusion method were selected. These isolates were identified as ESBL-producing isolates by double disk synergy tests using clavulanic acid, cefotaxime, ceftazidime and aztreonam. The blaCTX-M type determinants were identified by the Polymerase Chain Reaction (PCR) method followed by DNA sequencing. Results: Of the 100 Klebsiella isolates, 41 (41%) demonstrated resistance or reduced susceptibility to ceftazidime and/or aztreonam and 35% (n = 35) were ESBL-producers. Twenty-eight (8o%) of the ESBL-producing isolates carried the blaCTX-M type genes. Based on PCR assays and sequencing of blaCTX-M genes, CTX-M-1, CTX-M-2 and CTX-M-9 were identified in 21 (60%), 15 (42%) and nine (34%) of these isolates, respectively (GenBank accession numbers KJ803828-KJ803829). Conclusions: Our study showed that the frequency of blaCTX-M genes among Klebsiella isolates in our region is at an alarming rate. Also, we found a high prevalence of blaCTX-M-1 ?-lactamase in Klebsiella isolates in Kashan. PMID:26587221

  1. Inactivation of bacteria via photosensitization of vitamin K3 by UV-A light.

    PubMed

    Xu, Fei; Vostal, Jaroslav G

    2014-09-01

    This study investigated inactivation of bacteria with ultraviolet light A irradiation in combination with vitamin K3 as a photosensitizer. Six bacteria including Bacillus cereus, Pseudomonas aeruginosa, Staphylococcus aureus, Staphylococcus epidermidis, Klebsiella pneumoniae, and Escherichia coli suspended in vitamin K3 aqueous solution were exposed to ultraviolet light A. Five of six bacteria, with the exception of Pseudomonas aeruginosa, were reduced by eight logs with 1600 ?M of vitamin K3 and 5.8 J cm(-2) UV-A irradiation. Pseudomonas aeruginosa was reduced by four logs under these conditions. Reactive oxygen species including singlet oxygen, hydroxyl radical and superoxide anion radical were generated in vitamin K3 aqueous solution under UV-A irradiation. These results suggest that vitamin K3 and UV-A irradiation may be effective for bacterial inactivation in environmental and medical applications. PMID:25053393

  2. Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.

    PubMed

    Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching

    2014-06-15

    The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. PMID:24820641

  3. Harvesting energy of interaction between bacteria and bacteriophage in a membrane-less fuel cell.

    PubMed

    Gupta, Ragini; Bekele, Wasihun; Ghatak, Animangsu

    2013-11-01

    When a fuel and oxidant flow in laminar contact through a micro-fluidic channel, a sharp interface appears between the two liquids, which eliminate the need of a proton exchange membrane. This principle has been used to generate potential in a membrane-less fuel cell. This study use such a cell to harvest energy of interaction between a bacteria having negative charge on its surface and a bacteriophage with positive and negative charges on its tail and head, respectively. When Klebsiella pneumoniae (Kp6) and phage (P-Kp6) are pumped through a fuel cell fitted with two copper electrodes placed at its two sides, interaction between these two charged species at the interface results in a constant open circuit potential which varies with concentration of charged species but gets generated for both specific and non-specific bacteria and phage system. Oxygenation of bacteria or phage however diminishes the potential unlike in conventional microbial fuel cells. PMID:24021411

  4. Understanding the patterns of antibiotic susceptibility of bacteria causing urinary tract infection in West Bengal, India

    PubMed Central

    Saha, Sunayana; Nayak, Sridhara; Bhattacharyya, Indrani; Saha, Suman; Mandal, Amit K.; Chakraborty, Subhanil; Bhattacharyya, Rabindranath; Chakraborty, Ranadhir; Franco, Octavio L.; Mandal, Santi M.; Basak, Amit

    2014-01-01

    Urinary tract infection (UTI) is one of the most common infectious diseases at the community level. In order to assess the adequacy of empirical therapy, the susceptibility of antibiotics and resistance pattern of bacteria responsible for UTI in West Bengal, India, were evaluated throughout the period of 20082013. The infection reports belonging to all age groups and both sexes were considered. Escherichia coli was the most abundant uropathogen with a prevalence rate of 67.1%, followed by Klebsiella spp. (22%) and Pseudomonas spp. (6%). Penicillin was least effective against UTI-causing E. coli and maximum susceptibility was recorded for the drugs belonging to fourth generation cephalosporins. Other abundant uropathogens, Klebsiella spp., were maximally resistant to broad-spectrum penicillin, followed by aminoglycosides and third generation cephalosporin. The antibiotic resistance pattern of two principal UTI pathogens, E. coli and Klebsiella spp. in West Bengal, appears in general to be similar to that found in other parts of the Globe. Higher than 50% resistance were observed for broad-spectrum penicillin. Fourth generation cephalosporin and macrolides seems to be the choice of drug in treating UTIs in Eastern India. Furthermore, improved maintenance of infection incident logs is needed in Eastern Indian hospitals in order to facilitate regular surveillance of the occurrence of antibiotic resistance patterns, since such levels continue to change. PMID:25278932

  5. Screening of antibiotic susceptibility to ?-lactam-induced elongation of Gram-negative bacteria based on dielectrophoresis.

    PubMed

    Chung, Cheng-Che; Cheng, I-Fang; Chen, Hung-Mo; Kan, Heng-Chuan; Yang, Wen-Horng; Chang, Hsien-Chang

    2012-04-01

    We demonstrate a rapid antibiotic susceptibility test (AST) based on the changes in dielectrophoretic (DEP) behaviors related to the ?-lactam-induced elongation of Gram-negative bacteria (GNB) on a quadruple electrode array (QEA). The minimum inhibitory concentration (MIC) can be determined within 2 h by observing the changes in the positive-DEP frequency (pdf) and cell length of GNB under the cefazolin (CEZ) treatment. Escherichia coli and Klebsiella pneumoniae and the CEZ are used as the sample bacteria and antibiotic respectively. The bacteria became filamentous due to the inhibition of cell wall synthesis and cell division and cell lysis occurred for the higher antibiotic dose. According to the results, the pdfs of wild type bacteria decrease to hundreds of kHz and the cell length is more than 10 ?m when the bacterial growth is inhibited by the CEZ treatment. In addition, the growth of wild type bacteria and drug resistant bacteria differ significantly. There is an obvious decrease in the number of wild type bacteria but not in the number of drug resistant bacteria. Thus, the drug resistance of GNB to ?-lactam antibiotics can be rapidly assessed. Furthermore, the MIC determined using dielectrophoresis-based AST (d-AST) was consistent with the results of the broth dilution method. Utilizing this approach could reduce the time needed for bacteria growth from days to hours, help physicians to administer appropriate antibiotic dosages, and reduce the possibility of the occurrence of multidrug resistant (MDR) bacteria. PMID:22404714

  6. Identification and Characterization of the fis Operon in Enteric Bacteria

    PubMed Central

    Beach, Michael B.; Osuna, Robert

    1998-01-01

    The small DNA binding protein Fis is involved in several different biological processes in Escherichia coli. It has been shown to stimulate DNA inversion reactions mediated by the Hin family of recombinases, stimulate integration and excision of phage λ genome, regulate the transcription of several different genes including those of stable RNA operons, and regulate the initiation of DNA replication at oriC. fis has also been isolated from Salmonella typhimurium, and the genomic sequence of Haemophilus influenzae reveals its presence in this bacteria. This work extends the characterization of fis to other organisms. Very similar fis operon structures were identified in the enteric bacteria Klebsiella pneumoniae, Serratia marcescens, Erwinia carotovora, and Proteus vulgaris but not in several nonenteric bacteria. We found that the deduced amino acid sequences for Fis are 100% identical in K. pneumoniae, S. marcescens, E. coli, and S. typhimurium and 96 to 98% identical when E. carotovora and P. vulgaris Fis are considered. The deduced amino acid sequence for H. influenzae Fis is about 80% identical and 90% similar to Fis in enteric bacteria. However, in spite of these similarities, the E. carotovora, P. vulgaris, and H. influenzae Fis proteins are not functionally identical. An open reading frame (ORF1) preceding fis in E. coli is also found in all these bacteria, and their deduced amino acid sequences are also very similar. The sequence preceding ORF1 in the enteric bacteria showed a very strong similarity to the E. coli fis P region from −53 to +27 and the region around −116 containing an ihf binding site. Both β-galactosidase assays and primer extension assays showed that these regions function as promoters in vivo and are subject to growth phase-dependent regulation. However, their promoter strengths vary, as do their responses to Fis autoregulation and integration host factor stimulation. PMID:9811652

  7. [Study of Rapid Species Identification of Bacteria in Water].

    PubMed

    Wang, Jiu-yue; Zhao, Nan-jing; Duan, Jing-bo; Fang, Li; Meng, De-shuo; Yang, Rui-fang; Xiao, Xue; Liu, Jian-guo; Liu, Wen-qing

    2015-09-01

    Multi-wavelength ultraviolet visible (UV-Vis) transmission spectra of bacteria combined the forward scattering and absorption properties of microbes, contains substantial information on size, shape, and the other chemical, physiological character of bacterial cells, has the bacterial species specificity, which can be applied to rapid species identification of bacterial microbes. Four different kinds of bacteria including Escherichia coli, Staphylococcus aureus, Salmonella typhimurium and Klebsiella pneumonia which were commonly existed in water were researched in this paper. Their multi-wavelength UV-Vis transmission spectra were measured and analyzed. The rapid identification method and model of bacteria were built which were based on support vector machine (SVM) and multi-wavelength UV-Vis transmission spectra of the bacteria. Using the internal cross validation based on grid search method of the training set for obtaining the best penalty factor C and the kernel parameter g, which the model needed. Established the bacteria fast identification model according to the optimal parameters and one-against-one classification method included in LibSVM. Using different experimental bacteria strains of transmission spectra as a test set of classification accuracy verification of the model, the analysis results showed that the bacterial rapid identification model built in this paper can identification the four kinds bacterial which chosen in this paper as the accuracy was 100%, and the model also can identified different subspecies of E. coli test set as the accuracy was 100%, proved the model had a good stability in identification bacterial species. In this paper, the research results of this study not only can provide a method for rapid identification and early warning of bacterial microbial in drinking water sources, but also can be used as the microbes identified in biomedical a simple, rapid and accurate means. PMID:26669181

  8. Klebsiella pneumonia, a Microorganism that Approves the Non-linear Responses to Antibiotics and Window Theory after Exposure to Wi-Fi 2.4 GHz Electromagnetic Radiofrequency Radiation

    PubMed Central

    Taheri, M.; Mortazavi, S. M. J.; Moradi, M.; Mansouri, Sh.; Nouri, F.; Mortazavi, S. A. R.; Bahmanzadegan, F.

    2015-01-01

    Background Drug resistance is widely believed to be an increasingly serious threat to global public health. We have previously reported that short term exposure of microorganisms to diagnostic ultrasound waves could significantly alter their sensitivity to antibiotics. In our previous studies, Klebsiella pneumoniae showed major differences in the sensitivity to antibiotics in exposed and non-exposed samples. This study was aimed at investigating the alteration of antibiotic resistance of Klebsiella pneumonia, after exposure to Wi-Fi 2.4 GHz electromagnetic radiofrequency radiation. Materials and Methods In this in vitro study, three replicate agar plates were used for each test. The antibiotic susceptibility test was carried out using disc diffusion method on Mueller Hinton agar plates and the inhibition zones in both control and exposed groups were measured. A common Wi-Fi router was used in this study as the radiofrequency exposure source. Irradiated samples were exposed to Wi-Fi radiofrequency radiation for 3, 4.5 and 8 hours. Results Statistically significant variations of sensitivity to antibiotics were found for all studied antibiotics after 4.5 hours of RF exposure, compared to non-exposed bacteria. Interestingly, the mean diameters of the inhibition zones after 3 hours of exposure were less than those exposed for 4.5 hours. Following this rise in the sensitivity to antibiotics, a fall was observed in the bacteria exposed for 8 hours for all studied antibiotics. Conclusion The findings of this study show a statistically significant rise in the sensitivity of Klebsiella pneumoniae to different antibiotics after 4.5 hours of exposure to 2.4 GHz Wi-Fi radiation, followed by a fall after 8 hours of exposure. These observations can be interpreted by the concept of non-linearity in the responses of Klebsiella pneumoniae to different antibiotics after exposure to electromagnetic radiofrequency radiation. As in this study a minimum level of effect was needed for the induction of adaptive response, these results also confirm the validity of the so-called window theory. PMID:26396967

  9. Survival of pathogenic bacteria in various freshwater sediments.

    PubMed Central

    Burton, G A; Gunnison, D; Lanza, G R

    1987-01-01

    Four human-associated bacteria, Pseudomonas aeruginosa, Salmonella newport, Escherichia coli, and Klebsiella pneumoniae, were tested for survival in five freshwater sediments. Bacterial survival in continuous-flow chambers was monitored over 14-day periods on sediments ranging from organically rich high-clay fractions to organically poor sandy fractions. Bacterial die-off ranged from 1 to 5 orders of magnitude in sediments. E. coli survived as long as or longer than S. newport. P. aeruginosa and K. pneumoniae tended to survive longer than E. coli. Survival of E. coli and S. newport was greater in sediments containing at least 25% clay. Good reproducibility allowed the development of linear models to describe die-off rates. PMID:3107467

  10. Syntrophic co-culture of Bacillus subtilis and Klebsiella pneumonia for degradation of kraft lignin discharged from rayon grade pulp industry.

    PubMed

    Yadav, Sangeeta; Chandra, Ram

    2015-07-01

    In order to search the degradability of kraft lignin, the potential bacterial strains Bacillus subtilis (GU193980) and Klebsiella pneumoniae (GU193981) were isolated, screened and applied in axenic and co-culture conditions. Results revealed that mixed culture showed better decolorization efficiency (80%) and reduction of pollution parameters (COD 73% and BOD 62%) than axenic culture. This indicated syntrophic growth of these two bacteria rather than any antagonistic effect. The HPLC analysis of degraded samples of kraft lignin has shown the reduction in peak area compared to control, suggesting that decrease in color intensity might be largely attributed to the degradation of lignin by isolated bacteria. Further, the GC-MS analysis showed that most of the compounds detected in control were diminished after bacterial treatment. Further, the seed germination test using Phaseolus aureus has supported the detoxification of bacterial decolorized kraft lignin for environmental safety. All these observations have revealed that the developed bacterial co-culture was capable for the effective degradation and decolorization of lignin containing rayon grade pulp mill wastewater for environmental safety. PMID:26141897

  11. A Multicenter Study of Beta-Lactamase Resistant Escherichia coli and Klebsiella pneumoniae Reveals High Level Chromosome Mediated Extended Spectrum ? Lactamase Resistance in Ogun State, Nigeria.

    PubMed

    Adeyankinnu, Folasoge A; Motayo, Babatunde O; Akinduti, Akinniyi; Akinbo, John; Ogiogwa, Joseph I; Aboderin, Bukola W; Agunlejika, R A

    2014-01-01

    As a result of the ever increasing problem of multiresistant bacteria, we instituted a surveillance program with the aim of identifying the basic molecular properties of ESBL in our environment. About 197 isolates of Escherichia coli and Klebsiella pneumoniae were selected and tested for ESBL production and antimicrobial susceptibility. Plasmid profiles were determined and curing ability was tested. ESBL prevalence was 26.4% for all isolates tested, with E. coli having a greater proportion. There was absolute resistance to ampicilin, tetracycline, and co-trimaxole among tested isolates. There was above average susceptibility to the 2nd and 3rd generation cephalosporins. Plasmid profiles of tested isolates ranged from 9?kbp to 26?kbp with average of 14.99 2.3?kbp for E. coli and 20.98 1.8?kbp K. pneumoniae, 9.6% of ESBL positive E. coli plasmids were cured, while 3.9% of K. pneumoniae plasmids were cured after treatment. The present study shows an upsurge in ESBL acquisition by gram negative bacteria and evidence of cocirculation of varying subtypes of ESBL with both plasmid transmissible and chromosome encoded subtypes. This calls for universal surveillance and more effort towards molecular epidemiology of this public health treatment. PMID:24790598

  12. Chlorine resistance patterns of bacteria from two drinking water distribution systems.

    PubMed Central

    Ridgway, H F; Olson, B H

    1982-01-01

    The relative chlorine sensitivities of bacteria isolated from chlorinated and unchlorinated drinking water distribution systems were compared by two independent methods. One method measured the toxic effect of free chlorine on bacteria, whereas the other measured the effect of combined chlorine. Bacteria from the chlorinated system were more resistant to both the combined and free forms of chlorine than those from the unchlorinated system, suggesting that there may be selection for more chlorine-tolerant microorganisms in chlorinated waters. Bacteria retained on the surfaces of 2.0-microns Nuclepore membrane filters were significantly more resistant to free chlorine compared to the total microbial population recovered on 0.2-micron membrane filters, presumably because aggregated cells or bacteria attached to suspended particulate matter exhibit more resistance than unassociated microorganisms. In accordance with this hypothesis, scanning electron microscopy of suspended particulate matter from the water samples revealed the presence of attached bacteria. The most resistant microorganisms were able to survive a 2-min exposure to 10 mg of free chlorine per liter. These included gram-positive spore-forming bacilli, actinomycetes, and some micrococci. The most sensitive bacteria were readily killed by chlorine concentrations of 1.0 mg liter-1 or less, and included most gram-positive micrococci, Corynebacterium/Arthrobacter, Klebsiella, Pseudomonas/Alcaligenes, Flavobacterium/Moraxella, and Acinetobacter. Images PMID:7149722

  13. Differential elimination of enteric bacteria by protists in a freshwater system.

    PubMed

    Iriberri, J; Azúa, I; Labirua-Iturburu, A; Artolozaga, I; Barcina, I

    1994-11-01

    The short-term (1 h) and long-term (3 d) elimination of low and high densities of five enteric bacteria, Klebsiella pneumoniae, Aeromonas hydrophila, Escherichia coli, Enterococcus faecalis and Staphylococcus epidermidis, by flagellate and ciliate protists were measured in a freshwater system. In addition, the two processes, ingestion and digestion, which cause the disappearance of those enteric bacteria as time passes, were quantified. The results showed that the elimination of these enteric bacteria by protists depends on their initial density, which confirms that the lower the bacterial density the more difficult is their elimination. On the other hand, the short-term and long-term elimination rates of each enteric bacteria were different, and moreover, the order of priority for elimination in the two cases was not the same. Escherichia coli showed the highest elimination rate in short-term experiments, while Aer. hydrophila disappeared at highest rates in long-term experiments. This different order of priority in the elimination rates and the different digestion rates on the five enteric bacteria by phagotrophic protists indicated that the elimination in time is very much influenced by the digestive capacity on each enteric bacteria of those protists. Thus, the low digestion rates of Ent. faecalis and Staph. epidermidis by flagellates and ciliates as well as their low disappearance percentages in the long-term experiments confirm that enteric Gram-positive bacteria are eliminated from the aquatic systems at lower rates, because their digestion is difficult. PMID:8002473

  14. A Dimeric Chlorite Dismutase Exhibits O2-Generating Activity and Acts as a Chlorite Antioxidant in Klebsiella pneumoniae MGH 78578

    PubMed Central

    2015-01-01

    Chlorite dismutases (Clds) convert chlorite to O2 and Cl–, stabilizing heme in the presence of strong oxidants and forming the O=O bond with high efficiency. The enzyme from the pathogen Klebsiella pneumoniae (KpCld) represents a subfamily of Clds that share most of their active site structure with efficient O2-producing Clds, even though they have a truncated monomeric structure, exist as a dimer rather than a pentamer, and come from Gram-negative bacteria without a known need to degrade chlorite. We hypothesized that KpCld, like others in its subfamily, should be able to make O2 and may serve an in vivo antioxidant function. Here, it is demonstrated that it degrades chlorite with limited turnovers relative to the respiratory Clds, in part because of the loss of hypochlorous acid from the active site and destruction of the heme. The observation of hypochlorous acid, the expected leaving group accompanying transfer of an oxygen atom to the ferric heme, is consistent with the more open, solvent-exposed heme environment predicted by spectroscopic measurements and inferred from the crystal structures of related proteins. KpCld is more susceptible to oxidative degradation under turnover conditions than the well-characterized Clds associated with perchlorate respiration. However, wild-type K. pneumoniae has a significant growth advantage in the presence of chlorate relative to a Δcld knockout strain, specifically under nitrate-respiring conditions. This suggests that a physiological function of KpCld may be detoxification of endogenously produced chlorite. PMID:25437493

  15. Mechanism of nitrogenase switch-off by oxygen. [Klebsiella pneumoniae; Rhodopseudomonas sphaeroides f. sp. denitrificans; Rhodopseudomonas capsulate

    SciTech Connect

    Goldberg, I.; Nadler, V.; Hochman, A.

