Sample records for klebsiella oxytoca bacteria

  1. Distribution of amine oxidases and amine dehydrogenases in bacteria grown on primary arnines and characterization of the arnine oxidase f rom Klebsiella oxytoca

    Microsoft Academic Search

    Ayse Hacisalihoglu; Jaap A. Jongejan; Johannis A. Duine

    1997-01-01

    The bacteria Klebsiella oxytoca LMD 72.65 (ATCC 8724), Arthrobacter P1 LMD 81.60 (NCIB 11625), Paracoccus versutus LMD 80.62 (ATCC 25364), Escherichia coli W LMD 50.28 (ATCC 9637), E. coli K12 LMD 93.68, Pseudomonas aeruginosa PAO1 LMD 89.1 (ATCC 17933) and Pseudomonas putida LMD 68.20 (ATCC 12633) utilized primary amines as a carbon and energy source, although the range of amines

  2. Cytotoxic and Pathogenic Properties of Klebsiella oxytoca Isolated from Laboratory Animals

    E-print Network

    Darby, Alison

    Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin ...

  3. Anaerobic degradation of malonate via malonyl-CoA by Sporomusa malonica, Klebsiella oxytoca, and Rhodobacter capsulatus.

    PubMed

    Dehning, I; Schink, B

    1994-01-01

    Anaerobic decarboxylation of malonate to acetate was studied with Sporomusa malonica, Klebsiella oxytoca, and Rhodobacter capsulatus. Whereas S. malonica could grow with malonate as sole substrate (Y = 2.0 g.mol-1), malonate decarboxylation by K. oxytoca was coupled with anaerobic growth only in the presence of a cosubstrate, e.g. sucrose or yeast extract (Ys = 1.1-1.8 g.mol malonate-1). R. capsulatus used malonate anaerobically only in the light, and growth yields with acetate and malonate were identical. Malonate decarboxylation in cell-free extracts of all three bacteria was stimulated by catalytic amounts of malonyl-CoA, acetyl-CoA, or Coenzyme A plus ATP, indicating that actually malonyl-CoA was the substrate of decarboxylation. Less than 5% of malonyl-CoA decarboxylase activity was found associated with the cytoplasmic membrane. Avidin (except for K. oxytoca) and hydroxylamine inhibited the enzyme completely, EDTA inhibited partially. In S. malonica and K. oxytoca, malonyl-CoA decarboxylase was active only after growth with malonate; malonyl-CoA: acetate CoA transferase was found as well. These results indicate that malonate fermentation by these bacteria proceeds via malonyl-CoA mediated by a CoA transferase and that subsequent decarboxylation to acetyl-CoA is catalyzed, at least with S. malonica and R. capsulatus, by a biotin enzyme. PMID:7710283

  4. Refactoring the nitrogen fixation gene cluster from Klebsiella oxytoca.

    PubMed

    Temme, Karsten; Zhao, Dehua; Voigt, Christopher A

    2012-05-01

    Bacterial genes associated with a single trait are often grouped in a contiguous unit of the genome known as a gene cluster. It is difficult to genetically manipulate many gene clusters because of complex, redundant, and integrated host regulation. We have developed a systematic approach to completely specify the genetics of a gene cluster by rebuilding it from the bottom up using only synthetic, well-characterized parts. This process removes all native regulation, including that which is undiscovered. First, all noncoding DNA, regulatory proteins, and nonessential genes are removed. The codons of essential genes are changed to create a DNA sequence as divergent as possible from the wild-type (WT) gene. Recoded genes are computationally scanned to eliminate internal regulation. They are organized into operons and placed under the control of synthetic parts (promoters, ribosome binding sites, and terminators) that are functionally separated by spacer parts. Finally, a controller consisting of genetic sensors and circuits regulates the conditions and dynamics of gene expression. We applied this approach to an agriculturally relevant gene cluster from Klebsiella oxytoca encoding the nitrogen fixation pathway for converting atmospheric N(2) to ammonia. The native gene cluster consists of 20 genes in seven operons and is encoded in 23.5 kb of DNA. We constructed a "refactored" gene cluster that shares little DNA sequence identity with WT and for which the function of every genetic part is defined. This work demonstrates the potential for synthetic biology tools to rewrite the genetics encoding complex biological functions to facilitate access, engineering, and transferability. PMID:22509035

  5. Modulation of mgrB gene expression as a source of colistin resistance in Klebsiella oxytoca.

    PubMed

    Jayol, Aurélie; Poirel, Laurent; Villegas, Maria-Virginia; Nordmann, Patrice

    2015-07-01

    Gene modifications in the PmrAB and PhoPQ two-component regulatory systems, as well as inactivation of the mgrB gene, are known to be causes of colistin resistance in Klebsiella pneumoniae. The objective of this study was to characterise the mechanism involved in colistin resistance in a Klebsiella oxytoca isolate. A K. oxytoca clinical isolate showing resistance to colistin was recovered in Cali, Colombia. The pmrA, pmrB, phoP, phoQ and mgrB genes were amplified and sequenced. Wild-type mgrB genes from K. pneumoniae and K. oxytoca were cloned, and corresponding recombinant plasmids were used for complementation assays. By analysing the mgrB gene of the K. oxytoca isolate and its flanking sequences, an insertion sequence (IS) of 1196bp was identified in its promoter region. The insertion was located between nucleotides -39 and -38 when referring to the start codon of the mgrB gene, thus negatively interfering with expression of the mgrB gene by modifying its promoter structure. This IS was very similar to ISKpn26 (99% nucleotide identity) belonging to the IS5 family. Complementation assays with mgrB genes from wild-type K. pneumoniae or K. oxytoca restored full susceptibility to colistin. In conclusion, here we identified the mechanism involved in colistin resistance in a K. oxytoca isolate. Modulation of mgrB gene expression was the key factor for this acquired resistance to colistin. PMID:25982250

  6. Cytotoxic and Pathogenic Properties of Klebsiella oxytoca Isolated from Laboratory Animals

    PubMed Central

    Sarkar, Ujjal; Seneviratne, Uthpala; Park, Danny S.; Gamazon, Eric R.; Batchelder, Chara; Cheung, Cheryl; Buckley, Ellen M.; Taylor, Nancy S.; Shen, Zeli; Tannenbaum, Steven R.; Wishnok, John S.; Fox, James G.

    2014-01-01

    Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin production in animal isolates of K. oxytoca and its pathogenic properties have not been characterized. Furthermore, neither the identity of the toxin nor a complete repertoire of genes involved in K. oxytoca pathogenesis have been fully elucidated. Here, we showed that several animal isolates of K. oxytoca, including the clinical isolates, produced secreted products in bacterial culture supernatant that display cytotoxicity on HEp-2 and HeLa cells, indicating the ability to produce cytotoxin. Cytotoxin production appears to be regulated by the environment, and soy based product was found to have a strong toxin induction property. The toxin was identified, by liquid chromatography-mass spectrometry and NMR spectroscopy, as low molecular weight heat labile benzodiazepine, tilivalline, previously shown to cause cytotoxicity in several cell lines, including mouse L1210 leukemic cells. Genome sequencing and analyses of a cytotoxin positive K. oxytoca strain isolated from an abscess of a mouse, identified genes previously shown to promote pathogenesis in other enteric bacterial pathogens including ecotin, several genes encoding for type IV and type VI secretion systems, and proteins that show sequence similarity to known bacterial toxins including cholera toxin. To our knowledge, these results demonstrate for the first time, that animal isolates of K. oxytoca, produces a cytotoxin, and that cytotoxin production is under strict environmental regulation. We also confirmed tilivalline as the cytotoxin present in animal K. oxytoca strains. These findings, along with the discovery of a repertoire of genes with virulence potential, provide important insights into the pathogenesis of K. oxytoca. As a novel diagnostic tool, tilivalline may serve as a biomarker for K oxytoca-induced cytotoxicity in humans and animals through detection in various samples from food to diseased samples using LC-MS/MS. Induction of K. oxytoca cytotoxin by consumption of soy may be in part involved in the pathogenesis of gastrointestinal disease. PMID:25057966

  7. The pKO2 Linear Plasmid Prophage of Klebsiella oxytoca

    Microsoft Academic Search

    Sherwood R. Casjens; Eddie B. Gilcrease; Wai Mun Huang; Kim L. Bunny; Marisa L. Pedulla; Michael E. Ford; Jennifer M. Houtz; Graham F. Hatfull; Roger W. Hendrix

    2004-01-01

    Temperate bacteriophages with plasmid prophages are uncommon in nature, and of these only phages N15 and PY54 are known to have a linear plasmid prophage with closed hairpin telomeres. We report here the complete nucleotide sequence of the 51,601-bp Klebsiella oxytoca linear plasmid pKO2, and we demonstrate experimentally that it is also a prophage. We call this bacteriophage KO2. An

  8. The respiratory responses to cyanide of a cyanide-resistant Klebsiella oxytoca bacterial strain

    Microsoft Academic Search

    Ssu-Ching Chena; Jong-Kang Liu

    1999-01-01

    The respiratory system of a cyanide-resistant Klebsiella oxytoca was analyzed by monitoring the changes in the cytochrome contents in response to various inhibitors in the presence of various concentrations of cyanide. The cells grown in the medium without cyanide (KCN) have two terminal oxidases, cytochrome d (Ki=10?5 M KCN) and o (Ki=10?3 M KCN). When cells were grown on medium

  9. Draft Genome Sequences of Klebsiella oxytoca Isolates Originating from a Highly Contaminated Liquid Hand Soap Product.

    PubMed

    Hammerl, J A; Lasch, P; Nitsche, A; Dabrowski, P W; Hahmann, H; Wicke, A; Kleta, S; Dahouk, S Al; Dieckmann, R

    2015-01-01

    In 2013, contaminated liquid soap was detected by routine microbiological monitoring of consumer products through state health authorities. Because of its high load of Klebsiella oxytoca, the liquid soap was notified via the European Union Rapid Alert System for Dangerous Non-Food Products (EU-RAPEX) and recalled. Here, we present two draft genome sequences and a summary of their general features. PMID:26205867

  10. Gel sequestration of heavy metals by Klebsiella oxytoca isolated from iron mat

    Microsoft Academic Search

    Franco Baldi; Andrea Minacci; Milva Pepi; Andrea Scozzafava

    2001-01-01

    The enterobacterium Klebsiella oxytoca strain BAS-10 was isolated from sediments under an iron mat formed in a stream receiving leached waters from pyrite mine tailings. Under anaerobic laboratory conditions, BAS-10 fermented Fe(III)-citrate and Na-citrate giving CH3COOH and CO2. In the presence of ferric citrate, BAS-10 secreted quantities of a thick gel containing glucose and\\/or mannose, if not other sugars. Sugar

  11. Carbapenem-Resistant Strain of Klebsiella oxytoca Harboring Carbapenem-Hydrolyzing  Lactamase KPC2

    Microsoft Academic Search

    Hesna Yigit; Anne Marie Queenan; J. Kamile Rasheed; James W. Biddle; Antonio Domenech-Sanchez; Sebastian Alberti; Karen Bush; Fred C. Tenover

    2003-01-01

    We investigated a Klebsiella oxytoca isolate demonstrating resistance to imipenem, meropenem, extended- spectrum cephalosporins, and aztreonam. The MICs of both imipenem and meropenem were 32 g\\/ml. The -lactamase activity against imipenem and meropenem was inhibited in the presence of clavulanic acid. Isoelectric focusing studies demonstrated five -lactamases with pIs of 8.2 (SHV-46), 6.7 (KPC-2), 6.5 (un- known), 6.4 (probable OXY-2),

  12. Production of 2,3-butanediol by a low-acid producing Klebsiella oxytoca NBRF4.

    PubMed

    Han, Sung-Hyuk; Lee, Jung-Eun; Park, Kyungmoon; Park, Yong-Cheol

    2013-01-25

    2,3-Butanediol (2,3-BDO) is a value-added chemical with great potential for the industrial production of synthetic rubber, plastic and solvent. For microbial production of 2,3-BDO, in this study, Klebsiella oxytoca NBRF4 was constructed by chemical mutation and screening against NaBr, NaBrO(3) and fluoroacetate. Among metabolic enzymes involved in the production of lactate, acetate and 2,3-BDO, K. oxytoca NBRF4 possessed 1.2 times lower specific activities of lactate dehydrogenase and phosphotransacetylase, and 22% higher specific acetoin reductase activity than the K. oxytoca ATCC43863 control strain. A series of batch fermentations in a defined medium and application of a statistical tool of response surface method led to the determination of optimal culture conditions: 10% dissolved oxygen level, pH 4.3 and 38°C. The actual results of batch fermentation at the optimal conditions using 44 g/L glucose were coincident with the predetermined values: 14.4 g/L 2,3-BDO concentration, 0.32 g/g yield. To increase 2,3-BDO titer, fed-batch fermentation of K. oxytoca NBRF4 was performed by an intermittent feeding of 800 g/L glucose to control its concentration around 5-20 g/L in the culture broth. Finally, 34.2g/L 2,3-BDO concentration and 0.35 g/g yield were obtained without organic acid production in 70 hours of the fed-batch culture, which were 2.4 and 1.2 times higher than those of the batch fermentation using 44 g/L glucose. PMID:22989924

  13. Intracellular azo decolorization is coupled with aerobic respiration by a Klebsiella oxytoca strain.

    PubMed

    Yu, Lei; Zhang, Xiao-Yu; Xie, Tian; Hu, Jin-Mei; Wang, Shi; Li, Wen-Wei

    2015-03-01

    Reduction of azo dye methyl red coupled with aerobic respiration by growing cultures of Klebsiella oxytoca GS-4-08 was investigated. In liquid media containing dye and 0.6 % glucose in a mineral salts base, 100 mg l(-1) of the dye are completely removed in 3 h under shaking conditions. The dye cannot be aerobically decolorized by strain GS-4-08 without extra carbon sources, indicating a co-metabolism process. Higher initial dye concentration prolonged the lag phase of the cell growth, but final cell concentrations of each batches reached a same level with range from 6.3 to 7.6 mg l(-1) after the dye adaption period. This strain showed stronger dye tolerance and decolorization ability than many reported strains. Furthermore, a new intracellular oxygen-insensitive azoreductase was isolated from this strain, and the specific activity of enzyme was 0.846 and 0.633 U mg(-1) protein in the presence of NADH and NADPH, respectively. N,N dimethyl-p-phenylenediamine and anthranilic acid were stoichiometrically released from MR dye, indicating the breakage of azo bonds accounts for the intracellular decolorization. Combining the characteristics of azoreductase, the stoichiometry of EMP, and TCA cycle, the electron transfer chain theory of aerobic respiration, and the possible mechanism of aerobic respiration coupled with azo reduction by K. oxytoca GS-4-08 are proposed. This study is expected to provide a sound theoretical basis for the development of the K. oxytoca strain in aerobic process for azo dye containing wastewaters. PMID:25343980

  14. Mechanism of resistance and antibacterial susceptibility in extended-spectrum ?-lactamase phenotype Klebsiella pneumoniae and Klebsiella oxytoca isolated between 2000 and 2010 in Japan.

    PubMed

    Sato, Takafumi; Hara, Takafumi; Horiyama, Tsukasa; Kanazawa, Sachi; Yamaguchi, Takahiro; Maki, Hideki

    2015-05-01

    Clinical isolates of Klebsiella pneumoniae and Klebsiella oxytoca collected from 20 Japanese medical facilities between 2000 and 2010 were analysed to evaluate the mechanisms of resistance and antibacterial susceptibilities to 14 antimicrobials. Overall, eight of 484 (1.6?%) K. pneumoniae and 19 of 359 (5.3?%) K. oxytoca were determined to be extended-spectrum ?-lactamase (ESBL) phenotype isolates, and the identified ESBLs amongst the K. pneumoniae isolates were CTX-M-2, -3, -14 and -15, and SHV-12. In contrast, overproduction of chromosomal ?-lactamase OXY-2, which was due to a distinct mutation at the -?10 promoter region of this gene, conferred the ESBL phenotype to all the K. oxytoca isolates except one. Based on the Clinical and Laboratory Standards Institute breakpoints, all the ESBL phenotype K. pneumoniae were susceptible to doripenem, flomoxef, moxalactam (latamoxef), cefmetazole and tazobactam/piperacillin, whereas the ESBL phenotype K. oxytoca were susceptible to ceftazidime and ceftibuten in addition to the above, with the exception of tazobactam/piperacillin. Amongst the oral antimicrobials, ceftibuten was relatively effective against both ESBL phenotype Klebsiella species compared with levofloxacin and amoxicillin/clavulanic acid. PMID:25813819

  15. The pKO2 linear plasmid prophage of Klebsiella oxytoca.

    PubMed

    Casjens, Sherwood R; Gilcrease, Eddie B; Huang, Wai Mun; Bunny, Kim L; Pedulla, Marisa L; Ford, Michael E; Houtz, Jennifer M; Hatfull, Graham F; Hendrix, Roger W

    2004-03-01

    Temperate bacteriophages with plasmid prophages are uncommon in nature, and of these only phages N15 and PY54 are known to have a linear plasmid prophage with closed hairpin telomeres. We report here the complete nucleotide sequence of the 51,601-bp Klebsiella oxytoca linear plasmid pKO2, and we demonstrate experimentally that it is also a prophage. We call this bacteriophage phiKO2. An analysis of the 64 predicted phiKO2 genes indicate that it is a fairly close relative of phage N15; they share a mosaic relationship that is typical of different members of double-stranded DNA tailed-phage groups. Although the head, tail shaft, and lysis genes are not recognizably homologous between these phages, other genes such as the plasmid partitioning, replicase, prophage repressor, and protelomerase genes (and their putative targets) are so similar that we predict that they must have nearly identical DNA binding specificities. The phiKO2 virion is unusual in that its phage lambda-like tails have an exceptionally long (3,433 amino acids) central tip tail fiber protein. The phiKO2 genome also carries putative homologues of bacterial dinI and umuD genes, both of which are involved in the host SOS response. We show that these divergently transcribed genes are regulated by LexA protein binding to a single target site that overlaps both promoters. PMID:14996813

  16. Complete genome sequence of Klebsiella oxytoca M1, isolated from Manripo area of South Korea.

    PubMed

    Shin, Sang Heum; Roh, Hanseong; Kim, Juhyeok; Cho, Sukhyeong; Um, Youngsoon; Lee, Jinwon; Ryu, Yeon-Woo; Chong, Hyonyong; Yang, Kap-Seok

    2015-03-20

    Here we report the full genome sequence of Klesiella oxytoca M1, isolated from Manripo area of South Korea. The strain K. oxytoca M1 is able to produce either 2,3-butanediol or acetoin selectively by controlling the pH and temperature. PMID:25660421

  17. Nucleotide sequence of the nifLA operon of Klebsiella oxytoca NG13 and characterization of the gene products.

    PubMed

    Kim, Y M; Ahn, K J; Beppu, T; Uozumi, T

    1986-11-01

    The complete nucleotide sequence of the regulatory operon nifLA of a nitrogen fixer Klebsiella oxytoca NG13 was determined, and the transcriptional start point was assigned by S1 mapping. The nifL protein (a repressor) was coded by an open reading frame of 1,485 bases, corresponding to a protein of 495 amino acids with a calculated molecular weight of 55,242. The open reading frame (1,572 bases) of the nifA protein (an activator), corresponding to a molecular weight of 58,649, was confirmed by in vitro transcription-translation experiments, using the wild type and artificially deleted nifA genes. The initiation codon (ATG) of nifA overlapped the termination codon(TGA) of nifL, sharing the two bases T and G. A conserved DNA contact point [Gln-(X)3-Ala-(X)3-Gly-(X)5-Val] common in many DNA binding proteins was found in the C-terminal region of the nifA sequence. The promoter sequences of nifLA, nifB and nifF in K. oxytoca coincided exactly with those of K. pneumoniae in the consensus regions at -12 and -26, although the overall homology in the promoter regions was 96%. Changes of four amino acids were found between the nifA coding sequences of K. oxytoca and K. pneumoniae. PMID:3027503

  18. Influence of Carbon Source on Nitrate Removal by Nitrate-Tolerant Klebsiella oxytoca CECT 4460 in Batch and Chemostat Cultures

    PubMed Central

    Piñar, Guadalupe; Kovárová, Karin; Egli, Thomas; Ramos, Juan L.

    1998-01-01

    The nitrate-tolerant organism Klebsiella oxytoca CECT 4460 tolerates nitrate at concentrations up to 1 M and is used to treat wastewater with high nitrate loads in industrial wastewater treatment plants. We studied the influence of the C source (glycerol or sucrose or both) on the growth rate and the efficiency of nitrate removal under laboratory conditions. With sucrose as the sole C source the maximum specific growth rate was 0.3 h?1, whereas with glycerol it was 0.45 h?1. In batch cultures K. oxytoca cells grown on sucrose or glycerol were able to immediately use sucrose as a sole C source, suggesting that sucrose uptake and metabolism were constitutive. In contrast, glycerol uptake occurred preferentially in glycerol-grown cells. Independent of the preculture conditions, when sucrose and glycerol were added simultaneously to batch cultures, the sucrose was used first, and once the supply of sucrose was exhausted, the glycerol was consumed. Utilization of nitrate as an N source occurred without nitrite or ammonium accumulation when glycerol was used, but nitrite accumulated when sucrose was used. In chemostat cultures K. oxytoca CECT 4460 efficiently removed nitrate without accumulation of nitrate or ammonium when sucrose, glycerol, or mixtures of these two C sources were used. The growth yields and the efficiencies of C and N utilization were determined at different growth rates in chemostat cultures. Regardless of the C source, yield carbon (YC) ranged between 1.3 and 1.0 g (dry weight) per g of sucrose C or glycerol C consumed. Regardless of the specific growth rate and the C source, yield nitrogen (YN) ranged from 17.2 to 12.5 g (dry weight) per g of nitrate N consumed. In contrast to batch cultures, in continuous cultures glycerol and sucrose were utilized simultaneously, although the specific rate of sucrose consumption was higher than the specific rate of glycerol consumption. In continuous cultures double-nutrient-limited growth appeared with respect to the C/N ratio of the feed medium and the dilution rate, so that for a C/N ratio between 10 and 30 and a growth rate of 0.1 h?1 the process led to simultaneous and efficient removal of the C and N sources used. At a growth rate of 0.2 h?1 the zone of double limitation was between 8 and 11. This suggests that the regimen of double limitation is influenced by the C/N ratio and the growth rate. The results of these experiments were validated by pulse assays. PMID:9687459

  19. Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar

    SciTech Connect

    Moeis, Maelita R., E-mail: sony@sith.itb.ac.id; Berlian, Liska, E-mail: sony@sith.itb.ac.id; Suhandono, Sony, E-mail: sony@sith.itb.ac.id; Prima, Alex, E-mail: sony@sith.itb.ac.id; Komalawati, Eli, E-mail: sony@sith.itb.ac.id; Kristianti, Tati, E-mail: sony@sith.itb.ac.id

    2014-03-24

    Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5?. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation {sup 325}RLDRD{sup 329} and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNA sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.

  20. Antimicrobial activity of essential oils of cultivated oregano (Origanum vulgare), sage (Salvia officinalis), and thyme (Thymus vulgaris) against clinical isolates of Escherichia coli, Klebsiella oxytoca, and Klebsiella pneumoniae

    PubMed Central

    Fournomiti, Maria; Kimbaris, Athanasios; Mantzourani, Ioanna; Plessas, Stavros; Theodoridou, Irene; Papaemmanouil, Virginia; Kapsiotis, Ioannis; Panopoulou, Maria; Stavropoulou, Elisavet; Bezirtzoglou, Eugenia E.; Alexopoulos, Athanasios

    2015-01-01

    Background Oregano (Origanum vulgare), sage (Salvia officinalis), and thyme (Thymus vulgaris) are aromatic plants with ornamental, culinary, and phytotherapeutic use all over the world. In Europe, they are traditionally used in the southern countries, particularly in the Mediterranean region. The antimicrobial activities of the essential oils (EOs) derived from those plants have captured the attention of scientists as they could be used as alternatives to the increasing resistance of traditional antibiotics against pathogen infections. Therefore, significant interest in the cultivation of various aromatic and medicinal plants is recorded during the last years. However, to gain a proper and marketable chemotype various factors during the cultivation should be considered as the geographical morphology, climatic, and farming conditions. In this frame, we have studied the antimicrobial efficiency of the EOs from oregano, sage, and thyme cultivated under different conditions in a region of NE Greece in comparison to the data available in literature. Methods Plants were purchased from a certified supplier, planted, and cultivated in an experimental field under different conditions and harvested after 9 months. EOs were extracted by using a Clevenger apparatus and tested for their antibacterial properties (Minimum inhibitory concentration – MIC) against clinical isolates of multidrug resistant Escherichia coli (n=27), Klebsiella oxytoca (n=7), and Klebsiella pneumoniae (n=16) strains by using the broth microdilution assay. Results Our results showed that the most sensitive organism was K. oxytoca with a mean value of MIC of 0.9 µg/mL for oregano EOs and 8.1 µg/mL for thyme. The second most sensitive strain was K. pneumoniae with mean MIC values of 9.5 µg/mL for thyme and 73.5 µg/mL for oregano EOs. E. coli strains were among the most resistant to EOs antimicrobial action as the observed MICs were 24.8–28.6 µg/mL for thyme and above 125 µg/mL for thyme and sage. Most efficient were the EOs from thyme followed by those of oregano. Conclusions With MIC values above 150 µg/mL, sage EOs did not show any antibacterial efficiency against the majority of the strains. However, no significant differences were observed concerning the antimicrobial action of all EOs originating from irrigated versus non-irrigated cultivated aromatic plants. PMID:25881620

  1. NasFED proteins mediate assimilatory nitrate and nitrite transport in Klebsiella oxytoca (pneumoniae) M5al.

    PubMed

    Wu, Q; Stewart, V

    1998-03-01

    Klebsiella oxytoca can use nitrate and nitrite as sole nitrogen sources. The enzymes required for nitrate and nitrite assimilation are encoded by the nasFEDCBA operon. We report here the complete nasFED sequence. Sequence comparisons indicate that the nasFED genes encode components of a conventional periplasmic binding protein-dependent transport system consisting of a periplasmic binding protein (NasF), a homodimeric intrinsic membrane protein (NasE), and a homodimeric ATP-binding cassette (ABC) protein (NasD). The NasF protein and the related NrtA and CmpA proteins of cyanobacteria contain leader (signal) sequences with the double-arginine motif that is hypothesized to direct prefolded proteins to an alternate protein export pathway. The NasE protein and the related NrtB and CmpB proteins of cyanobacteria contain unusual variants of the EAA loop sequence that defines membrane-intrinsic proteins of ABC transporters. To characterize nitrate and nitrite transport, we constructed in-frame nonpolar deletions of the chromosomal nasFED genes. Growth tests coupled with nitrate and nitrite uptake assays revealed that the nasFED genes are essential for nitrate transport and participate in nitrite transport as well. Interestingly, the delta nasF strain exhibited leaky phenotypes, particularly at elevated nitrate concentrations, suggesting that the NasED proteins are not fully dependent on the NasF protein. PMID:9495773

  2. Isolation of an endophytic diazotroph, Klebsiella oxytoca, from sweet potato stems in Japan

    Microsoft Academic Search

    Katsuki Adachi; Makoto Nakatani; Hideyuki Mochida

    2002-01-01

    The population density of endophytic bacteria in the stem of field-grown sweet potato cultivars (Beniotome [BO], Koganesengan [KS], and Shiroyutaka [SYD in Miyakonojo, Miyazaki, Japan, ranged from 10 to 10 cells g fresh weight sample using a semi-solid nitrogen-free medium. Eleven strains were isolated from the stems and two isolates, BO-1 and BO-5, showed a positive reaction in the acetylene

  3. Adaptative biochemical pathways and regulatory networks in Klebsiella oxytoca BAS-10 producing a biotechnologically relevant exopolysaccharide during Fe(III)-citrate fermentation

    PubMed Central

    2012-01-01

    Background A bacterial strain previously isolated from pyrite mine drainage and named BAS-10 was tentatively identified as Klebsiella oxytoca. Unlikely other enterobacteria, BAS-10 is able to grow on Fe(III)-citrate as sole carbon and energy source, yielding acetic acid and CO2 coupled with Fe(III) reduction to Fe(II) and showing unusual physiological characteristics. In fact, under this growth condition, BAS-10 produces an exopolysaccharide (EPS) having a high rhamnose content and metal-binding properties, whose biotechnological applications were proven as very relevant. Results Further phylogenetic analysis, based on 16S rDNA sequence, definitively confirmed that BAS-10 belongs to K. oxytoca species. In order to rationalize the biochemical peculiarities of this unusual enterobacteriun, combined 2D-Differential Gel Electrophoresis (2D-DIGE) analysis and mass spectrometry procedures were used to investigate its proteomic changes: i) under aerobic or anaerobic cultivation with Fe(III)-citrate as sole carbon source; ii) under anaerobic cultivations using Na(I)-citrate or Fe(III)-citrate as sole carbon source. Combining data from these differential studies peculiar levels of outer membrane proteins, key regulatory factors of carbon and nitrogen metabolism and enzymes involved in TCA cycle and sugar biosynthesis or required for citrate fermentation and stress response during anaerobic growth on Fe(III)-citrate were revealed. The protein differential regulation seems to ensure efficient cell growth coupled with EPS production by adapting metabolic and biochemical processes in order to face iron toxicity and to optimize energy production. Conclusion Differential proteomics provided insights on the molecular mechanisms necessary for anaeorobic utilization of Fe(III)-citrate in a biotechnologically promising enterobacteriun, also revealing genes that can be targeted for the rational design of high-yielding EPS producer strains. PMID:23176641

  4. Metabolic Changes in Klebsiella oxytoca in Response to Low Oxidoreduction Potential, as Revealed by Comparative Proteomic Profiling Integrated with Flux Balance Analysis

    PubMed Central

    Zhu, Yan; Li, Dan; Bao, Guanhui; Wang, Shaohua; Mao, Shaoming; Song, Jiangning; Li, Yin

    2014-01-01

    Oxidoreduction potential (ORP) is an important physiological parameter for biochemical production in anaerobic or microaerobic processes. However, the effect of ORP on cellular physiology remains largely unknown, which hampers the design of engineering strategies targeting proteins associated with ORP response. Here we characterized the effect of altering ORP in a 1,3-propanediol producer, Klebsiella oxytoca, by comparative proteomic profiling combined with flux balance analysis. Decreasing the extracellular ORP from ?150 to ?240 mV retarded cell growth and enhanced 1,3-propanediol production. Comparative proteomic analysis identified 61 differentially expressed proteins, mainly involved in carbohydrate catabolism, cellular constituent biosynthesis, and reductive stress response. A hypothetical oxidoreductase (HOR) that catalyzes 1,3-propanediol production was markedly upregulated, while proteins involved in biomass precursor synthesis were downregulated. As revealed by subsequent flux balance analysis, low ORP induced a metabolic shift from glycerol oxidation to reduction and rebalancing of redox and energy metabolism. From the integrated protein expression profiles and flux distributions, we can construct a rational analytic framework that elucidates how (facultative) anaerobes respond to extracellular ORP changes. PMID:24584239

  5. Stereochemically Specific Proton Transfer in Decarboxylation of 4-Hydroxycinnamic Acids by 4-Hydroxycinnamate Decarboxylase from Klebsiella oxytoca

    Microsoft Academic Search

    Yasuyuki Hashidoko; Satoshi Tahara

    1998-01-01

    The stereochemical specificity in the decarboxylation ofE-4-hydroxycinnamic acid catalyzed byE-4-hydroxycinnamate decarboxylase (4-HCD) ofKlebsiella oxytocawas investigated. Unlike the pyrolytic decarboxylation of 8-deuteratedE-4-hydroxycinnamic acid to yield an equimolecular mixture of 8-Z- and 8-E-deuterated 4-hydroxystyrenes, treating 8-deuteratedE-4-hydroxycinnamic acid with the enzyme in H2O-based buffer yielded 8-Z-deuterated 4-hydroxystyrene selectively. The specificE-orientation in catalysis and the substrate specificity requiring 4-OH in the substrates suggest that

  6. Characterization and nucleotide sequence of a Klebsiella oxytoca cryptic plasmid encoding a CMY-type beta-lactamase: confirmation that the plasmid-mediated cephamycinase originated from the Citrobacter freundii AmpC beta-lactamase.

    PubMed

    Wu, S W; Dornbusch, K; Kronvall, G; Norgren, M

    1999-06-01

    Plasmid pTKH11, originally obtained by electroporation of a Klebsiella oxytoca plasmid preparation into Escherichia coli XAC, expressed a high level of an AmpC-like beta-lactamase. The enzyme, designated CMY-5, conferred resistance to extended-spectrum beta-lactams in E. coli; nevertheless, the phenotype was cryptic in the K. oxytoca donor. Determination of the complete nucleotide sequence of pTKH11 revealed that the 8,193-bp plasmid encoded seven open reading frames, including that for the CMY-5 beta-lactamase (blaCMY-5). The blaCMY-5 product was similar to the plasmidic CMY-2 beta-lactamase of K. pneumoniae and the chromosomal AmpC of Citrobacter freundii, with 99.7 and 97.0% identities, respectively; there was a substitution of phenylalanine in CMY-5 for isoleucine 105 in CMY-2. blaCMY-5 was followed by the Blc and SugE genes of C. freundii, and this cluster exhibited a genetic organization identical to that of the ampC region on the chromosome of C. freundii; these results confirmed that C. freundii AmpC was the evolutionary origin of the plasmidic cephamycinases. In the K. oxytoca host, the copy number of pTKH11 was very low and the plasmid coexisted with plasmid pNBL63. Analysis of the replication regions of the two plasmids revealed 97% sequence similarity in the RNA I transcripts; this result implied that the two plasmids might be incompatible. Incompatibility of the two plasmids might explain the cryptic phenotype of blaCMY-5 in K. oxytoca through an exclusion effect on pTKH11 by resident plasmid pNBL63. PMID:10348751

  7. Bacteria on housefly eggs, Musca domestica , suppress fungal growth in chicken manure through nutrient depletion or antifungal metabolites

    Microsoft Academic Search

    Kevin Lam; Kelsie Thu; Michelle Tsang; Margo Moore; Gerhard Gries

    2009-01-01

    Female houseflies, Musca domestica (Diptera: Muscidae), lay their eggs in ephemeral resources such as animal manure. Hatching larvae compete for essential nutrients\\u000a with fungi that also colonize such resources. Both the well-known antagonistic relationship between bacteria and fungi and\\u000a the consistent presence of the bacterium Klebsiella oxytoca on housefly eggs led us to hypothesize (1) that K. oxytoca, and possibly

  8. Evaluation of the VITEK 2 AST-N111 card for detection of extended-spectrum beta-lactamases (ESBLs) in Escherichia coli, Klebsiella pneumoniae, and Klebsiella oxytoca compared to ESBL Etests and combination disk methods

    Microsoft Academic Search

    G. Valenza; S. Müller; C. Schmitt; D. Turnwald; T. T. Lam; M. Frosch; M. Abele-Horn; Y. Pfeifer

    2011-01-01

    The VITEK 2 AST-N111 card was evaluated for detection of extended-spectrum beta-lactamases (ESBLs) by testing 51 ESBL positive\\u000a and 50 ESBL negative isolates of E. coli, K. pneumoniae, and K. oxytoca. The occurrence of beta-lactamase genes was confirmed by PCR and sequencing. The advanced expert system (AES) of the VITEK\\u000a 2 system achieved sensitivity and specificity values of 100% and

  9. Gene Integration and Expression and Extracellular Secretion of Erwinia chrysanthemi Endoglucanase CelY (celY) and CelZ (celZ) in Ethanologenic Klebsiella oxytoca P2†

    PubMed Central

    Zhou, Shengde; Davis, F. C.; Ingram, L. O.

    2001-01-01

    The development of methods to reduce costs associated with the solubilization of cellulose is essential for the utilization of lignocellulose as a renewable feedstock for fuels and chemicals. One promising approach is the genetic engineering of ethanol-producing microorganisms that also produce cellulase enzymes during fermentation. By starting with an ethanologenic derivative (strain P2) of Klebsiella oxytoca M5A1 with the native ability to metabolize cellobiose, the need for supplemental ?-glucosidase was previously eliminated. In the current study, this approach has been extended by adding genes encoding endoglucanase activities. Genes celY and celZ from Erwinia chrysanthemi have been functionally integrated into the chromosome of P2 using surrogate promoters from Zymomonas mobilis for expression. Both were secreted into the extracellular milieu, producing more than 20,000 endoglucanase units (carboxymethyl cellulase activity) per liter of fermentation broth. During the fermentation of crystalline cellulose with low levels of commercial cellulases of fungal origin, these new strains produced up to 22% more ethanol than unmodified P2. Most of the beneficial contribution was attributed to CelY rather than to CelZ. These results suggest that fungal enzymes with substrate profiles resembling CelY (preference for long-chain polymers and lack of activity on soluble cello-oligosaccharides of two to five glucosyl residues) may be limiting in commercial cellulase preparations. PMID:11133422

  10. ENUMERATION, TRANSPORT AND SURVIVAL OF BACTERIA ATTACHED TO GRANULAR ACTIVITATED CARBON IN DRINKING WATER

    EPA Science Inventory

    The surfaces of granular activated carbon (GAC), sand, and anthracite particles were found to be populated to the same levels with heterotrophic plate count (HPC) bacteria. GAC supported a greater number of Klebsiella oxytoca than the other two filter media. In a study of operati...

  11. EFFECTS OF VELOCITY ON THE TRANSPORT OF TWO BACTERIA THROUGH SATURATED SAND. GROUND WATER.

    EPA Science Inventory

    Transport of the bacteria Klebsiella oxytoca and Burkholderia cepacia G4PR1 (G4PR1) was investigated in column experiments conducted under conditions that allowed us to quantify sorption under a range of ground water velocities. Column experiments (33 mm I.D. X 114 mm long colu...

  12. Metabolism of tannin-protein complex by facultatively anaerobic bacteria isolated from koala feces

    Microsoft Academic Search

    Ro Osawa; Terry P. Walsh; Steven J. Cork

    1993-01-01

    The metabolic pathways involved in degradation of tannin-protein complex (T-PC) were investigated in various facultatively anaerobic bacteria, with specific reference to fecal isolates from the koala including T-PC-degrading enterobacteria (T-PCDE),Streptococcus bovis, Klebsiella pneumoniae, andK. oxytoca. It was demonstrated that T-PCDE andS. bovis biotype I were capable of degrading protein complexed with gallotannin (a hydrolyzable tannin), but not that complexed with

  13. Siderophore production of Klebsiella species isolated from different sources.

    PubMed

    Podschun, R; Fischer, A; Ullmann, U

    1992-04-01

    A total of 481 Klebsiella pneumoniae and K. oxytoca strains isolated from different sources was examined for siderophore production. Screening for siderophore secretion by chrome azurol S agar revealed that 475 strains (98.8%) produced siderophores. The isolates were further investigated for synthesis of enterochelin and aerobactin by means of specific bioassays. Almost all Klebsiella strains (99.4%) excreted enterochelin. Aerobactin production, however, was rarely observed among K. pneumoniae (6%) and K. oxytoca (4%) isolates. The incidence of aerobaction-positive strains was similar in clinical, fecal, and environmental isolates. These results suggest that the aerobactin system does not represent a major mechanism of iron supply in Klebsiella spp. PMID:1535249

  14. Preparation and characterization of vanadia-titania mixed oxide for immobilization of Serratia rubidaea CCT 5732 and Klebsiella marcescens bacteria

    SciTech Connect

    Saragiotto Colpini, Leda Maria [Departamento de Quimica, Universidade Estadual de Maringa, Av. Colombo 5790, 87020-900 Maringa, PR (Brazil)], E-mail: ledasaracol@yahoo.com.br; Correia Goncalves, Regina A. [Departamento de Farmacia e Farmacologia, Universidade Estadual de Maringa, Av. Colombo 5790, 87020-900 Maringa, PR (Brazil); Goncalves, Jose Eduardo [Centro Universitario de Maringa, Av. Guedner 1610, 87050-390 Maringa, PR (Brazil); Maieru Macedo Costa, Creusa [Departamento de Quimica, Universidade Estadual de Maringa, Av. Colombo 5790, 87020-900 Maringa, PR (Brazil)

    2008-08-04

    Vanadia-titania mixed oxide was synthesized by sol-gel method and characterized by several techniques. Texturally, it is formed by mesopores and presents high-specific surface area and controlled porosity. Scanning electron microscopy revealed that vanadium is homogeneously distributed in the material. Structurally, it was possible to identify characteristic V=O stretching bands by IR. The analysis of X-ray diffraction showed that the material, particularly vanadium, is highly dispersed. Application experiments were carried out through the immobilization of Serratia rubidae CCT 5732 and Klebsiella marcescens bacteria by adsorption on the surface of mixed oxide. The micrographies revealed that the bacteria were adsorbed on the entire support, with average surface densities of 8.55 x 10{sup 11} cells/m{sup 2} (Serratia rubidae CCT 5732) and 3.40 x 10{sup 11} cells/m{sup 2} (K. marcescens)

  15. Cultivable endophytic bacteria from leaf bases of Agave tequilana and their role as plant growth promoters.

    PubMed

    Martínez-Rodríguez, Julia del C; De la Mora-Amutio, Marcela; Plascencia-Correa, Luis A; Audelo-Regalado, Esmeralda; Guardado, Francisco R; Hernández-Sánchez, Elías; Peña-Ramírez, Yuri J; Escalante, Adelfo; Beltrán-García, Miguel J; Ogura, Tetsuya

    2014-01-01

    Agave tequilana Weber var. 'Azul' is grown for the production of tequila, inulin and syrup. Diverse bacteria inhabit plant tissues and play a crucial role for plant health and growth. In this study culturable endophytic bacteria were extracted from leaf bases of 100 healthy Agave tequilana plants. In plant tissue bacteria occurred at mean population densities of 3 million CFU/g of fresh plant tissue. Three hundred endophytic strains were isolated and 16s rDNA sequences grouped the bacteria into eight different taxa that shared high homology with other known sequences. Bacterial endophytes were identified as Acinectobacter sp., A. baumanii, A. bereziniae, Cronobacter sakazakii, Enterobacter hormaechei, Bacillus sp. Klebsiella oxytoca, Pseudomonas sp., Enterococcus casseliflavus, Leuconostoc mesenteroides subsp. mesenteroides and Gluconobacter oxydans. Isolates were confirmed to be plant growth promoting bacteria (PGPB) by their capacities for nitrogen fixation, auxin production, phosphate solubilization, or antagonism against Fusarium oxysporum AC132. E. casseliflavus JM47 and K. oxytoca JM26 secreted the highest concentrations of IAA. The endophyte Acinectobacter sp. JM58 exhibited the maximum values for nitrogen fixation and phosphate solubilization index (PSI). Inhibition of fungi was found in Pseudomonas sp. JM9p and K. oxytoca JM26. Bacterial endophytes show promise for use as bio-inoculants for agave cultivation. Use of endophytes to enhance cultivation of agave may be particularly important for plants produced by micropropagation techniques, where native endophytes may have been lost. PMID:25763038

  16. Cultivable endophytic bacteria from leaf bases of Agave tequilana and their role as plant growth promoters

    PubMed Central

    Martínez-Rodríguez, Julia del C.; la Mora-Amutio, Marcela De; Plascencia-Correa, Luis A.; Audelo-Regalado, Esmeralda; Guardado, Francisco R.; Hernández-Sánchez, Elías; Peña-Ramírez, Yuri J.; Escalante, Adelfo; Beltrán-García, Miguel J.; Ogura, Tetsuya

    2014-01-01

    Agave tequilana Weber var. ‘Azul’ is grown for the production of tequila, inulin and syrup. Diverse bacteria inhabit plant tissues and play a crucial role for plant health and growth. In this study culturable endophytic bacteria were extracted from leaf bases of 100 healthy Agave tequilana plants. In plant tissue bacteria occurred at mean population densities of 3 million CFU/g of fresh plant tissue. Three hundred endophytic strains were isolated and 16s rDNA sequences grouped the bacteria into eight different taxa that shared high homology with other known sequences. Bacterial endophytes were identified as Acinectobacter sp., A. baumanii, A. bereziniae, Cronobacter sakazakii, Enterobacter hormaechei, Bacillus sp. Klebsiella oxytoca, Pseudomonas sp., Enterococcus casseliflavus, Leuconostoc mesenteroides subsp. mesenteroides and Gluconobacter oxydans. Isolates were confirmed to be plant growth promoting bacteria (PGPB) by their capacities for nitrogen fixation, auxin production, phosphate solubilization, or antagonism against Fusarium oxysporum AC132. E. casseliflavus JM47 and K. oxytoca JM26 secreted the highest concentrations of IAA. The endophyte Acinectobacter sp. JM58 exhibited the maximum values for nitrogen fixation and phosphate solubilization index (PSI). Inhibition of fungi was found in Pseudomonas sp. JM9p and K. oxytoca JM26. Bacterial endophytes show promise for use as bio-inoculants for agave cultivation. Use of endophytes to enhance cultivation of agave may be particularly important for plants produced by micropropagation techniques, where native endophytes may have been lost. PMID:25763038

  17. Influence of Asellus aquaticus on Escherichia coli, Klebsiella pneumoniae, Campylobacter jejuni and naturally occurring heterotrophic bacteria in drinking water.

    PubMed

    Christensen, Sarah C B; Nissen, Erling; Arvin, Erik; Albrechtsen, Hans-Jørgen

    2012-10-15

    Water lice, Asellus aquaticus (isopoda), frequently occur in drinking water distribution systems where they are a nuisance to consumers and water utilities. Whether they are solely an aesthetic problem or also affect the microbial water quality is a matter of interest. We studied the influence of A. aquaticus on microbial water quality in non-chlorinated drinking water in controlled laboratory experiments. Pure cultures of the indicator organisms Escherichia coli and Klebsiella pneumoniae and the pathogen Campylobacter jejuni as well as naturally occurring heterotrophic drinking water bacteria (measured as heterotrophic plate counts, HPC) were investigated in microcosms at 7 °C, containing non-sterilised drinking water, drinking water sediment and A. aquaticus collected from a non-chlorinated ground water based drinking water supply system. Concentrations of E. coli, K. pneumoniae and C. jejuni decreased over time, following a first order decay with half lives of 5.3, 18.4 and 1.3 days, respectively. A. aquaticus did not affect survival of indicators and pathogens substantially whereas HPC were influenced by presence of dead A. aquaticus. Growth rates increased with an average of 48% for bacteria grown on R-2A agar and an average of 83% for bacteria grown on yeast extract agar when dead A. aquaticus were present compared to no and living A. aquaticus present. A. aquaticus associated E. coli, K. pneumoniae and C. jejuni were measured (up to 25 per living and 500 per dead A. aquaticus) and so were A. aquaticus associated heterotrophic bacteria (>1.8*10(4) CFU per living and >6*10(4) CFU per dead A. aquaticus). A. aquaticus did not serve as an optimised habitat that increased survival of indicators and pathogens, since A. aquaticus associated E. coli, K. pneumoniae and C. jejuni were only measured as long as the bacteria were also present in the water and sediment. PMID:22884244

  18. Genetic Organization of Transposase Regions Surrounding blaKPC Carbapenemase Genes on Plasmids from Klebsiella Strains Isolated in a New York City Hospital

    Microsoft Academic Search

    Thomas D. Gootz; Mary Kay Lescoe; Fadia Dib-Hajj; Brian A. Dougherty; Wen He; Phyllis Della-Latta; Richard C. Huard

    2009-01-01

    Carbapenem-resistant Klebsiella strains carrying Klebsiella pneumoniae carbapenemases (KPC) are endemic to New York City and are spreading across the United States and internationally. Recent studies have indicated that the KPC structural gene is located on a 10-kb plasmid-borne element designated Tn4401. Fourteen Klebsiella pneumoniae strains and one Klebsiella oxytoca strain isolated at a New York City hospital in 2005 carrying

  19. Extended-spectrum beta-lactamase-producing Klebsiella spp. in a neonatal intensive care unit: risk factors for the infection and the dynamics of the molecular epidemiology

    Microsoft Academic Search

    K. Kristóf; D. Szabó; J. W. Marsh; V. Cser; L. Janik; F. Rozgonyi; A. Nobilis; K. Nagy; D. L. Paterson

    2007-01-01

    The extended-spectrum beta-lactamase (ESBL)-producing Klebsiella spp. cause worldwide problems in intensive care units. The aim of this study was to investigate the molecular epidemiology\\u000a of ESBL-producing Klebsiella pneumoniae and K. oxytoca strains in a neonatal intensive care unit (NICU) in Budapest, Hungary and to determine the risk factors of the infections\\u000a and the epidemiological features. Infections with Klebsiella spp. were

  20. Evaluation of virulent multidrug resistant Klebsiella infection status in a tertiary care hospital in Eastern India.

    PubMed

    Chatterjee, Sumanta; Adhikari, Anjan; Ghosh, Reena Roy; Chatterjee, Nilay; Bhattacharyya, Kumkum; Bhattacharya, Sujata

    2012-11-01

    Klebsiella especially Klebsiella pneumoniae is gaining renewed interest because of emergence of multidrug resistance among klebsiellae associated with infections.These are now being recognised as one of the major threats to effective management of patients in hospital, especially in developing country like India. Pathogenic mechanism of klebsiella Infections are associated with virulence factors such as capsule and mucoid phenotype, etc. The present study was designed to determine the virulence factors and antibiogram of klebsiellae, isolated from various clinical specimen in a tertiary care hospital of West Bengal, India. A total of 2370 clinical specimens which include blood, urine, wound swab, sputum were processed for isolation and identification of klebsiella to the species level. For each klebsiella isolate demonstration of capsule was done by capsule relief stain and detection of mucoid phenotype was done by string test. Antibiogram was studied by Kirby-Bauer disc diffusion method according to Clinical and Laboratory Standard Institute (CLSI) guidelines. The results showed that klebsiella species were isolated and identified from 139 clinical samples (5.9% prevalence rate) among which 4 (2.9%) were Klebsiella oxytoca and the remaining 135 Isolates (97.1%) were Klebsiella pneumoniae. Out of 139 klebsiella isolates, capsule was demonstrated in 118 (84.9%) and 116 (83.4%) were positive for string test. Antibiogram revealed that most of isolates of Klebsiella pneumoniae were multidrug resistant. PMID:23785917

  1. Metabolic engineering of bacteria for ethanol production

    SciTech Connect

    Ingram, L.O.; Gomez, P.F.; Lai, X.; Moniruzzaman, M.; Wood, B.E.; Yomano, L.P.; York, S.W. [Univ. of Florida, Gainesville, FL (United States). Dept. of Microbiology and Cell Science] [Univ. of Florida, Gainesville, FL (United States). Dept. of Microbiology and Cell Science

    1998-04-20

    Technologies are available which will allow the conversion of lignocellulose into fuel ethanol using genetically engineered bacteria. Assembling these into a cost-effective process remains a challenge. The authors` work has focused primarily on the genetic engineering of enteric bacteria using a portable ethanol production pathway. Genes encoding Zymomonas mobilis pyruvate decarboxylase and alcohol dehydrogenase have been integrated into the chromosome of Escherichia coli B to produce strain KO11 for the fermentation of hemicellulose-derived syrups. This organism can efficiently ferment all hexose and pentose sugars present in the polymers of hemicellulose. Klebsiella oxytoca M5A1 has been genetically engineered in a similar manner to produce strain P2 for ethanol production from cellulose. This organism has the native ability to ferment cellobiose and cellotriose, eliminating the need for one class of cellulase enzymes. The optimal pH for cellulose fermentation with this organism is near that of fungal cellulases. The general approach for the genetic engineering of new biocatalysts has been most successful with enteric bacteria thus far. However, this approach may also prove useful with gram-positive bacteria which have other important traits for lignocellulose conversion. Many opportunities remain for further improvements in the biomass to ethanol processes.

  2. A Novel Complex Mutant bLactamase, TEM68, Identified in a Klebsiella pneumoniae Isolate from an Outbreak of Extended Spectrum bLactamase-Producing Klebsiellae

    Microsoft Academic Search

    JANUSZ FIETT; ANDRZEJ PAUCHA; MARIA STANKIEWICZ; HANNA PRZONDO-MORDARSKA; WALERIA HRYNIEWICZ; MAREK GNIADKOWSKI

    2000-01-01

    Twenty-two Klebsiella pneumoniae and two K. oxytoca extended-spectrum b-lactamase (ESBL)-producing isolates were collected in 1996 from patients in two pediatric wards of the University Hospital in Wrocaw, Poland. Molecular typing has revealed that the K. pneumoniae isolates represented four different epidemic strains. Three kinds of enzymes with ESBL activity (pI values of 5.7, 6.0, and 8.2) were identified. The pI

  3. Alimentary Tract Bacteria Isolated and Identified with API-20E and Molecular Cloning Techniques from Australian Tropical Fruit Flies, Bactrocera cacuminata and B. tryoni

    PubMed Central

    Thaochan, N.; Drew, R. A. I.; Hughes, J. M.; Vijaysegaran, S.; Chinajariyawong, A.

    2010-01-01

    Bacteria were isolated from the crop and midgut of field collected Bactrocera cacuminata (Hering) and Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). Two methods were used, firstly isolation onto two types of bacteriological culture media (PYEA and TSA) and identification using the API-20E diagnostic kit, and secondly, analysis of samples using the 16S rRNA gene molecular diagnostic method. Using the API-20E method, 10 genera and 17 species of bacteria in the family Enterobacteriaceae were identified from cultures growing on the nutrient agar. The dominant species in both the crop and midgut were Citrobacter freundii, Enterobacter cloacae and Klebsiella oxytoca. Providencia rettgeri, Klebsiella pneumoniae ssp ozaenae and Serratia marcescens were isolated from B. tryoni only. Using the molecular cloning technique that is based on 16S rRNA gene sequences, five bacteria classes were dignosed — Alpha-, Beta-, Gamma- and Delta- Proteobacteria and Firmicutes — including five families, Leuconostocaceae, Enterococcaceae, Acetobacteriaceae, Comamonadaceae and Enterobacteriaceae. The bacteria affiliated with Firmicutes were found mainly in the crop while the Gammaproteobacteria, especially the family Enterobacteriaceae, was dominant in the midgut. This paper presents results from the first known application of molecular cloning techniques to study bacteria within tephritid species and the first record of Firmicutes bacteria in these flies. PMID:20883132

  4. Emergence of DHA1-Producing Klebsiella spp. in the Parisian Region: Genetic Organization of the ampC and ampR Genes Originating from Morganella morganii

    Microsoft Academic Search

    Charlotte Verdet; Yahia Benzerara; Valerie Gautier; Olivier Adam; Zahia Ould-Hocine; Guillaume Arlet

    2006-01-01

    Eleven Klebsiella pneumoniae clinical isolates and one Klebsiella oxytoca clinical isolate showing various pulsed-field gel electrophoresis types and producing an inducible DHA-1 class C -lactamase were isolated in the Parisian region between 1998 and 2003. The aim of this study was to compare the genetic organization of the blaDHA-1 genes in this collection of clinical isolates. In four isolates, the

  5. Biochemical pathway and degradation of phthalate ester isomers by bacteria.

    PubMed

    Gu, J D; Li, J; Wang, Y

    2005-01-01

    Degradation of dimethyl isophthalate (DMI) and dimethyl phthalate ester (DMPE) was investigated using microorganisms isolated from mangrove sediment of Hong Kong Mai Po Nature Reserve. One enrichment culture was capable of utilizing DMI as the sole source of carbon and energy, but none of the bacteria in the enrichment culture was capable of degrading DMI alone. In co-culture of two bacteria, degradation was observed proceeding through monomethyl isophthalate (MMI) ester and isophthalic acid (IPA) before the aromatic ring opening. Using DMI as the sole carbon and energy source, Klebsiella oxytoca Sc and Methylobacterium mesophilicum Sr degraded DMI through the biochemical cooperation. The initial hydrolytic reaction of the ester bond was by K. oxytoca Sc and the next step of transformation was by M. mesophilicum Sr, and IPA was degraded by both of them. In another investigation, a novel bacterium, strain MPsc, was isolated for degradation of dimethyl phthalate ester (DMPE) also from the mangrove sediment. On the basis of phenotypic, biochemical and 16S rDNA gene sequence analyses, the strain MPsc should be considered as a new bacterium at the genus level (8% differences). This strain, together with a Rhodococcus zopfii isolated from the same mangrove sediment, was able to degrade DMPE aerobically. The consortium consisting of the two species degraded 450 mg/l DMPE within 3 days as the sole source of carbon and energy, but none of the individual species alone was able to transform DMPE. Furthermore, the biochemical degradation pathway proceeded through monomethyl phthalate (MMP), phthalic acid (PA) and then protocatechuate before aromatic ring cleavage. Our results suggest that degradation of complex organic compounds including DMI and DMPE may be carried out by several members of microorganisms working together in the natural environments. PMID:16312973

  6. Antimicrobial and Herbal Drug Resistance in Enteric Bacteria Isolated from Faecal Droppings of Common House Lizard/Gecko (Hemidactylus frenatus)

    PubMed Central

    Singh, Bhoj R.; Singh, Vidya; Ebibeni, N.; Singh, Raj K.

    2013-01-01

    From 194 faecal dropping samples of common house geckos collected from offices (60), houses (88), integrated farm units (IFS,18) and hostels, guest houses, and dining rooms of different canteen/mess (HGM, 28), 326 bacterial isolates of enteric bacteria belonging to 17 genera and 34 species were detected. Escherichia coli were the most frequently (39) isolated followed by Citrobacter freundii (33), Klebsiella pneumonia (27), Salmonella indica (12), Enterobacter gergoviae (12), and Ent. agglomerans (11). Other important bacteria isolated from gecko droppings were Listonella damsela (2), Raoultella terrigena (3), S. salamae (2), S. houtenae (3), Edwardsiella tarda (4), Edwardsiella hoshinae (1), and Klebsiella oxytoca (2). Of the 223 isolates tested for antimicrobial drug sensitivity, 27 (12.1%) had multiple drug resistance (MDR). None of the salmonellae or edwardsiellae had MDR however, MDR strains were significantly more common among Escherichia spp. (P = 1.9 × 10?5) and isolates from IFS units (P = 3.58 × 10?23). The most effective herbal drug, Ageratum conyzoides extract, inhibited growth of only 27.8% of strains tested followed by ethanolic extract of Zanthoxylum rhetsa (13.9%), eucalyptus oil (5.4%), patchouli oil (5.4%), lemongrass oil (3.6%), and sandalwood oil (3.1%), and Artemisia vulgaris essential oil (3.1%). PMID:24223595

  7. Efficacy of surface disinfectant cleaners against emerging highly resistant gram-negative bacteria

    PubMed Central

    2014-01-01

    Background Worldwide, the emergence of multidrug-resistant gram-negative bacteria is a clinical problem. Surface disinfectant cleaners (SDCs) that are effective against these bacteria are needed for use in high risk areas around patients and on multi-touch surfaces. We determined the efficacy of several SDCs against clinically relevant bacterial species with and without common types of multidrug resistance. Methods Bacteria species used were ATCC strains; clinical isolates classified as antibiotic-susceptible; and multi-resistant clinical isolates from Klebsiella oxytoca, Klebsiella pneumoniae, and Serratia marcescens (all OXA-48 and KPC-2); Acinetobacter baumannii (OXA-23); Pseudomonas aeruginosa (VIM-1); and Achromobacter xylosoxidans (ATCC strain). Experiments were carried out according to EN 13727:2012 in quadruplicate under dirty conditions. The five evaluated SDCs were based on alcohol and an amphoteric substance (AAS), an oxygen-releaser (OR), surface-active substances (SAS), or surface-active-substances plus aldehydes (SASA; two formulations). Bactericidal concentrations of SDCs were determined at two different contact times. Efficacy was defined as a log10???5 reduction in bacterial cell count. Results SDCs based on AAS, OR, and SAS were effective against all six species irrespective of the degree of multi-resistance. The SASA formulations were effective against the bacteria irrespective of degree of multi-resistance except for one of the four P. aeruginosa isolates (VIM-1). We found no general correlation between SDC efficacy and degree of antibiotic resistance. Conclusions SDCs were generally effective against gram-negative bacteria with and without multidrug resistance. SDCs are therefore suitable for surface disinfection in the immediate proximity of patients. Single bacterial isolates, however, might have reduced susceptibility to selected biocidal agents. PMID:24885029

  8. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...spp. from cultured isolates derived from clinical specimens. The identification aids in the diagnosis of diseases caused by bacteria belonging to the genus Klebsiella and provides epidemiological information on these diseases. These organisms can...

  9. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...spp. from cultured isolates derived from clinical specimens. The identification aids in the diagnosis of diseases caused by bacteria belonging to the genus Klebsiella and provides epidemiological information on these diseases. These organisms can...

  10. Isolation and characterization of polymeric galloyl-ester-degrading bacteria from a tannery discharge place.

    PubMed

    Franco, A R; Calheiros, C S C; Pacheco, C C; De Marco, P; Manaia, C M; Castro, P M L

    2005-11-01

    The culturable bacteria colonizing the rhizosphere of plants growing in the area of discharge of a tannery effluent were characterized. Relative proportions of aerobic, denitrifying, and sulfate-reducing bacteria were determined in the rhizosphere of Typha latifolia, Canna indica, and Phragmites australis. Aerobic bacteria were observed to be the most abundant group in the rhizosphere, and plant type did not seem to influence the abundance of the bacterial types analyzed. To isolate bacteria able to degrade polyphenols used in the tannery industry, enrichments were conducted under different conditions. Bacterial cultures were enriched with individual polyphenols (tannins Tara, Quebracho, or Mimosa) or with an undefined mixture of tannins present in the tannery effluent as carbon source. Cultures enriched with the effluent or Tara tannin were able to degrade tannic acid. Six bacterial isolates purified from these mixed cultures were able to use tannic acid as a sole carbon source in axenic culture. On the basis of 16S ribosomal DNA sequence analysis, these isolates were closely related to organisms belonging to the taxa Serratia, Stenotrophomonas maltophilia, Klebsiella oxytoca, Herbaspirillum chlorophenolicum, and Pseudomonas putida. PMID:16341641

  11. Novel methylotrophic bacteria isolated from the River Thames (London, UK).

    PubMed

    Boden, Rich; Thomas, Elizabeth; Savani, Parita; Kelly, Donovan P; Wood, Ann P

    2008-12-01

    Enrichment and elective culture for methylotrophs from sediment of the River Thames in central London yielded a diversity of pure cultures representing several genera of Gram-negative and Gram-positive bacteria, which were mainly of organisms not generally regarded as typically methylotrophic. Substrates leading to successful isolations included methanol, monomethylamine, dimethylamine, trimethylamine, methanesulfonate and dimethylsulfone. Several isolates were studied in detail and shown by their biochemical and morphological properties and 16S rRNA gene sequencing to be Sphingomonas melonis strain ET35, Mycobacterium fluoranthenivorans strain DSQ3, Rhodococcus erythropolis strain DSQ4, Brevibacterium casei strain MSQ5, Klebsiella oxytoca strains MMA/F and MMA/1, Pseudomonas mendocina strain TSQ4, and Flavobacterium sp. strains MSA/1 and MMA/2. The results show that facultative methylotrophy is present across a wide range of Bacteria, suggesting that turnover of diverse C(1)-compounds is of much greater microbiological and environmental significance than is generally thought. The origins of the genes encoding the enzymes of methylotrophy in diverse heterotrophs need further study, and could further our understanding of the phylogeny and antiquity of methylotrophic systems. PMID:18681896

  12. Monoclonal antibody against Klebsiella capsular polysaccharide reduces severity and hematogenic spread of experimental Klebsiella pneumoniae pneumonia.

    PubMed Central

    Held, T K; Trautmann, M; Mielke, M E; Neudeck, H; Cryz, S J; Cross, A S

    1992-01-01

    Klebsiella pneumoniae is an important nosocomial pathogen causing severe pulmonary infections. The majority of clinical Klebsiella isolates produce a high-molecular-weight capsular polysaccharide (CPS) which is one of the dominant virulence factors. In the present study, we examined the potency of a murine immunoglobulin M monoclonal antibody (MAb) with specificity to Klebsiella type 2 CPS to protect rats against experimental Klebsiella pneumonia. The MAb did not prevent the invasion of virulent bacteria into the interalveolar space. However, the resolution of infection was accelerated in MAb-treated animals. This was demonstrated by (i) less severe weight loss and (ii) markedly reduced inflammatory reactions in the lung. The elimination of bacteria was significantly increased not only in the lungs but also in the livers of antibody-treated rats. This was reflected by reduced levels of circulating, soluble CPS and MAb-bound CPS. A mixture of human MAbs with specificity to CPS of clinically important Klebsiella serotypes may prove to be a useful tool for the prevention or supportive treatment of Klebsiella pneumonia. Images PMID:1563764

  13. Carbapenemase-producing Klebsiella pneumoniae

    PubMed Central

    Deresinski, Stan

    2014-01-01

    The continuing emergence of infections due to multidrug resistant bacteria is a serious public health problem. Klebsiella pneumoniae, which commonly acquires resistance encoded on mobile genetic elements, including ones that encode carbapenemases, is a prime example. K. pneumoniae carrying such genetic material, including both blaKPC and genes encoding metallo-?-lactamases, have spread globally. Many carbapenemase-producing K. pneumoniae are resistant to multiple antibiotic classes beyond ?-lactams, including tetracyclines, aminoglycosides, and fluoroquinolones. The optimal treatment, if any, for infections due to these organisms is unclear but, paradoxically, appears to often require the inclusion of an optimally administered carbapenem. PMID:25343037

  14. Effects of some metallic compounds on Klebsiella

    SciTech Connect

    Wong, S.H.

    1988-04-01

    Many industrial and waste disposal practices unconsciously pollute the environment by adding excess heavy metals to it. Although reports show an inconsistency in the toxic levels of heavy metals such as zinc, nickel, cadmium, mercury and silvery between microbial groups, the toxic effects of the metals on microorganisms have been well documented. Little is known of the differential effects these metals have on coliform K. pneumoniae and K. oxytoca. These bacteria are widely recognized as antibiotic resistant opportunistic pathogens. Besides, they are able to fix dinitrogen. In this study, these metals were found to affect these organisms in a variety of concentrations. Such effect could affect the total coliform count in water, dinitrogen fixation, and removable of nitrate in soil and water.

  15. Effects of some metallic compounds on Klebsiella

    SciTech Connect

    Wong, S.H. (Univ. of Regina, Saskatchewan (Canada))

    1988-05-01

    Many industrial and waste disposal practices unconsciously pollute the environment by adding excess heavy metals to it. Although reports show an inconsistency in the toxic levels of heavy metals such as zinc, nickel, cadmium, mercury and silver between microbial groups, the toxic effects of the metals on microorganisms have been well documented. Little is known of the differential effects these metals have on coliform K. pneumoniae and K. oxytoca. These bacteria are widely recognized as antibiotic resistant opportunistic pathogens ubiquitously distributed in environments. Besides, they are able to fix dinitrogen. In this study, these metals were found to affect these organisms in a variety of concentrations. Such effect could affect the total coliform count in water, dinitrogen fixation, and removable of nitrate in soil and water.

  16. Klebsiella spp. as Nosocomial Pathogens: Epidemiology, Taxonomy, Typing Methods, and Pathogenicity Factors

    PubMed Central

    Podschun, R.; Ullmann, U.