    1987-02-01

    Oxygen caused a reversible inhibition (switch-off) of nitrogenase activity in whole cells of four strains of diazotrophs, the facultative anaerobe Klebsiella pneumoniae and three strains of photosynthetic bacteria (Rhodopseudomonas sphaeroides f. sp. denitrificans and Rhodopseudomonas capsulata strians AD2 and BK5). In K. pneumoniae 50% inhibition of acetylene reduction was attained at an O/sub 2/ concentration of 0.37 ..mu..M. Cyanide (90 ..mu..M), which did not affect acetylene reduction but inhibited whole-cell respiration by 60 to 70%, shifted the O/sub 2/ concentration that caused 50% inhibition of nitrogenase activity to 2.9 ..mu..M. A mutant strain of K. pneumoniae, strain AH11, has a respiration rate that is 65 to 75% higher than that of the wild type, but is nitrogenase activity is similar to wild-type activity. Acetylene reduction by whole cells of this mutant was inhibited 50% by 0.20 ..mu..M O/sub 2/. Inhibition by CN/sup -/ of 40 to 50% of the O/sub 2/ uptake in the mutant shifted the O/sub 2/ concentration that caused 50% inhibition of nitrogenase to 1.58 ..mu..M. Thus, when the respiration rates were lower, higher oxygen concentrations were required to inhibit nitrogenase. Reversible inhibition of nitrogenase activity in vivo was caused under anaerobic conditions by other electron acceptors. Addition of 2 mM sulfite to cell suspensions of R. capsulata B10 and R. sphaeroides inhibited nitrogenase activity. Nitrite also inhibited acetylene reduction in whole cells of the photodenitrifier R. sphaeroides but not in R. capsulata B10, which is not capable of enzymatic reduction of NO/sub 2//sup -/. Lower concentrations of NO/sub 2//sup -/ were required to inhibit the activity in NO/sub 3//sup -/-grown cells, which have higher activities of nitrite reductase.

  16. A dimeric chlorite dismutase exhibits O2-generating activity and acts as a chlorite antioxidant in Klebsiella pneumoniae MGH 78578.

    PubMed

    Celis, Arianna I; Geeraerts, Zachary; Ngmenterebo, David; Machovina, Melodie M; Kurker, Richard C; Rajakumar, Kumar; Ivancich, Anabella; Rodgers, Kenton R; Lukat-Rodgers, Gudrun S; DuBois, Jennifer L

    2015-01-20

    Chlorite dismutases (Clds) convert chlorite to O2 and Cl(-), stabilizing heme in the presence of strong oxidants and forming the O?O bond with high efficiency. The enzyme from the pathogen Klebsiella pneumoniae (KpCld) represents a subfamily of Clds that share most of their active site structure with efficient O2-producing Clds, even though they have a truncated monomeric structure, exist as a dimer rather than a pentamer, and come from Gram-negative bacteria without a known need to degrade chlorite. We hypothesized that KpCld, like others in its subfamily, should be able to make O2 and may serve an in vivo antioxidant function. Here, it is demonstrated that it degrades chlorite with limited turnovers relative to the respiratory Clds, in part because of the loss of hypochlorous acid from the active site and destruction of the heme. The observation of hypochlorous acid, the expected leaving group accompanying transfer of an oxygen atom to the ferric heme, is consistent with the more open, solvent-exposed heme environment predicted by spectroscopic measurements and inferred from the crystal structures of related proteins. KpCld is more susceptible to oxidative degradation under turnover conditions than the well-characterized Clds associated with perchlorate respiration. However, wild-type K. pneumoniae has a significant growth advantage in the presence of chlorate relative to a ?cld knockout strain, specifically under nitrate-respiring conditions. This suggests that a physiological function of KpCld may be detoxification of endogenously produced chlorite. PMID:25437493

  17. Genomics of Probiotic Bacteria

    NASA Astrophysics Data System (ADS)

    O'Flaherty, Sarah; Goh, Yong Jun; Klaenhammer, Todd R.

    Probiotic bacteria from the Lactobacillus and Bifidobacterium species belong to the Firmicutes and the Actinobacteria phylum, respectively. Lactobacilli are members of the lactic acid bacteria (LAB) group, a broadly defined family of microorganisms that ferment various hexoses into primarily lactic acid. Lactobacilli are typically low G + C gram-positive species which are phylogenetically diverse, with over 100 species documented to date. Bifidobacteria are heterofermentative, high G + C content bacteria with about 30 species of bifidobacteria described to date.

  18. Effect of Molybdenum Starvation and Tungsten on the Synthesis of Nitrogenase Components in Klebsiella pneumoniae

    PubMed Central

    Brill, Winston J.; Steiner, Ann L.; Shah, Vinod K.

    1974-01-01

    Klebsiella pneumoniae M5a1 grows well in the presence or absence of molybdenum in media containing excess NH4+. However, growth on N2 is completely dependent on the presence of molybdenum in the medium. Tungstate competes with the molybdate requirement during growth on N2. In molybdenum-depleted medium, neither protein component of nitrogenase is active and neither component can be detected antigenically. These data provide evidence that molybdenum is an inducer of nitrogenase synthesis. PMID:4598014

  19. Draft Genome Sequence of the First Hypermucoviscous Klebsiella variicola Clinical Isolate

    PubMed Central

    Silva-Sanchez, Jesus; Barrios, Humberto; Rodriguez-Medina, Nadia; Martnez-Barnetche, Jesus; Andrade, Veronica

    2015-01-01

    An antibiotic-susceptible and hypermucoviscous clinical isolate of Klebsiella variicola (K. variicola 8917) was obtained from the sputum of an adult patient. This work reports the complete draft genome sequence of K. variicola 8917 with 103 contigs and an annotation that revealed a 5,686,491-bp circular chromosome containing a total of 5,621 coding DNA sequences, 65 tRNA genes, and an average G+C content of 56.98%. PMID:25858850

  20. Draft Genome Sequence of the First Hypermucoviscous Klebsiella variicola Clinical Isolate.

    PubMed

    Garza-Ramos, Ulises; Silva-Sanchez, Jesus; Barrios, Humberto; Rodriguez-Medina, Nadia; Martnez-Barnetche, Jesus; Andrade, Veronica

    2015-01-01

    An antibiotic-susceptible and hypermucoviscous clinical isolate of Klebsiella variicola (K. variicola 8917) was obtained from the sputum of an adult patient. This work reports the complete draft genome sequence of K. variicola 8917 with 103 contigs and an annotation that revealed a 5,686,491-bp circular chromosome containing a total of 5,621 coding DNA sequences, 65 tRNA genes, and an average G+C content of 56.98%. PMID:25858850

  1. Community-Acquired Pyelonephritis in Pregnancy Caused by KPC-Producing Klebsiella pneumoniae

    PubMed Central

    Khatri, Asma; Naeger Murphy, Nina; Wiest, Peter; Osborn, Melissa; Garber, Kathleen; Hecker, Michelle; Hurless, Kelly; Rudin, Susan D.; Jacobs, Michael R.; Kalayjian, Robert C.; Salata, Robert A.; van Duin, David; Harris, Patrick N. A.

    2015-01-01

    Carbapenem-resistant Enterobacteriaceae (CRE) usually infect patients with significant comorbidities and health care exposures. We present a case of a pregnant woman who developed community-acquired pyelonephritis caused by KPC-producing Klebsiella pneumoniae. Despite antibiotic treatment, she experienced spontaneous prolonged rupture of membranes, with eventual delivery of a healthy infant. This report demonstrates the challenge that CRE may pose to the effective treatment of common infections in obstetric patients, with potentially harmful consequences to maternal and neonatal health. PMID:26185273

  2. Novel VIM metallo-beta-lactamase variant, VIM-24, from a Klebsiella pneumoniae isolate from Colombia.

    PubMed

    Montealegre, Maria Camila; Correa, Adriana; Briceo, David F; Rosas, Natalia C; De La Cadena, Elsa; Ruiz, Sory J; Mojica, Maria F; Camargo, Ruben Dario; Zuluaga, Ivan; Marin, Adriana; Quinn, John P; Villegas, Maria Virginia

    2011-05-01

    We report the emergence of a novel VIM variant (VIM-24) in a Klebsiella pneumoniae isolate in Colombia. The isolate displays MICs for carbapenems below the resistance breakpoints, posing a real challenge for its detection. The blaVIM-24 gene was located within a class 1 integron carried on a large plasmid. Further studies are needed to clarify its epidemiological and clinical impact. PMID:21282438

  3. First Isolate of KPC-2-Producing Klebsiella pneumonaie Sequence Type 23 from the Americas

    PubMed Central

    Cejas, Daniela; Fernández Canigia, Liliana; Rincón Cruz, Giovanna; Elena, Alan X.; Maldonado, Ivana; Gutkind, Gabriel O.

    2014-01-01

    KPC-2-producing Klebsiella pneumoniae isolates mainly correspond to clonal complex 258 (CC258); however, we describe KPC-2-producing K. pneumoniae isolates belonging to invasive sequence type 23 (ST23). KPC-2 has scarcely been reported to occur in ST23, and this report describes the first isolation of this pathogen in the Americas. Acquisition of resistant markers in virulent clones could mark an evolutionary step toward the establishment of these clones as major nosocomial pathogens. PMID:25031447

  4. Activity of Imipenem against Klebsiella pneumoniae Biofilms In Vitro and In Vivo

    PubMed Central

    Chen, Ping; Seth, Akhil K.; Abercrombie, Johnathan J.; Mustoe, Thomas A.

    2014-01-01

    Encapsulated Klebsiella pneumoniae has emerged as one of the most clinically relevant and more frequently encountered opportunistic pathogens in combat wounds as the result of nosocomial infection. In this report, we show that imipenem displayed potent activity against established K. pneumoniae biofilms under both static and flow conditions in vitro. Using a rabbit ear model, we also demonstrated that imipenem was highly effective against preformed K. pneumoniae biofilms in wounds. PMID:24247132

  5. Oxygen sensitivity of the nifLA promoter of Klebsiella pneumoniae

    SciTech Connect

    Kong, Q.T.; Wu, Q.L.; Ma, Z.F.; Shen, S.C.

    1986-05-01

    Oxygen sensitivity of the nifLA promoter of Klebsiella pneumoniae has been demonstrated. Studies on the oxygen regulation of nifB-lacZ and nifH-lacZ fusions in the presence of the nifLA operon, which contains either an intact or a deleted nifL gene, indicate that possible both the nifL promoter and the nifL product are responsible for nif repression by oxygen.

  6. Novel VIM Metallo-?-Lactamase Variant, VIM-24, from a Klebsiella pneumoniae Isolate from Colombia?

    PubMed Central

    Montealegre, Maria Camila; Correa, Adriana; Briceo, David F.; Rosas, Natalia C.; De La Cadena, Elsa; Ruiz, Sory J.; Mojica, Maria F.; Camargo, Ruben Dario; Zuluaga, Ivan; Marin, Adriana; Quinn, John P.; Villegas, Maria Virginia

    2011-01-01

    We report the emergence of a novel VIM variant (VIM-24) in a Klebsiella pneumoniae isolate in Colombia. The isolate displays MICs for carbapenems below the resistance breakpoints, posing a real challenge for its detection. The blaVIM-24 gene was located within a class 1 integron carried on a large plasmid. Further studies are needed to clarify its epidemiological and clinical impact. PMID:21282438

  7. Bacteria turn tiny gears

    SciTech Connect

    2009-01-01

    Swarms of bacteria turn two 380-micron long gears, opening the possibility of building hybrid biological machines at the microscopic scale. Read more at Wired: http://www.wired.com/wiredscience/2009/12/bacterial-micro-machine/#more-15684 or Scientific American: http://www.scientificamerican.com/article.cfm?id=brownian-motion-bacteria

  8. Bleach vs. Bacteria

    MedlinePLUS

    ... Inside Life Science > Bleach vs. Bacteria Inside Life Science View All Articles | Inside Life Science Home Page Bleach vs. Bacteria By Sharon Reynolds ... For Proteins, Form Shapes Function This Inside Life Science article also appears on LiveScience . Learn about related ...

  9. An outbreak of colistin-resistant Klebsiella pneumoniae carbapenemase-producing Klebsiella pneumoniae in the Netherlands (July to December 2013), with inter-institutional spread.

    PubMed

    Weterings, V; Zhou, K; Rossen, J W; van Stenis, D; Thewessen, E; Kluytmans, J; Veenemans, J

    2015-08-01

    We describe an outbreak of Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae (KPC-KP) ST258 that occurred in two institutions (a hospital and a nursing home) in the Netherlands between July and December 2013. In total, six patients were found to be positive for KPC-KP. All isolates were resistant to colistin and exhibited reduced susceptibility to gentamicin and tigecycline. In all settings, extensive environmental contamination was found. Whole genome sequencing revealed the presence of bla KPC-2 and bla SHV-12 genes, as well as the close relatedness of patient and environmental isolates. In the hospital setting, one transmission was detected, despite contact precautions. After upgrading to strict isolation, no further spread was found. After the transfer of the index patient to a nursing home in the same region, four further transmissions occurred. The outbreak in the nursing home was controlled by transferring all KPC-KP-positive residents to a separate location outside the nursing home, where a dedicated nursing team cared for patients. This outbreak illustrates that the spread of pan-resistant Enterobacteriaceae can be controlled, but may be difficult, particularly in long-term care facilities. It, therefore, poses a major threat to patient safety. Clear guidelines to control reservoirs in and outside the hospitals are urgently needed. PMID:26067658

  10. Whole genome sequencing of extended-spectrum β-lactamase producing Klebsiella pneumoniae isolated from a patient in Lebanon

    PubMed Central

    Tokajian, Sima; Eisen, Jonathan A.; Jospin, Guillaume; Farra, Anna; Coil, David A.

    2015-01-01

    Objective: The emergence of extended-spectrum β-lactamase (ESBL)-producing bacteria is now a critical concern. The ESBL-producing Klebsiella pneumoniae constitutes one of the most common multidrug-resistant (MDR) groups of gram-negative bacteria involved in nosocomial infections worldwide. In this study we report on the molecular characterization through whole genome sequencing of an ESBL-producing K. pneumoniae strain, LAU-KP1, isolated from a stool sample from a patient admitted for a gastrointestinal procedure/surgery at the Lebanese Amrican University Medical Center-Rizk Hospital (LAUMCRH) in Lebanon. Methods: Illumina paired-end libraries were prepared and sequenced, which resulted in 4,220,969 high-quality reads. All sequence processing and assembly were performed using the A5 assembly pipeline. Results: The initial assembly produced 86 contigs, for which no scaffolding was obtained. The final collection of contigs was submitted to GenBank. The final draft genome sequence consists of a combined 5,632,663 bases with 57% G+C content. Automated annotation was performed using the RAST annotation server. Sequencing analysis revealed that the isolate harbored different β-lactamase genes, including blaoxa−1, blaCTX−M−15, blaSHV−11, and blaTEM−1b. The isolate was also characterized by the concomitant presence of other resistance determinants most notably acc(6′)-lb-cr and qnrb1. The entire plasmid content was also investigated and revealed homology with four major plasmids pKPN-IT, pBS512_2, pRSF1010_SL1344, and pKPN3. Conclusions: The potential role of K. pneumonia as a reservoir for ESBL genes and other resistance determinants is along with the presence of key factors that favor the spread of antimicrobial resistance a clear cause of concern and the problem that Carbapenem-non-susceptible ESBL isolates are posing in hospitals should be reconsidered through systematic exploration and molecular characterization. PMID:25905047

  11. Endogenous Klebsiella Endophthalmitis Associated with Liver Abscess: First Case Report from Iran

    PubMed Central

    Dehghani, A.R.; Masjedi, A.; Fazel, F.; Ghanbari, H.; Akhlaghi, M.; Karbasi, N.

    2011-01-01

    Purpose To report the first case of endogenous Klebsiella endophthalmitis associated with liver abscess in Iran. Case Report A 79-year-old man was referred to our hospital due to severe pain and visual loss in the left eye. On physical examination, conjunctival hyperemia, corneal edema, hypopyon and severe vitreous cellular reaction were identified in the left eye; however, yellowish conjunctival discoloration was more apparent in the right eye. Abdominal CT scan showed a right liver lobe abscess that was confirmed by sonographically guided percutaneous liver mass biopsy. Blood, vitreous and liver mass aspirate cultures revealed Klebsiella pneumoniae growth. The patient was thus diagnosed with endogenous Klebsiella endophthalmitis secondary to bacteremia associated with liver abscess. Conclusion This report suggests that, rather than being confined to Taiwan, endogenous endophthalmitis secondary to a liver abscess due to K. pneumoniae may be a global problem. Therefore, physicians should be aware of the possibility of endophthalmitis whenever a patient with K. pneumoniae liver abscess complains of ocular symptoms. PMID:21532995

  12. wzi Gene Sequencing, a Rapid Method for Determination of Capsular Type for Klebsiella Strains

    PubMed Central

    Passet, Virginie; Haugaard, Anita Bjrk; Babosan, Anamaria; Kassis-Chikhani, Najiby; Struve, Carsten; Decr, Dominique

    2013-01-01

    Pathogens of the genus Klebsiella have been classified into distinct capsular (K) types for nearly a century. K typing of Klebsiella species still has important applications in epidemiology and clinical microbiology, but the serological method has strong practical limitations. Our objective was to evaluate the sequencing of wzi, a gene conserved in all capsular types of Klebsiella pneumoniae that codes for an outer membrane protein involved in capsule attachment to the cell surface, as a simple and rapid method for the prediction of K type. The sequencing of a 447-nucleotide region of wzi distinguished the K-type reference strains with only nine exceptions. A reference wzi sequence database was created by the inclusion of multiple strains representing K types associated with high virulence and multidrug resistance. A collection of 119 prospective clinical isolates of K. pneumoniae were then analyzed in parallel by wzi sequencing and classical K typing. Whereas K typing achieved typeability for 81% and discrimination for 94.4% of the isolates, these figures were 98.1% and 98.3%, respectively, for wzi sequencing. The prediction of K type once the wzi allele was known was 94%. wzi sequencing is a rapid and simple method for the determination of the K types of most K. pneumoniae clinical isolates. PMID:24088853

  13. Capsular Polysaccharide Is Involved in NLRP3 Inflammasome Activation by Klebsiella pneumoniae Serotype K1.

    PubMed

    Hua, Kuo-Feng; Yang, Feng-Ling; Chiu, Hsiao-Wen; Chou, Ju-Ching; Dong, Wei-Chih; Lin, Chien-Nan; Lin, Chai-Yi; Wang, Jin-Town; Li, Lan-Hui; Chiu, Huan-Wen; Chiu, Yi-Chich; Wu, Shih-Hsiung

    2015-09-01

    Klebsiella pneumoniae (strain 43816, K2 serotype) induces interleukin-1? (IL-1?) secretion, but neither the bacterial factor triggering the activation of these inflammasome-dependent responses nor whether they are mediated by NLRP3 or NLRC4 is known. In this study, we identified a capsular polysaccharide (K1-CPS) in K. pneumoniae (NTUH-K2044, K1 serotype), isolated from a primary pyogenic liver abscess (PLA K. pneumoniae), as the Klebsiella factor that induces IL-1? secretion in an NLRP3-, ASC-, and caspase-1-dependent manner in macrophages. K1-CPS induced NLRP3 inflammasome activation through reactive oxygen species (ROS) generation, mitogen-activated protein kinase phosphorylation, and NF-?B activation. Inhibition of both the mitochondrial membrane permeability transition and mitochondrial ROS generation inhibited K1-CPS-mediated NLRP3 inflammasome activation. Furthermore, IL-1? secretion in macrophages infected with PLA K. pneumoniae was shown to depend on NLRP3 but also on NLRC4 and TLR4. In macrophages infected with a K1-CPS deficiency mutant, an lipopolysaccharide (LPS) deficiency mutant, or K1-CPS and LPS double mutants, IL-1? secretion levels were lower than those in cells infected with wild-type PLA K. pneumoniae. Our findings indicate that K1-CPS is one of the Klebsiella factors of PLA K. pneumoniae that induce IL-1? secretion through the NLRP3 inflammasome. PMID:26077758

  14. Carbapenemase-Producing Klebsiella pneumoniae in Romania: A Six-Month Survey

    PubMed Central

    Straut, Monica; Usein, Codruta Romanita; Cristea, Dana; Ciontea, Simona; Codita, Irina; Rafila, Alexandru; Nica, Maria; Buzea, Mariana; Baicus, Anda; Ghita, Mihaela Camelia; Nistor, Irina; Tuchiluş, Cristina; Indreas, Marina; Antohe, Felicia; Glasner, Corinna; Grundmann, Hajo; Jasir, Aftab; Damian, Maria

    2015-01-01

    This study presents the first characterization of carbapenem-non-susceptible Klebsiella pneumoniae isolates by means of a structured six-month survey performed in Romania as part of an Europe-wide investigation. Klebsiella pneumoniae clinical isolates from different anatomical sites were tested for antibiotic susceptibility by phenotypic methods and confirmed by PCR for the presence of four carbapenemase genes. Genome macrorestriction fingerprinting with XbaI was used to analyze the relatedness of carbapenemase-producing Klebsiella pneumoniae isolates collected from eight hospitals. Among 75 non-susceptible isolates, 65 were carbapenemase producers. The most frequently identified genotype was OXA-48 (n = 51 isolates), eight isolates were positive for blaNDM-1 gene, four had the blaKPC-2 gene, whereas two were positive for blaVIM-1. The analysis of PFGE profiles of OXA-48 and NDM-1 producing K. pneumoniae suggests inter-hospitals and regional transmission of epidemic clones. This study presents the first description of K. pneumoniae strains harbouring blaKPC-2 and blaVIM-1 genes in Romania. The results of this study highlight the urgent need for the strengthening of hospital infection control measures in Romania in order to curb the further spread of the antibiotic resistance. PMID:26599338

  15. Competitive adsorption of heavy metals by extracellular polymeric substances extracted from Klebsiella sp. J1.

    PubMed

    Yang, Jixian; Wei, Wei; Pi, Shanshan; Ma, Fang; Li, Ang; Wu, Dan; Xing, Jie

    2015-11-01

    The adsorption of Cu(2+) and Zn(2+) by extracellular polymeric substances (EPS) extracted from Klebsiella sp. J1 and competitive adsorption mechanism were investigated. Equilibrium adsorption capacities of Cu(2+) (1.77mMg(-1)) on Klebsiella sp. J1 EPS were higher than those of Zn(2+) (1.36mMg(-1)) in single systems. The competitive Langmuir and Langmuir-Freundlich isotherm models were proven to be effective in describing the experimental data of binary component system. The three dimensional sorption surfaces of binary component system demonstrated that the presence of Cu(2+) more significantly decreased the sorption of Zn(2+), but the sorption of Cu(2+) was not disturbed by the presence of Zn(2+). FTIR and EEM results revealed the adsorption sites of Cu(2+) entirely overlapped with those of Zn(2+). Cu(2+) and Zn(2+) showed competitive adsorption in binary systems, and Cu(2+) was preferentially adsorbed because of the stronger complexation ability of the protein-like substances in Klebsiella sp. J1 EPS. PMID:26291413

  16. Prevalence of ESBL-Producing Klebsiella pneumoniae Isolates in Tertiary Care Hospital

    PubMed Central

    Sarojamma, Vemula; Ramakrishna, Vadde

    2011-01-01

    Extended-spectrum ? lactamases (ESBLs) continue to be a major challenge in clinical setups world over, conferring resistance to the expanded-spectrum cephalosporins. An attempt was made to study the prevalence of ESBL-producing Klebsiella pneumoniae clinical isolates in a tertiary care hospital in Kurnool. A total of hundred collected isolates of Klebsiella pneumoniae was studied for their susceptibility patterns to various antibiotics and detection of ESBL producers by double disc synergy test (DDST) and phenotypic confirmatory disc diffusion test (PCDDT). Of the 100 isolates tested for their antibiogram, 61% isolates have shown susceptibility to 3rd-generation cepholosporins and 39% were resistant. Amoxycillin showed the highest percentage of resistance followed by tetracyclins and cotrimoxazole. Among 39 resistant isolates of Klebsiella pneumoniae, 17 were ESBL producers detected by DDST and PCDDT. ESBL producers were more in the hospital isolates (28%) compared to community isolates (6%). Maximum percentage of ESBL producers were noticed from blood sample with 57.14%. In the present study, a large number of isolates were found to be multidrug resistant and ESBL producers. PCDDT was found to be better than DDST in the detection of ESBLs. Continued monitoring of drug resistance is necessary in clinical settings for proper disease management. PMID:23724303

  17. Prevalence of ESBL-Producing Klebsiella pneumoniae Isolates in Tertiary Care Hospital.

    PubMed

    Sarojamma, Vemula; Ramakrishna, Vadde

    2011-01-01

    Extended-spectrum ? lactamases (ESBLs) continue to be a major challenge in clinical setups world over, conferring resistance to the expanded-spectrum cephalosporins. An attempt was made to study the prevalence of ESBL-producing Klebsiella pneumoniae clinical isolates in a tertiary care hospital in Kurnool. A total of hundred collected isolates of Klebsiella pneumoniae was studied for their susceptibility patterns to various antibiotics and detection of ESBL producers by double disc synergy test (DDST) and phenotypic confirmatory disc diffusion test (PCDDT). Of the 100 isolates tested for their antibiogram, 61% isolates have shown susceptibility to 3rd-generation cepholosporins and 39% were resistant. Amoxycillin showed the highest percentage of resistance followed by tetracyclins and cotrimoxazole. Among 39 resistant isolates of Klebsiella pneumoniae, 17 were ESBL producers detected by DDST and PCDDT. ESBL producers were more in the hospital isolates (28%) compared to community isolates (6%). Maximum percentage of ESBL producers were noticed from blood sample with 57.14%. In the present study, a large number of isolates were found to be multidrug resistant and ESBL producers. PCDDT was found to be better than DDST in the detection of ESBLs. Continued monitoring of drug resistance is necessary in clinical settings for proper disease management. PMID:23724303

  18. Complete Genome Sequence of the N2-Fixing Broad Host Range Endophyte Klebsiella pneumoniae 342 and Virulence Predictions Verified in Mice

    PubMed Central

    Fouts, Derrick E.; Tyler, Heather L.; DeBoy, Robert T.; Daugherty, Sean; Ren, Qinghu; Badger, Jonathan H.; Durkin, Anthony S.; Huot, Heather; Shrivastava, Susmita; Kothari, Sagar; Dodson, Robert J.; Mohamoud, Yasmin; Khouri, Hoda; Roesch, Luiz F. W.; Krogfelt, Karen A.; Struve, Carsten; Triplett, Eric W.; Methé, Barbara A.

    2008-01-01

    We report here the sequencing and analysis of the genome of the nitrogen-fixing endophyte, Klebsiella pneumoniae 342. Although K. pneumoniae 342 is a member of the enteric bacteria, it serves as a model for studies of endophytic, plant-bacterial associations due to its efficient colonization of plant tissues (including maize and wheat, two of the most important crops in the world), while maintaining a mutualistic relationship that encompasses supplying organic nitrogen to the host plant. Genomic analysis examined K. pneumoniae 342 for the presence of previously identified genes from other bacteria involved in colonization of, or growth in, plants. From this set, approximately one-third were identified in K. pneumoniae 342, suggesting additional factors most likely contribute to its endophytic lifestyle. Comparative genome analyses were used to provide new insights into this question. Results included the identification of metabolic pathways and other features devoted to processing plant-derived cellulosic and aromatic compounds, and a robust complement of transport genes (15.4%), one of the highest percentages in bacterial genomes sequenced. Although virulence and antibiotic resistance genes were predicted, experiments conducted using mouse models showed pathogenicity to be attenuated in this strain. Comparative genomic analyses with the presumed human pathogen K. pneumoniae MGH78578 revealed that MGH78578 apparently cannot fix nitrogen, and the distribution of genes essential to surface attachment, secretion, transport, and regulation and signaling varied between each genome, which may indicate critical divergences between the strains that influence their preferred host ranges and lifestyles (endophytic plant associations for K. pneumoniae 342 and presumably human pathogenesis for MGH78578). Little genome information is available concerning endophytic bacteria. The K. pneumoniae 342 genome will drive new research into this less-understood, but important category of bacterial-plant host relationships, which could ultimately enhance growth and nutrition of important agricultural crops and development of plant-derived products and biofuels. PMID:18654632

  19. Antibacterial effects of Apis mellifera and stingless bees honeys on susceptible and resistant strains of Escherichia coli, Staphylococcus aureus and Klebsiella pneumoniae in Gondar, Northwest Ethiopia

    PubMed Central

    2013-01-01

    Background Honey is a natural substance produced by honeybees and has nutritional and therapeutic uses. In Ethiopia, honeys are used traditionally to treat wounds, respiratory infections and diarrhoea. Recent increase of drug resistant bacteria against the existing antibiotics forced investigators to search for alternative natural remedies and evaluate their potential use on scientific bases. Thus, the aim of this study was to evaluate the antibacterial effects of different types of honeys in Ethiopia which are used traditionally to treat different types of respiratory and gastrointestinal infections. Methods Mueller Hinton agar (70191) diffusion and nutrient broth culture medium assays were performed to determine susceptibility of Staphylococcus aureus (ATCC 25923), Escherichia coli (ATCC 25922) and resistant clinical isolates (Methicillin resistant Staphylococcus aureus(MRSA), Escherichia coli(R) and Klebsiella pneumoniae (R), using honeys of Apis mellifera and stingless bees in northern and north western Ethiopia. Results Honey of the stingless bees produced the highest mean inhibition (22.27 ± 3.79 mm) compared to white honey (21.0 ± 2.7 mm) and yellow honey (18.0 ± 2.3 mm) at 50% (v/v) concentration on all the standard and resistant strains. Stingless bees honey was found to have Minimum Inhibitory Concentration (MIC) of 6.25% (6.25 mg/ml) for 80% of the test organisms compared to 40% for white and yellow Apis mellifera honeys. All the honeys were found to have minimum bactericidal concentration (MBC) of 12.5% (12.5 mg/ml) against all the test organisms. Staphylococcus aureus (ATCC 25923) was susceptible to amoxicillin, methicillin, kanamycine, tetracycline, and vancomycine standard antibiotic discs used for susceptibility tests. Similarly, Escherichia coli (ATCC 25922) was found susceptible for kanamycine, tetracycline and vancomycine. Escherichia coli (ATCC 25922) has not been tested for amoxicillin ampicillin and methicillin. The susceptibility tests performed against Staphylococcus aureus (MRSA), Escherichia coli (R) and Klebsiella pneumoniae (R) using three of methicillin, erythromycin, ampicillin, Penicillin and amoxicillin discs were resistant. But, these drug resistant strains were susceptible to antibacterial agents found in the honeys and inhibited from 16 mm to 20.33 mm. Conclusions Honeys in Ethiopia can be used as therapeutic agents for drug resistant bacteria after pharmaceutical standardization and clinical trials. PMID:24138782

  20. Isolation, characterization and phylogeny of sponge-associated bacteria with antimicrobial activities from Brazil.

    PubMed

    Santos, Olinda C S; Pontes, Paula V M L; Santos, Juliana F M; Muricy, Guilherme; Giambiagi-deMarval, Marcia; Laport, Marinella S

    2010-09-01

    Bacteria associated with marine sponges represent a rich source of bioactive metabolites. The aim of this study was to isolate and characterize bacteria with antimicrobial activities from Brazilian sponges. A total of 158 colony-forming units were isolated from nine sponge species. Among these, 12 isolates presented antimicrobial activities against pathogenic bacteria. Based on comparative sequence analysis of their 16S rRNA genes, the sponge-associated bacterial strains could be subdivided into three phylogenetically different clusters. Five strains were affiliated with Firmicutes (genera Bacillus and Virgibacillus), three with alpha-Proteobacteria (Pseudovibrio sp.) and four with gamma-Proteobacteria (genera Pseudomonas and Stenotrophomonas). The sponge-associated bacterial strains Pseudomonas fluorescens H40 and H41 and Pseudomonas aeruginosa H51 exhibited antimicrobial activity against both Gram-negative and Gram-positive bacteria, including strains such as vancomycin-resistant Enterococcus faecium and multiresistant Klebsiella pneumoniae. Bacillus pumilus Pc31 and Pc32, Pseudovibrio ascidiaceicola Pm31 and Ca31 and Pseudovibrio denitrificans Mm37 strains were more effective against Gram-positive bacteria. These findings suggest that the identified strains may contribute to the search for new sources of antimicrobial substances, an important strategy for developing alternative therapies to treat infections caused by multidrug-resistant bacteria. PMID:20600863

  1. Bloodstream infections in intensive care unit patients: distribution and antibiotic resistance of bacteria

    PubMed Central

    Russotto, Vincenzo; Cortegiani, Andrea; Graziano, Giorgio; Saporito, Laura; Raineri, Santi Maurizio; Mammina, Caterina; Giarratano, Antonino

    2015-01-01

    Bloodstream infections (BSIs) are among the leading infections in critically ill patients. The case-fatality rate associated with BSIs in patients admitted to intensive care units (ICUs) reaches 35%–50%. The emergence and diffusion of bacteria with resistance to antibiotics is a global health problem. Multidrug-resistant bacteria were detected in 50.7% of patients with BSIs in a recently published international observational study, with methicillin resistance detected in 48% of Staphylococcus aureus strains, carbapenem resistance detected in 69% of Acinetobacter spp., in 38% of Klebsiella pneumoniae, and in 37% of Pseudomonas spp. Prior hospitalization and antibiotic exposure have been identified as risk factors for infections caused by resistant bacteria in different studies. Patients with BSIs caused by resistant strains showed an increased risk of mortality, which may be explained by a higher incidence of inappropriate empirical therapy in different studies. The molecular genetic characterization of resistant bacteria allows the understanding of the most common mechanisms underlying their resistance and the adoption of surveillance measures. Knowledge of epidemiology, risk factors, mechanisms of resistance, and outcomes of BSIs caused by resistant bacteria may have a major influence on global management of ICU patients. The aim of this review is to provide the clinician an update on BSIs caused by resistant bacteria in ICU patients. PMID:26300651

  2. Identification of Gram-Negative Bacteria and Genetic Resistance Determinants from Positive Blood Culture Broths by Use of the Verigene Gram-Negative Blood Culture Multiplex Microarray-Based Molecular Assay.