    1998-01-01

    Bacteria belonging to the genus Klebsiella frequently cause human nosocomial infections. In particular, the medically most important Klebsiella species, Klebsiella pneumoniae, accounts for a significant proportion of hospital-acquired urinary tract infections, pneumonia, septicemias, and soft tissue infections. The principal pathogenic reservoirs for transmission of Klebsiella are the gastrointestinal tract and the hands of hospital personnel. Because of their ability to spread rapidly in the hospital environment, these bacteria tend to cause nosocomial outbreaks. Hospital outbreaks of multidrug-resistant Klebsiella spp., especially those in neonatal wards, are often caused by new types of strains, the so-called extended-spectrum-?-lactamase (ESBL) producers. The incidence of ESBL-producing strains among clinical Klebsiella isolates has been steadily increasing over the past years. The resulting limitations on the therapeutic options demand new measures for the management of Klebsiella hospital infections. While the different typing methods are useful epidemiological tools for infection control, recent findings about Klebsiella virulence factors have provided new insights into the pathogenic strategies of these bacteria. Klebsiella pathogenicity factors such as capsules or lipopolysaccharides are presently considered to be promising candidates for vaccination efforts that may serve as immunological infection control measures. PMID:9767057

  17. Antimicrobial Effect of the Triterpene 3?,6?,16?-Trihydroxylup-20(29)-ene on Planktonic Cells and Biofilms from Gram Positive and Gram Negative Bacteria

    PubMed Central

    Evaristo, Francisco Flávio Vasconcelos; Albuquerque, Maria Rose Jane R.; dos Santos, Hélcio Silva; Bandeira, Paulo Nogueira; Ávila, Fábio do Nascimento; da Silva, Bruno Rocha; Vasconcelos, Ariana Azevedo; Rabelo, Érica de Menezes; Nascimento-Neto, Luiz Gonzaga; Arruda, Francisco Vassiliepe Sousa; Vasconcelos, Mayron Alves; Carneiro, Victor Alves; Cavada, Benildo Sousa; Teixeira, Edson Holanda

    2014-01-01

    This study evaluated the antimicrobial effect of 3?,6?,16?-trihydroxylup-20(29)-ene (CLF1), a triterpene isolated from Combretum leprosum Mart., in inhibiting the planktonic growth and biofilms of Gram positive bacteria Streptococcus mutans and S. mitis. The antimicrobial activity was assessed by determining the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC). The antibiofilm potential was determined by quantifying total biomass and enumerating biofilm-entrapped viable bacteria. In addition, the acute toxicity of CLF1 on Artemia sp. nauplii was also determined. The results showed that CLF1 was able in inhibiting the growth of S. mutans and S. mitis with MIC and MBC of 7.8??g/mL and 15.6??g/mL, respectively. CLF1 was highly effective on biofilms of both bacteria. Only 7.8??g/mL CLF1 was enough to inhibit by 97% and 90% biomass production of S. mutans and S. mitis, respectively. On the other hand, such effects were not evident on Gram negative Pseudomonas aeruginosa and Klebsiella oxytoca. The toxicity tests showed that the LC50 of CLF1 was 98.19??g/mL. Therefore, CLF1 isolated from C. leprosum may constitute an important natural agent for the development of new therapies for caries and other infectious diseases caused by S. mutans and S. mitis. PMID:25093179

  18. Klebsiella pneumoniae splenic abscess.

    PubMed

    Gill, V; Marzocca, F J; Cunha, B A

    1994-01-01

    Splenic abscesses may be solitary or multiple and are unusual infections. Signs and symptoms are variable and do not always include left upper quadrant pain or tenderness, as the Case Report illustrate. Abscesses of the spleen may occur as a result of endocarditis or from hematogenous seeding from a distant focus of infection. Computed tomographic scan of the spleen is the diagnostic method of choice. We report a case of multiple splenic abscesses caused by Klebsiella pneumoniae that resulted from a Klebsiella urinary tract infection and was successfully managed with antibiotic therapy and splenectomy. PMID:8039997

  19. Cloning, sequencing and characterization of Fnr from Klebsiella pneumoniae

    Microsoft Academic Search

    Roman Grabbe; Anita Kuhn; Ruth A. Schmitz

    2001-01-01

    The transcription factor Fnr (fumarate nitrate reductase regulator) globally regulates gene expression in response to oxygen deprivation in Escherichia coli. We report here the cloning and sequencing of the fnr gene from the facultative anaerobic bacterium Klebsiella pneumoniae M5al, another member of the enteric bacteria. The deduced amino acid sequence of K. pneumoniae fnr showed very high similarity (98% amino

  20. Klebsiella pneumoniae Flocculation Dynamics

    PubMed Central

    Jackson, T. L.; Taylor, K. A.; Thompson, A. P.; Younger, J. G.

    2011-01-01

    The bacterial pathogen Klebsiella pneumoniae is a cause of community- and hospital-acquired lung, urinary tract, and blood stream infections. A common contaminant of indwelling catheters, it is theorized that a common infection pathway for this organism is via shedding of aggregates off of biofilm colonies. In an effort to better understand bacterial proliferation in the host bloodstream, we develop a PDE model for the flocculation dynamics of Klebsiella pneumoniae in suspension. Existence and uniqueness results are provided, as well as a brief description of the numerical approximation scheme. We generate artificial data and illustrate the requirements to accurately identify proliferation, aggregation, and fragmentation of flocs in the experimental domain of interest. PMID:18071828

  1. Diversity of bacteria nesting the plant cover of north Sinai deserts, Egypt

    PubMed Central

    Hanna, Amira L.; Youssef, Hanan H.; Amer, Wafaa M.; Monib, Mohammed; Fayez, Mohammed; Hegazi, Nabil A.

    2012-01-01

    North Sinai deserts were surveyed for the predominant plant cover and for the culturable bacteria nesting their roots and shoots. Among 43 plant species reported, 13 are perennial (e.g. Fagonia spp., Pancratium spp.) and 30 annuals (e.g. Bromus spp., Erodium spp.). Eleven species possessed rhizo-sheath, e.g. Cyperus capitatus, Panicum turgidum and Trisetaria koelerioides. Microbiological analyses demonstrated: the great diversity and richness of associated culturable bacteria, in particular nitrogen-fixing bacteria (diazotrophs); the majority of bacterial residents were of true and/or putative diazotrophic nature; the bacterial populations followed an increasing density gradient towards the root surfaces; sizeable populations were able to reside inside the root (endorhizosphere) and shoot (endophyllosphere) tissues. Three hundred bacterial isolates were secured from studied spheres. The majority of nitrogen-fixing bacilli isolates belonged to Bacillus megaterium,Bacillus pumilus, Bacillus polymexa,Bacillus macerans,Bacillus circulans and Bacillus licheniformis. The family Enterobacteriaceae represented by Enterobacter agglomerans,Enterobacter sackazakii, Enterobacter cloacae, Serratia adorifera,Serratia liquefaciens and Klebsiella oxytoca. The non-Enterobacteriaceae population was rich in Pantoae spp., Agrobacterium rdiobacter, Pseudomonas vesicularis, Pseudomonas putida, Stenotrophomonas maltophilia, Ochrobactrum anthropi, Sphingomonas paucimobilis and Chrysemonas luteola.Gluconacetobacter diazotrophicus were reported inside root and shoot tissues of a number of tested plants. The dense bacterial populations reported speak well to the very possible significant role played by the endophytic bacterial populations in the survival, in respect of nutrition and health, of existing plants. Such groups of diazotrophs are good candidates, as bio-preparates, to support the growth of future field crops grown in deserts of north Sinai and irrigated by the water of El-Salam canal. PMID:25685397

  2. Diversity of bacteria nesting the plant cover of north Sinai deserts, Egypt.

    PubMed

    Hanna, Amira L; Youssef, Hanan H; Amer, Wafaa M; Monib, Mohammed; Fayez, Mohammed; Hegazi, Nabil A

    2013-01-01

    North Sinai deserts were surveyed for the predominant plant cover and for the culturable bacteria nesting their roots and shoots. Among 43 plant species reported, 13 are perennial (e.g. Fagonia spp., Pancratium spp.) and 30 annuals (e.g. Bromus spp., Erodium spp.). Eleven species possessed rhizo-sheath, e.g. Cyperus capitatus, Panicum turgidum and Trisetaria koelerioides. Microbiological analyses demonstrated: the great diversity and richness of associated culturable bacteria, in particular nitrogen-fixing bacteria (diazotrophs); the majority of bacterial residents were of true and/or putative diazotrophic nature; the bacterial populations followed an increasing density gradient towards the root surfaces; sizeable populations were able to reside inside the root (endorhizosphere) and shoot (endophyllosphere) tissues. Three hundred bacterial isolates were secured from studied spheres. The majority of nitrogen-fixing bacilli isolates belonged to Bacillus megaterium, Bacillus pumilus, Bacillus polymexa, Bacillus macerans, Bacillus circulans and Bacillus licheniformis. The family Enterobacteriaceae represented by Enterobacter agglomerans, Enterobacter sackazakii, Enterobacter cloacae, Serratia adorifera, Serratia liquefaciens and Klebsiella oxytoca. The non-Enterobacteriaceae population was rich in Pantoae spp., Agrobacterium rdiobacter, Pseudomonas vesicularis, Pseudomonas putida, Stenotrophomonas maltophilia, Ochrobactrum anthropi, Sphingomonas paucimobilis and Chrysemonas luteola. Gluconacetobacter diazotrophicus were reported inside root and shoot tissues of a number of tested plants. The dense bacterial populations reported speak well to the very possible significant role played by the endophytic bacterial populations in the survival, in respect of nutrition and health, of existing plants. Such groups of diazotrophs are good candidates, as bio-preparates, to support the growth of future field crops grown in deserts of north Sinai and irrigated by the water of El-Salam canal. PMID:25685397

  3. Effect of Algae and Plant Lectins on Planktonic Growth and Biofilm Formation in Clinically Relevant Bacteria and Yeasts

    PubMed Central

    Vasconcelos, Mayron Alves; Arruda, Francisco Vassiliepe Sousa; Carneiro, Victor Alves; Silva, Helton Colares; Nascimento, Kyria Santiago; Sampaio, Alexandre Holanda; Cavada, Benildo; Teixeira, Edson Holanda; Henriques, Mariana

    2014-01-01

    This study aimed to evaluate the abilities of plant and algae lectins to inhibit planktonic growth and biofilm formation in bacteria and yeasts. Initially, ten lectins were tested on Staphylococcus epidermidis, Staphylococcus aureus, Klebsiella oxytoca, Pseudomonas aeruginosa, Candida albicans, and C. tropicalis at concentrations of 31.25 to 250??g/mL. The lectins from Cratylia floribunda (CFL), Vatairea macrocarpa (VML), Bauhinia bauhinioides (BBL), Bryothamnion seaforthii (BSL), and Hypnea musciformis (HML) showed activities against at least one microorganism. Biofilm formation in the presence of the lectins was also evaluated; after 24?h of incubation with the lectins, the biofilms were analyzed by quantifying the biomass (by crystal violet staining) and by enumerating the viable cells (colony-forming units). The lectins reduced the biofilm biomass and/or the number of viable cells to differing degrees depending on the microorganism tested, demonstrating the different characteristics of the lectins. These findings indicate that the lectins tested in this study may be natural alternative antimicrobial agents; however, further studies are required to better elucidate the functional use of these proteins. PMID:24982871

  4. Duodenal-Mucosal Bacteria Associated with Celiac Disease in Children

    PubMed Central

    Sánchez, Ester; Donat, Ester; Ribes-Koninckx, Carmen; Fernández-Murga, Maria Leonor

    2013-01-01

    Celiac disease (CD) is an immune-mediated enteropathy triggered by the ingestion of cereal gluten proteins. This disorder is associated with imbalances in the gut microbiota composition that could be involved in the pathogenesis of CD. The aim of this study was to characterize the composition and diversity of the cultivable duodenal mucosa-associated bacteria of CD patients and control children. Duodenal biopsy specimens from patients with active disease on a gluten-containing diet (n = 32), patients with nonactive disease after adherence to a gluten-free diet (n = 17), and controls (n = 8) were homogenized and plated on plate count agar, Wilkins-Chalgren agar, brain heart agar, or yeast, Casitone, and fatty acid agar. The isolates were identified by partial 16S rRNA gene sequencing. Renyi diversity profiles showed the highest diversity values for active CD patients, followed by nonactive CD patients and control individuals. Members of the phylum Proteobacteria were more abundant in patients with active CD than in the other child groups, while those of the phylum Firmicutes were less abundant. Members of the families Enterobacteriaceae and Staphylococcaceae, particularly the species Klebsiella oxytoca, Staphylococcus epidermidis, and Staphylococcus pasteuri, were more abundant in patients with active disease than in controls. In contrast, members of the family Streptococcaceae were less abundant in patients with active CD than in controls. Furthermore, isolates of the Streptococcus anginosus and Streptococcus mutans groups were more abundant in controls than in both CD patient groups, regardless of inflammatory status. The findings indicated that the disease is associated with the overgrowth of possible pathobionts that exclude symbionts or commensals that are characteristic of the healthy small intestinal microbiota. PMID:23835180

  5. Rapid Identification of Carbapenemase Genes in Gram-Negative Bacteria with an Oligonucleotide Microarray-Based Assay

    PubMed Central

    Braun, Sascha D.; Monecke, Stefan; Thürmer, Alexander; Ruppelt, Antje; Makarewicz, Oliwia; Pletz, Mathias; Reißig, Annett; Slickers, Peter; Ehricht, Ralf

    2014-01-01

    Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well as selected extended (ESBL) and narrow spectrum (NSBL) beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13), blaGIM (2/2), blaKPC (27/27), blaNDM (5/5), blaIMP-2/4/7/8/13/14/15/16/31 (10/10), blaOXA-23 (12/13), blaOXA-40-group (7/7), blaOXA-48-group (32/33), blaOXA-51 (1/1) and blaOXA-58 (1/1). Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16), blaOXA-2 (4/4), blaOXA-9 (33/33), OXA-10 (3/3), blaOXA-51 (25/25), blaOXA-58 (2/2), CTX-M1/M15 (17/17) and blaVIM (1/1)]. In direct comparison to phenotypical identification obtained by VITEK or MALDI-TOF systems, 114 of 117 (97.4%) isolates, including Acinetobacter baumannii (28/28), Enterobacter spec. (5/5), Escherichia coli (4/4), Klebsiella pneumoniae (62/63), Klebsiella oxytoca (0/2), Pseudomonas aeruginosa (12/12), Citrobacter freundii (1/1) and Citrobacter braakii (2/2), were correctly identified by a panel of species specific probes. This assay might be easily extended, adapted and transferred to point of care platforms enabling fast surveillance, rapid detection and appropriate early treatment of infections caused by multiresistant Gram-negative bacteria. PMID:25068267

  6. Bacteria, toxins, and the peritoneum

    Microsoft Academic Search

    Toni Hau

    1990-01-01

    Intraperitoneal infections are caused by members of the gastrointestinal flora, mainlyEscherichia coli, enterococci, Klebsiella, Enterobacter, Proteus, Bacteroides, anaerobic cocci, Clostridia, and Fusobacteria. The Gram-negative aerobic bacteria exert their pathogenic potential mainly through endotoxin which acts by way of mediators, causing systemic septic response and, initially, the local response of the peritoneal cavity. The main virulence factors of anaerobic bacteria are

  7. Genetic organization of transposase regions surrounding blaKPC carbapenemase genes on plasmids from Klebsiella strains isolated in a New York City hospital.

    PubMed

    Gootz, Thomas D; Lescoe, Mary Kay; Dib-Hajj, Fadia; Dougherty, Brian A; He, Wen; Della-Latta, Phyllis; Huard, Richard C

    2009-05-01

    Carbapenem-resistant Klebsiella strains carrying Klebsiella pneumoniae carbapenemases (KPC) are endemic to New York City and are spreading across the United States and internationally. Recent studies have indicated that the KPC structural gene is located on a 10-kb plasmid-borne element designated Tn4401. Fourteen Klebsiella pneumoniae strains and one Klebsiella oxytoca strain isolated at a New York City hospital in 2005 carrying either bla(KPC-2) or bla(KPC-3) were examined for isoforms of Tn4401. Ten of the Klebsiella strains contained a 100-bp deletion in Tn4401, corresponding to the Tn4401a isoform. The presence of this deletion adjacent to the upstream promoter region of bla(KPC) in Tn4401a resulted in a different -35 promoter sequence of TGGAGA than that of CTGATT present in isoform Tn4401b. Complete sequencing of one plasmid carrying bla(KPC) from each of three nonclonal isolates indicated the presence of genes encoding other types of antibiotic resistance determinants. The 70.6-kb plasmid from K. pneumoniae strain S9 carrying bla(KPC-2) revealed two identical copies of Tn4401b inserted in an inverse fashion, but in this case, one of the elements disrupted a group II self-splicing intron. In K. pneumoniae strain S15, the Tn4401a element carrying bla(KPC-2) was found on both a large 120-kb plasmid and a smaller 24-kb plasmid. Pulsed-field gel electrophoresis results indicate that the isolates studied represent a heterogeneous group composed of unrelated as well as closely related Klebsiella strains. Our results suggest that endemic KPC-positive Klebsiella strains constitute a generally nonclonal population comprised of various alleles of bla(KPC) on several distinct plasmid genetic backgrounds. This study increases our understanding of the genetic composition of the evolving and expanding role of KPC-producing, healthcare-associated, gram-negative pathogens. PMID:19258268

  8. Worldwide emergence of colistin resistance in Klebsiella pneumoniae from healthy humans and patients in Lao PDR, Thailand, Israel, Nigeria and France owing to inactivation of the PhoP/PhoQ regulator mgrB: an epidemiological and molecular study.

    PubMed

    Olaitan, Abiola Olumuyiwa; Diene, Seydina M; Kempf, Marie; Berrazeg, Meryem; Bakour, Sofiane; Gupta, Sushim Kumar; Thongmalayvong, Boupha; Akkhavong, Kongsap; Somphavong, Silaphet; Paboriboune, Phimpha; Chaisiri, Kittipong; Komalamisra, Chalit; Adelowo, Olawale Olufemi; Fagade, Obasola Ezekiel; Banjo, Omowunmi Abosede; Oke, Adeyeye James; Adler, Amos; Assous, Marc Victor; Morand, Serge; Raoult, Didier; Rolain, Jean-Marc

    2014-12-01

    The emergence of colistin-resistant Klebsiella pneumoniae (CRKP) is a major public health concern worldwide. In this study, the prevalence and molecular basis of colistin resistance in CRKP isolated from healthy individuals and patients in Lao PDR, Thailand, Nigeria and France were investigated. Stool samples were screened by culture for the presence of colistin-resistant Klebsiella spp. Whole-genome sequence analysis was used to decipher the molecular mechanism of colistin resistance in a blaNDM-1-positive in vitro-selected CRKP mutant. PCR amplification and sequencing of the mgrB genetic environment was performed for all CRKP isolates as well as control colistin-susceptible K. pneumoniae (CSKP) isolates recovered from the same stools. A total of 869 stool samples were screened for colistin-resistant Klebsiella spp., yielding 32 CRKP and 2 colistin-resistant Klebsiella oxytoca. Comparative whole-genome sequence analysis revealed that an in vitro-selected CRKP mutant had an insertion sequence in its mgrB gene, as well as missense mutations in other selected clones. Of the 34 colistin-resistant Klebsiella spp. isolates, 14 (41.2%; 13 CRKP and 1 K. oxytoca) from the four countries also had various defects in their mgrB genes, but no such defects were found in the CSKP controls (P<10(-4)). Few mutations were observed in pmrAB compared with mgrB among the CRKP isolates. The worldwide emergence of CRKP is a major public health concern. Detection and surveillance of such strains are warranted to prevent an uncontrollable pandemic. Inactivation of the PhoP/PhoQ regulator gene mgrB is associated with ?40% of colistin resistance among the CRKP isolates observed in this study. PMID:25264127

  9. Occurrence of extended spectrum beta-lactamase enzymes in clinical isolates of Klebsiella species from Harar region, eastern Ethiopia.

    PubMed

    Seid, Jemal; Asrat, Daniel

    2005-08-01

    Extended Spectrum beta-Lactamases (ESBLs) producer and multidrug resistant Klebsiella spp. are becoming a major nosocomial pathogen globally. There are no documented reports yet on the occurrence of ESBL enzymes in Klebsiella spp. species from Ethiopia. This study was undertaken to isolate and determine the occurrence of ESBLs and multi-drug resistant Klebsiella spp. in different clinical samples obtained from patients. A cross-sectional survey was conducted in four different hospitals of Harar region (Hiwot Fana, Misrak-Arbegnoch, Police and Army) from December 2003 to February 2004. Three hundred and eighty four clinical specimens (202 sputum, 164 urine and 18 pus) were collected from patients admitted in different wards. Antimicrobial susceptibilities were performed on 57 clinical isolates by standard disk diffusion procedures against eight antimicrobial agents. The ESBLs detection was made by using cefotaxime and ceftazidime alone and in combination with clavulanate. A total of 57 (15%) Klebsiella spp. were isolated from 384 patients. Of the 57 isolates, 33 (58%) were from sputum, 18 (31.5%) from urine and 6 (10.5%) from pus. Of the 57 Klebsiella spp., 54 (94.7%) were identified as K. pneumoniae and 3 (5.3%) as K. oxytoca. Resistance was found against cephalosporins [cefotaxime (39.0%), cefoxitin (39.0%), ceftazidime (40.0%), ceftriaxone (40.0%), cephalothin (42.0%)], chloramphenicol (70.0%), gentamicin (61.0%) and trimethoprim-sulphamethoxazole (65.0%). Analyzed Klebsiella isolates were characterized also by a high degree of multi-resistance (67.0%). In 19/57 (33.3%) of the Klebsiella isolates, ESBL production was detected. Rates of detection of ESBL producers were 42.1, 26.3, 26.3 and 5.3% in Hiwot-Fana, Misrak-Arbegnoch, Police and Army hospitals, respectively. Multi-drug resistant isolates were more prevalent among the ESBLs producers (95.0%) than non-producers (53.0%) (p=0.24). In conclusion, our results show that awareness of ESBL production by Klebsiella spp. is clinically important. In the absence of infection control measures, ESBL producing organisms readily pass horizontally from patient to patient. These strains also transiently colonize the hands of hospital staff members, thereby facilitating patient-to-patient transmission of the organism. PMID:15993831

  10. Hypervirulent (hypermucoviscous) Klebsiella pneumoniae

    PubMed Central

    Shon, Alyssa S.; Bajwa, Rajinder P.S.; Russo, Thomas A.

    2013-01-01

    A new hypervirulent (hypermucoviscous) variant of Klebsiella pneumoniae has emerged. First described in the Asian Pacific Rim, it now increasingly recognized in Western countries. Defining clinical features are the ability to cause serious, life-threatening community-acquired infection in younger healthy hosts, including liver abscess, pneumonia, meningitis and endophthalmitis and the ability to metastatically spread, an unusual feature for enteric Gram-negative bacilli in the non-immunocompromised. Despite infecting a healthier population, significant morbidity and mortality occurs. Although epidemiologic features are still being defined, colonization, particularly intestinal colonization, appears to be a critical step leading to infection. However the route of entry remains unclear. The majority of cases described to date are in Asians, raising the issue of a genetic predisposition vs. geospecific strain acquisition. The traits that enhance its virulence when compared with “classical” K. pneumoniae are the ability to more efficiently acquire iron and perhaps an increase in capsule production, which confers the hypermucoviscous phenotype. An objective diagnostic test suitable for routine use in the clinical microbiology laboratory is needed. If/when these strains become increasingly resistant to antimicrobials, we will be faced with a frightening clinical scenario. PMID:23302790

  11. Role of Antibiotic Penetration Limitation in Klebsiella pneumoniae Biofilm Resistance to Ampicillin and Ciprofloxacin

    Microsoft Academic Search

    JEFF N. ANDERL; MICHAEL J. FRANKLIN; PHILIP S. STEWART

    2000-01-01

    The penetration of two antibiotics, ampicillin and ciprofloxacin, through biofilms developed in an in vitro model system was investigated. The susceptibilities of biofilms and corresponding freely suspended bacteria to killing by the antibiotics were also measured. Biofilms of Klebsiella pneumoniae were developed on microporous membranes resting on agar nutrient medium. The susceptibilities of planktonic cultures and biofilms to 10 times

  12. Complete Genome Sequence of a Klebsiella pneumoniae Strain Isolated from a Known Cotton Insect Boll Vector.

    PubMed

    Medrano, Enrique G; Forray, Marissa M; Bell, Alois A

    2014-01-01

    Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the bases of cotton pathogenesis by bacteria associated with vectors. PMID:25146146

  13. Mechanisms of Sodium Transport in Bacteria

    Microsoft Academic Search

    P. Dimroth

    1990-01-01

    In some bacteria, an Na^+ circuit is an important link between exergonic and endergonic membrane reactions. The physiological importance of Na^+ ion cycling is described in detail for three different bacteria. Klebsiella pneumoniae fermenting citrate pumps Na^+ outwards by oxaloacetate decarboxylase and uses the Na^+ ion gradient thus established for citrate uptake. Another possible function of the Na^+ gradient may

  14. Bacteriocin (klebocin) sensitivity typing of klebsiella.

    PubMed

    Buffenmyer, C L; Rycheck, R R; Yee, R B

    1976-09-01

    High-titer preparations of Klebsiella bacteriocins (klebocins) were obtained by using mitomycin to induce standard strains of Klebsiella. Of 296 clinical isolates of Klebsiella, 67% could be typed on the basis of their sensitivity to klebocins. The method proposed in this paper affords a standard basis for the further development of klebocin typing as a suitable procedure for hospital laboratories concerned with epidemiological investigations of hospital-associated infections. Evidence is also provided to show that high-titered klebocin typing can be used in conjunction with biochemical typing to provide a sensitive epidemiological marker for Klebsiella. PMID:972191

  15. [An outbreak of Klebsiella pneumoniae mastitis].

    PubMed

    Sampimon, O C; Sol, J; Kock, P A

    2006-01-01

    A serious outbreak of mastitis caused by Klebsiella pneumoniae is described. Shortly after drying off, three cows died of mastitis caused by Klebsiella pneumoniae and five other cows became seriously ill but survived. Sawdust contiminated with Klebsiella pneumoniae was identified as the most likely source of these infections. In addition to detection of possible sources of infection, another important aspect of eradication is the detection of quarters infected with Klebsiella pneumoniae. Rigorous application of these measures led to resolution of the outbreak within a few months. PMID:16430158

  16. Immobilization of enzymes for Klebsiella BOD sensor

    Microsoft Academic Search

    Mal-Nam Kim; Kyoung-Hwa Park

    2004-01-01

    Klebsiella sp. was isolated from the activated sludge of a wastewater disposal facility treating wastewater contaminated with highly concentrated lactose. A BOD probe loaded with Klebsiella sp. showed an improved performance for lactose detection, however, the sensitivity of the microbial BOD sensor toward glucose or fructose was still higher than that corresponding to lactose. Accordingly, an enzyme capable of hydrolyzing

  17. Klebsiella pneumoniae: a progression to multidrug resistance 

    E-print Network

    Findlay, Jacqueline

    2012-06-22

    Klebsiella pneumoniae is a common cause of nosocomial and community-acquired infections, and the increasing incidence and prevalence of antibiotic resistant strains is proving to be particularly problematic to clinicians. ...

  18. Electricity generation from glucose by a Klebsiella sp. in microbial fuel cells

    Microsoft Academic Search

    Xue Xia; Xiao-xin Cao; Peng Liang; Xia Huang; Su-ping Yang; Gen-gui Zhao

    2010-01-01

    As electrochemically active bacteria play an important role in microbial fuel cells (MFCs), it is necessary to get a comprehensive\\u000a understanding of their electrogenesis mechanisms. In this study, a new electrochemically active bacterium, Klebsiella sp. ME17, was employed into an “H” typed MFC for electrogenesis, with glucose as the electron donor. The maximum power density\\u000a was 1,209 mW\\/m2 at a resistance

  19. Evaluation of an Automated Rapid Diagnostic Assay for Detection of Gram-Negative Bacteria and Their Drug-Resistance Genes in Positive Blood Cultures

    PubMed Central

    Tojo, Masayoshi; Fujita, Takahiro; Ainoda, Yusuke; Nagamatsu, Maki; Hayakawa, Kayoko; Mezaki, Kazuhisa; Sakurai, Aki; Masui, Yoshinori; Yazaki, Hirohisa; Takahashi, Hiroshi; Miyoshi-Akiyama, Tohru; Totsuka, Kyoichi; Kirikae, Teruo; Ohmagari, Norio

    2014-01-01

    We evaluated the performance of the Verigene Gram-Negative Blood Culture Nucleic Acid Test (BC-GN; Nanosphere, Northbrook, IL, USA), an automated multiplex assay for rapid identification of positive blood cultures caused by 9 Gram-negative bacteria (GNB) and for detection of 9 genes associated with ?-lactam resistance. The BC-GN assay can be performed directly from positive blood cultures with 5 minutes of hands-on and 2 hours of run time per sample. A total of 397 GNB positive blood cultures were analyzed using the BC-GN assay. Of the 397 samples, 295 were simulated samples prepared by inoculating GNB into blood culture bottles, and the remaining were clinical samples from 102 patients with positive blood cultures. Aliquots of the positive blood cultures were tested by the BC-GN assay. The results of bacterial identification between the BC-GN assay and standard laboratory methods were as follows: Acinetobacter spp. (39 isolates for the BC-GN assay/39 for the standard methods), Citrobacter spp. (7/7), Escherichia coli (87/87), Klebsiella oxytoca (13/13), and Proteus spp. (11/11); Enterobacter spp. (29/30); Klebsiella pneumoniae (62/72); Pseudomonas aeruginosa (124/125); and Serratia marcescens (18/21); respectively. From the 102 clinical samples, 104 bacterial species were identified with the BC-GN assay, whereas 110 were identified with the standard methods. The BC-GN assay also detected all ?-lactam resistance genes tested (233 genes), including 54 blaCTX-M, 119 blaIMP, 8 blaKPC, 16 blaNDM, 24 blaOXA-23, 1 blaOXA-24/40, 1 blaOXA-48, 4 blaOXA-58, and 6 blaVIM. The data shows that the BC-GN assay provides rapid detection of GNB and ?-lactam resistance genes in positive blood cultures and has the potential to contributing to optimal patient management by earlier detection of major antimicrobial resistance genes. PMID:24705449

  20. Auxin, Gibberellin, Cytokinin and Abscisic Acid Production in Some Bacteria

    Microsoft Academic Search

    A. Karadeniz; ?. F. Topcuo?lu; S. ?nan

    2006-01-01

    Summary  In this study, auxin (indole-3-acetic acid), gibberellin, cytokinin (zeatin) and abscisic acid production were investigated in the culture medium of the bacteria Proteus mirabilis, P. vulgaris, Klebsiella pneumoniae, Bacillus megaterium, B. cereus, Escherichia coli. To determine the levels of these plant growth regulators, high performance liquid chromatography (HPLC) technique was used. Our findings show that the bacteria used in this

  1. Emergence of OXA-162-producing Klebsiella pneumoniae in Hungary.

    PubMed

    Jánvári, Laura; Damjanova, Ivelina; Lázár, Andrea; Rácz, Katalin; Kocsis, Béla; Urbán, Edit; Tóth, Ákos

    2014-04-01

    In August 2012, 2 carbapenem-resistant Klebsiella pneumoniae isolates from the University of Szeged were submitted to the National Reference Laboratory at the National Centre for Epidemiology to confirm the carbapenem resistance mechanism. PCR assays and sequencing revealed that the isolates harboured the blaOXA-162 carbapenemase gene, a very recently described variant of OXA-48, and the blaCTX-M-15 extended-spectrum ?-lactamase gene. The isolates had indistinguishable PFGE patterns and belonged to sequence type ST15. To the best of our knowledge, this is the first description of OXA-48-like carbapenemase-producing bacteria in Hungary and of an OXA-162-type carbapenemase gene in the K. pneumoniae ST15 clone. PMID:24552581

  2. Complete Genome Sequence of the N2Fixing Broad Host Range Endophyte Klebsiella pneumoniae 342 and Virulence Predictions Verified in Mice

    Microsoft Academic Search

    Derrick E. Fouts; Heather L. Tyler; Robert T. DeBoy; Sean Daugherty; Qinghu Ren; Jonathan H. Badger; Anthony S. Durkin; Heather Huot; Susmita Shrivastava; Sagar Kothari; Robert J. Dodson; Yasmin Mohamoud; Hoda Khouri; Luiz F. W. Roesch; Karen A. Krogfelt; Carsten Struve; Eric W. Triplett; Barbara A. Methé

    2008-01-01

    We report here the sequencing and analysis of the genome of the nitrogen-fixing endophyte, Klebsiella pneumoniae 342. Although K. pneumoniae 342 is a member of the enteric bacteria, it serves as a model for studies of endophytic, plant-bacterial associations due to its efficient colonization of plant tissues (including maize and wheat, two of the most important crops in the world),

  3. Plasmid-Mediated Antibiotic Resistance and Virulence in Gram-negatives: the Klebsiella pneumoniae Paradigm

    PubMed Central

    Ramirez, Maria S.; Traglia, German M.; Lin, David L.; Tran, Tung; Tolmasky, Marcelo E.

    2015-01-01

    Summary Plasmids harbor genes coding for specific functions including virulence factors and antibiotic resistance that permit bacteria to survive the hostile environment found in the host and resist treatment. Together with other genetic elements such as integrons and transposons, and using a variety of mechanisms, plasmids participate in the dissemination of these traits resulting in the virtual elimination of barriers among different kinds of bacteria. In this article we review the current information about physiology and role in virulence and antibiotic resistance of plasmids from the gram-negative opportunistic pathogen Klebsiella pneumoniae. This bacterium has acquired multidrug resistance and is the causative agent of serious communityand hospital-acquired infections. It is also included in the recently defined ESKAPE group of bacteria that cause most of US hospital infections. PMID:25705573

  4. KPC2-producing Klebsiella pneumoniae isolated from a Czech patient previously hospitalized in Greece and in vivo selection of colistin resistance

    Microsoft Academic Search

    Jaroslav Hrabák; Jana Niemczyková; Eva Chudá?ková; Marta Fridrichová; Vendula Študentová; Dana ?ervená; Pavla Urbášková; Helena Žemli?ková

    2011-01-01

    Carbapenemase-producing Gram-negative bacteria peak clinical interest due to their ability to hydrolyze most ?-lactams, including\\u000a carbapenems; moreover, their genes spread through bacterial populations by horizontal transfer. Bacteria with acquired carbapenemase\\u000a have sporadically been reported in the Czech Republic, so far only in Enterobacteriaceae and Pseudomonas aeruginosa. In this study, we described the first finding of a KPC-2-producing strain of Klebsiella

  5. Specific Modification of a Na+ Binding Site in NADH:Quinone Oxidoreductase from Klebsiella pneumoniae with Dicyclohexylcarbodiimide

    Microsoft Academic Search

    Irini Vgenopoulou; Anja C. Gemperli; Julia Steuber

    2006-01-01

    Received 16 September 2005\\/Accepted 13 February 2006 The respiratory NADH:quinone oxidoreductase (complex I) (NDH-1) is a multisubunit enzyme that trans- locates protons (or in some cases Na) across energy-conserving membranes from bacteria or mitochondria. We studied the reaction of the Na-translocating complex I from the enterobacterium Klebsiella pneumoniae with N,N-dicyclohexylcarbodiimide (DCCD), with the aim of identifying a subunit critical for

  6. Formation of a new oxidative metabolite from kobophenol A by human intestinal bacterium Klebsiella pneumoniae.

    PubMed

    Liang, Gaolin; Qian, Lisheng; Cui, Yiling; Hu, Changqi

    2005-04-01

    During our studies on the metabolism of kobophenol A (1) in rats, we had isolated, purified, and identified the main new oxidative metabolite of 1, koboquinone A (2) from rats' feces. To elucidate the metabolic pathway of 1 in rats, we conducted the in vitro metabolic experiments of 1 by human intestinal bacteria and found that Klebsiella pneumoniae produced appreciable amounts of 2. This was verified by means of high performance liquid chromatography mass/mass spectrometry (HPLC/MS/MS) analysis. PMID:17191999

  7. The function of ubiquinone in Klebsiella aerogenes

    Microsoft Academic Search

    Dick L. Knook; Rudi J. Planta

    1973-01-01

    1.Membranes fromKlebsiella aerogenes were used to study the reaction site and possible functional heterogeneity of ubiquinone participating in electron transport to both oxygen and nitrate.2.Ubiquinone-8 was found to be present in great molar excess as compared with the other electron transport carriers. Pentane extraction of ubiquinoe resulted in a decrease in the level of reduction of cytochromeb in the aerobic

  8. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a) Identification....

  9. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a) Identification....

  10. Emergence of DHA-1-Producing Klebsiella spp. in the Parisian Region: Genetic Organization of the ampC and ampR Genes Originating from Morganella morganii

    PubMed Central

    Verdet, Charlotte; Benzerara, Yahia; Gautier, Valérie; Adam, Olivier; Ould-Hocine, Zahia; Arlet, Guillaume

    2006-01-01

    Eleven Klebsiella pneumoniae clinical isolates and one Klebsiella oxytoca clinical isolate showing various pulsed-field gel electrophoresis types and producing an inducible DHA-1 class C ?-lactamase were isolated in the Parisian region between 1998 and 2003. The aim of this study was to compare the genetic organization of the blaDHA-1 genes in this collection of clinical isolates. In four isolates, the Morganella morganii-derived genomic region containing blaDHA-1 was inserted in an entire complex sul1-type integron, including a region common to In6-In7 (CR1), as previously described in a blaDHA-1-producing Salmonella enterica serovar Enteritidis KF92 isolate from Saudi Arabia in 1992. Different gene cassette arrays were characterized in each of these integrons. In two of them, an additional 10-kb fragment was inserted between the CR1 and the M. morganii-derived region and was similar to the sap (ABC transporter family) and psp (phage shock protein) operons originated from Salmonella enterica serovar Typhimurium. The length of the M. morganii region was variable, suggesting that several independent recombination events have occurred and that open reading frame orf513 encodes a recombinase involved in the mobilization of the resistance genes. The genetic organization of blaDHA-1 was identical in the eight other isolates. This structure is likely derived from a complex integron following the insertion of IS26, leading to the deletion of the first part of integron. The horizontal transfer of one plasmid carrying that truncated integron was shown for seven of these isolates. PMID:16436717

  11. Emergence of DHA-1-producing Klebsiella spp. in the Parisian region: genetic organization of the ampC and ampR genes originating from Morganella morganii.

    PubMed

    Verdet, Charlotte; Benzerara, Yahia; Gautier, Valérie; Adam, Olivier; Ould-Hocine, Zahia; Arlet, Guillaume

    2006-02-01

    Eleven Klebsiella pneumoniae clinical isolates and one Klebsiella oxytoca clinical isolate showing various pulsed-field gel electrophoresis types and producing an inducible DHA-1 class C beta-lactamase were isolated in the Parisian region between 1998 and 2003. The aim of this study was to compare the genetic organization of the bla(DHA-1) genes in this collection of clinical isolates. In four isolates, the Morganella morganii-derived genomic region containing bla(DHA-1) was inserted in an entire complex sul1-type integron, including a region common to In6-In7 (CR1), as previously described in a bla(DHA-1)-producing Salmonella enterica serovar Enteritidis KF92 isolate from Saudi Arabia in 1992. Different gene cassette arrays were characterized in each of these integrons. In two of them, an additional 10-kb fragment was inserted between the CR1 and the M. morganii-derived region and was similar to the sap (ABC transporter family) and psp (phage shock protein) operons originated from Salmonella enterica serovar Typhimurium. The length of the M. morganii region was variable, suggesting that several independent recombination events have occurred and that open reading frame orf513 encodes a recombinase involved in the mobilization of the resistance genes. The genetic organization of bla(DHA-1) was identical in the eight other isolates. This structure is likely derived from a complex integron following the insertion of IS26, leading to the deletion of the first part of integron. The horizontal transfer of one plasmid carrying that truncated integron was shown for seven of these isolates. PMID:16436717

  12. BOGUS BACTERIA...

    NSDL National Science Digital Library

    Mrs. Deaton

    2007-01-24

    Here are some websites to get you started... Just click on the links and start searching! microbe world- bacteria Bacteria Rule Quiz! Bacteria.... Harmful Bacteria Bacteria Museum Bacteria! Microbes- all sorts of info... When you are finished looking at the sites or when you have enough information concerning bacteria, ask Mrs. Deaton for some books that can give you even more DETAIL!!! *Don\\'t forget to keep track of your information on your I-CHARTS... ...

  13. Anti-Biofilm Activity: A Function of Klebsiella pneumoniae Capsular Polysaccharide

    PubMed Central

    Dos Santos Goncalves, Marina; Delattre, Cédric; Balestrino, Damien; Charbonnel, Nicolas; Elboutachfaiti, Redouan; Wadouachi, Anne; Badel, Stéphanie; Bernardi, Thierry; Michaud, Philippe; Forestier, Christiane

    2014-01-01

    Competition and cooperation phenomena occur within highly interactive biofilm communities and several non-biocides molecules produced by microorganisms have been described as impairing biofilm formation. In this study, we investigated the anti-biofilm capacities of an ubiquitous and biofilm producing bacterium, Klebsiella pneumoniae. Cell-free supernatant from K. pneumoniae planktonic cultures showed anti-biofilm effects on most Gram positive bacteria tested but also encompassed some Gram negative bacilli. The anti-biofilm non-bactericidal activity was further investigated on Staphylococcus epidermidis, by determining the biofilm biomass, microscopic observations and agglutination measurement through a magnetic bead-mediated agglutination test. Cell-free extracts from K. pneumoniae biofilm (supernatant and acellular matrix) also showed an influence, although to a lesser extend. Chemical analyses indicated that the active molecule was a high molecular weight polysaccharide composed of five monosaccharides: galactose, glucose, rhamnose, glucuronic acid and glucosamine and the main following sugar linkage residues [?2)-?-l-Rhap-(1?]; [?4)-?-l-Rhap-(1?]; [?-d-Galp-(1?]; [?2,3)-?-d-Galp-(1?]; [?3)-?-d-Galp-(1?] and, [?4)-?-d-GlcAp-(1?]. Characterization of this molecule indicated that this component was more likely capsular polysaccharide (CPS) and precoating of abiotic surfaces with CPS extracts from different serotypes impaired the bacteria-surface interactions. Thus the CPS of Klebsiella would exhibit a pleiotropic activity during biofilm formation, both stimulating the initial adhesion and maturation steps as previously described, but also repelling potential competitors. PMID:24932475

  14. Normal anti-Klebsiella lymphocytotoxicity in ankylosing spondylitis

    SciTech Connect

    Kinsella, T.D.; Fritzler, M.J.; Lewkonia, R.M.

    1986-03-01

    We compared in vitro lymphocytotoxicity (LCT) of peripheral blood lymphocytes (PBL), obtained from patients with ankylosing spondylitis (AS) and normal controls (NC). Assays were performed with antibacterial antisera prepared from AS- and NC-derived Klebsiella and coliforms Escherichia coli. LCT assessed by eosin staining was not significantly different in PBL of 12 AS patients and 28 controls when reacted with 3 Klebsiella and 1 E coli antisera. LCT assessed by /sup 51/Cr release was not significantly different for PBL of 20 age- and sex-matched pairs of AS patients and NC when reacted with 3 Klebsiella and 1 E coli antisera. Similarly, LCT-/sup 51/Cr of PBL of 15 matched AS and NC pairs was not significantly different for anti-K21, a serotype putatively implicated in Klebsiella-HLA-B27 antigenic cross-reactivity. Our results do not support the notion of molecular mimicry between Klebsiella and B27 in the pathogenesis of primary AS.

  15. Hands as route of transmission for Klebsiella species.

    PubMed Central

    Casewell, M; Phillips, I

    1977-01-01

    Seventeen per cent of the staff of an intensive care ward were found to have Klebsiella spp contaminating their hands, and these strains could be related to serotypes infecting or colonising patients in the ward on the same day. We identified some simple ward procedures that resulted in contamination of nurses' hands with 100-1000 klebsiellae per hand. Klebsiellae survived on artifically inoculated hands for up to 150 minutes. Handwashing with chlorhexidine hand cleanser reliably gave 98-100% reduction in hand counts, and the introduction of routine handwashing by staff before moving from one patient to the next was associated with a significant and sustained reduction in the number of patients colonised or infected with Klebsiella spp. Staff clothing was occasionally contaminated, but ward air and dust rarely contained klebsiellae. PMID:589166

  16. Small Molecule Suppression of Carbapenem Resistance in NDM-1 Producing Klebsiella pneumoniae

    PubMed Central

    2012-01-01

    The already considerable global public health threat of multidrug-resistant Gram-negative bacteria has become even more of a concern following the emergence of New Delhi metallo-?-lactamase (NDM-1) producing strains of Klebsiella pneumoniae and other Gram-negative bacteria. As an alternative approach to the traditional development of new bactericidal entities, we have identified a 2-aminoimidazole-derived small molecule that acts as an antibiotic adjuvant and is able to suppress resistance of a NDM-1 producing strain of K. pneumoniae to imipenem and meropenem, in addition to suppressing resistance of other ?-lactam nonsusceptible K. pneumoniae strains. The small molecule is able to lower carbapenem minimum inhibitory concentrations by up to 16-fold, while exhibiting little bactericidal activity itself. PMID:22844552

  17. Description of Klebsiella quasipneumoniae sp. nov., isolated from human infections, with two subspecies, Klebsiella quasipneumoniae subsp. quasipneumoniae subsp. nov. and Klebsiella quasipneumoniae subsp. similipneumoniae subsp. nov., and demonstration that Klebsiella singaporensis is a junior heterotypic synonym of Klebsiella variicola.

    PubMed

    Brisse, Sylvain; Passet, Virginie; Grimont, Patrick A D

    2014-09-01

    Strains previously classified as members of Klebsiella pneumoniae phylogroups KpI, KpII-A, KpII-B and KpIII were characterized by 16S rRNA (rrs) gene sequencing, multilocus sequence analysis based on rpoB, fusA, gapA, gyrA and leuS genes, average nucleotide identity and biochemical characteristics. Phylogenetic analysis demonstrated that KpI and KpIII corresponded to K. pneumoniae and Klebsiella variicola, respectively, whereas KpII-A and KpII-B formed two well-demarcated sequence clusters distinct from other members of the genus Klebsiella. Average nucleotide identity between KpII-A and KpII-B was 96.4?%, whereas values lower than 94?% were obtained for both groups when compared with K. pneumoniae and K. variicola. Biochemical properties differentiated KpII-A, KpII-B, K. pneumoniae and K. variicola, with acid production from adonitol and l-sorbose and ability to use 3-phenylproprionate, 5-keto-d-gluconate and tricarballylic acid as sole carbon sources being particularly useful. Based on their genetic and phenotypic characteristics, we propose the names Klebsiella quasipneumoniae subsp. quasipneumoniae subsp. nov. and K. quasipneumoniae subsp. similipneumoniae subsp. nov. for strains of KpII-A and KpII-B, respectively. The type strain of K. quasipneumoniae sp. nov. and of K. quasipneumoniae subsp. quasipneumoniae subsp. nov. is 01A030(T) (?=?SB11(T)?=?CIP 110771(T)?=?DSM 28211(T)). The type strain of K. quasipneumoniae subsp. similipneumoniae subsp. nov. is 07A044(T) (?=?SB30(T)?=?CIP 110770(T)?=?DSM 28212(T)). Both strains were isolated from human blood cultures. This work also showed that Klebsiella singaporensis is a junior heterotypic synonym of K. variicola. PMID:24958762

  18. Klebsiella singaporensis sp. nov., a novel isomaltulose-producing bacterium.

    PubMed

    Li, Xianzhen; Zhang, Daohai; Chen, Feng; Ma, Jie; Dong, Yihu; Zhang, Lianhui

    2004-11-01

    Cells of strain LX3(T), isolated from soil, were Gram-negative, facultatively anaerobic, non-motile, capsulated and non-endospore-forming straight rods, able to grow at 10 degrees C, unable to produce gas from lactose at 45 degrees C and unable to produce indole. The isolate converted sucrose to isomaltulose and did not produce detectable glucose by-products. The G+C content of the DNA was 56.4 mol%. Furthermore, comparison of 16S rRNA and rpoB gene sequences showed that the isolate clearly belongs to the genus Klebsiella. The closest phylogenetic relative was Klebsiella pneumoniae, there being 99.3 and 97.5 % similarity in 16S rRNA and rpoB gene sequences, respectively. DNA-DNA hybridization analysis demonstrated a very low level of relatedness to other members of the genus Klebsiella, indicating that the isolated strain and other species in the genus Klebsiella were not related at the species level. The isolate could be differentiated from other previously described members of the genus Klebsiella on the basis of phenotypic differences and 16S rRNA and rpoB gene sequence divergence, together with DNA-DNA reassociation data. Therefore, it is proposed that strain LX3(T) (=DSM 16265(T)=JCM 12419(T)) should be classified as the type strain of a novel species of genus Klebsiella, Klebsiella singaporensis sp. nov. PMID:15545446

  19. Characterization of Klebsiella sp. strain 10982, a colonizer of humans that contains novel antibiotic resistance alleles and exhibits genetic similarities to plant and clinical Klebsiella isolates.

    PubMed

    Hazen, Tracy H; Zhao, LiCheng; Sahl, Jason W; Robinson, Gwen; Harris, Anthony D; Rasko, David A; Johnson, J Kristie

    2014-01-01

    A unique Klebsiella species strain, 10982, was cultured from a perianal swab specimen obtained from a patient in the University of Maryland Medical Center intensive care unit. Klebsiella sp. 10982 possesses a large IncA/C multidrug resistance plasmid encoding a novel FOX AmpC ?-lactamase designated FOX-10. A novel variant of the LEN ?-lactamase was also identified. Genome sequencing and bioinformatic analysis demonstrated that this isolate contains genes associated with nitrogen fixation, allantoin metabolism, and citrate fermentation. These three gene regions are typically present in either Klebsiella pneumoniae clinical isolates or Klebsiella nitrogen-fixing endophytes but usually not in the same organism. Phylogenomic analysis of Klebsiella sp. 10982 and sequenced Klebsiella genomes demonstrated that Klebsiella sp. 10982 is present on a branch that is located intermediate between the genomes of nitrogen-fixing endophytes and K. pneumoniae clinical isolates. Metabolic features identified in the genome of Klebsiella sp. 10982 distinguish this isolate from other Klebsiella clinical isolates. These features include the nitrogen fixation (nif) gene cluster, which is typically present in endophytic Klebsiella isolates and is absent from Klebsiella clinical isolates. Additionally, the Klebsiella sp. 10982 genome contains genes associated with allantoin metabolism, which have been detected primarily in K. pneumoniae isolates from liver abscesses. Comparative genomic analysis of Klebsiella sp. 10982 demonstrated that this organism has acquired genes conferring new metabolic strategies and novel antibiotic resistance alleles, both of which may enhance its ability to colonize the human body. PMID:24395222

  20. Klebsiella pneumoniae liver abscess and endophthalmitis

    PubMed Central

    Abdul-Hamid, Ayeshah; Bailey, Sarah-Jane

    2013-01-01

    A 36-year-old man was referred to the general medical team with endophthalmitis. He was noted to have raised inflammatory markers and deranged liver function tests on admission. Subsequent abdominal ultrasound scan revealed a liver abscess requiring percutaneous drainage. A common human pathogen, Klebsiella pneumoniae, was cultured from multiple sites. K pneumoniae has virulent serotypes (K1 and K2) that can cause primary liver abscess with metastatic infections. Cases have previously been predominantly reported in Southeast Asia but are increasing in prevalence in Europe and North America. The main known risk factor for the disease is diabetes mellitus. Swift antibiotic therapy, ophthalmology review and percutaneous drainage of any liver abscess are essential. Early recognition of the syndrome, despite potentially few initial symptoms, can significantly reduce morbidity and mortality. The authors report the first recorded case of K pneumoniae liver abscess with endophthalmitis in the UK. PMID:23559652

  1. Capsular Types of Klebsiella pneumoniae Revisited by wzc Sequencing

    PubMed Central

    Pan, Yi-Jiun; Lin, Tzu-Lung; Chen, Yen-Hua; Hsu, Chun-Ru; Hsieh, Pei-Fang; Wu, Meng-Chuan; Wang, Jin-Town

    2013-01-01

    Capsule is an important virulence factor in bacteria. A total of 78 capsular types have been identified in Klebsiella pneumoniae. However, there are limitations in current typing methods. We report here the development of a new genotyping method based on amplification of the variable regions of the wzc gene. Fragments corresponding to the variable region of wzc were amplified and sequenced from 76 documented capsular types of reference or clinical strains. The remaining two capsular types (reference strains K15 and K50) lacked amplifiable wzc genes and were proven to be acapsular. Strains with the same capsular type exhibited ?94% DNA sequence identity across the variable region (CD1-VR2-CD2) of wzc. Strains with distinct K types exhibited <80% DNA sequence identity across this region, with the exception of three pairs of strains: K22/K37, K9/K45, and K52/K79. Strains K22 and K37 shared identical capsular polysaccharide synthesis (cps) genes except for one gene with a difference at a single base which resulted in frameshift mutation. The wzc sequences of K9 and K45 exhibited high DNA sequence similarity but possessed different genes in their cps clusters. K52 and K79 exhibited 89% wzc DNA sequence identity but were readily distinguished from each other at the DNA level; in contrast, strains with the same capsular type as K52 exhibited 100% wzc sequence identity. A total of 29 strains from patients with bacteremia were typed by the wzc system. wzc DNA sequences confirmed the documented capsular type for twenty-eight of these clinical isolates; the remaining strain likely represents a new capsular type. Thus, the wzc genotyping system is a simple and useful method for capsular typing of K. pneumoniae. PMID:24349011

  2. CHARACTERISTICS OF KLEBSIELLA FROM TEXTILE FINISHING PLANT EFFLUENTS

    EPA Science Inventory

    Klebsiella strains are found in abnormally high numbers in a stream receiving wastewater from a textile finishing plant. Representative strains are randomly selected to determine biochemical, serotype, and virulence patterns. All strains conform to the commonly accepted biochemic...

  3. Klebsiella pneumoniae Infection: A Virulent Cause of Visual Loss

    PubMed Central

    Soon, Wai Cheong; Pouncey, Anna; Ashley, Elizabeth; Bowen, Elizabeth Frances

    2014-01-01

    Bacterial endophthalmitis is endogenous in 2–6% of cases and is frequently misdiagnosed initially. Klebsiella pneumoniae is being increasingly recognised as an aggressive causative organism, and it is particularly prevalent in Asian populations. We describe the case of a 71-year-old female of Southeast Asian origin with type 2 diabetes mellitus who presented with visual loss secondary to bacterial endophthalmitis and concomitant cerebral abscesses. Imaging revealed the probable primary source of infection to be a liver abscess. She developed retinal detachment and subsequently underwent an evisceration of her right eye. A Klebsiella spp. was identified from the eye tissue by 16S rRNA amplification. Klebsiella pneumoniae endophthalmitis has a characteristic disease phenotype and a particularly aggressive course with poor visual outcomes observed in most cases. This case highlights the risks of metastatic infection including bacterial endophthalmitis in association with Klebsiella infection. PMID:25606041

  4. The nitrogen fixation genes of Klebsiella pneumoniae: a model system.

    PubMed

    Drummond, M H

    1984-05-01

    The genetics of nitrogen fixation and its regulation has been intensively studied in Klebsiella pneumoniae. The resulting model, whilst not complete, is proving very useful in understanding this process in other organisms. PMID:6444092

  5. The priB Gene of Klebsiella pneumoniae Encodes a 104Amino Acid Protein That Is Similar in Structure and Function to Escherichia coli PriB

    Microsoft Academic Search

    Linda Berg; Matthew E. Lopper; Arthur J. Lustig

    2011-01-01

    Primosome protein PriB is a single-stranded DNA-binding protein that serves as an accessory factor for PriA helicase-catalyzed origin-independent reinitiation of DNA replication in bacteria. A recent report describes the identification of a novel PriB protein in Klebsiella pneumoniae that is significantly shorter than most sequenced PriB homologs. The K. pneumoniae PriB protein is proposed to comprise 55 amino acid residues,

  6. Distribution of bacteria with the arylsulfate sulfotransferase activity.

    PubMed

    Baek, M C; Kwon, A R; Chung, Y J; Kim, B K; Choi, E C

    1998-08-01

    This study is to predict the possible roles of the arylsulfate sulfotransferase (ASST) in the microorganism. At first we studied the spectrum of a distribution of the ASST enzyme through about 1,300 bacteria and the several selected strains were compared with Klebsiella K-36 previously reported in the level of DNA homology using the Southern blot method. From this study, we could predict that this enzyme would not exist in specific bacteria and it might not be a critical enzyme for the life of bacteria. PMID:9875479

  7. Bacteria Museum

    NSDL National Science Digital Library

    Who knew that bacteria had their own virtual museum? Here, visitors will "learn that not all bacteria are harmful, how they are used in industry, that they belong to the oldest living creatures on Earth", and many more interesting facts to discover about the diverse world of bacteria. The "Bacterial Species Files" tab at the top of the page, allows visitors to look up information on 40 different specific bacteria, from Anthrax to Yersinia enterocolitica. The information provided for each bacterium includes photographs, consumer guides, fact sheets, and scientific links. Visitors will find that the "Main Exhibits" tab addresses the basics about bacteria, as well as "Pathogenic Bacteria", "Evolution", "How We Fight Bacteria", and "Food and Water Safety". Visitors will surely enjoy the "Good Bacteria in Food" link found in the Food and Water Safety section, as it explains how some foods benefit from good bacteria, such as Swiss cheese, sausage, sauerkraut, chocolate, and coffee.

  8. Extended-Spectrum ?-Lactamase CTX-M-15-Producing Klebsiella pneumoniae of Sequence Type ST274 in Companion Animals

    PubMed Central

    Poirel, Laurent; Ducroz, Sébastien; Boulouis, Henri-Jean; Arné, Pascal; Millemann, Yves

    2013-01-01

    Screening of extended-spectrum ?-lactamase (ESBL)-producing Gram-negative bacteria in companion animals living in the Paris area in France identified a high rate of CTX-M-15-producing Klebsiella pneumoniae. Those isolates were recovered during the 2010-2011 period from both infections and asymptomatic colonizations. Sequence typing revealed that most of these isolates belonged to sequence type ST274. Interestingly, the blaCTX-M-15 gene was located on a specific and novel plasmid scaffold. These findings highlight that companion animals may be reservoirs for CTX-M-15-producing K. pneumoniae evolving separately from the human reservoir of CTX-M-15 producers. PMID:23422912

  9. Two Transsulfurylation Pathways in Klebsiella pneumoniae

    Microsoft Academic Search

    Thomas A. Seiflein; Jeffrey G. Lawrence

    2006-01-01

    In most bacteria, inorganic sulfur is assimilated into cysteine, which provides sulfur for methionine bio-synthesis via transsulfurylation. Here, cysteine is transferred to the terminal carbon of homoserine via its sulfhydryl group to form cystathionine, which is cleaved to yield homocysteine. In the enteric bacteria Esch-erichia coli and Salmonella enterica, these reactions are catalyzed by irreversible cystathionine--synthase and cystathionine--lyase enzymes. Alternatively,

  10. Tracking a Hospital Outbreak of Carbapenem-Resistant Klebsiella pneumoniae with Whole-Genome Sequencing

    PubMed Central

    Snitkin, Evan S.; Zelazny, Adrian M.; Thomas, Pamela J.; Stock, Frida; Henderson, David K.; Palmore, Tara N.; Segre, Julia A.

    2012-01-01

    The Gram-negative bacteria Klebsiella pneumoniae is a major cause of nosocomial infections, primarily among immunocompromised patients. The emergence of strains resistant to carbapenems has left few treatment options, making infection containment critical. In 2011, the U.S. National Institutes of Health Clinical Center experienced an outbreak of carbapenem-resistant K. pneumoniae that affected 18 patients, 11 of whom died. Whole-genome sequencing was performed on K. pneumoniae isolates to gain insight into why the outbreak progressed despite early implementation of infection control procedures. Integrated genomic and epidemiological analysis traced the outbreak to three independent transmissions from a single patient who was discharged 3 weeks before the next case became clinically apparent. Additional genomic comparisons provided evidence for unexpected transmission routes, with subsequent mining of epidemiological data pointing to possible explanations for these transmissions. Our analysis demonstrates that integration of genomic and epidemiological data can yield actionable insights and facilitate the control of nosocomial transmission. PMID:22914622

  11. Tracking a hospital outbreak of carbapenem-resistant Klebsiella pneumoniae with whole-genome sequencing.

    PubMed

    Snitkin, Evan S; Zelazny, Adrian M; Thomas, Pamela J; Stock, Frida; Henderson, David K; Palmore, Tara N; Segre, Julia A

    2012-08-22

    The Gram-negative bacteria Klebsiella pneumoniae is a major cause of nosocomial infections, primarily among immunocompromised patients. The emergence of strains resistant to carbapenems has left few treatment options, making infection containment critical. In 2011, the U.S. National Institutes of Health Clinical Center experienced an outbreak of carbapenem-resistant K. pneumoniae that affected 18 patients, 11 of whom died. Whole-genome sequencing was performed on K. pneumoniae isolates to gain insight into why the outbreak progressed despite early implementation of infection control procedures. Integrated genomic and epidemiological analysis traced the outbreak to three independent transmissions from a single patient who was discharged 3 weeks before the next case became clinically apparent. Additional genomic comparisons provided evidence for unexpected transmission routes, with subsequent mining of epidemiological data pointing to possible explanations for these transmissions. Our analysis demonstrates that integration of genomic and epidemiological data can yield actionable insights and facilitate the control of nosocomial transmission. PMID:22914622

  12. 'KLEBSIELLA' OCCURRENCE, SIGNIFICANCE AND DETECTION IN WATER SYSTEMS: A PROGRESS REPORT

    EPA Science Inventory

    Frequent occurrence of Klebsiella in coliform colonization problems found in water supply distribution has prompted the development of a new medium (m-Kleb agar) for specific detection. The medium has excellent differential characteristics, and an average 94% Klebsiella recovery ...

  13. Distribution of bacteria with the arylsulfate sulfotransferase activity

    Microsoft Academic Search

    Moon-Chang Baek; Ae-Ran Kwon; Young-Ja Chung; Byong-Kak Kim; Eung-Chil Choi

    1998-01-01

    This study is to predict the possible roles of the arylsulfate sulfotransferase (ASST) in the microorganism. At first we studied\\u000a the spectrum of a distribution of the ASST enzyme through about 1,300 bacteria and the several selected strains were compared\\u000a withKlebsiella K-36 previously reported in the level of DNA homology using the Southern blot method. From this study, we could

  14. Biotransformation of furfural and 5-hydroxymethyl furfural by enteric bacteria

    Microsoft Academic Search

    R. Boopathy; H. Bokang; L. Daniels

    1993-01-01

    Summary A survey was conducted with seventeen enteric bacterial strains (including the generaKlebsiella, Enterobacter, Escherichia, Citrobacter, Edwardsiella andProteus) to examine their ability to transform furfural and 5-hydroxymethyl furfural (5-MHF). The enteric bacteria were able to convert furfural to furfuryl alcohol under both aerobic and anaerobic conditions in a relatively short incubation time of 8 h. 5-HMF was transformed by all

  15. Glutathione-S-Transferase Activity and Metabolism of Glutathione Conjugates by Rhizosphere Bacteria

    Microsoft Academic Search

    ROBERT M. ZABLOTOWICZ; ROBERT E. HOAGLAND; MARTIN A. LOCKE

    1995-01-01

    Glutathione-S-transferase (GST) activity was determined in 36 species of rhizosphere bacteria with the substrate 1-chloro-2,4-dinitrobenzene (CDNB) and in 18 strains with the herbicide alachlor. Highest levels of CDNB-GST activity (60 to 222 nmol z h21 z mg21) were found in gram-negative bacteria:Enterobacter cloacae, Citrobacter diversus, Klebsiella planticola, Pseudomonas cepacia, Pseudomonas fluorescens, Pseudomonas putida, and Xanthomonas campestris. There was very low

  16. Metabolism of Melamine by Klebsiella terragena

    PubMed Central

    Shelton, D. R.; Karns, J. S.; Mccarty, G. W.; Durham, D. R.

    1997-01-01

    Experiments were conducted to determine the pathway of melamine metabolism by Klebsiella terragena (strain DRS-1) and the effect of added NH(inf4)(sup+) on the rates and extent of melamine metabolism. In the absence of added NH(inf4)(sup+), 1 mM melamine was metabolized concomitantly with growth. Ammeline, ammelide, cyanuric acid, and NH(inf4)(sup+) accumulated transiently in the culture medium to maximal concentrations of 0.012 mM, 0.39 mM, trace levels, and 0.61 mM, respectively. In separate incubations, in which cells were grown on either ammeline or ammelide (in the absence of NH(inf4)(sup+)), ammeline was metabolized without a lag while ammelide metabolism was observed only after 3 h. In the presence of 6 mM added NH(inf4)(sup+) (enriched with 5% (sup15)N), ammeline, ammelide, and cyanuric acid accumulated transiently to maximal concentrations of 0.002 mM, 0.47 mM, and trace levels, respectively, indicating that the added NH(inf4)(sup+) had little effect on the relative rates of triazine metabolism. These data suggest that the primary mode of melamine metabolism by K. terragena is hydrolytic, resulting in successive deaminations of the triazine ring. Use of (sup15)N-enriched NH(inf4)(sup+) allowed estimates of rates of triazine-N mineralization and assimilation of NH(inf4)(sup+)-N versus triazine-N into biomass. A decrease in the percent (sup15)N in the external NH(inf4)(sup+) pool, in conjunction with the accumulation of ammelide and/or triazine-derived NH(inf4)(sup+) in the culture medium, suggests that the initial reactions in the melamine metabolic pathway may occur outside the cytoplasmic membrane. PMID:16535652

  17. Ribitol Catabolic Pathway in Klebsiella aerogenes

    PubMed Central

    Charnetzky, W. T.; Mortlock, R. P.

    1974-01-01

    In Klebsiella aerogenes W70, there is an inducible pathway for the catabolism of ribitol consisting of at least two enzymes, ribitol dehydrogenase (RDH) and d-ribulokinase (DRK). These two enzymes are coordinately controlled and induced in response to d-ribulose, an intermediate of the pathway. Whereas wild-type K. aerogenes W70 are unable to utilize xylitol as a carbon and energy source, mutants constitutive for the ribitol pathway are able to utilize RDH to oxidize the unusual pentitol, xylitol, to d-xylulose. These mutants are able to grow on xylitol, presumably by utilization of the d-xylulose produced. Mutants constitutive for l-fucose isomerase can utilize the isomerase to convert d-arabinose to d-ribulose. In the presence of d-ribulose, RDH and DRK are induced, and such mutants are thus able to phosphorylate the d-ribulose by using the DRK of the ribitol pathway. Derivatives of an l-fucose isomerase-constitutive mutant were plated on d-arabinose, ribitol, and xylitol to select and identify mutations in the ribitol pathway. Using the transducing phage PW52, we were able to demonstrate genetic linkage of the loci involved. Three-point crosses, using constitutive mutants as donors and RDH?, DRK? double mutants as recipients and selecting for DRK+ transductants on d-arabinose, resulted in DRK+RDH+-constitutive, DRK+RDH+-inducible, and DRK+RDH?-inducible transductants but no detectable DRK+RDH? constitutive transductants, data consistent with the order rbtC-rbtD-rbtK, where rbtC is a control site and rbtD and rbtK correspond to the sites for the sites for the enzymes RDH and DRK, respectively. PMID:4366025

  18. DUOX2 promotes the elimination of the Klebsiella pneumoniae strain K5 from T24 cells through the reactive oxygen species pathway.

    PubMed

    Lu, Huixia; Wu, Qi; Yang, Huijun

    2015-08-01

    Dual oxidase 2 (DUOX2) plays a major role in host defense in intestinal and airway epithelial cells through the reactive oxygen species (ROS) pathway. Klebsiella pneumoniae is a uropathogen that causes urinary tract infections. It is not known whether DUOX2 plays a role in host defense in bladder cancer epithelial cells. It is also not known whether Klebsiella pneumoniae invades T24 human bladder carcinoma cells and whether DUOX2 plays a role in eliminating the Klebsiella pneumoniae strain K5 through the ROS pathway in T24 cells. Thus, in the present study, we aimed to investigate the infectious capability of the Klebsiella pneumoniae K5 strain and the immunity?promoting capability of DUOX2 in T24 cells. We quantified the number of viable intracellular bacteria using the plate count method. DUOX2 expression was evaluated by western blot analysis and reverse transcription-quantitative PCR (RT-qPCR) follwoing treatment with or without multiple cytokines, phorbol 12?myristate 13?acetate (PMA), muramyl dipeptide (MDP), N?acetylmuramyl?D?alanyl?D?isoglutamine (MDP?DD), H2O2 inhibitor, catalase (CAT), the nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) oxidase inhibitor, diphenyleneiodonium (DPI), or siRNA targeting DUOX2 (siDUOX2). The levels of ROS in the T24 cells infected with the K5 strain were examined following treatment with DPI, CAT or siDUOX2. Our results revealed that DUOX2 expression increased and the number of viable intracellular bacteria decreased in the T24 cells following infection with the K4 bacteria. Treatment with the cytokines and MDP and PMA also induced DUOX2 expression and decreased the number of viable intracellular bacteria. The levels of ROS also increased following treatment with the cytokines and MDP and PMA. However, when the cells were treated with the inhibitors (DPI or CAT), these effects were all reversed. Our data demonstrated that DUOX2 played an important role in innate immunity against bacterial cytoinvasion through the ROS pathway in T24 cells. Our findings also provide insight into the protection of uroepithelial cells from Klebsiella pneumoniae K5 bacterial cytoinvasion, and thus lay the foundation for the development of novel therapies for urinary tract infections. PMID:26046128

  19. Bacteria Transformation

    NSDL National Science Digital Library

    National Science Foundation GK-12 and Research Experience for Teachers (RET) Programs,

    Students construct paper recombinant plasmids to simulate the methods genetic engineers use to create modified bacteria. They learn what role enzymes, DNA and genes play in the modification of organisms. For the particular model they work on, they isolate a mammal insulin gene and combine it with a bacteria's gene sequence (plasmid DNA) for production of the protein insulin.