    PubMed

    Ledeboer, Nathan A; Lopansri, Bert K; Dhiman, Neelam; Cavagnolo, Robert; Carroll, Karen C; Granato, Paul; Thomson, Richard; Butler-Wu, Susan M; Berger, Heather; Samuel, Linoj; Pancholi, Preeti; Swyers, Lettie; Hansen, Glen T; Tran, Nam K; Polage, Christopher R; Thomson, Kenneth S; Hanson, Nancy D; Winegar, Richard; Buchan, Blake W

    2015-08-01

    Bloodstream infection is a serious condition associated with significant morbidity and mortality. The outcome of these infections can be positively affected by the early implementation of effective antibiotic therapy based on the identification of the infecting organism and genetic markers associated with antibiotic resistance. In this study, we evaluated the microarray-based Verigene Gram-negative blood culture (BC-GN) assay in the identification of 8 genus or species targets and 6 genetic resistance determinants in positive blood culture broths. A total of 1,847 blood cultures containing Gram-negative organisms were tested using the BC-GN assay. This comprised 729 prospective fresh, 781 prospective or retrospective frozen, and 337 simulated cultures representing 7 types of aerobic culture media. The results were compared to those with standard bacterial culture and biochemical identification with nucleic acid sequence confirmation of the resistance determinants. Among monomicrobial cultures, the positive percent agreement (PPA) of the BC-GN assay with the reference method was as follows; Escherichia coli, 100%; Klebsiella pneumoniae, 92.9%; Klebsiella oxytoca, 95.5%; Enterobacter spp., 99.3%; Pseudomonas aeruginosa, 98.9%; Proteus spp., 100%; Acinetobacter spp., 98.4%; and Citrobacter spp., 100%. All organism identification targets demonstrated >99.5% negative percent agreement (NPA) with the reference method. Of note, 25/26 cultures containing K. pneumoniae that were reported as not detected by the BC-GN assay were subsequently identified as Klebsiella variicola. The PPA for identification of resistance determinants was as follows; blaCTX-M, 98.9%; blaKPC, 100%; blaNDM, 96.2%; blaOXA, 94.3%; blaVIM, 100%; and blaIMP, 100%. All resistance determinant targets demonstrated >99.9% NPA. Among polymicrobial specimens, the BC-GN assay correctly identified at least one organism in 95.4% of the broths and correctly identified all organisms present in 54.5% of the broths. The sample-to-result processing and automated reading of the detection microarray results enables results within 2 h of culture positivity. PMID:25994165

  3. Identification of Gram-Negative Bacteria and Genetic Resistance Determinants from Positive Blood Culture Broths by Use of the Verigene Gram-Negative Blood Culture Multiplex Microarray-Based Molecular Assay

    PubMed Central

    Ledeboer, Nathan A.; Lopansri, Bert K.; Dhiman, Neelam; Cavagnolo, Robert; Carroll, Karen C.; Granato, Paul; Thomson, Richard; Butler-Wu, Susan M.; Berger, Heather; Samuel, Linoj; Pancholi, Preeti; Swyers, Lettie; Hansen, Glen T.; Tran, Nam K.; Polage, Christopher R.; Thomson, Kenneth S.; Hanson, Nancy D.; Winegar, Richard

    2015-01-01

    Bloodstream infection is a serious condition associated with significant morbidity and mortality. The outcome of these infections can be positively affected by the early implementation of effective antibiotic therapy based on the identification of the infecting organism and genetic markers associated with antibiotic resistance. In this study, we evaluated the microarray-based Verigene Gram-negative blood culture (BC-GN) assay in the identification of 8 genus or species targets and 6 genetic resistance determinants in positive blood culture broths. A total of 1,847 blood cultures containing Gram-negative organisms were tested using the BC-GN assay. This comprised 729 prospective fresh, 781 prospective or retrospective frozen, and 337 simulated cultures representing 7 types of aerobic culture media. The results were compared to those with standard bacterial culture and biochemical identification with nucleic acid sequence confirmation of the resistance determinants. Among monomicrobial cultures, the positive percent agreement (PPA) of the BC-GN assay with the reference method was as follows; Escherichia coli, 100%; Klebsiella pneumoniae, 92.9%; Klebsiella oxytoca, 95.5%; Enterobacter spp., 99.3%; Pseudomonas aeruginosa, 98.9%; Proteus spp., 100%; Acinetobacter spp., 98.4%; and Citrobacter spp., 100%. All organism identification targets demonstrated >99.5% negative percent agreement (NPA) with the reference method. Of note, 25/26 cultures containing K. pneumoniae that were reported as not detected by the BC-GN assay were subsequently identified as Klebsiella variicola. The PPA for identification of resistance determinants was as follows; blaCTX-M, 98.9%; blaKPC, 100%; blaNDM, 96.2%; blaOXA, 94.3%; blaVIM, 100%; and blaIMP, 100%. All resistance determinant targets demonstrated >99.9% NPA. Among polymicrobial specimens, the BC-GN assay correctly identified at least one organism in 95.4% of the broths and correctly identified all organisms present in 54.5% of the broths. The sample-to-result processing and automated reading of the detection microarray results enables results within 2 h of culture positivity. PMID:25994165

  4. Biokinetic evaluation and modeling of continuous thiocyanate biodegradation by Klebsiella sp.

    PubMed

    Ahn, Johng-Hwa; Kim, Jaai; Lim, Juntaek; Hwang, Seokhwan

    2004-01-01

    Biokinetics for autotrophic degradation of thiocyanate using batch culture of Klebsiella sp. were evaluated both analytically and numerically. A sequential approach with an analytical method followed by a numerical approximation was used to evaluate and to ensure the accuracy of the parameter estimation. The nonlinear least-squares method with a 95% confidence interval was employed. The growth conditions were maintained at pH 7 and 38 degrees C for all experiments. With an automated incubation and turbidity reader, a total of 16 different initial thiocyanate concentrations, ranging from 10 to 300 mg L(-1), were used to develop a kinetic expression of specific growth rate as a function of substrate concentration. The biodegradation of thiocyanate with Klebsiella sp. followed a substrate inhibition pattern. Three identical automated bioreactors with working volumes of 1.5 L, equipped with sterilizable sampling ports, were also used for the numerical approximation of the biokinetic parameters in batch mode. A fourth order Runge-Kutta method was used to approximate the substrate inhibition kinetics of the Klebsiella sp. utilizing thiocyanate. Although the kinetic coefficients estimated by analytical and numerical methods were not statistically different at a 0.05 alpha level, model responses of numerical approximation generated a better prediction of changes in thiocyanate and cell mass concentrations. The hypothetical maximum growth rate, micro m, half saturation coefficient, Ks, microbial yield coefficient, Y, cell mass decay rate coefficient, kd, and substrate inhibition coefficient, Ksi, were evaluated as being 0.62 +/- 0.05 d(-1), 85 +/- 8 mg SCN- L(-1), 0.076 +/- 0.011 mg cell mass (mg SCN)(-1), 0.03 +/- 0.002 d(-1), and 131 +/- 22 mg SCN- L(-1), respectively. The calculated maximal substrate concentration, Sm, and apparent maximum specific growth rate, micro'm, were 105.5 +/- 8.7 mg SCN- L(-1) and 0.24 +/- 0.01 d(-1), respectively. Using these estimated parameters, the theoretical performance of the continuous operation was also illustrated, which depicts the residual thiocyanate and Klebsiella sp. concentrations in the non-steady and steady states at different hydraulic retention times (HRTs). Assuming the influent concentration of 250 mg SCN- L(-1), the expected treatment efficiency ranged from 94.9% to 69.4% between 20 and 5 days HRT, respectively. Klebsiella sp. was expected to be washed out at 4.8 days HRT, thus resulting in no treatment of thiocyanate. PMID:15296431

  5. Polyhexamethylene guanidine hydrochloride shows bactericidal advantages over chlorhexidine digluconate against ESKAPE bacteria.

    PubMed

    Zhou, Zhongxin; Wei, Dafu; Lu, Yanhua

    2015-01-01

    More information regarding the bactericidal properties of polyhexamethylene guanidine hydrochloride (PHMG) against clinically important antibiotic-resistant ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogens needs to be provided for its uses in infection control. The bactericidal properties of PHMG and chlorhexidine digluconate (CHG) were compared based on their minimum inhibitory concentrations (MICs), minimum bactericidal concentrations, and time-course-killing curves against clinically important antibiotic-susceptible and antibiotic-resistant ESKAPE pathogens. Results showed that PHMG exhibited significantly higher bactericidal activities against methicillin-resistant Staphylococcus aureus, carbapenem-resistant Klebsiella pneumoniae, and ceftazidime-resistant Enterobacter spp. than CHG. A slight bactericidal advantage over CHG was obtained against vancomycin-resistant Enterococcus faecium, ciprofloxacin- and levofloxacin-resistant Acinetobacter spp., and multidrug-resistant Pseudomonas aeruginosa. In previous reports, PHMG had higher antimicrobial activity against almost all tested Gram-negative bacteria and several Gram-positive bacteria than CHG using MIC test. These studies support the further development of covalently bound PHMG in sterile-surface materials and the incorporation of PHMG in novel disinfectant formulas. PMID:24888899

  6. Photobiosensors containing luminescent bacteria.

    PubMed

    Ismailov, A D; Aleskerova, L E

    2015-06-01

    The scientific basis for producing luminescent biosensors containing free and immobilized luminescent bacteria is discussed. Modern technologies for engineering target objects, procedures used to immobilize bacteria in different carriers, as well as procedures for integral and specific biodetection of toxins are presented. Data regarding generation and application of biomonitoring for ecotoxicants derived from natural and genetically engineered photobacterial strains are analyzed. Special attention is given to immobilization of photobacteria in polyvinyl alcohol-containing cryogel. The main physicochemical, biochemical, and technological parameters for stabilizing luminescence in immobilized bacteria are described. Results of the application of immobilized photobacterial preparations both during discrete and continuous biomonitoring for different classes of ecotoxicants are presented. PMID:26531018

  7. Interspecies communication in bacteria

    PubMed Central

    Federle, Michael J.; Bassler, Bonnie L.

    2003-01-01

    Until recently, bacteria were considered to live rather asocial, reclusive lives. New research shows that, in fact, bacteria have elaborate chemical signaling systems that enable them to communicate within and between species. One signal, termed AI-2, appears to be universal and facilitates interspecies communication. Many processes, including virulence factor production, biofilm formation, and motility, are controlled by AI-2. Strategies that interfere with communication in bacteria are being explored in the biotechnology industry with the aim of developing novel antimicrobials. AI-2 is a particularly attractive candidate for such studies because of its widespread use in the microbial kingdom. PMID:14597753

  8. Multidrug Resistance in Bacteria

    PubMed Central

    Nikaido, Hiroshi

    2010-01-01

    Large amounts of antibiotics used for human therapy, as well as for farm animals and even for fish in aquaculture, resulted in the selection of pathogenic bacteria resistant to multiple drugs. Multidrug resistance in bacteria may be generated by one of two mechanisms. First, these bacteria may accumulate multiple genes, each coding for resistance to a single drug, within a single cell. This accumulation occurs typically on resistance (R) plasmids. Second, multidrug resistance may also occur by the increased expression of genes that code for multidrug efflux pumps, extruding a wide range of drugs. This review discusses our current knowledge on the molecular mechanisms involved in both types of resistance. PMID:19231985

  9. Multidrug-resistant Gram-negative bacteria: a product of globalization.

    PubMed

    Hawkey, P M

    2015-04-01

    Global trade and mobility of people has increased rapidly over the last 20 years. This has had profound consequences for the evolution and the movement of antibiotic resistance genes. There is increasing exposure of populations all around the world to resistant bacteria arising in the emerging economies. Arguably the most important development of the last two decades in the field of antibiotic resistance is the emergence and spread of extended-spectrum β-lactamases (ESBLs) of the CTX-M group. A consequence of the very high rates of ESBL production among Enterobacteriaceae in Asian countries is that there is a substantial use of carbapenem antibiotics, resulting in the emergence of plasmid-mediated resistance to carbapenems. This article reviews the emergence and spread of multidrug-resistant Gram-negative bacteria, focuses on three particular carbapenemases--imipenem carbapenemases, Klebsiella pneumoniae carbapenemase, and New Delhi metallo-β-lactamase--and highlights the importance of control of antibiotic use. PMID:25737092

  10. Carbapenemase-producing Gram-negative bacteria: current epidemics, antimicrobial susceptibility and treatment options.

    PubMed

    Jean, Shio-Shin; Lee, Wen-Sen; Lam, Carlos; Hsu, Chin-Wang; Chen, Ray-Jade; Hsueh, Po-Ren

    2015-01-01

    Carbapenemases, with versatile hydrolytic capacity against β-lactams, are now an important cause of resistance of Gram-negative bacteria. The genes encoding for the acquired carbapenemases are associated with a high potential for dissemination. In addition, infections due to Gram-negative bacteria with acquired carbapenemase production would lead to high clinical mortality rates. Of the acquired carbapenemases, Klebsiella pneumoniae carbapenemase (Ambler class A), Verona integron-encoded metallo-β-lactamase (Ambler class B), New Delhi metallo-β-lactamase (Ambler class B) and many OXA enzymes (OXA-23-like, OXA-24-like, OXA-48-like, OXA-58-like, class D) are considered to be responsible for the worldwide resistance epidemics. As compared with monotherapy with colistin or tigecycline, combination therapy has been shown to effectively lower case-fatality rates. However, development of new antibiotics is crucial in the present pandrug-resistant era. PMID:25812463

  11. Novel antimicrobial agents against multi-drug-resistant gram-negative bacteria: an overview.

    PubMed

    Karras, George; Giannakaki, Venetia; Kotsis, Vasilios; Miyakis, Spiros

    2012-12-01

    No novel antimicrobial agents against multi-drug-resistant Gram-negative bacteria have been available to daily clinical practice during the last 5 years. On the other hand, resistance rates and mechanisms of those pathogens are increasing worldwide. Pan-resistant (against which none of the currently available antibiotics is effective) strains of Klebsiella pneumoniae, Acinetobacter baumannii and Pseudomonas aeruginosa have been described. Encouraging is the fact that several novel compounds (some of them with mechanisms of action different to those of the antibiotics commercially available) are through the development stages. We summarize the main such compounds that show potential for offering solution to the treatment of Gram-negative multi-resistant bacteria along with the discussion of some patents associated with the topic. PMID:23061790

  12. Growth inhibition of selected food-borne bacteria, particularly Listeria monocytogenes, by plant extracts.

    PubMed

    Chung, K T; Thomasson, W R; Wu-Yuan, C D

    1990-10-01

    Six extracts from Chinese medicinal plants: Tin Men Chu, Sey Lau Pai, Siu Mao Heung, Bak Tao Yung, Kam Chin Chiu and Liao Ya, were tested for their inhibitory effect on selected food-borne bacteria by the well assay technique. Among them, Tin Men Chu, Siu Mao Heung and Sey Lau Pai inhibited the growth of Staphylococcus aureus, Klebsiella pneumonia, Escherichia coli, Shigella flexneri, Streptococcus faecalis, Salmonella paratyphi, Salm. enteritidis, Enterobacter aerogenes, Pseudomonas fluorescens, Proteus vulgaris, Alcaligenes faecalis, and three strains of Listeria monocytogenes. Two of these three extracts, Tin Men Chu and Siu Mao Heung, suppressed the growth of L. monocytogenes Scott A in cabbage juice. This inhibition was prevented by the addition of protein but not sodium chloride. Plant extracts show potential to control the growth of food-borne bacteria. PMID:2127264

  13. Indicator For Pseudomonas Bacteria

    NASA Technical Reports Server (NTRS)

    Margalit, Ruth

    1990-01-01

    Characteristic protein extracted and detected. Natural protein marker found in Pseudomonas bacteria. Azurin, protein containing copper readily extracted, purified, and used to prepare antibodies. Possible to develop simple, fast, and accurate test for marker carried out in doctor's office.

  14. Plasmid Mediated Antibiotic Resistance in Isolated Bacteria From Burned Patients

    PubMed Central

    Beige, Fahimeh; Baseri Salehi, Majid; Bahador, Nima; Mobasherzadeh, Sina

    2014-01-01

    Background: Nowadays, the treatment of burned patients is difficult because of the high frequency of infection with antibiotic resistance bacteria. Objectives: This study was conducted to evaluate the level of antibiotic resistance in Gram-negative bacteria and its relation with the existence of plasmid. Materials and Methods: The samples were collected from two hundred twenty hospitalized burned patients in Isfahan burn hospital during a three-month period (March 2012 to June 2012). The samples were isolated and the Gram-negative bacteria were identified using phenotypic method and API 20E System. Antibiotic susceptibility and plasmid profile were determined by standard Agar disc diffusion and plasmid spin column extraction methods. Results: Totally 117 Gram-negative bacteria were isolated, the most common were Pseudomonas aerugionsa (37.6%), P. fluorescens (25.6%), Acinetobacter baumanii (20/5%) and Klebsiella pneumoniae (7.6%), respectively. The isolates showed high frequency of antibiotic resistance against ceftazidime and co-amoxiclave (100%) and low frequency of antibiotic resistance against amikacin with (70%).The results indicated that 60% of the isolates harboured plasmid. On the other hand, the patients infected with A. baumanii and P. aeruginosa were cured (with 60% frequency) whereas, those infected with P. fluorescens were not cured. Hence, probably antibiotic resistance markers of A. baumanii and P. aeruginosa are plasmid mediated; however, P. fluorescens is chromosomally mediated. Conclusions: Based on our findings, P. aerugionsa is a major causative agent of wound infections and amikacin could be considered as a more effective antibiotic for treatment of the burned patients. PMID:25789121

  15. Aerobic Anoxygenic Phototrophic Bacteria

    PubMed Central

    Yurkov, Vladimir V.; Beatty, J. Thomas

    1998-01-01

    The aerobic anoxygenic phototrophic bacteria are a relatively recently discovered bacterial group. Although taxonomically and phylogenetically heterogeneous, these bacteria share the following distinguishing features: the presence of bacteriochlorophyll a incorporated into reaction center and light-harvesting complexes, low levels of the photosynthetic unit in cells, an abundance of carotenoids, a strong inhibition by light of bacteriochlorophyll synthesis, and the inability to grow photosynthetically under anaerobic conditions. Aerobic anoxygenic phototrophic bacteria are classified in two marine (Erythrobacter and Roseobacter) and six freshwater (Acidiphilium, Erythromicrobium, Erythromonas, Porphyrobacter, Roseococcus, and Sandaracinobacter) genera, which phylogenetically belong to the α-1, α-3, and α-4 subclasses of the class Proteobacteria. Despite this phylogenetic information, the evolution and ancestry of their photosynthetic properties are unclear. We discuss several current proposals for the evolutionary origin of aerobic phototrophic bacteria. The closest phylogenetic relatives of aerobic phototrophic bacteria include facultatively anaerobic purple nonsulfur phototrophic bacteria. Since these two bacterial groups share many properties, yet have significant differences, we compare and contrast their physiology, with an emphasis on morphology and photosynthetic and other metabolic processes. PMID:9729607

  16. Lipopolysaccharides in diazotrophic bacteria

    PubMed Central

    Serrato, Rodrigo V.

    2014-01-01

    Biological nitrogen fixation (BNF) is a process in which the atmospheric nitrogen (N2) is transformed into ammonia (NH3) by a select group of nitrogen-fixing organisms, or diazotrophic bacteria. In order to furnish the biologically useful nitrogen to plants, these bacteria must be in constant molecular communication with their host plants. Some of these molecular plant-microbe interactions are very specific, resulting in a symbiotic relationship between the diazotroph and the host. Others are found between associative diazotrophs and plants, resulting in plant infection and colonization of internal tissues. Independent of the type of ecological interaction, glycans, and glycoconjugates produced by these bacteria play an important role in the molecular communication prior and during colonization. Even though exopolysaccharides (EPS) and lipochitooligosaccharides (LCO) produced by diazotrophic bacteria and released onto the environment have their importance in the microbe-plant interaction, it is the lipopolysaccharides (LPS), anchored on the external membrane of these bacteria, that mediates the direct contact of the diazotroph with the host cells. These molecules are extremely variable among the several species of nitrogen fixing-bacteria, and there are evidences of the mechanisms of infection being closely related to their structure. PMID:25232535

  17. Assessment of pathogenic bacteria in treated graywater and irrigated soils.

    PubMed

    Benami, Maya; Gross, Amit; Herzberg, Moshe; Orlofsky, Ezra; Vonshak, Ahuva; Gillor, Osnat

    2013-08-01

    Reuse of graywater (GW) for irrigation is recognized as a sustainable solution for water conservation. One major impediment for reuse of GW is the possible presence of pathogenic microorganisms. The presence and abundance of six pathogens and indicators were investigated in three GW recirculating vertical flow constructed wetland treatment systems and their respective irrigated yard soils. The treated GW and soils were monitored once every two months for six months using real-time quantitative PCR. As a control, samples from four soils irrigated with fresh water (FW) were similarly analyzed for pathogens and indicators. Comparable types of pathogens and fecal indicator bacteria, including Escherichia coli, Klebsiella pneumoniae, Salmonella enterica, Pseudomonas aeruginosa, Enterococcus faecalis, and Shigella spp., were found in the treated GW, their corresponding irrigated soils and the FW-irrigated soils. Moreover, the abundance of these bacteria in the GW- and FW-irrigated soils was of the same order of magnitude, suggesting that the source of the pathogens cannot be established. Our results suggest that GW irrigation has no effect on the diversity and abundance of the tested pathogens and indicators in yard soils. PMID:23666359

  18. [Gram-negative bacteria resistant to antibiotics in foods].

    PubMed

    Dias, J C; Hofer, E

    1985-01-01

    From 154 food samples, including vegetables (lettuce), milk and meals served at school it was possible to isolate and identify 400 Gram negative bacilli distributed among 339 enteric bacteria (Escherichia, Shigella, Citrobacter, Klebsiella, Enterobacter, Serratia and Proteus) and other 61 non enteric bacilli (Acinetobacter, Flavobacterium, Aeromonas and Pseudomonas). Submitting this cultures to the drugs sulfadiazine (Su), streptomycin (Sm), tetracycline (Tc), chloramphenicol (Cm), kanamycin (Km), ampicillin (Ap), nalidixic acid (Nal) and gentamycin (Gm) it was observed only six stocks susceptible to all drugs and total sensibility to Gm. Among enteric bacteria the profiles Su (27,6%) and Su-Ap (39,6%) predominated, while for the non enteric bacilli percentages of 18.0 for Ap and 9.8 for Su-Ap were detected. Aiming to better characterization of resistance, experiments of conjugation were made with standard strains of Escherichia coli K 12. Great concern was raised by the recognition of these cultures due to the elevated R+ taxes for the enteric bacilli that were close to 90% (milk and food at school) and about 70% in relation to lettuce. PMID:3837834

  19. Occurrence of carbapenemase-producing bacteria in coastal recreational waters.

    PubMed

    Montezzi, Lara Feital; Campana, Eloiza Helena; Corra, Las Lisboa; Justo, Livia Helena; Paschoal, Raphael Paiva; da Silva, Isabel Lemos Vieira Dias; Souza, Maria do Carmo Maciel; Drolshagen, Marcia; Pico, Renata Cristina

    2015-02-01

    The spread of carbapenemase-producing Gram-negative rods is an emerging global problem. Although most infections due to carbapenemase producers are limited to healthcare institutions, reports of the occurrence of clinically relevant carbapenemase producers in sewage and polluted rivers are increasingly frequent. Polluted rivers flowing to oceans may contaminate coastal waters with multidrug-resistant bacteria, potentially threatening the safety of recreational activities in these locations. Here we assessed the occurrence of carbapenemase producers in water from touristic beaches located in Rio de Janeiro, Brazil, showing distinct pollution patterns. The presence of enterobacteria was noted, including the predominantly environmental genus Kluyvera spp., producing either Klebsiella pneumoniae carbapenemase (KPC) or Guyana extended-spectrum (GES)-type carbapenemases and often associated with quinolone resistance determinants. An Aeromonas sp. harbouring blaKPC and qnrS was also observed. These findings strengthen the role of aquatic matrices as reservoirs and vectors of clinically relevant antimicrobial-resistant bacteria, with potential to favour the spread of these resistance threats throughout the community. PMID:25499185

  20. The fecal bacteria

    USGS Publications Warehouse

    Sadowsky, Michael J., (Edited By); Whitman, Richard L.

    2011-01-01

    The Fecal Bacteria offers a balanced, integrated discussion of fecal bacteria and their presence and ecology in the intestinal tract of mammals, in the environment, and in the food supply. This volume covers their use in examining and assessing water quality in order to offer protection from illnesses related to swimming in or ingesting contaminated water, in addition to discussing their use in engineering considerations of water quality, modeling, monitoring, and regulations. Fecal bacteria are additionally used as indicators of contamination of ready-to-eat foods and fresh produce. The intestinal environment, the microbial community structure of the gut microbiota, and the physiology and genomics of this broad group of microorganisms are explored in the book. With contributions from an internationally recognized group of experts, the book integrates medicine, public health, environmental, and microbiological topics in order to provide a unique, holistic understanding of fecal bacteria. Moreover, it shows how the latest basic science and applied research findings are helping to solve problems and develop effective management strategies. For example, readers will discover how the latest tools and molecular approaches have led to our current understanding of fecal bacteria and enabled us to improve human health and water quality. The Fecal Bacteria is recommended for microbiologists, clinicians, animal scientists, engineers, environmental scientists, food safety experts, water quality managers, and students. It will help them better understand fecal bacteria and use their knowledge to protect human and environmental health. They can also apply many of the techniques and molecular tools discussed in this book to the study of a broad range of microorganisms in a variety of habitats.

  1. Prevention of biofilm colonization by Gram-negative bacteria on minocycline-rifampin-impregnated catheters sequentially coated with chlorhexidine.

    PubMed

    Jamal, Mohamed A; Rosenblatt, Joel S; Hachem, Ray Y; Ying, Jiang; Pravinkumar, Egbert; Nates, Joseph L; Chaftari, Anne-Marie P; Raad, Issam I

    2014-01-01

    Resistant Gram-negative bacteria are increasing central-line-associated bloodstream infection threats. To better combat this, chlorhexidine (CHX) was added to minocycline-rifampin (M/R) catheters. The in vitro antimicrobial activity of CHX-M/R catheters against multidrug resistant, Gram-negative Acinetobacter baumannii, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia was tested. M/R and CHX-silver sulfadiazine (CHX/SS) catheters were used as comparators. The novel CHX-M/R catheters were significantly more effective (P < 0.0001) than CHX/SS or M/R catheters in preventing biofilm colonization and showed better antimicrobial durability. PMID:24165191

  2. Retrospective study of an outbreak in a Kuwaiti hospital of multidrug-resistant Klebsiella pneumoniae possessing the new SHV-112 extended-spectrum beta-lactamase.

    PubMed

    Dashti, A A; Jadaon, M M; Amyes, S G B

    2010-10-01

    Patients infected with bacteria producing extendedspectrum beta-lactamases (ESBL) are at higher risk of mortality and morbidity. Several mutations in genes encoding SHV, tem and CTX-M beta-lactamases have been associated with ESBL activity. This paper describes a new SHV mutation in ESBL-producing strains of Klebsiella pneumoniae isolated in Kuwait. The study included 13 K. penumoniae strains isolated from patients admitted to the Amiri hospital of Kuwait. The production of ESBL in all strains was confirmed by Vitek system and E-test. All the ESBL genes were amplified by PCR and examined by DNA sequencing. All these ESBL-positive isolates were resistant to ceftazidime and cefotaxime. DNA sequencing revealed an A815G point mutation in the bla (SHV )gene causing an asparagine (AAT) to aspartic acid (GAT) mutation at position 253 of the enzyme. This new mutation was assigned the unique number SHV-112, and the Genebank accession number EU477409. This study reports a new mutation in the SHV gene in K. pneumoniae with ESBL capability. There could be other mutations still to be found in ESBL genes of K. pneumoniae in Kuwait and probably in other middle eastern countries, and researchers in the region should make use of molecular techniques to look for more novel mutations in ESBL-producing strains of K. pneumoniae. PMID:21123157

  3. Active hexose correlated compound enhances resistance to Klebsiella pneumoniae infection in mice in the hindlimb-unloading model of spaceflight conditions.

    PubMed

    Aviles, Hernan; Belay, Tesfaye; Fountain, Kimberly; Vance, Monique; Sun, Buxiang; Sonnenfeld, Gerald

    2003-08-01

    Previous studies have demonstrated that resistance to infection is decreased in Swiss Webster female mice maintained in the hindlimb-unloading model (Aviles H, Belay T, Fountain K, Vance M, and Sonnenfeld G. J Appl Physiol 95: 73-80, 2003; Belay T, Aviles H, Vance M, Fountain K, and Sonnenfeld G. J Allergy Clin Immunol 110: 262-268, 2002). This is a model of some of the aspects of spaceflight conditions, including lack of load bearing on hindlimbs and a fluid shift to the head. Active hexose correlated compound (AHCC), extracted from Basidiomycete mushrooms, has been shown to induce enhancement of immune responses, including enhanced natural killer activity. In the present study, AHCC was orally administered to mice to determine whether the treatment could decrease immunosuppression and mortality of mice maintained in the hindlimb-unloaded model and infected with Klebsiella pneumoniae. The results of the present study showed that administration of AHCC by gavage for 1 wk (1 g/kg body wt) before suspension and throughout the 10-day suspension period yielded significant beneficial effects for the hindlimb-unloaded group, including 1). decreased mortality, 2). increased time to death, and 3). increased ability to clear bacteria. The results suggest that AHCC can decrease the deleterious effects of the hindlimb-unloading model on immunity and resistance to infection. PMID:12692142

  4. Structural Basis of a Physical Blockage Mechanism for the Interaction of Response Regulator PmrA with Connector Protein PmrD from Klebsiella pneumoniae *

    PubMed Central

    Luo, Shih-Chi; Lou, Yuan-Chao; Rajasekaran, Mahalingam; Chang, Yi-Wei; Hsiao, Chwan-Deng; Chen, Chinpan

    2013-01-01

    In bacteria, the two-component system is the most prevalent for sensing and transducing environmental signals into the cell. The PmrA-PmrB two-component system, responsible for sensing external stimuli of high Fe3+ and mild acidic conditions, can control the genes involved in lipopolysaccharide modification and polymyxin resistance in pathogens. In Klebsiella pneumoniae, the small basic connector protein PmrD protects phospho-PmrA and prolongs the expression of PmrA-activated genes. We previously determined the phospho-PmrA recognition mode of PmrD. However, how PmrA interacts with PmrD and prevents its dephosphorylation remains unknown. To address this question, we solved the x-ray crystal structure of the N-terminal receiver domain of BeF3?-activated PmrA (PmrAN) at 1.70 ?. With this structure, we applied the data-driven docking method based on NMR chemical shift perturbation to generate the complex model of PmrD-PmrAN, which was further validated by site-directed spin labeling experiments. In the complex model, PmrD may act as a blockade to prevent phosphatase from contacting with the phosphorylation site on PmrA. PMID:23861396

  5. Piscidin is highly active against carbapenem-resistant Acinetobacter baumannii and NDM-1-producing Klebsiella pneumonia in a systemic Septicaemia infection mouse model.

    PubMed

    Pan, Chieh-Yu; Chen, Jian-Chyi; Chen, Te-Li; Wu, Jen-Leih; Hui, Cho-Fat; Chen, Jyh-Yih

    2015-04-01

    This study was designed to investigate the antimicrobial activity of two synthetic antimicrobial peptides from an aquatic organism, tilapia piscidin 3 (TP3) and tilapia piscidin 4 (TP4), in vitro and in a murine sepsis model, as compared with ampicillin, tigecycline, and imipenem. Mice were infected with (NDM-1)-producing K. pneumonia and multi-drug resistant Acinetobacter baumannii, and subsequently treated with TP3, TP4, or antibiotics for different periods of time (up to 168 h). Mouse survival and bacterial colony forming units (CFU) in various organs were measured after each treatment. Toxicity was determined based on observation of behavior and measurement of biochemical parameters. TP3 and TP4 exhibited strong activity against K. pneumonia and A. baumannii in vitro. Administration of TP3 (150 ?g/mouse) or TP4 (50 ?g/mouse) 30 min after infection with K. pneumonia or A. baumannii significantly increased survival in mice. TP4 was more effective than tigecycline at reducing CFU counts in several organs. TP3 and TP4 were shown to be non-toxic, and did not affect mouse behavior. TP3 and TP4 are able at potentiate anti-Acinetobacter baumannii or anti-Klebsiella pneumonia drug activity, reduce bacterial load, and prevent drug resistance, indicating their potential for use in combating multidrug-resistant bacteria. PMID:25874924

  6. Production of a novel bioflocculant MNXY1 by Klebsiella pneumoniae strain NY1 and application in precipitation of cyanobacteria and municipal wastewater treatment

    PubMed Central

    Nie, M.; Yin, X.; Jia, J.; Wang, Y.; Liu, S.; Shen, Q.; Li, P.; Wang, Z.

    2015-01-01

    Aims To isolate and characterize the novel bioflocculant-producing bacteria, to optimize the bioflocculant production and evaluate its potential applications. Methods and Results Klebsiella pneumoniae strain NY1, a bacterium that produces a novel bioflocculant (MNXY1), was selected on the chemically defined media. It was classified according to the 16S rRNA gene sequence, morphological and microscopic characteristics. MNXY1 was characterized to contain 26% protein and 66% total sugar. The constituent sugar monomers of MNXY1, revealed by NMR analysis, are glucose, galactose and quinovose. Favorable culture conditions for MNXY1 production were determined. Strain NY1 produces a high level (14.9 g l?1) of MNXY1. MNXY1 is thermostable and tolerant to the extreme pH. It precipitated 54% of cyanobacteria from laboratory culture and 72% of the total suspended solids from raw wastewater. Conclusions Strain NY1 was identified to produce a novel bioflocculant MNXY1. The outstanding performance of MNXY1 in practical applications and its availability in copious amounts make it attractive for further investigation and development for industrial scale applications. PMID:21679283

  7. Efficacy of pivmecillinam for treatment of lower urinary tract infection caused by extended-spectrum ?-lactamase-producing Escherichia coli and Klebsiella pneumoniae.

    PubMed

    Titelman, Emilia; Iversen, Aina; Kalin, Mats; Giske, Christian G

    2012-04-01

    To evaluate the clinical and bacteriological efficacy of pivmecillinam against lower urinary tract infection (UTI) caused by extended-spectrum ?-lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae, patients treated for lower UTI with pivmecillinam (n=8) were studied. Patients treated with nitrofurantoin (n=3) and trimethoprim (n=3) or a combination of these agents with pivmecillinam (n=3) were included as a control group. Antimicrobial susceptibility was determined with EUCAST methodology. Bacteriologic cure was defined as <10(3) CFU/ml at follow-up (30 days), and clinical cure as resolved UTI symptoms after completed treatment. All patients receiving pivmecillinam had good clinical response (8/8), but bacteriological cure rates were low (2/8). However, none of the patients with persisting bacteriuria had a relapse of UTI symptoms within 6 months. All isolates were susceptible to the given antimicrobial. Most isolates belonged to the CTX-M-1 group (n=11, 65%) or CTX-M-9-group (n=4, 24%). Four E. coli isolates belonged to the international clone O25b-ST131 (25%). In conclusion, pivmecillinam had good clinical activity against lower UTI caused by ESBL-producing Enterobacteriaceae, but bacteriological cure rates were low. The persistent bacteriuria appears to be of little clinical importance, but larger clinical studies are needed to determine the usefulness of pivmecillinam in infections caused by ESBL-producing bacteria. PMID:22204597

  8. Oral DAV131, a charcoal-based adsorbent, inhibits intestinal colonization by ?-lactam-resistant Klebsiella pneumoniae in cefotaxime-treated mice.

    PubMed

    Grall, Nathalie; Massias, Laurent; Nguyen, Thu Thuy; Sayah-Jeanne, Sakina; Ducrot, Nicolas; Chachaty, Elisabeth; de Gunzburg, Jean; Andremont, Antoine

    2013-11-01

    Antibiotics excreted into the intestinal tract, such as broad-spectrum cephalosporins, disrupt the indigenous microflora, affect colonization resistance (CR), and promote intestinal colonization by resistant bacteria. We tested whether oral DAV131, a charcoal-based adsorbent, would prevent colonization by a cefotaxime (CTX)-resistant Klebsiella pneumoniae strain (PUG-2) in CTX-treated mice. Mice received CTX, saline, CTX and DAV131, or saline and DAV131 for 3 days before oral challenge with 10(6) CFU of PUG-2. The fecal CTX concentrations and counts of PUG-2 were assayed. Fecal CTX disappeared when DAV131 was given concomitantly with CTX (P < 0.05), and the area under the curve of PUG-2 fecal density was significantly reduced (P < 0.01). In conclusion, reducing intestinal antibiotic exposure with DAV131 may reduce colonization by resistant strains during treatment compared to treatment with CTX only. This might open new possibilities for decreasing the impact of antibiotics on the intestinal microbiota during treatments. PMID:23959311

  9. Oral DAV131, a Charcoal-Based Adsorbent, Inhibits Intestinal Colonization by ?-Lactam-Resistant Klebsiella pneumoniae in Cefotaxime-Treated Mice

    PubMed Central

    Massias, Laurent; Nguyen, Thu Thuy; Sayah-Jeanne, Sakina; Ducrot, Nicolas; Chachaty, Elisabeth; de Gunzburg, Jean; Andremont, Antoine

    2013-01-01

    Antibiotics excreted into the intestinal tract, such as broad-spectrum cephalosporins, disrupt the indigenous microflora, affect colonization resistance (CR), and promote intestinal colonization by resistant bacteria. We tested whether oral DAV131, a charcoal-based adsorbent, would prevent colonization by a cefotaxime (CTX)-resistant Klebsiella pneumoniae strain (PUG-2) in CTX-treated mice. Mice received CTX, saline, CTX and DAV131, or saline and DAV131 for 3 days before oral challenge with 106 CFU of PUG-2. The fecal CTX concentrations and counts of PUG-2 were assayed. Fecal CTX disappeared when DAV131 was given concomitantly with CTX (P < 0.05), and the area under the curve of PUG-2 fecal density was significantly reduced (P < 0.01). In conclusion, reducing intestinal antibiotic exposure with DAV131 may reduce colonization by resistant strains during treatment compared to treatment with CTX only. This might open new possibilities for decreasing the impact of antibiotics on the intestinal microbiota during treatments. PMID:23959311

  10. Piscidin is Highly Active against Carbapenem-Resistant Acinetobacter baumannii and NDM-1-Producing Klebsiella pneumonia in a Systemic Septicaemia Infection Mouse Model

    PubMed Central

    Pan, Chieh-Yu; Chen, Jian-Chyi; Chen, Te-Li; Wu, Jen-Leih; Hui, Cho-Fat; Chen, Jyh-Yih

    2015-01-01

    This study was designed to investigate the antimicrobial activity of two synthetic antimicrobial peptides from an aquatic organism, tilapia piscidin 3 (TP3) and tilapia piscidin 4 (TP4), in vitro and in a murine sepsis model, as compared with ampicillin, tigecycline, and imipenem. Mice were infected with (NDM-1)-producing K. pneumonia and multi-drug resistant Acinetobacter baumannii, and subsequently treated with TP3, TP4, or antibiotics for different periods of time (up to 168 h). Mouse survival and bacterial colony forming units (CFU) in various organs were measured after each treatment. Toxicity was determined based on observation of behavior and measurement of biochemical parameters. TP3 and TP4 exhibited strong activity against K. pneumonia and A. baumannii in vitro. Administration of TP3 (150 μg/mouse) or TP4 (50 μg/mouse) 30 min after infection with K. pneumonia or A. baumannii significantly increased survival in mice. TP4 was more effective than tigecycline at reducing CFU counts in several organs. TP3 and TP4 were shown to be non-toxic, and did not affect mouse behavior. TP3 and TP4 are able at potentiate anti-Acinetobacter baumannii or anti-Klebsiella pneumonia drug activity, reduce bacterial load, and prevent drug resistance, indicating their potential for use in combating multidrug-resistant bacteria. PMID:25874924

  11. Phytochemistry and Preliminary Assessment of the Antibacterial Activity of Chloroform Extract of Amburana cearensis (Allemo) A.C. Sm. against Klebsiella pneumoniae Carbapenemase-Producing Strains

    PubMed Central

    S, Mirivaldo Barros; Ralph, Maria Taciana; Nascimento, Danielle Cristina Oliveira; Ramos, Clcio Souza; Barbosa, Isvnia Maria Serafin; S, Fabrcio Bezerra; Lima-Filho, J. V.