  20. Recurrent Klebsiella pneumoniae Liver Abscess: Clinical and Microbiological Characteristics?

    PubMed Central

    Yang, Ya-Sung; Siu, L. K.; Yeh, Kuo-Ming; Fung, Chang-Phong; Huang, Shenq-Jie; Hung, Han-Chang; Lin, Jung-Chung; Chang, Feng-Yee

    2009-01-01

    Recurrent Klebsiella pneumoniae liver abscesses (KLAs) are rarely reported. Six cases of recurrent KLAs are characterized. Most of the patients had diabetes and K1 serotype KLAs. All of the isolates were uniformly susceptible to cefazolin. Distinct molecular fingerprints were found for the strains isolated from both primary and recurrent KLAs. PMID:19692563

  1. Genomic diversity of citrate fermentation in Klebsiella pneumoniae

    Microsoft Academic Search

    Ying-Tsong Chen; Tsai-Lien Liao; Keh-Ming Wu; Tsai-Ling Lauderdale; Jing-Jou Yan; I-Wen Huang; Min-Chi Lu; Yi-Chyi Lai; Yen-Ming Liu; Hung-Yu Shu; Jin-Town Wang; Ih-Jen Su; Shih-Feng Tsai

    2009-01-01

    BACKGROUND: It has long been recognized that Klebsiella pneumoniae can grow anaerobically on citrate. Genes responsible for citrate fermentation of K. pneumoniae were known to be located in a 13-kb gene cluster on the chromosome. By whole genome comparison of the available K. pneumoniae sequences (MGH 78578, 342, and NTUH-K2044), however, we discovered that the fermentation gene cluster was present

  2. Role of Bacterial Surface Structures on the Interaction of Klebsiella pneumoniae with Phagocytes

    PubMed Central

    Moranta, David; Llobet, Enrique; Pérez-Gutiérrez, Camino; Tomás, Juan M.; Suárez, Teresa; Garmendia, Junkal; Bengoechea, José A.

    2013-01-01

    Phagocytosis is a key process of the immune system. The human pathogen Klebsiella pneumoniae is a well known example of a pathogen highly resistant to phagocytosis. A wealth of evidence demonstrates that the capsule polysaccharide (CPS) plays a crucial role in resistance to phagocytosis. The amoeba Dictyostelium discoideum shares with mammalian macrophages the ability to phagocytose and kill bacteria. The fact that K. pneumoniae is ubiquitous in nature and, therefore, should avoid predation by amoebae, poses the question whether K. pneumoniae employs similar means to counteract amoebae and mammalian phagocytes. Here we developed an assay to evaluate K. pneumoniae-D. discoideum interaction. The richness of the growth medium affected the threshold at which the cps mutant was permissive for Dictyostelium and only at lower nutrient concentrations the cps mutant was susceptible to predation by amoebae. Given the critical role of bacterial surface elements on host-pathogen interactions, we explored the possible contribution of the lipopolysaccharide (LPS) and outer membrane proteins (OMPs) to combat phagoyctosis by D. discoideum. We uncover that, in addition to the CPS, the LPS O-polysaccharide and the first core sugar participate in Klebsiella resistance to predation by D. discoideum. K. pneumoniae LPS lipid A decorations are also necessary to avoid predation by amoebae although PagP-dependent palmitoylation plays a more important role than the lipid A modification with aminoarabinose. Mutants lacking OMPs OmpA or OmpK36 were also permissive for D. discoideium growth. Except the LPS O-polysaccharide mutants, all mutants were more susceptible to phagocytosis by mouse alveolar macrophages. Finally, we found a correlation between virulence, using the pneumonia mouse model, and resistance to phagocytosis. Altogether, this work reveals novel K. pneumoniae determinants involved in resistance to phagocytosis and supports the notion that Dictyostelium amoebae might be useful as host model to measure K. pneumoniae virulence and not only phagocytosis. PMID:23457627

  3. Invasion of cultured human epithelial cells by Klebsiella pneumoniae isolated from the urinary tract.

    PubMed Central

    Oelschlaeger, T A; Tall, B D

    1997-01-01

    The mechanisms which enable entry into cultured human epithelial cells by Klebsiella pneumoniae were compared with those of Salmonella typhi Ty2. K. pneumoniae 3091, isolated from a urine sample of a patient with a urinary tract infection, invaded human epithelial cells from the bladder and ileocecum and persisted for days in vitro. Electron microscopic studies demonstrated that K. pneumoniae was always contained in endosomes. The internalization mechanism(s) triggered by K. pneumoniae was studied by invasion assays conducted with different inhibitors that act on prokaryotic and eukaryotic cell structures and processes. Chloramphenicol inhibition of bacterial uptake revealed that bacterial de novo protein synthesis was essential for efficient invasion by K. pneumoniae and S. typhi. Interference with receptor-mediated endocytosis by g-strophanthin or monodansylcadaverine and inhibition of endosome acidification by monensin reduced the number of viable intracellular K. pneumoniae cells, but not S. typhi cells. The depolymerization of microfilaments by cytochalasin D inhibited the uptake of both bacteria. Microtubule depolymerization caused by colchicine, demecolcine, or nocodazole and the stabilization of microtubules with taxol reduced only the invasion ability of K. pneumoniae. S. typhi invasion was unaffected by microtubule depolymerization or stabilization. These data suggest that the internalization mechanism triggered by K. pneumoniae 3091 is strikingly different from the solely microfilament-dependent invasion mechanism exhibited by many of the well-studied enteric bacteria, such as enteroinvasive Escherichia coli, Salmonella, Shigella, and Yersinia strains. PMID:9199471

  4. Mast Cell IL-6 Improves Survival From Klebsiella Pneumonia and Sepsis by Enhancing Neutrophil Killing

    PubMed Central

    Sutherland, Rachel E.; Olsen, Joanna S.; McKinstry, Andrew; Villalta, S. Armando; Wolters, Paul J.

    2008-01-01

    The pleiotropic cytokine interleukin 6 (IL-6) has favorable and harmful effects on survival from bacterial infections. While many innate immune cells produce IL-6, little is known about relevant sources in vivo and the nature of its contributions to host responses to severe bacterial infections. To examine these roles, we subjected mast cell-specific IL-6-deficient mice to the cecal ligation and puncture model of septic peritonitis, finding that survival in these mice is markedly worse than in controls. Following intranasal or intraperitoneal inoculation with Klebsiella pneumoniae, IL-6-/- mice are less likely to survive than wild-type controls and at the time of death have higher numbers of bacteria but not inflammatory cells in lungs and peritoneum. Similarly, mast cell-specific IL-6-deficient mice have diminished survival and higher numbers of K. pneumoniae following intraperitoneal infection. Neutrophils lacking IL-6 have greater numbers of live intracellular K. pneumonia, suggesting impaired intracellular killing contributes to reduced clearance in IL-6-/- mice. These results establish that mast cell IL-6 is a critical mediator of survival following K. pneumoniae infection and sepsis and suggest that IL-6 protects from death by augmenting neutrophil killing of bacteria. PMID:18832718

  5. Metabolic Response to Klebsiella pneumoniae Infection in an Experimental Rat Model

    PubMed Central

    Dong, Fangcong; Wang, Bin; Zhang, Lulu; Tang, Huiru; Li, Jieshou; Wang, Yulan

    2012-01-01

    Bacteremia, the presence of viable bacteria in the blood stream, is often associated with several clinical conditions. Bacteremia can lead to multiple organ failure if managed incorrectly, which makes providing suitable nutritional support vital for reducing bacteremia-associated mortality. In order to provide such information, we investigated the metabolic consequences of a Klebsiella pneumoniae (K. pneumoniae) infection in vivo by employing a combination of 1H nuclear magnetic resonance spectroscopy and multivariate data analysis. K. pneumoniae was intravenously infused in rats; urine and plasma samples were collected at different time intervals. We found that K. pneumoniae-induced bacteremia stimulated glycolysis and the tricarboxylic acid cycle and also promoted oxidation of fatty acids and creatine phosphate to facilitate the energy-demanding host response. In addition, K. pneumoniae bacteremia also induced anti-endotoxin, anti-inflammatory and anti-oxidization responses in the host. Furthermore, bacteremia could cause a disturbance in the gut microbiotal functions as suggested by alterations in a range of amines and bacteria-host co-metabolites. Our results suggest that supplementation with glucose and a high-fat and choline-rich diet could ameliorate the burdens associated with bacteremia. Our research provides underlying pathological processes of bacteremia and a better understanding of the clinical and biochemical manifestations of bacteremia. PMID:23226457

  6. Susceptibility of different phases of biofilm of Klebsiella pneumoniae to three different antibiotics.

    PubMed

    Singla, Saloni; Harjai, Kusum; Chhibber, Sanjay

    2013-02-01

    The existence of majority of bacteria in biofilm mode makes it difficult to eradicate them as antibiotics at much higher concentrations than the MICs are required to destroy these bacteria. This study investigated the effect of different classes of antibiotics on different phases of biofilm formed by Klebsiella pneumoniae. The organism was grown in different phases relevant to biofilm formation: planktonic cells at mid-log phase, planktonic cells at stationary phase, adherent monolayers and mature biofilms and their susceptibility to different classes of antibiotics was assessed. The results showed that planktonic organisms were susceptible to ciprofloxacin, amikacin and piperacillin, and their MBC values were same or eight times higher than their corresponding MICs. MBC of ciprofloxacin and amikacin was found to be four and eight times higher for monolayer than planktonic cells. On the other hand, MBC of piperacillin was >1024??g?ml(-1). K. pneumoniae in a biofilm growth mode was more resistant to antibiotics than all other modes. The effect of amikacin and ciprofloxacin on young and older biofilms, at the highest achievable serum concentrations, was also examined. It was observed that amikacin at a concentration of 40??g?ml(-1) was able to eradicate the young biofilms; however, with increase in the age of the biofilm, it became completely ineffective. Calcofluor staining suggested increased production of exopolysaccharide in older biofilm compared with younger biofim that might be responsible for the increased resistance of older biofilm of K. pneumoniae to antibiotics. PMID:23168403

  7. Medicinal smoke reduces airborne bacteria.

    PubMed

    Nautiyal, Chandra Shekhar; Chauhan, Puneet Singh; Nene, Yeshwant Laxman

    2007-12-01

    This study represents a comprehensive analysis and scientific validation of our ancient knowledge about the effect of ethnopharmacological aspects of natural products' smoke for therapy and health care on airborne bacterial composition and dynamics, using the Biolog microplate panels and Microlog database. We have observed that 1h treatment of medicinal smoke emanated by burning wood and a mixture of odoriferous and medicinal herbs (havan sámagri=material used in oblation to fire all over India), on aerial bacterial population caused over 94% reduction of bacterial counts by 60 min and the ability of the smoke to purify or disinfect the air and to make the environment cleaner was maintained up to 24h in the closed room. Absence of pathogenic bacteria Corynebacterium urealyticum, Curtobacterium flaccumfaciens, Enterobacter aerogenes (Klebsiella mobilis), Kocuria rosea, Pseudomonas syringae pv. persicae, Staphylococcus lentus, and Xanthomonas campestris pv. tardicrescens in the open room even after 30 days is indicative of the bactericidal potential of the medicinal smoke treatment. We have demonstrated that using medicinal smoke it is possible to completely eliminate diverse plant and human pathogenic bacteria of the air within confined space. PMID:17913417

  8. Rapid Ertapenem Susceptibility Testing and Klebsiella pneumoniae Carbapenemase Phenotype Detection in Klebsiella pneumoniae Isolates by Use of Automated Microscopy of Immobilized Live Bacterial Cells

    PubMed Central

    Frobel, Rachel A.; Herrera, Monica L.; Wickes, Brian L.

    2014-01-01

    We evaluated detection of ertapenem (ETP) resistance and Klebsiella pneumoniae carbapenemase (KPC) in 47 Klebsiella pneumoniae isolates using a novel automated microscopy system. Automated microscopy correctly classified 22/23 isolates as ETP resistant and 24/24 as ETP susceptible and correctly classified 21/21 isolates as KPC positive and 26/26 as KPC negative. PMID:24391202

  9. Cofactor engineering through heterologous expression of an NADH oxidase and its impact on metabolic flux redistribution in Klebsiella pneumoniae

    PubMed Central

    2013-01-01

    Background Acetoin is an important bio-based platform chemical. However, it is usually existed as a minor byproduct of 2,3-butanediol fermentation in bacteria. Results The present study reports introducing an exogenous NAD+ regeneration sysytem into a 2,3-butanediol producing strain Klebsiella pneumoniae to increse the accumulation of acetoin. Batch fermentation suggested that heterologous expression of the NADH oxidase in K. pneumoniae resulted in large decreases in the intracellular NADH concentration (1.4 fold) and NADH/NAD+ ratio (2.0 fold). Metabolic flux analysis revealed that fluxes to acetoin and acetic acid were enhanced, whereas, production of lactic acid and ethanol were decreased, with the accumualation of 2,3-butanediol nearly unaltered. By fed-batch culture of the recombinant, the highest reported acetoin production level (25.9 g/L) by Klebsiella species was obtained. Conclusions The present study indicates that microbial production of acetoin could be improved by decreasing the intracellular NADH/NAD+ ratio in K. pneumoniae. It demonstrated that the cofactor engineering method, which is by manipulating the level of intracellular cofactors to redirect cellular metabolism, could be employed to achieve a high efficiency of producing the NAD+-dependent microbial metabolite. PMID:23351660

  10. Absence of impaired lymphocyte transformation to Klebsiella spp. in ankylosing spondylitis.

    PubMed Central

    Kinsella, T D; Lanteigne, C; Fritzler, M J; Lewkonia, R M

    1984-01-01

    We have evaluated claims that impaired peripheral blood lymphocyte (PBL) transformation can occur with Klebsiella spp. in patients with ankylosing spondylitis (AS). PBL of four AS patients were cultured in vitro with autogenous faecal klebsiella, as were the PBL of age (+/- 3 years) and sex-matched pairs of 15-20 AS and normal controls cultured with heterogeneous AS-derived klebsiella and control bacterial isolates. Three of four AS patients responded to their own isolates, and no significant differences were found between the matched pairs in response to heterogeneous klebsiella isolates, including K21. Our studies did not show impaired PBL transformation with klebsiella in AS and therefore do not support claims of antigenic cross-reactivity between klebsiella and HLA-B27. PMID:6332581

  11. Emergence of KPC-producing Klebsiella pneumoniae in Italy

    Microsoft Academic Search

    Carla Fontana; Marco Favaro; Loredana Sarmati; Silvia Natoli; Anna Altieri; Maria C Bossa; Silvia Minelli; Francesca Leonardis; Cartesio Favalli

    2010-01-01

    BACKGROUND: The emergence of KPC-producing K. pneumoniae has now become a global concern. KPC beta-lactamases are plasmid-borne and, like extended spectrum beta lactamases (ESBLs), can accumulate and transfer resistance determinants to other classes of antibiotics. Therefore, infection control guidelines on early identification and control of the spread of organisms carrying these resistant determinants are needed. FINDINGS: Klebsiella pneumoniae carbapenemase (KPC)

  12. Nucleotide sequence and structure of the Klebsiella pneumoniae pqq operon

    Microsoft Academic Search

    J. J. M. Meulenberg; E. Sellink; N. H. Riegman; P. W. Postma

    1992-01-01

    A 6940 by Klebsiella pneumoniae chromosomal DNA fragment, containing genes involved in pyrroloquinoline quinone (PQQ) biosynthesis, was sequenced. Six open reading frames, pqqA, pqqB, pqqC, pqqD, pqqE and pqqF were identified in the pqq operon, which coded for polypeptides of 2764 (23 amino acids), 33 464, 28 986, 10 436, 42 881 and 83 616 Da, respectively. The transcription startpoint

  13. Isolation and characterization of Klebsiella pneumoniae unencapsulated mutants

    SciTech Connect

    Benedi, V.J.; Ciurana, B.; Tomas, J.M.

    1989-01-01

    Klebsiella pneumoniae mutants were obtained after UV irradiation and negative selection with anticapsular serum. Unencapsulation, rather than expression of a structurally altered capsule, was found in the mutants. The mutant strains showed no alterations in their outer membrane proteins and lipopolysaccharide, and a great similarity with the wild type in the properties tested (serum resistance, antimicrobial sensitivity, and lipopolysaccharide-specific bacteriophage sensitivity), with the exception of a higher cell surface hydrophobicity and resistance to bacteriophage FC3-9.

  14. Methanotrophic bacteria.

    PubMed Central

    Hanson, R S; Hanson, T E

    1996-01-01

    Methane-utilizing bacteria (methanotrophs) are a diverse group of gram-negative bacteria that are related to other members of the Proteobacteria. These bacteria are classified into three groups based on the pathways used for assimilation of formaldehyde, the major source of cell carbon, and other physiological and morphological features. The type I and type X methanotrophs are found within the gamma subdivision of the Proteobacteria and employ the ribulose monophosphate pathway for formaldehyde assimilation, whereas type II methanotrophs, which employ the serine pathway for formaldehyde assimilation, form a coherent cluster within the beta subdivision of the Proteobacteria. Methanotrophic bacteria are ubiquitous. The growth of type II bacteria appears to be favored in environments that contain relatively high levels of methane, low levels of dissolved oxygen, and limiting concentrations of combined nitrogen and/or copper. Type I methanotrophs appear to be dominant in environments in which methane is limiting and combined nitrogen and copper levels are relatively high. These bacteria serve as biofilters for the oxidation of methane produced in anaerobic environments, and when oxygen is present in soils, atmospheric methane is oxidized. Their activities in nature are greatly influenced by agricultural practices and other human activities. Recent evidence indicates that naturally occurring, uncultured methanotrophs represent new genera. Methanotrophs that are capable of oxidizing methane at atmospheric levels exhibit methane oxidation kinetics different from those of methanotrophs available in pure cultures. A limited number of methanotrophs have the genetic capacity to synthesize a soluble methane monooxygenase which catalyzes the rapid oxidation of environmental pollutants including trichloroethylene. PMID:8801441

  15. Extended-Spectrum ?-Lactamase (ESBL)-Producing Klebsiella pneumoniae in Bulk Tank Milk from Dairy Farms in Indonesia.

    PubMed

    Sudarwanto, Mirnawati; Akineden, Ömer; Odenthal, Sabrina; Gross, Madeleine; Usleber, Ewald

    2015-07-01

    Bulk tank milk from 80 dairy farms located in the West Java Region of Indonesia was analyzed for the presence of extended-spectrum ?-lactamase (ESBL)-producing Enterobacteriaceae. Isolates from seven dairy farms were ESBL positive, and all were identified as Klebsiella pneumoniae. The isolates showed ESBL-characteristic antibiotic resistance patterns. Further analysis revealed that all K. pneumoniae isolates harbored the blaSHV gene, and two isolates were additionally positive for the blaTEM-1 and blaCTX-M-15 genes. Isolates from different farms were clonally diverse according to macrorestriction analysis. The results indicate that the relatively high frequency of ESBL-producing K. pneumoniae in bulk tank milk implies the risk that milk is both a source of local exposure and a vector contributing to the supraregional spread of antibiotic-resistant bacteria by trade. PMID:26135892

  16. Endocarditis Due to Rare and Fastidious Bacteria

    PubMed Central

    Brouqui, P.; Raoult, D.

    2001-01-01

    The etiologic diagnosis of infective endocarditis is easily made in the presence of continuous bacteremia with gram-positive cocci. However, the blood culture may contain a bacterium rarely associated with endocarditis, such as Lactobacillus spp., Klebsiella spp., or nontoxigenic Corynebacterium, Salmonella, Gemella, Campylobacter, Aeromonas, Yersinia, Nocardia, Pasteurella, Listeria, or Erysipelothrix spp., that requires further investigation to establish the relationship with endocarditis, or the blood culture may be uninformative despite a supportive clinical evaluation. In the latter case, the etiologic agents are either fastidious extracellular or intracellular bacteria. Fastidious extracellular bacteria such as Abiotrophia, HACEK group bacteria, Clostridium, Brucella, Legionella, Mycobacterium, and Bartonella spp. need supplemented media, prolonged incubation time, and special culture conditions. Intracellular bacteria such as Coxiella burnetii cannot be isolated routinely. The two most prevalent etiologic agents of culture-negative endocarditis are C. burnetti and Bartonella spp. Their diagnosis is usually carried out serologically. A systemic pathologic examination of excised heart valves including periodic acid-Schiff (PAS) staining and molecular methods has allowed the identification of Whipple's bacillus endocarditis. Pathologic examination of the valve using special staining, such as Warthin-Starry, Gimenez, and PAS, and broad-spectrum PCR should be performed systematically when no etiologic diagnosis is evident through routine laboratory evaluation. PMID:11148009

  17. Magnetotactic Bacteria

    Microsoft Academic Search

    Richard Blakemore

    1975-01-01

    Bacteria with motility directed by the local geomagnetic field have been observed in marine sediments. These magnetotactic microorganisms possess flagella and contain novel structured particles, rich in iron, within intracytoplasmic membrane vesicles. Conceivably these particles impart to cells a magnetic moment. This could explain the observed migration of these organisms in fields as weak as 0.5 gauss.

  18. Molecular dissection of the evolution of carbapenem-resistant multilocus sequence type 258 Klebsiella pneumoniae.

    PubMed

    Deleo, Frank R; Chen, Liang; Porcella, Stephen F; Martens, Craig A; Kobayashi, Scott D; Porter, Adeline R; Chavda, Kalyan D; Jacobs, Michael R; Mathema, Barun; Olsen, Randall J; Bonomo, Robert A; Musser, James M; Kreiswirth, Barry N

    2014-04-01

    Infections caused by drug-resistant bacteria are a major problem worldwide. Carbapenem-resistant Klebsiella pneumoniae, most notably isolates classified as multilocus sequence type (ST) 258, have emerged as an important cause of hospital deaths. ST258 isolates are predominantly multidrug resistant, and therefore infections caused by them are difficult to treat. It is not known why the ST258 lineage is the most prevalent cause of multidrug-resistant K. pneumoniae infections in the United States and other countries. Here we tested the hypothesis that carbapenem-resistant ST258 K. pneumoniae is a single genetic clone that has disseminated worldwide. We sequenced to closure the genomes of two ST258 clinical isolates and used these genomes as references for comparative genome sequencing of 83 additional clinical isolates recovered from patients at diverse geographic locations worldwide. Phylogenetic analysis of the SNPs in the core genome of these isolates revealed that ST258 K. pneumoniae organisms are two distinct genetic clades. This unexpected finding disproves the single-clone hypothesis. Notably, genetic differentiation between the two clades results from an ? 215-kb region of divergence that includes genes involved in capsule polysaccharide biosynthesis. The region of divergence appears to be a hotspot for DNA recombination events, and we suggest that this region has contributed to the success of ST258 K. pneumoniae. Our findings will accelerate research on novel diagnostic, therapeutic, and vaccine strategies designed to prevent and/or treat infections caused by multidrug resistant K. pneumoniae. PMID:24639510

  19. Molecular dissection of the evolution of carbapenem-resistant multilocus sequence type 258 Klebsiella pneumoniae

    PubMed Central

    DeLeo, Frank R.; Chen, Liang; Porcella, Stephen F.; Martens, Craig A.; Kobayashi, Scott D.; Porter, Adeline R.; Chavda, Kalyan D.; Jacobs, Michael R.; Mathema, Barun; Olsen, Randall J.; Bonomo, Robert A.; Musser, James M.; Kreiswirth, Barry N.

    2014-01-01

    Infections caused by drug-resistant bacteria are a major problem worldwide. Carbapenem-resistant Klebsiella pneumoniae, most notably isolates classified as multilocus sequence type (ST) 258, have emerged as an important cause of hospital deaths. ST258 isolates are predominantly multidrug resistant, and therefore infections caused by them are difficult to treat. It is not known why the ST258 lineage is the most prevalent cause of multidrug-resistant K. pneumoniae infections in the United States and other countries. Here we tested the hypothesis that carbapenem-resistant ST258 K. pneumoniae is a single genetic clone that has disseminated worldwide. We sequenced to closure the genomes of two ST258 clinical isolates and used these genomes as references for comparative genome sequencing of 83 additional clinical isolates recovered from patients at diverse geographic locations worldwide. Phylogenetic analysis of the SNPs in the core genome of these isolates revealed that ST258 K. pneumoniae organisms are two distinct genetic clades. This unexpected finding disproves the single-clone hypothesis. Notably, genetic differentiation between the two clades results from an ?215-kb region of divergence that includes genes involved in capsule polysaccharide biosynthesis. The region of divergence appears to be a hotspot for DNA recombination events, and we suggest that this region has contributed to the success of ST258 K. pneumoniae. Our findings will accelerate research on novel diagnostic, therapeutic, and vaccine strategies designed to prevent and/or treat infections caused by multidrug resistant K. pneumoniae. PMID:24639510

  20. Biofilm formation of Klebsiella pneumoniae on urethral catheters requires either type 1 or type 3 fimbriae

    PubMed Central

    Stahlhut, Steen G; Struve, Carsten; Krogfelt, Karen A; Reisner, Andreas

    2012-01-01

    Urinary catheters are standard medical devices utilized in both hospital and nursing home settings, but are associated with a high frequency of catheter-associated urinary tract infections (CAUTI). In particular, biofilm formation on the catheter surface by uropathogens such as Klebsiella pneumoniae causes severe problems. Here we demonstrate that type 1 and type 3 fimbriae expressed by K. pneumoniae enhance biofilm formation on urinary catheters in a catheterized bladder model that mirrors the physico-chemical conditions present in catheterized patients. Furthermore, we show that both fimbrial types are able to functionally compensate for each other during biofilm formation on urinary catheters. In situ monitoring of fimbrial expression revealed that neither of the two fimbrial types is expressed when cells are grown planktonically. Interestingly, during biofilm formation on catheters, both fimbrial types are expressed, suggesting that they are both important in promoting biofilm formation on catheters. Additionally, transformed into and expressed by a nonfimbriated Escherichia coli strain, both fimbrial types significantly increased biofilm formation on catheters compared with the wild-type E. coli strain. The widespread occurrence of the two fimbrial types in different species of pathogenic bacteria stresses the need for further assessment of their role during urinary tract infections. PMID:22448614

  1. Emergence of Klebsiella pneumoniae clinical isolates producing KPC-2 carbapenemase in Cuba.

    PubMed

    Quiñones, D; Hart, M; Espinosa, F; Garcia, S; Carmona, Y; Ghosh, S; Urushibara, N; Kawaguchiya, M; Kobayashi, N

    2014-07-01

    The emergence of Klebsiella pneumoniae producing carbapenemase (KPC) has now become a global concern. As a part of a nationwide multicentre surveillance study in Cuba, three K. pneumoniae clinical isolates resistant to carbapenems were detected for a 1-month period (September to October 2011). PCR and sequence analysis revealed that the three strains harboured bla KPC-2. They showed resistance or intermediate susceptibility to expanded-spectrum cephalosporins, other ?-lactams, a ?-lactam/?-lactamase inhibitor combination, and gentamicin. Two strains were susceptible only to colistin, whereas the other strain showing colistin resistance was susceptible to fluoroquinolones. These bla KPC -2-positive K. pneumoniae strains were classified into ST1271 (CC29), a novel clone harbouring bla KPC -2, and were revealed to be genetically identical by PCR-based DNA fingerprinting. The three patients infected with the KPC-producing K. pneumoniae had common risk factors, and had no overseas travel experience outside Cuba, suggesting local acquisition of the resistant pathogen. This is the first report of a KPC-producing K. pneumoniae in Cuba. Although detection of KPC in Enterobacteriaceae is still rare in Cuba, our finding indicated that KPC-producing bacteria are a global concern and highlighted the need to identify these microorganisms in clinical laboratories. PMID:25356357

  2. Multicellularity and Antibiotic Resistance in Klebsiella pneumoniae Grown Under Bloodstream-Mimicking Fluid Dynamic Conditions

    PubMed Central

    Thornton, Margaret M.; Chung-Esaki, Hangyul M.; Irvin, Charlene B.; Bortz, David M.; Solomon, Michael J.; Younger, John G.

    2012-01-01

    Background.?While the importance of fluid dynamical conditions is well recognized in the growth of biofilms, their role during bacteremia is unknown. We examined the impact of physiological fluid shear forces on the development of multicellular aggregates of Klebsiella pneumoniae. Methods.?Wild-type and O-antigen or capsular mutants of K. pneumoniae were grown as broth culture in a Taylor-Couette flow cell configured to provide continuous shear forces comparable to those encountered in the human arterial circulation (ie, on the order of 1.0 Pa). The size distribution and antibiotic resistance of aggregates formed in this apparatus were determined, as was their ability to persist in the bloodstream of mice following intravenous injection. Results.?Unlike growth in shaking flasks, bacteria grown in the test apparatus readily formed aggregates, a phenotype largely absent in capsular mutants and to a lesser degree in O-antigen mutants. Aggregates were found to persist in the bloodstream of mice. Importantly, organisms grown under physiological shear were found to have an antibiotic resistance phenotype intermediate between that of fully planktonic and biofilm states. Conclusions.?When grown under intravascular-magnitude fluid dynamic conditions, K. pneumoniae spontaneously develops into multicellular aggregates that are capable of persisting in the circulation and exhibit increased antibiotic resistance. PMID:22711903

  3. Resistance of Klebsiella pneumoniae to the innate immune system of African green monkeys.

    PubMed

    Cox, Brandi L; Schiffer, Holly; Dagget, Gregory; Beierschmitt, Amy; Sithole, Fortune; Lee, Elise; Revan, Floyd; Halliday-Simmonds, Iona; Beeler-Marfisi, Janet; Palmour, Roberta; Soto, Esteban

    2015-03-23

    In recent years, an emergent Klebsiella pneumoniae hypermucoviscosity (HMV) phenotype has been associated with increased invasiveness and pathogenicity in primates. In this project, bacteria recovered from infected African green monkeys (AGM) (Chlorocebus aethiops sabaeus) were screened for HMV phenotype, and were compared to non-HMV isolates in in vitro, serum, and oxidative-mediated killing assays. Complement-mediated killing was assessed utilizing freshly collected serum from healthy AGM. Oxidative-mediated killing was investigated utilizing sodium hypochlorite and hydrogen peroxide. Compared to non-HMV isolates, HMV isolates were more resistant to serum-mediated and oxidative killing (p<0.05). Phagocytosis resistance was evaluated using AGM peripheral blood monocytes (PBMC), and results indicated that non-HMV isolates associated with the AGM PBMC to a greater extent than HMV isolates (p<0.001). Measurement of lactate dehydrogenase release showed that HMV isolates were more cytotoxic to AGM PBMC than non-HMV isolates (p<0.001). Thus, the hypermucoid phenotype appears to be an important virulence factor that promotes evasion of innate immune defenses. PMID:25614101

  4. Experimental study on the growth of Salmonella and coli-aerogenes bacteria in pure and mixed cultures, in a fermentor, in two different enrichment media: Sodium selenite and tetrathionate broth

    Microsoft Academic Search

    B. Hugues; M. Plissier; A. Pagliardini; J. L. Plantat; J. Gaissa

    1978-01-01

    Different serotypes of Salmonella and coli-aerogenes bacteria were grown in a fermentor at +43°C. The Culture media used were composed of two different nutrient broths, one supplemented with sodium selenite, the other with potassium tetrathionate. The growth of both bacteria and the following types of mixed bacteria was studied: Escherichia coli-Salmonella brancaster and Klebsiella pneumoniae-Salmonella brancaster. During the first 10

  5. D-galactan II is an immunodominant antigen in O1 lipopolysaccharide and affects virulence in Klebsiella pneumoniae: implication in vaccine design

    PubMed Central

    Hsieh, Pei-Fang; Wu, Meng-Chuan; Yang, Feng-Ling; Chen, Chun-Tang; Lou, Tzu-Chi; Chen, Yi-Yin; Wu, Shih-Hsiung; Sheu, Jin-Chuan; Wang, Jin-Town

    2014-01-01

    In the O1 strain of Klebsiella, the lipopolysaccharide (LPS) O-antigen is composed of D-galactan I and D-galactan II. Although the composition of the O1 antigen of Klebsiella was resolved more than two decades, the genetic locus involved in the biosynthesis of D-galactan II and the role of D-galactan II in bacterial pathogenesis remain unclear. Here, we report the identification of the D-galactan II-synthesizing genes by screening a transposon mutant library of an acapsulated Klebsiella pneumoniae O1 strain with bacteriophage. K. pneumoniae strain deleted for wbbY exhibited abrogated D-galactan II production; altered serum resistance and attenuation of virulence. Serologic analysis of K. pneumoniae clinical isolates demonstrated that D-galactan II was more prevalent in community-acquired pyogenic liver abscess (PLA)—causing strains than in non-tissue-invasive strains. WbbY homologs, WbbZ homologs, and lipopolysaccharide structures based on D-galactan II also were present in several Gram-negative bacteria. Immunization of mice with the magA-mutant (K?1 O1) (that is, with a LPS D-galactan II-producing strain) provided protection against infection with an O1:K2 PLA strain. Our findings indicate that both WbbY and WbbZ homologs are sufficient for the synthesis of D-galactan II. D-galactan II represents an immunodominant antigen; is conserved among multiple species of Gram-negative bacteria and could be a useful vaccine candidate. PMID:25477867

  6. CTX-M-12 ?-Lactamase in a Klebsiella pneumoniae Clinical Isolate in Colombia

    PubMed Central

    Villegas, Maria Virginia; Correa, Adriana; Perez, Federico; Zuluaga, Tania; Radice, Marcela; Gutkind, Gabriel; Casellas, José María; Ayala, Juan; Lolans, Karen; Quinn, John P.

    2004-01-01

    We describe the detection of the CTX-M-12 ?-lactamase from a clinical isolate of Klebsiella pneumoniae in Colombia. Screening of nosocomial Klebsiella spp. and Escherichia coli isolates from a network of teaching hospitals revealed the presence of CTX-M enzymes in multiple cities. This is the first description of CTX-M in Colombia. PMID:14742223

  7. Caracterización de Klebsiella pneumoniae productora de la ?-lactamasa SHV-5, en una unidad de cuidados intensivos

    Microsoft Academic Search

    Verónica Andrade

    Objective. To perform the molecular characterization of Klebsiella pneumoniae isolates from pediatric patients and health care workers at the intensive care unit of a tertiary care hospital in Mexico City. Material and Methods. Fif- teen Klebsiella pneumoniae isolates collected during an out- break in June 1996 were analyzed; eight were from patients and seven from health care workers of Mexico's

  8. IN VITRO ANTIMICROBIAL ACTIVITY OF ETHANOLIC AND METHANOLIC FRUIT EXTRACTS OF XYLOPIA AETHIOPICA AND ITS COMBINATION WITH DISC ANTIBIOTICS AGAINST CLINICAL ISOLATES OF BACTERIA AND FUNGI

    Microsoft Academic Search

    EMEKA INNOCENT NWEZE; MICHEAL CHIJIOKE UGWU

    2010-01-01

    Objective: To evaluate the in vitro antimicrobial activity of ethanolic and methanolic fruit extracts of Xylopia aethiopica separately and in combination with three antibacterial antibiotics: gentamycin, ofloxacin and ciprofloxacin; and two antifungal antibiotics: fluconazole and ketoconazole. Methods: Clinically isolated strains of bacteria: Pseudomonas aeruginosa, Klebsiella pneumonia, Escherichia coli, Bacillus subtilis, Staphylococcus aureus and fungi: Candida albicans and Aspergillus flavus were

  9. Effects of waste water treatment on the species composition and Antibiotic resistance of coliform bacteria

    Microsoft Academic Search

    Sigrid Rita Andersen

    1993-01-01

    Coliform bacteria from raw and treated sewage in a mechanical-biological treatment plant were examined for resistance to four to six antibiotics, and randomly selected isolates were identified. The results indicate that certain coliform species are eliminated at lower rates than others by the treatment.Klebsiella sp. became more frequent, whereas the proportion ofEscherichia coli diminished. A comparison of raw and treated

  10. First report of KPC-producing Klebsiella pneumoniae in Croatia.

    PubMed

    Bedeni?, Branka; Mazzariol, Annarita; Ple?ko, Vanda; Bošnjak, Zrinka; Barl, Petra; Vraneš, Jasmina; Cornaglia, Giuseppe

    2012-08-01

    In February 2011, a 78-year-old male patient was admitted to Clinical Hospital Center Zagreb with subdural haematoma. Klebsiella pneumoniae with reduced susceptibility to carbapenems was isolated. PCR revealed the presence of bla(KPC), bla(TEM), and bla(SHV) genes. Sequencing of bla(KPC) gene identified K. pneumoniae carbapenemase (KPC)-2 beta-lactamase. The strain belonged to ST37 clone by multilocus sequence typing. Infection control efforts limited the spread of KPC-producing clone of K. pneumoniae in our hospital so far. To our knowledge, this is the first report of a KPC-producing K. pneumoniae in Croatia. PMID:23040691

  11. Identification and clinical significance of Klebsiella species in chest infections

    PubMed Central

    Darrell, J. H.; Hurdle, A. D. F.

    1964-01-01

    Using a short series of biochemical tests already in use in many routine laboratories, it is possible to identify strains of the genus Klebsiella and to differentiate K. aerogenes from other types. Marked production of slime is not peculiar to the group and colonial appearance alone is not a satisfactory basis for identification. K. aerogenes is the type most commonly isolated from all clinical specimens. It is suggested that the name may be retained in clinical bacteriology and used when applicable, particularly when reporting urinary strains. K. aerogenes is of doubtful pathogenicity when isolated from sputum; frequently its appearance follows antibiotic treatment for other organisms. It should be clearly distinguished from other Klebsiella types occurring as primary pathogens in sputum. Friedlander's bacillus is considered a suitable collective term for the latter, namely K. edwardsii-edwardsii, K. pneumoniae, and K. edwardsii-atlantae. The clinical significance of K. rhinoscleromatis and K. ozaenae could not be assessed as so few isolations were made. On the rare occasions when they occur they would, with the tests recommended, be included as Friedlander's bacillus, the distinction not being readily made in the clinical laboratory. PMID:14227430

  12. Bacteria TMDL Projects

    E-print Network

    Wythe, Kathy

    2007-01-01

    of TMDL projects for water bodies where swimming or wading may be unsafe or harvesting of oysters is limited or prohibited due to high concentrations of bacteria. ? Atascosa River: A TMDL Project for Bacteria ? Buffalo andWhite Oak Bayous: A TMDL... Creek: A TMDL Project for Bacteria ? Lower San Antonio River: A TMDL Project for Bacteria ? Upper San Antonio River: A TMDL Project for Bacteria ? Trinity River: A TMDL Project for Bacteria ? Upper Oyster Creek: A TMDL Project for Bacteria...

  13. Bacteria TMDL Projects 

    E-print Network

    Wythe, Kathy

    2007-01-01

    of TMDL projects for water bodies where swimming or wading may be unsafe or harvesting of oysters is limited or prohibited due to high concentrations of bacteria. ? Atascosa River: A TMDL Project for Bacteria ? Buffalo andWhite Oak Bayous: A TMDL... Creek: A TMDL Project for Bacteria ? Lower San Antonio River: A TMDL Project for Bacteria ? Upper San Antonio River: A TMDL Project for Bacteria ? Trinity River: A TMDL Project for Bacteria ? Upper Oyster Creek: A TMDL Project for Bacteria...

  14. Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences

    PubMed Central

    Motalleb, Gholamreza

    2014-01-01

    Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism’s transcriptome is related to its cellular proteome. PMID:24551820

  15. Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences.

    PubMed

    Motalleb, Gholamreza

    2014-01-01

    Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome. PMID:24551820

  16. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria

    PubMed Central

    Olaitan, Abiola O.; Morand, Serge; Rolain, Jean-Marc

    2014-01-01

    Polymyxins are polycationic antimicrobial peptides that are currently the last-resort antibiotics for the treatment of multidrug-resistant, Gram-negative bacterial infections. The reintroduction of polymyxins for antimicrobial therapy has been followed by an increase in reports of resistance among Gram-negative bacteria. Some bacteria, such as Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii, develop resistance to polymyxins in a process referred to as acquired resistance, whereas other bacteria, such as Proteus spp., Serratia spp., and Burkholderia spp., are naturally resistant to these drugs. Reports of polymyxin resistance in clinical isolates have recently increased, including acquired and intrinsically resistant pathogens. This increase is considered a serious issue, prompting concern due to the low number of currently available effective antibiotics. This review summarizes current knowledge concerning the different strategies bacteria employ to resist the activities of polymyxins. Gram-negative bacteria employ several strategies to protect themselves from polymyxin antibiotics (polymyxin B and colistin), including a variety of lipopolysaccharide (LPS) modifications, such as modifications of lipid A with phosphoethanolamine and 4-amino-4-deoxy-L-arabinose, in addition to the use of efflux pumps, the formation of capsules and overexpression of the outer membrane protein OprH, which are all effectively regulated at the molecular level. The increased understanding of these mechanisms is extremely vital and timely to facilitate studies of antimicrobial peptides and find new potential drugs targeting clinically relevant Gram-negative bacteria. PMID:25505462

  17. Legionella pneumophila Persists within Biofilms Formed by Klebsiella pneumoniae, Flavobacterium sp., and Pseudomonas fluorescens under Dynamic Flow Conditions

    PubMed Central

    Stewart, Catherine R.; Muthye, Viraj; Cianciotto, Nicholas P.

    2012-01-01

    Legionella pneumophila, the agent of Legionnaires' disease pneumonia, is transmitted to humans following the inhalation of contaminated water droplets. In aquatic systems, L. pneumophila survives much of time within multi-organismal biofilms. Therefore, we examined the ability of L. pneumophila (clinical isolate 130b) to persist within biofilms formed by various types of aquatic bacteria, using a bioreactor with flow, steel surfaces, and low-nutrient conditions. L. pneumophila was able to intercalate into and persist within a biofilm formed by Klebsiella pneumoniae, Flavobacterium sp. or Pseudomonas fluorescens. The levels of L. pneumophila within these biofilms were as much as 4×104 CFU per cm2 of steel coupon and lasted for at least 12 days. These data document that K. pneumoniae, Flavobacterium sp., and P. fluorescens can promote the presence of L. pneumophila in dynamic biofilms. In contrast to these results, L. pneumophila 130b did not persist within a biofilm formed by Pseudomonas aeruginosa, confirming that some bacteria are permissive for Legionella colonization whereas others are antagonistic. In addition to colonizing certain mono-species biofilms, L. pneumophila 130b persisted within a two-species biofilm formed by K. pneumoniae and Flavobacterium sp. Interestingly, the legionellae were also able to colonize a two-species biofilm formed by K. pneumoniae and P. aeruginosa, demonstrating that a species that is permissive for L. pneumophila can override the inhibitory effect(s) of a non-permissive species. PMID:23185637

  18. The non-conventional MHC class I MR1 molecule controls infection by Klebsiella pneumoniae in mice.

    PubMed

    Georgel, Philippe; Radosavljevic, Mirjana; Macquin, Cécile; Bahram, Seiamak

    2011-02-01

    As opposed to the well established role of MHC-linked, polymorphic, class I (MHC-I) genes in adaptive immunity, a universal role for non-conventional MHC-I is unknown, thus requiring a case-by-case study. The MHC unlinked, monomorphic, but ??microglobulin (??m)-associated "MHC class I related" MR1 molecule interacts with a semi-invariant TCR. The pathophysiology of this interaction or more importantly of this peculiar MHC-I remains mostly unknown. Recently it was shown that ??m deficient mice were more susceptible to infection by Klebsiella pneumoniae, a widely spread Gram-negative bacteria that causes diverse and often severe ailments in man. Here we demonstrate, using both an in vivo imaging system and survival tests, the increased susceptibility to K. pneumoniae (but not to several other Gram negative bacteria) of MR1 deficient mice. This is accompanied by a consequent change in body temperature and systemic cytokine profile. Hence MR1 controls K. pneumoniae infection in vivo. PMID:21190736

  19. Cadmium-tolerant bacteria induce metal stress tolerance in cereals.

    PubMed

    Ahmad, Iftikhar; Akhtar, Muhammad Javed; Zahir, Zahir Ahmad; Naveed, Muhammad; Mitter, Birgit; Sessitsch, Angela

    2014-09-01

    Cadmium usually hampers plant growth, but bacterial inoculation may improve stress tolerance in plants to Cd by involving various mechanisms. The objective was to characterize and identify bacteria that improve plant growth under Cd stress and reduce Cd uptake. Cadmium-tolerant bacteria were isolated from rhizosphere soil, which was irrigated with tannery effluent, and six strains were selected as highly tolerant to Cd, showing minimum inhibitory concentration as 500 mg L(-1) or 4.45 mmol L(-1). These strains were identified by 16S rRNA gene analysis and functional analysis in regard to plant growth promotion characteristics. To determine their effect on cereal growth under Cd stress, seeds were inoculated with these strains individually and grown in soil contaminated with three Cd levels (0, 40 and 80 mg kg(-1)). Biomass production, relative water content (RWC), electrolyte leakage (ELL) and tissue Cd concentration were measured. Biomass of both cereals was inhibited strongly when exposed to Cd; however, bacterial inoculation significantly reduced the suppressive effect of Cd on cereal growth and physiology. The bacterial isolates belonged to the genera Klebsiella, Stenotrophomonas, Bacillus and Serratia. Maize was more sensitive than wheat to Cd. Klebsiella sp. strain CIK-502 had the most pronounced effects in promoting maize and wheat growth and lowering Cd uptake under Cd stress. PMID:24849374

  20. Carbapenemase-producing Klebsiella pneumoniae: molecular and genetic decoding.

    PubMed

    Chen, Liang; Mathema, Barun; Chavda, Kalyan D; DeLeo, Frank R; Bonomo, Robert A; Kreiswirth, Barry N

    2014-12-01

    Klebsiella pneumoniae carbapenemases (KPCs) were first identified in 1996 in the USA. Since then, regional outbreaks of KPC-producing K. pneumoniae (KPC-Kp) have occurred in the USA, and have spread internationally. Dissemination of blaKPC involves both horizontal transfer of blaKPC genes and plasmids, and clonal spread. Of epidemiological significance, the international spread of KPC-producing K. pneumoniae is primarily associated with a single multilocus sequence type (ST), ST258, and its related variants. However, the molecular factors contributing to the success of ST258 largely remain unclear. In this review, we discuss the recent progresses in understanding KPC-producing K. pneumoniae that are contributing to our knowledge of plasmid and genome composition and structure among the KPC epidemic clone, and we identify possible factors that influence its epidemiological success. PMID:25304194

  1. Synergistic antibiotic combinations for colistin-resistant Klebsiella pneumoniae.

    PubMed

    Kádár, Béla; Kocsis, Béla; Tóth, Ákos; Damjanova, Ivelina; Szász, Máté; Kristóf, Katalin; Nagy, Károly; Szabó, Dóra

    2013-06-01

    In this study antibiotic combinations for multidrug-resistant Klebsiella pneumoniae strains were investigated. The study included a colistin-susceptible and a colistin-resistant KPC-2 producing K. pneumoniae ST258 strains isolated in 2008 and 2009 during an outbreak in Hungary. Antibiotic combinations were analyzed by checkerboard technique and fractional inhibitory concentration indices were calculated. The following antibiotics were tested: ceftazidime, cefotaxime, ceftriaxone, ampicillin, imipenem, ertapenem, amikacin, tobramycin, ciprofloxacin, levofloxacin, moxifloxacin, rifampicin, polymyxin B and colistin. Combinations including 0.25 ?g/ml colistin plus 1 ?g/ml rifampicin, 0.25 ?g/ml polymyxin B plus 1 ?g/ml rifampicin, 1 ?g/ml imipenem plus 2 ?g/ml tobramycin, were found synergistic.These in vitro synergistic combinations suggest potential therapeutical options against infections caused by KPC-2 producing, multidrug-resistant K. pneumoniae ST258. PMID:23827751

  2. Molecular epidemiology of OXA-48-producing Klebsiella pneumoniae in France.

    PubMed

    Liapis, E; Pantel, A; Robert, J; Nicolas-Chanoine, M-H; Cavalié, L; van der Mee-Marquet, N; de Champs, C; Aissa, N; Eloy, C; Blanc, V; Guyeux, C; Hocquet, D; Lavigne, J-P; Bertrand, X

    2014-12-01

    We characterized 53 OXA-48-producing Klebsiella pneumoniae (OXA-48-Kp) isolated between 2011 and 2013 in 21 French hospitals. All the isolates were genotyped using MLST and PFGE and the population structure of the species was determined by a nucleotide-based analysis of the entire K. pneumoniae MLST database. Most of the OXA-48-Kp isolates also produced CTX-M-15 and remained susceptible to imipenem and meropenem. The isolates were distributed into 20 STs, of which five were dominant (ST15, ST101, ST147, ST395 and ST405). All the OXA-48-Kp clustered in the major clade of K. pneumoniae KpI. PMID:24942039

  3. Lactose metabolism involving phospho-beta-galactosidase in Klebsiella.

    PubMed Central

    Hall, B G

    1979-01-01

    Klebsiella strain RE1755A is a Lac- Gal- mutant which has lost both of its lac operons, but possesses a gene specifying beta-galactosidase III, an enzyme which hydrolyzes o-nitrophenyl-beta-D-galactopyranoside but does not hydrolyze lactose. Selective pressure was applied to isolate mutants able to utilize lactose. The lactose-utilizing mutants obtained were shown to possess an unaltered beta-galactosidase III. Lactose utilization was shown to result from a pleiotropic mutation which also (i) permits galactose utilization and (ii) prevents induction of beta-galactosidase III synthesis by lactose. Evidence is presented suggesting that a phospho-beta-galactosidase enzyme is involved in lactose metabolism. PMID:110764

  4. Complete genome sequence of Klebsiella pneumoniae phage JD001.

    PubMed

    Cui, Zelin; Shen, Wenbin; Wang, Zheng; Zhang, Haotian; Me, Rao; Wang, Yanchun; Zeng, Lingbin; Zhu, Yongzhang; Qin, Jinhong; He, Ping; Guo, Xiaokui

    2012-12-01

    Klebsiella pneumoniae is a member of the family Enterobacteriaceae, opportunistic pathogens that are among the eight most prevalent infectious agents in hospitals. The emergence of multidrug-resistant strains of K. pneumoniae has became a public health problem globally. To develop an effective antimicrobial agent, we isolated a bacteriophage, named JD001, from seawater and sequenced its genome. Comparative genome analysis of phage JD001 with other K. pneumoniae bacteriophages revealed that phage JD001 has little similarity to previously published K. pneumoniae phages KP15, KP32, KP34, and phiKO2. Here we announce the complete genome sequence of JD001 and report major findings from the genomic analysis. PMID:23166250

  5. Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae

    PubMed Central

    Al-Marzooq, Farah; Mohd Yusof, Mohd Yasim; Tay, Sun Tee

    2015-01-01

    Infections caused by multidrug resistant Klebsiella pneumoniae have been increasingly reported in many parts of the world. A total of 93 Malaysian multidrug resistant K. pneumoniae isolated from patients attending to University of Malaya Medical Center, Kuala Lumpur, Malaysia from 2010-2012 were investigated for antibiotic resistance determinants including extended-spectrum beta-lactamases (ESBLs), aminoglycoside and trimethoprim/sulfamethoxazole resistance genes and plasmid replicons. CTX-M-15 (91.3%) was the predominant ESBL gene detected in this study. aacC2 gene (67.7%) was the most common gene detected in aminoglycoside-resistant isolates. Trimethoprim/sulfamethoxazole resistance (90.3%) was attributed to the presence of sul1 (53.8%) and dfrA (59.1%) genes in the isolates. Multiple plasmid replicons (1-4) were detected in 95.7% of the isolates. FIIK was the dominant replicon detected together with 13 other types of plasmid replicons. Conjugative plasmids (1-3 plasmids of ~3-100 kb) were obtained from 27 of 43 K. pneumoniae isolates. An ESBL gene (either CTX-M-15, CTX-M-3 or SHV-12) was detected from each transconjugant. Co-detection with at least one of other antibiotic resistance determinants [sul1, dfrA, aacC2, aac(6?)-Ib, aac(6?)-Ib-cr and qnrB] was noted in most conjugative plasmids. The transconjugants were resistant to multiple antibiotics including ?-lactams, gentamicin and cotrimoxazole, but not ciprofloxacin. This is the first study describing the characterization of plasmids circulating in Malaysian multidrug resistant K. pneumoniae isolates. The results of this study suggest the diffusion of highly diverse plasmids with multiple antibiotic resistance determinants among the Malaysian isolates. Effective infection control measures and antibiotic stewardship programs should be adopted to limit the spread of the multidrug resistant bacteria in healthcare settings. PMID:26203651

  6. Interhospital spread of NDM-7-producing Klebsiella pneumoniae belonging to ST437 in Spain.

    PubMed

    Seara, Nieves; Oteo, Jesús; Carrillo, Raquel; Pérez-Blanco, Verónica; Mingorance, Jesús; Gómez-Gil, Rosa; Herruzo, Rafael; Pérez-Vázquez, María; Astray, Jenaro; García-Rodríguez, Julio; Ruiz-Velasco, Luis Moisés; Campos, José; de Burgos, Carmen; Ruiz-Carrascoso, Guillermo

    2015-08-01

    This study describes an interhospital spread of carbapenem-resistant Klebsiella pneumoniae (CRKP) producing NDM-7 carbapenemase that started in December 2013 in Madrid, Spain. NDM-7-producing CRKP were isolated from urine, rectal swabs or blood samples from seven patients admitted to three different hospitals (Hospital Universitario La Paz, Hospital de Cantoblanco and Hospital Central de la Cruz Roja). The isolates were resistant to all antimicrobials tested except colistin and fosfomycin. One blood isolate was susceptible to minocycline and tigecycline but was resistant to fosfomycin. All isolates were closely related by pulsed-field gel electrophoresis (PFGE) and DiversiLab(®) analysis and belonged to multilocus sequence typing (MLST) sequence type 437. In addition, blaNDM-7, blaTEM-1, blaCTX-M-15 and aac(3)-IIa were identified. Family contacts of the index case were negative for NDM-producing bacteria. The outbreak occurred in two separate waves and the cases associated with Hospital de Cantoblanco had been admitted to the same room. Environmental samples from the trap of a sink and a shower in this room were positive for NDM-7-producing CRKP. To our knowledge, this is the first reported worldwide outbreak of NDM-7-producing CRKP. No relationship with the Indian continent, the Balkans or the Middle East could be established. Frequent transfer of aged or chronically ill patients between the facilities involved may have favoured the spread of NDM-7-producing CRKP. The spread of the second wave in Hospital de Cantoblanco probably occurred as a result of transmission from an environmental reservoir. PMID:25982912

  7. Presence of Nitrogen Fixing Klebsiella pneumoniae in the gut of the Formosan Subterranean Termite (Coptotermes formosanus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A gram-negative facultative anaerobic enteric bacterium, Klebsiella pneumoniae was isolated from the hindgut of the Formosan subterranean termite (FST). It was characterized using, Fatty acid methyl ester (FAME) analysis, BIOLOG assay, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-...

  8. Back To Bacteria.

    ERIC Educational Resources Information Center

    Flannery, Maura C.

    1997-01-01

    Explores new research about bacteria. Discusses bacterial genomes, archaea, unusual environments, evolution, pathogens, bacterial movement, biofilms, bacteria in the body, and a bacterial obsession. Contains 29 references. (JRH)

  9. Characterization of Siphoviridae phage Z and studying its efficacy against multidrug-resistant Klebsiella pneumoniae planktonic cells and biofilm.

    PubMed

    Jamal, Muhsin; Hussain, Tahir; Das, Chythanya Rajanna; Andleeb, Saadia

    2015-04-01

    Biofilm has many serious consequences for public health and is a major virulence factor contributing to the chronicity of infections. The aim of the current study was to isolate and characterize a bacteriophage that inhibits multidrug-resistant Klebsiella pneumonia (M) in planktonic form as well as biofilm. This phage, designated bacteriophage Z, was isolated from wastewater. Its adsorption rate to its host bacterium was significantly enhanced by MgCl2 and CaCl2. It has a wide range of pH and heat stability. From its one-step growth, latent time and burst size were determined to be 24 min and about 320 virions per cell, respectively. As analysed by transmission electron microscopy, phage Z had an icosahedral head of width 76±10 nm, length 92±14 nm and icosahedron side 38 nm, and a non-contractile tail 200±15 nm long and 14-29 nm wide. It belongs to the family Siphoviridae in the order Caudovirales. Six structural proteins ranging from 18 to 65 kDa in size were revealed by SDS-PAGE. The genome was found to comprise double-stranded DNA with an approximate size of 36 kb. Bacteria were grown in suspension and as biofilms to compare the susceptibility of both phenotypes to the phage lytic action. Phage Z was effective in reducing biofilm biomass after 24 and 48 h, showing more than twofold and threefold reduction, respectively. Biofilm cells and stationary-phase planktonic bacteria were killed at a lower rate than exponential-phase planktonic bacteria. PMID:25681321

  10. Pneumonia and bacteremia in a golden-headed lion tamarin (Leontopithecus chrysomelas) caused by Klebsiella pneumoniae subsp. pneumoniae during a translocation program of free-ranging animals in Brazil.

    PubMed

    Bueno, Marina G; Iovine, Renata O; Torres, Luciana N; Catão-Dias, José L; Pissinatti, Alcides; Kierulff, Maria C M; Carvalho, Vania M

    2015-05-01

    Klebsiella pneumoniae is an important emerging pathogen in humans, particularly the invasive hypermucoviscosity (HMV) phenotype. In addition, the organism is an important public health concern because of nosocomial infections and antimicrobial resistance. Nonhuman primates in captivity are susceptible to Klebsiella, particularly when a stress factor is involved. Infections vary depending on the species but can cause significant morbidity and mortality in these animals. The objective of this study was to describe a case of bronchopneumonia and bacteremia caused by Klebsiella pneumoniae in a free-ranging golden-headed lion tamarin (Leontopithecus chrysomelas) caught and maintained in quarantine during a translocation program for conservation purposes. An adult male, that had showed emaciation and apathy, was clinically examined and, despite being provided supportive therapy, died 2 days after onset of clinical signs. At postmortem examination, generalized bilateral pneumonia and pericarditis were observed. Tissue samples were fixed in 10% formalin for histology, and pulmonary tissues and cardiac blood were collected for microbiologic diagnostic procedures. Bacteria that were shown to be HMV K. pneumoniae subsp. pneumoniae strains were isolated from the pulmonary fluids and cardiac blood in pure cultures. Severe bronchopneumonia was the main pathological finding. The consequences of the confirmed presence of the HMV phenotype of K. pneumoniae subsp. pneumoniae in this wildlife species for human, animal, and ecosystem health should be determined. These results demonstrate the importance of quarantine and potential pathogen screening during wildlife translocation procedures. PMID:25943130

  11. Prevalence of Extended Spectrum ?-lactamase-Producing Klebsiella pneumoniae in Clinical Isolates

    PubMed Central

    Ali Abdel Rahim, Khalid Abdalla; Ali Mohamed, Ahmed Mohamed

    2014-01-01

    Background: Extended spectrum ?-lactamase (ESBL) are gram-negative bacteria that produce the enzyme, ?-lactamase, which can break down commonly used antibiotics, such as penicillin and cephalosporins, making infections with ESBL producing bacteria more difficult to treat. Extended spectrum ?-lactamase-producing Klebsiella pneumoniae were first reported in 1983 from Germany, and since then a steady increase in resistance against cephalosporins has been seen causing health problems. Objectives: The aim of this study was to determine the prevalence of ESBL in strains of K. pneumoniae isolated from different clinical samples. Patients and Methods: One hundred and thirty isolates of K. pneumoniae were isolated from different clinical specimens from King Khalid hospital, Hafr Elbatin, Kingdom Saudi Arabia. These isolates were then characterized, tested for antimicrobial susceptibility and screened for ESBL production by the MicroScan WalkAway-96 SI System. Extended spectrum ?-lactamase production was confirmed by the phenotypic confirmatory disc diffusion test (PCDDT) and the double disc synergy test (DDST). Results: Overall, 76.9% (100) of the isolates were resistant to cefuroxime, cefepime and cefazolin, 69.23% (90) were resistant to cefotaxime, and 46.15% (60) were resistant to cefoxitin. Extended spectrum ?-lactamase was detected in 53.8% (70) of K. pneumoniae as detected by the MicroScan “WalkAway-96” SI System and 50.07% (66) by PCDDT and 46.15% (60) by DDST. All K. pneumoniae isolates were resistant to ampicillin followed by both piperacillin and mezlocillin 92.30% (120). K. pneumoniae isolates showed high sensitivity to imipenem (15.38%) (20), followed by ertapenem, tetracycline, tigecycline pipracilline/tazobactam and amikacin (23.07%) (30). Conclusions: Our study showed that the prevalence of ESBL-producing K. pneumoniae at King Khalid Hospital was significantly high. Routine detection of ESBL-producing microorganisms is required by each of the laboratory standard detection methods to control the spread of these infections and allow a proper therapeutic strategy. For detection, the phenotypic confirmatory disc diffusion test is simple, sensitive and cost effective. However, there is a need for larger scale drug susceptibility surveillance. PMID:25774279

  12. Fe(III) oxides accelerate microbial nitrate reduction and electricity generation by Klebsiella pneumoniae L17.

    PubMed

    Liu, Tongxu; Li, Xiaomin; Zhang, Wei; Hu, Min; Li, Fangbai

    2014-06-01

    Klebsiella pneumoniae L17 is a fermentative bacterium that can reduce iron oxide and generate electricity under anoxic conditions, as previously reported. This study reveals that K. pneumoniae L17 is also capable of dissimilatory nitrate reduction, producing NO2(-), NH4(+), NO and N2O under anoxic conditions. The presence of Fe(III) oxides (i.e., ?-FeOOH, ?-FeOOH, ?-Fe2O3 and ?-Fe2O3) significantly accelerates the reduction of nitrate and generation of electricity by K. pneumoniae L17, which is similar to a previous report regarding another fermentative bacterium, Bacillus. No significant nitrate reduction was observed upon treatment with Fe(2+) or ?-FeOOH+Fe(2+), but a slight facilitation of nitrate reduction and electricity generation was observed upon treatment with L17+Fe(2+). This result suggests that aqueous Fe(II) or mineral-adsorbed Fe(II) cannot reduce nitrate abiotically but that L17 can catalyze the reduction of nitrate and generation of electricity in the presence of Fe(II) (which might exist as cell surface-bound Fe(II)). To rule out the potential effect of Fe(II) produced by L17 during microbial iron reduction, treatments with the addition of TiO2 or Al2O3 instead of Fe(III) oxides also exhibited accelerated microbial nitrate reduction and electricity generation, indicating that cell-mineral sorption did account for the acceleration effect. However, the acceleration caused by Fe(III) oxides is only partially attributed to the cell surface-bound Fe(II) and cell-mineral sorption but may be driven by the iron oxide conduction band-mediated electron transfer from L17 to nitrate or an electrode, as proposed previously. The current study extends the diversity of bacteria of which nitrate reduction and electricity generation can be facilitated by the presence of iron oxides and confirms the positive role of Fe(III) oxides on microbial nitrate reduction and electricity generation by particular fermentative bacteria in anoxic environments. PMID:24703664

  13. K-antigen-specific, but not O-antigen-specific natural human serum antibodies promote phagocytosis of Klebsiella pneumoniae

    Microsoft Academic Search

    Philipp M Lepper; Angelika Möricke; Thomas K Held; E. Marion Schneider; Matthias Trautmann

    2003-01-01

    Infections due to Klebsiella pneumoniae and other Klebsiella spp. are a leading cause of hospital-associated morbidity, especially in the intensive care setting. In this study, the hypothesis that normal human sera contain sufficient concentrations of K-antigen-specific antibodies to promote phagocytic killing of encapsulated, highly virulent Klebsiella organisms was tested. K2-antigen-specific IgG and IgM antibodies were detected in each of 10

  14. The Museum of Bacteria

    NSDL National Science Digital Library

    The Museum of Bacteria serves as a clearinghouse of Web links on bacteria and bacteriology and also provides "crystal-clear information about many aspects of bacteria." The Museum of Bacteria is provided by the Foundation of Bacteria, a non-profit organization dedicated to promoting the field of bacteriology. Links are selected for a general audience, although one section is geared toward professionals in the field. Some of the latest features of the Museum are an "exhibit" on the good bacteria found in food and a Student Hall where students can present their own bacteria-related projects.

  15. Asymptomatic carriage of Klebsiella pneumoniae producing extended-spectrum beta-lactamase by patients in a neurological early rehabilitation unit: management of an outbreak.

    PubMed

    Holländer, R; Ebke, M; Barck, H; von Pritzbuer, E

    2001-07-01

    During 11 months 58 extended-spectrum beta-lactamase-producing Klebsiella pneumoniae (ESBL-Kp) isolates were grown from 10 patients on a neurological early rehabilitation unit. The patients had no signs of infection but were colonized in the nose and trachea, and unusually only one had colonization in the gut. A single clone of ESBL-Kp was identified by pulse field gel electrophoresis. Strong hygienic precautions similar to those for Methicillin-resistant Staphylococcus aureus patients prevented spread of the bacteria to other wards. However, rehabilitation for patients with severe neurological failures made it very difficult to follow hygienic requirements. Disinfection of mucous membranes was difficult. Eventually the application of a nasal spray containing povidone-iodine proved to be successful. PMID:11439008

  16. Klebsiella pneumoniae 1,3-propanediol:NAD+ oxidoreductase.

    PubMed

    Johnson, E A; Lin, E C

    1987-05-01

    Fermentative utilization of glycerol, a more reduced carbohydrate than aldoses and ketoses, requires the disposal of the two extra hydrogen atoms. This is accomplished by sacrificing an equal quantity of glycerol via an auxiliary pathway initiated by glycerol dehydratase. The product, 3-hydroxypropionaldehyde, is then reduced by 1,3-propanediol NAD+:oxidoreductase (1,3-propanediol dehydrogenase; EC 1.1.1.202), resulting in the regeneration of NAD+ from NADH. The pathway for the assimilation of glycerol is initiated by an NAD-linked dehydrogenase. In Klebsiella pneumoniae the two pathways are encoded by the dha regulon which is inducible only anaerobically. In this study 1,3-propanediol:NAD+ oxidoreductase was purified from cells grown anaerobically on glycerol. The enzyme was immunochemically distinct from the NAD-linked glycerol dehydrogenase and was an octamer or hexamer of a polypeptide of 45,000 +/- 3,000 daltons. When tested as a dehydrogenase, only 1,3-propanediol served as a substrate; no activity was detected with ethanol, 1-propanol, 1,2-propanediol, glycerol, or 1,4-butanediol. The enzyme was inhibited by chelators of divalent cations. An enzyme preparation inhibited by alpha,alpha'-dipyridyl was reactivated by the addition of Fe2+ or Mn2+ after removal of the chelator by gel filtration. As for glycerol dehydrogenase, 1,3-propanediol oxidoreductase is apparently inactivated by oxidation during aerobic metabolism, under which condition the enzyme becomes superfluous. PMID:3553154

  17. Klebsiella pneumoniae 1,3-propanediol:NAD+ oxidoreductase.

    PubMed Central

    Johnson, E A; Lin, E C

    1987-01-01

    Fermentative utilization of glycerol, a more reduced carbohydrate than aldoses and ketoses, requires the disposal of the two extra hydrogen atoms. This is accomplished by sacrificing an equal quantity of glycerol via an auxiliary pathway initiated by glycerol dehydratase. The product, 3-hydroxypropionaldehyde, is then reduced by 1,3-propanediol NAD+:oxidoreductase (1,3-propanediol dehydrogenase; EC 1.1.1.202), resulting in the regeneration of NAD+ from NADH. The pathway for the assimilation of glycerol is initiated by an NAD-linked dehydrogenase. In Klebsiella pneumoniae the two pathways are encoded by the dha regulon which is inducible only anaerobically. In this study 1,3-propanediol:NAD+ oxidoreductase was purified from cells grown anaerobically on glycerol. The enzyme was immunochemically distinct from the NAD-linked glycerol dehydrogenase and was an octamer or hexamer of a polypeptide of 45,000 +/- 3,000 daltons. When tested as a dehydrogenase, only 1,3-propanediol served as a substrate; no activity was detected with ethanol, 1-propanol, 1,2-propanediol, glycerol, or 1,4-butanediol. The enzyme was inhibited by chelators of divalent cations. An enzyme preparation inhibited by alpha,alpha'-dipyridyl was reactivated by the addition of Fe2+ or Mn2+ after removal of the chelator by gel filtration. As for glycerol dehydrogenase, 1,3-propanediol oxidoreductase is apparently inactivated by oxidation during aerobic metabolism, under which condition the enzyme becomes superfluous. Images PMID:3553154

  18. Properties of Klebsiella phage P13 and associated exopolysaccharide depolymerase

    NASA Astrophysics Data System (ADS)

    Liu, Yang; Li, Guiyang; Mo, Zhaolan; Chai, Zihan; Shang, Anqi; Mou, Haijin

    2013-11-01

    The bacteriophage P13 that infects Klebsiella serotype K13 contains a heat-stable depolymerase capable of effective degradation of exopolysaccharide (EPS) produced by this microorganism. In this study, the titer of phage P13, initially 2.0 × 107 pfu mL-1, was found increasing 20 min after infection and reached 5.0 × 109 pfu mL-1 in 60 min. Accordingly, the enzyme activity of depolymerase approached the maximum 60 min after infection. Treatment at 70°C for 30 min inactivated all the phage, but retained over 90% of the depolymerase activity. Addition of acetone into the crude phage lysate led to precipitation of the protein, with a marked increase in bacterial EPS degradation activity and a rapid drop in the titer of phage. After partial purification by acetone precipitation and ultrafiltration centrifugation, the enzyme was separated from the phage particles, showing two components with enzyme activity on Q-Sepharose Fast Flow. The soluble enzyme had an optimum degradation activity at 60°C and pH 6.5. Transmission electron microscopy demonstrated that the phage P13 particles were spherical with a diameter of 50 nm and a short stumpy tail. It was a doublestrand DNA virus consisting of a nucleic acid molecule of 45976 bp. This work provides an efficient purification operation including thermal treatment and ultrafiltration centrifugation, to dissociate depolymerase from phage particles. The characterization of phage P13 and associated EPS depolymerase is beneficial for further application of this enzyme.