    2014-01-01

    The chloroform extract of the stem bark of Amburana cearensis was chemically characterized and tested for antibacterial activity.The extract was analyzed by gas chromatography and mass spectrometry. The main compounds identified were 4-methoxy-3-methylphenol (76.7%), triciclene (3.9%), ?-pinene (1.0%), ?-pinene (2.2%), and 4-hydroxybenzoic acid (3.1%). Preliminary antibacterial tests were carried out against species of distinct morphophysiological characteristics: Escherichia coli, Salmonella enterica Serotype Typhimurium, Pseudomonas aeruginosa, Staphylococcus aureus, Listeria monocytogenes, and Bacillus cereus. The minimum inhibitory concentration (MIC) was determinate in 96-well microplates for the chloroform extract and an analogue of themain compound identified, which was purchased commercially.We have shown that plant's extract was only inhibitory (but not bactericidal) at the maximum concentration of 6900??g/mL against Pseudomonas aeruginosa and Bacillus cereus. Conversely, the analogue 2-methoxy-4-methylphenol produced MICs ranging from215 to 431??g/mL against all bacterial species.New antibacterial assays conducted with such chemical compound against Klebsiella pneumoniae carbapenemase-producing strains have shown similarMICresults and minimumbactericidal concentration (MBC) of 431??g/mL.We conclude that A. cearensis is a good source of methoxy-methylphenol compounds,which could be screened for antibacterial activity againstmultiresistant bacteria fromdifferent species PMID:24772183

  12. Characterising the biology of novel lytic bacteriophages infecting multidrug resistant Klebsiella pneumoniae

    PubMed Central

    2013-01-01

    Background Members of the genus Klebsiella are among the leading microbial pathogens associated with nosocomial infection. The increased incidence of antimicrobial resistance in these species has propelled the need for alternate/combination therapeutic regimens to aid clinical treatment. Bacteriophage therapy forms one of these alternate strategies. Methods Electron microscopy, burst size, host range, sensitivity of phage particles to temperature, chloroform, pH, and restriction digestion of phage DNA were used to characterize Klebsiella phages. Results and conclusions Of the 32 isolated phages eight belonged to the family Myoviridae, eight to the Siphoviridae whilst the remaining 16 belonged to the Podoviridae. The host range of these phages was characterised against 254 clinical Enterobacteriaceae strains including multidrug resistant Klebsiella isolates producing extended-spectrum beta-lactamases (ESBLs). Based on their lytic potential, six of the phages were further characterised for burst size, physicochemical properties and sensitivity to restriction endonuclease digestion. In addition, five were fully sequenced. Multiple phage-encoded host resistance mechanisms were identified. The Siphoviridae phage genomes (KP16 and KP36) contained low numbers of host restriction sites similar to the strategy found in T7-like phages (KP32). In addition, phage KP36 encoded its own DNA adenine methyltransferase. The ?KMV-like KP34 phage was sensitive to all endonucleases used in this study. Dam methylation of KP34 DNA was detected although this was in the absence of an identifiable phage encoded methyltransferase. The Myoviridae phages KP15 and KP27 both carried Dam and Dcm methyltransferase genes and other anti-restriction mechanisms elucidated in previous studies. No other anti-restriction mechanisms were found, e.g. atypical nucleotides (hmC or glucosyl hmC), although Myoviridae phage KP27 encodes an unknown anti-restriction mechanism that needs further investigation. PMID:23537199

  13. [Occupational exposure to airborne fungi and bacteria in a household recycled container sorting plant ].

    PubMed

    Solans, Xavier; Alonso, Rosa Mara; Constans, Angelina; Mansilla, Alfonso

    2007-06-01

    Several studies have showed an association between the work in waste treatment plants and occupational health problems such as irritation of skin, eyes and mucous membranes, pulmonary diseases, gastrointestinal problems and symptoms of organic dust toxic syndrome (ODTS). These symptoms have been related to bioaerosol exposure. The aim of this study was to investigate the occupational exposure to biological agents in a plant sorting source-separated packages (plastics materials, ferric and non-ferric metals) household waste. Airborne samples were collected with M Air T Millipore sampler. The concentration of total fungi and bacteria and gram-negative bacteria were determined and the most abundant genera were identified. The results shown that the predominant airborne microorganisms were fungi, with counts greater than 12,000 cfu/m(3) and gram-negative bacteria, with a environmental concentration between 1,395 and 5,280 cfu/m(3). In both cases, these concentrations were higher than levels obtained outside of the sorting plant. Among the fungi, the predominant genera were Penicillium and Cladosporium, whereas the predominant genera of gram-negative bacteria were Escherichia, Enterobacter, Klebsiella and Serratia. The present study shows that the workers at sorting source-separated packages (plastics materials, ferric and non-ferric metals) domestic waste plant may be exposed to airborne biological agents, especially fungi and gram-negative bacteria. PMID:17604432

  14. In vitro growth inhibition of mastitis causing bacteria by phenolics and metal chelators

    SciTech Connect

    Chew, B.P.; Tjoelker, L.W.; Tanaka, T.S.

    1985-11-01

    Antimicrobial activities of three phenolic compounds and four metal chelators were tested at 0, 250, 500, and 1000 ppm in vitro against four major mastitis-causing bacteria, Streptococcus agalactiae, Staphylococcus aureus, Klebsiella pnuemoniae, and Escherichia coli. Overall, butylated hydroxyanisole and tert-butylhydroquinone showed the greatest antimicrobial activity. These phenolics were bactericidal at 250 to 500 ppm against all four bacteria tested. The butylated hydroxytoluene was bactericidal against the gram-positive bacteria but was ineffective against the coliforms. At 250 ppm, disodium ethylenediaminetetraacetic acid was bactericidal against the gram-positive bacteria but much less effective against the gram-negatives. However, diethylene-triaminepentaacetic acid was more growth inhibitory than ethylenediaminetetraacetic acid against the gram-negative bacteria and especially against Escherichia coli. All other compounds were generally much less effective or ineffective against all four microorganisms. Therefore, butylated hydroxyanisole, butylated hydroxytoluene, tert-butylhydroquinone, ethylenediaminetetraacetic acid, and diethylenetriaminepentaacetic acid may have practical implications in the prevention or treatment of bovine mastitis.

  15. First Report of KPC-2 Carbapenemase-Producing Klebsiella pneumoniae in Japan

    PubMed Central

    Takahashi, Rieko; Sawabe, Etsuko; Koyano, Saho; Takahashi, Yutaka; Shima, Mari; Ushizawa, Hiroto; Fujie, Toshihide; Tosaka, Naoki; Kato, Yuko; Moriya, Kyoji; Tohda, Shuji; Tojo, Naoko; Koike, Ryuji; Kubota, Tetsuo

    2014-01-01

    We investigated a novel Japanese isolate of sequence type 11 (ST11), the Klebsiella pneumoniae carbapenemase-2 (KPC-2)-producing K. pneumoniae strain Kp3018, which was previously obtained from a patient treated at a Brazilian hospital. This strain was resistant to various antibiotic classes, including carbapenems, and harbored the gene blaKPC-2, which was present on the transferable plasmid of ca. 190 kb, in addition to the blaCTX-M-15 gene. Furthermore, the ca. 2.3-kb sequences (ISKpn8-blaKPC-2ISKpn6-like), encompassing blaKPC-2, were found to be similar to those of K. pneumoniae strains from China. PMID:24566171

  16. Tigecycline therapy for carbapenem-resistant Klebsiella pneumoniae (CRKP) bacteriuria leads to tigecycline resistance.

    PubMed

    van Duin, D; Cober, E D; Richter, S S; Perez, F; Cline, M; Kaye, K S; Kalayjian, R C; Salata, R A; Evans, S R; Fowler, V G; Bonomo, R A

    2014-12-01

    Carbapenem-resistant Klebsiella pneumoniae (CRKP) is an increasing global threat. Here, we describe the prevalence and impact of tigecycline use in a cohort of patients with CRKP bacteriuria nested within a multicentre, prospective study. In the 21-month study period, 260 unique patients were included. Tigecycline was given to 80 (31%) patients. The use of tigecycline during the index hospitalization was significantly associated with the subsequent development of tigecycline resistance in the same patient (OR, 6.13; 95% CI, 1.15-48.65; p0.03). In conclusion, the use of tigecycline with CRKP bacteriuria is common, and is associated with the subsequent development of tigecycline resistance. PMID:24931918

  17. Genetic profiling of Klebsiella pneumoniae: comparison of pulsed field gel electrophoresis and random amplified polymorphic DNA

    PubMed Central

    Ashayeri-Panah, Mitra; Eftekhar, Fereshteh; Ghamsari, Maryam Mobarak; Parvin, Mahmood; Feizabadi, Mohammad Mehdi

    2013-01-01

    In this study, the discriminatory power of pulsed field gel electrophoresis (PFGE) and random amplified polymorphic DNA (RAPD) methods for subtyping of 54 clinical isolates of Klebsiella pneumoniae were compared. All isolates were typeable by RAPD, while 3.6% of them were not typeable by PFGE. The repeatability of both typing methods were 100% with satisfying reproducibility (≥ 95%). Although the discriminatory power of PFGE was greater than RAPD, both methods showed sufficient discriminatory power (DI > 0.95) which reflects the heterogeneity among the K. pneumoniae isolates. An optimized RAPD protocol is less technically demanding and time consuming that makes it a reliable typing method and competitive with PFGE. PMID:24516423

  18. Complete genome sequence of endophytic nitrogen-fixing Klebsiella variicola strain DX120E

    PubMed Central

    2015-01-01

    Klebsiella variicola strain DX120E (=CGMCC 1.14935) is an endophytic nitrogen-fixing bacterium isolated from sugarcane crops grown in Guangxi, China and promotes sugarcane growth. Here we summarize the features of the strain DX120E and describe its complete genome sequence. The genome contains one circular chromosome and two plasmids, and contains 5,718,434 nucleotides with 57.1% GC content, 5,172 protein-coding genes, 25 rRNA genes, 87 tRNA genes, 7 ncRNA genes, 25 pseudo genes, and 2 CRISPR repeats. PMID:26203334

  19. Population Structure of KPC-Producing Klebsiella pneumoniae Isolates from Midwestern U.S. Hospitals

    PubMed Central

    Wright, Meredith S.; Perez, Federico; Brinkac, Lauren; Jacobs, Michael R.; Kaye, Keith; Cober, Eric; van Duin, David; Marshall, Steven H.; Hujer, Andrea M.; Rudin, Susan D.; Hujer, Kristine M.

    2014-01-01

    Genome sequencing of carbapenem-resistant Klebsiella pneumoniae isolates from regional U.S. hospitals was used to characterize strain diversity and the blaKPC genetic context. A phylogeny based on core single-nucleotide variants (SNVs) supports a division of sequence type 258 (ST258) into two distinct groups. The primary differences between the groups are in the capsular polysaccharide locus (cps) and their plasmid contents. A strict association between clade and KPC variant was found. The blaKPC gene was found on variants of two plasmid backbones. This study indicates that highly similar K. pneumoniae subpopulations coexist within the same hospitals over time. PMID:24913165

  20. Citrate substitutes for homocitrate in nitrogenase of a nifV mutant of Klebsiella pneumoniae

    SciTech Connect

    Liang, Jihong; Madden, M.; Shah, V.K.; Burris, R.H. )

    1990-09-18

    An organic acid extracted from purified dinitrogenase isolated from a nifV mutant of Klebsiella pneumoniae has been identified as citric acid. H{sub 2} evolution by the citrate-containing dinitrogenase is partially inhibited by CO, and by some substrates for nitrogenase. The response of maximum velocities to changes in pH for both the wild-type and the NifV{sup {minus}} dinitrogenase was compared. No substantial differences between the enzymes were observed, but there are minor differences. Both enzymes are stable in the pH range 4.8-10, but the enzyme activities dropped dramatically below pH 6.2.

  1. Inorganic phosphate accumulation and cadmium detoxification in Klebsiella aerogenes NCTC 418 growing in continuous culture

    SciTech Connect

    Aiking, H.; Stijnman, A.; van Garderen, C.; van Heerikhuizen, H.; van Riet, J.

    1984-02-01

    Klebsiella aerogenes NCTC-418, growing in the presence of cadmium under glucose-, sulfate-, or phosphate-limited conditions in continuous culture, exhibits two different cadmium detoxifying mechanisms. In addition to sulfide formation, increased accumulation of P/sub i/ is demonstrated as a novel mechanism. Intracellular cadmium is always quantitatively counterbalanced by a concerted increase in both inorganic sulfide and P/sub i/ contents of the cells. This led to the conclusion that production of sulfide and accumulation of P/sub i/ are detoxification mechanisms present in K. aerogenes but that their relative importance is crucially dependent on the strain and the growth conditions employed.

  2. Infection of mice by aerosols of Klebsiella pneumoniae under hyperbaric conditions.

    PubMed Central

    Heckly, R J; Chatigny, M A; Dimmick, R L

    1980-01-01

    Both the physical behavior of aerosols and survival of airborne Serratia marcescens in hyperbaric chambers with a helium-air mixture at 20 atm of pressure was approximately the same as in the system at ambient pressures. Exposure of mice to aerosols of Klebsiella pneumoniae at 1-, 2-, and 17-atm (ca. 101-, 203-, and 1,722-kPa) pressures of helium-oxygen mixture showed that the number of viable organisms constituting a 50% lethal dose was not significantly affected by the hyperbaric conditions. Images PMID:6996616

  3. Outbreak of OXA-48-Positive Carbapenem-Resistant Klebsiella pneumoniae Isolates in France▿

    PubMed Central

    Cuzon, Gaelle; Ouanich, Jocelyne; Gondret, Remy; Naas, Thierry; Nordmann, Patrice

    2011-01-01

    Seventeen Klebsiella pneumoniae isolates producing the OXA-48 carbapenemase, obtained from 10 patients hospitalized from April to June 2010, mostly in the medical intensive care unit of the Villeneuve-Saint-Georges Hospital in a suburb of Paris, France, were analyzed. Seven patients were infected, of whom five were treated at least with a carbapenem, and five patients died. Molecular analysis showed that the isolates belonged to a single clone that harbored a 70-kb plasmid carrying the blaOXA-48 gene and coproduced CTX-M-15 and TEM-1 β-lactamases. This is the first reported outbreak of OXA-48-producing K. pneumoniae isolates in France. PMID:21343451

  4. Influence of the Biliary System on Biliary Bacteria Revealed by Bacterial Communities of the Human Biliary and Upper Digestive Tracts

    PubMed Central

    Ye, Fuqiang; Shen, Hongzhang; Li, Zhen; Meng, Fei; Li, Lei; Yang, Jianfeng; Chen, Ying; Bo, Xiaochen; Zhang, Xiaofeng; Ni, Ming

    2016-01-01

    Biliary bacteria have been implicated in gallstone pathogenesis, though a clear understanding of their composition and source is lacking. Moreover, the effects of the biliary environment, which is known to be generally hostile to most bacteria, on biliary bacteria are unclear. Here, we investigated the bacterial communities of the biliary tract, duodenum, stomach, and oral cavity from six gallstone patients by using 16S rRNA amplicon sequencing. We found that all observed biliary bacteria were detectable in the upper digestive tract. The biliary microbiota had a comparatively higher similarity with the duodenal microbiota, versus those of the other regions, but with a reduced diversity. Although the majority of identified bacteria were greatly diminished in bile samples, three Enterobacteriaceae genera (Escherichia, Klebsiella, and an unclassified genus) and Pyramidobacter were abundant in bile. Predictive functional analysis indicated enhanced abilities of environmental information processing and cell motility of biliary bacteria. Our study provides evidence for the potential source of biliary bacteria, and illustrates the influence of the biliary system on biliary bacterial communities. PMID:26930491

  5. Influence of the Biliary System on Biliary Bacteria Revealed by Bacterial Communities of the Human Biliary and Upper Digestive Tracts.

    PubMed

    Ye, Fuqiang; Shen, Hongzhang; Li, Zhen; Meng, Fei; Li, Lei; Yang, Jianfeng; Chen, Ying; Bo, Xiaochen; Zhang, Xiaofeng; Ni, Ming

    2016-01-01

    Biliary bacteria have been implicated in gallstone pathogenesis, though a clear understanding of their composition and source is lacking. Moreover, the effects of the biliary environment, which is known to be generally hostile to most bacteria, on biliary bacteria are unclear. Here, we investigated the bacterial communities of the biliary tract, duodenum, stomach, and oral cavity from six gallstone patients by using 16S rRNA amplicon sequencing. We found that all observed biliary bacteria were detectable in the upper digestive tract. The biliary microbiota had a comparatively higher similarity with the duodenal microbiota, versus those of the other regions, but with a reduced diversity. Although the majority of identified bacteria were greatly diminished in bile samples, three Enterobacteriaceae genera (Escherichia, Klebsiella, and an unclassified genus) and Pyramidobacter were abundant in bile. Predictive functional analysis indicated enhanced abilities of environmental information processing and cell motility of biliary bacteria. Our study provides evidence for the potential source of biliary bacteria, and illustrates the influence of the biliary system on biliary bacterial communities. PMID:26930491

  6. Prevalence and antimicrobial susceptibility of gram-negative bacteria isolated from bovine mastitis between 2003 and 2008 in Korea.

    PubMed

    Nam, H M; Lim, S K; Kang, H M; Kim, J M; Moon, J S; Jang, K C; Kim, J M; Joo, Y S; Jung, S C

    2009-05-01

    The objective of this study was to assess trends in the prevalence and distribution of gram-negative bacteria isolated from bovine mastitis and their antimicrobial susceptibilities during a 6-yr period between 2003 and 2008 in Korea. Escherichia coli, Pseudomonas fluorescens, Klebsiella pneumoniae, Enterobacter cloacae, Acinetobacter lwoffi/junii, Pseudomonas aeruginosa, and Serratia marcescens were the most commonly observed pathogens during this period. Generally, gram-negative bacteria showed low susceptibilities to most of the antimicrobials tested in this study, except amikacin and gentamicin. Although these 2 aminoglycosides were broadly active against gram-negative bacteria, less than half of those bacteria showed susceptibilities to streptomycin. The beta-lactams, except piperacillin, had the lowest activity among antimicrobials tested in this study. Susceptibilities to chloramphenicol and trimethoprim were fairy high in all genera of gram-negative bacteria, except Acinetobacter spp. and Pseudomonas spp., whereas relatively high resistance to tetracycline was observed uniformly among gram-negative bacteria. There was no significant change in the prevalence of bacterial and the proportion of antimicrobial resistance among gram-negative bacteria isolates during a 6-yr period. PMID:19389959

  7. Alterations in peptidoglycan chemical composition associated with rod-to-sphere transition in a conditional mutant of Klebsiella pneumoniae.