  19. Structural and Mechanical Properties of Klebsiella pneumoniae Type 3 Fimbriae? §

    PubMed Central

    Chen, Feng-Jung; Chan, Chia-Han; Huang, Ying-Jung; Liu, Kuo-Liang; Peng, Hwei-Ling; Chang, Hwan-You; Liou, Gunn-Guang; Yew, Tri-Rung; Liu, Cheng-Hsien; Hsu, Ken Y.; Hsu, Long

    2011-01-01

    This study investigated the structural and mechanical properties of Klebsiella pneumoniae type 3 fimbriae, which constitute a known virulence factor for the bacterium. Transmission electron microscopy and optical tweezers were used to understand the ability of the bacterium to survive flushes. An individual K. pneumoniae type 3 fimbria exhibited a helix-like structure with a pitch of 4.1 nm and a three-phase force-extension curve. The fimbria was first nonlinearly stretched with increasing force. Then, it started to uncoil and extended several micrometers at a fixed force of 66 ± 4 pN (n = 22). Finally, the extension of the fimbria shifted to the third phase, with a characteristic force of 102 ± 9 pN (n = 14) at the inflection point. Compared with the P fimbriae and type 1 fimbriae of uropathogenic Escherichia coli, K. pneumoniae type 3 fimbriae have a larger pitch in the helix-like structure and stronger uncoiling and characteristic forces. PMID:21239584

  20. Purification and properties of Klebsiella aerogenes D-arabitol dehydrogenase.

    PubMed Central

    Neuberger, M S; Patterson, R A; Hartley, B S

    1979-01-01

    An Escherichia coli K12 strain was constructed that synthesized elevated quantities of Klebsiella aerogenes D-arabitol dehydrogenase; the enzyme accounted for about 5% of the soluble protein in this strain. Some 280 mg of enzyme was purified from 180 g of cell paste. The purified enzyme was active as a monomer of 46,000 mol.wt. The amino acid composition and kinetic constants of the enzyme for D-arabitol and D-mannitol are reported. The apparent Km for D-mannitol was more than 3-fold that for D-arabitol, whereas the maximum velocities with both substrates were indistinguishable. The enzyme purified from the E. coli K12 construct was indistinguishable by the criteria of molecular weight, electrophoretic mobility in native polyacrylamide gel and D-mannitol/D-arabitol activity ratio from D-arabitol dehydrogenase synthesized in wild-type K. aerogenes. Purified D-arabitol dehydrogenase showed no immunological cross-reaction with K. aerogenes ribitol dehydrogenase. During electrophoresis in native polyacrylamide gels, oxidation by persulphate catalysed the formation of inactive polymeric forms of the enzyme. Dithiothreitol and pre-electrophoresis protected against this polymerization. Images Fig. 1. Fig. 2. PMID:393250

  1. CRYSTAL STRUCTURE ANALYSIS OF A PUTATIVE OXIDOREDUCTASE FROM KLEBSIELLA PNEUMONIAE

    SciTech Connect

    Baig, M.; Brown, A.; Eswaramoorthy, S.; Swaminathan, S.

    2009-01-01

    Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) at Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.

  2. Prevalence and characterization of extended-spectrum-?-lactamase-producing Escherichia coli and Klebsiella pneumoniae in ready-to-eat vegetables.

    PubMed

    Kim, Hong-Seok; Chon, Jung-Whan; Kim, Young-Ji; Kim, Dong-Hyeon; Kim, Mu-Sang; Seo, Kun-Ho

    2015-08-17

    The objective of this investigation was to determine the prevalence and characteristics of extended-spectrum-?-lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae in ready-to-eat (RTE) vegetables. A total of 189 RTE vegetable samples (91 sprouts and 98 mixed salads) were collected in a retail market in South Korea from October 2012 to February 2013. The prevalence of ESBL-producing E. coli and K. pneumoniae was 10.1%. Of these, 94.7% were from the sprout samples. All isolates were resistant to cefotaxime, and many of the ESBL producers were also resistant to non-?-lactam antibiotics, including gentamicin, trimethoprim/sulfamethoxazole, and ciprofloxacin (73.7%, 63.2%, and 26.3% respectively). TEM-1, SHV-1, -2, -11, -12, -27, -28 and -61, and CTX-M-14, -15 and -55 ?-lactamases were detected alone or in combination. The genetic platforms of all CTX-M producing isolates were ISEcp1-blaCTX-M-orf477 and ISEcp1-blaCTX-M-IS903 in CTX-M groups 1 and 9, respectively. To our knowledge, this is the first report of the prevalence and characterization of ESBL-producing E. coli and K. pneumoniae isolated from RTE vegetables. The results of this study indicate that RTE vegetables, sprouts, in particular, may play a role in spreading antimicrobial resistant bacteria and ESBL genes to humans. PMID:26001064

  3. Effects of the hindlimb-unloading model of spaceflight conditions on resistance of mice to infection with Klebsiella pneumoniae

    NASA Technical Reports Server (NTRS)

    Belay, Tesfaye; Aviles, Hernan; Vance, Monique; Fountain, Kimberly; Sonnenfeld, Gerald

    2002-01-01

    BACKGROUND: It has been well documented in several studies that many immunologic parameters are altered in experimental animals and human subjects who have flown in space. However, it is not fully known whether these immunologic changes could result in increased susceptibility to infection. Hindlimb (antiorthostatic) unloading of rodents has been used successfully to simulate some of the effects of spaceflight on physiologic systems. OBJECTIVE: The objective of this study was to determine the effect of hindlimb unloading on the outcome of Klebsiella pneumoniae infection in mice. METHODS: Hindlimb-unloaded, hindlimb-restrained, and control mice were intraperitoneally infected with one 50% lethal dose of K pneumoniae 2 days after suspension. Mortality and bacterial load in several organs were compared among the groups. RESULTS: Unloaded mice showed significantly increased mortality and reduced mean time to death compared with that seen in the control groups. Kinetics of bacterial growth with smaller infective doses revealed that control mice were able to clear bacteria from the organs after 30 hours. In contrast, unloaded mice had continued bacterial growth at the same time point. CONCLUSION: The results of this study suggest that hindlimb unloading might enhance the dissemination of K pneumoniae, leading to increased mortality. The complex physiologic changes observed during hindlimb unloading, including stress, have a key role in the pathophysiology of this infection.

  4. Comparison of biofilm and attachment mechanisms of a phytopathological and clinical isolate of Klebsiella pneumoniae Subsp. pneumoniae.

    PubMed

    Nicolau Korres, Adriana Marcia; Aquije, Gloria Maria de Farias V; Buss, David S; Ventura, Jose Aires; Fernandes, Patricia Machado Bueno; Fernandes, Antonio Alberto Ribeiro

    2013-01-01

    Some bacterial species can colonize humans and plants. It is almost impossible to prevent the contact of clinically pathogenic bacteria with food crops, and if they can persist there, they can reenter the human food chain and cause disease. On the leaf surface, microorganisms are exposed to a number of stress factors. It is unclear how they survive in such different environments. By increasing adhesion to diverse substrates, minimizing environmental differences, and providing protection against defence mechanisms, biofilms could provide part of the answer. Klebsiella pneumoniae subsp. pneumoniae is clinically important and also associated with fruit diseases, such as "pineapple fruit collapse." We aimed to characterize biofilm formation and adhesion mechanisms of this species isolated from pineapple in comparison with a clinical isolate. No differences were found between the two isolates quantitatively or qualitatively. Both tested positive for capsule formation and were hydrophobic, but neither produced adherence fibres, which might account for their relatively weak adhesion compared to the positive control Staphylococcus epidermidis ATCC 35984. Both produced biofilms on glass and polystyrene, more consistently at 40°C than 35°C, confirmed by atomic force and high-vacuum scanning electron microscopy. Biofilm formation was maintained in an acidic environment, which may be relevant phytopathologically. PMID:24222755

  5. Insect Antimicrobial Peptide Complexes Prevent Resistance Development in Bacteria

    PubMed Central

    Chernysh, Sergey; Gordya, Natalia; Suborova, Tatyana

    2015-01-01

    In recent decades much attention has been paid to antimicrobial peptides (AMPs) as natural antibiotics, which are presumably protected from resistance development in bacteria. However, experimental evolution studies have revealed prompt resistance increase in bacteria to any individual AMP tested. Here we demonstrate that naturally occurring compounds containing insect AMP complexes have clear advantage over individual peptide and small molecule antibiotics in respect of drug resistance development. As a model we have used the compounds isolated from bacteria challenged maggots of Calliphoridae flies. The compound isolated from blow fly Calliphora vicina was found to contain three distinct families of cell membrane disrupting/permeabilizing peptides (defensins, cecropins and diptericins), one family of proline rich peptides and several unknown antimicrobial substances. Resistance changes under long term selective pressure of the compound and reference antibiotics cefotaxime, meropenem and polymyxin B were tested using Escherichia coli, Klebsiella pneumonia and Acinetobacter baumannii clinical strains. All the strains readily developed resistance to the reference antibiotics, while no signs of resistance growth to the compound were registered. Similar results were obtained with the compounds isolated from 3 other fly species. The experiments revealed that natural compounds containing insect AMP complexes, in contrast to individual AMP and small molecule antibiotics, are well protected from resistance development in bacteria. Further progress in the research of natural AMP complexes may provide novel solutions to the drug resistance problem. PMID:26177023

  6. PCR-based identification of Klebsiella pneumoniae subsp. rhinoscleromatis, the agent of rhinoscleroma.

    PubMed

    Fevre, Cindy; Passet, Virginie; Deletoile, Alexis; Barbe, Valérie; Frangeul, Lionel; Almeida, Ana S; Sansonetti, Philippe; Tournebize, Régis; Brisse, Sylvain

    2011-05-01

    Rhinoscleroma is a chronic granulomatous infection of the upper airways caused by the bacterium Klebsiella pneumoniae subsp. rhinoscleromatis. The disease is endemic in tropical and subtropical areas, but its diagnosis remains difficult. As a consequence, and despite available antibiotherapy, some patients evolve advanced stages that can lead to disfiguration, severe respiratory impairment and death by anoxia. Because identification of the etiologic agent is crucial for the definitive diagnosis of the disease, the aim of this study was to develop two simple PCR assays. We took advantage of the fact that all Klebsiella pneumoniae subsp. rhinoscleromatis isolates are (i) of capsular serotype K3; and (ii) belong to a single clone with diagnostic single nucleotide polymorphisms (SNP). The complete sequence of the genomic region comprising the capsular polysaccharide synthesis (cps) gene cluster was determined. Putative functions of the 21 genes identified were consistent with the structure of the K3 antigen. The K3-specific sequence of gene Kr11509 (wzy) was exploited to set up a PCR test, which was positive for 40 K3 strains but negative when assayed on the 76 other Klebsiella capsular types. Further, to discriminate Klebsiella pneumoniae subsp. rhinoscleromatis from other K3 Klebsiella strains, a specific PCR assay was developed based on diagnostic SNPs in the phosphate porin gene phoE. This work provides rapid and simple molecular tools to confirm the diagnostic of rhinoscleroma, which should improve patient care as well as knowledge on the prevalence and epidemiology of rhinoscleroma. PMID:21629720

  7. Bacteria isolated from amoebae/bacteria consortium

    DOEpatents

    Tyndall, R.L.

    1995-05-30

    New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

  8. Bacteria isolated from amoebae/bacteria consortium

    DOEpatents

    Tyndall, Richard L. (Clinton, TN)

    1995-01-01

    New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

  9. In Silico Analysis of Usher Encoding Genes in Klebsiella pneumoniae and Characterization of Their Role in Adhesion and Colonization

    PubMed Central

    Khater, Fida; Balestrino, Damien; Charbonnel, Nicolas; Dufayard, Jean François; Brisse, Sylvain; Forestier, Christiane

    2015-01-01

    Chaperone/usher (CU) assembly pathway is used by a wide range of Enterobacteriaceae to assemble adhesive surface structures called pili or fimbriae that play a role in bacteria-host cell interactions. In silico analysis revealed that the genome of Klebsiella pneumoniae LM21 harbors eight chromosomal CU loci belonging to ??? and ? clusters. Of these, only two correspond to previously described operons, namely type 1 and type 3-encoding operons. Isogenic usher deletion mutants of K. pneumoniae LM21 were constructed for each locus and their role in adhesion to animal (Intestine 407) and plant (Arabidopsis thaliana) cells, biofilm formation and murine intestinal colonization was investigated. Type 3 pili usher deleted mutant was impaired in all assays, whereas type 1 pili usher deleted mutant only showed attenuation in adhesion to plant cells and in intestinal colonization. The LM21?kpjC mutant was impaired in its capacity to adhere to Arabidopsis cells and to colonize the murine intestine, either alone or in co-inoculation experiments. Deletion of LM21kpgC induced a significant decrease in biofilm formation, in adhesion to animal cells and in colonization of the mice intestine. The LM21?kpaC and LM21?kpeC mutants were only attenuated in biofilm formation and the adhesion abilities to Arabidopsis cells, respectively. No clear in vitro or in vivo effect was observed for LM21?kpbC and LM21?kpdC mutants. The multiplicity of CU loci in K. pneumoniae genome and their specific adhesion pattern probably reflect the ability of the bacteria to adhere to different substrates in its diverse ecological niches. PMID:25751658

  10. Whole genome sequencing of extended-spectrum ?-lactamase producing Klebsiella pneumoniae isolated from a patient in Lebanon

    PubMed Central

    Tokajian, Sima; Eisen, Jonathan A.; Jospin, Guillaume; Farra, Anna; Coil, David A.

    2015-01-01

    Objective: The emergence of extended-spectrum ?-lactamase (ESBL)-producing bacteria is now a critical concern. The ESBL-producing Klebsiella pneumoniae constitutes one of the most common multidrug-resistant (MDR) groups of gram-negative bacteria involved in nosocomial infections worldwide. In this study we report on the molecular characterization through whole genome sequencing of an ESBL-producing K. pneumoniae strain, LAU-KP1, isolated from a stool sample from a patient admitted for a gastrointestinal procedure/surgery at the Lebanese Amrican University Medical Center-Rizk Hospital (LAUMCRH) in Lebanon. Methods: Illumina paired-end libraries were prepared and sequenced, which resulted in 4,220,969 high-quality reads. All sequence processing and assembly were performed using the A5 assembly pipeline. Results: The initial assembly produced 86 contigs, for which no scaffolding was obtained. The final collection of contigs was submitted to GenBank. The final draft genome sequence consists of a combined 5,632,663 bases with 57% G+C content. Automated annotation was performed using the RAST annotation server. Sequencing analysis revealed that the isolate harbored different ?-lactamase genes, including blaoxa?1, blaCTX?M?15, blaSHV?11, and blaTEM?1b. The isolate was also characterized by the concomitant presence of other resistance determinants most notably acc(6?)-lb-cr and qnrb1. The entire plasmid content was also investigated and revealed homology with four major plasmids pKPN-IT, pBS512_2, pRSF1010_SL1344, and pKPN3. Conclusions: The potential role of K. pneumonia as a reservoir for ESBL genes and other resistance determinants is along with the presence of key factors that favor the spread of antimicrobial resistance a clear cause of concern and the problem that Carbapenem-non-susceptible ESBL isolates are posing in hospitals should be reconsidered through systematic exploration and molecular characterization. PMID:25905047

  11. Insights into the evolution of gene organization and multidrug resistance from Klebsiella pneumoniae plasmid pKF3-140.

    PubMed

    Bai, Jie; Liu, Qi; Yang, Yang; Wang, Junrong; Yang, Yanmei; Li, Jinsong; Li, Peizhen; Li, Xueying; Xi, Yali; Ying, Jun; Ren, Ping; Yang, Lei; Ni, Liyan; Wu, Jinyu; Bao, Qiyu; Zhou, Tieli

    2013-04-25

    Plasmid-mediated transfer of drug-resistance genes among various bacterial species is considered one of the most important mechanisms for the spread of multidrug resistance. To gain insights into the evolution of gene organization and antimicrobial resistance in clinical bacterial samples, a complete plasmid genome of Klebsiella pneumoniae pKF3-140 is determined, which has a circular chromosome of 147,416bp in length. Among the 203 predicted genes, 142 have function assignment and about 50 appear to be involved in plasmid replication, maintenance, conjugative transfer, iron acquisition and transport, and drug resistance. Extensive comparative genomic analyses revealed that pKF3-140 exhibits a rather low sequence similarity and structural conservation with other reported K. pneumoniae plasmids. In contrast, the overall organization of pKF3-140 is highly similar to Escherichia coli plasmids p1ESCUM and pUTI89, which indicates the possibility that K. pneumoniae pKF3-140 may have a potential origin in E. coli. Meanwhile, interestingly, several drug resistant genes show high similarity to the plasmid pU302L in Salmonella enterica serovar Typhimurium U302 strain G8430 and the plasmid pK245 in K. pneumoniae. This mosaic pattern of sequence similarities suggests that pKF3-140 might have arisen from E. coli and acquired the resistance genes from a variety of enteric bacteria and underscores the importance of a further understanding of horizontal gene transfer among enteric bacteria. PMID:23402892

  12. Meropenem Resistance in Imipenem-Susceptible Meropenem-Resistant Klebsiella pneumoniae Isolates Not Detected by Rapid Automated Testing Systems

    PubMed Central

    Harino, Toshie; Kayama, Shizuo; Kuwahara, Ryuichi; Kashiyama, Seiya; Shigemoto, Norifumi; Onodera, Makoto; Yokozaki, Michiya; Ohge, Hiroki

    2013-01-01

    Klebsiella pneumoniae showing high resistance to all ?-lactams except imipenem, designated as ISMRK (imipenem-susceptible meropenem-resistant Klebsiella) is emerging in Japan. The carbapenem resistance of ISMRK cannot be screened by the Vitek and the RAISUS rapid automated susceptibility test systems, which may lead to inappropriate antimicrobial therapy, resulting in compromised patient outcomes. PMID:23720796

  13. Bacteria Inactivation During Lithotripsy

    NASA Astrophysics Data System (ADS)

    del Sol Quintero, María; Mora, Ulises; Gutiérrez, Jorge; Mues, Enrique; Castaño, Eduardo; Fernández, Francisco; Loske, Achim M.

    2006-09-01

    The influence of extracorporeal and intracorporeal lithotripsy on the viability of bacteria contained inside artificial kidney stones was investigated in vitro. Two different bacteria were exposed to the action of one extracorporeal shock wave generator and four intracorporeal lithotripters.

  14. Inactivation of bacteria via photosensitization of vitamin K3 by UV-A light.

    PubMed

    Xu, Fei; Vostal, Jaroslav G

    2014-09-01

    This study investigated inactivation of bacteria with ultraviolet light A irradiation in combination with vitamin K3 as a photosensitizer. Six bacteria including Bacillus cereus, Pseudomonas aeruginosa, Staphylococcus aureus, Staphylococcus epidermidis, Klebsiella pneumoniae, and Escherichia coli suspended in vitamin K3 aqueous solution were exposed to ultraviolet light A. Five of six bacteria, with the exception of Pseudomonas aeruginosa, were reduced by eight logs with 1600 ?M of vitamin K3 and 5.8 J cm(-2) UV-A irradiation. Pseudomonas aeruginosa was reduced by four logs under these conditions. Reactive oxygen species including singlet oxygen, hydroxyl radical and superoxide anion radical were generated in vitamin K3 aqueous solution under UV-A irradiation. These results suggest that vitamin K3 and UV-A irradiation may be effective for bacterial inactivation in environmental and medical applications. PMID:25053393

  15. Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.

    PubMed

    Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching

    2014-06-15

    The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. PMID:24820641

  16. Identification of Enterobacter bacteria as saxitoxin producers in cattle's rumen and surface water from Venezuelan Savannahs.

    PubMed

    Sevcik, C; Noriega, J; D'Suze, G

    2003-09-15

    We have previously shown that a paralytic toxin able to block sodium channels in nerve is associated with a cattle disease known as bovine paraplegic syndrome (BPS) [Toxicon. 31 (1993) 1581]. We have now identified this as saxitoxin (STX) using HPLC by either the methods of [Toxicon. 31 (1993) 1581], or [Toxicon. 25 (1987) 1105]. In recent experiments we were able to collect and cultivate facultative anaerobic bacteria growing on rumen, grass and ponds of corrals with high incidence of BPS; the cultured bacteria produce compounds indistinguishable from STX under both HPLC procedures described above. Two species of the Enterobacter genus (E. asburiae and E. cloacae) and a strain of Klebsiella pneumoniae, were identified using standard biochemical criteria as well as gas chromatography of bacterial lipids. All these bacteria produced STX in aerobic cultures. PMID:14505935

  17. Klebsiella Biotypes Among Coliforms Isolated from Forest Environments and Farm Produce

    PubMed Central

    Duncan, D. W.; Razzell, W. E.

    1972-01-01

    Samples of water, soil, needles, and bark were collected from three different forest environments and from a pulp and paper mill. In addition, samples of fresh produce were obtained from a local supermarket. All samples were examined for total and fecal coliforms. The counts obtained from the forestrelated samples did not correlate with sample type or location. When 123 isolates were identified biochemically, 71% were Klebsiella, 19% Enterobacter, 8% Citrobacter, and 2% Escherichia. All the Citrobacter, 75% of the Enterobacter, and 65% of the Klebsiella were negative for growth in elevated coliform (EC) broth. All the Escherichia were EC positive. The counts obtained from the fresh produce were generally higher than the forest counts, but the distribution of biotypes was similar. Of the 146 isolates examined 64% were Klebsiella, 14% were Escherichia, 14% were Enterobacter, and 8% were Citrobacter. All the Enterobacter and Citrobacter were EC negative, whereas 25% of the Klebesiella and 80% of the Escherichia were EC positive. PMID:4568255

  18. Surveillance of Carbapenem-Resistant Klebsiella pneumoniae: Tracking Molecular Epidemiology and Outcomes through a Regional Network

    PubMed Central

    Perez, Federico; Rudin, Susan D.; Cober, Eric; Hanrahan, Jennifer; Ziegler, Julie; Webber, Raymond; Fox, Jacqueline; Mason, Pamela; Richter, Sandra S.; Cline, Marianne; Hall, Geraldine S.; Kaye, Keith S.; Jacobs, Michael R.; Kalayjian, Robert C.; Salata, Robert A.; Segre, Julia A.; Conlan, Sean; Evans, Scott; Fowler, Vance G.

    2014-01-01

    Carbapenem resistance in Gram-negative bacteria is on the rise in the United States. A regional network was established to study microbiological and genetic determinants of clinical outcomes in hospitalized patients with carbapenem-resistant (CR) Klebsiella pneumoniae in a prospective, multicenter, observational study. To this end, predefined clinical characteristics and outcomes were recorded and K. pneumoniae isolates were analyzed for strain typing and resistance mechanism determination. In a 14-month period, 251 patients were included. While most of the patients were admitted from long-term care settings, 28% of them were admitted from home. Hospitalizations were prolonged and complicated. Nonsusceptibility to colistin and tigecycline occurred in isolates from 7 and 45% of the patients, respectively. Most of the CR K. pneumoniae isolates belonged to repetitive extragenic palindromic PCR (rep-PCR) types A and B (both sequence type 258) and carried either blaKPC-2 (48%) or blaKPC-3 (51%). One isolate tested positive for blaNDM-1, a sentinel discovery in this region. Important differences between strain types were noted; rep-PCR type B strains were associated with blaKPC-3 (odds ratio [OR], 294; 95% confidence interval [CI], 58 to 2,552; P < 0.001), gentamicin nonsusceptibility (OR, 24; 95% CI, 8.39 to 79.38; P < 0.001), amikacin susceptibility (OR, 11.0; 95% CI, 3.21 to 42.42; P < 0.001), tigecycline nonsusceptibility (OR, 5.34; 95% CI, 1.30 to 36.41; P = 0.018), a shorter length of stay (OR, 0.98; 95% CI, 0.95 to 1.00; P = 0.043), and admission from a skilled-nursing facility (OR, 3.09; 95% CI, 1.26 to 8.08; P = 0.013). Our analysis shows that (i) CR K. pneumoniae is seen primarily in the elderly long-term care population and that (ii) regional monitoring of CR K. pneumoniae reveals insights into molecular characteristics. This work highlights the crucial role of ongoing surveillance of carbapenem resistance determinants. PMID:24798270

  19. Klebsiella pneumoniae Induces an Inflammatory Response in an In Vitro Model of Blood-Retinal Barrier

    PubMed Central

    Motta, C.; Salmeri, M.; Anfuso, C. D.; Amodeo, A.; Scalia, M.; Toscano, M. A.; Giurdanella, G.; Alberghina, M.

    2014-01-01

    Klebsiella pneumoniae has become an important pathogen in recent years. Although most cases of K. pneumoniae endogenous endophthalmitis occur via hematogenous spread, it is not yet clear which microbial and host factors are responsible for the ability of K. pneumoniae to cross the blood-retinal barrier (BRB). In the present study, we show that in an in vitro model of BRB based on coculturing primary bovine retinal endothelial cells (BREC) and primary bovine retinal pericytes (BRPC), K. pneumoniae infection determines changes of transendothelial electrical resistance (TEER) and permeability to sodium fluorescein. In the coculture model, bacteria are able to stimulate the enzyme activities of endothelial cytosolic and Ca2+-independent phospholipase A2s (cPLA2 and iPLA2). These results were confirmed by the incremental expression of cPLA2, iPLA2, cyclo-oxygenase-1 (COX1), and COX2 in BREC, as well as by cPLA2 phosphorylation. In supernatants of K. pneumoniae-stimulated cocultures, increases in prostaglandin E2 (PGE2), interleukin-6 (IL-6), IL-8, and vascular endothelial growth factor (VEGF) production were found. Incubation with K. pneumoniae in the presence of arachidonoyl trifluoromethyl ketone (AACOCF3) or bromoenol lactone (BEL) caused decreased PGE2 and VEGF release. Scanning electron microscopy and transmission electron microscopy images of BREC and BRPC showed adhesion of K. pneumoniae to the cells, but no invasion occurred. K. pneumoniae infection also produced reductions in pericyte numbers; transfection of BREC cocultured with BRPC and of human retinal endothelial cells (HREC) cocultured with human retinal pericytes (HRPC) with small interfering RNAs (siRNAs) targeted to cPLA2 and iPLA2 restored the pericyte numbers and the TEER and permeability values. Our results show the proinflammatory effect of K. pneumoniae on BREC, suggest a possible mechanism by which BREC and BRPC react to the K. pneumoniae infection, and may provide physicians and patients with new ways of fighting blinding diseases. PMID:24478098

  20. Lactic Acid Bacteria

    NSDL National Science Digital Library

    This on-line exercise is focused on lactic acid bacteria, a group of related bacteria that produce lactic acid as a result of carbohydrate fermentation. It includes a protocol for the enrichment of lactic acid bacteria from enriched samples (like yogurt, sauerkraut, decaying plant matter, and tooth plaque). Three parameters are measured: growth, culture diversity, and pH. The exercise also includes instructions for the isolation of some of these bacteria by using the streak-plate method.

  1. Epidemic Klebsiella pneumoniae ST258 Is a Hybrid Strain

    PubMed Central

    Chen, Liang; Mathema, Barun; Pitout, Johann D. D.; DeLeo, Frank R.

    2014-01-01

    ABSTRACT Carbapenem-resistant Enterobacteriaceae (CRE), especially Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae, pose an urgent threat in health facilities in the United States and worldwide. K. pneumoniae isolates classified as sequence type 258 (ST258) by multilocus sequence typing are largely responsible for the global spread of KPC. A recent comparative genome study revealed that ST258 K. pneumoniae strains are two distinct genetic clades; however, the molecular origin of ST258 largely remains unknown, and our understanding of the evolution of the two genetic clades is incomplete. Here we compared the genetic structures and single-nucleotide polymorphism (SNP) distributions in the core genomes of strains from two ST258 clades and other STs (ST11, ST442, and ST42). We identified an ~1.1-Mbp region on ST258 genomes that is homogeneous to that of ST442, while the rest of the ST258 genome resembles that of ST11. Our results suggest ST258 is a hybrid clone—80% of the genome originated from ST11-like strains and 20% from ST442-like strains. Meanwhile, we sequenced an ST42 strain that carries the same K-antigen-encoding capsule polysaccharide biosynthesis gene (cps) region as ST258 clade I strains. Comparison of the cps-harboring regions between the ST42 and ST258 strains (clades I and II) suggests the ST258 clade I strains evolved from a clade II strain as a result of cps region replacement. Our findings unravel the molecular evolution history of ST258 strains, an important first step toward the development of diagnostic, therapeutic, and vaccine strategies to combat infections caused by multidrug-resistant K. pneumoniae. PMID:24961694

  2. Identification of Antigenic Proteins of the Nosocomial Pathogen Klebsiella pneumoniae

    PubMed Central

    Hoppe, Sebastian; Bier, Frank F.; von Nickisch-Rosenegk, Markus

    2014-01-01

    The continuous expansion of nosocomial infections around the globe has become a precarious situation. Key challenges include mounting dissemination of multiple resistances to antibiotics, the easy transmission and the growing mortality rates of hospital-acquired bacterial diseases. Thus, new ways to rapidly detect these infections are vital. Consequently, researchers around the globe pursue innovative approaches for point-of-care devices. In many cases the specific interaction of an antigen and a corresponding antibody is pivotal. However, the knowledge about suitable antigens is lacking. The aim of this study was to identify novel antigens as specific diagnostic markers. Additionally, these proteins might be aptly used for the generation of vaccines to improve current treatment options. Hence, a cDNA-based expression library was constructed and screened via microarrays to detect novel antigens of Klebsiella pneumoniae, a prominent agent of nosocomial infections well-known for its extensive antibiotics resistance, especially by extended-spectrum beta-lactamases (ESBL). After screening 1536 clones, 14 previously unknown immunogenic proteins were identified. Subsequently, each protein was expressed in full-length and its immunodominant character examined by ELISA and microarray analyses. Consequently, six proteins were selected for epitope mapping and three thereof possessed linear epitopes. After specificity analysis, homology survey and 3d structural modelling, one epitope sequence GAVVALSTTFA of KPN_00363, an ion channel protein, was identified harboring specificity for K. pneumoniae. The remaining epitopes showed ambiguous results regarding the specificity for K. pneumoniae. The approach adopted herein has been successfully utilized to discover novel antigens of Campylobacter jejuni and Salmonella enterica antigens before. Now, we have transferred this knowledge to the key nosocomial agent, K. pneumoniae. By identifying several novel antigens and their linear epitope sites, we have paved the way for crucial future research and applications including the design of point-of-care devices, vaccine development and serological screenings for a highly relevant nosocomial pathogen. PMID:25333280

  3. Bacteria: More Than Pathogens

    NSDL National Science Digital Library

    Trudy Wassenaar (; )

    2002-07-01

    The issue-focused, peer-reviewed article reveals that there are more bacteria on Earth than there are humans. Bacteria: inhabit every environment on the planet, playing a key ecological role, can be good for our health -- for example, by helping us digest food, and can cause disease even though the human body is not the natural host for many bacteria.

  4. Bacteria: Friend or Foe?

    NSDL National Science Digital Library

    David Brock (Roland Park Public School; )

    2003-01-10

    This lesson explores "good" and "bad" bacteria. Students can draw "Wanted!" bacteria mug shots, create composting trials and designs, produce a skit involving a boastful virus and bacterium, experiment with soil and ordinary objects in the lab, write a news story about an outbreak, complete a multiple-choice bacteria quiz and more!

  5. Sequence of the sor-operon for L-sorbose utilization from Klebsiella pneumoniae KAY2026.

    PubMed

    Wehmeier, U F; Lengeler, J W

    1994-10-19

    We have sequenced the complete sor-operon of Klebsiella pneumoniae KAY2026. The operon has been mapped at 91 min on the Klebsiella gene-map. It comprises seven open reading frames for the genes sorCDFBAME, which are expressed from the single promotor sorCP. The gene sorC codes for a regulator protein that positively and negatively regulates the expression of the operon; sorD encodes a D-glucitol-6-phosphate dehydrogenase, the genes sorFBAM encode four proteins of a phosphoenolpyruvate-dependent L-sorbose-phosphotransferase system and sorE, finally, an L-sorbose-1-phosphate-reductase. PMID:7947968

  6. Identification and Characterization of the fis Operon in Enteric Bacteria

    PubMed Central

    Beach, Michael B.; Osuna, Robert

    1998-01-01

    The small DNA binding protein Fis is involved in several different biological processes in Escherichia coli. It has been shown to stimulate DNA inversion reactions mediated by the Hin family of recombinases, stimulate integration and excision of phage ? genome, regulate the transcription of several different genes including those of stable RNA operons, and regulate the initiation of DNA replication at oriC. fis has also been isolated from Salmonella typhimurium, and the genomic sequence of Haemophilus influenzae reveals its presence in this bacteria. This work extends the characterization of fis to other organisms. Very similar fis operon structures were identified in the enteric bacteria Klebsiella pneumoniae, Serratia marcescens, Erwinia carotovora, and Proteus vulgaris but not in several nonenteric bacteria. We found that the deduced amino acid sequences for Fis are 100% identical in K. pneumoniae, S. marcescens, E. coli, and S. typhimurium and 96 to 98% identical when E. carotovora and P. vulgaris Fis are considered. The deduced amino acid sequence for H. influenzae Fis is about 80% identical and 90% similar to Fis in enteric bacteria. However, in spite of these similarities, the E. carotovora, P. vulgaris, and H. influenzae Fis proteins are not functionally identical. An open reading frame (ORF1) preceding fis in E. coli is also found in all these bacteria, and their deduced amino acid sequences are also very similar. The sequence preceding ORF1 in the enteric bacteria showed a very strong similarity to the E. coli fis P region from ?53 to +27 and the region around ?116 containing an ihf binding site. Both ?-galactosidase assays and primer extension assays showed that these regions function as promoters in vivo and are subject to growth phase-dependent regulation. However, their promoter strengths vary, as do their responses to Fis autoregulation and integration host factor stimulation. PMID:9811652

  7. Bacteria Are Everywhere!

    NSDL National Science Digital Library

    AMPS GK-12 Program,

    Students are introduced to the concept of engineering biological organisms and studying their growth to be able to identify periods of fast and slow growth. They learn that bacteria are found everywhere, including on the surfaces of our hands. Student groups study three different conditions under which bacteria are found and compare the growth of the individual bacteria from each source. In addition to monitoring the quantity of bacteria from differ conditions, they record the growth of bacteria over time, which is an excellent tool to study binary fission and the reproduction of unicellular organisms.

  8. Evaluation of Methods To Identify the Klebsiella pneumoniae Carbapenemase in Enterobacteriaceae

    Microsoft Academic Search

    K. F. Anderson; D. R. Lonsway; J. K. Rasheed; J. Biddle; B. Jensen; L. K. McDougal; R. B. Carey; A. Thompson; S. Stocker; B. Limbago; J. B. Patel

    2007-01-01

    The Klebsiella pneumoniae carbapenem (KPC) -lactamase occurs in Enterobacteriaceae and can confer resistance to all -lactam agents including carbapenems. The enzyme may confer low-level carbapenem resistance, and the failure of susceptibility methods to identify this resistance has been reported. Automated and nonautomated methods for carbapenem susceptibility were evaluated for identification of KPC-mediated resistance. Ertapenem was a more sensitive indicator of

  9. Regulation of Gene Expression and Cellular Localization of Cloned Klebsiella aerogenes (K. pneumoniae) Urease

    Microsoft Academic Search

    SCOTT B. MULROONEY; H. S. PANKRATZ; ROBERT P. HAUSINGER

    1989-01-01

    The genes for Klebsiella aerogenes (K. pneumoniae) urease were cloned and the protein was overexpressed (up to 18% of total protein consisted of this enzyme) in several hosts. The small size of the DNA encoding urease (3.5 kb), the restriction map, and the regulation of enzyme expression directed by the recombinant plasmid are distinct from other cloned ureases. Nickel concentration

  10. In vitro activities of streptomycin and 11 oral antimicrobial agents against clinical isolates of Klebsiella rhinoscleromatis.

    PubMed Central

    Perkins, B A; Hamill, R J; Musher, D M; O'Hara, C

    1992-01-01

    We tested in vitro the activities of streptomycin and tetracycline--antibiotics that have long been used to treat rhinoscleroma--as well as several newer oral agents by using 23 isolates of the causative organism Klebsiella rhinoscleromatis. All isolates were inhibited by clinically achievable concentrations of trimethoprim-sulfamethoxazole, amoxicillin-clavulanate, chloramphenicol, ciprofloxacin, cephalexin, cefuroxime, and cefpodoxime. PMID:1416867

  11. Detection of extended spectrum b-lactamase production in clinical isolates of Klebsiella spp

    Microsoft Academic Search

    Amita Jain; Rajesh Mondal

    Background & objectives: Clinical laboratories need to develop quick screening methods for detection of extended spectrum b-lactamase (ESBL) producing strains, so that the appropriate medication can be started without delay. In this study, we report the screening sensitivity of four representative antimicrobial agents i.e., cefpodoxime, cefotaxime, ceftazidime and aztreonam, commonly used for ESBL detection in Klebsiella spp. Methods: A total

  12. Microbiological and Genetic Characterization of Carbapenem-Resistant Klebsiella pneumoniae Isolated From Pediatric Patients.

    PubMed

    Dara, Jasmeen S; Chen, Liang; Levi, Michael H; Kreiswirth, Barry N; Pellett Madan, Rebecca

    2014-03-01

    This manuscript reports the clinical, microbiological, and genetic characteristics of carbapenem-resistant K. pnuemoniae isolates from pediatric patients at a tertiary-care children's hospital. Although there is an extensive body of literature describing carbapenem-resistant Klebsiella infections in adults, pediatric data are comparatively limited. PMID:24567846

  13. Positive selection of colicin cured cells by mitomycin C in Klebsiella pneumoniae.

    PubMed

    Debbia, E; Pruzzo, C

    1984-04-01

    A colicinogenic strain of Klebsiella pneumoniae (MirM7cx) was treated with chemical and physical agents in an attempt to cure it from colicin. Mitomycin C was the only agent able to eliminate the extrachromosomal element from the strain. A simple method to isolate colicin cured cells of K. pneumoniae is described. PMID:6431230

  14. Lipocalin 2 Is Required for Pulmonary Host Defense against Klebsiella Infection1

    E-print Network

    Strong, Roland K.

    expression with downstream induction of IL-17 in KP infection was TLR4 dependent, making IL-17 an attractive that lipocalin 2 is rapidly and robustly induced by Klebsiella pneumoniae infection and is TLR4 dependent. IL-1 the lipocalin 2 deficiency in TLR4 knockout animals and rescue them from infection. Lipocalin 2-deficient

  15. Intrinsic Klebsiella pneumoniae contamination of liquid germicidal hand soap containing chlorhexidine.

    PubMed

    Brooks, Steven E; Walczak, Mary A; Malcolm, Sharon; Hameed, Rizwanullah

    2004-10-01

    We describe intrinsic contamination with Klebsiella pneumoniae occurring during the manufacture of germicidal hand soap, labeled as containing 2% chlorhexidine, used throughout a 350-bed community medical center. A 3-year retrospective study failed to find evidence of increased incidence of clinical isolates of this strain. PMID:15518034

  16. Phenotypic and genotypic characterization of Klebsiella pneumonia recovered from nonhuman primates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Klebsiella pneumoniae is a zoonotic, Gram-negative member of the family Enterobacteriaceae and is the causative agent of nosocomial septicemic, pneumonic, and urinary tract infections. Recently, pathogenic strains of K. pneumoniae sharing a hypermucoviscosity (HMV) phenotype have been attributed to ...

  17. Virulent Clones of Klebsiella pneumoniae: Identification and Evolutionary Scenario Based on Genomic and Phenotypic Characterization

    Microsoft Academic Search

    Sylvain Brisse; Cindy Fevre; Virginie Passet; Sylvie Issenhuth-Jeanjean; Régis Tournebize; Laure Diancourt; Patrick Grimont

    2009-01-01

    Klebsiella pneumoniae is found in the environment and as a harmless commensal, but is also a frequent nosocomial pathogen (causing urinary, respiratory and blood infections) and the agent of specific human infections including Friedlander's pneumonia, rhinoscleroma and the emerging disease pyogenic liver abscess (PLA). The identification and precise definition of virulent clones, i.e. groups of strains with a single ancestor

  18. Phenotypic and Molecular Characterization of Multidrug Resistant Klebsiella pneumoniae Isolated from a University Teaching Hospital, China

    PubMed Central

    Liu, Helu; Lü, Dongyue; Liang, Hong; Dou, Yuhong

    2014-01-01

    The multidrug-resistant rate of Klebsiella pneumoniae has risen rapidly worldwide. To better understand the multidrug resistance situation and molecular characterization of Klebsiella pneumoniae, a total of 153 Klebsiella pneumoniae isolates were collected, and drug susceptibility test was performed to detect its susceptibility patterns to 13 kinds of antibiotics. Phenotypic tests for carbapenemases ESBLs and AmpC enzyme-producing strains were performed to detect the resistance phenotype of the isolates. Then PCR amplification and sequencing analysis were performed for the drug resistance determinants. The results showed that 63 strains harbored blaCTX-M gene, and 14 strains harbored blaDHA gene. Moreover, there were 5 strains carrying blaKPC gene, among which 4 strains carried blaCTX-M, blaDHA and blaKPC genes, and these 4 strains were also resistant to imipenem. Our data indicated that drug-resistant Klebsiella pneumoniae were highly prevalent in the hospital. Thus it is warranted that surveillance of epidemiology of those resistant isolates should be a cause for concern, and appropriate drugs should be chosen. PMID:24740167

  19. Necrotizing Fasciitis Caused by Hypermucoviscous Klebsiella pneumoniae in a Filipino Female in North America

    PubMed Central

    Ng, Daniel; Frazee, Brad

    2015-01-01

    Necrotizing fasciitis caused by Klebsiella pneumoniae has been described in Southeast Asia, but has only recently begun to emerge in North America. The hypermucoviscous strain of K. pneumoniae is a particularly virulent strain known to cause devastatingly invasive infections, including necrotizing fasciitis. Here we present the first known case of necrotizing fasciitis caused by hypermucoviscous K. pneumoniae in North America. PMID:25671032

  20. Epidemiology and molecular characterization of nosocomially transmitted multidrug-resistant Klebsiella pneumoniae

    Microsoft Academic Search

    Navaratnam Parasakthi; Jamuna Vadivelu; Hany Ariffin; Lakshmy Iyer; Selvi Palasubramaniam; Anusha Arasu

    2000-01-01

    Objectives: To describe the epidemiology, antimicrobial susceptibility, genomic profiles, and control of a nosocomial outbreak of multidrug-resistant Klebsiella pneumoniae (MRKP) that occurred in the pediatric oncology unit of the University of Malaya Medical Centre in Kuala Lumpur.Materials and Methods: A prospective epidemiologic and microbiologic study was conducted of MRKP isolated from the blood and wound of a boy with necrotizing

  1. Identification of Genes Present Specifically in a Virulent Strain of Klebsiella pneumoniae

    Microsoft Academic Search

    YI-CHYI LAI; SHU-LI YANG; HWEI-LING PENG; HWAN-YOU CHANG

    2000-01-01

    Klebsiella pneumoniae is a common cause of septicemia and urinary tract infections. The PCR-supported genomic subtractive hybridization was employed to identify genes specifically present in a virulent strain of K. pneumoniae. Analysis of 25 subtracted DNA clones has revealed 19 distinct nucleotide sequences. Two of the sequences were found to be the genes encoding the transposase of Tn3926 and a

  2. PCR-Based Identification of Klebsiella pneumoniae subsp. rhinoscleromatis, the Agent of Rhinoscleroma

    Microsoft Academic Search

    Cindy Fevre; Virginie Passet; Alexis Deletoile; Valérie Barbe; Lionel Frangeul; Ana S. Almeida; Philippe Sansonetti; Régis Tournebize; Sylvain Brisse

    2011-01-01

    Rhinoscleroma is a chronic granulomatous infection of the upper airways caused by the bacterium Klebsiella pneumoniae subsp. rhinoscleromatis. The disease is endemic in tropical and subtropical areas, but its diagnosis remains difficult. As a consequence, and despite available antibiotherapy, some patients evolve advanced stages that can lead to disfiguration, severe respiratory impairment and death by anoxia. Because identification of the

  3. Complete genome sequence of Klebsiella pneumoniae 1084, a hypermucoviscosity-negative K1 clinical strain.

    PubMed

    Lin, Ann-Chi; Liao, Tsai-Lien; Lin, Yi-Chun; Lai, Yi-Chyi; Lu, Min-Chi; Chen, Ying-Tsong

    2012-11-01

    We report the complete genome sequence of Klebsiella pneumoniae 1084, a hypermucoviscosity-negative K1 clinical strain. Sequencing and annotation revealed a 5,386,705-bp circular chromosome (57.4% G+C content), which contains 4,962 protein-coding genes, 80 tRNA genes, and 25 rRNA genes. PMID:23105059

  4. Complete genome sequence of the 2,3-butanediol-producing Klebsiella pneumoniae strain KCTC 2242.

    PubMed

    Shin, Sang Heum; Kim, Sewhan; Kim, Jae Young; Lee, Soojin; Um, Youngsoon; Oh, Min-Kyu; Kim, Young-Rok; Lee, Jinwon; Yang, Kap-Seok

    2012-05-01

    Here we report the full genome sequence of Klebsiella pneumoniae KCTC 2242,consisting of a 5.26-Mb chromosome (57.6% GC%; 5,035 genes [4,923 encoding known proteins, 112 RNA genes]) and a 202-kb plasmid (50.2% GC%; 229 genes [229 encoding known proteins]). PMID:22535926

  5. Isolation of a Chromosomal Region of Klebsiella pneumoniae Associated with Allantoin Metabolism and Liver Infection

    Microsoft Academic Search

    Huei-Chi Chou; Cha-Ze Lee; Li-Chen Ma; Chi-Tai Fang; Shan-Chwen Chang; Jin-Town Wang

    2004-01-01

    Klebsiella pneumoniae liver abscess with metastatic complications is an emerging infectious disease in Taiwan. To identify genes associated with liver infection, we used a DNA microarray to compare the tran- scriptional profiles of three strains causing liver abscess and three strains not associated with liver infection. There were 13 clones that showed higher RNA expression levels in the three liver

  6. Molecular Serotyping of Klebsiella Species Isolates by Restriction of the Amplified Capsular Antigen Gene Cluster

    Microsoft Academic Search

    Sylvain Brisse; Sylvie Issenhuth-Jeanjean; Patrick A. D. Grimont

    2004-01-01

    The objective of the present work was to develop a molecular method that would enable determination of the capsular serotypes of Klebsiella isolates without the use of antiserum. PCR amplification of the capsular antigen gene cluster (cps) was followed by digestion with the restriction enzyme HincII (cps PCR-restriction fragment length polymorphism (RFLP) analysis). The profiles (C patterns) obtained for 224

  7. Complete genome sequence of a Klebsiella pneumoniae strain isolated from a known cotton insect boll vector

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the...

  8. Bacteria: Fossil Record

    NSDL National Science Digital Library

    This description of the fossil record of bacteria focuses on one particular group of bacteria, the cyanobacteria or blue-green algae, which have left a fossil record that extends far back into the Precambrian. The oldest cyanobacteria-like fossils known are nearly 3.5 billion years old and are among the oldest fossils currently known. Cyanobacteria are larger than most bacteria and may secrete a thick cell wall. More importantly, cyanobacteria may form large layered structures, called stromatolites (if more or less dome-shaped) or oncolites (if round). The site also refers to pseudomorphs of pyrite and siderite, and a group of bacteria known as endolithic. Two links are available for more information. One provides information on the discovery of possible remains of bacteria-like organisms on a meteorite from Mars and the other has a research report on fossilized filamentous bacteria and other microbes, found in Cretaceous amber.

  9. Modeling Klebsiella pneumoniae Pathogenesis by Infection of the Wax Moth Galleria mellonella

    PubMed Central

    Insua, José Luis; Llobet, Enrique; Moranta, David; Pérez-Gutiérrez, Camino; Tomás, Anna; Garmendia, Junkal

    2013-01-01

    The implementation of infection models that approximate human disease is essential for understanding pathogenesis at the molecular level and for testing new therapies before they are entered into clinical stages. Insects are increasingly being used as surrogate hosts because they share, with mammals, essential aspects of the innate immune response to infections. We examined whether the larva of the wax moth Galleria mellonella could be used as a host model to conceptually approximate Klebsiella pneumoniae-triggered pneumonia. We report that the G. mellonella model is capable of distinguishing between pathogenic and nonpathogenic Klebsiella strains. Moreover, K. pneumoniae infection of G. mellonella models some of the known features of Klebsiella-induced pneumonia, i.e., cell death associated with bacterial replication, avoidance of phagocytosis by phagocytes, and the attenuation of host defense responses, chiefly the production of antimicrobial factors. Similar to the case for the mouse pneumonia model, activation of innate responses improved G. mellonella survival against subsequent Klebsiella challenge. Virulence factors necessary in the mouse pneumonia model were also implicated in the Galleria model. We found that mutants lacking capsule polysaccharide, lipid A decorations, or the outer membrane proteins OmpA and OmpK36 were attenuated in Galleria. All mutants activated G. mellonella defensive responses. The Galleria model also allowed us to monitor Klebsiella gene expression. The expression levels of cps and the loci implicated in lipid A remodeling peaked during the first hours postinfection, in a PhoPQ- and PmrAB-governed process. Taken together, these results support the utility of G. mellonella as a surrogate host for assessing infections with K. pneumoniae. PMID:23836821

  10. Bacteria and lignin degradation

    Microsoft Academic Search

    Jing Li; Hongli Yuan; Jinshui Yang

    2009-01-01

    Lignin is both the most abundant aromatic (phenolic) polymer and the second most abundant raw material. It is degraded and\\u000a modified by bacteria in the natural world, and bacteria seem to play a leading role in decomposing lignin in aquatic ecosystems.\\u000a Lignin-degrading bacteria approach the polymer by mechanisms such as tunneling, erosion, and cavitation. With the advantages\\u000a of immense environmental

  11. TSSWCB Bacteria-Related Projects

    E-print Network

    Wythe, Kathy

    2007-01-01

    of TMDL projects for water bodies where swimming or wading may be unsafe or harvesting of oysters is limited or prohibited due to high concentrations of bacteria. ? Atascosa River: A TMDL Project for Bacteria ? Buffalo andWhite Oak Bayous: A TMDL... Creek: A TMDL Project for Bacteria ? Lower San Antonio River: A TMDL Project for Bacteria ? Upper San Antonio River: A TMDL Project for Bacteria ? Trinity River: A TMDL Project for Bacteria ? Upper Oyster Creek: A TMDL Project for Bacteria...

  12. TSSWCB Bacteria-Related Projects 

    E-print Network

    Wythe, Kathy

    2007-01-01

    of TMDL projects for water bodies where swimming or wading may be unsafe or harvesting of oysters is limited or prohibited due to high concentrations of bacteria. ? Atascosa River: A TMDL Project for Bacteria ? Buffalo andWhite Oak Bayous: A TMDL... Creek: A TMDL Project for Bacteria ? Lower San Antonio River: A TMDL Project for Bacteria ? Upper San Antonio River: A TMDL Project for Bacteria ? Trinity River: A TMDL Project for Bacteria ? Upper Oyster Creek: A TMDL Project for Bacteria...

  13. Introduction to Bacteria

    NSDL National Science Digital Library

    DiscoverySchool.com

    2007-12-12

    This science site has students research how bacteria move, where they live, and how they reproduce; learn how bacteria can be helpful or harmful; and create a design illustrating what they have learned about bacteria. Included in the lesson plan are the objectives, needed materials and Web sites, procedures, discussion questions, evaluation, extensions, suggested reading, and vocabulary. Teachers can link to Teaching Tools to create custom worksheets, puzzles, and quizzes. A printable version of the lesson plan can be downloaded. The video Bacteria, Viruses and Allergies can be purchased and comprehension questions and answers can be downloaded.

  14. Risk Factors of Nosocomial Infection with Extended-Spectrum Beta-Lactamase-Producing Bacteria in a Neonatal Intensive Care Unit in China

    Microsoft Academic Search

    Y. Huang; S. Zhuang; M. Du

    2007-01-01

    Background:  To study risk factors of neonatal nosocomial infection caused by extended-spectrum beta-lactamase (ESBL)-producing bacteria\\u000a in a neonatal intensive care unit (NICU).\\u000a \\u000a \\u000a \\u000a Patients and Methods:  A retrospective cohort study was conducted in a university hospital NICU in south China. Medical records of neonatal nosocomial\\u000a infection caused by Escherichia coli or Klebsiella pneumoniae were reviewed. Twenty-two neonates infected with ESBL-producing bacteria (case patients)

  15. A dimeric chlorite dismutase exhibits O2-generating activity and acts as a chlorite antioxidant in Klebsiella pneumoniae MGH 78578.

    PubMed

    Celis, Arianna I; Geeraerts, Zachary; Ngmenterebo, David; Machovina, Melodie M; Kurker, Richard C; Rajakumar, Kumar; Ivancich, Anabella; Rodgers, Kenton R; Lukat-Rodgers, Gudrun S; DuBois, Jennifer L

    2015-01-20

    Chlorite dismutases (Clds) convert chlorite to O2 and Cl(-), stabilizing heme in the presence of strong oxidants and forming the O?O bond with high efficiency. The enzyme from the pathogen Klebsiella pneumoniae (KpCld) represents a subfamily of Clds that share most of their active site structure with efficient O2-producing Clds, even though they have a truncated monomeric structure, exist as a dimer rather than a pentamer, and come from Gram-negative bacteria without a known need to degrade chlorite. We hypothesized that KpCld, like others in its subfamily, should be able to make O2 and may serve an in vivo antioxidant function. Here, it is demonstrated that it degrades chlorite with limited turnovers relative to the respiratory Clds, in part because of the loss of hypochlorous acid from the active site and destruction of the heme. The observation of hypochlorous acid, the expected leaving group accompanying transfer of an oxygen atom to the ferric heme, is consistent with the more open, solvent-exposed heme environment predicted by spectroscopic measurements and inferred from the crystal structures of related proteins. KpCld is more susceptible to oxidative degradation under turnover conditions than the well-characterized Clds associated with perchlorate respiration. However, wild-type K. pneumoniae has a significant growth advantage in the presence of chlorate relative to a ?cld knockout strain, specifically under nitrate-respiring conditions. This suggests that a physiological function of KpCld may be detoxification of endogenously produced chlorite. PMID:25437493

  16. Electron transfer capacity dependence of quinone-mediated Fe(III) reduction and current generation by Klebsiella pneumoniae L17.

    PubMed

    Li, Xiaomin; Liu, Liang; Liu, Tongxu; Yuan, Tian; Zhang, Wei; Li, Fangbai; Zhou, Shungui; Li, Yongtao

    2013-06-01

    Quinone groups in exogenous electron shuttles can accelerate extracellular electron transfer (EET) from bacteria to insoluble terminal electron acceptors, such as Fe(III) oxides and electrodes, which are important in biogeochemical redox processes and microbial electricity generation. However, the relationship between quinone-mediated EET performance and electron-shuttling properties of the quinones remains incompletely characterized. This study investigates the effects of a series of synthetic quinones (SQs) on goethite reduction and current generation by a fermenting bacterium Klebsiella pneumoniae L17. In addition, the voltammetric behavior and electron transfer capacities (ETCs) of SQ, including electron accepting (EAC) and donating (EDC) capacities, is also examined using electrochemical methods. The results showed that SQ can significantly increase both the Fe(III) reduction rates and current outputs of L17. Each tested SQ reversibly accepted and donated electrons as indicated by the cyclic voltammograms. The EAC and EDC results showed that Carmine and Alizarin had low relative capacities of electron transfer, whereas 9,10-anthraquinone-2,6-disulfonic acid (AQDS), 2-hydroxy-1,4-naphthoquinone (2-HNQ), and 5-hydroxy-1,4-naphthoquinone (5-HNQ) showed stronger relative ETC, and 9,10-anthraquinone-2-carboxylic acid (AQC) and 9,10-anthraquinone-2-sulfonic acid (AQS) had high relative ETC. Enhancement of microbial goethite reduction kinetics and current outputs by SQ had a good linear relationship with their ETC, indicating that the effectiveness of quinone-mediated EET may be strongly dependent on the ETC of the quinones. Therefore, the presence of quinone compounds and fermenting microorganisms may increase the diversity of microbial populations that contribute to element transformation in natural environments. Moreover, ETC determination of different SQ would help to evaluate their performance for microbial EET under anoxic conditions. PMID:23461838

  17. THE MITOCHONDRIA OF BACTERIA

    Microsoft Academic Search

    STUART MUDD

    1953-01-01

    Recent evidence from the biochemical, the genetic and the morphologic study of bacteria, in that chronological order, has indicated essential similarities of the bacterial cell to the cells of higher organisms. Recognition in bacteria of a large category of cytoplasmic granules as possessing characteristics which strongly sug- gest that they are the functional equivalents of the mitochondria of anirnaE and

  18. Bacteria turn tiny gears

    SciTech Connect

    None

    2009-01-01

    Swarms of bacteria turn two 380-micron long gears, opening the possibility of building hybrid biological machines at the microscopic scale. Read more at Wired: http://www.wired.com/wiredscience/2009/12/bacterial-micro-machine/#more-15684 or Scientific American: http://www.scientificamerican.com/article.cfm?id=brownian-motion-bacteria

  19. Toxicological Effects of Selective Herbicides on Plant Growth Promoting Activities of Phosphate Solubilizing Klebsiella sp . Strain PS19

    Microsoft Academic Search

    Munees Ahemad

    2011-01-01

    This study examines the effect of four herbicides, quizalafop-p-ethyl, clodinafop, metribuzin and glyphosate, on plant growth promoting activities like phosphate solubilization, siderophores,\\u000a indole acetic acid, exo-polysaccharides, hydrogen cyanide and ammonia production by herbicide tolerant Klebsiella sp. strain PS19. The strain was isolated from mustard rhizosphere. The selected herbicides were applied two to three times\\u000a at the recommended rates. Klebsiella sp.

  20. Polyhexamethylene guanidine hydrochloride shows bactericidal advantages over chlorhexidine digluconate against ESKAPE bacteria.

    PubMed

    Zhou, Zhongxin; Wei, Dafu; Lu, Yanhua

    2015-03-01

    More information regarding the bactericidal properties of polyhexamethylene guanidine hydrochloride (PHMG) against clinically important antibiotic-resistant ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogens needs to be provided for its uses in infection control. The bactericidal properties of PHMG and chlorhexidine digluconate (CHG) were compared based on their minimum inhibitory concentrations (MICs), minimum bactericidal concentrations, and time-course-killing curves against clinically important antibiotic-susceptible and antibiotic-resistant ESKAPE pathogens. Results showed that PHMG exhibited significantly higher bactericidal activities against methicillin-resistant Staphylococcus aureus, carbapenem-resistant Klebsiella pneumoniae, and ceftazidime-resistant Enterobacter spp. than CHG. A slight bactericidal advantage over CHG was obtained against vancomycin-resistant Enterococcus faecium, ciprofloxacin- and levofloxacin-resistant Acinetobacter spp., and multidrug-resistant Pseudomonas aeruginosa. In previous reports, PHMG had higher antimicrobial activity against almost all tested Gram-negative bacteria and several Gram-positive bacteria than CHG using MIC test. These studies support the further development of covalently bound PHMG in sterile-surface materials and the incorporation of PHMG in novel disinfectant formulas. PMID:24888899

  1. Multidrug resistance in hydrocarbon-tolerant Gram-positive and Gram-negative bacteria.

    PubMed

    Stancu, Mihaela Marilena; Grifoll, Magdalena

    2011-01-01

    New Gram-positive and Gram-negative bacteria were isolated from Poeni oily sludge, using enrichment procedures. The six Gram-positive strains belong to Bacillus, Lysinibacillus and Rhodococcus genera. The eight Gram-negative strains belong to Shewanella, Aeromonas, Pseudomonas and Klebsiella genera. Isolated bacterial strains were tolerant to saturated (i.e., n-hexane, n-heptane, n-decane, n-pentadecane, n-hexadecane, cyclohexane), monoaromatic (i.e., benzene, toluene, styrene, xylene isomers, ethylbenzene, propylbenzene) and polyaromatic (i.e., naphthalene, 2-methylnaphthalene, fluorene) hydrocarbons, and also resistant to different antimicrobial agents (i.e., ampicillin, kanamycin, rhodamine 6G, crystal violet, malachite green, sodium dodecyl sulfate). The presence of hydrophilic antibiotics like ampicillin or kanamycin in liquid LB-Mg medium has no effects on Gram-positive and Gram-negative bacteria resistance to toxic compounds. The results indicated that Gram-negative bacteria are less sensitive to toxic compounds than Gram-positive bacteria, except one bacteria belonging to Lysinibacillus genus. There were observed cellular and molecular modifications induced by ampicillin or kanamycin to isolated bacterial strains. Gram-negative bacteria possessed between two and four catabolic genes (alkB, alkM, alkB/alkB1, todC1, xylM, PAH dioxygenase, catechol 2,3-dioxygenase), compared with Gram-positive bacteria (except one bacteria belonging to Bacillus genus) which possessed one catabolic gene (alkB/alkB1). Transporter genes (HAE1, acrAB) were detected only in Gram-negative bacteria. PMID:21478643

  2. Complete Genome Sequence of the N2-Fixing Broad Host Range Endophyte Klebsiella pneumoniae 342 and Virulence Predictions Verified in Mice

    PubMed Central

    Fouts, Derrick E.; Tyler, Heather L.; DeBoy, Robert T.; Daugherty, Sean; Ren, Qinghu; Badger, Jonathan H.; Durkin, Anthony S.; Huot, Heather; Shrivastava, Susmita; Kothari, Sagar; Dodson, Robert J.; Mohamoud, Yasmin; Khouri, Hoda; Roesch, Luiz F. W.; Krogfelt, Karen A.; Struve, Carsten; Triplett, Eric W.; Methé, Barbara A.

    2008-01-01

    We report here the sequencing and analysis of the genome of the nitrogen-fixing endophyte, Klebsiella pneumoniae 342. Although K. pneumoniae 342 is a member of the enteric bacteria, it serves as a model for studies of endophytic, plant-bacterial associations due to its efficient colonization of plant tissues (including maize and wheat, two of the most important crops in the world), while maintaining a mutualistic relationship that encompasses supplying organic nitrogen to the host plant. Genomic analysis examined K. pneumoniae 342 for the presence of previously identified genes from other bacteria involved in colonization of, or growth in, plants. From this set, approximately one-third were identified in K. pneumoniae 342, suggesting additional factors most likely contribute to its endophytic lifestyle. Comparative genome analyses were used to provide new insights into this question. Results included the identification of metabolic pathways and other features devoted to processing plant-derived cellulosic and aromatic compounds, and a robust complement of transport genes (15.4%), one of the highest percentages in bacterial genomes sequenced. Although virulence and antibiotic resistance genes were predicted, experiments conducted using mouse models showed pathogenicity to be attenuated in this strain. Comparative genomic analyses with the presumed human pathogen K. pneumoniae MGH78578 revealed that MGH78578 apparently cannot fix nitrogen, and the distribution of genes essential to surface attachment, secretion, transport, and regulation and signaling varied between each genome, which may indicate critical divergences between the strains that influence their preferred host ranges and lifestyles (endophytic plant associations for K. pneumoniae 342 and presumably human pathogenesis for MGH78578). Little genome information is available concerning endophytic bacteria. The K. pneumoniae 342 genome will drive new research into this less-understood, but important category of bacterial-plant host relationships, which could ultimately enhance growth and nutrition of important agricultural crops and development of plant-derived products and biofuels. PMID:18654632

  3. Complete genome sequence of the N2-fixing broad host range endophyte Klebsiella pneumoniae 342 and virulence predictions verified in mice.

    PubMed

    Fouts, Derrick E; Tyler, Heather L; DeBoy, Robert T; Daugherty, Sean; Ren, Qinghu; Badger, Jonathan H; Durkin, Anthony S; Huot, Heather; Shrivastava, Susmita; Kothari, Sagar; Dodson, Robert J; Mohamoud, Yasmin; Khouri, Hoda; Roesch, Luiz F W; Krogfelt, Karen A; Struve, Carsten; Triplett, Eric W; Methé, Barbara A

    2008-01-01

    We report here the sequencing and analysis of the genome of the nitrogen-fixing endophyte, Klebsiella pneumoniae 342. Although K. pneumoniae 342 is a member of the enteric bacteria, it serves as a model for studies of endophytic, plant-bacterial associations due to its efficient colonization of plant tissues (including maize and wheat, two of the most important crops in the world), while maintaining a mutualistic relationship that encompasses supplying organic nitrogen to the host plant. Genomic analysis examined K. pneumoniae 342 for the presence of previously identified genes from other bacteria involved in colonization of, or growth in, plants. From this set, approximately one-third were identified in K. pneumoniae 342, suggesting additional factors most likely contribute to its endophytic lifestyle. Comparative genome analyses were used to provide new insights into this question. Results included the identification of metabolic pathways and other features devoted to processing plant-derived cellulosic and aromatic compounds, and a robust complement of transport genes (15.4%), one of the highest percentages in bacterial genomes sequenced. Although virulence and antibiotic resistance genes were predicted, experiments conducted using mouse models showed pathogenicity to be attenuated in this strain. Comparative genomic analyses with the presumed human pathogen K. pneumoniae MGH78578 revealed that MGH78578 apparently cannot fix nitrogen, and the distribution of genes essential to surface attachment, secretion, transport, and regulation and signaling varied between each genome, which may indicate critical divergences between the strains that influence their preferred host ranges and lifestyles (endophytic plant associations for K. pneumoniae 342 and presumably human pathogenesis for MGH78578). Little genome information is available concerning endophytic bacteria. The K. pneumoniae 342 genome will drive new research into this less-understood, but important category of bacterial-plant host relationships, which could ultimately enhance growth and nutrition of important agricultural crops and development of plant-derived products and biofuels. PMID:18654632

  4. Nitrogenase of Klebsiella pneumoniae. Purification and properties of the component proteins

    PubMed Central

    Eady, R. R.; Smith, B. E.; Cook, K. A.; Postgate, J. R.