    PubMed Central

    Fontana, R; Canepari, P; Satta, G

    1979-01-01

    Klebsiella pneumoniae Mir M7 is a spontaneous parentless morphology mutant which grows as cocci at pH 7 and as rods at pH 5.8. This strain has been characterized as defective in lateral wall formation (at pH7). Data suggest that the cell wall is mainly made up of poles of the rods (G. Satta, R. Fontana, P. Canepari, and G. Botta, J. Bacteriol. 137:727--734, 1979). In this work the isolation and the biochemical properties of the peptidoglycan of both Mir M7 rods and cocci and a nonconditional rod-shaped Mir M7 revertant (strain Mir A12) are described. The peptidoglycan of Mir M7 (both rods and cocci) and Mir A12 strains carried covalently bound proteins which could be easily removed by pronase treatment in Mir M7 rods and Mir A12 cells, but not in Mir M7 round cells. However, when the sodium dodecyl sulfate-insoluble residues of Mir M7 cocci were pretreated with ethylenediaminetetraacetic acid (EDTA), pronase digestion removed the covalently bound proteins, and pure peptidoglycan was obtained. EDTA treatment of the rigid layer of Mir M7 cocci removed amounts of Mg2+ and Ca2+, which were 10- and 50-fold higher, respectively, than the amount liberated from the rigid layer of Mir M7 rods and Mir A12 cells. Amino acid composition was qualitatively similar in both strains, but Mir M7 cocci contained a higher amount of alanine and glucosamine. Mir M7 cocci contained approximately 50% less peptidoglycan than rods. Under electron microscopy, the rigid layer of the Mir M7 rods and Mir A12 cells appeared to be rod-shaped and their shape remained unchanged after EDTA and pronase treatment. On the contrary, the Mir M7 cocci rigid layer appeared to be round, and after EDTA treatment it collapsed and lost any definite morphology. In spite of these alterations, the peptidoglycan of Mir M7 cocci still appeared able to determine the shape of the cell and protect it from osmotic shock and mechanical damages. The accumluation of divalent cations appeared necessary for the peptidoglycan to acquire sufficient rigidity for shape determination and cell protection. We concluded that the coccal shape in Mir M7 cells is not due to loss of cell wall rigidity but is a consequence of the formation of a round peptidoglycan molecule. The possibility that the alterations found in the Mir M7 cocci rigid layer may reflect natural differences in the biochemical composition of the septa and lateral wall of normally shaped bacteria is discussed. Images PMID:113382

  8. Epidemic potential of Escherichia coli ST131 and Klebsiella pneumoniae ST258: a systematic review and meta-analysis

    PubMed Central

    Dautzenberg, M J D; Haverkate, M R; Bonten, M J M; Bootsma, M C J

    2016-01-01

    Objectives Observational studies have suggested that Escherichia coli sequence type (ST) 131 and Klebsiella pneumoniae ST258 have hyperendemic properties. This would be obvious from continuously high incidence and/or prevalence of carriage or infection with these bacteria in specific patient populations. Hyperendemicity could result from increased transmissibility, longer duration of infectiousness, and/or higher pathogenic potential as compared with other lineages of the same species. The aim of our research is to quantitatively estimate these critical parameters for E. coli ST131 and K. pneumoniae ST258, in order to investigate whether E. coli ST131 and K. pneumoniae ST258 are truly hyperendemic clones. Primary outcome measures A systematic literature search was performed to assess the evidence of transmissibility, duration of infectiousness, and pathogenicity for E. coli ST131 and K. pneumoniae ST258. Meta-regression was performed to quantify these characteristics. Results The systematic literature search yielded 639 articles, of which 19 data sources provided information on transmissibility (E. coli ST131 n=9; K. pneumoniae ST258 n=10)), 2 on duration of infectiousness (E. coli ST131 n=2), and 324 on pathogenicity (E. coli ST131 n=285; K. pneumoniae ST258 n=39). Available data on duration of carriage and on transmissibility were insufficient for quantitative assessment. In multivariable meta-regression E. coli isolates causing infection were associated with ST131, compared to isolates only causing colonisation, suggesting that E. coli ST131 can be considered more pathogenic than non-ST131 isolates. Date of isolation, location and resistance mechanism also influenced the prevalence of ST131. E. coli ST131 was 3.2 (95% CI 2.0 to 5.0) times more pathogenic than non-ST131. For K. pneumoniae ST258 there were not enough data for meta-regression assessing the influence of colonisation versus infection on ST258 prevalence. Conclusions With the currently available data, it cannot be confirmed nor rejected, that E. coli ST131 or K. pneumoniae ST258 are hyperendemic clones. PMID:26988349

  9. A trial with IgY chicken antibodies to eradicate faecal carriage of Klebsiella pneumoniae and Escherichia coli producing extended-spectrum beta-lactamases

    PubMed Central

    Jonsson, Anna-Karin; Larsson, Anders; Tängdén, Thomas; Melhus, Åsa; Lannergård, Anders

    2015-01-01

    Background Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae is an emerging therapeutic challenge, especially in the treatment of urinary tract infections. Following an outbreak of CTX-M-15 Klebsiella pneumoniae in Uppsala, Sweden, an orphan drug trial on IgY chicken antibodies was undertaken in an attempt to eradicate faecal carriage of ESBL-producing K. pneumoniae and Escherichia coli. Methods Hens were immunised with epitopes from freeze-dried, whole-cell bacteria (ESBL-producing K. pneumoniae and E. coli) and recombinant proteins of two K. pneumoniae fimbriae subunits (fimH and mrkD). The egg yolks were processed according to good manufacturing practice and the product was stored at−20°C until used. Using an internal database from the outbreak and the regular laboratory database, faecal carriers were identified and recruited from May 2005 to December 2013. The participants were randomised in a placebo-controlled 1:1 manner. Results From 749 eligible patients, 327 (44%) had deceased, and only 91 (12%) were recruited and signed the informed consent. In the initial screening performed using the polymerase chain reaction, 24 participants were ESBL positive and subsequently randomised and treated with either the study drug or a placebo. The study was powered for 124 participants. Because of a very high dropout rate, the study was prematurely terminated. From the outbreak cohort (n=247), only eight patients were screened, and only one was positive with the outbreak strain in faeces. Conclusions The present study design, using IgY chicken antibodies for the eradication of ESBL-producing K. pneumonia and E. coli, was ineffective in reaching its goal due to high mortality and other factors resulting in a low inclusion rate. Spontaneous eradication of ESBL-producing bacteria was frequently observed in recruited participants, which is consistent with previous reports. PMID:26560861

  10. The plant-growth-promoting bacterium Klebsiella sp. SBP-8 confers induced systemic tolerance in wheat (Triticum aestivum) under salt stress.

    PubMed

    Singh, Rajnish Prakash; Jha, Prameela; Jha, Prabhat Nath

    2015-07-20

    Plant-growth-promoting bacteria (PGPB) with 1-aminocyclopropane-1-carboxylatedeaminase (ACCD) activity can protect plants from the deleterious effects of abioticstressors. An ACCD bacterial strain, SBP-8, identified as Klebsiella sp., also having other plant-growth-promoting activities, was isolated from Sorghum bicolor growing in the desertregion of Rajasthan, India. ACCD activity of SBP-8 was characterized at biochemical, physiological, and molecular levels. The presence of AcdS, a structural gene for ACCD, was confirmed by the polymerase chain reaction. Strain SBP-8 showed optimum growth and ACCD activity at increased salt (NaCl) concentrations of up to 6%, indicating its potential to survive and associate with plants growing in saline soil. Inoculation of wheat plants with SBP-8 when grow in the presence of salt (150-200 mM) and temperature (30-40 °C) stressors resulted inamelioration of stress conditions by increasing plant biomass and chlorophyll content, and are duction in plant growth inhibition (10-100%) occurred due to salt and temperature stressors. Moreover, strain SBP-8 also caused Na(+) exclusion (65%) and increased uptake of K(+) (84.21%) in the host plant. This property can protect plants from adverse effects of Na(+) on plant growth and physiology. Thus, SBP-8 improves growth of the host plant and protects from salt stressors through more than one mechanism including an effect of ACCD activity and on K(+)/Na(+) ratio in plants. The colonization efficiency of strain SBP-8 was confirmedby CFU (colony-forming unit) count, microscopy, and ERIC-PCR based DNA-finger-printing approach. Therefore, and the use of efficient colonizing plant-growth-promoting bacteria may provideinsights into possible biotechnological approaches to decrease the impact of salinity and other stressors. PMID:26217911

  11. Lemierre's Syndrome Caused by Klebsiella pneumoniae in a Diabetic Patient: A Case Report and Review of the Literature

    PubMed Central

    Chuncharunee, Alan

    2015-01-01

    Lemierre's syndrome is characterized by an oropharyngeal infection with internal jugular vein thrombosis followed by metastatic infections in other organs. This infection is usually caused by Fusobacterium spp. In this report, we present a rare case of Klebsiella pneumoniae-associated Lemierre's syndrome in a patient with poorly-controlled diabetes mellitus. The infection was complicated by septic emboli in many organs, which led to the patient's death, despite combined antibiotics, anticoagulant therapy, and surgical intervention. Therein, a literature review was performed for reported cases of Lemierre's syndrome caused by Klebsiella pneumoniae and the results are summarized here. PMID:26279962

  12. Risk Factor Analysis in Clinical Isolates of ESBL and MBL (Including NDM-1) Producing Escherichia coli and Klebsiella Species in a Tertiary Care Hospital

    PubMed Central

    Dutta, Renu; Saxena, Sonal; Singhal, Smita

    2015-01-01

    Background Extended-spectrum ?-lactamase (ESBL) and metallo-?-lactamase (MBL) producing Gram negative organisms are emerging as a worldwide public health concern. Aim To elucidate risk factors for infection with ESBL and MBL (also NDM-1) producing E. coli and Klebsiella spp. Materials and Methods A prospective observational study was conducted from November 2010 to March 2012. ESBL production was detected using ESBL E-test, MBL by MBL E-test and NDM-1 by polymerase chain reaction (PCR). Risk factors analysed includes age, sex, clinical specimen, type of infection, duration of hospital stay prior to collection of sample, admitting ward, antimicrobial susceptibility, previous antibiotics used, co-morbid illnesses like diabetes mellitus, immunodeficiency, low birth weight, respiratory/neurological/cardiac/haematological/liver diseases, malignancy, urinary or central venous catheter, ventilatory support, surgical procedures and dialysis. Statistical analysis z-test or Fishers exact test. Results E. coli ESBL producing isolates E. coli revealed female preponderance, equal incidence of hospital and community acquired infections, mostly from surgical wards, isolated from urine, age group among females >20-30 years and among males >28 days-1 year. They showed high resistance to cephalosporins, monobactam, penicillin but low resistance to carbapenems and aminoglycosides. Co-morbid conditions observed were surgery, urinary catheterisation, haematological disease, ventilatory support, diabetes mellitus and neurological disease. MBL producing strains were mainly from females, surgical wards, (including both NDM-1 isolates), hospital acquired infections, isolated from body fluids (NDM-1 positive), female genital tract specimen and urine (one NDM-1 positive). NDM-1 positive isolates belonged to age groups >5-10 year and >0-28 days and underwent surgery and urinary catheterisation. Klebsiella spp.- ESBL producing isolates showed female preponderance, hospital acquired infections, from surgical wards, high resistance levels to cephalosporins, fluoroquinolones, monobactam, but low levels to carbapenems, among males isolated from pus in age group >0-28 days and >28 days -1 year and among females from urine in >20-30 years, no significant difference when correlated with risk factors. MBL (NDM-1) producing isolates were mainly from females with age range 0 days to 70 years, mainly admitted to ICU/postoperative wards with urinary catheter in-situ, ventilatory support, surgery, diabetes mellitus, haematological and neurological disease. Conclusion Risk factors for infections due to ESBL and MBL producing Gram Negative Bacteria (GNB) should be clearly identified to reduce their spread and to optimise antibiotic use. PMID:26675893

  13. Genetic analysis of capsular polysaccharide synthesis gene clusters in 79 capsular types of Klebsiella spp

    PubMed Central

    Pan, Yi-Jiun; Lin, Tzu-Lung; Chen, Chun-Tang; Chen, Yi-Yin; Hsieh, Pei-Fang; Hsu, Chun-Ru; Wu, Meng-Chuan; Wang, Jin-Town

    2015-01-01

    A total of 79 capsular types have been reported in Klebsiella spp., whereas capsular polysaccharide synthesis (cps) regions were available in only 22 types. Due to the limitations of serotyping, complete repertoire of cps will be helpful for capsular genotyping. We therefore resolved the rest 57 cps and conducted comparative analysis. Clustering results of 1,515 predicted proteins from cps loci categorized proteins which share similarity into homology groups (HGs) revealing that 77 Wzy polymerases were classified into 56 HGs, which indicate the high specificity of wzy between different types. Accordingly, wzy-based capsular genotyping could differentiate capsule types except for those lacking wzy (K29 and K50), those sharing identical wzy (K22 vs. K37); and should be carefully applied in those exhibited high similarity (K12 vs. K41, K2 vs. K13, K74 vs. K80, K79 vs. KN1 and K30 vs. K69). Comparison of CPS structures in several capsular types that shared similarity in their gene contents implies possible functions of glycosyltransferases. Therefore, our results provide complete set of cps in various types of Klebsiella spp., which enable the understandings of relationship between genes and CPS structures and are useful for identification of documented or new capsular types. PMID:26493302

  14. Biosorption of Cadmium and Manganese Using Free Cells of Klebsiella sp. Isolated from Waste Water

    PubMed Central

    Hou, Yunnan; Cheng, Keke; Li, Zehua; Ma, Xiaohui; Wei, Yahong; Zhang, Lei; Wang, Yao

    2015-01-01

    In the present study, we evaluated a bacterium that was isolated from waste water for its ability to take up cadmium and manganese. The strain, identified both biochemically and by its 16S rRNA gene sequence as Klebsiella, was named Yangling I2 and was found to be highly resistant to heavy metals. Surface characterization of the bacterium via SEM revealed gross morphological changes, with cells appearing as biconcave discs after metal exposure rather than their typical rod shape. The effects of pH, temperature, heavy metal concentration, agitation and biomass concentration on the uptake of Cd(II) and Mn(II) was measured using atomic absorption spectrophotometry. The results showed that the biosorption was most affected by pH and incubation temperature, being maximized at pH 5.0 and 30°C, with absorption capacities of 170.4 and 114.1 mg/g for Cd(II) and Mn(II), respectively. Two models were investigated to compare the cells’ capacity for the biosorption of Cd and Mn, and the Langmuir model based on fuzzy linear regression was found to be close to the observed absorption curves and yield binding constants of 0.98 and 0.86 for Cd and Mn, respectively. This strain of Klebsiella has approximately ten times the absorption capacity reported for other strains and is promising for the removal of heavy metals from waste water. PMID:26505890

  15. Genetic and molecular properties of an infectious antibiotic resistance (R) factor isolated from Klebsiella.

    PubMed

    Iyer, R V; Iyer, V N

    1969-11-01

    A Klebsiella strain of human origin that was resistant to ampicillin, chloramphenicol, kanamycin, neomycin, streptomycin, and tetracycline was found to have all of these resistances associated with a R factor and a satellite molecular species of deoxyribonucleic acid (DNA) with an average buoyant density of 1.710 in cesium chloride gradients. There was no evidence of the existence of DNA with other buoyant densities. The strain bears two separable mutations for chloramphenicol resistance, both of which are associated with the R factor (KR9). Exposure of the Klebsiella strain to acridine derivatives or to ethidium bromide (which was more efficient) resulted in partial losses of resistance accompanied by the disappearance of the satellite DNA peak or shifts in its density. The R factor and its component genes were conjugally transmitted across generic boundaries and maintained in new hosts with different efficiencies. The basis of this difference lies not only in the efficiency of conjugal transfer but also in the stability of the components after transfer. All of the resistance genes and the resistance transfer factor were cotransducible by phage Plkc from Escherichia coli. Partially resistant strains could be reconstituted to full resistance or to a recombined pattern of partial resistance by conjugation with donors having complementary resistance patterns. This recombination serves as an efficient mechanism for rescuing superinfecting genes that are otherwise intracellularly excluded. KR9 is an fi(+) type of R factor which in the natural state does not appear to be as repressed in conjugal transfer as other R factors. PMID:4901355

  16. PATHOGENICITY OF BIOFILM BACTERIA

    EPA Science Inventory

    There is a paucity of information concerning any link between the microorganisms commonly found in biofilms of drinking water systems and their impacts on human health. For bacteria, culture-based techniques detect only a limited number of the total microorganisms associated wit...

  17. Aquatic Bacteria Samples

    USGS Multimedia Gallery

    On April 20, 2010, the BP Deepwater Horizon drilling platform collapsed and sank in the Gulf of Mexico, causing one of the largest oil spills in history. One of the big dilemmas in responding to the oil spil is how to clean up the oil itself. One way currently under research is to use bacteria that ...

  18. Antibiotic-Resistant Bacteria.

    ERIC Educational Resources Information Center

    Longenecker, Nevin E.; Oppenheimer, Dan

    1982-01-01

    A study conducted by high school advanced bacteriology students appears to confirm the hypothesis that the incremental administration of antibiotics on several species of bacteria (Escherichia coli, Staphylococcus epidermis, Bacillus sublitus, Bacillus megaterium) will allow for the development of antibiotic-resistant strains. (PEB)

  19. Communication among Oral Bacteria

    PubMed Central

    Kolenbrander, Paul E.; Andersen, Roxanna N.; Blehert, David S.; Egland, Paul G.; Foster, Jamie S.; Palmer, Robert J.

    2002-01-01

    Human oral bacteria interact with their environment by attaching to surfaces and establishing mixed-species communities. As each bacterial cell attaches, it forms a new surface to which other cells can adhere. Adherence and community development are spatiotemporal; such order requires communication. The discovery of soluble signals, such as autoinducer-2, that may be exchanged within multispecies communities to convey information between organisms has emerged as a new research direction. Direct-contact signals, such as adhesins and receptors, that elicit changes in gene expression after cell-cell contact and biofilm growth are also an active research area. Considering that the majority of oral bacteria are organized in dense three-dimensional biofilms on teeth, confocal microscopy and fluorescently labeled probes provide valuable approaches for investigating the architecture of these organized communities in situ. Oral biofilms are readily accessible to microbiologists and are excellent model systems for studies of microbial communication. One attractive model system is a saliva-coated flowcell with oral bacterial biofilms growing on saliva as the sole nutrient source; an intergeneric mutualism is discussed. Several oral bacterial species are amenable to genetic manipulation for molecular characterization of communication both among bacteria and between bacteria and the host. A successful search for genes critical for mixed-species community organization will be accomplished only when it is conducted with mixed-species communities. PMID:12209001

  20. Bacteria-surface interactions

    PubMed Central

    Tuson, Hannah H.; Weibel, Douglas B.