    1972-01-01

    1. Nitrogenase from the facultative anaerobe Klebsiella pneumoniae was resolved into two protein components resembling those obtained from other nitrogen-fixing bacteria. 2. Both proteins were purified to homogeneity as shown by the criteria of disc electrophoresis and ultracentrifugal analysis. 3. The larger component had a mol.wt. of 218000 and contained one Mo atom, 17Fe atoms and 17 acid-labile sulphide groups/mol; it contained two types of subunit, present in equal amounts, of mol.wts. 50000 and 60000. All the common amino acids were present, with a predominance of acidic residues. The apparent partial specific volume was 0.73; ultracentrifugal analysis gave s020,w=11.0S and D020,w=4.94×10?7cm2/s. The specific activities (nmol of product formed/min per mg of protein) when assayed with the second nitrogenase component were 1500 for H2 evolution, 380 for N2 reduction, 1200 for acetylene reduction and 5400 for ATP hydrolysis. The reduced protein showed electron-paramagnetic-resonance signals at g=4.3, 3.7 and 2.015; the Mössbauer spectrum of the reduced protein consisted of at least three doublets. The u.v. spectra of the oxidized and reduced proteins were identical. On oxidation the absorbance increased generally throughout the visible region and a shoulder at 430nm appeared. The circular-dichroism spectra of both the oxidized and reduced proteins were the same, consisting mainly of a negative trough at 220nm. 4. The smaller component had mol.wt. 66800 and contained four Fe atoms and four acid-labile sulphide groups in a molecule comprising two subunits each of mol.wt. 34600. All common amino acids except tryptophan were present, with a predominance of acidic residues. The apparent partial specific volume calculated from the amino acid analysis was 0.732, which was significantly higher than that obtained from density measurements (0.69); ultracentrifugal analysis gave s020,w=4.8S and D020,w=5.55×10?7cm2/s. The specific activities (nmol of product formed/min per mg of protein) were 1050 for H2 evolution, 275 for N2 reduction, 980 for acetylene reduction and 4350 for ATP hydrolysis. The protein was not cold-labile. The reduced protein showed electron-paramagnetic-resonance signals in the g=1.94 region. The Mössbauer spectrum of the reduced protein consisted of a doublet at 77°K. The u.v. spectra of reduced and O2-inactivated proteins were identical, and inactivation by O2 generally increased the absorbance in the visible region and resulted in a shoulder at 460nm. The circular-dichroism spectra exhibited a negative trough at 220nm and inactivation by O2 decreased the depth of the trough. 5. The reduction of N2 and acetylene, and H2 evolution, were maximal at a 1:1 molar ratio of the Fe-containing protein to the Mo–Fe-containing protein; excess of the Mo–Fe-containing protein was inhibitory. All reductions were accompanied by H2 evolution. The combined proteins had no ATP-independent hydrogenase activity. ImagesPLATE 1Fig. 2. PMID:4344006

  5. Biosynthesis of selenium nanoparticles using Klebsiella pneumoniae and their recovery by a simple sterilization process

    PubMed Central

    Fesharaki, Parisa Jafari; Nazari, Pardis; Shakibaie, Mojtaba; Rezaie, Sassan; Banoee, Maryam; Abdollahi, Mohammad; Shahverdi, Ahmad Reza

    2010-01-01

    The use of biologically derived metal nanoparticles for various proposes is going to be an issue of considerable importance; thus, appropriate methods should be developed and tested for the biological synthesis and recovery of these nanoparticles from bacterial cells. In this research study, a strain of Klebsiella pneumoniae was tested for its ability to synthesize elemental selenium nanoparticles from selenium chloride. A broth of Klebsiella pneumoniae culture containing selenium nanoparticles was subjected to sterilization at 121oC and 17 psi for 20 minutes. Released selenium nanoparticles ranged in size from 100 to 550 nm, with an average size of 245 nm. Our study also showed that no chemical changes occurred in selenium nanoparticles during the wet heat sterilization process. Therefore, the wet heat sterilization process can be used successfully to recover elemental selenium from bacterial cells. PMID:24031517

  6. Hypermucoviscous Klebsiella Syndrome Without Liver Abscess in a Patient With Immunoglobulin G2 Immune Deficiency

    PubMed Central

    Alsaedi, Asim; Janower, Amber; Wang, Jin-Town; Nichol, Kim; Karlowsky, James; Orr, Pamela; Keynan, Yoav

    2014-01-01

    Background ?Hypermucoviscous Klebsiella pneumoniae (HMVKP) emerged as a cause of invasive infections in South-East (SE) Asia. It has become the most common cause of liver abscess in that region, and it is a significant causative organism in endogenous endophthalmitis and meningitis. During the past decade, cases of this uniquely virulent organism have been reported outside of SE Asia, with a propensity to affect individuals of SE Asian descent. Cases have been reported from North America including Canada. Methods ?We report a case of a patient of Filipino descent living in Canada who presented with recurrent HMVKP bacteremia in the absence of pyogenic liver abscess or other localized metastatic Klebsiella infection. Results ?Investigations identified an immunoglobulin (Ig)G2 deficiency and low IgM indicating potential common variable immunodeficiency, and administration of intravenous immunoglobulins was associated with prevention of further recurrences. Conclusions ?To our knowledge, this is the first report of HMVKP associated with predisposing antibody deficiency. PMID:25734148

  7. Clinical Disease Caused by Klebsiella in 2 Unrelated Patients With Interleukin 12 Receptor ?1 Deficiency

    PubMed Central

    Pedraza, Sigifredo; Lezana, Jose Luis; Samarina, Arina; Aldana, Ruth; Herrera, Maria Teresa; Boisson-Dupuis, Stéphanie; Bustamante, Jacinta; Pages, Perle; Casanova, Jean-Laurent; Picard, Capucine

    2010-01-01

    Patients with interleukin 12 (IL-12)p40 or IL-12 receptor ?1 (IL12R?1) deficiencies are prone to develop infections caused by mycobacteria and salmonella; other infections have only been rarely observed. In this report we describe 2 unrelated patients with complete autosomal recessive IL12R?1 deficiency who suffered from sepsis attributable to Klebsiella pneumoniae. A Mexican boy suffered from disseminated bacilli Calmette-Guérin disease and infections caused by K pneumoniae and Candida albicans and had a fatal outcome. A Turkish girl living in France suffered from disseminated Nocardia nova infection and K pneumoniae sepsis. Therefore, Klebsiella infections should be considered in patients with IL12R?1 deficiency. Conversely, IL12R?1 deficiency should be considered in patients with unexplained klebsiellosis. PMID:20855390

  8. Plasmid Mediated Antibiotic Resistance in Isolated Bacteria From Burned Patients

    PubMed Central

    Beige, Fahimeh; Baseri Salehi, Majid; Bahador, Nima; Mobasherzadeh, Sina

    2014-01-01

    Background: Nowadays, the treatment of burned patients is difficult because of the high frequency of infection with antibiotic resistance bacteria. Objectives: This study was conducted to evaluate the level of antibiotic resistance in Gram-negative bacteria and its relation with the existence of plasmid. Materials and Methods: The samples were collected from two hundred twenty hospitalized burned patients in Isfahan burn hospital during a three-month period (March 2012 to June 2012). The samples were isolated and the Gram-negative bacteria were identified using phenotypic method and API 20E System. Antibiotic susceptibility and plasmid profile were determined by standard Agar disc diffusion and plasmid spin column extraction methods. Results: Totally 117 Gram-negative bacteria were isolated, the most common were Pseudomonas aerugionsa (37.6%), P. fluorescens (25.6%), Acinetobacter baumanii (20/5%) and Klebsiella pneumoniae (7.6%), respectively. The isolates showed high frequency of antibiotic resistance against ceftazidime and co-amoxiclave (100%) and low frequency of antibiotic resistance against amikacin with (70%).The results indicated that 60% of the isolates harboured plasmid. On the other hand, the patients infected with A. baumanii and P. aeruginosa were cured (with 60% frequency) whereas, those infected with P. fluorescens were not cured. Hence, probably antibiotic resistance markers of A. baumanii and P. aeruginosa are plasmid mediated; however, P. fluorescens is chromosomally mediated. Conclusions: Based on our findings, P. aerugionsa is a major causative agent of wound infections and amikacin could be considered as a more effective antibiotic for treatment of the burned patients. PMID:25789121

  9. Profiling of the bacteria responsible for pyogenic liver abscess by 16S rRNA gene pyrosequencing.

    PubMed

    Song, Yun Gyu; Shim, Sang Gun; Kim, Kwang Min; Lee, Dong-Hae; Kim, Dae-Soo; Choi, Sang-Haeng; Song, Jae-Young; Kang, Hyung-Lyun; Baik, Seung-Chul; Lee, Woo-Kon; Cho, Myung-Je; Rhee, Kwang-Ho

    2014-06-01

    Pyogenic liver abscess (PLA) is a severe disease with considerable mortality and is often polymicrobial. Understanding the pathogens that cause PLA is the basis for PLA treatment. Here, we profiled the bacterial composition in PLA fluid by pyrosequencing the 16S ribosomal RNA (rRNA) gene based on next-generation sequencing (NGS) technology to identify etiological agents of PLA and to provide information of their 16S rRNA sequences for application to DNA-based techniques in the hospital. Twenty patients with PLA who underwent percutaneous catheter drainage, abscess culture, and blood culture for isolates were included. Genomic DNAs from abscess fluids were subjected to polymerase chain reaction and pyrosequencing of the 16S rRNA gene with a 454 GS Junior System. The abscess and blood cultures were positive in nine (45%) and four (20%) patients, respectively. Pyrosequencing of 16S rRNA gene showed that 90% of the PLA fluid samples contained single or multiple genera of known bacteria such as Klebsiella, Fusobacterium, Streptococcus, Bacteroides, Prevotella, Peptostreptococcus, unassigned Enterobacteriaceae, and Dialister. Klebsiella was predominantly found in the PLA fluid samples. All samples that carried unassigned bacteria had 26.8% reads on average. We demonstrated that the occurrence of PLA was associated with eight known bacterial genera as well as unassigned bacteria and that 16S rRNA gene sequencing was more useful than conventional culture methods for accurate identification of bacterial pathogens from PLA. PMID:24871976

  10. Ertapenem resistance among Klebsiella and Enterobacter submitted in the UK to a reference laboratory

    Microsoft Academic Search

    Neil Woodford; John W. T. Dallow; Robert L. R. Hill; Marie-France I. Palepou; Rachel Pike; M. Elaina Ward; Marina Warner; David M. Livermore

    2007-01-01

    The emergence of carbapenem resistance in Enterobacteriaceae represents a major public health concern. We investigated ertapenem-resistant clinical isolates of Klebsiella spp. and Enterobacter spp. referred to the UK's national reference laboratory for antibiotic resistance. Minimum inhibitory concentrations (MICs) were determined and interpreted according to British Society for Antimicrobial Chemotherapy guidelines. Genes for carbapenemases and CTX-M extended-spectrum ?-lactamases (ESBLs) were sought

  11. Carbapenem-Hydrolyzing Oxacillinase, OXA-48, Persists in Klebsiella pneumoniae in Istanbul, Turkey

    Microsoft Academic Search

    Ines Schneider; Kenan Midilli; Adolf Bauernfeind

    2008-01-01

    Background: Two OXA-48-producing Klebsiella pneumoniae isolates(KP-4936 and KP-154488) were analyzed. Method: Minimum inhibitory concentrations were determined using agar dilution and E-test, ?-lactamase production by phenotypic tests (E-test MBL and ESBL, isoelectric focusing, and bioassay) and molecular methods (PCR, RAPD-PCR, sequencing, plasmid analysis, and conjugation). Results: Isolateswere resistant to all ?-lactams, including carbapenems. PCR and sequencing identifiedblaOXA-48in bothisolates and the transconjugant.

  12. First Isolate of KPC-2-Producing Klebsiella pneumonaie Sequence Type 23 from the Americas

    PubMed Central

    Cejas, Daniela; Fernández Canigia, Liliana; Rincón Cruz, Giovanna; Elena, Alan X.; Maldonado, Ivana; Gutkind, Gabriel O.

    2014-01-01

    KPC-2-producing Klebsiella pneumoniae isolates mainly correspond to clonal complex 258 (CC258); however, we describe KPC-2-producing K. pneumoniae isolates belonging to invasive sequence type 23 (ST23). KPC-2 has scarcely been reported to occur in ST23, and this report describes the first isolation of this pathogen in the Americas. Acquisition of resistant markers in virulent clones could mark an evolutionary step toward the establishment of these clones as major nosocomial pathogens. PMID:25031447

  13. Emerging Severe and Fatal Infections Due to Klebsiella pneumoniae in Two University Hospitals in France?

    PubMed Central

    Decré, Dominique; Verdet, Charlotte; Emirian, Aurélie; Le Gourrierec, Thibault; Petit, Jean-Claude; Offenstadt, Georges; Maury, Eric; Brisse, Sylvain; Arlet, Guillaume

    2011-01-01

    Severe infections caused by hypermucoviscous Klebsiella pneumoniae have been reported in Southeast Asian countries over the past several decades. This report shows their emergence in France, with 12 cases observed during a 2-year period in two university hospitals. Two clones (sequence type 86 [ST86] and ST380) of serotype K2 caused five rapidly fatal bacteremia cases, three of which were associated with pneumonia, whereas seven liver abscess cases were caused by K1 strains of ST23. PMID:21677064

  14. Emerging severe and fatal infections due to Klebsiella pneumoniae in two university hospitals in France.

    PubMed

    Decré, Dominique; Verdet, Charlotte; Emirian, Aurélie; Le Gourrierec, Thibault; Petit, Jean-Claude; Offenstadt, Georges; Maury, Eric; Brisse, Sylvain; Arlet, Guillaume

    2011-08-01

    Severe infections caused by hypermucoviscous Klebsiella pneumoniae have been reported in Southeast Asian countries over the past several decades. This report shows their emergence in France, with 12 cases observed during a 2-year period in two university hospitals. Two clones (sequence type 86 [ST86] and ST380) of serotype K2 caused five rapidly fatal bacteremia cases, three of which were associated with pneumonia, whereas seven liver abscess cases were caused by K1 strains of ST23. PMID:21677064

  15. Molecular cloning and analysis of the genes encoding the 4-hydroxyphenylacetate hydroxylase from Klebsiella pneumoniae

    Microsoft Academic Search

    Alicia Gibello; Mónica Suárez; J. Luis Allende; Margarita Martín

    1997-01-01

    The Klebsiella pneumoniae genes encoding the hydroxylase involved in the meta-cleavage pathway of 4-hydroxyphenylacetic acid (4-HPA) were cloned, and the DNA fragment from the region essential for hydroxylase\\u000a activity was sequenced. K. pneumoniae 4-HPA hydroxylase was composed of two proteins (HpaA and HpaH) with different molecular masses. HpaA seems to be a flavin-containing hydroxylase with a molecular mass of 58,781

  16. The origin of the sodium-dependent NADH oxidation by the respiratory chain of Klebsiella pneumoniae

    Microsoft Academic Search

    Yulia V Bertsova; Alexander V Bogachev

    2004-01-01

    Properties of Klebsiella pneumoniae respiratory chain enzymes catalyzing NADH oxidation have been studied. Using constructed K. pneumoniae mutant strains, it was shown that three enzymes belonging to different families of NADH:quinone oxidoreductases operate in this bacterium. The NDH-2-type enzyme is not coupled with energy conservation, the NDH-1-type enzyme is a primary proton pump, and the NQR-type enzyme is homologous to

  17. Nosocomial Liver Abscess Caused by Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae

    Microsoft Academic Search

    Jung-Chung Lin; L. K. Siu; Kao-Ming Yeh; Feng-Yee Chang

    2007-01-01

    A nosocomial pyogenic liver abscess caused by an extended-spectrum beta-lactamase-producing Klebsiella pneumoniae isolate presented in a man with adenocarcinoma of the stomach. The K. pneumoniae strain isolated from blood and liver aspirate cultures after antibiotic therapy for recurrent bacteremia was resistant to all extended-spectrum beta-lactams except imipenem and differed from K. pneumoniae strains causing community- acquired liver abscesses. CASE REPORT

  18. Nosocomial Liver Abscess Caused by Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae

    Microsoft Academic Search

    Jung-Chung Lin; L. K. Siu; Kao-Ming Yeh; Feng-Yee Chang

    A nosocomial pyogenic liver abscess caused by an extended-spectrum beta-lactamase-producing Klebsiella pneumoniae isolate presented in a man with adenocarcinoma of the stomach. The K. pneumoniae strain isolated from blood and liver aspirate cultures after antibiotic therapy for recurrent bacteremia was resistant to all extended-spectrum beta-lactams except imipenem and differed from K. pneumoniae strains causing community- acquired liver abscesses. CASE REPORT

  19. Emergence of KPC-Possessing Klebsiella pneumoniae in Brooklyn, New York: Epidemiology and Recommendations for Detection

    Microsoft Academic Search

    Simona Bratu; Mohamad Mooty; Satyen Nichani; David Landman; Carl Gullans; Barbara Pettinato; Usha Karumudi; Pooja Tolaney; John Quale

    2005-01-01

    Among 257 isolates of Klebsiella pneumoniae collected in Brooklyn, NY, 24% were found to possess blaKPC. Clinical microbiology laboratories that used automated broth microdilution systems reported 15% of the KPC-possessing isolates as susceptible to imipenem. The imipenem MIC was found to be markedly affected by the inoculum. For accurate detection of KPC-possessing K. pneumoniae, particular attention should be paid to

  20. First outbreak of Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae in Germany

    Microsoft Academic Search

    C. Wendt; S. Schütt; A. H. Dalpke; M. Konrad; M. Mieth; B. Trierweiler-Hauke; M. A. Weigand; S. Zimmermann; K. Biehler; D. Jonas

    2010-01-01

    We report the first outbreak of Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae in Germany. The presence of KPC was confirmed by polymerase chain reaction (PCR). The KPC-encoding plasmid was analysed by\\u000a transconjugation experiments, DNA sequencing, Southern blotting and isoelectric focussing. Typing was performed by pulsed-field\\u000a gel electrophoresis (PFGE). An ertapenem-resistant K. pneumoniae with low minimum inhibitory concentrations (MIC) to other

  1. Arrival of Klebsiella pneumoniae producing KPC carbapenemase in the United Kingdom

    Microsoft Academic Search

    Neil Woodford; Jiancheng Zhang; Marina Warner; Mary E. Kaufmann; Jorge Matos; Alan MacDonald; Daniel Brudney; David Sompolinsky; Shiri Navon-Venezia; David M. Livermore

    2008-01-01

    Background: KPC-type carbapenemases are increasingly prevalent in parts of the USA and Israel and are an emerging concern in South America, Europe and China. We investigated the UK's first two KPC-producing Klebsiella pneumoniae isolates. Methods: The isolates were referred to the UK's national reference laboratory for confirmation of carba- penem resistance. Susceptibilities were determined by agar dilution, and blaKPC and

  2. Sources of diversity of carbapenem resistance levels in Klebsiella pneumoniae carrying blaVIM-1

    Microsoft Academic Search

    A. Loli; L. S. Tzouvelekis; E. Tzelepi; A. Carattoli; A. C. Vatopoulos; P. T. Tassios; V. Miriagou

    2006-01-01

    Objectives: To elucidate the mechanisms responsible for the diversity of b-lactam resistance phenotypes among isolates of a VIM-1-producing Klebsiella pneumoniae (VPKP) strain that is endemic in Greek hospitals. Methods: Five VPKP clinical isolates were studied. MICs of b-lactams were determined by agar dilution. PFGE of XbaI-digested genomic DNA was used for typing. Profiles of outer membrane proteins (OMPs) were determined

  3. Activity of Imipenem against Klebsiella pneumoniae Biofilms In Vitro and In Vivo

    PubMed Central

    Chen, Ping; Seth, Akhil K.; Abercrombie, Johnathan J.; Mustoe, Thomas A.

    2014-01-01

    Encapsulated Klebsiella pneumoniae has emerged as one of the most clinically relevant and more frequently encountered opportunistic pathogens in combat wounds as the result of nosocomial infection. In this report, we show that imipenem displayed potent activity against established K. pneumoniae biofilms under both static and flow conditions in vitro. Using a rabbit ear model, we also demonstrated that imipenem was highly effective against preformed K. pneumoniae biofilms in wounds. PMID:24247132

  4. A case of acute postoperative keratitis after deep anterior lamellar keratoplasty by multidrug resistant Klebsiella

    PubMed Central

    Bajracharya, Leena; Sharma, Binita; Gurung, Reeta

    2015-01-01

    A healthy lady of 42 years underwent deep anterior lamellar keratoplasty for granular dystrophy. The very next day, it was complicated by development of infectious keratitis. The organism was identified as multidrug resistant Klebsiella pneumoniae. Donor corneal button may be implicated in the transmission of infection in an otherwise uneventful surgery and follow-up. Nosocomial infections are usually severe, rapidly progressive and difficult to treat. Finally, the lady had to undergo therapeutic penetrating keratoplasty for complete resolution of infection. PMID:26044477

  5. Role of the htrA Gene in Klebsiella pneumoniae Virulence

    Microsoft Academic Search

    Guadalupe Cortes; Beatriz de Astorza; V. J. Benedi; S. Alberti

    2002-01-01

    We recently described the use of mini-Tn5 to generate complement-sensitive mutants derived from a complement-resistant Klebsiella pneumoniae clinical isolate deficient in the lipopolysaccharide O side chain. One mutant with a reduced capacity to survive in nonimmune human sera carried the transposon inserted in the htrA gene. We cloned and sequenced the gene and predicted from the deduced amino acid sequence

  6. Genetic Determinants of Capsular Serotype K1 of Klebsiella pneumoniae Causing Primary Pyogenic Liver Abscess

    Microsoft Academic Search

    2006-01-01

    Background. Primary pyogenic liver abscess (PLA) caused by Klebsiella pneumoniae is an emerging infectious disease. Capsular serotype K1 and the magA gene have been reported to be associated with this disease. Methods. The prevalence of magA was determined by polymerase chain reaction (PCR). The sequences of the magA flanking region were completed by inverse PCR and direct sequencing. Serotyping was

  7. Metabolic Flux Analysis of Bioconversion of Glycerol into 1,3-Propandiol by Klebsiella Pneumoniae

    Microsoft Academic Search

    Qingrui Zhang; Hu Teng; Yaqin Sun; Zhilong Xiu

    2007-01-01

    This study presents an analysis of metabolic fluxes of the anaerobic glycerol metabolism by Klebsiella pneumoniae for the production of 1,3-propanediol (1,3-PD). A metabolic network was reconstructed from the partly annotated genome sequence as well as from biochemical and physiological literatures. Extracellular fluxes measured in continuous culture under steady condition were used to estimate intracellular fluxes. A comparison of changes

  8. Capsular Polysaccharide Synthesis Regions in Klebsiella pneumoniae Serotype K57 and a New Capsular Serotype

    Microsoft Academic Search

    Yi-Jiun Pan; Han-Chi Fang; Hui-Ching Yang; Tzu-Lung Lin; Pei-Fang Hsieh; Feng-Chiao Tsai; Yoav Keynan; Jin-Town Wang

    Received 29 August 2007\\/Returned for modification 12 December 2007\\/Accepted 17 March 2008 Community-acquired pyogenic liver abscess caused by Klebsiella pneumoniae is an emerging infectious disease. We explored the capsular polysaccharide synthesis (cps) regions of three non-K1, non-K2 K. pneu- moniae strains, A1142, A7754, and A1517, from Taiwanese patients experiencing pyogenic liver abscess. Two of the strains, A1142 and A7754, belonged

  9. Isolation and characterisation of KP34—a novel ?KMV-like bacteriophage for Klebsiella pneumoniae

    Microsoft Academic Search

    Zuzanna Drulis-Kawa; Pawe? Mackiewicz; Agata K?sik-Szeloch; Ewa Maciaszczyk-Dziubinska; Beata Weber-D?browska; Agata Dorotkiewicz-Jach; Daria Augustyniak; Gra?yna Majkowska-Skrobek; Tomasz Bocer; Joanna Empel; Andrew M. Kropinski

    2011-01-01

    Bacteriophage KP34 is a novel virus belonging to the subfamily Autographivirinae lytic for extended-spectrum ?-lactamase-producing Klebsiella pneumoniae strains. Its biological features, morphology, susceptibility to chemical and physical agents, burst size, host specificity\\u000a and activity spectrum were determined. As a potential antibacterial agent used in therapy, KP34 molecular features including\\u000a genome sequence and protein composition were examined. Phylogenetic analyses and clustering

  10. Cloning and Sequence Analysis of the Gene Encoding NiFe-hydrogenase from Klebsiella pneumoniae

    Microsoft Academic Search

    Fei LIU; Bai-Shan FANG

    2007-01-01

    Degenerate PCR primers were designed by multiple alignment of the protein sequences of known structural genes encoding the catalytic subunits of NiFe-hydrogenases obtained from Swiss-Prot Protein Sequence Database through CLUSTAL-W software and compared for conserved sequence motifs. A 1 kb amplified PCR product was obtained from the genomic DNA of Klebsiella pneumoniae using a set of degenerate primers, and then

  11. CTX-M-15 extended-spectrum b-lactamase from Nigerian Klebsiella pneumoniae

    Microsoft Academic Search

    Olusegun O. Soge; Anne Marie Queenan; Kayode K. Ojo; Bolanle A. Adeniyi; Marilyn C. Roberts

    2006-01-01

    Objectives: In this study, extended-spectrum b-lactamases (ESBLs) were characterized from 30 selected multidrug-resistant Klebsiella pneumoniae strains isolated from patients with community-acquired urinary tract infections from Southwest Nigeria. Methods: The b-lactamases were phenotypically characterized using isoelectric focusing, genotypically characterized using PCR assays and hybridization of the PCR products. Two of the blaCTX-M genes were completely sequenced. The location of the CTX-M-type

  12. Liver abscess due to Klebsiella pneumoniae in a healthy 12-year-old boy

    PubMed Central

    Yoon, Da Hye; Jeon, Yeon Jin; Bae, E Young; Jeong, Dae Chul

    2013-01-01

    Pyogenic liver abscess (PLA) is rare in healthy children. We report a case of PLA in an immunocompetent 12-year-old boy. Percutaneous catheter drainage was performed for the abscess. In addition, parenteral antibiotics were administered for 3 weeks. Klebsiella pneumoniae was detected in the culture of blood and drained fluid. Here, we present this case and a brief review of the literature on this subject. PMID:24348663

  13. Gluconate metabolism of Klebsiella pneumoniae NCTC 418 grown in chemostat culture

    Microsoft Academic Search

    Joost A. Simons; M. Joost Teixeira de Mattos; Oense M. Neijssel

    1993-01-01

    The metabolism of gluconate by Klebsiella pneumoniae NCTC 418 was studied in continuous culture. Under all gluconate-excess conditions at low culture pH values (pH 4.5–5.5) the majority (70–90%) of the gluconate metabolized was converted to 2-oxogluconate via gluconate dehydrogenase (GADH), although specific 2-oxogluconate production rates under potassium-limited conditions were significantly lower than under other gluconate-excess conditions. At high culture pH

  14. Biodegradation of 2-methylquinoline by Klebsiella pneumoniae TJ-A isolated from acclimated activated sludge.

    PubMed

    Wang, Lin; Li, Yongmei; Duan, Jingyuan

    2014-01-01

    Bacterial strain Klebsiella pneumoniae TJ-A, which was capable of utilizing 2-methylquinoline as the sole carbon and energy source, was isolated from acclimated activated sludge under aerobic conditions. Effects of temperature and initial pH on the biodegradation of 2-methylquinoline by Klebsiella pneumoniae TJ-A were investigated. The optimal temperature and initial pH were 30°C and 7.5, respectively. The degradation process was well described by the Haldane model. Then 1, 2, 3, 4-tetrahydro-2-methylquinoline, 4-ethyl-benzenamine and N-butyl-benzenamine were metabolites detected during the degradation of 2-methylquinoline. 2-Methylquinoline was initially hydroxylated at C-4 to form 2-methyl-4-hydroxy-quinoline, and then to form 2-methyl-4-quinolinol as a result of tautomerism. Hydrogenation of heterocyclic ring between the position 2 and 3 produced 2, 3-dihydro-2-methyl-4-quinolinol. The carbon-carbon bond between the position 2 and 3 in the heterocyclic ring cleaved and then formed 2-ethyl-N-ethyl-benzenamine. Tautomerism might result in the formation of N-butyl-benzenamine. The 4-ethyl-benzenamine was produced as a result of losing one ethyl group from N-butyl-benzenamine. The bacterial strain Klebsiella pneumoniae TJ-A was the priority species in the aerobic activated sludge responsible for the degradation of 2-methylquinoline. PMID:24117081

  15. In vitro growth inhibition of mastitis causing bacteria by phenolics and metal chelators

    SciTech Connect

    Chew, B.P.; Tjoelker, L.W.; Tanaka, T.S.

    1985-11-01

    Antimicrobial activities of three phenolic compounds and four metal chelators were tested at 0, 250, 500, and 1000 ppm in vitro against four major mastitis-causing bacteria, Streptococcus agalactiae, Staphylococcus aureus, Klebsiella pnuemoniae, and Escherichia coli. Overall, butylated hydroxyanisole and tert-butylhydroquinone showed the greatest antimicrobial activity. These phenolics were bactericidal at 250 to 500 ppm against all four bacteria tested. The butylated hydroxytoluene was bactericidal against the gram-positive bacteria but was ineffective against the coliforms. At 250 ppm, disodium ethylenediaminetetraacetic acid was bactericidal against the gram-positive bacteria but much less effective against the gram-negatives. However, diethylene-triaminepentaacetic acid was more growth inhibitory than ethylenediaminetetraacetic acid against the gram-negative bacteria and especially against Escherichia coli. All other compounds were generally much less effective or ineffective against all four microorganisms. Therefore, butylated hydroxyanisole, butylated hydroxytoluene, tert-butylhydroquinone, ethylenediaminetetraacetic acid, and diethylenetriaminepentaacetic acid may have practical implications in the prevention or treatment of bovine mastitis.

  16. Prevention of biofilm colonization by Gram-negative bacteria on minocycline-rifampin-impregnated catheters sequentially coated with chlorhexidine.

    PubMed

    Jamal, Mohamed A; Rosenblatt, Joel S; Hachem, Ray Y; Ying, Jiang; Pravinkumar, Egbert; Nates, Joseph L; Chaftari, Anne-Marie P; Raad, Issam I

    2014-01-01

    Resistant Gram-negative bacteria are increasing central-line-associated bloodstream infection threats. To better combat this, chlorhexidine (CHX) was added to minocycline-rifampin (M/R) catheters. The in vitro antimicrobial activity of CHX-M/R catheters against multidrug resistant, Gram-negative Acinetobacter baumannii, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia was tested. M/R and CHX-silver sulfadiazine (CHX/SS) catheters were used as comparators. The novel CHX-M/R catheters were significantly more effective (P < 0.0001) than CHX/SS or M/R catheters in preventing biofilm colonization and showed better antimicrobial durability. PMID:24165191

  17. Prevention of Biofilm Colonization by Gram-Negative Bacteria on Minocycline-Rifampin-Impregnated Catheters Sequentially Coated with Chlorhexidine

    PubMed Central

    Jamal, Mohamed A.; Rosenblatt, Joel S.; Hachem, Ray Y.; Ying, Jiang; Pravinkumar, Egbert; Nates, Joseph L.; Chaftari, Anne-Marie P.

    2014-01-01

    Resistant Gram-negative bacteria are increasing central-line-associated bloodstream infection threats. To better combat this, chlorhexidine (CHX) was added to minocycline-rifampin (M/R) catheters. The in vitro antimicrobial activity of CHX-M/R catheters against multidrug resistant, Gram-negative Acinetobacter baumannii, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia was tested. M/R and CHX-silver sulfadiazine (CHX/SS) catheters were used as comparators. The novel CHX-M/R catheters were significantly more effective (P < 0.0001) than CHX/SS or M/R catheters in preventing biofilm colonization and showed better antimicrobial durability. PMID:24165191

  18. Cellulolytic activity and structure of symbiotic bacteria in locust guts.

    PubMed

    Su, L-J; Liu, H; Li, Y; Zhang, H-F; Chen, M; Gao, X-H; Wang, F-Q; Song, A-D

    2014-01-01

    Locusts are able to digest the cellulose of Gramineae plants, resulting in their being considered as major crop pests. To illustrate the mechanism involved in cellulose digestion, the cellulolytic activity and zymography in the gut contents of 16 locust species were determined using carboxymethyl cellulose (CMC) as substrate. The diversity of gut symbiotic bacteria was studied using denaturing gradient gel electrophoresis (DGGE). The results showed that high CMC activity was present in Acrididae gut fluid (mean 356.4 U/g proteins). Of the 5 locust species, Oxya chinensis had the highest diversity of intestinal symbiotic bacteria, characterized by the DGGE profile containing more than 20 bands of 16S rRNA. Klebsiella pneumoniae, in the gut of Locusta migratoria manilensis, was identified as the most abundant symbiotic bacterium by DNA sequencing, with a relative abundance of 19.74%. In comparison, Methylobacterium sp was the most dominant species in the Atractomorpha sinensis gut, with a relative abundance of 29.04%. The results indicated that the cellulolytic enzymes and gut microbial communities probably reflected their phylogenetic relationship with different locust species and associated feeding strategies. PMID:25299108

  19. Antagonistic activity against pathogenic bacteria by human vaginal lactobacilli.

    PubMed

    Voravuthikunchai, Supayang Piyawan; Bilasoi, Sopa; Supamala, Orawan

    2006-01-01

    This study attempted to isolate lactobacilli strains from healthy vaginal ecosystem to search for a new effective antibacterial probiotic strain. The strains were identified and characterized for their probiotic properties including bile salt and acid tolerance, growth at acidic pH, their ability to utilize protein, starch, and lipid, the production of hydrogen peroxide and bacteriocin as well as their antibiotic resistance patterns. The antibacterial activity of the culture supernatant of these strains were tested against a wide range of Gram-positive and Gram-negative pathogenic bacteria including Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae. Salmonella typhi, and Salmonella typhimurium. None of the strains inhibited the growth of Gram-negative bacteria. Contrastly, the culture supernatant of strain L 22, identified as Lactobacillus reuteri, significantly inhibited all of the clinical isolates of methicillin-resistant S. aureus (MRSA). The antibacterial effect of the selected strain L 22 was further investigated. In the presence of L 22, the bacterial growth was assessed in vitro by viable bacterial counting. The numbers of viable cells were significantly lower in L 22-containing broth than those in the control by 6h. This finding clearly demonstrates that strain L 22 can produce an anti-MRSA effect. The antibacterial ability of the strain L 22 was fundamentally attributed to their bacteriocin production which can cause both cell inhibition and cell death. PMID:16931064

  20. Cultivation Media for Bacteria

    NSDL National Science Digital Library

    American Society For Microbiology

    2009-12-08

    Common bacteriological culture media (tryptic soy agar, chocolate agar, Thayer-Martin agar, MacConkey agar, eosin-methylene blue agar, hektoen agar, mannitol salt agar, and sheep blood agar) are shown uninoculated and inoculated with bacteria.

  1. Bleach vs. Bacteria

    MedlinePLUS

    ... the University of Michigan. In a series of experiments, her team showed that hypochlorous acid causes bacterial ... produced by almost all organisms, from bacteria to humans, may be one of the oldest molecular chaperones ...

  2. Bacteria in shear flow

    E-print Network

    Marcos, Ph.D. Massachusetts Institute of Technology

    2011-01-01

    Bacteria are ubiquitous and play a critical role in many contexts. Their environment is nearly always dynamic due to the prevalence of fluid flow: creeping flow in soil, highly sheared flow in bodily conduits, and turbulent ...

  3. How honey kills bacteria

    Microsoft Academic Search

    P. H. S. Kwakman; A. A. te Velde; L. de Boer; D. Speijer; C. M. J. E. Vandenbroucke-Grauls; S. A. J. Zaat

    2010-01-01

    With the rise in prevalence of antibiotic-resistant bacteria, honey is increasingly valued for its antibacterial activity. To characterize all bactericidal factors in a medical-grade honey, we used a novel approach of successive neutralization of individual honey bactericidal factors. All bacteria tested, including Bacillus subtilis, methicillin-resistant Staphylococcus aureus, extended-spectrum beta-lactamase producing Escherichia coli, ciprofloxacin-resistant Pseudomonas aeruginosa, and vancomycin-resistant Enterococcus faecium, were

  4. Ecophysiology of Magnetotactic Bacteria

    Microsoft Academic Search

    Dennis A. Bazylinski; Timothy Williams

    Magnetotactic bacteria are a physiologically diverse group of prokaryotes whose main common features\\u000a are the biomineralization of magnetosomes and magnetotaxis, the passive alignment and active motility along\\u000a geomagnetic field lines. Magnetotactic bacteria exist in their highest numbers at or near the oxic–anoxic\\u000a interfaces (OAI) of chemically stratified aquatic habitats that contain inverse concentration gradients\\u000a of oxidants and reductants. Few species are

  5. Lipopolysaccharides in diazotrophic bacteria

    PubMed Central

    Serrato, Rodrigo V.

    2014-01-01

    Biological nitrogen fixation (BNF) is a process in which the atmospheric nitrogen (N2) is transformed into ammonia (NH3) by a select group of nitrogen-fixing organisms, or diazotrophic bacteria. In order to furnish the biologically useful nitrogen to plants, these bacteria must be in constant molecular communication with their host plants. Some of these molecular plant-microbe interactions are very specific, resulting in a symbiotic relationship between the diazotroph and the host. Others are found between associative diazotrophs and plants, resulting in plant infection and colonization of internal tissues. Independent of the type of ecological interaction, glycans, and glycoconjugates produced by these bacteria play an important role in the molecular communication prior and during colonization. Even though exopolysaccharides (EPS) and lipochitooligosaccharides (LCO) produced by diazotrophic bacteria and released onto the environment have their importance in the microbe-plant interaction, it is the lipopolysaccharides (LPS), anchored on the external membrane of these bacteria, that mediates the direct contact of the diazotroph with the host cells. These molecules are extremely variable among the several species of nitrogen fixing-bacteria, and there are evidences of the mechanisms of infection being closely related to their structure. PMID:25232535

  6. The fecal bacteria

    USGS Publications Warehouse

    Sadowsky, Michael J., (Edited By); Whitman, Richard L.

    2011-01-01

    The Fecal Bacteria offers a balanced, integrated discussion of fecal bacteria and their presence and ecology in the intestinal tract of mammals, in the environment, and in the food supply. This volume covers their use in examining and assessing water quality in order to offer protection from illnesses related to swimming in or ingesting contaminated water, in addition to discussing their use in engineering considerations of water quality, modeling, monitoring, and regulations. Fecal bacteria are additionally used as indicators of contamination of ready-to-eat foods and fresh produce. The intestinal environment, the microbial community structure of the gut microbiota, and the physiology and genomics of this broad group of microorganisms are explored in the book. With contributions from an internationally recognized group of experts, the book integrates medicine, public health, environmental, and microbiological topics in order to provide a unique, holistic understanding of fecal bacteria. Moreover, it shows how the latest basic science and applied research findings are helping to solve problems and develop effective management strategies. For example, readers will discover how the latest tools and molecular approaches have led to our current understanding of fecal bacteria and enabled us to improve human health and water quality. The Fecal Bacteria is recommended for microbiologists, clinicians, animal scientists, engineers, environmental scientists, food safety experts, water quality managers, and students. It will help them better understand fecal bacteria and use their knowledge to protect human and environmental health. They can also apply many of the techniques and molecular tools discussed in this book to the study of a broad range of microorganisms in a variety of habitats.

  7. Piscidin is highly active against carbapenem-resistant Acinetobacter baumannii and NDM-1-producing Klebsiella pneumonia in a systemic Septicaemia infection mouse model.

    PubMed

    Pan, Chieh-Yu; Chen, Jian-Chyi; Chen, Te-Li; Wu, Jen-Leih; Hui, Cho-Fat; Chen, Jyh-Yih

    2015-04-01

    This study was designed to investigate the antimicrobial activity of two synthetic antimicrobial peptides from an aquatic organism, tilapia piscidin 3 (TP3) and tilapia piscidin 4 (TP4), in vitro and in a murine sepsis model, as compared with ampicillin, tigecycline, and imipenem. Mice were infected with (NDM-1)-producing K. pneumonia and multi-drug resistant Acinetobacter baumannii, and subsequently treated with TP3, TP4, or antibiotics for different periods of time (up to 168 h). Mouse survival and bacterial colony forming units (CFU) in various organs were measured after each treatment. Toxicity was determined based on observation of behavior and measurement of biochemical parameters. TP3 and TP4 exhibited strong activity against K. pneumonia and A. baumannii in vitro. Administration of TP3 (150 ?g/mouse) or TP4 (50 ?g/mouse) 30 min after infection with K. pneumonia or A. baumannii significantly increased survival in mice. TP4 was more effective than tigecycline at reducing CFU counts in several organs. TP3 and TP4 were shown to be non-toxic, and did not affect mouse behavior. TP3 and TP4 are able at potentiate anti-Acinetobacter baumannii or anti-Klebsiella pneumonia drug activity, reduce bacterial load, and prevent drug resistance, indicating their potential for use in combating multidrug-resistant bacteria. PMID:25874924

  8. Active hexose correlated compound enhances resistance to Klebsiella pneumoniae infection in mice in the hindlimb-unloading model of spaceflight conditions.

    PubMed

    Aviles, Hernan; Belay, Tesfaye; Fountain, Kimberly; Vance, Monique; Sun, Buxiang; Sonnenfeld, Gerald

    2003-08-01

    Previous studies have demonstrated that resistance to infection is decreased in Swiss Webster female mice maintained in the hindlimb-unloading model (Aviles H, Belay T, Fountain K, Vance M, and Sonnenfeld G. J Appl Physiol 95: 73-80, 2003; Belay T, Aviles H, Vance M, Fountain K, and Sonnenfeld G. J Allergy Clin Immunol 110: 262-268, 2002). This is a model of some of the aspects of spaceflight conditions, including lack of load bearing on hindlimbs and a fluid shift to the head. Active hexose correlated compound (AHCC), extracted from Basidiomycete mushrooms, has been shown to induce enhancement of immune responses, including enhanced natural killer activity. In the present study, AHCC was orally administered to mice to determine whether the treatment could decrease immunosuppression and mortality of mice maintained in the hindlimb-unloaded model and infected with Klebsiella pneumoniae. The results of the present study showed that administration of AHCC by gavage for 1 wk (1 g/kg body wt) before suspension and throughout the 10-day suspension period yielded significant beneficial effects for the hindlimb-unloaded group, including 1). decreased mortality, 2). increased time to death, and 3). increased ability to clear bacteria. The results suggest that AHCC can decrease the deleterious effects of the hindlimb-unloading model on immunity and resistance to infection. PMID:12692142

  9. Phenotypic and Molecular Characterization of Plasmid Mediated AmpC among Clinical Isolates of Klebsiella pneumoniae Isolated from Different Hospitals in Tehran

    PubMed Central

    Azimi, Leila; Erajiyan, Gholamreza; Talebi, Malihe; Owlia, Parviz; Bina, Mahsa; Shojaie, Ali

    2015-01-01

    Introduction: Klebsiella pneumoniae is one of the main opportunistic pathogens which can cause different types of infections. Production of beta-lactamases like AmpC and ESBL mostly lead to beta-lactam resistance in these Gram-Negative bacteria. The aim of this study was the detection of AmpC-producing K. pneumoniae in clinical isolates. Materials and Methods: Three hundred and three isolates of K. pneumoniae were identified. Double disc method including cefoxitin with cefepime and using boronic acid with cloxacillin were performed as two phenotypic methods for detection of AmpC. Amplification of AmpC gene was performed by PCR. Results: Eight and three isolates showed positive results in double disc method and by using boronic acid with cloxacillin, respectively. Five isolates had specific band for AmpC gene after electrophoresis. Conclusion: Our results were indicated the low prevalence of AmpC-producer-K. pnemoniae in Iran. On the other hand these two tested phenotypic methods showed low sensitivity for detection of AmpC. PMID:26046018

  10. Characterization of the gene cluster involved in allantoate catabolism and its transcriptional regulation by the RpiR-type repressor HpxU in Klebsiella pneumoniae.

    PubMed

    Guzmán, Karla; Campos, Evangelina; Aguilera, Laura; Toloza, Lorena; Giménez, Rosa; Aguilar, Juan; Baldoma, Laura; Badia, Josefa

    2013-09-01

    Bacteria, fungi, and plants have metabolic pathways for the utilization of nitrogen present in purine bases. In Klebsiella pneumoniae, the genes responsible for the assimilation of purine ring nitrogen are distributed in three separated clusters. We characterized the gene cluster involved in the metabolism of allantoate (genes KPN_01761 to KPN_01771). The functional assignments of HpxK, as an allantoate amidohydrolase, and of HpxU, as a regulator involved in the control of allantoate metabolism, were assessed experimentally. Gene hpxU encodes a repressor of the RpiR family that mediates the regulation of this system by allantoate. In this study, the binding of HpxU to the hpxF promoter and to the hpxU-hpxW intergenic region containing the divergent promoter for these genes was evidenced by electrophoretic mobility shift assays. Allantoate released the HpxU repressor from its target operators whereas other purine intermediate metabolites, such as allantoin and oxamate, failed to induce complex dissociation. Sequence alignment of the four HpxU identified operators identified TGAA-N8-TTCA as the consensus motif recognized by the HpxU repressor. PMID:24568032

  11. Phytochemistry and Preliminary Assessment of the Antibacterial Activity of Chloroform Extract of Amburana cearensis (Allemão) A.C. Sm. against Klebsiella pneumoniae Carbapenemase-Producing Strains

    PubMed Central

    Sá, Mirivaldo Barros; Ralph, Maria Taciana; Nascimento, Danielle Cristina Oliveira; Ramos, Clécio Souza; Barbosa, Isvânia Maria Serafin; Sá, Fabrício Bezerra; Lima-Filho, J. V.

    2014-01-01

    The chloroform extract of the stem bark of Amburana cearensis was chemically characterized and tested for antibacterial activity.The extract was analyzed by gas chromatography and mass spectrometry. The main compounds identified were 4-methoxy-3-methylphenol (76.7%), triciclene (3.9%), ?-pinene (1.0%), ?-pinene (2.2%), and 4-hydroxybenzoic acid (3.1%). Preliminary antibacterial tests were carried out against species of distinct morphophysiological characteristics: Escherichia coli, Salmonella enterica Serotype Typhimurium, Pseudomonas aeruginosa, Staphylococcus aureus, Listeria monocytogenes, and Bacillus cereus. The minimum inhibitory concentration (MIC) was determinate in 96-well microplates for the chloroform extract and an analogue of themain compound identified, which was purchased commercially.We have shown that plant's extract was only inhibitory (but not bactericidal) at the maximum concentration of 6900??g/mL against Pseudomonas aeruginosa and Bacillus cereus. Conversely, the analogue 2-methoxy-4-methylphenol produced MICs ranging from215 to 431??g/mL against all bacterial species.New antibacterial assays conducted with such chemical compound against Klebsiella pneumoniae carbapenemase-producing strains have shown similarMICresults and minimumbactericidal concentration (MBC) of 431??g/mL.We conclude that A. cearensis is a good source of methoxy-methylphenol compounds,which could be screened for antibacterial activity againstmultiresistant bacteria fromdifferent species PMID:24772183

  12. pIMP-PH114 carrying bla IMP-4 in a Klebsiella pneumoniae strain is closely related to other multidrug-resistant IncA/C2 plasmids.

    PubMed

    Ho, Pak-Leung; Lo, Wai-U; Chan, Jane; Cheung, Yuk-Yam; Chow, Kin-Hung; Yam, Wing-Cheong; Lin, Chi-Ho; Que, Tak-Lun

    2014-02-01

    The IncA/C plasmids are broad host-range vehicles which have been associated with wide dissemination of CMY-2 among Enterobacteriaceae of human and animal origins. Acquired metallo-?-lactamases (MBLs) such as the IMP-type enzymes are increasingly reported in multidrug-resistant Gram-negative bacteria worldwide, particularly in Enterobacteriaceae. We described the complete sequence of the first IMP-4-encoding IncA/C2 plasmid, pIMP-PH114 (151,885 bp), from a sequence type 1 Klebsiella pneumoniae strain that was recovered from a patient who was hospitalized in the Philippines. pIMP-PH114 consists of a backbone from the IncA/C2 plasmids, with the insertion of a novel Tn21-like class 1 integron composite structure (containing the cassette array bla IMP-4-qacG-aacA4-catB3, followed by a class C ?-lactamase bla DHA-1 and the mercury resistance operon, merRTPCADE) and a sul2-floR encoding region. Phylogenetic analysis of the IncA/C repA sequences showed that pIMP-PH114 formed a subgroup with other IncA/C plasmids involved in the international spread of CMY-2, TEM-24 and NDM-1. Identical bla IMP-4 arrays have been described among different Enterobacteriaceae and Acinetobacter spp. in China, Singapore and Australia but the genetic context is different. The broad host range of IncA/C plasmids may have facilitated dissemination of the bla IMP-4 arrays among different diverse groups of bacteria. PMID:24121549

  13. Occurrence of Multidrug Resistant Extended Spectrum Beta-Lactamase-Producing Bacteria on Iceberg Lettuce Retailed for Human Consumption

    PubMed Central

    Talreja, Deepa; Rana, Sonia Walia; Walia, Sandeep; Walia, Satish K.

    2015-01-01

    Antibiotic resistance in bacteria is a global problem exacerbated by the dissemination of resistant bacteria via uncooked food, such as green leafy vegetables. New strains of bacteria are emerging on a daily basis with novel expanded antibiotic resistance profiles. In this pilot study, we examined the occurrence of antibiotic resistant bacteria against five classes of antibiotics on iceberg lettuce retailed in local convenience stores in Rochester, Michigan. In this study, 138 morphologically distinct bacterial colonies from 9 iceberg lettuce samples were randomly picked and tested for antibiotic resistance. Among these isolates, the vast majority (86%) demonstrated resistance to cefotaxime, and among the resistant bacteria, the majority showed multiple drug resistance, particularly against cefotaxime, chloramphenicol, and tetracycline. Three bacterial isolates (2.17%) out of 138 were extended spectrum beta-lactamase (ESBL) producers. Two ESBL producers (T1 and T5) were identified as Klebsiella pneumoniae, an opportunistic pathogen with transferable sulfhydryl variable- (SHV-) and TEM-type ESBLs, respectively. The DNA sequence analysis of the blaSHV detected in K. pneumoniae isolate T1 revealed 99% relatedness to blaSHV genes found in clinical isolates. This implies that iceberg lettuce is a potential reservoir of newly emerging and evolving antibiotic resistant bacteria and its consumption poses serious threat to human health.

  14. Biodegradation of the herbicide trifluralin by bacteria isolated from soil.

    PubMed

    Bellinaso, Maria De Lourdes; Greer, Charles William; Peralba, Maria do Carmo; Henriques, João Antônio Pêgas; Gaylarde, Christine Claire

    2003-03-01

    Trifluralin (alpha,alpha,alpha-trifluoro-2,6-dinitro-N,N-dipropyl-p-toluidine; TFL) is a pre-emergence, soil-incorporated herbicide that has been in agricultural use since the early 1960s and is moderately persistent in soil. The purpose of this study was to isolate and characterise TFL-resistant bacteria from a soil in which this pesticide has been used for the last four decades and to determine their ability to degrade TFL using HPLC. Eight bacteria were isolated by repeated subculture in liquid medium with TFL as carbon source and a ninth (isolate 9) from growth around TFL crystals on solid medium. The bacteria from enriched liquid culture were identified by biochemical tests and 16S rDNA sequencing. In a mineral salts medium with 0.1% succinate, 0.1% yeast extract and 50 mg l(-1) TFL, reductions in the level of pesticide of 24.6% for Klebsiella sp., 16.4% for Herbaspirillum sp., 25.0% and 16.0% for two strains of Bacillus sp. and 21.0% for unidentified isolate number 9 were obtained after 30 days. These were similar to the level obtained using a known TFL-degrading bacterium, Brevundimonas diminuta (NCIMB 10329). Three Pseudomonas sp. and one Bacillus sp. reduced levels by less than 5%. The five positive isolates can be used to study the biochemical and molecular biology of TFL biodegradation with the aim of optimising the degradative ability of one or more of the isolates for future use in bioremediation processes. PMID:19719679

  15. Recurring Klebsiella pneumoniae Pyogenic Liver Abscesses in a Resident of San Diego, California, Due to a K1 Strain Carrying the Virulence Plasmid ?

    PubMed Central

    Fierer, Joshua; Walls, Lorraine; Chu, Pauline

    2011-01-01

    We report a diabetic patient who had three episodes of cryptogenic liver abscess due to Klebsiella pneumoniae. He was a Caucasian who lived in California and had no epidemiological connection to East Asia. The isolate from his third episode was a hyperviscous K1 strain that carried the Klebsiella virulence plasmid. PMID:21998428

  16. Rapid discrimination of Klebsiella pneumoniae carbapenemase 2-producing and non-producing Klebsiella pneumoniae strains using near-infrared spectroscopy (NIRS) and multivariate analysis.

    PubMed

    Marques, Aline S; Moraes, Edgar P; Júnior, Miguel A A; Moura, Andrew D; Neto, Valter F A; Neto, Renato M; Lima, Kássio M G

    2015-03-01

    Klebsiella pneumoniae Carbapenemase (KPC-2)-producing and non-producing Klebsiella pneumoniae (KP) have rapidly disseminated worldwide, challenging the diagnostics of Gram-negative infections. We evaluate the potential of a novel non-destructive and rapid method based on Near-Infrared Spectroscopic (NIRS) and multivariate analysis for distinguishing KPC-2-producing and non-producing KP. Thirty-nine NIRS spectra (24 KPC-2-producing KP, 15 KPC-2 non-producing KP) were acquired; different pre-processing methods such as baseline correction, derivative and Savitzky-Golay smoothing were performed. A spectral region fingerprint was achieved after using genetic algorithm-linear discriminant analysis (GA-LDA) and successive projection algorithm (SPA-LDA) algorithms for variable selection. The variables selected were then used for discriminating the microorganisms.Accuracy test results including sensitivity and specificity were determined. Sensitivity in KPC-2 producing and non-producing KP categories was 66.7% and 75%, respectively, using a SPA-LDA model with 66 wavenumbers. The resulting GA-LDA model successfully classified both microorganisms with respect to their "fingerprints" using only 39 wavelengths. Sensitivity in KPC-2 producing category was moderate(?66.7%) using a GA-LDA model. However, sensitivity in KPC-2 non-producing category using GA-LDA accurately predicted the correct class (with 100% accuracy). As100% accuracy was achieved, this novel approach identifies potential biochemical markers that may have a relation with microbial functional roles and means of rapid identification of KPC-2 producing and non-producing KP strains. PMID:25618648

  17. Differential effects of catecholamines on in vitro growth of pathogenic bacteria

    NASA Technical Reports Server (NTRS)

    Belay, Tesfaye; Sonnenfeld, Gerald

    2002-01-01

    Supplementation of minimal medium inoculated with bacterial cultures with norepinephrine, epinephrine, dopamine, or isoproterenol resulted in marked increases in growth compared to controls. Norepinephrine and dopamine had the greatest enhancing effects on growth of cultures of Pseudomonas aeruginosa and Klebsiella pneumoniae, while epinephrine and isoproterenol also enhanced growth to a lesser extent. The growth of Escherichia coli in the presence of norepinephrine was greater than growth in the presence of the three other neurochemicals used in the study. Growth of Staphylococcus aureus was also enhanced in the presence of norepinephrine, but not to the same degree as was the growth of gram negative bacteria. Addition of culture supernatants from E. coli cultures that had been grown in the presence of norepinephrine was able to enhance the growth of K. pneumoniae. Addition of the culture supernatant fluid culture from E. coli cultures that had been grown in the presence of norepinephrine did not enhance growth of P. aeruginosa or S. aureus. Culture supernatant fluids from bacteria other than E. coli grown in the presence of norepinephrine were not able to enhance the growth of any bacteria tested. The results suggest that catecholamines can enhance growth of pathogenic bacteria, which may contribute to development of pathogenesis; however, there is no uniform effect of catecholamines on bacterial growth.

  18. Glutathione-S-Transferase Activity and Metabolism of Glutathione Conjugates by Rhizosphere Bacteria

    PubMed Central

    Zablotowicz, R. M.; Hoagland, R. E.; Locke, M. A.; Hickey, W. J.

    1995-01-01

    Glutathione-S-transferase (GST) activity was determined in 36 species of rhizosphere bacteria with the substrate 1-chloro-2,4-dinitrobenzene (CDNB) and in 18 strains with the herbicide alachlor. Highest levels of CDNB-GST activity (60 to 222 nmol (middot) h(sup-1) (middot) mg(sup-1)) were found in gram-negative bacteria: Enterobacter cloacae, Citrobacter diversus, Klebsiella planticola, Pseudomonas cepacia, Pseudomonas fluorescens, Pseudomonas putida, and Xanthomonas campestris. There was very low CDNB-GST activity in the gram-positive strains. Rapid metabolism of CDNB-glutathione conjugates, attributable to high levels of (gamma)-glutamyltranspeptidase, also occurred in the gram-negative bacteria, especially pseudomonads. Alachlor-GST activity detected in cell extracts and whole-cell suspensions of some strains of the families Enterobacteriaceae and Pseudomonaceae was 50- to 100-fold lower than CDNB-GST activity (0.5 to 2.5 nmol (middot) h(sup-1) (middot) mg(sup-1)) and was, for the most part, constitutive. The glutathione-alachlor conjugate was rarely detected. Cysteineglycine and/or cysteine conjugates were the major products of alachlor-GST metabolism. Whole-cell suspensions of certain Pseudomonas spp. dechlorinated from 20 to 75% of 100 (mu)M alachlor in 24 h. Results indicate that rhizosphere bacteria, especially fluorescent pseudomonads, may play an important role in the degradation of xenobiotics such as alachlor via GST-mediated reactions. PMID:16534956

  19. Alterations in peptidoglycan chemical composition associated with rod-to-sphere transition in a conditional mutant of Klebsiella pneumoniae.

    PubMed Central

    Fontana, R; Canepari, P; Satta, G

    1979-01-01

    Klebsiella pneumoniae Mir M7 is a spontaneous parentless morphology mutant which grows as cocci at pH 7 and as rods at pH 5.8. This strain has been characterized as defective in lateral wall formation (at pH7). Data suggest that the cell wall is mainly made up of poles of the rods (G. Satta, R. Fontana, P. Canepari, and G. Botta, J. Bacteriol. 137:727--734, 1979). In this work the isolation and the biochemical properties of the peptidoglycan of both Mir M7 rods and cocci and a nonconditional rod-shaped Mir M7 revertant (strain Mir A12) are described. The peptidoglycan of Mir M7 (both rods and cocci) and Mir A12 strains carried covalently bound proteins which could be easily removed by pronase treatment in Mir M7 rods and Mir A12 cells, but not in Mir M7 round cells. However, when the sodium dodecyl sulfate-insoluble residues of Mir M7 cocci were pretreated with ethylenediaminetetraacetic acid (EDTA), pronase digestion removed the covalently bound proteins, and pure peptidoglycan was obtained. EDTA treatment of the rigid layer of Mir M7 cocci removed amounts of Mg2+ and Ca2+, which were 10- and 50-fold higher, respectively, than the amount liberated from the rigid layer of Mir M7 rods and Mir A12 cells. Amino acid composition was qualitatively similar in both strains, but Mir M7 cocci contained a higher amount of alanine and glucosamine. Mir M7 cocci contained approximately 50% less peptidoglycan than rods. Under electron microscopy, the rigid layer of the Mir M7 rods and Mir A12 cells appeared to be rod-shaped and their shape remained unchanged after EDTA and pronase treatment. On the contrary, the Mir M7 cocci rigid layer appeared to be round, and after EDTA treatment it collapsed and lost any definite morphology. In spite of these alterations, the peptidoglycan of Mir M7 cocci still appeared able to determine the shape of the cell and protect it from osmotic shock and mechanical damages. The accumluation of divalent cations appeared necessary for the peptidoglycan to acquire sufficient rigidity for shape determination and cell protection. We concluded that the coccal shape in Mir M7 cells is not due to loss of cell wall rigidity but is a consequence of the formation of a round peptidoglycan molecule. The possibility that the alterations found in the Mir M7 cocci rigid layer may reflect natural differences in the biochemical composition of the septa and lateral wall of normally shaped bacteria is discussed. Images PMID:113382

  20. Toward Repurposing Ciclopirox as an Antibiotic against Drug-Resistant Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae

    PubMed Central

    Carlson-Banning, Kimberly M.; Chou, Andrew; Liu, Zhen; Hamill, Richard J.; Song, Yongcheng; Zechiedrich, Lynn

    2013-01-01

    Antibiotic-resistant infections caused by gram-negative bacteria are a major healthcare concern. Repurposing drugs circumvents the time and money limitations associated with developing new antimicrobial agents needed to combat these antibiotic-resistant infections. Here we identified the off-patent antifungal agent, ciclopirox, as a candidate to repurpose for antibiotic use. To test the efficacy of ciclopirox against antibiotic-resistant pathogens, we used a curated collection of Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae clinical isolates that are representative of known antibiotic resistance phenotypes. We found that ciclopirox, at 5–15 µg/ml concentrations, inhibited bacterial growth regardless of the antibiotic resistance status. At these same concentrations, ciclopirox reduced growth of Pseudomonas aeruginosa clinical isolates, but some of these pathogens required higher ciclopirox concentrations to completely block growth. To determine how ciclopirox inhibits bacterial growth, we performed an overexpression screen in E. coli. This screen revealed that galE, which encodes UDP-glucose 4-epimerase, rescued bacterial growth at otherwise restrictive ciclopirox concentrations. We found that ciclopirox does not inhibit epimerization of UDP-galactose by purified E. coli GalE; however, ?galU, ?galE, ?rfaI, or ?rfaB mutant strains all have lower ciclopirox minimum inhibitory concentrations than the parent strain. The galU, galE, rfaI, and rfaB genes all encode enzymes that use UDP-galactose or UDP-glucose for galactose metabolism and lipopolysaccharide (LPS) biosynthesis. Indeed, we found that ciclopirox altered LPS composition of an E. coli clinical isolate. Taken together, our data demonstrate that ciclopirox affects galactose metabolism and LPS biosynthesis, two pathways important for bacterial growth and virulence. The lack of any reported fungal resistance to ciclopirox in over twenty years of use in the clinic, its excellent safety profiles, novel target(s), and efficacy, make ciclopirox a promising potential antimicrobial agent to use against multidrug-resistant problematic gram-negative pathogens. PMID:23936064

  1. Toward repurposing ciclopirox as an antibiotic against drug-resistant Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae.

    PubMed

    Carlson-Banning, Kimberly M; Chou, Andrew; Liu, Zhen; Hamill, Richard J; Song, Yongcheng; Zechiedrich, Lynn

    2013-01-01

    Antibiotic-resistant infections caused by gram-negative bacteria are a major healthcare concern. Repurposing drugs circumvents the time and money limitations associated with developing new antimicrobial agents needed to combat these antibiotic-resistant infections. Here we identified the off-patent antifungal agent, ciclopirox, as a candidate to repurpose for antibiotic use. To test the efficacy of ciclopirox against antibiotic-resistant pathogens, we used a curated collection of Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae clinical isolates that are representative of known antibiotic resistance phenotypes. We found that ciclopirox, at 5-15 µg/ml concentrations, inhibited bacterial growth regardless of the antibiotic resistance status. At these same concentrations, ciclopirox reduced growth of Pseudomonas aeruginosa clinical isolates, but some of these pathogens required higher ciclopirox concentrations to completely block growth. To determine how ciclopirox inhibits bacterial growth, we performed an overexpression screen in E. coli. This screen revealed that galE, which encodes UDP-glucose 4-epimerase, rescued bacterial growth at otherwise restrictive ciclopirox concentrations. We found that ciclopirox does not inhibit epimerization of UDP-galactose by purified E. coli GalE; however, ?galU, ?galE, ?rfaI, or ?rfaB mutant strains all have lower ciclopirox minimum inhibitory concentrations than the parent strain. The galU, galE, rfaI, and rfaB genes all encode enzymes that use UDP-galactose or UDP-glucose for galactose metabolism and lipopolysaccharide (LPS) biosynthesis. Indeed, we found that ciclopirox altered LPS composition of an E. coli clinical isolate. Taken together, our data demonstrate that ciclopirox affects galactose metabolism and LPS biosynthesis, two pathways important for bacterial growth and virulence. The lack of any reported fungal resistance to ciclopirox in over twenty years of use in the clinic, its excellent safety profiles, novel target(s), and efficacy, make ciclopirox a promising potential antimicrobial agent to use against multidrug-resistant problematic gram-negative pathogens. PMID:23936064

  2. Partial Excision of blaKPC from Tn4401 in Carbapenem-Resistant Klebsiella pneumoniae

    PubMed Central

    Chen, Liang; Chavda, Kalyan D.; Mediavilla, José R.; Jacobs, Michael R.; Levi, Michael H.; Bonomo, Robert A.

    2012-01-01

    We describe a novel Tn4401 variant (Tn4401d) in epidemic Klebsiella pneumoniae clone ST258, from which a partial blaKPC fragment has been excised along with ISKpn7 and a partial tnpA fragment. Nested-PCR experiments confirmed that this region can be removed from distinct Tn4401 isoforms in both K. pneumoniae and Escherichia coli. This study highlights that the region surrounding blaKPC is undergoing recombination and that Tn4401 itself is heterogeneous and highly plastic. PMID:22203593

  3. Partial excision of blaKPC from Tn4401 in carbapenem-resistant Klebsiella pneumoniae.

    PubMed

    Chen, Liang; Chavda, Kalyan D; Mediavilla, José R; Jacobs, Michael R; Levi, Michael H; Bonomo, Robert A; Kreiswirth, Barry N

    2012-03-01

    We describe a novel Tn4401 variant (Tn4401d) in epidemic Klebsiella pneumoniae clone ST258, from which a partial bla(KPC) fragment has been excised along with ISKpn7 and a partial tnpA fragment. Nested-PCR experiments confirmed that this region can be removed from distinct Tn4401 isoforms in both K. pneumoniae and Escherichia coli. This study highlights that the region surrounding bla(KPC) is undergoing recombination and that Tn4401 itself is heterogeneous and highly plastic. PMID:22203593

  4. KPC-Producing, Multidrug-Resistant Klebsiella pneumoniae Sequence Type 258 as a Typical Opportunistic Pathogen

    PubMed Central

    Tzouvelekis, L. S.; Miriagou, V.; Kotsakis, S. D.; Spyridopoulou, K.; Athanasiou, E.; Karagouni, E.; Tzelepi, E.

    2013-01-01

    The virulence of a KPC-producing Klebsiella pneumoniae sequence type 258 (ST258) strain representing those circulating in Greece was assessed in a mouse septicemia model. The strain was virtually avirulent (50% lethal dose, >108 and 5 × 107 CFU for immunocompetent and neutropenic animals, respectively). Also, it was highly susceptible to serum killing, rapidly phagocytosed in vitro, and classified as K41, which is not among the virulent capsular types. The findings indirectly support the notion that high ST258-associated mortality is largely due to inefficient antimicrobial treatment. PMID:23856769

  5. Effect of various inducing agents on bacteriocin (klebocin) production by Klebsiella pneumoniae.

    PubMed

    Chhibber, S; Vadehra, D V

    1987-01-01

    The influence of various inducing agents on growth, synthesis and release of klebocin by Klebsiella pneumoniae was studied. A significant level of klebocin was detected only after induction. The highest level of klebocin was achieved with mitomycin C followed by rifampicin and polymyxin B. Chloramphenicol and UV irradiation did not show any effect on klebocin production. Maximum klebocin release occurred after 8 h of induction with all the agents. Concentration of mitomycin C did not show any significant effect on klebocin production. PMID:3108118

  6. KPC-Producing Klebsiella pneumoniae Strains That Harbor AAC(6?)-Ib Exhibit Intermediate Resistance to Amikacin

    PubMed Central

    Bremmer, Derek N.; Clancy, Cornelius J.; Press, Ellen G.; Almaghrabi, Reem; Chen, Liang; Doi, Yohei; Nguyen, M. Hong

    2014-01-01

    The aminoglycoside-modifying enzyme AAC(6?)-Ib is common among carbapenem-resistant Klebsiella pneumoniae (CR-Kp) strains. We investigated amikacin (AMK) activity against 20 AAC(6?)-Ib-producing CR-Kp strains. MICs clustered at 16 to 32 ?g/ml. By the time-kill study, AMK (1× and 4× the MIC) was bactericidal against 30% and 85% of the strains, respectively. At achievable human serum concentrations, however, the majority of strains showed regrowth, suggesting that AAC(6?)-Ib confers intermediate AMK resistance. AMK and trimethoprim-sulfamethoxazole (TMP-SMX) were synergistic against 90% of the strains, indicating that the combination may overcome resistance. PMID:25288089

  7. Complete genome sequence of endophytic nitrogen-fixing Klebsiella variicola strain DX120E

    PubMed Central

    2015-01-01

    Klebsiella variicola strain DX120E (=CGMCC 1.14935) is an endophytic nitrogen-fixing bacterium isolated from sugarcane crops grown in Guangxi, China and promotes sugarcane growth. Here we summarize the features of the strain DX120E and describe its complete genome sequence. The genome contains one circular chromosome and two plasmids, and contains 5,718,434 nucleotides with 57.1% GC content, 5,172 protein-coding genes, 25 rRNA genes, 87 tRNA genes, 7 ncRNA genes, 25 pseudo genes, and 2 CRISPR repeats.

  8. Infection of mice by aerosols of Klebsiella pneumoniae under hyperbaric conditions.

    PubMed Central

    Heckly, R J; Chatigny, M A; Dimmick, R L

    1980-01-01

    Both the physical behavior of aerosols and survival of airborne Serratia marcescens in hyperbaric chambers with a helium-air mixture at 20 atm of pressure was approximately the same as in the system at ambient pressures. Exposure of mice to aerosols of Klebsiella pneumoniae at 1-, 2-, and 17-atm (ca. 101-, 203-, and 1,722-kPa) pressures of helium-oxygen mixture showed that the number of viable organisms constituting a 50% lethal dose was not significantly affected by the hyperbaric conditions. Images PMID:6996616

  9. Immunoprotective activity of capsular polysaccharide in Klebsiella pneumoniae ribosomal preparations does not involve ribonucleic acid.

    PubMed Central

    Riottot, M M; Fournier, J M

    1981-01-01

    Two peaks were obtained by cesium chloride density gradient ultracentrifugation of Klebsiella pneumoniae ribosomal preparations. Peak I contained capsular polysaccharide, lipopolysaccharide, protein, and less than 0.5% ribonucleic acid. Peak II consisted mainly of ribonucleic acid, with low amounts of protein and capsular polysaccharide. Expressed as capsular polysaccharide content, the 50% protective dose of peak I and of nonfractionated ribosomal preparations was nearly constant (2.6 and 1.2 ng, respectively). Since peak I contained less than 0.5% ribonucleic acid, these results provide evidence that ribosomal ribonucleic acid is not required for protection of mice by K. pneumoniae capsular polysaccharide which contaminates ribosomal preparations. PMID:6170582

  10. Population Structure of KPC-Producing Klebsiella pneumoniae Isolates from Midwestern U.S. Hospitals

    PubMed Central

    Wright, Meredith S.; Perez, Federico; Brinkac, Lauren; Jacobs, Michael R.; Kaye, Keith; Cober, Eric; van Duin, David; Marshall, Steven H.; Hujer, Andrea M.; Rudin, Susan D.; Hujer, Kristine M.