    2013-01-01

    The interaction of bacteria with surfaces has important implications in a range of areas, including bioenergy, biofouling, biofilm formation, and the infection of plants and animals. Many of the interactions of bacteria with surfaces produce changes in the expression of genes that influence cell morphology and behavior, including genes essential for motility and surface attachment. Despite the attention that these phenotypes have garnered, the bacterial systems used for sensing and responding to surfaces are still not well understood. An understanding of these mechanisms will guide the development of new classes of materials that inhibit and promote cell growth, and complement studies of the physiology of bacteria in contact with surfaces. Recent studies from a range of fields in science and engineering are poised to guide future investigations in this area. This review summarizes recent studies on bacteria-surface interactions, discusses mechanisms of surface sensing and consequences of cell attachment, provides an overview of surfaces that have been used in bacterial studies, and highlights unanswered questions in this field. PMID:23930134

  1. Draft Genome Sequences of Two Multidrug-Resistant Extended-Spectrum-?-Lactamase-Producing Klebsiella pneumoniae Strains Causing Bloodstream Infections.

    PubMed

    Carasso, Eran; Salmon-Divon, Mali; Carmeli, Yehuda; Banin, Ehud; Navon-Venezia, Shiri

    2016-01-01

    Multidrug-resistant (MDR) Klebsiella pneumoniae has become a major contributor to nosocomial bloodstream infections. Here, we report the draft genome sequences of two MDR extended-spectrum-?-lactamase-producing strains causing bloodstream infections. These sequenced genomes display a wide-spectrum virulence arsenal and will help us understand the genomic basis of K.pneumoniae virulence. PMID:26798092

  2. Draft Genome Sequences of Two Multidrug-Resistant Extended-Spectrum-β-Lactamase-Producing Klebsiella pneumoniae Strains Causing Bloodstream Infections

    PubMed Central

    Carasso, Eran; Salmon-Divon, Mali; Carmeli, Yehuda; Banin, Ehud

    2016-01-01

    Multidrug-resistant (MDR) Klebsiella pneumoniae has become a major contributor to nosocomial bloodstream infections. Here, we report the draft genome sequences of two MDR extended-spectrum-β-lactamase-producing strains causing bloodstream infections. These sequenced genomes display a wide-spectrum virulence arsenal and will help us understand the genomic basis of K. pneumoniae virulence. PMID:26798092

  3. Emerging K1 serotype Klebsiella pneumoniae primary liver abscess: three cases presenting to a single university hospital in Norway

    PubMed Central

    Holms, Kristoffer; Fostervold, Aasmund; Stahlhut, Steen Gustav; Struve, Carsten; Holter, Jan Cato

    2014-01-01

    Key Clinical Message Community-acquired Klebsiella pneumoniae primary liver abscess (KLA) has been emerging worldwide over the past two decades and with high incidence in Asia. The presence of specific virulence characteristics is a risk factor for a syndrome with metastatic complications. This report signals an increasing emergence in Northern Europe. PMID:25356268

  4. Genome Sequence of a Klebsiella pneumoniae Sequence Type 258 Isolate with Prophage-Encoded K. pneumoniae Carbapenemase

    PubMed Central

    Chen, Liang; Chavda, Kalyan D.; DeLeo, Frank R.; Bryant, Kendall A.; Jacobs, Michael R.; Bonomo, Robert A.

    2015-01-01

    We present the draft genome sequence of a Klebsiella pneumoniae carbapenemase (KPC)-producing sequence type 258 (ST258) K. pneumoniae strain, ST258_FL. Uniquely, strain ST258_FL harbors two copies of the blaKPC gene on the chromosome, one of which is integrated into a prophage. PMID:26089425

  5. Genome Sequence of Klebsiella pneumoniae CICC10011, a Promising Strain for High 2,3-Butanediol Production.

    PubMed

    Tong, Ying-Jia; Ji, Xiao-Jun; Liu, Lu-Gang; Shen, Meng-Qiu; Huang, He

    2015-01-01

    Klebsiellapneumoniae CICC10011, a promising 2,3-butanediol producer, has received much attention because of its high productivity. Here, the first draft genome sequence of this efficient strain may provide the genetic basis for further insights into the metabolic and regulatory mechanisms underlying the production of 2,3-butanediol at a high titer. PMID:26205860

  6. Draft Genome Sequences of Four NDM-1-Producing Klebsiella pneumoniae Strains from a Health Care Facility in Northern California

    PubMed Central

    Greninger, Alexander L.; Chorny, Ilya; Knowles, Susan; Ng, Valerie L.

    2015-01-01

    We report the draft genome sequences of Klebsiella pneumoniae strains from four patients at a northern California health care facility. All strains contained the New Delhi metallo-?-lactamase (NDM1) carbapenemase with extended antibiotic resistance, including resistance to expanded-spectrum cephalosporins, imipenem, ertapenem, and meropenem. NDM gene alignments revealed that the resistance was plasmid encoded. PMID:25977423

  7. Complete Genome Sequence of Klebsiella pneumoniae Strain HKUOPLC, a Cellulose-Degrading Bacterium Isolated from Giant Panda Feces.

    PubMed

    Lu, Matthew Guan-Xi; Jiang, Jingwei; Liu, Lirui; Ma, Angel Po-Yee; Leung, Frederick Chi-Ching

    2015-01-01

    We report here the complete genome sequence of Klebsiella pneumoniae strain HKUOPLC, isolated from a giant panda fecal sample collected from Ocean Park, Hong Kong. The complete genome of this bacterium may contribute to the discovery of efficient cellulose-degrading pathways. PMID:26564041

  8. Complete Genome Sequence of Klebsiella variicola Strain HKUOPLA, a Cellulose-Degrading Bacterium Isolated from Giant Panda Feces

    PubMed Central

    Lu, Matthew Guan-Xi; Jiang, Jingwei; Liu, Lirui; Ma, Angel Po-Yee

    2015-01-01

    We report here the complete genome sequence of Klebsiella variicola strain HKUOPLA, isolated from a giant panda feces sample collected from Ocean Park, Hong Kong. The complete genome of this bacterium may contribute toward the discovery of efficient cellulose-degrading pathways. PMID:26472841

  9. Identification of putative plant pathogenic determinants from a draft genome sequence of an opportunistic klebsiella pneumoniae strain

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Klebsiella pneumoniae has been known historically as a causal agent of bacterial pneumonia. More recently, K. pneumoniaerepresentatives have been shown to have a broad ecological distribution and are recognized nitrogen-fixers. Previously, we demonstrated the capacity of K. pneumoniae strain Kp 5-1R...

  10. Draft Genome Sequence of an NDM-5-Producing Klebsiella pneumoniae Sequence Type 14 Strain of Serotype K2.

    PubMed

    Liu, Pan-Pan; Liu, Yang; Wang, Lian-Hui; Wei, Dan-Dan; Wan, La-Gen

    2016-01-01

    We report here the draft genome sequence of uropathogenic Klebsiella pneumoniae sequence type 14 strain of serotype K2 possessing blaNDM-5, isolated from a 65-year-old male in China without a history of travel abroad. PMID:26988061

  11. Destruction of single-species biofilms of Escherichia coli or Klebsiella pneumoniae subsp. pneumoniae by dextranase, lactoferrin, and lysozyme

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The activity of dextranase, lactoferrin, lysozyme, and nisin against biofilms composed of either Klebsiella pneumonia or Escherichia coli was examined using the MBEC Assay™. Mature biofilms were treated and then sonicated to remove the adherent biofilm. This material was quantified using a lumines...

  12. Draft Genome Sequence of an NDM-5-Producing Klebsiella pneumoniae Sequence Type 14 Strain of Serotype K2

    PubMed Central

    Liu, Pan-pan; Wang, Lian-hui; Wei, Dan-dan; Wan, La-Gen

    2016-01-01

    We report here the draft genome sequence of uropathogenic Klebsiella pneumoniae sequence type 14 strain of serotype K2 possessing blaNDM-5, isolated from a 65-year-old male in China without a history of travel abroad. PMID:26988061

  13. Nucleotide sequence of a plasmid-mediated cephalosporinase gene (blaLAT-1) found in Klebsiella pneumoniae.

    PubMed Central

    Tzouvelekis, L S; Tzelepi, E; Mentis, A F

    1994-01-01

    The nucleotide sequence of the gene encoding a novel cephalosporinase (LAT-1), carried by a non-self-transferable plasmid from Klebsiella pneumoniae, has been determined. It was found that the sequence shares a high degree of homology with the Citrobacter freundii OS60 ampC structural gene. PMID:7811049

  14. First Outbreak of KPC-2-Producing Klebsiella pneumoniae Sequence Type 258 in a Hospital in South Korea

    PubMed Central

    Hong, Sung Kwan; Yong, Dongeun; Kim, Kyeongmi; Hong, Sang Sook; Khosbayar, Tulgaa; Song, Wonkeun; Roh, Kyoung Ho; Jeong, Seok Hoon; Lee, Kyungwon; Chong, Yunsop

    2013-01-01

    In this study, we report the first outbreak of KPC-2-producing Klebsiella pneumoniae isolates from three patients admitted to a neurosurgery department in a South Korean teaching hospital. Multilocus sequence typing showed that the isolates were identical to the previous KPC producers in South Korea and other countries, suggesting clonal spread. PMID:24006005

  15. Occurrence of Multidrug Resistant Extended Spectrum Beta-Lactamase-Producing Bacteria on Iceberg Lettuce Retailed for Human Consumption

    PubMed Central

    Talreja, Deepa; Rana, Sonia Walia; Walia, Sandeep; Walia, Satish K.

    2015-01-01

    Antibiotic resistance in bacteria is a global problem exacerbated by the dissemination of resistant bacteria via uncooked food, such as green leafy vegetables. New strains of bacteria are emerging on a daily basis with novel expanded antibiotic resistance profiles. In this pilot study, we examined the occurrence of antibiotic resistant bacteria against five classes of antibiotics on iceberg lettuce retailed in local convenience stores in Rochester, Michigan. In this study, 138 morphologically distinct bacterial colonies from 9 iceberg lettuce samples were randomly picked and tested for antibiotic resistance. Among these isolates, the vast majority (86%) demonstrated resistance to cefotaxime, and among the resistant bacteria, the majority showed multiple drug resistance, particularly against cefotaxime, chloramphenicol, and tetracycline. Three bacterial isolates (2.17%) out of 138 were extended spectrum beta-lactamase (ESBL) producers. Two ESBL producers (T1 and T5) were identified as Klebsiella pneumoniae, an opportunistic pathogen with transferable sulfhydryl variable- (SHV-) and TEM-type ESBLs, respectively. The DNA sequence analysis of the blaSHV detected in K. pneumoniae isolate T1 revealed 99% relatedness to blaSHV genes found in clinical isolates. This implies that iceberg lettuce is a potential reservoir of newly emerging and evolving antibiotic resistant bacteria and its consumption poses serious threat to human health. PMID:26064922

  16. Bactericidal effects of sugar-fed antibiotics on resident midgut bacteria of newly emerged anopheline mosquitoes (Diptera: Culicidae).

    PubMed

    Tour, A M; Mackey, A J; Wang, Z X; Beier, J C

    2000-03-01

    A protocol was developed for significantly reducing resident midgut bacteria in newly emerged anopheline mosquitoes using a combination of antibiotics. Pupa harvested from colony-reared Anopheles gambiae s.l. Giles and Anopheles stephensi (Liston) were placed in cages wiped previously with 70% alcohol and kept under UV light for 24 h. Emerging adult mosquitoes were fed for 3 consecutive days on antibiotic solution, consisting of 0.4% gentamicin sulfate and 1% penicillin-streptomycin solution in a 10% sterile sucrose solution. Bacterial suspensions of Escherichia coli, Klebsiella pneumoniae (Schroeter, 1886), and Pseudomonas stutzeri (Lehmann & Neumann, 1896) isolated from wild-caught anophelines were fed to antibiotic-treated mosquitoes starved for 24 h via either sugar or membrane-feeding. Mosquitoes dissected 1 and 24 h after blood-feeding or sugar-feeding, and plated on trypticase soy agar plates, yielded the same type of bacteria fed originally without evidence of contaminants. There was no residual effect of the antibiotics on introduced single bacteria strains as judged by the presence of bacteria in antibiotic-treated mosquitoes. This experimental reduction of resident midgut bacteria and their replacement with single strains in newly emerged anopheline mosquitoes should facilitate further investigations of the interactions between malaria parasites and bacteria found in the midguts of mosquitoes. PMID:10730495

  17. Bacteria associated with crabs from cold waters with emphasis on the occurrence of potential human pathogens.

    PubMed Central

    Faghri, M A; Pennington, C L; Cronholm, L S; Atlas, R M

    1984-01-01

    A diverse array of bacterial species, including several potential human pathogens, was isolated from edible crabs collected in cold waters. Crabs collected near Kodiak Island, Alaska, contained higher levels of bacteria than crabs collected away from regions of human habitation. The bacteria associated with the crabs collected near Kodiak included Yersinia enterocolitica, Klebsiella pneumoniae, and coagulase-negative Staphylococcus species; the pathogenicity of these isolates was demonstrated in mice. Although coliforms were not found, the bacterial species associated with the tissues of crabs collected near Kodiak indicate possible fecal contamination that may have occurred through contact with sewage. Compared with surrounding waters and sediments, the crab tissues contained much higher proportions of gram-positive cocci. As revealed by indirect plate counts and direct scanning electron microscopic observations, muscle and hemolymph tissues contained much lower levels of bacteria than shell and gill tissues. After the death of a crab, however, the numbers of bacteria associated with hemolymph and muscle tissues increased significantly. Microcosm studies showed that certain bacterial populations, e.g., Vibrio cholerae, can be bioaccumulated in crab gill tissues. The results of this study indicate the need for careful review of waste disposal practices where edible crabs may be contaminated with microorganisms that are potential human pathogens and the need for surveillance of shellfish for pathogenic microorganisms that naturally occur in marine ecosystems. Images PMID:6742824

  18. Transfer of antibiotic multiresistant plasmid RP4 from escherichia coli to activated sludge bacteria.

    PubMed

    Soda, Satoshi; Otsuki, Hidetaka; Inoue, Daisuke; Tsutsui, Hirofumi; Sei, Kazunari; Ike, Michihiko

    2008-09-01

    In situ transfer of a self-transmissible, antibiotic-multiresistant plasmid RP4 from a laboratory Escherichia coli strain C600 to indigenous activated sludge bacteria was investigated using filter mating. The transfer frequency of RP4 from the donor E. coli to the bacteria that was sampled from two wastewater treatment plants was 5.1x10(-2) to 7.5x10(-1) and 4.6x10(-3) to 1.3x10(-2)/potential recipient. The isolated transconjugants showed resistance to Ap, Km, and Tc and the presence of a plasmid with a similar size to RP4. The traG gene on RP4 was also detected from all transconjugants. Reverse-transfer experiments from the transconjugants to E. coli HB101 indicated that RP4 maintained self-transmissibility in the transconjugants. The transconjugant strains were dominant bacteria in activated sludge including Pseudomonas fluorescens, P. putida, and Ochrobactrum anthropi and minor populations of enteric bacterial strains including Citrobacter freundii, E. coli, Enterobacter cloacae, E. asburiae, and Klebsiella pneumoniae ssp. pneumoniae. The transconjugant strains K. pneumoniae ssp. pneumonia, E. cloacae, and E. asburiae had several naturally occurring plasmids. These results suggest that in situ transfer of plasmids and the exchange of antibiotic-resistant genes can occur between released and indigenous bacteria in activated sludge. PMID:18930008

  19. Differential effects of catecholamines on in vitro growth of pathogenic bacteria

    NASA Technical Reports Server (NTRS)

    Belay, Tesfaye; Sonnenfeld, Gerald

    2002-01-01

    Supplementation of minimal medium inoculated with bacterial cultures with norepinephrine, epinephrine, dopamine, or isoproterenol resulted in marked increases in growth compared to controls. Norepinephrine and dopamine had the greatest enhancing effects on growth of cultures of Pseudomonas aeruginosa and Klebsiella pneumoniae, while epinephrine and isoproterenol also enhanced growth to a lesser extent. The growth of Escherichia coli in the presence of norepinephrine was greater than growth in the presence of the three other neurochemicals used in the study. Growth of Staphylococcus aureus was also enhanced in the presence of norepinephrine, but not to the same degree as was the growth of gram negative bacteria. Addition of culture supernatants from E. coli cultures that had been grown in the presence of norepinephrine was able to enhance the growth of K. pneumoniae. Addition of the culture supernatant fluid culture from E. coli cultures that had been grown in the presence of norepinephrine did not enhance growth of P. aeruginosa or S. aureus. Culture supernatant fluids from bacteria other than E. coli grown in the presence of norepinephrine were not able to enhance the growth of any bacteria tested. The results suggest that catecholamines can enhance growth of pathogenic bacteria, which may contribute to development of pathogenesis; however, there is no uniform effect of catecholamines on bacterial growth.

  20. Risk factors and outcomes of carbapenem-resistant Klebsiella pneumoniae infections in liver transplant recipients.

    PubMed

    Pereira, Marcus R; Scully, Brendan F; Pouch, Stephanie M; Uhlemann, Anne-Catrin; Goudie, Stella; Emond, Jean E; Verna, Elizabeth C

    2015-12-01

    Carbapenem-resistant Klebsiella pneumoniae (CRKP) infection is increasing in incidence and is associated with increased mortality in liver transplantation (LT) recipients. We performed a retrospective cohort study of all patients transplanted between January 2010 and January 2013 to identify the incidence and risk factors for post-LT CRKP infection and evaluate the impact of this infection on outcomes in a CRKP-endemic area. We studied 304 recipients, of whom 20 (6.6%) developed CRKP and 36 (11.8%) carbapenem-susceptible Klebsiella pneumoniae (CSKP) infections in the year following LT. Among the 20 recipients with post-LT CRKP infection, 8 (40%) were infected in ? 2 sites; 13 (65%) had surgical site-intra-abdominal infections; 12 (60%) had pneumonia; and 3 (15%) had a urinary tract infection. There were 6 patients with a CRKP infection before LT, 5 of whom developed a CRKP infection after LT. Significant risk factors for post-LT CRKP infection in multivariate analysis included laboratory Model for End-Stage Liver Disease at LT (odds ratio [OR], 1.07; P = 0.001), hepatocellular carcinoma (OR, 3.19; P = 0.02), Roux-en-Y biliary choledochojejunostomy (OR, 3.15; P = 0.04), and bile leak (OR, 5.89; P = 0.001). One-year estimated patient survival was 55% (95% confidence interval, 31%-73%), 72% (55%-84%), and 93% (89%-96%), for patients with CRKP, CSKP, and no Klebsiella pneumoniae infection, respectively. In multivariate analysis, CRKP (hazard ratio [HR], 6.92; P < 0.001) and CSKP infections (CSKP, HR, 3.84; P < 0.001), as well as bile leak (HR, 2.10; P = 0.03) were the strongest predictors of post-LT mortality. In an endemic area, post-LT CRKP infection is common, occurring in 6.6% of recipients, and is strongly associated with post-LT mortality. Improved strategies for screening and prevention of CRKP infection are urgently needed. Liver Transpl 21:1511-1519, 2015. 2015 AASLD. PMID:26136397