    2014-01-01

    Genome sequencing of carbapenem-resistant Klebsiella pneumoniae isolates from regional U.S. hospitals was used to characterize strain diversity and the blaKPC genetic context. A phylogeny based on core single-nucleotide variants (SNVs) supports a division of sequence type 258 (ST258) into two distinct groups. The primary differences between the groups are in the capsular polysaccharide locus (cps) and their plasmid contents. A strict association between clade and KPC variant was found. The blaKPC gene was found on variants of two plasmid backbones. This study indicates that highly similar K. pneumoniae subpopulations coexist within the same hospitals over time. PMID:24913165

  11. Molecular characterization of newly emerged blaKPC-2-producing Klebsiella pneumoniae in Singapore.

    PubMed

    Balm, Michelle N D; Ngan, Grace; Jureen, Roland; Lin, Raymond T P; Teo, Jeanette

    2012-02-01

    In Asia, bla(KPC) detection has been limited to East Asia and not yet seen in Southeast Asia. We report four bla(KPC-2)-containing Klebsiella pneumoniae isolates from two different hospitals in Singapore. All isolates belonged to strain type 11 (ST11) and were indistinguishable by pulsed-field gel electrophoresis (PFGE). bla(KPC-2) was located on nonconjugative plasmids and flanked by mobile genetic structures composed of a partial Tn4401 transposon and a Tn3-based transposon which previously have been described only in Chinese isolates. PMID:22116160

  12. Outbreak of NDM-1-Producing Klebsiella pneumoniae in a Neonatal Unit in Colombia

    PubMed Central

    Olarte Escobar, Narda María; Castro-Cardozo, Betsy; Valderrama Márquez, Ismael Alberto; Garzón Aguilar, Martha Isabel; Martinez de la Barrera, Leslie; Barrero Barreto, Esther Rocio; Marquez-Ortiz, Ricaurte Alejandro; Moncada Guayazán, Maria Victoria; Vanegas Gómez, Natasha

    2013-01-01

    Six multiresistant, NDM-1-producing Klebsiella pneumoniae strains were recovered from an outbreak that affected six neonatal patients in a Colombian hospital. Molecular analysis showed that all of the isolates harbored the blaNDM-1, qnrA, and intI1 genes and were clonally related. Multilocus sequence typing showed that the isolates belonged to a new sequence type (ST1043) that was different from the sequence types that had previously been reported. This is the first report of NDM-1-producing isolates in South America. PMID:23357776

  13. Complete Nucleotide Sequence of Klebsiella pneumoniae Multiresistance Plasmid pJHCMW1

    Microsoft Academic Search

    Renee Sarno; Glen McGillivary; David J. Sherratt; Luis A. Actis; Marcelo E. Tolmasky

    2002-01-01

    The multiresistance plasmid pJHCMW1, harbored by a clinical Klebsiella pneumoniae strain isolated from a neonate with meningitis, was sequenced. A circular sequence of 11,354 bp was generated, of which 7,993 bp make up Tn1331, a transposon including the antibiotic resistance genes aac(6)-Ib, aadA1, blaOXA-9, and blaTEM-1. The gene aac(6)-Ib is included in a gene cassette, and both aadA1 and blaOXA-9

  14. Sexual isolation in bacteria

    Microsoft Academic Search

    Jacek Majewski

    2001-01-01

    Bacteria exchange genes rarely but are promiscuous in the choice of their genetic partners. Inter-specific recombination has the advantage of increasing genetic diversity and promoting dissemination of novel adaptations, but suffers from the negative effect of importing potentially harmful alleles from incompatible genomes. Bacterial species experience a degree of 'sexual isolation' from genetically divergent organisms ^ recombination occurs more frequently

  15. Aquatic Bacteria Samples

    USGS Multimedia Gallery

    On April 20, 2010, the BP Deepwater Horizon drilling platform collapsed and sank in the Gulf of Mexico, causing one of the largest oil spills in history. One of the big dilemmas in responding to the oil spil is how to clean up the oil itself. One way currently under research is to use bacteria that ...

  16. Three Activities: Bacteria Study, Micro Study, and Bacteria Killers

    NSDL National Science Digital Library

    This resource provides a problem-based activity on risk assessment of environmental health issues. The lesson consists of three related activities: Bacteria Study, Micro Study and Bacteria Killers. "Bacteria Study" gives students hands-on experience with the concepts of epidemiology. "Micro Study" has students sketch, observe, and compare different types of bacteria that can grow in moist conditions. "Bacteria Killers" has students determine what kills bateria, especially in common household products. Detailed instructions are provided for each activity. This resource is free to download. Users must first create a login with ATEEC's website to access the file.

  17. Neutrophil Extracellular Traps Kill Bacteria

    Microsoft Academic Search

    Volker Brinkmann; Ulrike Reichard; Christian Goosmann; Beatrix Fauler; Yvonne Uhlemann; David S. Weiss; Yvette Weinrauch; Arturo Zychlinsky

    2004-01-01

    Neutrophils engulf and kill bacteria when their antimicrobial granules fuse with the phagosome. Here, we describe that, upon activation, neutrophils release granule proteins and chromatin that together form extracellular fibers that bind Gram-positive and -negative bacteria. These neutrophil extracellular traps (NETs) degrade virulence factors and kill bacteria. NETs are abundant in vivo in experimental dysentery and spontaneous human appendicitis, two

  18. News and Research Good Bacteria

    E-print Network

    West, Stuart

    News and Research Good Bacteria Part 2 Article 13 Click here for Probiotics Basics Cooperation Is A No-brainer For Symbiotic Bacteria 9-4-2003 Humans may learn cooperation in kindergarten, but what about bacteria, whose behavior is preprogrammed by their DNA? Some legume plants, which rely

  19. Antibiofilm Peptides Increase the Susceptibility of Carbapenemase-Producing Klebsiella pneumoniae Clinical Isolates to ?-Lactam Antibiotics.

    PubMed

    Ribeiro, Suzana Meira; de la Fuente-Núñez, César; Baquir, Beverlie; Faria-Junior, Célio; Franco, Octávio L; Hancock, Robert E W

    2015-07-01

    Multidrug-resistant carbapenemase-producing Klebsiella pneumoniae (KpC) strains are becoming a common cause of infections in health care centers. Furthermore, Klebsiella can develop multicellular biofilms, which lead to elevated adaptive antibiotic resistance. Here, we describe the antimicrobial and antibiofilm activities of synthetic peptides DJK-5, DJK-6, and 1018 against five KpC isolates. Using static microplate assays, it was observed that the concentration required to prevent biofilm formation by these clinical isolates was below the MIC for planktonic cells. More-sophisticated flow cell experiments confirmed the antibiofilm activity of the peptides against 2-day-old biofilms of different KpC isolates, and in some cases, the peptides induced significant biofilm cell death. Clinically relevant combinations of DJK-6 and ?-lactam antibiotics, including the carbapenem meropenem, also prevented planktonic growth and biofilm formation of KpC strain1825971. Interestingly, peptide DJK-6 was able to enhance, at least 16-fold, the ability of meropenem to eradicate preformed biofilms formed by this strain. Using peptide DJK-6 to potentiate the activity of ?-lactams, including meropenem, represents a promising strategy to treat infections caused by KpC isolates. PMID:25896694

  20. The respiratory complex I (NDH I) from Klebsiella pneumoniae, a sodium pump.

    PubMed

    Gemperli, Anja C; Dimroth, Peter; Steuber, Julia

    2002-09-13

    The electrogenic NADH:Q oxidoreductase from the enterobacterium Klebsiella pneumoniae transports Na(+) ions. The complex was purified with an increase of the specific Na(+) transport activity from 0.2 micromol min(-1) mg(-1) in native membrane vesicles to 4.7 micromol min(-1) mg(-1) in reconstituted enzyme specimens. The subunit pattern resembled that of complex I from Escherichia coli, and two prominent polypeptides were identified as the NuoF and NuoG subunits of complex I. During purification the typical cofactors of complex I were enriched to yield approximately 17 nmol mg(-1) iron, 24 nmol mg(-1) acid-labile sulfide, and 0.79 nmol mg(-1) FMN in the purified sample. The enzyme contained approximately 1.2 nmol mg(-1) Q6 and 1.5 nmol mg(-1) Q8. The reduction of ubiquinone by NADH was Na(+)-dependent, which indicates coupling of the chemical and the vectorial reaction of the pump. The Na(+) activation profile corresponded to the Hill equation with a Hill coefficient K(H)(Na(+)) = 1.96 and with a half-maximal saturation at 0.33 mm Na(+). The reconstituted complex I from Klebsiella pneumoniae catalyzed deamino-NADH oxidation, Q1 reduction, and Na(+) translocation with specific activities of 2.6 units mg(-1), 2.4 units mg(-1), and 4.7 units mg(-1), respectively, which indicate a Na(+)/electron stoichiometry of one. PMID:12110677

  1. Effects of cadmium, copper, magnesium, and zinc on the decomposition of citrate by a Klebsiella sp.

    PubMed Central

    Brynhildsen, L; Rosswall, T

    1989-01-01

    The effects of Cd2+, Cu2+, Mg2+, and Zn2+ on the decomposition of citric acid by a Klebsiella sp. were studied by monitoring the degradation of [14C]citrate. The carbon concentration used was 10 micrograms of C liter-1, and the media were designed to provide at least 95% of the citrate complexed to the metal studied. After 72 h of incubation, 80% of the uncomplexed citric acid and 76% of the magnesium citrate had been decomposed. A marked inhibition was observed when Cd2+, Cu2+, or Zn2+ was bound to the organic anion; only 23% of the cadmium citrate, 14% of the zinc citrate, and 5% of the cuprous citrate had been decomposed. The effects were not the result of toxicity, since experiments run with [14C]glucose (nonchelating compound) instead of citrate resulted in similar decomposition rates regardless of the presence of the metal. To examine whether the binding of a metal to citrate enhanced its uptake by the Klebsiella sp., we studied the relative uptake of 65Zn in citrate- and in glucose-containing media. No such effect could be observed, with the uptake of Zn2+ being higher in the glucose-containing media. The study shows that metals may render low-molecular-weight organic acids, such as citric acid, resistant to bacterial degradation. This stresses the importance of metals in influencing microbial decomposition of organic compounds, not only as a result of toxicity. PMID:2764560

  2. Complete nucleotide sequence of Klebsiella phage P13 and prediction of an EPS depolymerase gene.

    PubMed

    Shang, Anqi; Liu, Yang; Wang, Jianlei; Mo, Zhaolan; Li, Guiyang; Mou, Haijin

    2015-02-01

    The complete genome of Klebsiella phage P13 was sequenced and analyzed. Bacteriophage P13 has a double-stranded linear DNA with a length of 45,976 bp and a G+C content of 51.7 %, which is slightly lower than that of Klebsiella pneumoniae KCTC 2242. The codon biases of phage P13 are very similar to those of SP6-like phages and K. pneumoniae KCTC 2242. Bioinformatics analysis shows that the phage P13 genome has 282 open reading frames (ORFs) that are greater than 100 bp in length, and 50 of these ORFs were identified as predicted genes with an average length of 833 bp. Among these genes, 41 show homology to known proteins in the GenBank database. The functions of the 24 putative proteins were investigated, and 13 of these were found to be highly conserved. According to the homology analysis of the 50 predicted genes and the whole genome, phage P13 is homologous to SP6-like phages. Furthermore, the morphological characteristics of phage P13 suggest that it belongs to the SP6-like viral genus of the Podoviridae subfamily Autographivirinae. Two hypothetical genes encoding an extracellular polysaccharide depolymerase were predicted using PSI-BLAST. This analysis serves as groundwork for further research and application of the enzyme. PMID:25392088

  3. In vitro antibacterial potency of Butea monosperma Lam. against 12 clinically isolated multidrug resistant bacteria

    PubMed Central

    Sahu, Mahesh Chandra; Padhy, Rabindra Nath

    2013-01-01

    Objective To investigate the antibacterial activity, using cold and hot extraction procedures with five solvents, petroleum ether, acetone, ethanol, methanol and water to validate medicinal uses of Butea monosperma Lam (B. monosperma) in controlling infections; and to qualitatively estimate phytochemical constituents of leaf-extracts of the plant. Methods The antibacterial activity of leaf-extracts was evaluated by the agar-well diffusion method against clinically isolated 12 Gram-positive and -negative multidrug resistant (MDR) pathogenic bacteria in vitro. Values of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of leaf-extracts against each bacterium were obtained in a 96-well micro-titre plate, by broth dilution micro-titre plate technique. Results The presence of tannins, flavonoids, starch, glycosides and carbohydrates in different leaf extracts was established. Pathogenic bacteria used were, Acinetobacter sp., Chromobacterium violaceum, Citrobacter freundii, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhi, Shigella sp., Enterococcus sp., Staphylococcus aureus (S. aureus), methicillin resistant S. aureus and vancomycin resistant S. aureus, along with standard bacterial strains. These MDR bacteria had been recorded to have significant inhibitions by leaf extracts, obtained by cold and hot extraction procedures with five solvents. In addition, the hot aqueous extract against Enterococcus sp. had the highest inhibition zone-size (21 mm). Ciprofloxacin 30 µg/disc was the positive/reference control and the diluting solvent, 10% dimethyl sulphoxide was the negative control. Recorded MIC values of different extracts ranged between 0.23 and 13.30 mg/mL, and MBC values were 0.52 to 30.00 mg/mL, for these bacteria. Conclusions Leaf-extracts with hot water and ethanol had shown significant antibacterial activity against all bacteria. B. monosperma leaf-extract could be used in treating infectious diseases, caused by the range of tested bacteria, as complementary and alternate medicine.

  4. Lipoprotein sorting in bacteria.

    PubMed

    Okuda, Suguru; Tokuda, Hajime

    2011-01-01

    Bacterial lipoproteins are synthesized as precursors in the cytoplasm and processed into mature forms on the cytoplasmic membrane. A lipid moiety attached to the N terminus anchors these proteins to the membrane surface. Many bacteria are predicted to express more than 100 lipoproteins, which play diverse functions on the cell surface. The Lol system, composed of five proteins, catalyzes the localization of Escherichia coli lipoproteins to the outer membrane. Some lipoproteins play vital roles in the sorting of other lipoproteins, lipopolysaccharides, and ?-barrel proteins to the outer membrane. On the basis of results from biochemical, genetic, and structural studies, we discuss the biogenesis of lipoproteins in bacteria, their importance in cellular functions, and the molecular mechanisms underlying efficient sorting of hydrophobic lipoproteins to the outer membrane through the hydrophilic periplasm. PMID:21663440

  5. Reanimation of Ancient Bacteria

    SciTech Connect

    Russell Vreeland

    2009-01-09

    Recent highly publicized experiments conducted on salt crystals taken from the Permian Salado Formation in Southeastern New Mexico have shown that some ancient crystals contain viable microorganisms trapped within fluid inclusions. Stringent geological and microbiological selection criteria were used to select crystals and conduct all sampling. This talk will focus on how each of these lines of data support the conclusion that such isolated bacteria are as old as the rock in which they are trapped. In this case, the isolated microbes are salt tolerant bacilli that grow best in media containing 8% NaCl, and respond to concentrated brines by forming spores. One of the organisms is phylogenetically related to several bacilli, but does have several unique characteristics. This talk will trace the interdisciplinary data and procedures supporting these discoveries, and describe the various isolated bacteria.

  6. Bacteria, food, and cancer

    PubMed Central

    Rooks, Michelle G.

    2011-01-01

    Gut microbes are essential components of the human organism—helping us metabolize food into energy, produce micronutrients, and shape our immune systems. Having a particular pattern of gut microbes is also increasingly being linked to medical conditions including obesity, inflammatory bowel disease, and diabetes. Recent studies now indicate that our resident intestinal bacteria may also play a critical role in determining one's risk of developing cancer, ranging from protection against cancer to promoting its initiation and progression. Gut bacteria are greatly influenced by diet and in this review we explore evidence that they may be the missing piece that explains how dietary intake influences cancer risk, and discuss possible prevention and treatment strategies. PMID:21876723

  7. Manufacture of Probiotic Bacteria

    NASA Astrophysics Data System (ADS)

    Muller, J. A.; Ross, R. P.; Fitzgerald, G. F.; Stanton, C.

    Lactic acid bacteria (LAB) have been used for many years as natural biopreservatives in fermented foods. A small group of LAB are also believed to have beneficial health effects on the host, so called probiotic bacteria. Probiotics have emerged from the niche industry from Asia into European and American markets. Functional foods are one of the fastest growing markets today, with estimated growth to 20 billion dollars worldwide by 2010 (GIA, 2008). The increasing demand for probiotics and the new food markets where probiotics are introduced, challenges the industry to produce high quantities of probiotic cultures in a viable and stable form. Dried concentrated probiotic cultures are the most convenient form for incorporation into functional foods, given the ease of storage, handling and transport, especially for shelf-stable functional products. This chapter will discuss various aspects of the challenges associated with the manufacturing of probiotic cultures.

  8. QUORUM SENSING IN BACTERIA

    Microsoft Academic Search

    Melissa B. Miller; Bonnie L. Bassler

    2001-01-01

    ? Abstract Quorum sensing is the regulation of gene expression in response to fluctuations in cell-population density. Quorum sensing bacteria produce and release chemical signal molecules called autoinducers that increase in concentration as a function of cell density. The detection of a minimal threshold stimulatory con- centration of an autoinducer leads to an alteration in gene expression. Gram-positive and Gram-negative

  9. Bacteria: More Than Pathogens

    NSDL National Science Digital Library

    Wassenaar, Trudy M.

    This ActionBioscience lesson plan has students explore the many roles of bacteria, harmful and beneficial. A detailed article written for ActionBioscience by a microbiologist provides background information, which is followed by discussion questions and educational activities designed for middle school to undergraduate biology courses. The Web site also provides carefully selected links for further exploring the topic, including useful sites for student research projects.

  10. Glacial Lake Hides Bacteria

    NSDL National Science Digital Library

    Peplow, Mark

    2010-03-01

    This article highlights the published work of a geomicrobiology research team led by Eric Gaidos from the University of Hawaii and Brian Lanoil, from the University of California, Riverside. This group reports the identification of bacteria from an Icelandic sub-glacial lake, and how the collection and description of these microorganisms immured within glacial ice and sub-surface water serve as a model in the search for extra-terrestrial life.

  11. Gram-Negative Bacteria

    Microsoft Academic Search

    Craig A. Martin

    \\u000a Gram-negative bacteria are responsible for a broad array of infections in both the ambulatory and hospital settings. Urinary\\u000a tract infections, otitis media, pneumonia, abdominal infections, and meningitis are among the common and serious diseases\\u000a caused by these pathogens. Beta-lactams including penicillins, cephalosporins, monobactams, and carbapenems, along with fluoroquinolones\\u000a and aminoglycosides, comprise the most commonly used treatment regimens for gram-negative infections.

  12. Bacteria in Confined Spaces

    NASA Astrophysics Data System (ADS)

    Wilking, Connie; Weitz, David

    2010-03-01

    Bacterial cells can display differentiation between several developmental pathways, from planktonic to matrix-producing, depending upon the colony conditions. We study the confinement of bacteria in hydrogels as well as in liquid-liquid double emulsion droplets and observe the growth and morphology of these colonies as a function of time and environment. Our results can give insight into the behavior of bacterial colonies in confined spaces that can have applications in the areas of food science, cosmetics, and medicine.

  13. Growing Unculturable Bacteria

    PubMed Central

    2012-01-01

    The bacteria that can be grown in the laboratory are only a small fraction of the total diversity that exists in nature. At all levels of bacterial phylogeny, uncultured clades that do not grow on standard media are playing critical roles in cycling carbon, nitrogen, and other elements, synthesizing novel natural products, and impacting the surrounding organisms and environment. While molecular techniques, such as metagenomic sequencing, can provide some information independent of our ability to culture these organisms, it is essentially impossible to learn new gene and pathway functions from pure sequence data. A true understanding of the physiology of these bacteria and their roles in ecology, host health, and natural product production requires their cultivation in the laboratory. Recent advances in growing these species include coculture with other bacteria, recreating the environment in the laboratory, and combining these approaches with microcultivation technology to increase throughput and access rare species. These studies are unraveling the molecular mechanisms of unculturability and are identifying growth factors that promote the growth of previously unculturable organisms. This minireview summarizes the recent discoveries in this area and discusses the potential future of the field. PMID:22661685

  14. The inhibitory effect of Zingiber corallinum Hance essential oil on drug-resistant bacteria and evaluation of its acute toxicity

    PubMed Central

    Yang, Ce; Zhou, Lin-Lin; Wang, Hai-Yan; Huang, Su-Na; Liu, Qing; Hu, Shi-Lin; Li, Ting-Rong; Chen, Yan-Bing; Jiang, Jian-Xin

    2011-01-01

    Summary Background The excessive and irregular use of antibiotics could result in the generation and diffusion of drug-resistant bacteria. The aim of this study was to investigate the inhibitory effect of Zingiber corallinum Hance essential oil (ZCHO) on drug-resistant bacteria, especially on drug-resistant Acinetobacter baumannii. Material/Methods Susceptibility testing was used to evaluate the effect of ZCHO on growth inhibition of drug-resistant bacteria by paper disk method. Mice orally administered with ZCHO were used to observe acute toxicity and to determine median lethal dose (LD50) of ZCHO. Broth dilution method was used to determine minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of ZCHO on drug-resistant Acinetobacter baumannii. Results ZCHO exhibited an obvious inhibitory effect not only on gram-negative drug-resistant bacteria including Escherichia coli, Klebsiella pneumoniae, Enterobacter cloacae and Acinetobacter baumannii, but also on gram-positive drug-resistant bacteria including Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus haemolyticus. The ZCHO containing 79% terpinen-4-ol revealed better bacteriostatic effect than ZCHO with 34% terpinen-4-ol. The LD50 of ZCHO was 1790.427 mg/kg. The MIC and MBC of ZCHO on drug-resistant Acinetobacter baumannii were 1457.81 mg/L. Conclusions ZCHO has obvious bacteriostasis and bactericidal effects, especially against drug-resistant Acinetobacter baumannii. Therefore, ZCHO is a promising natural bioactive component with antibacterial effect and satisfactory safety due to its low toxicity. PMID:21525802

  15. Molecular characterization of DHA-1-producing Klebsiella pneumoniae isolates collected during a 4-year period in an intensive care unit.

    PubMed

    Compain, Fabrice; Decré, Dominique; Fulgencio, Jean-Pierre; Berraho, Sfia; Arlet, Guillaume; Verdet, Charlotte

    2014-10-01

    Seventeen Klebsiella pneumoniae isolates producing DHA-1 ?-lactamase were collected in an intensive care unit between 2006 and 2010. Molecular analysis revealed the predominance of ST48 and ST1263 clones of K. pneumoniae and the spread of DHA-1-encoding plasmids belonging to incompatibility group IncL/M or IncHI2. PMID:25053201

  16. Genome Sequence of a Klebsiella pneumoniae Sequence Type 258 Isolate with Prophage-Encoded K. pneumoniae Carbapenemase.

    PubMed

    Chen, Liang; Chavda, Kalyan D; DeLeo, Frank R; Bryant, Kendall A; Jacobs, Michael R; Bonomo, Robert A; Kreiswirth, Barry N

    2015-01-01

    We present the draft genome sequence of a Klebsiella pneumoniae carbapenemase (KPC)-producing sequence type 258 (ST258) K. pneumoniae strain, ST258_FL. Uniquely, strain ST258_FL harbors two copies of the blaKPC gene on the chromosome, one of which is integrated into a prophage. PMID:26089425

  17. Genome Sequence of a Klebsiella pneumoniae Sequence Type 258 Isolate with Prophage-Encoded K. pneumoniae Carbapenemase

    PubMed Central

    Chen, Liang; Chavda, Kalyan D.; DeLeo, Frank R.; Bryant, Kendall A.; Jacobs, Michael R.; Bonomo, Robert A.

    2015-01-01

    We present the draft genome sequence of a Klebsiella pneumoniae carbapenemase (KPC)-producing sequence type 258 (ST258) K. pneumoniae strain, ST258_FL. Uniquely, strain ST258_FL harbors two copies of the blaKPC gene on the chromosome, one of which is integrated into a prophage.

  18. Complete Genome Sequence of a CTX-M-15-Producing Klebsiella pneumoniae Outbreak Strain from Multilocus Sequence Type 514

    PubMed Central

    Becker, Laura; Bunk, Boyke; Eller, Christoph; Steglich, Matthias; Pfeifer, Yvonne; Werner, Guido

    2015-01-01

    We report here the genome sequence of a multidrug-resistant Klebsiella pneumoniae strain, which caused an outbreak in a neonatal ward in 2011. The genome consists of a single chromosome (5,278 kb) and three plasmids (362 kb, 5 kb, and 4 kb). PMID:26159529

  19. Multiplex PCR for Detection of Seven Virulence Factors and K1/K2 Capsular Serotypes of Klebsiella pneumoniae

    PubMed Central

    Babosan, Ana; Brisse, Sylvain; Genel, Nathalie; Audo, Jennifer; Ailloud, Florent; Kassis-Chikhani, Najiby; Arlet, Guillaume; Decré, Dominique

    2014-01-01

    A single multiplex PCR assay targeting seven virulence factors and the wzi gene specific for the K1 and K2 capsular serotypes of Klebsiella pneumoniae was developed and tested on 65 clinical isolates, which included 45 isolates responsible for community-acquired severe human infections. The assay is useful for the surveillance of emerging highly virulent strains. PMID:25275000

  20. Genome Sequence of Klebsiella pneumoniae KpQ3, a DHA-1 ?-Lactamase-Producing Nosocomial Isolate

    PubMed Central

    Tobes, Raquel; Codoñer, Francisco M.; López-Camacho, Elena; Salanueva, Iñigo J.; Manrique, Marina; Brozynska, Marta; Gómez-Gil, Rosa; Martínez-Blanch, Juan F.; Álvarez-Tejado, Miguel; Pareja, Eduardo

    2013-01-01

    Klebsiella pneumoniae KpQ3 is a multidrug-resistant isolate obtained from a blood culture of a patient in a burn unit in the Hospital Universitario La Paz (Madrid, Spain) in 2008. The genome contains multiple antibiotic resistance genes, including a plasmid-mediated DHA-1 cephalosporinase gene. PMID:23469341

  1. Complete Genome Sequence of a Klebsiella pneumoniae Isolate with Chromosomally Encoded Carbapenem Resistance and Colibactin Synthesis Loci.

    PubMed

    Conlan, Sean; Deming, Clayton; Tsai, Yu-Chih; Lau, Anna F; Dekker, John P; Korlach, Jonas; Segre, Julia A

    2014-01-01

    Klebsiella pneumoniae is an important nosocomial pathogen, and multidrug-resistant strains have become a worldwide concern. Here, we report the complete genome of a K. pneumoniae isolate with chromosomally integrated blaKPC genes and a colibactin synthesis locus. PMID:25540345

  2. Characterization of GlaKP, a UDP-Galacturonic Acid C4Epimerase from Klebsiella pneumoniae with Extended Substrate Specificity

    Microsoft Academic Search

    Emilisa Frirdich; Chris Whitfield

    2005-01-01

    In Escherichia coli and Salmonella enterica, the core oligosaccharide backbone of the lipopolysaccharide is modified by phosphoryl groups. The negative charges provided by these residues are important in maintaining the barrier function of the outer membrane. In contrast, Klebsiella pneumoniae lacks phosphoryl groups in its core oligosaccharide but instead contains galacturonic acid residues that are proposed to serve a similar

  3. Complete genome sequence of Klebsiella pneumoniae subsp. pneumoniae HS11286, a multidrug-resistant strain isolated from human sputum.

    PubMed

    Liu, Pinglei; Li, Peng; Jiang, Xiaofei; Bi, Dexi; Xie, Yingzhou; Tai, Cui; Deng, Zixin; Rajakumar, Kumar; Ou, Hong-Yu

    2012-04-01

    Klebsiella pneumoniae is an important pathogen commonly associated with opportunistic infections. Here we report the genome sequence of a strain, HS11286, isolated from human sputum in 2011 in Shanghai, China. It contains one chromosome (5.3 Mb), three multidrug resistance plasmids (?110 kb), including a carbapenemase producer, and three small plasmids (?3 kb). PMID:22408243

  4. Cloning and organisation of some genes for nitrogen fixation from Azotobacter chroococcum and their expression in Klebsiella pneumoniae

    Microsoft Academic Search

    Robert Jones; Paul Woodley; Robert Robson

    1984-01-01

    By DNA hybridisation, restriction fragments of genomic DNA from Azotobacter chroococcum and A. vinelandii bearing sequences homologous to Klebsiella pneumoniae nitrogenase structural genes were detected. These were different in the two species and inconsistent with the arrangement of the homologous sequences as a contiguous cluster of unique genes. The use of a DNA probe specific for nifH showed that in

  5. Genome Sequencing and Comparative Analysis of Klebsiella pneumoniae NTUH-K2044, a Strain Causing Liver Abscess and Meningitis

    Microsoft Academic Search

    Keh-Ming Wu; Ling-Hui Li; Jing-Jou Yan; Nina Tsao; Tsai-Lien Liao; Hui-Chi Tsai; Hsiang-Ju Chen; Yen-Ming Liu; Jin-Tung Wang; Chi-Tai Fang; Shan-Chwen Chang; Hung-Yu Shu; Tze-Tze Liu; Ying-Tsong Chen; Yih-Ru Shiau; Tsai-Ling Lauderdale; Ih-Jen Su; Ralph Kirby; Shih-Feng Tsai

    2009-01-01

    Nosocomial infections caused by antibiotic-resistant Klebsiella pneumoniae are emerging as a major health problem worldwide, while community-acquired K. pneumoniae infections present with a range of diverse clinical pictures in different geographic areas. In particular, an invasive form of K. pneumoniae that causes liver abscesses was first observed in Asia and then was found worldwide. We are interested in how differences

  6. Role of metal ions in negative regulation of nitrogen fixation by the nifL gene product from Klebsiella pneumoniae

    Microsoft Academic Search

    N. Henderson; S. Austin; R. A. Dixon

    1989-01-01

    The ability of the Klebsiella pneumoniae nifL gene product to antagonise NIFA mediated transcriptional activation from the nifH promoter in vivo was inhibited either by metal deprivation, or by the presence of the iron chelators EDDA or Desferal in the growth medium. This inhibition of the repressive activity of NIFL was reversed by the addition of ferrous or manganous ions

  7. The physiological function of periplasmic glucose oxidation in phosphate-limited chemistat cultures of klebsiella pneumoniae NCTC 418

    Microsoft Academic Search

    Ed T. Buurman; Voorde ten G. H. J; M. J. Teixeira De Mattos

    1994-01-01

    Periplasmic oxidation of glucose into gluconate and 2-ketogluconate in Klebsiella pneumoniae occurs via glucose dehydrogenase (GDH) and gluconate dehydrogenase (GaDH), respectively. Since, as is shown here, in the presence of glucose, gluconate and 2-ketogluconate are not further metabolized intracellularly the physiological function of this periplasmic route was studied. It was found that periplasmic oxidation of glucose could function as an

  8. Living bacteria in silica gels

    NASA Astrophysics Data System (ADS)

    Nassif, Nadine; Bouvet, Odile; Noelle Rager, Marie; Roux, Cécile; Coradin, Thibaud; Livage, Jacques

    2002-09-01

    The encapsulation of enzymes within silica gels has been extensively studied during the past decade for the design of biosensors and bioreactors. Yeast spores and bacteria have also been recently immobilized within silica gels where they retain their enzymatic activity, but the problem of the long-term viability of whole cells in an inorganic matrix has never been fully addressed. It is a real challenge for the development of sol-gel processes. Generic tests have been performed to check the viability of Escherichia coli bacteria in silica gels. Surprisingly, more bacteria remain culturable in the gel than in an aqueous suspension. The metabolic activity of the bacteria towards glycolysis decreases slowly, but half of the bacteria are still viable after one month. When confined within a mineral environment, bacteria do not form colonies. The exchange of chemical signals between isolated bacteria rather than aggregates can then be studied, a point that could be very important for 'quorum sensing'.

  9. KPC-mediated resistance in Klebsiella pneumoniae in two hospitals in Padua, Italy, June 2009-December 2011: massive spreading of a KPC-3-encoding plasmid and involvement of non-intensive care units

    PubMed Central

    2012-01-01

    Background Klebsiella pneumoniae carbapenemases (KPCs) producing bacteria have emerged as a cause of multidrug-resistant nosocomial infections worldwide. KPCs are plasmid-encoded enzymes capable of hydrolysing a broad spectrum of beta-lactams, including carbapenems and monobactams, therefore worryingly limiting antimicrobial treatment options. Analysis of circulating bacterial strains and KPC alleles may help understanding the route of KPC dissemination and therefore help containing the infection. Methods KPC-producing Klebsiella pneumoniae dissemination in two 1580- and 300- bed hospitals in Padua, Italy, from initial outbreak in 2009 to late 2011 was analysed. Molecular and clinical epidemiology, including bacterial strains, KPC-encoding plasmid sequences and associated resistance genes, involved hospital wards and relocation of patients were described. Routine antimicrobial susceptibility testing and MIC of carbapenems on clinical isolates were performed. Detection of resistance genes was obtained by PCR and sequencing. MLST, PFGE and ERIC were used for molecular genotyping. Plasmid analysis was obtained by digestion with restriction enzymes and deep sequencing. Results KPC-positive clinical samples were isolated from nearly 200 patients. In the initial outbreak intensive care units were almost exclusively involved, while medical, surgical and long-term wards were successively massively concerned. Analysis of KPC alleles, plasmids and bacterial sequence types (STs) indicated that during the initial outbreak KPC-3 in ST258 and KPC-2 in ST147 were each confined in one of the two surveilled hospitals. While KPC-2 dissemination was effectively contained, KPC-3 in ST258 cross-spreading was observed. The simultaneous presence of two carbapenemases, VIM-1 and KPC-2, in the same isolate was also observed in three patients. Total sequencing of plasmid content of two KPC-3 strains showed novel association of resistance plasmids. Conclusions The acquired molecular epidemiology demonstrated that 1) both acquisitions from outward sources and patient relocation within the hospitals were responsible for the observed spreading; 2) KPC-3-encoding Klebsiella pneumoniae ST258 prevailed over other strains. In addition, the described massive transfer of KPC-mediated resistance to non-intensive care units may anticipate spreading of resistance to the non-hospitalized population. Therefore, genotypic analysis alongside phenotypic identification of carbapenemase producers, also at the carriage state, is advisable to prevent and contain further carbapenemase resistance dissemination. PMID:22800501

  10. [Surveillance report of drug-resistant bacteria from 2007 to 2012 in Saga Prefecture, Japan (the second report)].

    PubMed

    Kiyosuke, Makiko; Nagasawa, Zenzo; Hotta, Taeko; Utsumi, Takashi; Kang, Dongchon; Miyamoto, Hiroshi

    2014-06-01

    Drug-resistant bacteria are a problematic issue in Japan. Surveillance of drug-resistant bacteria is important because the frequency of isolation and kinds of such bacteria vary between hospitals and local areas. This study summarizes the results of detection of drug-resistant bacteria in Saga Prefecture from July 2007 to June 2012. Data presented in this study were collected through questionnaire survey that was conducted in 12 hospitals. Frequency of drug-resistant bacteria are as follows: 62.5% of Staphylococcus aureus was methicillin-resistant S. aureus (MRSA); 62.2% of Streptococcus pneumoniae was penicillin-intermediate S. pneumoniae (PISP) or penicillin-resistant S. pneumoniae (PRSP); 26.4% of Haemophilus influenzae was beta-lactamase negative ampicillin-resistant H. influenzae (BLNAR); 0.5% of Pseudomonas aeruginosa was metallo-beta-lactamase (MBL) P. aeruginosa; 0.5% of P. aeruginosa was multi-drug resistant P. aeruginosa (MDRP); 12.9% and 5.1% of Escherichia coli and Klebsiella pneumoniae, respectively, were extended-spectrum beta-lactamase (ESBL) producing organisms. While the isolation frequencies of MRSA and PISP/PRSP were unchanged, those of BLNAR, ESBL producing E. coli and ESBL producing K. pneumoniae raised from 15.4% to 34.2%, from 5.7% to 18.4% and from 2.6% to 8.2%, respectively, over the past 5 years. The frequencies of isolation of MDRP and two drug resistant P. aeruginosa declined. This study revealed that the overall trend in the long-term changes of isolation frequency of drug-resistant bacteria in Saga Prefecture is similar to the trend in the national data. It also showed that the frequency and kinds of drug-resistant bacteria are variable between hospitals and local areas. Further study, such as examination of the usage and MIC value of antimicrobial drugs, will enable us to gain more detailed information on the drug-resistant bacteria. PMID:25151773

  11. Relationship between Antimicrobial Consumption and the Incidence of Antimicrobial Resistance in Escherichia coli and Klebsiella pneumoniae Isolates

    PubMed Central

    Joseph, Noyal Mariya; Shewade, Deepak Gopal; Harish, Belgode Narasimha

    2015-01-01

    Introduction: Gram negative organisms are one of the major causes of nosocomial diseases. Development of resistance to antibiotics by these organisms increases their risk in clinical treatment of patients. It also affects morbidity and mortality hence needs to be monitored and controlled. Aim: The aim of the present study was to analyse the correlation between consumption of parenteral antibiotics and the rates of antimicrobial resistance among the Escherichia coli and Klebsiella pneumoniae isolates collected during Dec 2010 - Jun 2013 from JIPMER hospital. Materials and Methods: Consumption data of parenteral antibiotics in J01 category of Anatomical Therapeutic Chemical (ATC) in JIPMER was obtained and expressed in Defined Daily Doses (DDD) per 1000 inhabitants. Valid consumption and resistance data during the period Dec 2010 to Jun 2013 were obtained at 6 month intervals and were correlated to draw a relationship between antimicrobial consumption and its impact on drug resistance for Escherichia coli and Klebsiella pneumoniae. Results: Escherichia coli isolates showed high resistance for increased use of gentamycin and ciprofloxacin. Increase in antibiotic consumption increases the resistance for Escherichia coli except for amikacin. Among the Klebsiella isolates, meropenem and gentamycin showed high correlations followed by ceftazidime, amikacin, ceftriaxone and ciprofloxacin. Conclusion: In summary, a statistically significant association was noticed between consumption of the studied antimicrobials and resistance of Escherichia coli isolates, except for amikacin and ceftazidime. In the case of Klebsiella pneumoniae, there was a statistically significant association between the resistance rates and consumption of gentamycin, ceftazidime and meropenem. Further, a linear relationship was noted between antimicrobial consumption and resistant isolates of Escherichia coli and Klebsiella pneumoniae, except for Escherichia coli resistance to amikacin. PMID:25859453

  12. Effect of low-dose gaseous ozone on pathogenic bacteria

    PubMed Central

    2012-01-01

    Background Treatment of chronically infected wounds is a challenge, and bacterial environmental contamination is a growing issue in infection control. Ozone may have a role in these situations. The objective of this study was to determine whether a low dose of gaseous ozone/oxygen mixture eliminates pathogenic bacteria cultivated in Petri dishes. Methods A pilot study with 6 bacterial strains was made using different concentrations of ozone in an ozone-oxygen mixture to determine a minimally effective dose that completely eliminated bacterial growth. The small and apparently bactericidal gaseous dose of 20 ?g/mL ozone/oxygen (1:99) mixture, applied for 5min under atmospheric pressure was selected. In the 2nd phase, eight bacterial strains with well characterized resistance patterns were evaluated in vitro using agar-blood in adapted Petri dishes (105 bacteria/dish). The cultures were divided into 3 groups: 1- ozone-oxygen gaseous mixture containing 20 ?g of O3/mL for 5 min; 2- 100% oxygen for 5 min; 3- baseline: no gas was used. Results The selected ozone dose was applied to the following eight strains: Escherichia coli, oxacillin-resistant Staphylococcus aureus, oxacillin-susceptible Staphylococcus aureus, vancomycin-resistant Enterococcus faecalis, extended-spectrum beta-lactamase-producing Klebsiella pneumoniae, carbapenem-resistant Acinetobacter baumannii, Acinetobacter baumannii susceptible only to carbapenems, and Pseudomonas aeruginosa susceptible to imipenem and meropenem. All isolates were completely inhibited by the ozone-oxygen mixture while growth occurred in the other 2 groups. Conclusion A single topical application by nebulization of a low ozone dose completely inhibited the growth of all potentially pathogenic bacterial strains with known resistance to antimicrobial agents. PMID:23249441

  13. IN VITRO ANTIBACTERIAL ACTIVITY OF CLOVE AGAINST GRAM NEGATIVE BACTERIA

    Microsoft Academic Search

    SABAHAT SAEED; PERWEEN TARIQ

    A study was carried out to investigate the potential of using aqueous infusion, decoction and essential oil of clove (Syzygium aromaticum) as natural antibacterial agents against 100 isolates belonging to 10 different species of Gram -ve bacilli viz., Escherichia coli (36), Proteus mirabilis (6), Pseudomonas aeruginosa (10), Enterobacter aerogenes (5), Klebsiella ozaenae (2), Klebsiella pneumoniae (24), Serratia marcescens (4), Salmonella

  14. Atomic Force Microscopy Reveals the Mechanobiology of Lytic Peptide Action on Bacteria.

    PubMed

    Mularski, Anna; Wilksch, Jonathan J; Wang, Huabin; Hossain, Mohammed Akhter; Wade, John D; Separovic, Frances; Strugnell, Richard A; Gee, Michelle L

    2015-06-01

    Increasing rates of antimicrobial-resistant medically important bacteria require the development of new, effective therapeutics, of which antimicrobial peptides (AMPs) are among the promising candidates. Many AMPs are membrane-active, but their mode of action in killing bacteria or in inhibiting their growth remains elusive. This study used atomic force microscopy (AFM) to probe the mechanobiology of a model AMP (a derivative of melittin) on living Klebsiella pneumoniae bacterial cells. We performed in situ biophysical measurements to understand how the melittin peptide modulates various biophysical behaviors of individual bacteria, including the turgor pressure, cell wall elasticity, and bacterial capsule thickness and organization. Exposure of K. pneumoniae to the peptide had a significant effect on the turgor pressure and Young's modulus of the cell wall. The turgor pressure increased upon peptide addition followed by a later decrease, suggesting that cell lysis occurred and pressure was lost through destruction of the cell envelope. The Young's modulus also increased, indicating that interaction with the peptide increased the rigidity of the cell wall. The bacterial capsule did not prevent cell lysis by the peptide, and surprisingly, the capsule appeared unaffected by exposure to the peptide, as capsule thickness and inferred organization were within the control limits, determined by mechanical measurements. These data show that AFM measurements may provide valuable insights into the physical events that precede bacterial lysis by AMPs. PMID:25978768

  15. Distribution and Persistence of Staphylococcus and Micrococcus Species and Other Aerobic Bacteria on Human Skin1

    PubMed Central

    Kloos, Wesley E.; Musselwhite, Margaret S.

    1975-01-01

    The distribution of Staphylococcus and Micrococcus species and associated coryneform bacteria, Acinetobacter, Klebsiella, Enterobacter, Bacillus, and Streptomyces on skin was determined during October 1971 from samples collected on persons living in North Carolina and New Jersey. Persistence of these organisms on skin was estimated in temporal studies conducted during the period from June 1971 to June 1972 on persons living in North Carolina. Staphylococci and coryneforms were the most predominant and persistent bacteria isolated from the nares and axillae. Staphylococci, coryneforms, micrococci, and Bacillus were the most predominant and persistent bacteria isolated from the head, legs, and arms. Acinetobacters were most frequently isolated during the warmer months of the years. Staphylococcus aureus and S. epidermidis were the most predominant and persistent staphylococci isolated from the nares, whereas S. epidermidis and S. hominis were the most predominant and persistent staphylococci isolated from the axillae, head, legs, and arms. S. capitis was often isolated from the head and arms and S. haemolyticus was often isolated from the head, legs, and arms. S. simulans, S. xylosus, S. cohnii, S. saprophyticus, S. warneri, and an unclassified coagulase-positive species were only occasionally isolated from skin. Micrococcus luteus was the most predominant and persistent Micrococcus isolated from skin and preferred regions of the head, legs, and arms. M. varians was the second most frequent Micrococcus isolated. M. lylae, M. sedentarius, M. roseus, M. kristinae, and M. nishinomiyaensis were only occasionally isolated from skin. M. lylae was most frequently isolated during the colder months of the years. PMID:810086

  16. Vapor-induced transfer of bacteria in the absence of mechanical disturbances.

    PubMed

    Ayoub, G M; Dahdah, L; Alameddine, I; Malaeb, L

    2014-09-15

    Transfer of bacteria through water vapor generated at moderate temperatures (30-50°C) in passive solar stills, has scarcely been reported. The objective of this research was to investigate whether bacteria in highly humid atmospheres can get transferred through water vapor in the absence of other transfer media to find their way to the distillate. To achieve this objective, passive solar reactors were chosen as the medium for experimentation, and distillation experiments were conducted by spiking a pure bacterial culture (Escherichia coli, Klebsiella pneumonia or Enterococcus faecalis) in low mineralized water vs. highly mineralized water in the dark under moderate temperatures ranges (30-35°C, 40-45°C and 50-55°C). Results showed that bacteria indeed get transferred with the vapor in stills when not exposed to solar U.V. radiation. The trends observed were adequately explained by a zero-modified Hurdle-Poisson model. The numbers of cultivable bacterial colonies transferred were bacterial size, water type and temperature dependent with highest transfers occurring in E. faecalis>E. coli>K. pneumonia at the 40°C range in low mineralized water. Proper management strategies are recommended to achieve complete disinfection in solar stills. PMID:25169809

  17. Molecular phylogenetic profiling of gut-associated bacteria in larvae and adults of flesh flies.

    PubMed

    Gupta, A K; Rastogi, G; Nayduch, D; Sawant, S S; Bhonde, R R; Shouche, Y S

    2014-12-01

    Flesh flies of the genus Sarcophaga (Diptera: Sarcophagidae) are carrion-breeding, necrophagous insects important in medical and veterinary entomology as potential transmitters of pathogens to humans and animals. Our aim was to analyse the diversity of gut-associated bacteria in wild-caught larvae and adult flesh flies using culture-dependent and culture-independent methods. Analysis of 16S rRNA gene sequences from cultured isolates and clone libraries revealed bacteria affiliated to Proteobacteria, Actinobacteria, Firmicutes and Bacteroidetes in the guts of larval and adult flesh flies. Bacteria cultured from larval and adult flesh fly guts belonged to the genera Acinetobacter, Bacillus, Budvicia, Citrobacter, Dermacoccus, Enterococcus, Ignatzschineria, Lysinibacillus, Myroides, Pasteurella, Proteus, Providencia and Staphylococcus. Phylogenetic analysis showed clone sequences of the genera Aeromonas, Bacillus, Bradyrhizobium, Citrobacter, Clostridium, Corynebacterium, Ignatzschineria, Klebsiella, Pantoea, Propionibacterium, Proteus, Providencia, Serratia, Sporosarcina, Weissella and Wohlfahrtiimonas. Species of clinically significant genera such as Ignatzschineria and Wohlfahrtiimonas spp. were detected in both larvae and adult flesh flies. Sequence analysis of 16S rRNA gene libraries supported culture-based results and revealed the presence of additional bacterial taxa. This study determined the diversity of gut microbiota in flesh flies, which will bolster the ability to assess microbiological risk associated with the presence of these flies. The present data thereby establish a platform for a much larger study. PMID:24805263

  18. Isolation of Extended Spectrum ?-lactamase (ESBL) Producing Bacteria from Urban Surface Waters in Malaysia

    PubMed Central

    Tissera, Shehani; Lee, Sui Mae

    2013-01-01

    Background: This was a preliminary study to test for the presence of multiple antibiotic-resistant extended spectrum ?-lactamase (ESBL) producing bacteria in Malaysian urban surface waters. Although the literature review revealed several published papers on clinical ESBL isolates in Malaysia, none were found on ESBL isolates obtained from local surface waters Methods: Isolated bacterial species were tested for resistance to cefotaxime, amoxicillin/clavulanate and aztreonam, and susceptibility to imipenem and meropenem using antibiotic susceptibility testing (AST) by disc diffusion. This served as a screening step to detect bacteria that could be potential ESBL species. 16S ribose ribonucleic acid (rRNA) polymerase chain reaction (PCR) testing with two clusters of bla (?-lactamase) gene primers was used to test for the bla genes CTX-M (Groups 1, 2, 9), OXA-1, SHV and TEM. Results: A total of 19 isolates were found, possessing at least one of the bla genes tested for. There was a relatively high occurrence of CTX-M genes (84.2%) among these, followed by TEM genes (47.4%). The isolates were identified as Enterobacteriaceae (89.5%), predominantly Escherichia coli and Klebsiella pneumoniae. Conclusion: There appears to be a high occurrence of ESBL-bacteria in local surface waters, among these being opportunistic pathogens. The persistence and spread of these species in the environment poses a threat to exposed human populations. PMID:23966820

  19. Activating transcription in bacteria.

    PubMed

    Lee, David J; Minchin, Stephen D; Busby, Stephen J W

    2012-01-01

    Bacteria use a variety of mechanisms to direct RNA polymerase to specific promoters in order to activate transcription in response to growth signals or environmental cues. Activation can be due to factors that interact at specific promoters, thereby increasing transcription directed by these promoters. We examine the range of architectures found at activator-dependent promoters and outline the mechanisms by which input from different factors is integrated. Alternatively, activation can be due to factors that interact with RNA polymerase and change its preferences for target promoters. We summarize the different mechanistic options for activation that are focused directly on RNA polymerase. PMID:22726217

  20. Magnetosomes in Magnetotactic Bacteria

    Microsoft Academic Search

    André Scheffel; Dirk Schüler

    The ability of magnetotactic bacteria (MTB) to orient and migrate along magnetic field lines is based\\u000a on magnetosomes, which are membrane-enclosed intracellular crystals of a magnetic iron mineral. The\\u000a biomineralization of magnetosomes is a process with genetic control over the accumulation of iron,\\u000a the deposition of the magnetic crystal within a specific compartment, as well as their intracellular\\u000a assembly and alignment into chain-like

  1. Glycerol fermentation in Klebsiella pneumoniae: functions of the coenzyme B12-dependent glycerol and diol dehydratases.

    PubMed Central

    Forage, R G; Foster, M A

    1982-01-01

    Glycerol and diol dehydratases are inducible, coenzyme B12-dependent enzymes found together in Klebsiella pneumoniae ATCC 25955 during anaerobic growth on glycerol. Mutants of this strain isolated by a novel procedure were separately constitutive for either dehydratase, showing the structural genes for the two enzymes to be under independent control in vivo. Glycerol dehydratase and a trimethylene glycol dehydrogenase were implicated as members of a pleiotropic control system that includes glycerol dehydrogenase and dihydroxyacetone kinase for the anaerobic dissimilation of glycerol (the "dha system"). The dehydratase and dehydrogenases were induced by dihydroxyacetone and were jointly constitutive in mutants isolated as constitutive for either the dha system or glycerol dehydratase. These data and the stimulation of growth by Co2+ suggested that glycerol dehydratase and trimethylene glycol dehydrogenase are obligatory enzymes for anaerobic growth on glycerol as the sole carbon source. Images PMID:7035429

  2. Cloning and sequencing of the Klebsiella K-36 astA gene, encoding an arylsulfate sulfotransferase.

    PubMed

    Baek, M C; Kim, S K; Kim, D H; Kim, B K; Choi, E C

    1996-01-01

    A gene-encoding arylsulfate sulfotransferase (ASST) was cloned from a Klebsiella K-36 genomic library. ASST transfers a sulfate group from phenolic sulfate esters to a phenolic acceptor substrate. The gene, designated astA, was subcloned into vector pGEM3Zf(-) and sequenced. Recombinant clone-harbouring astA was directly identified using a fluorescent product. The nucleotide sequencing revealed an open reading frame (ORF) of 2,082 bp encoding a protein of 694 amino acids with a secretory signal sequence. A protein of similar size was visualized after in vitro transcription and translation using a plasmid carrying the cloned 3.1-kb fragment as a template. The N-terminal amino acid sequence of the purified processed protein was found to be identical to that predicted from the gene sequence. When searching the database for astA nucleotide or its deduced amino acid sequence, no significant homology to any sequence was found. PMID:8887346

  3. Klebsiella pneumoniae harbouring OXA-48 carbapenemase in a Libyan refugee in Italy.

    PubMed

    Kocsis, E; Savio, C; Piccoli, M; Cornaglia, G; Mazzariol, A

    2013-09-01

    A carbapenem-resistant Klebsiella pneumoniae was isolated from a blood-culture of an inpatient from Libya, hospitalized in the intensive-care unit of Negrar Hospital, Italy. The clinical isolate carried the following ?-lactamase genes, bla(TEM -1), bla(SHV -11), bla(OXA -1), bla(CTX -M-15) and bla(OXA -48), respectively. The bla(OXA -48) gene was inserted in the Tn1999.2 transposon type, carried on a conjugative, 60-kilobase plasmid, that presented an L/M backbone, hosted by a multidrug-resistant ST 101 K. pneumoniae strain. Our report highlights the international transfer of bla(OXA -48) gene and the importance of screening measures of multidrug-resistant Enterobacteriaceae. PMID:23659538

  4. Structural and kinetic insights into the mechanism of 5-hydroxyisourate hydrolase from Klebsiella pneumoniae

    SciTech Connect

    French, Jarrod B.; Ealick, Steven E. (Cornell)

    2011-07-19

    The stereospecific oxidative degradation of uric acid to (S)-allantoin has recently been demonstrated to proceed via two unstable intermediates and requires three separate enzymatic reactions. The second step of this reaction, the conversion of 5-hydroxyisourate (HIU) to 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline, is catalyzed by HIU hydrolase (HIUH). The high-resolution crystal structure of HIUH from the opportunistic pathogen Klebsiella pneumoniae (KpHIUH) has been determined. KpHIUH is a homotetrameric protein that, based on sequence and structural similarity, belongs to the transthyretin-related protein family. In addition, the steady-state kinetic parameters for this enzyme and four active-site mutants have been measured. These data provide valuable insight into the functional roles of the active-site residues. Based upon the structural and kinetic data, a mechanism is proposed for the KpHIUH-catalyzed reaction.

  5. Structural and kinetic insights into the mechanism of 5-hydroxyisourate hydrolase from Klebsiella pneumoniae

    PubMed Central

    French, Jarrod B.; Ealick, Steven E.

    2011-01-01

    The stereospecific oxidative degradation of uric acid to (S)-­allantoin has recently been demonstrated to proceed via two unstable intermediates and requires three separate enzymatic reactions. The second step of this reaction, the conversion of 5-­hydroxyisourate (HIU) to 2-oxo-4-hydroxy-4-­carboxy-5-ureidoimidazoline, is catalyzed by HIU hydrolase (HIUH). The high-resolution crystal structure of HIUH from the opportunistic pathogen Klebsiella pneumoniae (KpHIUH) has been determined. KpHIUH is a homotetrameric protein that, based on sequence and structural similarity, belongs to the transthyretin-related protein family. In addition, the steady-state kinetic parameters for this enzyme and four active-site mutants have been measured. These data provide valuable insight into the functional roles of the active-site residues. Based upon the structural and kinetic data, a mechanism is proposed for the KpHIUH-catalyzed reaction. PMID:21795808

  6. Multiclonal epidemic of Klebsiella pneumoniae isolates producing DHA-1 in a Spanish hospital.

    PubMed

    Diestra, K; Miró, E; Martí, C; Navarro, D; Cuquet, J; Coll, P; Navarro, F

    2011-07-01

    Between June 2007 and January 2008, 26 Klebsiella pneumoniae isolates carrying bla(DHA-1) on an IncL/M plasmid were obtained from clinical samples at Granollers Hospital, Barcelona, Spain. Three of the isolates also carried a bla(CTX-M-15) gene. The 26 isolates showed 11 pulsed-field gel electrophoresis (PFGE) patterns. Multilocus sequence typing showed that PFGE patterns A, B and C belonged to sequence type (ST)17, D to ST13, E to ST427, F and G to ST416, H to ST37, I to ST440, J to ST326, and K to ST428. Results demonstrated the effectiveness of the infection control programme in place at the centre. This study reports the first characterization of STs for bla(DHA-1) -producing K. pneumoniae isolates. PMID:20673270

  7. Glucosyltransferase production by Klebsiella sp. K18 and conversion of sucrose to palatinose using immobilized cells

    PubMed Central

    Orsi, Daniela C.; Kawaguti, Haroldo Y.; Sato, Hélia H.

    2009-01-01

    The strain Klebsiella sp. K18 produces the enzyme glucosyltransferase and catalyses the conversion of sucrose to palatinose, an alternative sugar that presents low cariogenicity. Response Surface Methodology was successfully employed to determine the optimal concentration of culture medium components. Maximum glucosyltransferase production (21.78 U mL-1) was achieved using the optimized medium composed by sugar cane molasses (80 g L-1), bacteriological peptone (7 g L-1) and yeast extract (20 g L-1), after 8 hours of fermentation at 28°C. The conversion of sucrose to palatinose was studied utilizing immobilized cells in calcium alginate. The effects of the alginate concentration (2-4%), cell mass concentration (20-40%) and substrate concentration (25-45%) were evaluated and the yield of palatinose was approximately 62.5%. PMID:24031319

  8. IMP-Producing Carbapenem-Resistant Klebsiella pneumoniae in the United States ?

    PubMed Central

    Limbago, Brandi M.; Rasheed, J. Kamile; Anderson, Karen F.; Zhu, Wenming; Kitchel, Brandon; Watz, Nancy; Munro, Susan; Gans, Hayley; Banaei, Niaz; Kallen, Alex J.

    2011-01-01

    The emergence and spread of carbapenem-resistant Enterobacteriaceae (CRE) producing acquired carbapenemases have created a global public health crisis. In the United States, CRE producing the Klebsiella pneumoniae carbapenemase (KPC) are increasingly common and are endemic in some regions. Metallo-?-lactamase (MBL)-producing CRE have recently been reported in the United States among patients who received medical care in countries where such organisms are common. Here, we describe three carbapenem-resistant K. pneumoniae isolates recovered from pediatric patients at a single U.S. health care facility, none of whom had a history of international travel. The isolates were resistant to carbapenems but susceptible to aztreonam, trimethoprim-sulfamethoxazole, and fluoroquinolones. The three isolates were closely related to each other by pulsed-field gel electrophoresis and contained a common plasmid. PCR and sequence analysis confirmed that these isolates produce IMP-4, an MBL carbapenemase not previously published as present among Enterobacteriaceae in the United States. PMID:21998425

  9. Clinical and bacteriological efficacy of amikacin in the treatment of lower urinary tract infection caused by extended-spectrum beta-lactamase-producing Escherichia coli or Klebsiella pneumoniae.

    PubMed

    Ipekci, Tumay; Seyman, Derya; Berk, Hande; Celik, Orcun

    2014-12-01

    Urinary tract infections (UTIs) caused by extended-spectrum beta-lactamase (ESBL)-producing bacteria have become a growing problem limiting therapeutic options. The aim of this study was to investigate the clinical and microbiological efficacy of amikacin treatment in adult patients with lower UTIs due to ESBL-producing Escherichia coli (Ec) or Klebsiella pneumonia (Kp). We conducted a retrospective study of 36 outpatients aged >18 years with dysuria or problems with frequency or urgency in passing urine; pyuria and a positive urine culture (10(5) cfu/ml) for ESBL producing Ec or Kp which is also resistant to nitrofurantoin, fosfomycin, quinolones and trimethoprim/sulfamethoxazole, between January 2013 and February 2014. Patients received intramuscular amikacin 15 mg/kg/day for 10 days. Clinical success was defined as disappearance of symptoms. Bacteriological success was defined as sterile control urine cultures. 58.3% of patients were female. Age range was 18-89 years. All of the patients had at least one complicating factor. 77.8% of the isolates were E. coli. Clinical success rate was 97.2%. Overall bacteriological success rates were 91.7% on the 3 day of treatment, 97.1% at the end of the treatment and 94.1% on the 7-10 days after treatment. After 28-32 days following the treatment, reinfection was found in 12% whereas relapse was not determined. Nephrotoxicity was developed in one patient. The clinicians should keep in mind that amikacin treatment is an efficient and safe alternative treatment option before the carbapenem treatment especially in patients with lower UTIs caused by ESBL-producing Ec or Kp that are resistant to all oral antibiotics. PMID:25179392

  10. Detection and Molecular Characterization of Escherichia coli CTX-M-15 and Klebsiella pneumoniae SHV-12 ?-Lactamases from Bovine Mastitis Isolates in the United Kingdom

    PubMed Central

    Maciuca, Iuliana E.; Evans, Nicholas J.; Williams, Helen; Wattret, Andrew; Fick, Jenny C.; Williams, Nicola J.

    2014-01-01

    Recent reports raised concerns about the role that farm stock may play in the dissemination of extended-spectrum ?-lactamase (ESBL)-producing bacteria. This study characterized the ESBLs in two Escherichia coli and three Klebsiella pneumoniae subsp. pneumoniae isolates from cases of clinical bovine mastitis in the United Kingdom. Bacterial culture and sensitivity testing of bovine mastitic milk samples identified Gram-negative cefpodoxime-resistant isolates, which were assessed for their ESBL phenotypes. Conjugation experiments and PCR-based replicon typing (PBRT) were used for characterization of transferable plasmids. E. coli isolates belonged to sequence type 88 (ST88; determined by multilocus sequence typing) and carried blaCTX-M-15 and blaTEM-1, while K. pneumoniae subsp. pneumoniae isolates carried blaSHV-12 and blaTEM-1. Conjugation experiments demonstrated that blaCTX-M-15 and blaTEM-1 were carried on a conjugative plasmid in E. coli, and PBRT identified this to be an IncI1 plasmid. The resistance genes were nontransferable in K. pneumoniae subsp. pneumoniae isolates. Moreover, in the E. coli isolates, an association of ISEcp1 and IS26 with blaCTX-M-15 was found where the IS26 element was inserted upstream of both ISEcp1 and the blaCTX-M promoter, a genetic arrangement highly similar to that described in some United Kingdom human isolates. We report the first cases in Europe of bovine mastitis due to E. coli CTX-M-15 and also of bovine mastitis due to K. pneumoniae subsp. pneumoniae SHV-12 ?-lactamases in the United Kingdom. We also describe the genetic environment of blaCTX-M-15 and highlight the role that IncI1 plasmids may play in the spread and dissemination of ESBL genes, which have been described in both human and cattle isolates. PMID:24247146

  11. Can entropy save bacteria?

    E-print Network

    Suckjoon Jun

    2008-08-29

    This article presents a physical biology approach to understanding organization and segregation of bacterial chromosomes. The author uses a "piston" analogy for bacterial chromosomes in a cell, which leads to a phase diagram for the organization of two athermal chains confined in a closed geometry characterized by two length scales (length and width). When applied to rod-shaped bacteria such as Escherichia coli, this phase diagram predicts that, despite strong confinement, duplicated chromosomes will demix, i.e., there exists a primordial physical driving force for chromosome segregation. The author discusses segregation of duplicating chromosomes using the concentric-shell model, which predicts that newly synthesized DNA will be found in the periphery of the chromosome during replication. In contrast to chromosomes, these results suggest that most plasmids will be randomly distributed inside the cell because of their small sizes. An active partitioning system is therefore required for accurate segregation of low-copy number plasmids. Implications of these results are also sketched, e.g., on the role of proteins, segregation mechanisms for bacteria of diverse shapes, cell cycle of an artificial cell, and evolution.

  12. Trail following by gliding bacteria.

    PubMed Central

    Burchard, R P

    1982-01-01

    Slime trails, which are deposited on surfaces by gliding bacteria and which serve as preferential pathways for gliding motility, were tested for the species specificity of their support of movement. Among the pairs of bacteria tested, a variety of gliding bacteria and a flagellated bacterium moved along trails of unrelated species. Thus, the trails did not serve as pheromones. Rather, they may have guided gliding elasticotactically. Some biological implications of this finding are considered. Images PMID:6811562

  13. Molecular Characterization of Klebsiella pneumoniae Carbapenemase (KPC)-Producing Enterobacteriaceae in Ontario, Canada, 2008-2011

    PubMed Central

    Tijet, Nathalie; Sheth, Prameet M.; Lastovetska, Olga; Chung, Catherine; Patel, Samir N.; Melano, Roberto G.

    2014-01-01

    Due to the lack of detailed reports of Klebsiella pneumoniae carbapenemase (KPC)-producing enterobacteria in Ontario, Canada, we perform a molecular characterization of KPC-producing Enterobacteriaceae submitted to the provincial reference laboratory from 2008 to 2011. Susceptibility profiles were accessed by E-test. Molecular types of isolates were determined by pulse-field gel electrophoresis (PFGE) and multilocus sequence typing. Screening of ß-lactamase genes was performed by multiplex PCR and alleles were identified by DNA sequencing. The genetic platform of blaKPC gene was analyzed by PCR. Plasmid replicons were typed using PCR-based typing approach. KPC-plasmids were also evaluated by S1 nuclease-PFGE and Southern blot. Thirty unique clinical isolates (26 Klebsiella pneumoniae, 2 Enterobacter cloacae, 1 Citrobacter freundii and 1 Raoultella ornithinolytica) were identified as blaKPC positive: 4 in 2008, 3 in 2009, 10 in 2010 and 13 in 2011. The majority exhibited resistance to carbapenems, cephalosporins and fluoroquinolones and two isolates were also resistant to colistin. The isolates harbored blaKPC-2 (n?=?23) or blaKPC-3 (n?=?7). blaTEM-1 (n?=?27) was commonly detected and occasionally blaOXA-1 (n?=?3) and blaCTX-M-15 (n?=?1). As expected, all K. pneumoniae isolates carried blaSHV-11. blaKPC genes were identified on Tn4401a (n?=?20) or b (n?=?10) isoforms, on plasmids of different sizes belonging to the incompatibility groups IncFIIA (n?=?19), IncN (n?=?3), IncI2 (n?=?3), IncFrep (n?=?2) and IncA/C (n?=?1). The occurrence of KPC ß-lactamase in Ontario was mainly associated with the spread of the K. pneumoniae clone ST258. PMID:25549365

  14. Residence in Skilled Nursing Facilities Is Associated with Tigecycline Nonsusceptibility in Carbapenem-Resistant Klebsiella pneumoniae.

    PubMed

    van Duin, David; Cober, Eric; Richter, Sandra S; Perez, Federico; Kalayjian, Robert C; Salata, Robert A; Evans, Scott; Fowler, Vance G; Bonomo, Robert A; Kaye, Keith S

    2015-08-01

    OBJECTIVE To determine the rates of and risk factors for tigecycline nonsusceptibility among carbapenem-resistant Klebsiella pneumoniae (CRKPs) isolated from hospitalized patients DESIGN Multicenter prospective observational study SETTING Acute care hospitals participating in the Consortium on Resistance against Carbapenems in Klebsiella pneumoniae (CRaCKle) PATIENTS A cohort of 287 patients who had CRKPs isolated from clinical cultures during hospitalization METHODS For the period from December 24, 2011 to October 1, 2013, the first hospitalization of each patient with a CRKP during which tigecycline susceptibility for the CRKP isolate was determined was included. Clinical data were entered into a centralized database, including data regarding pre-hospital origin. Breakpoints established by the European Committee on Antimicrobial Susceptibility Testing (EUCAST) were used to interpret tigecycline susceptibility testing. RESULTS Of 287 patients included in the final cohort, 155 (54%) had tigecycline-susceptible CRKPs. Of all index isolates, 81 (28%) were tigecycline-intermediate and 51 (18%) were tigecycline resistant. In multivariate modeling, independent risk factors for tigecycline nonsusceptibility were (1) admission from a skilled nursing facility (OR, 2.51; 95% CI, 1.51-4.21; P=.0004), (2) positive culture within 2 days of admission (OR, 1.82; 95% CI, 1.06-3.15; P=.03), and (3) receipt of tigecycline within 14 days (OR, 4.38, 95% CI, 1.37-17.01, P=.02). CONCLUSIONS In hospitalized patients with CRKPs, tigecycline nonsusceptibility was more frequently observed in those admitted from skilled nursing facilities and occurred earlier during hospitalization. Skilled nursing facilities are an important target for interventions to decrease antibacterial resistance to antibiotics of last resort for treatment of CRKPs. Infect Control Hosp Epidemiol 2015;36(8):942-948. PMID:25990806

  15. Resistance determinants and mobile genetic elements of an NDM-1-encoding Klebsiella pneumoniae strain.

    PubMed

    Hudson, Corey M; Bent, Zachary W; Meagher, Robert J; Williams, Kelly P

    2014-01-01

    Multidrug-resistant Enterobacteriaceae are emerging as a serious infectious disease challenge. These strains can accumulate many antibiotic resistance genes though horizontal transfer of genetic elements, those for ?-lactamases being of particular concern. Some ?-lactamases are active on a broad spectrum of ?-lactams including the last-resort carbapenems. The gene for the broad-spectrum and carbapenem-active metallo-?-lactamase NDM-1 is rapidly spreading. We present the complete genome of Klebsiella pneumoniae ATCC BAA-2146, the first U.S. isolate found to encode NDM-1, and describe its repertoire of antibiotic-resistance genes and mutations, including genes for eight ?-lactamases and 15 additional antibiotic-resistance enzymes. To elucidate the evolution of this rich repertoire, the mobile elements of the genome were characterized, including four plasmids with varying degrees of conservation and mosaicism and eleven chromosomal genomic islands. One island was identified by a novel phylogenomic approach, that further indicated the cps-lps polysaccharide synthesis locus, where operon translocation and fusion was noted. Unique plasmid segments and mosaic junctions were identified. Plasmid-borne blaCTX-M-15 was transposed recently to the chromosome by ISEcp1. None of the eleven full copies of IS26, the most frequent IS element in the genome, had the expected 8-bp direct repeat of the integration target sequence, suggesting that each copy underwent homologous recombination subsequent to its last transposition event. Comparative analysis likewise indicates IS26 as a frequent recombinational junction between plasmid ancestors, and also indicates a resolvase site. In one novel use of high-throughput sequencing, homologously recombinant subpopulations of the bacterial culture were detected. In a second novel use, circular transposition intermediates were detected for the novel insertion sequence ISKpn21 of the ISNCY family, suggesting that it uses the two-step transposition mechanism of IS3. Robust genome-based phylogeny showed that a unified Klebsiella cluster contains Enterobacter aerogenes and Raoultella, suggesting the latter genus should be abandoned. PMID:24905728

  16. Predictors of Mortality in Patients with Bloodstream Infection Due to Ceftazidime-Resistant Klebsiella pneumoniae

    PubMed Central

    Anderson, Deverick J.; Engemann, John J.; Harrell, Lizzie J.; Carmeli, Yehuda; Reller, L. Barth; Kaye, Keith S.

    2006-01-01

    Bloodstream infection (BSI) due to multidrug-resistant Klebsiella is associated with high rates of morbidity and mortality. The aim of this study was to identify predictors of in-hospital mortality among patients with BSI due to ceftazidime-resistant (CAZ-R) Klebsiella pneumoniae at a tertiary care medical center. Patients with CAZ-R K. pneumoniae BSI were identified by our microbiology laboratory between January 1995 and June 2003. Clinical data were collected retrospectively. Logistic regression was used to identify independent predictors of all causes of in-hospital mortality. Of 779 patients with K. pneumoniae BSI, 60 (7.7%) had BSI due to CAZ-R K. pneumoniae; 43 (72%) of these were nosocomial infections. Pulsed-field gel electrophoresis identified a single predominant strain in 17 (28%) patients. The in-hospital mortality rate was 43% (n = 26). Among patients with CAZ-R K. pneumoniae BSI, those who died were similar to survivors with respect to demographic, clinical, and antimicrobial susceptibility characteristics. Only 43 (72%) patients received effective therapy within 5 days of BSI. In bivariable analysis, delay in initiation of effective therapy for >72 h after diagnosis of BSI was associated with death (P = 0.03). Strain genotype was not predictive of outcome. In multivariable analysis, delay in initiation of effective therapy for >72 h after diagnosis of BSI was an independent predictor of death (odds ratio, 3.32; 95% confidence interval, 1.07 to 10.3). Thus, among patients with BSI due to CAZ-R K. pneumoniae, a delay in the initiation of effective therapy of greater than 72 h after BSI was associated with a >3-fold increase in mortality risk. PMID:16641440

  17. Occurrence of gram-negative bacteria in hens' eggs depending on their source and storage conditions.

    PubMed

    Stepie?-Py?niak, D

    2010-01-01

    The aim of this study was to analyse the qualitative composition of Gram-negative microbes, mainly of the family Enterobacteriaceae, including pathogenic bacteria such as Salmonella, in the albumens and yolks and on the shells of hens' eggs, depending on their source and on the temperature and duration of their storage. A total of 375 table eggs were studied, from a large-scale poultry farm, a small-scale poultry farm and a supermarket. Each group was divided into 5 subgroups according to the temperature and duration of their storage during the study. Two serotypes of bacteria of the genus Salmonella were identified: S. Enteritidis and S. Arizonae. Strains of Salmonella spp. were also isolated. Apart from Salmonella and Escherichia coli, among the most frequently isolated bacteria of the family Enterobacteriaceae were Enterobacter spp., Klebsiella spp. and Citrobacter freundii. Qualitative analysis of the bacterial microflora of the eggs also showed the presence of other Gram negative bacteria, including Acinetobacter spp., Pseudomonas spp., Tatumella ptyseos, Providencia stuartii, Serratia liquefaciens, Flavimonas oryzihabitans, Vibrio metschnikovii, Leclercia adecarboxylata, Kluyvera spp., Rahnella aquatilis, Proteus mirabilis, and Achromobacter spp. The study demonstrated that the conditions applied, i.e., the temperature and duration of storage, did not significantly influence the prevalence of particular species of Gram-negative bacteria in the eggs. However, based on the analysis of contamination of eggs with Salmonella depending on their source, it can be concluded that the system in which the hens are housed affects the risk of contamination of eggs with these pathogens. PMID:21033566

  18. Effect of aerosolization on culturability and viability of gram-negative bacteria.

    PubMed Central

    Heidelberg, J F; Shahamat, M; Levin, M; Rahman, I; Stelma, G; Grim, C; Colwell, R R

    1997-01-01

    Estimations of the bacterial content of air can be more easily made now than a decade ago, with colony formation the method of choice for enumeration of airborne bacteria. However, plate counts are subject to error because bacteria exposed to the air may remain viable yet lose the ability to form colonies, i.e., they become viable but nonculturable. If airborne bacteria exhibit this phenomenon, colony formation data will significantly underestimate the bacterial populations in air samples. The objective of the study reported here was to determine the effect of aerosolization on viability and colony-forming ability of Serratia marcescens, Klebsiella planticola, and Cytophaga allerginae. A collision nebulizer was used to spray bacterial suspensions into an aerosol chamber, after which duplicate samples were collected in all-glass impingers over a 4-h period. Humidity was maintained at ca. 20 to 25%, and temperature was maintained at 20 to 22 degrees C for each of two replicate trials per microorganism. Viability was determined by using a modified direct viable count method, employing nalidixic acid or aztreonam and p-iodonitrotetrazolium violet (INT). Cells were stained with acridine orange and observed by epifluorescence microscopy to enumerate total and viable cells. Viable cells were defined as those elongating in the presence of antibiotic and/or reducing INT. CFU were determined by plating on tryptic soy agar and R2A agar. It was found that culture techniques did not provide an adequate description of the bacterial burdens of indoor air (i.e., less than 10% of the aerosolized bacteria were capable of forming visible colonies). It is concluded that total cell count procedures provide a better approximation of the number of bacterial cells in air and that procedures other than plate counting are needed to enumerate bacteria in aerosol samples, especially if the public health quality of indoor air is to be estimated. PMID:9293010

  19. A direct viable count method for the enumeration of attached bacteria and assessment of biofilm disinfection

    NASA Technical Reports Server (NTRS)

    Yu, F. P.; Pyle, B. H.; McFeters, G. A.

    1993-01-01

    This report describes the adaptation of an in situ direct viable count (in situ DVC) method in biofilm disinfection studies. The results obtained with this technique were compared to two other enumeration methods, the plate count (PC) and conventional direct viable count (c-DVC). An environmental isolate (Klebsiella pneumoniae Kp1) was used to form biofilms on stainless steel coupons in a stirred batch reactor. The in situ DVC method was applied to directly assess the viability of bacteria in biofilms without disturbing the integrity of the interfacial community. As additional advantages, the results were observed after 4 h instead of the 24 h incubation time required for colony formation and total cell numbers that remained on the substratum were enumerated. Chlorine and monochloramine were used to determine the susceptibilities of attached and planktonic bacteria to disinfection treatment using this novel analytical approach. The planktonic cells in the reactor showed no significant change in susceptibility to disinfectants during the period of biofilm formation. In addition, the attached cells did not reveal any more resistance to disinfection than planktonic cells. The disinfection studies of young biofilms indicated that 0.25 mg/l free chlorine (at pH 7.2) and 1 mg/l monochloramine (at pH 9.0) have comparable disinfection efficiencies at 25 degrees C. Although being a weaker disinfectant, monochloramine was more effective in removing attached bacteria from the substratum than free chlorine. The in situ DVC method always showed at least one log higher viable cell densities than the PC method, suggesting that the in situ DVC method is more efficient in the enumeration of biofilm bacteria. The results also indicated that the in situ DVC method can provide more accurate information regarding the cell numbers and viability of bacteria within biofilms following disinfection.

  20. Bacteria within ovules and seeds.

    PubMed Central

    Mundt, J O; Hinkle, N F

    1976-01-01

    Surface-sterilized ovules and seeds of 27 species of plants were cultured in the water of syneresis of a nutrient medium low in agar content. Bacteria were obtained from 30% of the ovules, 15% of the seeds of herbaceous plants, 16% of the seeds of woody plants, 5.4% of the overwintered noncereal seeds, and 13.5% of overwintered cereal seeds. In no instance did every ovule or seed of a plant species contain bacteria. No bacteria were obtained from the hard, waxy seeds of mimosa or yellowwood. They were not obtained from ovules with unbroken coats or from seeds with coats that were not ruptured during the swelling of the seed. Only one species of bacteria was recovered in 93% of the instances in which bacteria were obtained. Bacteria were obtained from seeds that were embedded in the acidic parenchyma of the lemon or surrounded by the thickened flesh of the cucurbits. The bacteria were distributed among 19 genera and 46 species. The species isolated in greatest numbers were Bacillus megaterium, B. cereus, Erwinia herbicola, Flavobacterium devorans, and Pseudomonas fluorescens. Bacteria recovered less frequently were in the genera Achromobacter, Acinetobacter, Alcaligenes, Brevibacterium, Corynebacterium, Cytophaga, Leuconostoc, Micrococcus, Nocardia, Proteus, Streptococcus, Streptomyces, and Xanthomonas. Members of 11 genera and 15 species of bacteria were isolated once. PMID:984839

  1. Resistance in Gram-Negative Bacteria: Enterobacteriaceae

    Microsoft Academic Search

    David L. Paterson

    2006-01-01

    The emergence and spread of resistance in Enterobacteriaceae are complicating the treatment of serious nosocomial infections and threatening to create species resistant to all currently available agents. Approximately 20% of Klebsiella pneumoniae infections and 31% of Enterobacter spp infections in intensive care units in the United States now involve strains not susceptible to third-generation cephalosporins. Such resistance in K pneumoniae

  2. Programmed Death in Bacteria

    PubMed Central

    Lewis, Kim

    2000-01-01

    Programmed cell death (PCD) in bacteria plays an important role in developmental processes, such as lysis of the mother cell during sporulation of Bacillus subtilis and lysis of vegetative cells in fruiting body formation of Myxococcus xanthus. The signal transduction pathway leading to autolysis of the mother cell includes the terminal sporulation sigma factor E?K, which induces the synthesis of autolysins CwlC and CwlH. An activator of autolysin in this and other PCD processes is yet to be identified. Autolysis plays a role in genetic exchange in Streptococcus pneumoniae, and the gene for the major autolysin, lytA, is located in the same operon with recA. DNA from lysed cells is picked up by their neighbors and recombined into the chromosome by RecA. LytA requires an unknown activator controlled by a sensory kinase, VncS. Deletion of vncS inhibits autolysis and also decreases killing by unrelated antibiotics. This observation suggests that PCD in bacteria serves to eliminate damaged cells, similar to apoptosis of defective cells in metazoa. The presence of genes affecting survival without changing growth sensitivity to antibiotics (vncS, lytA, hipAB, sulA, and mar) indicates that bacteria are able to control their fate. Elimination of defective cells could limit the spread of a viral infection and donate nutrients to healthy kin cells. An altruistic suicide would be challenged by the appearance of asocial mutants without PCD and by the possibility of maladaptive total suicide in response to a uniformly present lethal factor or nutrient depletion. It is proposed that a low rate of mutation serves to decrease the probability that asocial mutants without PCD will take over the population. It is suggested that PCD is disabled in persistors, rare cells that are resistant to killing, to ensure population survival. It is suggested that lack of nutrients leads to the stringent response that suppresses PCD, producing a state of tolerance to antibiotics, allowing cells to discriminate between nutrient deprivation and unrepairable damage. High levels of persistors are apparently responsible for the extraordinary survival properties of bacterial biofilms, and genes affecting persistence appear to be promising targets for development of drugs aimed at eradicating recalcitrant infections. PCD in unicellular eukaryotes is also considered, including aging in Saccharomyces cerevisiae. Apoptosis-like elimination of defective cells in S. cerevisiae and protozoa suggests that all unicellular life forms evolved altruistic programmed death that serves a variety of useful functions. PMID:10974124

  3. Aminopeptidase Profiles of Various Bacteria

    PubMed Central

    Westley, J. W.; Anderson, P. J.; Close, V. A.; Halpern, B.; Lederberg, E. M.

    1967-01-01

    The aminopeptidase specificity of 24 strains of bacteria was determined fluorometrically by use of a series of ?-amino acid ?-naphthylamides as substrates. Provided that strict control over medium and growth time was adhered to, a reproducible profile of aminopeptidase activity was obtained which could be used for the identification of bacteria. PMID:4963444

  4. Isolation of cellulolytic bacteria from the intestine of Diatraea saccharalis larvae and evaluation of their capacity to degrade sugarcane biomass.

    PubMed

    Dantur, Karina I; Enrique, Ramón; Welin, Björn; Castagnaro, Atilio P

    2015-01-01

    As a strategy to find efficient lignocellulose degrading enzymes/microorganisms for sugarcane biomass pretreatment purposes, 118 culturable bacterial strains were isolated from intestines of sugarcane-fed larvae of the moth Diatraea saccharalis. All strains were tested for cellulolytic activity using soluble carboxymethyl cellulose (CMC) degrading assays or by growing bacteria on sugarcane biomass as sole carbon sources. Out of the 118 strains isolated thirty eight were found to possess cellulose degrading activity and phylogenetic studies of the 16S rDNA sequence revealed that all cellulolytic strains belonged to the phyla ?-Proteobacteria, Actinobacteria and Firmicutes. Within the three phyla, species belonging to five different genera were identified (Klebsiella, Stenotrophomonas, Microbacterium, Bacillus and Enterococcus). Bacterial growth on sugarcane biomass as well as extracellular endo-glucanase activity induced on soluble cellulose was found to be highest in species belonging to genera Bacillus and Klebsiella. Good cellulolytic activity correlated with high extracellular protein concentrations. In addition, scanning microscopy studies revealed attachment of cellulolytic strains to different sugarcane substrates. The results of this study indicate the possibility to find efficient cellulose degrading enzymes and microorganisms from intestines of insect larvae feeding on sugarcane and their possible application in industrial processing of sugarcane biomass such as second generation biofuel production. PMID:25852992

  5. Salvage therapy with tigecycline for recurrent infection caused by ertapenem-resistant extended-spectrum ?-lactamase-producing Klebsiella pneumoniae

    Microsoft Academic Search

    Po-Lin Chen; Jing-Jou Yan; Chi-Jung Wu; Hsin-Chun Lee; Chia-Ming Chang; Nan-Yao Lee; Nai-Ying Ko; Li-Rong Wang; Hsin-I Shih; Ching-Chi Lee; Wen-Chien Ko

    2010-01-01

    Optimal antimicrobial therapy for infections due to ertapenem-resistant Enterobacteriaceae remains undetermined. In this study, a diabetic patient with recurrent pyomyositis and osteomyelitis caused by extended-spectrum ?-lactamase (ESBL)-producing Klebsiella pneumoniae developed ertapenem resistance after imipenem\\/cilastatin treatment, which was a currently recommended therapy. He was finally treated successfully using tigecycline. Ertapenem resistance was in part explained by the production of SHV-type ESBL

  6. Emergence of KPC2 and KPC3 in Carbapenem-Resistant Klebsiella pneumoniae Strains in an Israeli Hospital

    Microsoft Academic Search

    Azita Leavitt; Shiri Navon-Venezia; Inna Chmelnitsky; Mitchell J. Schwaber; Yehuda Carmeli

    2007-01-01

    Carbapenem resistance due to KPC has rarely been observed outside the United States. We noticed a sharp increase in carbapenem-resistant Klebsiella pneumoniae strains possessing KPC in Tel Aviv Medical Center from 2004 to 2006. Sixty percent of the isolates belonged to a single clone susceptible only to gentamicin and colistin and carried the blaKPC-3 gene, while almost all other clones

  7. Predictors of Carbapenem-Resistant Klebsiella pneumoniae Acquisition among Hospitalized Adults and Effect of Acquisition on Mortality

    Microsoft Academic Search

    Mitchell J. Schwaber; Shiri Klarfeld-Lidji; Shiri Navon-Venezia; David Schwartz; Azita Leavitt; Yehuda Carmeli

    2008-01-01

    Received 2 August 2007\\/Returned for modification 3 September 2007\\/Accepted 9 December 2007 Carbapenem-resistant Klebsiella pneumoniae (CRKP) is an emerging nosocomial pathogen. Little is known about its risk factors or mortality. We performed a case-case-control study to assess the risks for CRKP isolation and a retrospective cohort study to assess mortality in three groups of hospitalized adults: (i) patients from whom

  8. Outbreak of Klebsiella pneumoniae producing transferable AmpC-type ?-lactamase (ACC1) originating from Hafnia alvei

    Microsoft Academic Search

    David Nadjar; Martine Rouveau; Charlotte Verdet; Jean-Luc Donay; Jean-Louis Herrmann; Philippe H. Lagrange; Alain Philippon; Guillaume Arlet

    2000-01-01

    Fifty-two strains of Klebsiella pneumoniae producing an AmpC-type plasmid-mediated ?-lactamase were isolated from 13 patients in the same intensive care unit between March 1998 and February 1999. These strains were resistant to ceftazidime, cefotaxime and ceftriaxone, but susceptible to cefoxitin, cefepime and aztreonam. Plasmid content and genomic DNA restriction pattern analysis suggested dissemination of a single clone. Two ?-lactamases were

  9. A primary respiratory Na + pump of an anaerobic bacterium: the Na + -dependent NADH:quinone oxidoreductase of Klebsiella pneumoniae

    Microsoft Academic Search

    Peter Dimroth; Anna Thomer

    1989-01-01

    Membranes of Klebsiella pneumoniae, grown anaerobically on citrate, contain a NADH oxidase activity that is activated specifically by Na+ or Li+ ions and effectively inhibited by 2-heptyl-4-hydroxyquinoline-N-oxide (HQNO). Cytochromes b and d were present in the membranes,\\u000a and the steady state reduction level of cytochrome b increased on NaCl addition. Inverted bacterial membrane vesicles accumulated\\u000a Na+ ions upon NADH oxidation.

  10. GlnK effects complex formation between NifA and NifL in Klebsiella pneumoniae

    Microsoft Academic Search

    Jessica Stips; Robert Thummer; Melanie Neumann; Ruth A. Schmitz

    2004-01-01

    In Klebsiella pneumoniae, the nif specific transcriptional activator NifA is inhibited by NifL in response to molecular oxygen and ammonium. Here, we demonstrate complex formation between NifL and NifA (approximately 1 : 1 ratio), when synthesized in the presence of oxygen and\\/or ammonium. Under simultaneous oxygen- and nitrogen- limitation, significant but fewer NifL-NifA complexes (approximately 1%) were formed in the

  11. The production of soluble pyrroloquinoline quinone glucose dehydrogenase by Klebsiella pneumoniae, the alternative host of PQQ enzymes

    Microsoft Academic Search

    Katsuhiro Kojima; Arief Budi Witarto; Koji Sode

    2000-01-01

    Klebsiella pneumoniae, which produces PQQ and is available for use with a conventional expression vector system, was selected as the host strain for soluble PQQ glucose dehydrogenase (PQQGDH-B) production. The recombinant K. pneumoniaeexpressed PQQGDH-B in its holo-form at about 18?000 U l-1, equal to that achieved in recombinant Escherichia coli. The signal sequence of recombinant PQQGDH-B produced by K. pneumoniaewas correctly processed.

  12. The role of magnesium and calcium ions in the glucose dehydrogenase activity of Klebsiella pneumoniae NCTC 418

    Microsoft Academic Search

    Ed T. Buurman; José L. Boiardi; M. Joost Teixeira de Mattos; Oense M. Neijssel

    1990-01-01

    Magnesium-limited chemostat cultures of Klebsiella pneumoniae NCTC 418 with 20 µM CaCl2 in the medium showed a low rate of gluconate plus 2-ketogluconate production relative to potassium- or phosphate-limited cultures. However, when the medium concentration of CaCl2 was increased to 1 mM, the glucose dehydrogenase (GDH) activities also increased and became similar to those observed in potassium- or phosphate limited

  13. Regulation of expression of Na + -translocating NADH:quinone oxidoreductase genes in Vibrio harveyi and Klebsiella pneumoniae

    Microsoft Academic Search

    Maria S. Fadeeva; Evgenia A. Yakovtseva; Galina A. Belevich; Yulia V. Bertsova; Alexander V. Bogachev

    2007-01-01

    The expression of genes encoding sodium-translocating NADH:quinone oxidoreductase (Na+-NQR) was studied in the marine bacterium Vibrio harveyi and in the enterobacterium Klebsiella pneumoniae. It has been shown that such parameters as NaCl concentration, pH value, and presence of an uncoupler in the growth media\\u000a do not influence significantly the level of nqr expression. However, nqr expression depends on the growth

  14. A molecular genetic study of nif expression in Klebsiella pneumoniae at the level of transcription, translation and nitrogenase activity

    Microsoft Academic Search

    Maura Cannon; Susan Hill; Eugene Kavanaugh; Frank Cannon

    1985-01-01

    A comprehensive study of nif expression in Klebsiella pneumoniae at the level of transcription, translation and nitrogenase activity during derepression and repression by NH4+and O2 revealed that (1) transcription and translation rates remained coupled under all conditions; (2) these rates reached a peak during derepression and then decreased to a low level; (3) the transcription profile of nifLA had two

  15. Detection of SHV-5 extended-spectrum beta-lactamase in Klebsiella pneumoniae strains isolated in Italy

    Microsoft Academic Search

    A. Marchese; G. Arlet; G. C. Schito; P. H. Lagrange; A. Philippen

    1996-01-01

    Thirty-fiveKlebsiella pneumoniae strains isolated during 1993–1994 in intensive care units of a large Italian hospital were examined for the presence of extended-spectrum ß-lactamases. Five strains showed a high level of simultaneous resistance to ß-lactam agents, including ceftazidime and aztreonam, conferred by a large (130 kb) self-transferable plasmid (in 4 of 5 strains). Isoelectrofocusing and hybridisation studies suggest that these enzymes

  16. Extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae bloodstream infection: risk factors and clinical outcome

    Microsoft Academic Search

    Bin Du; Yun Long; Hongzhong Liu; Dechang Chen; Dawei Liu; Yingchun Xu; Xiuli Xie

    2002-01-01

    Objectives. To study the risk factor for nosocomial bacteremia caused by Escherichia coli or Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) and the influence on patient outcome. Design. Retrospective, single-center study of consecutive bacteremic patients. Settings. A university-affiliated teaching hospital. Patients. A total of 85 patients with nosocomial bacteremia due to E. coli or K. pneumoniae were enrolled. Intervention. None. Measurements

  17. Molecular Epidemiology of KPC-Producing Klebsiella pneumoniae Isolates in the United States: Clonal Expansion of Multilocus Sequence Type 258

    Microsoft Academic Search

    Brandon Kitchel; J. Kamile Rasheed; Jean B. Patel; Arjun Srinivasan; Shiri Navon-Venezia; Yehuda Carmeli; Alma Brolund; Christian G. Giske

    2009-01-01

    Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacteriaceae have become more common in the United States and throughout the world. We used pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) to examine the molecular epidemiology of KPC-producing K. pneumoniae isolates sent to the Centers for Disease Control and Prevention (CDC) for reference testing from 1996 to 2008. A dominant strain, sequence type

  18. Evaluation of Boronic Acid Disk Tests for Differentiating KPC-Possessing Klebsiella pneumoniae Isolates in the Clinical Laboratory

    Microsoft Academic Search

    Athanassios Tsakris; Ioulia Kristo; Aggeliki Poulou; Katerina Themeli-Digalaki; Alexandros Ikonomidis; Dimitra Petropoulou; Spyros Pournaras; Danai Sofianou

    The worldwide increase in the occurrence and dissemination of KPC -lactamases among gram-negative pathogens makes critical the early detection of these enzymes. Boronic acid disk tests using different antibiotic substrates were evaluated for detection of KPC-possessing Klebsiella pneumoniae isolates. A total of 57 genotypically confirmed KPC-possessing K. pneumoniae isolates with varying carbapenem MICs were examined. To measure the specificity of

  19. Escherichia coli and Klebsiella pneumoniae Producing CTX-M Cephalosporinase from Swine Finishing Barns and Their Association with Antimicrobial Use

    PubMed Central

    Mollenkopf, Dixie F.; Mirecki, Jennifer M.; Daniels, Joshua B.; Funk, Julie A.; Henry, Steven C.; Hansen, Glenn E.; Davies, Peter R.; Donovan, Tara S.

    2013-01-01

    We report the recovery of Escherichia coli or Klebsiella pneumoniae containing the extended-spectrum ?-lactamase gene blaCTX-M from 24 of 1,495 (1.6%) swine fecal samples in 8 of 50 (16%) finishing barns located in 5 U.S. states. We did not detect an association between antimicrobial use and recovery of blaCTX-M. PMID:23204421

  20. Emergence of four cases of KPC-2 and KPC-3-carrying Klebsiella pneumoniae introduced to Switzerland, 2009-10.

    PubMed

    Babouee, B; Widmer, A F; Dubuis, O; Ciardo, D; Droz, S; Betsch, B Y; Garzoni, C; Führer, U; Battegay, M; Frei, R; Goldenberger, D

    2011-01-01

    We report four epidemiologically unrelated cases of KPC-carrying Klebsiella pneumoniae identified in Switzerland between May 2009 and November 2010. Three cases were transferred from Italy (two KPC-3, one KPC-2) and one from Greece (KPC-2). Resistance to colistin and doxycycline emerged in one KPC-3-carrying K. pneumoniae strain during therapy. These results demonstrate ongoing dissemination of KPC throughout Europe. Rapid and reliable identification of KPC and implementation of control measures is essential to limit spread. PMID:21435328

  1. Application of cyanide hydrolase from Klebsiella sp. in a biosensor system for the detection of low-level cyanide

    Microsoft Academic Search

    Karen K. W. Mak; Alex W. C. Law; Shinsuke Tokuda; Hideshi Yanase; Reinhard Renneberg

    2005-01-01

    A partially purified preparation of cyanide hydrolase (cyanidase) from a bacterium, Klebsiella sp., was applied as a biocatalyst in a biosensor system for low-level cyanide detection. In the biosensor system cyanide hydrolase converts cyanide into formate and ammonia. The formate produced in the cyanide degradation was detected with a formate biosensor, in which formate dehydrogenase (FDH; E.C. 1.2.1.2) was co-immobilized

  2. A k2A-positive Klebsiella pneumoniae causes liver and brain abscess in a Saint Kitt's man

    PubMed Central

    Doud, Melissa S.; Grimes-Zeppegno, Reni; Molina, Enrique; Miller, Nancimae; Balachandar, Danajeyan; Schneper, Lisa; Poppiti, Robert; Mathee, Kalai

    2009-01-01

    Klebsiella pneumoniae isolated in community-acquired pneumonia is increasingly found in primary pyogenic liver abscesses. The presence of magA in K. pneumoniae has been implicated in hypermucoviscosity and virulence of liver abscess isolates. The K2 serotype has also been strongly associated with hypervirulence. We report the isolation of non-magA, K2 K. pneumoniae strain from a liver abscess of a Saint Kitt's man who survived the invasive syndrome. PMID:19774200

  3. Characterization of a T7Like Lytic Bacteriophage of Klebsiella pneumoniae B5055: A Potential Therapeutic Agent

    Microsoft Academic Search

    Vivek Verma; Kusum Harjai; Sanjay Chhibber

    2009-01-01

    Characterization of bacteriophages to be used prophylactically or therapeutically is mandatory, as use of uncharacterized\\u000a bacteriophages is considered as one of the major reasons of failure of phage therapy in preantibiotic era. In the present\\u000a study, one lytic bacteriophage, KPO1K2, specific for Klebsiella pneumoniae B5055, with broad host range was selected for characterization. As shown by TEM, morphologically KPO1K2 possessed

  4. ACT6, a novel plasmid-encoded class C ?-lactamase in a Klebsiella pneumoniae isolate from China

    Microsoft Academic Search

    Yu-lin Zhu; Xiao-ni Zhang; Fan Gao; Jun Cheng; Li-fen Hu; Tai Ma; Jun Yin; Ying Ye; Jia-Bin Li

    2011-01-01

    The purpose of this study was to investigate the phenotypic and molecular characterization of a novel plasmid-mediated AmpC-type ?-lactamase in Klebsiella pneumoniae E701 isolated from Anhui province in China. In comparison with the ACT-1, sequence analysis revealed that there were 43 point mutations in the coding gene, and 10 of which led to amino-acid substitution. Resistance could be transferred by

  5. Why Hypothetical Protein KPN00728 of Klebsiella pneumoniae Should Be Classified as Chain C of Succinate Dehydrogenase?

    Microsoft Academic Search

    Sy Bing Choi; Yahaya M. Normi; Habibah A. Wahab

    2009-01-01

    Twenty percent of genes that encode for hypothetical proteins from Klebsiella pneumoniae MGH78578 were identified, leading to KPN00728 and KPN00729 after bioinformatics analysis. Both open reading frames showed\\u000a high sequence homology to Succinate dehydrogenase Chain C (SdhC) and D (SdhD) from Escherichia coli. Recently, KPN00729 was assigned as SdhD. KPN00728 thus remains of particular interest as no annotated genes from

  6. Inhibition of Gene Expression and Growth by Antisense Peptide Nucleic Acids in a Multiresistant  -Lactamase-Producing Klebsiella pneumoniae Strain

    Microsoft Academic Search

    Prathiba Kurupati; K. S. W. Tan; G. Kumarasinghe; C. L. Poh

    2007-01-01

    Klebsiella pneumoniae causes common and severe hospital- and community-acquired infections with a high incidence of multidrug resistance. The emergence and spread of -lactamase-producing K. pneumoniae strains highlight the need to develop new therapeutic strategies. In this study, we developed antisense peptide nucleic acids (PNAs) conjugated to the (KFF)3K peptide and investigated whether they could mediate gene-specific antisense effects in K.

  7. Identification of the Klebsiella pneumoniae glnB gene: Nucleotide sequence of wild-type and mutant alleles

    Microsoft Academic Search

    Andreas Holtel; Mike Merrick

    1988-01-01

    The glnB gene of Klebsiella pneumoniae, which encodes the nitrogen regulation protein PII has been cloned and sequenced. The gene encodes a 12429 dalton polypeptide and is highly homologous to the Escherichia coli glnB gene. The sequences of a glnB mutation which causes glutamine auxotrophy and of a Tn5 induced Gln+ suppressor of this mutation were also determined. The glutamine

  8. Identification and Characterization of a New Porin Gene of Klebsiella pneumoniae: Its Role in b-Lactam Antibiotic Resistance

    Microsoft Academic Search

    ANTONIO DOMENECH-SANCHEZ; SANTIAGO HERNANDEZ-ALLES; LUIS MARTINEZ-MARTINEZ; VICENTE J. BENEDI; SEBASTIAN ALBERTI ´

    Klebsiella pneumoniae porin genes were analyzed to detect mutations accounting for the porin deficiency observed in many b-lactam-resistant strains. PCR and Southern blot analysis revealed the existence of a third porin gene in addition to the OmpK36 and OmpK35 porin genes previously described. This new porin gene was designated ompK37 and is present in all of the clinical isolates tested.

  9. Cloning and Sequencing of the Klebsiella pneumoniae O5 wb Gene Cluster and Its Role in Pathogenesis

    Microsoft Academic Search

    SUSANA MERINO; MARIA ALTARRIBA; LUIS IZQUIERDO; M. M. Nogueras; MIGUEL REGUE; JUAN M. TOMAS

    2000-01-01

    One representative recombinant clone encoding Klebsiella pneumoniae O5-antigen lipopolysaccharide (LPS) was found upon screening for serum resistance in a cosmid-based genomic library of K. pneumoniae KT769 (O5:K57) introduced into Escherichia coli DH5a. A total of eight open reading frames (wbO5 gene cluster) were necessary to produce K. pneumoniae O5-antigen LPS in E. coli K-12. The enzymatic activities proposed for the

  10. Résistance aux quinolones de type qnr chez les entérobactéries productrices de bêta-lactamases à spectre élargi à Abidjan en Côte d’Ivoire

    Microsoft Academic Search

    N. Guessennd; S. Bremont; V. Gbonon; A. Kacou-NDouba; E. Ekaza; T. Lambert; M. Dosso; P. Courvalin

    2008-01-01

    The aim of the study was to show the emergence of the qnr genes in extended spectrum beta-lactamases producing enterobacteria in Abidjan between 2005 and 2006. The whole of 151 strains of extended spectrum beta-lactamases producing enterobacteria were studied: 64 Escherichia coli, 66 Klebsiella pneumoniae, seven Klebsiella oxytoca and 14 Enterobacter spp. isolated from various biological products and from in-

  11. Prevalence and Antimicrobial Susceptibility Pattern of Extended-Spectrum Beta-Lactamase-Producing Enterobacteriaceae in the United Arab Emirates

    Microsoft Academic Search

    Mansour Al-Zarouni; Abiola Senok; Fatima Rashid; Shaikha Mohammed Al-Jesmi; Debadatta Panigrahi

    2008-01-01

    Objective: To investigate the prevalence and antibiotic susceptibility pattern of extended-spectrum ?-lactamases (ESBL)-producing Enterobacteriaecae among patients in the United Arab Emirates. Materials and Methods: A total of 130 Enterobacteriaceaecomprising of Escherichia coli (n = 83), Klebsiella pneumoniae (n = 45) and Klebsiella oxytoca (n = 2) was studied. Of these 130 isolates, 64 were from urine. ESBL screening was by

  12. Magnetic Microstructure of Magnetotactic Bacteria by

    E-print Network

    Dunin-Borkowski, Rafal E.

    Magnetic Microstructure of Magnetotactic Bacteria by Electron Holography Rafal E. Dunin microstructure of magnetite nanocrys- tals in magnetotactic bacteria. The magnetite crystals were all single). For example, magnetotactic bacteria contain magnetosomes, which are intracellular, ferri- magnetic crystals

  13. Urine Isn't Free of Bacteria

    MedlinePLUS

    ... fullstory_151843.html Urine Isn't Free of Bacteria New study links bacteria found in urine in bladder to urinary incontinence ... News) -- Though it's commonly believed that urine is bacteria-free, normal urine is not sterile, a new ...

  14. Klebsiella pneumoniae Capsule Polysaccharide Impedes the Expression of ?-Defensins by Airway Epithelial Cells?

    PubMed Central

    Moranta, David; Regueiro, Verónica; March, Catalina; Llobet, Enrique; Margareto, Javier; Larrate, Eider; Garmendia, Junkal; Bengoechea, José A.

    2010-01-01

    Human ?-defensins (hBDs) contribute to the protection of the respiratory tract against pathogens. It is reasonable to postulate that pathogens have developed countermeasures to resist them. Klebsiella pneumoniae capsule polysaccharide (CPS), but not the lipopolysaccharide O antigen, mediated resistance against hBD1 and hBD2. hBD3 was the most potent hBD against Klebsiella. We investigated the possibility that as a strategy for survival in the lung, K. pneumoniae may not activate the expression of hBDs. Infection of A549 and normal human bronchial cells with 52145-?wcaK2, a CPS mutant, increased the expression of hBD2 and hBD3. Neither the wild type nor the lipopolysaccharide O antigen mutant increased the expression of hBDs. In vivo, 52145-?wcaK2 induced higher levels of mBD4 and mBD14, possible mouse orthologues of hBD2 and hBD3, respectively, than the wild type. 52145-?wcaK2-dependent upregulation of hBD2 occurred via NF-?B and mitogen-activated protein kinases (MAPKs) p44/42, Jun N-terminal protein kinase (JNK)-dependent pathways. The increase in hBD3 expression was dependent on the MAPK JNK. 52145-?wcaK2 engaged Toll-like receptors 2 and 4 (TLR2 and TLR4) to activate hBD2, whereas hBD3 expression was dependent on NOD1. K. pneumoniae induced the expression of CYLD and MKP-1, which act as negative regulators for 52145-?wcaK2-induced expression of hBDs. Bacterial engagement of pattern recognition receptors induced CYLD and MKP-1, which may initiate the attenuation of proinflammatory pathways. The results of this study indicate that K. pneumoniae CPS not only protects the pathogen from the bactericidal action of defensins but also impedes their expression. These features of K. pneumoniae CPS may facilitate pathogen survival in the hostile environment of the lung. PMID:20008534

  15. Bacteria Growth Inquiry: Bodily Bacteria and Healthy Hygiene Habits

    NSDL National Science Digital Library

    In this inquiry activity, students generate investigable questions to explore the link between hygiene/cleanliness and bacteria growth/population. The students will present their conclusions, and video clips containing additional information will be discussed.

  16. Sampling bacteria with a laser

    NASA Astrophysics Data System (ADS)

    Schwarzwälder, Kordula; Rutschmann, Peter

    2014-05-01

    Water quality is a topic of high interest and it's getting more and more important due to climate change and the implementation of European Water Framework Directive (WFD). One point of interest here is the inflow of bacteria into a river caused by combined sewer overflows which lead untreated wastewater including bacteria directly into a river. These bacteria remain in the river for a certain time, they settle down and can be remobilised again. In our study we want to investigate these processes of sedimentation and resuspension and use the results for the development of a software module coupled with the software Flow3D. Thereby we should be able to simulate and therefore predict the water quality influenced by combined sewer overflows. Hence we need to get information about the bacteria transport and fate. We need to know about the size of the bacteria or of the bacteria clumps and the size of the particles the bacteria are attached to. The agglomerates lead to different characteristics and velocities of settlement. The timespan during this bacteria can be detected in the bulk phase depends on many factors like the intensity of UV light, turbidity of the water, the temperature of the water, if there are grazers and a lot more. The size, density and composition of the agglomerates is just a part of all these influencing factors, but it is extremely difficult to differ between the other effects if we have no information about the simple sedimentation in default of these basic information. However we have a big problem getting the data. The chaining between bacteria or bacteria and particles is not too strong, so filtering the water to get a sieving curve may destroy these connections. We did some experiments similar to PIV (particle image velocimetry) measurements and evaluated the pictures with a macro written for the software ImageJ. Doing so we were able to get the concentration of bacteria in the water and collect information about the size of the bacteria. We also compared these data to samples of usual collection and filtering. The results of these laser measurements are very promising.

  17. Sampling for Bacteria in Wells

    E-print Network

    Lesikar, Bruce J.

    2001-11-15

    Sampling for Bacteria in Wells E-126 11/01 Water samples for bacteria tests must always be col- lected in a sterile container. The procedure for collect- ing a water sample is as follows: 1. Obtain a sterile container from a Health Department... immediately after collecting water sample. Refrigerate the sample and transport it to the laborato- ry (in an ice chest) as soon after collection as possible (six hours is best, but up to 30 hours). Many labs will not accept bacteria samples on Friday so check...

  18. Inactivation ofBiofilm Bacteria

    Microsoft Academic Search

    MARK W. LECHEVALLIER; CHERYL D. CAWTHON; RAMON G. LEE

    1988-01-01

    Thecurrent project was developed toexamine inactivation ofbiofilm bacteria andtocharacterize the interaction ofbiocides withpipesurfaces. Unattached bacteria were quite susceptible tothevariety of disinfectants tested. Viable bacterial counts were reduced 99%byexposureto0.08 mg ofhypochlorous acid (pH7.0) perliter (1to2°C) for1min.Formonochloramine, 94mg\\/liter wasrequired tokill 99%ofthebacteria within 1min.Theseresults wereconsistent withthose found byother investigators. Biofilm bacteria grown on thesurfaces ofgranular activated carbon particles, metal coupons,orglass microscope slides were

  19. The role of nanotechnology in combating multi-drug resistant bacteria.

    PubMed

    Singh, Rajni; Smitha, M S; Singh, Surinder P

    2014-07-01

    The development of antibiotics has played a significant role in combating the dreaded infectious disease such as tuberculosis, pneumonia, typhoid fever and meningitis in 20th century. However, the improper use of antibiotics led to the development of multidrug resistance (MDR) in microbial flora raising a global public health concern of 21st century. This unforeseen threat demands the development of new drugs and strategies for combating antibiotic resistance shown by many microbial species. Recent developments in nanotechnology to engineer nanoparticles with desired physicochemical properties have been projected as a new line of defense against MDR micro-organism. In this review, we summarized and discussed the recent development demonstrating the potential of nanomaterials to evade the MDR. Nanoparticles have shown effective antimicrobial activity against MDR bacteria, such as Acinetobacter baumanii, Pseudomonas aeruginosa, Klebsiella pneumoniae, Mycobacterium tuberculosis, vancomycin resistant enterococci, methicillin-resistant Staphylococcus aureus and others. Furthermore, new strategies like combination of radiation and drugs with nanoparticle that are being explored to potentiate the effectiveness against MDR bacteria have also been summarized. PMID:24757944

  20. Clinical microbiology of coryneform bacteria.

    PubMed Central

    Funke, G; von Graevenitz, A; Clarridge, J E; Bernard, K A

    1997-01-01

    Coryneform bacteria are aerobically growing, asporogenous, non-partially-acid-fast, gram-positive rods of irregular morphology. Within the last few years, there has been a massive increase in the number of publications related to all aspects of their clinical microbiology. Clinical microbiologists are often confronted with making identifications within this heterogeneous group as well as with considerations of the clinical significance of such isolates. This review provides comprehensive information on the identification of coryneform bacteria and outlines recent changes in taxonomy. The following genera are covered: Corynebacterium, Turicella, Arthrobacter, Brevibacterium, Dermabacter. Propionibacterium, Rothia, Exiguobacterium, Oerskovia, Cellulomonas, Sanguibacter, Microbacterium, Aureobacterium, "Corynebacterium aquaticum," Arcanobacterium, and Actinomyces. Case reports claiming disease associations of coryneform bacteria are critically reviewed. Minimal microbiological requirements for publications on disease associations of coryneform bacteria are proposed. PMID:8993861

  1. Where Bacteria and Languages Concur

    NSDL National Science Digital Library

    Colin Renfrew (University of Cambridge; McDonald Institute for Archaeological Research)

    2009-01-23

    Access to the article is free, however registration and sign-in are required. Genetic data from human gastric bacteria provide independent support for a linguistic analysis of Pacific population dispersals.

  2. Recombinant glycerol dehydratase from Klebsiella pneumoniae XJPD-Li: induction optimization, purification and characterization.

    PubMed

    Xu, X L; Zhang, G L; Lv, B; Yuan, Y J; Li, C

    2011-01-01

    Glycerol dehydratase (GDHt) is the rate limiting enzyme in the biosynthesis of 1,3-propanediol from glycerol. The optimization of inducting process for recombinant GDHt from Klebsiella pneumoniae XJPD-Li carried out to increase specific activity and ratio of soluble form. The optimum condition was inducing under the isopropyl-beta-D-thiogalactoside concentration of 0.8 mM and the temperature of 20 degrees C for 3 h. Homogeneity of GDHt then was obtained by affinity chromatography, resulted in 2.11-fold purification and an overall yield of 47.5%. The optimum pH and reaction temperature of GDHt were pH 8.0 and 45 degrees C, respectively. The K(m) for glycerol, 1,2-propanediol, 1,2-ethanediol and coenzyme B12 were 0.48, 1.43, 3.07 mM, and 10.03 nM, respectively. The GDHt showed relatively stable even under temperature of 40 degrees C and a bit blunt to oxygen. The thermo-inactivation kinetic models were fit linear under different temperatures. PMID:22808739

  3. Heterologous expression and characterization of recombinant glycerol dehydratase from Klebsiella pneumoniae in Escherichia coli.

    PubMed

    Wang, Fenghuan; Qu, Huijin; Tian, Pingfang; Tan, Tianwei

    2007-06-01

    Glycerol dehydratase (EC 4.2.1.30), as one of the key enzymes in converting glycerol to the valuable intermediate 1,3-propanediol, is important for biochemical industry. The dhaB genes encoding coenzyme B(12)-dependent glycerol dehydratase in Klebsiella pneumoniae were cloned and expressed in Escherichia coli. An effective co-expression system of multiple subunits protein was constructed. Heterologous expression vectors were constructed using the splicing by overlap extension-PCR technique to co-express the three subunits of the glycerol dehydratase. After induction by isopropyl-beta-D-thiogalactopyranoside, SDS-PAGE analysis revealed that: (i) only the alpha subunit of glycerol dehydratase was expressed in direct expression system, (ii) the three subunits of glycerol dehydratase with predicted molecular massess of 64 (agr;), 22 (beta), and 16 kDa (gamma) were expressed simultaneously in co-expression system, and (iii) the fusion expression system expressed the fusion protein of 99 kDa. Enzyme assay showed that the activities of three heterologous expression products were 27.4, 2.3, and 0.2 U/mg. The highest enzyme activity was almost 17 times of that in K. pneumoniae. The recombinant enzyme was purified and biochemically characterized. The apparent Km values of the enzyme for coenzyme B(12) and 1, 2-propanediol were 8.5 nM and 1.2 mM, respectively. The enzyme showed maximum activity at pH 8.5 and 37 degrees C. PMID:17373646

  4. Acetoin catabolic system of Klebsiella pneumoniae CG43: sequence, expression, and organization of the aco operon.

    PubMed Central

    Deng, W L; Chang, H Y; Peng, H L

    1994-01-01

    A cosmid clone which was capable of depleting acetoin in vivo was isolated from a library of Klebsiella pneumoniae CG43 cosmids. The smallest functional subclone contained a 3.9-kb DNA fragment of the cosmid clone. Sequencing of the DNA fragment revealed three open reading frames (ORFs A, B, and C) encoding polypeptides of 34, 36, and 52 kDa, respectively. The presence of these proteins was demonstrated by expression of the recombinant DNA clone in Escherichia coli. Considerable similarities between the deduced amino acid sequences of the ORFs and those of the following enzymes were found: acetoin dissimilation enzymes, pyruvate dehydrogenase complex, 2-oxoglutarate dehydrogenase complex, and branched-chain 2-oxo acid dehydrogenase complex of various origins. Activities of these enzymes, including acetoin-dependent dichlorophenolin-dohenol oxidoreductase and dihydrolipoamide acetyltransferase, were detected in the extracts of E. coli harboring the genes encoding products of the three ORFs. Although not required for acetoin depletion in vivo, a possible fourth ORF (ORF D), located 39 nucleotides downstream of ORF C, was also identified. The deduced N-terminal sequence of the ORF D product was highly homologous to the dihydrolipoamide dehydrogenases of several organisms. Primer extension analysis identified the transcriptional start of the operon as an A residue 72 nucleotides upstream of ORF A. Images PMID:8206829

  5. Improved process for exopolysaccharide production by Klebsiella pneumoniae sp. pneumoniae by a fed-batch strategy.

    PubMed

    Ramírez-Castillo, M L; Uribelarrea, J L

    2004-08-01

    Exopolysaccharide (EPS) was produced by Klebsiella pneumoniae K63 grown in fed-batch cultures using different procedures of the supply of carbon or nitrogen (N) source, or both. Cultures grown with excess of glucose and limitation or exhaustion of N produced 54.8 and 47.4 g(EPS) l(-1), respectively. These cultures also led to an accumulation of 'overflow' metabolites representing more than 16% of carbon conversion. The consistency indexes ( K ) obtained to the end of the cultures, characteristic of the rheological property of the biopolymer, were 16.4 Pa s(n) for N deficiency and 5.2 Pa s(n) for N limitation conditions. The simultaneous limitation of glucose and N decreased the excretion of co-metabolites (6.4% of carbon conversion) and the EPS production (18.1 g(EPS) l(-1)), while improving the quality of the polysaccharide, characterized by the highest K of 126.2 Pa s(n) and the highest pseudoplasticity degree (flow behaviour index, n=0.2). PMID:15483391

  6. Protection against fatal Klebsiella pneumoniae burn wound sepsis by passive transfer of anticapsular polysaccharide.

    PubMed Central

    Cryz, S J; Fürer, E; Germanier, R

    1984-01-01

    Klebsiella pneumoniae KP1-0 capsular polysaccharide (PS) was isolated from culture supernatants by coprecipitation with N-cetyl-N,N,N-trimethylammonium bromide. PS was composed primarily of carbohydrate and contained less than 1% (wt/wt) protein and nucleic acids. The protective capacity of passively transferred anti-PS was evaluated in a murine burn wound sepsis model. Anti-PS antibody was found to offer high levels of protection (P less than or equal to 0.02) against a low challenge dose of K. pneumoniae KP1-0. The 50% lethal dose for mice which received anti-PS antibody was increased from 10- to 40-fold over that for mice which received normal rabbit serum. Anti-PS antibody was found to be most effective at reducing mortality when administered before the challenge. In experiments designed to monitor the course of the infection, anti-PS was found to both delay the onset of bacteremia and reduce bacterial counts in the blood. Optimal protection against fatal burn wound sepsis was obtained by the use of a combined antibiotic and passive antibody therapy regimen. PMID:6376353

  7. Genomic and transcriptomic analysis of NDM-1 Klebsiella pneumoniae in spaceflight reveal mechanisms underlying environmental adaptability

    PubMed Central

    Li, Jia; Liu, Fei; Wang, Qi; Ge, Pupu; Woo, Patrick C. Y.; Yan, Jinghua; Zhao, Yanlin; Gao, George F.; Liu, Cui Hua; Liu, Changting

    2014-01-01

    The emergence and rapid spread of New Delhi Metallo-beta-lactamase-1 (NDM-1)-producing Klebsiella pneumoniae strains has caused a great concern worldwide. To better understand the mechanisms underlying environmental adaptation of those highly drug-resistant K. pneumoniae strains, we took advantage of the China's Shenzhou 10 spacecraft mission to conduct comparative genomic and transcriptomic analysis of a NDM-1 K. pneumoniae strain (ATCC BAA-2146) being cultivated under different conditions. The samples were recovered from semisolid medium placed on the ground (D strain), in simulated space condition (M strain), or in Shenzhou 10 spacecraft (T strain) for analysis. Our data revealed multiple variations underlying pathogen adaptation into different environments in terms of changes in morphology, H2O2 tolerance and biofilm formation ability, genomic stability and regulation of metabolic pathways. Additionally, we found a few non-coding RNAs to be differentially regulated. The results are helpful for better understanding the adaptive mechanisms of drug-resistant bacterial pathogens. PMID:25163721

  8. Surface changes and polymyxin interactions with a resistant strain of Klebsiella pneumoniae

    PubMed Central

    Velkov, Tony; Deris, Zakuan Z; Huang, Johnny X; Azad, Mohammad AK; Butler, Mark; Sivanesan, Sivashangarie; Kaminskas, Lisa M; Dong, Yao-Da; Boyd, Ben; Baker, Mark A; Cooper, Matthew A; Nation, Roger L; Li, Jian

    2014-01-01

    This study examines the interaction of polymyxin B and colistin with the surface and outer membrane components of a susceptible and resistant strain of Klebsiella pneumoniae. The interaction between polymyxins and bacterial membrane and isolated LPS from paired wild type and polymyxin-resistant strains of K. pneumoniae were examined with N-phenyl-1-naphthylamine (NPN) uptake, fluorometric binding and thermal shift assays, lysozyme and deoxycholate sensitivity assays, and by 1H NMR. LPS from the polymyxin-resistant strain displayed a reduced binding affinity for polymyxins B and colistin in comparison with the wild type LPS. The outer membrane NPN permeability of the resistant strain was greater compared with the susceptible strain. Polymyxin exposure enhanced the permeability of the outer membrane of the wild type strain to lysozyme and deoxycholate, whereas polymyxin concentrations up to 32 mg/ml failed to permeabilize the outer membrane of the resistant strain. Zeta potential measurements revealed that mid-logarithmic phase wild type cells exhibited a greater negative charge than the mid-logarithmic phase-resistant cells. Taken together, our findings suggest that the resistant derivative of K. pneumoniae can block the electrostatically driven first stage of polymyxin action, which thereby renders the hydrophobically driven second tier of polymyxin action on the outer membrane inconsequential. PMID:23887184

  9. Klebsiella: a long way to go towards understanding this enigmatic jet-setter

    PubMed Central

    Broberg, Christopher A.; Palacios, Michelle

    2014-01-01

    Klebsiella pneumoniae is the causative agent of a variety of diseases, including pneumonia, urinary tract infections, septicemia, and the recently recognized pyogenic liver abscesses (PLA). Renewed efforts to identify and understand the bacterial determinants required to cause disease have come about because of the worldwide increase in the isolation of strains resistant to a broad spectrum of antibiotics. The recent increased isolation of carbapenem-resistant strains further reduces the available treatment options. The rapid geographic spread of the resistant isolates and the spread to other pathogens are of particular concern. For many years, the best characterized virulence determinants were capsule, lipopolysaccharide, siderophores, and types 1 and 3 fimbriae. Recent efforts to expand this list include in vivo screens and whole-genome sequencing. However, we still know little about how this bacterium is able to cause disease. Some recent clonal analyses of K. pneumoniae strains indicate that there are distinct clonal groups, some of which may be associated with specific disease syndromes. However, what makes one clonal group more virulent and what changes the disease pattern are not yet clear and remain important questions for the future. PMID:25165563

  10. Carbapenemases in Klebsiella pneumoniae and Other Enterobacteriaceae: an Evolving Crisis of Global Dimensions

    PubMed Central

    Tzouvelekis, L. S.; Markogiannakis, A.; Psichogiou, M.; Tassios, P. T.

    2012-01-01

    Summary: The spread of Enterobacteriaceae, primarily Klebsiella pneumoniae, producing KPC, VIM, IMP, and NDM carbapenemases, is causing an unprecedented public health crisis. Carbapenemase-producing enterobacteria (CPE) infect mainly hospitalized patients but also have been spreading in long-term care facilities. Given their multidrug resistance, therapeutic options are limited and, as discussed here, should be reevaluated and optimized. Based on susceptibility data, colistin and tigecycline are commonly used to treat CPE infections. Nevertheless, a review of the literature revealed high failure rates in cases of monotherapy with these drugs, whilst monotherapy with either a carbapenem or an aminoglycoside appeared to be more effective. Combination therapies not including carbapenems were comparable to aminoglycoside and carbapenem monotherapies. Higher success rates have been achieved with carbapenem-containing combinations. Pharmacodynamic simulations and experimental infections indicate that modification of the current patterns of carbapenem use against CPE warrants further attention. Epidemiological data, though fragmentary in many countries, indicate CPE foci and transmission routes, to some extent, whilst also underlining the lack of international collaborative systems that could react promptly and effectively. Fortunately, there are sound studies showing successful containment of CPE by bundles of measures, among which the most important are active surveillance cultures, separation of carriers, and assignment of dedicated nursing staff. PMID:23034326

  11. Genomic and transcriptomic analysis of NDM-1 Klebsiella pneumoniae in spaceflight reveal mechanisms underlying environmental adaptability.

    PubMed

    Li, Jia; Liu, Fei; Wang, Qi; Ge, Pupu; Woo, Patrick C Y; Yan, Jinghua; Zhao, Yanlin; Gao, George F; Liu, Cui Hua; Liu, Changting

    2014-01-01

    The emergence and rapid spread of New Delhi Metallo-beta-lactamase-1 (NDM-1)-producing Klebsiella pneumoniae strains has caused a great concern worldwide. To better understand the mechanisms underlying environmental adaptation of those highly drug-resistant K. pneumoniae strains, we took advantage of the China's Shenzhou 10 spacecraft mission to conduct comparative genomic and transcriptomic analysis of a NDM-1 K. pneumoniae strain (ATCC BAA-2146) being cultivated under different conditions. The samples were recovered from semisolid medium placed on the ground (D strain), in simulated space condition (M strain), or in Shenzhou 10 spacecraft (T strain) for analysis. Our data revealed multiple variations underlying pathogen adaptation into different environments in terms of changes in morphology, H2O2 tolerance and biofilm formation ability, genomic stability and regulation of metabolic pathways. Additionally, we found a few non-coding RNAs to be differentially regulated. The results are helpful for better understanding the adaptive mechanisms of drug-resistant bacterial pathogens. PMID:25163721

  12. Identification of natural compounds which inhibit biofilm formation in clinical isolates of Klebsiella pneumoniae.

    PubMed

    Magesh, H; Kumar, Arun; Alam, Ayesha; Priyam; Sekar, Uma; Sumantran, Venil N; Vaidyanathan, Rama

    2013-09-01

    Klebsiella pneumoniae, an important opportunistic pathogen, exists as a biofilm in persistent infections and in-dwelling medical devices. With the objective of identifying natural compounds inhibiting biofilm formation in K. pneumoniae, 35 clinical isolates were screened,out of which 7 strong biofilm producers were identified. Six natural compounds were tested for their inhibitory effects on bacterial growth and biofilm formation by determining the minimum inhibitory concentration and minimum concentration for biofilm inhibition (MBIC) for each compound. The results show that reserpine followed by linoleic acid, were the most potent biofilm inhibitors. Reserpine, an efflux pump inhibitor was effective at biofilm inhibition at a concentration of 0.0156 mg/mL, 64-fold lower concentration than its MIC. Linoleic acid, an essential fatty acid was effective as a biofilm inhibitor at 0.0312 mg/mL, which is 32-fold lower than its MIC. Berberine, another plant derived antimicrobial, chitosan and eugenol had an MBIC value of 0.0635 mg/mL. Curcumin, a natural phenolic compound was effective at biofilm inhibition at a concentration of 0.25 mg/mL, which is 50 fold less than its MIC. Notably, the MIC and MBIC data on these 6 natural compounds was reproducible in all seven high biofilm forming isolates of K. pneumoniae. The present report is a comprehensive comparative analysis of the dose dependent inhibition of various natural compounds on biofilm formation in K. pneumoniae. PMID:24377137

  13. Isomaltulose synthase from Klebsiella sp. strain LX3: gene cloning and characterization and engineering of thermostability.

    PubMed

    Zhang, Daohai; Li, Xianzhen; Zhang, Lian-Hui

    2002-06-01

    The gene (palI) encoding isomaltulose synthase (PalI) from a soil bacterial isolate, Klebsiella sp. strain LX3, was cloned and characterized. PalI converts sucrose into isomaltulose, trehalulose, and trace amounts of glucose and fructose. Sequence domain analysis showed that PalI contains an alpha-amylase domain and (beta/alpha)(8)-barrel structures, suggesting that it belongs to the alpha-amylase family. Sequence alignment indicated that the five amino acid residues of catalytic importance in alpha-amylases and glucosyltransferases (Asp(241), Glu(295), Asp(369), His(145), and His(368)) are conserved in PalI. Purified recombinant PalI displayed high catalytic efficiency, with a Km of 54.6 +/- 1.7 mM for sucrose, and maximum activity (approximately 328.0 +/- 2.5 U/mg) at pH 6.0 and 35 degrees C. PalI activity was strongly inhibited by Fe3+ and Hg2+ and was enhanced by Mn2+ and Mg2+. The half-life of PalI was 1.8 min at 50 degrees C. Replacement of selected amino acid residues by proline significantly increased the thermostability of PalI. Simultaneous replacement of Glu(498) and Arg(310) with proline resulted in an 11-fold increase in the half-life of PalI at 50 degrees C. PMID:12039719

  14. Isomaltulose Synthase from Klebsiella sp. Strain LX3: Gene Cloning and Characterization and Engineering of Thermostability

    PubMed Central

    Zhang, Daohai; Li, Xianzhen; Zhang, Lian-Hui

    2002-01-01

    The gene (palI) encoding isomaltulose synthase (PalI) from a soil bacterial isolate, Klebsiella sp. strain LX3, was cloned and characterized. PalI converts sucrose into isomaltulose, trehalulose, and trace amounts of glucose and fructose. Sequence domain analysis showed that PalI contains an ?-amylase domain and (?/?)8-barrel structures, suggesting that it belongs to the ?-amylase family. Sequence alignment indicated that the five amino acid residues of catalytic importance in ?-amylases and glucosyltransferases (Asp241, Glu295, Asp369, His145, and His368) are conserved in PalI. Purified recombinant PalI displayed high catalytic efficiency, with a Km of 54.6 ± 1.7 mM for sucrose, and maximum activity (approximately 328.0 ± 2.5 U/mg) at pH 6.0 and 35°C. PalI activity was strongly inhibited by Fe3+ and Hg2+ and was enhanced by Mn2+ and Mg2+. The half-life of PalI was 1.8 min at 50°C. Replacement of selected amino acid residues by proline significantly increased the thermostability of PalI. Simultaneous replacement of Glu498 and Arg310 with proline resulted in an 11-fold increase in the half-life of PalI at 50°C. PMID:12039719

  15. Isomaltulose synthase (PalI) of Klebsiella sp. LX3. Crystal structure and implication of mechanism.

    PubMed

    Zhang, Daohai; Li, Nan; Lok, Shee-Mei; Zhang, Lian-Hui; Swaminathan, Kunchithapadam

    2003-09-12

    Isomaltulose synthase from Klebsiella sp. LX3 (PalI, EC 5.4.99.11) catalyzes the isomerization of sucrose to produce isomaltulose (alpha-D-glucosylpyranosyl-1,6-D-fructofuranose) and trehalulose (alpha-D-glucosylpyranosyl-1,1-d-fructofuranose). The PalI structure, solved at 2.2-A resolution with an R-factor of 19.4% and Rfree of 24.2%, consists of three domains: an N-terminal catalytic (beta/alpha)8 domain, a subdomain between N beta 3 and N alpha 3, and a C-terminal domain having seven beta-strands. The active site architecture of PalI is identical to that of other glycoside hydrolase family 13 members, suggesting a similar mechanism in substrate binding and hydrolysis. However, a unique RLDRD motif in the proximity of the active site has been identified and shown biochemically to be responsible for sucrose isomerization. A two-step reaction mechanism for hydrolysis and isomerization, which occurs in the same pocket is proposed based on both the structural and biochemical data. Selected C-terminal truncations have been shown to reduce and even abolish the enzyme activity, consistent with the predicted role of the C-terminal residues in the maintenance of enzyme conformation and active site topology. PMID:12819210

  16. Physical Characterization of Ten R Plasmids Obtained from an Outbreak of Nosocomial Klebsiella pneumoniae Infections

    PubMed Central

    Sadowski, Peter L.; Peterson, Bryan C.; Gerding, Dale N.; Cleary, Paul P.

    1979-01-01

    Gentamicin resistance in Klebsiella pneumoniae involved in an outbreak at the Minneapolis Veterans Administration Hospital was due to a transmissible R plasmid. In addition to gentamicin, this plasmid conferred resistance to tobramycin, kanamycin, ampicillin, carbenicillin, cephalothin, chloramphenicol, and sulfathiazole. R plasmids which transferred this complex antibiogram were identified in several clinical isolates, including four different serotypes of K. pneumoniae, Escherichia coli, Enterobacter cloacae, and Proteus morganii. The covalently closed circular form of all R plasmids isolated had a sedimentation coefficient of 76S to 77S, corresponding to a molecular weight of 58 × 106. The possibility that a single R plasmid was responsible for the dissemination of multiple drug resistance among all of these different clinical strains was examined by characterizing the plasmids by using EcoRI restriction endonuclease. The same 15 fragments were obtained from each of the 10 plasmids analyzed. Their molecular weights ranged from 4 × 105 to 11 × 106. Thus, we conclude that each of the 10 plasmids present in the various clinical strains isolated from the hospital over a 7-month period originated from a common source and that R plasmid transfer was important in their spread. PMID:380464

  17. Rapid detection of the Klebsiella pneumoniae carbapenemase (KPC) gene by loop-mediated isothermal amplification (LAMP).

    PubMed

    Nakano, Ryuichi; Nakano, Akiyo; Ishii, Yoshikazu; Ubagai, Tsuneyuki; Kikuchi-Ueda, Takane; Kikuchi, Hirotoshi; Tansho-Nagakawa, Shigeru; Kamoshida, Go; Mu, Xiaoqin; Ono, Yasuo

    2015-03-01

    Klebsiella pneumoniae carbapenemases (KPC), which are associated with resistance to carbapenem, have recently spread worldwide and have become a global concern. It is necessary to detect KPC-producing organisms in clinical settings to be able to control the spread of this resistance. We have developed a loop-mediated isothermal amplification (LAMP) method for rapid detection of KPC producers. LAMP primer sets were designed to recognize the homologous regions of blaKPC-2 to blaKPC-17 and could amplify blaKPC rapidly. The specificity and sensitivity of the primers in the LAMP reactions for blaKPC detection were determined. This LAMP assay was able to specifically detect KPC producers at 68 °C, and no cross-reactivity was observed for other types of ?-lactamase (class A, B, C, or D) producers. The detection limit for this assay was found to be 10(0) CFU per tube, in 25 min, which was 10-fold more sensitive than a PCR assay for blaKPC detection. Then, the sensitivity of the LAMP reactions for blaKPC detection in human specimens (sputum samples, urine samples, fecal samples and blood samples) was analyzed; it was observed that the LAMP assay had almost the same sensitivity in these samples as when using purified DNA. The LAMP assay is easy to perform and rapid. It may therefore be routinely applied for detection of KPC producers in the clinical laboratory. PMID:25529001

  18. Identification of the first imported KPC-3 Klebsiella pneumoniae from the USA to Taiwan.

    PubMed

    Tang, Hung-Jen; Chen, Ying-Tsong; Chiang, Tom; Fung, Chang-Phone; Chuang, Yin-Ching; Kristopher Siu, L

    2014-11-01

    Establishment of KPC-associated genes into a new region usually requires travellers with hospital admission and their carriage into the communities. In this report, a worldwide spreading clone carrying KPC-3 was isolated from the sputum of a hospitalised patient with a serious infection who had just come from the USA and had been admitted to a New York hospital. By genetic comparison with a strain isolated from New Jersey (NJ-KPC-21), this isolate from the traveller was genetically related. The blaKPC-3 gene was harboured on a large plasmid with a complex structure of a Tn3-based transposon, Tn4401a. The KPC-3-carrying plasmid was very similar (>99.9% identity) to the 113 637-bp blaKPC-3-encoding plasmid pKpQIL that originated from the 2006 epidemic carbapenem-resistant Klebsiella pneumoniae outbreak in Israel. With the first recognition of KPC-2 in 2011 and continuing spread, physicians should be aware of the coming of KPC-3 K. pneumoniae in Taiwan. PMID:25442359

  19. Closely Related NDM-1-Encoding Plasmids from Escherichia coli and Klebsiella pneumoniae in Taiwan

    PubMed Central

    Chen, Chao-Ju; Wu, Tsu-Lan; Lu, Po-Liang; Chen, Ying-Tsong; Fung, Chang-Phone; Chuang, Yin-Ching; Lin, Jung-Chung; Siu, L. Kristopher

    2014-01-01

    Objective Two plasmids carrying blaNDM-1 isolated from carbapenem-resistant Klebsiella pneumoniae (CR-KP) and carbapenem-resistant Escherichia coli (CR-EC) were sequenced. CR-KP and CR-EC were isolated from two Taiwanese patients without travel histories. Methods Complete sequencing of the plasmids (pLK75 and pLK78) was conducted using a shotgun approach. Annotation of the contigs was performed using the RAST Server, followed by manual inspection and correction. Results These similar plasmids were obtained from two patients with overlapping stays at the same hospital. The pLK75 and pLK78 plasmids were 56,489-bp and 56,072-bp in length, respectively. Plasmid annotation revealed a common backbone similar to the IncN plasmid pR46. The regions flanking the blaNDM-1 genes in these plasmids were very similar to plasmid pNDM-HU01 in Japan, which contains a complex class 1 integron located next to an ISCR1 element. The ISCR1 element has been suggested to provide a powerful mechanism for mobilising antibiotic resistance genes. Conclusion Two indigenous NDM-1-producing Enterobacteriaceae cases were identified for the first time in Taiwan, highlighting the alarming introduction of NDM-1-producing Enterobacteriaceae in this region. PMID:25144712

  20. Synergistic activity of 5-trifluoromethylthioribose and inhibitors of methionine synthesis against Klebsiella pneumoniae.

    PubMed Central

    Tower, P A; Johnson, L L; Ferro, A J; Fitchen, J H; Riscoe, M K

    1991-01-01

    5-Methylthioribose (MTR) is an intermediate in the methionine recycling pathway of organisms containing the enzyme MTR kinase. Analogs of MTR have been proposed as a new class of antimicrobial agents because of their ability to perturb the growth of MTR kinase-containing pathogens through inhibition of methionine salvage or by conversion to toxic products. One such analog, 5-trifluoromethylthioribose (TFMTR), has demonstrated potent inhibitory effects on the growth of Klebsiella pneumoniae (A. G. Gianotti, P. A. Tower, J. H. Sheley, P. A. Conte, C. Spiro, J. H. Fitchen, and M. K. Riscoe, J. Biol. Chem. 265:831-837, 1990). Although the mode of action of TFMTR has yet to be determined, it is believed that the drug is converted to the toxic products trifluoromethionine or carbonothioic difluoride via MTR kinase and the methionine recycling pathway. On the basis of this assumption, we theorized that blocking de novo methionine synthesis would increase dependence on the methionine salvage pathway and lead to an increased rate of synthesis of toxic metabolites from TFMTR. In this report, we show that three separate inhibitors of de novo methionine synthesis (1,2,4-triazole, azaserine, and propargylglycine) act synergistically with TFMTR in inhibiting the growth of K. pneumoniae. PMID:1929327

  1. Seroepidemiology of Klebsiella pneumoniae in an Australian Tertiary Hospital and Its Implications for Vaccine Development

    PubMed Central

    Jenney, Adam W.; Clements, Abigail; Farn, Jacinta L.; Wijburg, Odilia L.; McGlinchey, Andrew; Spelman, Denis W.; Pitt, Tyrone L.; Kaufmann, Mary E.; Liolios, Lisa; Moloney, Margaret B.; Wesselingh, Steven L.; Strugnell, Richard A.

    2006-01-01

    The aim of this study was to determine the diversity of Klebsiella pneumoniae capsular serotypes in an Australian setting. Consecutive (n = 293) nonrepetitive isolates of K. pneumoniae from a large teaching hospital laboratory were analyzed. The majority of isolates were from urinary specimens (60.8%); the next most common source was sputum (14.3%), followed by blood (14%). Serotyping revealed a wide range of capsule types. K54 (17.1%), K28 (4.1%), and K17 (3.1%) were the most common, and K54 isolates displayed a high degree of clonality, suggesting a common, nosocomial source. In vitro, one K54 isolate was more adherent to urinary catheters and HEp-2 cells than four other tested isolates; it was slightly more resistant to chlorhexidine but was more susceptible to drying than heavily encapsulated strains. This is the first seroprevalence survey of K. pneumoniae to be performed on Australian isolates, and the high level of diversity of serotypes suggests that capsule-based immunoprophylaxis might not be useful for Australia. In addition there are significant differences in the predominance of specific serotypes compared to the results of surveys performed overseas, which has important implications for capsule-based immunoprophylaxis aimed at a global market. PMID:16390956

  2. Alginate microparticles loaded with lipopolysaccharide subunit antigen for mucosal vaccination against Klebsiella pneumoniae.

    PubMed

    Jain, R R; Mehta, M R; Bannalikar, A R; Menon, M D

    2015-05-01

    Klebsiella pneumoniae (K. pneumoniae) is one of the commonest causes of nosocomial infections in human beings. Since K. pneumoniae infections are air borne type, controlling it by mucosal vaccination through nasal and pulmonary route could be a promising approach in order to simulate the natural infection. New vaccines such as subunit vaccines are safer than traditional vaccines, but they are less immunogenic. Therefore to enhance their immunogenicity, there is a need to develop potent and safe adjuvants and delivery systems. It has been established that micro-particles are one of the most potent adjuvants available for mucosal delivery of vaccines and they do so by improving uptake of encapsulated antigen by antigen presenting cells (APCs). Lipopolysaccharide (LPS), the antigenic fraction was extracted from K. pneumoniae by hot phenol extraction method. LPS loaded sodium alginate microparticles were prepared by emulsion ionic gelation method. Microparticles with particle size less than 5 ?m were obtained. Loading efficiency of the LPS loaded microparticles ranged from 76 to 82 %. Comparative in vivo immunogenicity studies were carried for free LPS and encapsulated LPS, administered via intramuscular, intratracheal and intranasal routes in Swiss albino mice. The study revealed that LPS encapsulated microparticles exhibit greater efficacy when administered by intra-tracheal route as compared to free LPS vaccine. PMID:25737397

  3. The nitrogen assimilation control protein, NAC, is a DNA binding transcription activator in Klebsiella aerogenes.

    PubMed Central

    Goss, T J; Bender, R A

    1995-01-01

    A 32-kDa polypeptide corresponding to NAC, the product of the Klebsiella aerogenes nac gene, was overexpressed from a plasmid carrying a tac'-'nac operon fusion and purified to near homogeneity by taking advantage of its unusual solubility properties. NAC was able to shift the electrophoretic migration of DNA fragments carrying the NAC-sensitive promoters hutUp, putPp1, and ureDp. The interaction between NAC and hutUp was localized to a 26-bp region centered approximately 64 bp upstream of the hutUp transcription initiation site. Moreover, NAC protected this region from DNase I digestion. Mobility shift and DNase I protection studies utilizing the putP and ureD promoter regions identified NAC-binding regions of sizes and locations similar to those found in hutUp. Comparison of the DNA sequences which were protected from DNase I digestion by NAC suggests a minimal NAC-binding consensus sequence: 5'-ATA-N9-TAT-3'. In vitro transcription assays demonstrated that NAC was capable of activating the transcription of hutUp by sigma 70-RNA polymerase holoenzyme when this promoter was presented as either a linear or supercoiled DNA molecule. Thus, NAC displays the in vitro DNA-binding and transcription activation properties which have been predicted for the product of the nac gene. PMID:7768865

  4. Response of Differentiated Human Airway Epithelia to Alcohol Exposure and Klebsiella Pneumoniae Challenge

    PubMed Central

    Raju, Sammeta V.; Painter, Richard G.; Bagby, Gregory J.; Nelson, Steve; Wang, Guoshun

    2014-01-01

    Alcohol abuse has been associated with increased susceptibility to pulmonary infection. It is not fully defined how alcohol contributes to the host defense compromise. Here primary human airway epithelial cells were cultured at an air-liquid interface to form a differentiated and polarized epithelium. This unique culture model allowed us to closely mimic lung infection in the context of alcohol abuse by basolateral alcohol exposure and apical live bacterial challenge. Application of clinically relevant concentrations of alcohol for 24 hours did not significantly alter epithelial integrity or barrier function. When apically challenged with viable Klebsiella pneumoniae, the cultured epithelia had an enhanced tightness which was unaffected by alcohol. Further, alcohol enhanced apical bacterial growth, but not bacterial binding to the cells. The cultured epithelium in the absence of any treatment or stimulation had a base-level IL-6 and IL-8 secretion. Apical bacterial challenge significantly elevated the basolateral secretion of inflammatory cytokines including IL-2, IL-4, IL-6, IL-8, IFN-?, GM-CSF, and TNF-?. However, alcohol suppressed the observed cytokine burst in response to infection. Addition of adenosine receptor agonists negated the suppression of IL-6 and TNF-?. Thus, acute alcohol alters the epithelial cytokine response to infection, which can be partially mitigated by adenosine receptor agonists. PMID:25485141

  5. Genetic profiles of fluoroquinolone-nonsusceptible Klebsiella pneumoniae among cephalosporin-resistant K. pneumoniae.

    PubMed

    Nagasaka, Yukiko; Kimura, Kouji; Yamada, Keiko; Wachino, Jun-Ichi; Jin, Wanchun; Notake, Shigeyuki; Yanagisawa, Hideji; Arakawa, Yoshichika

    2015-04-01

    The rate of fluoroquinolone (FQ) resistance among the cephalosporin-resistant Klebsiella pneumoniae is considerably high, however, their genetic profiles have not been well investigated. We selected 61 ciprofloxacin-nonsusceptible isolates from 102 K. pneumoniae isolates judged to be "resistant" to some cephalosporins during 2009 and 2012 throughout Japan. Pulsed-field gel electrophoresis excluded clonal isolates, and 29 isolates were subjected to multilocus sequence typing (MLST), detection of the amino acid substitutions in the quinolone resistance determining regions (QRDRs) of GyrA and ParC, ?-lactamase typing, and identification of plasmid-mediated quinolone resistance (PMQR) genes. PCR-based replicon typing was performed, after PMQR gene transfer. Four major sequence types (STs) or clonal complexes (CCs), that is, ST37, CC17 (consisting of ST17 and ST20), ST11, and CC528 (consisting of ST528 and ST1130), were found, and they accounted for 48.2% of the isolates tested. Amino acid substitutions in the QRDRs and the presence of PMQR genes were identified in 20 (68.9%) and 18 (62.0%) isolates, respectively. The replicon type of three PMQR-carrying plasmids was IncN, but others were nontypable. Fifteen (83.3%) of the 18 PMQR-harboring isolates coharbored blaCTX-M and/or blaDHA-1. Ciprofloxacin-nonsusceptible K. pneumoniae clinical isolates demonstrating cephalosporin resistance often belong to the global epidemic lineages and possess PMQR and/or QRDR substitutions. PMID:25419619

  6. Molecular epidemiology of KPC-2-producing Enterobacteriaceae (non-Klebsiella pneumoniae) isolated from Brazil.

    PubMed

    Tavares, Carolina Padilha; Pereira, Polyana Silva; Marques, Elizabeth de Andrade; Faria, Celio; de Souza, Maria da Penha Araújo Herkenhoff; de Almeida, Robmary; Alves, Carlene de Fátima Morais; Asensi, Marise Dutra; Carvalho-Assef, Ana Paula D'Alincourt

    2015-08-01

    In Brazil, since 2009, there has been an ever increasing widespread of the blaKPC-2 gene, mainly in Klebsiella pneumoniae. This study aims to assess the molecular epidemiology and genetic background of this gene in Enterobacteriaceae (non-K. pneumoniae) species from 9 Brazilian states between 2009 and 2011. Three hundred eighty-seven isolates were analyzed exhibiting nonsusceptibility to carbapenems, in which the blaKPC-2 gene was detected in 21.4%. By disk diffusion and E-test, these isolates exhibited high rates of resistance to most of the antimicrobials tested, including tigecycline (45.6% nonsusceptible) and polymyxin B (16.5%), the most resistant species being Enterobacter aerogenes and Enterobacter cloacae. We found great clonal diversity and a variety of blaKPC-2-carrying plasmids, all of them exhibiting a partial Tn4401 structure. Therefore, this study demonstrates the dissemination of KPC-2 in 9 Enterobacteriaceae species, including species that were not previously described such as Pantoea agglomerans and Providencia stuartii. PMID:25935630

  7. Clinical and microbiological characteristics of Klebsiella pneumoniae from community-acquired recurrent urinary tract infections.

    PubMed

    Lin, W H; Kao, C Y; Yang, D C; Tseng, C C; Wu, A B; Teng, C H; Wang, M C; Wu, J J

    2014-09-01

    Understanding the pathogenesis of recurrent urinary tract infection (RUTI) and whether it is attributable to reinfection with a new strain or relapse with the primary infecting strain is of considerable importance. Because previous studies regarding community-acquired Klebsiella pneumoniae RUTI are inconclusive, we undertook this study to evaluate the characteristics of the host and the bacterial agent K. pneumoniae in RUTI. A prospective study was designed, using consecutive patients diagnosed with community-acquired K. pneumoniae-related UTI from January 2007 to December 2009. Of the total 468 consecutive episodes, we found 7 patients with RUTI. All the patients with RUTI were elderly (median, 74 years), with diabetes (100 %, 7 out of 7). Clinical K. pneumoniae isolates derived from the same patients with RUTI revealed identical genomic fingerprints, indicating that K. pneumoniae UTI relapsed despite appropriate antibiotic therapy. The antimicrobial resistance, growth curve and biofilm formation of the recurrent isolates did not change. K. pneumoniae strains causing RUTI had more adhesion and invasiveness than the colonization strains (p?

  8. Characterization of MATE-Type Multidrug Efflux Pumps from Klebsiella pneumoniae MGH78578

    PubMed Central

    Ogawa, Wakano; Minato, Yusuke; Dodan, Hayata; Onishi, Motoyasu; Tsuchiya, Tomofusa; Kuroda, Teruo

    2015-01-01

    We previously described the cloning of genes related to drug resistance from Klebsiella pneumoniae MGH78578. Of these, we identified a putative gene encoding a MATE-type multidrug efflux pump, and named it ketM. Escherichia coli KAM32 possessing ketM on a plasmid showed increased minimum inhibitory concentrations for norfloxacin, ciprofloxacin, cefotaxime, acriflavine, Hoechst 33342, and 4',6-diamidino-2-phenyl indole (DAPI). The active efflux of DAPI was observed in E. coli KAM32 possessing ketM on a plasmid. The expression of mRNA for ketM was observed in K. pneumoniae cells, and we subsequently disrupted ketM in K. pneumoniae ATCC10031. However, no significant changes were observed in drug resistance levels between the parental strain ATCC10031 and ketM disruptant, SKYM. Therefore, we concluded that KetM was a multidrug efflux pump, that did not significantly contribute to intrinsic resistance to antimicrobial chemicals in K. pneumoniae. MATE-type transporters are considered to be secondary transporters; therefore, we investigated the coupling cations of KetM. DAPI efflux by KetM was observed when lactate was added to produce a proton motive force, indicating that KetM effluxed substrates using a proton motive force. However, the weak efflux of DAPI by KetM was also noted when NaCl was added to the assay mixture without lactate. This result suggests that KetM may utilize proton and sodium motive forces. PMID:25807080

  9. Phylogenetic groups among Klebsiella pneumoniae isolates from Brazil: relationship with antimicrobial resistance and origin.

    PubMed

    de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina

    2011-05-01

    The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene. PMID:21350801

  10. NAD(+)-independent aldehyde oxidase catalyzes cofactor balanced 3-hydroxypropionic acid production in Klebsiella pneumoniae.

    PubMed

    Li, Ying; Liu, Luo; Tian, Pingfang

    2014-11-01

    The limiting step for biosynthesis of 3-hydroxypropionic acid (3-HP) in Klebsiella pneumoniae is the conversion of 3-hydroxypropionaldehyde (3-HPA) to 3-HP. This reaction is catalyzed by aldehyde dehydrogenase (ALDH) with NAD(+) as a cofactor. Although NAD(+)-dependent ALDH overexpression facilitates 3-HP biosynthesis, ALDH activity decreases and 3-HP stops accumulation when NAD(+) is exhausted. Here, we show that an NAD(+)-independent aldehyde oxidase (AOX) from Pseudomonas sp. AIU 362 holds promise for cofactor-balanced 3-HP production in K. pneumoniae. The AOX coding gene, alod, was heterologously expressed in E. coli and K. pneumoniae, and their respective crude cell extracts showed 38.1 U/mg and 16.6 U/mg activities toward propionaldehyde. The recombinant K. pneumoniae expressing alod showed 13.7 U/mg activity toward 3-HPA; K m and V max were 6.7 mM and 42 ?M/min/mg, respectively. In shake-flask cultures, the recombinant K. pneumoniae strain produced 0.89 g 3-HP/l, twice that of the control. Moreover, it produced 3 g 3-HP/l during 24 h fed-batch cultivation in a 5 l bioreactor. The results indicate that AOX can efficiently convert 3-HPA into 3-HP. PMID:24980850

  11. Short Chain N-Acylhomoserine Lactone Production by Clinical Multidrug Resistant Klebsiella pneumoniae Strain CSG20

    PubMed Central

    Ngeow, Yun Fong; Cheng, Huey Jia; Chen, Jian Woon; Yin, Wai-Fong; Chan, Kok-Gan

    2013-01-01

    Klebsiella pneumoniae is one of the most common Gram-negative bacterial pathogens in clinical practice. It is associated with a wide range of disorders, ranging from superficial skin and soft tissue infections to potentially fatal sepsis in the lungs and blood stream. Quorum sensing, or bacterial cell-cell communication, refers to population density-dependent gene expression modulation. Quorum sensing in Proteobacteria relies on the production and sensing of signaling molecules which are mostly N-acylhomoserine lactones. Here, we report the identification of a multidrug resistant clinical isolate, K. pneumoniae strain CSG20, using matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) mass spectrometry. We further confirmed quorum sensing activity in this strain with the use of high resolution tandem liquid chromatography quadrupole mass spectrometry and provided evidence K. pneumoniae strain CSG20 produced N-hexanoyl-homoserine lactone (C6-HSL). To the best of our knowledge, this is the first report on the production of N-hexanoylhomoserine lactone (C6-HSL) in clinical isolate K. pneumoniae. PMID:24284772

  12. Isolation and characterization of Klebsiella pneumoniae specific bacteriophages from sewage samples.

    PubMed

    Kumari, S; Harjai, K; Chhibber, S

    2010-05-01

    Five bacteriophages (Kpn5, Kpn12, Kpn13, Kpn17 and Kpn22), each having specificity against Klebsiella pneumoniae strain B5055, were isolated from sewage samples and characterized in terms of growth characteristics, genetic material, morphology and structural proteins. Adsorption rate as well as single step growth curve experiments showed variation among phages. Restriction enzyme digestion of DNA confirmed the presence of double stranded DNA as well as the heterogeneous nature of genetic material. RAPD-PCR was performed to further distinguish these closely related phages. Their genome fingerprint confirmed their diversity. Transmission electron microscopy, on the other hand, showed their morphological similarity; they were assigned to family Podoviridae, order Caudovirales on the basis of their head and tail morphology. Structural proteins resolved on SDS-PAGE showed the presence of similar major outer membrane proteins. The bacteriophages, belonging to Podoviridae family with short stumpy tails, were found to be nontoxic to mice. They showed maximum count in various organs at 6 h post inoculation, which persisted till 36 h. These phages thus have the potential to be used for phage therapy. PMID:20526833

  13. Nucleotide sequence of the gene coding for the nitrogenase iron protein from Klebsiella pneumoniae.

    PubMed

    Sundaresan, V; Ausubel, F M

    1981-03-25

    We report the complete DNA sequence of the Klebsiella pneumoniae nifH gene, the gene which codes for component 2 (Fe protein or nitrogenase reductase) of the nitrogenase enzyme complex. The amino acid sequence of the K. pneumoniae nitrogenase Fe protein is deduced from the DNA sequence. The K. pneumoniae Fe protein contains 292 amino acids, has a Mr = 31,753, and contains 9 cysteine residues. We compare the amino acid sequence of the K. pneumoniae protein with available amino acid sequence data on nitrogenase Fe proteins from two other species, Clostridium pasteurianum and Azotobacter vinelandii. The C. pasteurianum Fe protein, for which the complete sequence is known, shows 67% homology with the K. pneumoniae Fe protein. Extensive regions of strong conservation (90-95%) are found, while other regions show relatively poor conservation (30-35%). It is suggested that these strongly conserved regions are of special importance to the function of this enzyme, and the findings are discussed in the light of evolutionary theories on the origin of nif genes. PMID:6259144

  14. Evolution of aminobenzoate synthases: nucleotide sequences of Salmonella typhimurium and Klebsiella aerogenes pabB.

    PubMed

    Goncharoff, P; Nichols, B P

    1988-09-01

    p-Aminobenzoate synthase (PS) and anthranilate synthase (AS) are structurally related enzymes that catalyze similar reactions and produce similar products, para- and ortho-aminobenzoate (anthranilate). Each enzyme is composed of two non-identical subunits: a glutamine amidotransferase subunit (CoII) and a subunit that produces an aminobenzoate product (CoI). Nucleotide sequence comparisons of the Escherichia coli genes encoding each of the subunits suggest a common evolutionary origin for both subunits of the enzyme complexes. We report here the nucleotide sequences of the pabB genes that encode Salmonella typhimurium and Klebsiella aerogenes PS CoI. Comparative sequence information suggests that pabB is encoded as the first gene in a multicistronic transcript. Comparison of deduced amino acid sequences of PS CoI genes indicates that the majority of sequence identity occurs in the C-terminal two-thirds of the proteins. Similarly, identities in an alignment of eight PS and AS CoI sequences are confined to the C-terminal segments of the proteins. Secondary-structure predictions for the nine sequences suggest considerable similarity in the folding of the C-terminal portions of the aminobenzoate synthases. PMID:3057324

  15. Taxonomy of phosphate solublizing bacteria

    Microsoft Academic Search

    P. Kämpfer

    Although phosphate solubilizing capabilities seem to be widespread within bacterial taxa, it is surprising, that the description\\u000a of phosphate solubilizing bacteria is restricted to relatively few bacterial genera. Among the bacteria, strains belonging\\u000a to the genus Rhizobium and related organisms have been investigated most extensively until now. In addition, several other organisms belonging to\\u000a taxonomically different and phylogenetic largely unrelated

  16. Methanogenic bacteria in mangrove sediments

    Microsoft Academic Search

    R. Mohanraju; R. Natarajan

    1992-01-01

    The occurrence of methanogenic bacteria in the Kodiakkarai (10° 18' N; 79° 52' E) mangrove sediments, whereAvicennia spp are predominant, was studied. Trimethylamine under N2:CO2 (80:20% v\\/v) was used as the substrate. Most Probable Number (MPN) of methanogenic bacteria was determined for a period of one year from July 1987 to June 1988 with monthly sampling. The methanogenic bacterial populations

  17. MICROBIOLOGY: How Bacteria Respire Minerals

    NSDL National Science Digital Library

    Dianne K. Newman (California Institute of Technology; Division of Geological and Planetary Sciences)

    2001-05-18

    Access to the article is free, however registration and sign-in are required: Some bacteria respire minerals; that is, they harvest energy from minerals through using them as electron acceptors. Many details of this respiration process have remained obscure. In her Perspective, Newman highlights the study by Lower et al., who have used a customized atomic force microscope to observe bacteria during mineral respiration.

  18. Genetic resources of nodule bacteria

    Microsoft Academic Search

    M. L. Roumiantseva

    2009-01-01

    Nodule bacteria (rhizobia) form highly specific symbiosis with leguminous plants. The efficiency of accumulation of biological\\u000a nitrogen depends on molecular-genetic interaction between the host plant and rhizobia. Genetic characteristics of microsymbiotic\\u000a strains are crucial in developing highly productive and stress-resistant symbiotic pairs: rhizobium strain-host plant cultivar\\u000a (species). The present review considers the issue of studying genetic resources of nodule bacteria

  19. Exploring Dangerous Connections between Klebsiella pneumoniae Biofilms and Healthcare-Associated Infections

    PubMed Central

    Bandeira, Maria; Almeida Carvalho, Patricia; Duarte, Aida; Jordao, Luisa

    2014-01-01

    Healthcare-associated infections (HAI) are a huge public health concern, particularly when the etiological agents are multidrug resistant. The ability of bacteria to develop biofilm is a helpful skill, both to persist within hospital units and to increase antibiotic resistance. Although the links between antibiotic resistance, biofilms assembly and HAI are consensual, little is known about biofilms. Here, electron microscopy was adopted as a tool to investigate biofilm structures associated with increased antibiotic resistance. The K. pneumoniae strains investigated are able to assemble biofilms, albeit with different kinetics. The biofilm structure and the relative area fractions of bacteria and extracellular matrix depend on the particular strain, as well as the minimal inhibitory concentration (MIC) for the antibiotics. Increased values were found for bacteria organized in biofilms when compared to the respective planktonic forms, except for isolates Kp45 and Kp2948, the MIC values for which remained unchanged for fosfomycin. Altogether, these results showed that the emergence of antimicrobial resistance among bacteria responsible for HAI is a multifactorial phenomenon dependent on antibiotics and on bacteria/biofilm features. PMID:25438020

  20. Bioreporter bacteria for landmine detection

    SciTech Connect

    Burlage, R.S. [Oak Ridge National Lab., TN (United States); Youngblood, T. [Frisby Technologies, Aiken, SC (United States); Lamothe, D. [American Technologies, Inc., Huntsville, AL (United States). Ordnance/Explosives Environmental Services Div.

    1998-04-01

    Landmines (and other UXO) gradually leak explosive chemicals into the soil at significant concentrations. Bacteria, which have adapted to scavenge low concentrations of nutrients, can detect these explosive chemicals. Uptake of these chemicals results in the triggering of specific bacterial genes. The authors have created genetically recombinant bioreporter bacteria that detect small concentrations of energetic chemicals. These bacteria are genetically engineered to produce a bioluminescent signal when they contact specific explosives. A gene for a brightly fluorescent compound can be substituted for increased sensitivity. By finding the fluorescent bacteria, you find the landmine. Detection might be accomplished using stand-off illumination of the minefield and GPS technology, which would result in greatly reduced risk to the deminers. Bioreporter technology has been proven at the laboratory scale, and will be tested under field conditions in the near future. They have created a bacterial strain that detects sub-micromolar concentrations of o- and p-nitrotoluene. Related bacterial strains were produced using standard laboratory protocols, and bioreporters of dinitrotoluene and trinitrotoluene were produced, screening for activity with the explosive compounds. Response time is dependent on the growth rate of the bacteria. Although frill signal production may require several hours, the bacteria can be applied over vast areas and scanned quickly, producing an equivalent detection speed that is very fast. This technology may be applicable to other needs, such as locating buried explosives at military and ordnance/explosive manufacturing facilities.

  1. Survival of coliforms and bacterial pathogens within protozoa during chlorination.

    PubMed Central

    King, C H; Shotts, E B; Wooley, R E; Porter, K G

    1988-01-01

    The susceptibility of coliform bacteria and bacterial pathogens to free chlorine residuals was determined before and after incubation with amoebae and ciliate protozoa. Viability of bacteria was quantified to determine their resistance to free chlorine residuals when ingested by laboratory strains of Acanthamoeba castellanii and Tetrahymena pyriformis. Cocultures of bacteria and protozoa were incubated to facilitate ingestion of the bacteria and then were chlorinated, neutralized, and sonicated to release intracellular bacteria. Qualitative susceptibility of protozoan strains to free chlorine was also assessed. Protozoa were shown to survive and grow after exposure to levels of free chlorine residuals that killed free-living bacteria. Ingested coliforms Escherichia coli, Citrobacter freundii, Enterobacter agglomerans, Enterobacter cloacae, Klebsiella pneumoniae, and Klebsiella oxytoca and bacterial pathogens Salmonella typhimurium, Yersinia enterocolitica, Shigella sonnei, Legionella gormanii, and Campylobacter jejuni had increased resistance to free chlorine residuals. Bacteria could be cultured from within treated protozoans well after the time required for 99% inactivation of free-living cells. All bacterial pathogens were greater than 50-fold more resistant to free chlorine when ingested by T. pyriformis. Escherichia coli ingested by a Cyclidium sp., a ciliate isolated from a drinking water reservoir, were also shown to be more resistant to free chlorine. The mechanism that increased resistance appeared to be survival within protozoan cells. This study indicates that bacteria can survive ingestion by protozoa. This bacterium-protozoan association provides bacteria with increased resistance to free chlorine residuals which can lead to persistence of bacteria in chlorine-treated water. We propose that resistance to digestion by predatory protozoa was an evolutionary precursor of pathogenicity in bacteria and that today it is a mechanism for survival of fastidious bacteria in dilute and inhospitable aquatic environments. Images PMID:3223766

  2. The yiaKLX1X2PQRS and ulaABCDEFG Gene Systems Are Required for the Aerobic Utilization of l-Ascorbate in Klebsiella pneumoniae Strain 13882 with l-Ascorbate-6-Phosphate as the Inducer?

    PubMed Central

    Campos, Evangelina; de la Riva, Lucia; Garces, Fernando; Giménez, Rosa; Aguilar, Juan; Baldoma, Laura; Badia, Josefa

    2008-01-01

    The capacity to both ferment and oxidize l-ascorbate has been widely documented for a number of enteric bacteria. Here we present evidence that all the strains of Klebsiella pneumoniae tested in this study ferment l-ascorbate using the ula regulon-encoded proteins. Under aerobic conditions, several phenotypes were observed for the strains. Our results showed that the yiaK-S system is required for this aerobic metabolic process. Gel shift experiments performed with UlaR and YiaJ and probes corresponding to the specific promoters indicated that l-ascorbate-6-phosphate is the effector molecule recognized by both regulators, since binding of the repressors to their recognition sites was impaired by the presence of this compound. We demonstrated that in K. pneumoniae cells l-ascorbate-6-phosphate is formed only by the action of the UlaABC phosphotransferase system. This finding explains why strains that lack the ula genetic system and therefore are unable to form the inducer intracellularly cannot efficiently use this vitamin as a carbon source under either anaerobic or aerobic conditions. Thus, efficient aerobic metabolism of l-ascorbate in K. pneumoniae is dependent on the presence of both the yiaK-S and ula systems. The expression of the yiaK-S operon, but not the expression of the ula regulon, is controlled by oxygen availability. Both systems are regulated by the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex and by IHF. PMID:18708499

  3. Bacteria Galore by Sunday at Four

    NSDL National Science Digital Library

    Mel Rosenberg

    This colorful picture book provides an introduction to the world of bacteria – where bacteria are found, what it is and how they spread. While the book is beautiful to look at, this children’s picture book is also full of accurate and interesting facts about bacteria. Author Dr. Mel Rosenberg emphasizes the colors, shapes, sizes, forms, and functions of bacteria.

  4. Prevalence and pattern of bacteria and intestinal parasites among food handlers in the Federal Capital Territory of Nigeria

    PubMed Central

    Ifeadike, C. O.; Ironkwe, O. C.; Adogu, P. O. U.; Nnebue, C. C.; Emelumadu, O. F.; Nwabueze, S. A.; Ubajaka, C. F.

    2012-01-01

    Background: In developing countries, biological contaminants largely bacteria and other parasites constitute the major causes of food-borne diseases often transmitted through food, water, nails, and fingers contaminated with faeces. Accordingly, food-handlers with poor personal hygiene could be potential sources of infections by these micro-organisms. Objective: This study was aimed at determining the prevalence and pattern of bacteria and intestinal parasites among food handlers in the Federal Capital Territory. Materials and Methods: The study was a descriptive one in which a multistage sampling technique was employed to select 168 food handlers of various types. Subjects’ stool, urine, and fingernail analyses were carried out and the result scientifically scrutinized. Results: Fingernail bacteria isolates include: E. Coli (1.8%), coagulase-negative staphylococcus (17.9%), Staphylococcus aureus(7.1%), Klebsiella species (2.4%), Serratia species (1.2%), Citrobacter species (1.2%), and Enterococcus species (1.8%). The subjects’ stool samples tested positive: For A. lumbricoides (14.9%), T. trichuria (1.8%), S. starcolaris (3.0%), E. histolytica (10.7%), G. lambilia (1.8%), S. mansoni (1.2%), and Taenia species (4.8%). Furthermore, 42.3% and 15.5% of the stool specimen tested positive for Salmonella and Shigella species, respectively. Conclusion: Food establishments should screen and treat staff with active illness, and regularly train them on good personal and workplace hygiene practices. PMID:23293419

  5. Microgravity effects on magnetotactic bacteria

    NASA Astrophysics Data System (ADS)

    Urban, James E.

    1998-01-01

    An unusual group of iron bacteria has recently been discovered which form inclusion bodies containing a form of iron oxide known as magnetite (ferrosoferric oxide, Fe3O4.) The inclusions are of a nano-particle size, are encased within a protein envelope, and are called magnetosomes. Magnetosomes are arranged adjacent to one another and parallel to the long axis of the cell such that cells appear to contain an electron-dense string of beads. The bacteria containing magnetosomes exhibit metal reductase activity, an activity critical to element recycling in nature, and the inclusions are a means for the organism to sequester reduced iron atoms and thereby keep iron reduction stoichiometry favorable. The magnetosomes also allow the bacteria to display magnetotaxis, which is movement in response to a magnetic field, such as the north or south magnetic poles. It is presumed that the bacteria use the alignment to the earth's magnetic field to orient themselves downward towards sediments where the habitat is favorable to their growth and metabolism. The comparatively few species of these bacteria isolated in the northern and southern hemispheres respond to magnetic north and south respectively, or alternatively respond only to the magnetic pole of the hemisphere from which they were isolated. This apparent dichotomy in response to magnetism could mean that the organisms are not responding to magnetism, per se, but instead are using the magnetosomes to respond to gravity. To resolve if magnetosomes respond to gravity in addition to magnetism we have used Magnetospirillum magnetotacticum, a well-studied magnetotactic bacterium isolated in the northern hemisphere, to examine magnetotactic behavior in the absence of gravity. Experiments to compare the orientation of Magnetospirillum magnetotacticum to north- or south-pole magnets were conducted in normal gravity and in the microgravity environments aboard the Space Shuttle and Space Station MIR. In each of the microgravity situations studied, bacteria were impaired in their ability to orient to magnets, suggesting that on earth the bacteria use magnetosomes to respond to gravity. These experiments could have significant commercial utility and could lead to the use of magnetosomes to direct biodegrading bacteria to contaminated aquifers or soils and likewise could be used to direct and localize bacteria used in element leaching and microbial mining.

  6. Role of the small RNA RyhB in the Fur regulon in mediating the capsular polysaccharide biosynthesis and iron acquisition systems in Klebsiella pneumoniae

    PubMed Central

    2012-01-01

    Background The capsular polysaccharide (CPS) and iron acquisition systems are important determinants of Klebsiella pneumoniae infections, and we have previously reported that the ferric uptake repressor (Fur) can play dual role in iron acquisition and CPS biosynthesis. In many bacteria, Fur negatively controls the transcription of the small non-coding RNA RyhB to modulate cellular functions and virulence. However, in K. pneumoniae, the role played by RyhB in the Fur regulon has not been characterised. This study investigated Fur regulation of ryhB transcription and the functional role of RyhB in K. pneumoniae. Results Deletion of fur from K. pneumoniae increased the transcription of ryhB; the electric mobility shift assay and the Fur-titration assay revealed that Fur could bind to the promoter region of ryhB, suggesting that Fur directly represses ryhB transcription. Additionally, in a ?fur strain with elevated CPS production, deletion of ryhB obviously reduced CPS production. The following promoter-reporter assay and quantitative real-time PCR of cps genes verified that RyhB activated orf1 and orf16 transcription to elevate CPS production. However, deletion of ryhB did not affect the mRNA levels of rcsA, rmpA, or rmpA2. These results imply that Fur represses the transcription of ryhB to mediate the biosynthesis of CPS, which is independent of RcsA, RmpA, and RmpA2. In addition, the ?fur strain’s high level of serum resistance was attenuated by the deletion of ryhB, indicating that RyhB plays a positive role in protecting the bacterium from serum killing. Finally, deletion of ryhB in ?fur reduced the expression of several genes corresponding to 3 iron acquisition systems in K. pneumoniae, and resulted in reduced siderophore production. Conclusions The regulation and functional role of RyhB in K. pneumoniae is characterized in this study. RyhB participates in Fur regulon to modulate the bacterial CPS biosynthesis and iron acquisition systems in K. pneumoniae. PMID:22827802

  7. Comparative analysis of the complete genome of KPC-2-producing Klebsiella pneumoniae Kp13 reveals remarkable genome plasticity and a wide repertoire of virulence and resistance mechanisms

    PubMed Central

    2014-01-01

    Background Klebsiella pneumoniae is an important opportunistic pathogen associated with nosocomial and community-acquired infections. A wide repertoire of virulence and antimicrobial resistance genes is present in K. pneumoniae genomes, which can constitute extra challenges in the treatment of infections caused by some strains. K. pneumoniae Kp13 is a multidrug-resistant strain responsible for causing a large nosocomial outbreak in a teaching hospital located in Southern Brazil. Kp13 produces K. pneumoniae carbapenemase (KPC-2) but is unrelated to isolates belonging to ST 258 and ST 11, the main clusters associated with the worldwide dissemination of KPC-producing K. pneumoniae. In this report, we perform a genomic comparison between Kp13 and each of the following three K. pneumoniae genomes: MGH 78578, NTUH-K2044 and 342. Results We have completely determined the genome of K. pneumoniae Kp13, which comprises one chromosome (5.3 Mbp) and six plasmids (0.43 Mbp). Several virulence and resistance determinants were identified in strain Kp13. Specifically, we detected genes coding for six beta-lactamases (SHV-12, OXA-9, TEM-1, CTX-M-2, SHV-110 and KPC-2), eight adhesin-related gene clusters, including regions coding for types 1 (fim) and 3 (mrk) fimbrial adhesins. The rmtG plasmidial 16S rRNA methyltransferase gene was also detected, as well as efflux pumps belonging to five different families. Mutations upstream the OmpK35 porin-encoding gene were evidenced, possibly affecting its expression. SNPs analysis relative to the compared strains revealed 141 mutations falling within CDSs related to drug resistance which could also influence the Kp13 lifestyle. Finally, the genetic apparatus for synthesis of the yersiniabactin siderophore was identified within a plasticity region. Chromosomal architectural analysis allowed for the detection of 13 regions of difference in Kp13 relative to the compared strains. Conclusions Our results indicate that the plasticity occurring at many hierarchical levels (from whole genomic segments to individual nucleotide bases) may play a role on the lifestyle of K. pneumoniae Kp13 and underlie the importance of whole-genome sequencing to study bacterial pathogens. The general chromosomal structure was somewhat conserved among the compared bacteria, and recombination events with consequent gain/loss of genomic segments appears to be driving the evolution of these strains. PMID:24450656

  8. In vitro pharmacodynamics of piperacillin, piperacillin-tazobactam, and ciprofloxacin alone and in combination against Staphylococcus aureus, Klebsiella pneumoniae, Enterobacter cloacae, and Pseudomonas aeruginosa.

    PubMed Central

    Hyatt, J M; Nix, D E; Stratton, C W; Schentag, J J

    1995-01-01

    The time-kill curve methodology was used to determine the pharmacodynamics of piperacillin, ciprofloxacin, piperacillin-tazobactam and the combinations piperacillin-ciprofloxacin and ciprofloxacin-piperacillin-tazobactam. Kill curve studies were performed for piperacillin, ciprofloxacin, and piperacillin-tazobactam at concentrations of 0.25 to 50 times the MICs for 13 strains of bacteria: four Pseudomonas aeruginosa, three Enterobacter cloacae, three Klebsiella pneumoniae, and three Staphylococcus aureus isolates (tazobactam concentrations of 0.5, 4, and 12 micrograms/ml). By using a sigmoid Emax model and nonlinear least squares regression, the 50% lethal concentrations and the maximum lethal rates of each agent were determined for each bacterial strain. For piperacillin-ciprofloxacin and ciprofloxacin-piperacillin-tazobactam, kill curve studies were performed with concentrations obtained by the fractional maximal effect method (R. C. Li, J. J. Schentag, and D. E. Nix, Antimicrob. Agents Chemother. 37:523-531, 1993) and from individual 50% lethal concentrations and maximum lethal rates. Ciprofloxacin-piperacillin-tazobactam was evaluated only against the four P. aeruginosa strains. Interactions between piperacillin and ciprofloxacin were generally additive. At physiologically relevant concentrations of piperacillin and ciprofloxacin, ciprofloxacin had the highest rates of killing against K. pneumoniae. Piperacillin-tazobactam (12 micrograms/ml) had the highest rate of killing against E. cloacae. Piperacillin-ciprofloxacin with relatively higher ciprofloxacin concentrations had the greatest killing rates against S. aureus. This combination had significantly higher killing rates than piperacillin (P < 0.002). For all the bacterial strains tested, killing rates by ciprofloxacin were significantly higher than those by piperacillin-tazobactam (4 and 12 micrograms/ml had significantly higher killing rates than piperacillin alone (P < 0.02 and P < 0.004, respectively). The effect of the combination of piperacillin-ciprofloxacin, in which piperacillin concentrations were relatively higher, was not statistically different from that of piperacillin alone (p > or = 0.71). The combination of ciprofloxacin-piperacillin-tazobactam achieved greater killing than other combinations or monotherapies against P. aeruginosa. The reduction in the initial inoculum was 1 to 4 logs greater with ciprofloxacin-piperacillin-tazobactam at 4 and 12 micrograms/ml than with any other agent or combination of agents. On the basis of the additive effects prevalently demonstrated in the in vitro study, the combinations of piperacillin-ciprofloxacin and piperacillin-tazobactam are rational therapeutic options. Greater killing of P. aeruginosa was demonstrated with ciprofloxacin-piperacillin--tazobactam. Since treatment failure of P. aeruginosa pneumonia is a significant problem, clinical studies are warranted. PMID:7486906

  9. Prevalence of Plasmid-Mediated AmpC Lactamases in a Chinese University Hospital from 2003 to 2005: First Report of CMY-2Type AmpC Lactamase Resistance in China

    Microsoft Academic Search

    Yi Li; Qing Li; Yuzhen Du; Xiaofei Jiang; Jin Tang; Jianqiang Wang; Guilan Li; Yanqun Jiang

    2008-01-01

    The aim of this study was to investigate the prevalences of plasmid-mediated AmpC -lactamases (PABLs) in isolates of Escherichia coli and Klebsiella spp. from a university hospital in China. A total of 1,935 consecutive nonrepeat clinical isolates of Escherichia coli, Klebsiella pneumoniae, and Klebsiella oxytoca were collected between January 2003 and July 2005. The isolates with cefoxitin zone diameters less

  10. Functional Genomic Screen Identifies Klebsiella pneumoniae Factors Implicated in Blocking Nuclear Factor ?B (NF-?B) Signaling*

    PubMed Central

    Tomás, Anna; Lery, Leticia; Regueiro, Verónica; Pérez-Gutiérrez, Camino; Martínez, Verónica; Moranta, David; Llobet, Enrique; González-Nicolau, Mar; Insua, Jose L.; Tomas, Juan M.; Sansonetti, Philippe J.; Tournebize, Régis; Bengoechea, José A.

    2015-01-01

    Klebsiella pneumoniae is an etiologic agent of community-acquired and nosocomial pneumonia. It has been shown that K. pneumoniae infections are characterized by reduced early inflammatory response. Recently our group has shown that K. pneumoniae dampens the activation of inflammatory responses by antagonizing the activation of the NF-?B canonical pathway. Our results revealed that K. pneumoniae capsule polysaccharide (CPS) was necessary but not sufficient to attenuate inflammation. To identify additional Klebsiella factors required to dampen inflammation, we standardized and applied a high-throughput gain-of-function screen to examine a Klebsiella transposon mutant library. We identified 114 mutants that triggered the activation of NF-?B. Two gene ontology categories accounted for half of the loci identified in the screening: metabolism and transport genes (32% of the mutants) and envelope-related genes (17%). Characterization of the mutants revealed that the lack of the enterobactin siderophore was linked to a reduced CPS expression, which in turn underlined the NF-?B activation induced by the mutant. The lipopolysaccharide (LPS) O-polysaccharide and the pullulanase (PulA) type 2 secretion system (T2SS) are required for full effectiveness of the immune evasion. Importantly, these factors do not play a redundant role. The fact that LPS O-polysaccharide and T2SS mutant-induced responses were dependent on TLR2-TLR4-MyD88 activation suggested that LPS O-polysaccharide and PulA perturbed Toll-like receptor (TLR)-dependent recognition of K. pneumoniae. Finally, we demonstrate that LPS O-polysaccharide and pulA mutants are attenuated in the pneumonia mouse model. We propose that LPS O-polysaccharide and PulA T2SS could be new targets for the design of new antimicrobials. Increasing TLR-governed defense responses might provide also selective alternatives for the management of K. pneumoniae pneumonia. PMID:25971969

  11. Klebsiella pneumoniae Increases the Levels of Toll-Like Receptors 2 and 4 in Human Airway Epithelial Cells?

    PubMed Central

    Regueiro, Verónica; Moranta, David; Campos, Miguel A.; Margareto, Javier; Garmendia, Junkal; Bengoechea, José A.

    2009-01-01

    Airway epithelial cells act as the first barrier against pathogens. These cells recognize conserved structural motifs expressed by microbial pathogens via Toll-like receptors (TLRs) expressed on the surface. In contrast to the level of expression in lymphoid cells, the level of expression of TLR2 and TLR4 in airway epithelial cells is low under physiological conditions. Here we explored whether Klebsiella pneumoniae upregulates the expression of TLRs in human airway epithelial cells. We found that the expression of TLR2 and TLR4 by A549 cells and human primary airway cells was upregulated upon infection with K. pneumoniae. The increased expression of TLRs resulted in enhancement of the cellular response upon stimulation with Pam3CSK4 and lipopolysaccharide, which are TLR2 and TLR4 agonists, respectively. Klebsiella-dependent upregulation of TLR expression occurred via a positive I?B?-dependent NF-?? pathway and via negative p38 and p44/42 mitogen-activated protein kinase-dependent pathways. We showed that Klebsiella-induced TLR2 and TLR4 upregulation was dependent on TLR activation. An isogenic capsule polysaccharide (CPS) mutant did not increase TLR2 and TLR4 expression. Purified CPS upregulated TLR2 and TLR4 expression, and polymyxin B did not abrogate CPS-induced TLR upregulation. Although no proteins were detected in the CPS preparation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and colloidal gold staining, we could not rule out the possibility that traces of protein in our CPS preparation could have been responsible, at least in part, for the TLR upregulation. PMID:19015258

  12. Functional Genomic Screen Identifies Klebsiella pneumoniae Factors Implicated in Blocking Nuclear Factor ?B (NF-?B) Signaling.

    PubMed

    Tomás, Anna; Lery, Leticia; Regueiro, Verónica; Pérez-Gutiérrez, Camino; Martínez, Verónica; Moranta, David; Llobet, Enrique; González-Nicolau, Mar; Insua, Jose L; Tomas, Juan M; Sansonetti, Philippe J; Tournebize, Régis; Bengoechea, José A

    2015-07-01

    Klebsiella pneumoniae is an etiologic agent of community-acquired and nosocomial pneumonia. It has been shown that K. pneumoniae infections are characterized by reduced early inflammatory response. Recently our group has shown that K. pneumoniae dampens the activation of inflammatory responses by antagonizing the activation of the NF-?B canonical pathway. Our results revealed that K. pneumoniae capsule polysaccharide (CPS) was necessary but not sufficient to attenuate inflammation. To identify additional Klebsiella factors required to dampen inflammation, we standardized and applied a high-throughput gain-of-function screen to examine a Klebsiella transposon mutant library. We identified 114 mutants that triggered the activation of NF-?B. Two gene ontology categories accounted for half of the loci identified in the screening: metabolism and transport genes (32% of the mutants) and envelope-related genes (17%). Characterization of the mutants revealed that the lack of the enterobactin siderophore was linked to a reduced CPS expression, which in turn underlined the NF-?B activation induced by the mutant. The lipopolysaccharide (LPS) O-polysaccharide and the pullulanase (PulA) type 2 secretion system (T2SS) are required for full effectiveness of the immune evasion. Importantly, these factors do not play a redundant role. The fact that LPS O-polysaccharide and T2SS mutant-induced responses were dependent on TLR2-TLR4-MyD88 activation suggested that LPS O-polysaccharide and PulA perturbed Toll-like receptor (TLR)-dependent recognition of K. pneumoniae. Finally, we demonstrate that LPS O-polysaccharide and pulA mutants are attenuated in the pneumonia mouse model. We propose that LPS O-polysaccharide and PulA T2SS could be new targets for the design of new antimicrobials. Increasing TLR-governed defense responses might provide also selective alternatives for the management of K. pneumoniae pneumonia. PMID:25971969

  13. 1,3-Propanediol production by Escherichia coli expressing genes from the Klebsiella pneumoniae dha regulon.

    PubMed Central

    Tong, I T; Liao, H H; Cameron, D C

    1991-01-01

    The dha regulon in Klebsiella pneumoniae enables the organism to grow anaerobically on glycerol and produce 1,3-propanediol (1,3-PD). Escherichia coli, which does not have a dha system, is unable to grow anaerobically on glycerol without an exogenous electron acceptor and does not produce 1,3-PD. A genomic library of K. pneumoniae ATCC 25955 constructed in E. coli AG1 was enriched for the ability to grow anaerobically on glycerol and dihydroxyacetone and was screened for the production of 1,3-PD. The cosmid pTC1 (42.5 kb total with an 18.2-kb major insert) was isolated from a 1,3-PD-producing strain of E. coli and found to possess enzymatic activities associated with four genes of the dha regulon: glycerol dehydratase (dhaB), 1,3-PD oxidoreductase (dhaT), glycerol dehydrogenase (dhaD), and dihydroxyacetone kinase (dhaK). All four activities were inducible by the presence of glycerol. When E. coli AG1/pTC1 was grown on complex medium plus glycerol, the yield of 1,3-PD from glycerol was 0.46 mol/mol. The major fermentation by-products were formate, acetate, and D-lactate. 1,3-PD is an intermediate in organic synthesis and polymer production. The 1,3-PD fermentation provides a useful model system for studying the interaction of a biochemical pathway in a foreign host and for developing strategies for metabolic pathway engineering. Images PMID:1785929

  14. Impact of growth conditions on resistance of Klebsiella pneumoniae to chloramines.

    PubMed Central

    Stewart, M H; Olson, B H

    1992-01-01

    The resistance of Klebsiella pneumoniae to inorganic monochloramine (1.5 mg/liter; 3:1 Cl2:N ratio, pH 8.0) was examined in relation to growth phase, temperature of growth, and growth under decreased nutrient conditions. Growth phase did not impact resistance to chloramines. Mid-exponential and stationary-phase cells, grown in a yeast extract-based medium, had CT99 values and standard deviations of 4.8 +/- 0.1 and 4.6 +/- 0.2 mg.min/liter, respectively. Growth temperature did not alter chloramine resistance at short contact times. CT99 values of cells grown at 15 and 23 degrees C were 4.5 +/- 0.2 and 4.6 +/- 0.2 mg.min/liter, respectively. However, at longer contact times, CT99.99 values of cells grown at 15 and 23 degrees C were 14 and 8 mg.min/liter, respectively, suggesting a small resistant subpopulation for cells grown at the lower temperature. Growth under decreased nutrient conditions resulted in a concomitant increase in resistance to chloramines. When K. pneumoniae was grown in undiluted Ristroph medium and Ristroph medium diluted by 1:100 and 1:1,000, the CT99 values were 4.6 +/- 0.2, 9.6 +/- 0.4, and 24 +/- 7.0 mg.min/liter, respectively. These results indicate that nutrient availability has a greater impact than growth phase or growth temperature in promoting the resistance of K. pneumoniae to inorganic monochloramine. PMID:1514811

  15. Pyrroloquinoline Quinone Biogenesis: Demonstration that PqqE from Klebsiella pneumoniae is a Radical SAM Enzyme†

    PubMed Central

    Wecksler, Stephen R.; Stoll, Stefan; Tran, Ha; Magnusson, Olafur T.; Wu, Shu-pao; King, David; Britt, R. David; Klinman, Judith P.

    2009-01-01

    Biogenesis of pyrroloquinoline quinone (PQQ) in Klebsiella pneumoniae requires the expression of six genes (pqqA-F). One of these genes (pqqE) encodes a 43 kDa protein (PqqE) that plays a role in the initial steps in PQQ formation (Veletrop et al. (1995) J. Bacteriol. 177, 5088-5098). PqqE contains two highly conserved cysteine motifs at the N and C-termini, with the N-terminal motif comprised of a consensus sequence of CX3CX2C that is unique to a family of proteins known as radical S-adenosyl-L-methionine (SAM) enzymes (Sofia et al. (2001) Nucleic Acids Res. 29, 1097-1106). PqqE from K. pneumoniae was cloned into E. coli and expressed as the native protein and with an N-terminal His6-tag. Anaerobic expression and purification of the His6-tag PqqE results in an enzyme with a brownish-red hue indicative of Fe-S cluster formation. Spectroscopic and physical analyses indicate that PqqE contains a mixture of Fe-S clusters, with the predominant form of the enzyme containing two [4Fe-4S] clusters. PqqE isolated anaerobically yields active enzyme capable of cleaving SAM to methionine and 5?-deoxyadenosine in an uncoupled reaction (kobs = 0.011 ± 0.001 min-1). In this reaction, the 5?-deoxyadenosyl radical either abstracts a hydrogen atom from a solvent accessible position in the enzyme or obtains a proton and electron from buffer. The putative PQQ substrate PqqA has not yet been shown to be modified by PqqE, implying either that PqqA must be modified before becoming the substrate for PqqE and/or that another protein in the biosynthetic pathway is critical for the initial steps in PQQ biogenesis. PMID:19746930

  16. Quorum quenching activity of Syzygium cumini (L.) Skeels and its anthocyanin malvidin against Klebsiella pneumoniae.

    PubMed

    Gopu, Venkadesaperumal; Kothandapani, Sundar; Shetty, Prathapkumar Halady

    2015-02-01

    Many bacterial species use their intercellular signaling mechanism called quorum sensing (QS), which is found to be implicated in various factors including bacterial pathogenicity and food spoilage. Interrupting the bacterial communication is an attractive strategy to develop novel QS-based antibacterial drugs. Present study is aimed to investigate the quorum sensing inhibitory activity of Syzygium cumini and its anti-biofilm property against opportunistic pathogen using a biosensor strain Chromobacterium violaceum CV026. Ethanol extract of S. cumini was investigated for its anti-QS activity, and the possible active component was identified by docking with LasR receptor protein. Based on docking analysis, methanol extract was enriched for its total anthocyanin (STA) and its effect on QS regulated phenotypes was assessed. STA specifically inhibited the violacein production in C. violaceum; biofilm formation and EPS production in Klebsiella pneumoniae up to 82, 79.94 and 64.29% respectively. Synergistic activity of conventional antibiotics with STA enhanced the susceptibility of K. pneumoniae up to 58.45%. Molecular docking analysis of active components attributes the QSI activity of S. cumini to malvidin. Malvidin exhibited highest ligand binding with LasR receptor protein with docking score more than -7. Effect of malvidin to interrupt the QS regulated phenotypes was also assessed, and it was found to reduce the violacein production, biofilm formation and EPS production of K. pneumoniae in a concentration-dependent manner. These findings suggest that S. cumini can be used as novel QS-based antibacterial/anti-biofilm agent to manage food-borne pathogens and to increase food safety. PMID:25637095

  17. Homology modeling, molecular docking and electrostatic potential analysis of MurF ligase from Klebsiella pneumonia.

    PubMed

    Sivaramakrishnan, Venkatabalasubramanian; Thiyagarajan, Chinnaiyan; Kalaivanan, Sivakumaran; Selvakumar, Raj; Anusuyadevi, Muthuswamy; Jayachandran, Kesavan Swaminathan

    2012-01-01

    In spite of availability of moderately protective vaccine and antibiotics, new antibacterial agents are urgently needed to decrease the global incidence of Klebsiella pneumonia infections. MurF ligase, a key enzyme, which participates in the bacterial cell wall assembly, is indispensable to existence of K. pneumonia. MurF ligase lack mammalian vis-à-vis and have high specificity, uniqueness, and occurrence only in eubacteria, epitomizing them as promising therapeutic targets for intervention. In this study, we present a unified approach involving homology modeling and molecular docking studies on MurF ligase enzyme. As part of this study, a homology model of K. pneumonia (MurF ligase) enzyme was predicted for the first time in order to carry out structurebased drug design. The accuracy of the model was further validated using different computational approaches. The comparative molecular docking study on this enzyme was undertaken using different phyto-ligands from Desmodium sp. and a known antibiotic Ciprofloxacin. The docking analysis indicated the importance of hotspots (HIS 281 and ASN 282) within the MurF binding pocket. The Lipinski's rule of five was analyzed for all ligands considered for this study by calculating the ADME/Tox, drug likeliness using Qikprop simulation. Only ten ligands were found to comply with the Lipinski rule of five. Based on the molecular docking results and Lipinki values 6-Methyltetrapterol A was confirmed as a promising lead compound. The present study should therefore play a guiding role in the experimental design and development of 6-Methyltetrapterol A as a bactericidal agent. PMID:22715301

  18. Correlation of Klebsiella pneumoniae Comparative Genetic Analyses with Virulence Profiles in a Murine Respiratory Disease Model

    PubMed Central

    Tam, Hok-Hei; Yan, Pearlly; Pfeffer, Tia L.; Bundschuh, Ralf; Warawa, Jonathan M.

    2014-01-01

    Klebsiella pneumoniae is a bacterial pathogen of worldwide importance and a significant contributor to multiple disease presentations associated with both nosocomial and community acquired disease. ATCC 43816 is a well-studied K. pneumoniae strain which is capable of causing an acute respiratory disease in surrogate animal models. In this study, we performed sequencing of the ATCC 43816 genome to support future efforts characterizing genetic elements required for disease. Furthermore, we performed comparative genetic analyses to the previously sequenced genomes from NTUH-K2044 and MGH 78578 to gain an understanding of the conservation of known virulence determinants amongst the three strains. We found that ATCC 43816 and NTUH-K2044 both possess the known virulence determinant for yersiniabactin, as well as a Type 4 secretion system (T4SS), CRISPR system, and an acetonin catabolism locus, all absent from MGH 78578. While both NTUH-K2044 and MGH 78578 are clinical isolates, little is known about the disease potential of these strains in cell culture and animal models. Thus, we also performed functional analyses in the murine macrophage cell lines RAW264.7 and J774A.1 and found that MGH 78578 (K52 serotype) was internalized at higher levels than ATCC 43816 (K2) and NTUH-K2044 (K1), consistent with previous characterization of the antiphagocytic properties of K1 and K2 serotype capsules. We also examined the three K. pneumoniae strains in a novel BALB/c respiratory disease model and found that ATCC 43816 and NTUH-K2044 are highly virulent (LD50<100 CFU) while MGH 78578 is relatively avirulent. PMID:25203254

  19. Bloodstream infections among carriers of carbapenem-resistant Klebsiella pneumoniae: etiology, incidence and predictors.

    PubMed

    Amit, S; Mishali, H; Kotlovsky, T; Schwaber, M J; Carmeli, Y

    2015-01-01

    Carriers of carbapenem-resistant Klebsiella pneumoniae (CRKP) are increasingly recognised through active surveillance in much of the world. We studied incidence, aetiology and predictors of bloodstream infections (BSI) among such carriers. Via a retrospective cohort study conducted in a tertiary care teaching hospital, we examined occurrence of BSI within 45 days of CRKP carrier detection. Three nested case-control studies were conducted to analyse parameters associated with all-cause (ALL), Gram-negative rod (GNR) and CRKP BSI. Cases and controls were compared with respect to demographics, clinical parameters and recent receipt of antibiotics. A total of 431 patients were identified as CRKP carriers (28% by clinical culture, 72% by rectal surveillance), mean age was 75.2 years. Twenty percent of the patients (n = 85) developed BSI, of them 80% (n = 68) with GNR. Of 83 GNR isolates, 58 (70%) were Enterobacteriaceae, of which 19 were CRKP and 20 were extended-spectrum ?-lactamase (ESBL) producers (23% and 24% of total GNR, respectively); 29% of the GNR isolates were nonfermenters (14.5% Pseudomonas aeruginosa, 14.5% Acinetobacter baumannii). Mechanical ventilation predicted ALL BSI (p = 0.04), whereas Clostridium difficile-associated diarrhoea predicted GNR BSI (p = 0.04). Receipt of broad-spectrum antibiotics (piperacillin-tazobactam, amikacin, imipenem) was significantly associated with ALL BSI or GNR BSI. No exposure independently predicted CRKP BSI. We conclude that patients detected as CRKP carriers are at high risk for BSI within 45 days of detection, primarily with multidrug-resistant GNR. Lack of predictive factors differentiating between pathogens and associated high mortality raises once more the dilemma regarding the appropriate empiric therapy for CRKP carriers who develop severe sepsis. PMID:25636924

  20. Analysis of complement C3 deposition and degradation on Klebsiella pneumoniae.

    PubMed

    Albertí, S; Alvarez, D; Merino, S; Casado, M T; Vivanco, F; Tomás, J M; Benedí, V J

    1996-11-01

    The majority of Klebsiella pneumoniae serum-resistant strains activate complement and bind C3b, the opsonic fragment of C3, without C5b-9 formation and bacterial killing. The mechanisms leading to C3b deposition without cell death were studied, and the results indicate that serum-resistant strains activate principally the alternative pathway and that serum-sensitive strains activate both the alternative and classical pathways. Bacterial molecules implicated in C3b deposition are the outer membrane porin proteins and smooth and rough lipopolysaccharides. Porins activate both complement pathways, and the rough lipopolysaccharide activates the classical pathway, causing deposition of C3b in serum-sensitive strains. The smooth lipopolysaccharide of serum-resistant strains activates only the alternative pathway, impeding the binding of C1q to porins (S. Albertí, G. Marqués, S. Camprubí, S. Merino, J. M. Tomás, F. Vivanco, and V. J. Benedí, Infect. Immun. 61:852-860, 1993; S. Albertí, F. Rodríguez-Quinónes, T. Schirmer, G. Rummel, J. M. Tomás, J. P. Rosenbusch, and V. J. Benedí, Infect. Immun. 63:903-910, 1995) and rough lipopolysaccharide molecules and thereby preventing activation of the classical pathway. After its deposition, C3b is quickly degraded to iC3b on both types of strains, but the higher-level deposition of C3b on serum-sensitive strains, resulting from activation of both the alternative and classical complement pathways, supports further complement activation and killing of serum-sensitive strains. PMID:8890232

  1. Clonal Dissemination of OXA-370-Producing Klebsiella pneumoniae in Rio de Janeiro, Brazil.

    PubMed

    Pereira, Polyana Silva; Borghi, Mirla; de Araújo, Carlos Felipe Machado; Aires, Caio Augusto Martins; Oliveira, Jane Cleide Ribeiro; Asensi, Marise Dutra; Carvalho-Assef, Ana Paula D'Alincourt

    2015-08-01

    Enzymes of the OXA-48 family have become some of the most important beta-lactamases in the world. A new OXA-48 variant (OXA-370) was first described for an Enterobacter hormaechei strain isolated in Rio Grande do Sul (southern region of Brazil) in 2013. Here we report detection of the blaOXA-370 gene in 24 isolates belonging to three Enterobacteriaceae species (22 Klebsiella pneumoniae isolates, 1 Enterobacter cloacae isolate, and 1 Enterobacter aerogenes isolate) collected from five hospitals in Rio de Janeiro, Brazil, in 2013 and 2014. The isolates showed a multidrug resistance profile, and 12.5% were resistant to polymyxin B. Besides blaOXA-370, no other carbapenemase genes were observed by PCR, whereas blaOXA-1 was found in all isolates and 22 isolates (91.6%) possessed blaCTX-M-15. Molecular typing of the K. pneumoniae isolates by pulsed-field gel electrophoresis (PFGE) showed the presence of two clonal groups, i.e., KpA (21 isolates) and KpB (1 isolate). KpA was characterized as sequence type 16 (ST16) and KpB as ST1041 by multilocus sequence typing (MLST). ST16 has been observed for KPC-producing K. pneumoniae in Rio de Janeiro. Plasmid analysis performed with six representative OXA-370-producing isolates showed plasmids harboring the blaOXA-370 gene in all strains, ranging from 25 kb to 150 kb. This study suggests that there is an urgent need to investigate the presence of OXA-370 and dissemination of the K. pneumoniae ST16 clone carrying this gene in Brazil. PMID:25987619

  2. In vitro evaluation of antibiotic synergy for polymyxin B-resistant carbapenemase-producing Klebsiella pneumoniae.

    PubMed

    Elemam, Azza; Rahimian, Joseph; Doymaz, Mehmet

    2010-10-01

    Since carbapenemase-producing Klebsiella pneumoniae strains were first reported in North Carolina, these highly resistant organisms have been isolated with increasing frequency, especially in the New York City area. Polymyxin B is one of the few antimicrobials that retain reliable activity against these organisms. However, polymyxin B MICs are elevated against K. pneumoniae isolates with increasing frequency, leaving clinicians with few therapeutic options. We investigated several antimicrobial agents for potential synergy with polymyxin B against 12 clinical strains of carbapenemase-producing K. pneumoniae. A broth microdilution assay using a 96-well plate was developed in which graded dilutions of polymyxin B and the study drug were incubated with resistant isolates in a checkerboard pattern. Polymyxin B was studied in combination with cefazolin, ceftriaxone, cefepime, imipenem, gentamicin, tigecycline, doxycycline, and rifampin. All K. pneumoniae strains tested positive for K. pneumoniae carbapenemase (KPC) genes by real-time PCR and had elevated polymyxin B MIC values ranging from 16 to 128 ?g/ml. Synergy was observed with the combination of polymyxin B and rifampin as well as with polymyxin B and doxycycline, resulting in at least a 4-fold decrease in the polymyxin B MIC. For both combinations, this effect occurred at physiologically achievable concentrations. Less pronounced synergy was noted with tigecycline and polymyxin B. No synergy was observed at physiologic concentrations with the other antimicrobials studied. These results suggest that rifampin, doxycycline, and tigecycline may be useful additions to polymyxin B in the treatment of infections caused by highly resistant carbapenemase-producing K. pneumoniae. Further studies are warranted to determine if these in vitro findings translate into clinical efficacy. PMID:20686085

  3. 1,3-Propanediol production by Escherichia coli expressing genes from the Klebsiella pneumoniae dha regulon

    SciTech Connect

    I-Teh Tong; Hans H. Liao; Cameron, D.C. (Univ. of Wisconsin, Madison (United States))

    1991-12-01

    The dha regulon in Klebsiella pneumoniae enables the organism to grown anaerobically on glycerol and produce 1,3-propanediol (1,3-PD). Escherichia coli, which does not have a dha system, is unable to grow anaerobically on glycerol without an exogenous electron acceptor and does not produce 1,3-PD. A genomic library of K. pneumoniae ATCC 25955 constructed in E. coli AG1 was enriched for the ability to grow anaerobically on glycerol and dihydoxyacetone and was screened for the production of 1, 3-PD. The cosmid pTC1 (42.5 kn total with an 18.2-kb major insert) was isolated from a 1,3-PD-producing strain of E. coli and found to possess enzymatic activities associated with four genes of the dha regulon: glycersol dehydratase (dhaB), 1,3-PD oxidoreductase (dhaT), glycerol dehydrogenase (dhaD), and dihydroxyacetone kinase (dhaK). All four activities were inducible by the presence of glycerol. When E. coli AG1/pTC1 was grown on complex medium plus glycerol, the yield of 1, 3-PD from glycerol was 0.46 mol/mol. The major fermentation by-products were formate, acetate, and D-lactate. 1,3-PD is an intermediate in organic synthesis and polymer production. The 1,3-PD fermentation provides a useful model system for studying the interaction of a biochemical pathway in a foreign host and for developing strategies for metabolic pathway engineering.

  4. Klebsiella pneumoniae bloodstream infection: epidemiology and impact of inappropriate empirical therapy.

    PubMed

    Girometti, Nicolò; Lewis, Russell E; Giannella, Maddalena; Ambretti, Simone; Bartoletti, Michele; Tedeschi, Sara; Tumietto, Fabio; Cristini, Francesco; Trapani, Filippo; Gaibani, Paolo; Viale, Pierluigi

    2014-10-01

    Multidrug resistance associated with extended-spectrum beta-lactamase (ESBL) and Klebsiella pneumoniae carbapenemase (KPC) among K. pneumoniae is endemic in southern Europe. We retrospectively analyzed the impact of resistance on the appropriateness of empirical therapy and treatment outcomes of K. pneumoniae bloodstream infections (BSIs) during a 2-year period at a 1420-bed tertiary-care teaching hospital in northern Italy. We identified 217 unique patient BSIs, including 92 (42%) KPC-positive, 49 (23%) ESBL-positive, and 1 (0.5%) metallo-beta-lactamase-positive isolates. Adequate empirical therapy was administered in 74% of infections caused by non-ESBL non-KPC strains, versus 33% of ESBL and 23% of KPC cases (p < 0.0001). To clarify the impact of resistance on BSI treatment outcomes, we compared several different models comprised of non-antibiotic treatment-related factors predictive of patients' 30-day survival status. Acute Physiology and Chronic Health Evaluation (APACHE) II score determined at the time of positive blood culture was superior to other investigated models, correctly predicting survival status in 83% of the study cohort. In multivariate analysis accounting for APACHE II, receipt of inadequate empirical therapy was associated with nearly a twofold higher rate of death (adjusted hazard ratio 1.9, 95% confidence interval 1.1-3.4; p = 0.02). Multidrug-resistant K. pneumoniae accounted for two-thirds of all K. pneumoniae BSIs, high rates of inappropriate empirical therapy, and twofold higher rates of patient death irrespective of underlying illness. PMID:25398065

  5. Epidemiology and molecular characterization of bacteremia due to carbapenem-resistant Klebsiella pneumoniae in transplant recipients.

    PubMed

    Clancy, C J; Chen, L; Shields, R K; Zhao, Y; Cheng, S; Chavda, K D; Hao, B; Hong, J H; Doi, Y; Kwak, E J; Silveira, F P; Abdel-Massih, R; Bogdanovich, T; Humar, A; Perlin, D S; Kreiswirth, B N; Hong Nguyen, M

    2013-10-01

    We conducted a retrospective study of 17 transplant recipients with carbapenem-resistant Klebsiella pneumoniae bacteremia, and described epidemiology, clinical characteristics and strain genotypes. Eighty-eight percent (15/17) of patients were liver or intestinal transplant recipients. Outcomes were death due to septic shock (18%), cure (24%) and persistent (>7 days) or recurrent bacteremia (29% each). Thirty- and 90-day mortality was 18% and 47%, respectively. Patients who were cured received at least one active antimicrobial agent and underwent source control interventions. Forty-one percent (7/17) of patients had intra-abdominal infections; all except one developed persistent/recurrent bacteremia despite drainage. Two patients tolerated persistent bacteremia for >300 days. All patients except one were infected with sequence type 258 (ST258), K. pneumoniae carbapenemase (KPC)-2-producing strains harboring a mutant ompK35 porin gene; the exception was infected with an ST37, KPC-3-producing strain. Seventy-one percent (12/17) of patients were infected with ST258 ompK36 mutant strains. In two patients, persistent bacteremia was caused by two strains with different ompK36 genotypes. Three ompK36 mutations were associated with significantly higher carbapenem minimum inhibitory concentrations than wild-type ompK36. Pulse-field gel electrophoresis identified a single ST258 lineage; serial strains from individual patients were indistinguishable. In conclusion, KPC-K. pneumoniae bacteremia exhibited highly diverse clinical courses following transplantation, and was caused by clonal ST258 strains with different ompK36 genotypes. PMID:24011185

  6. Minim Typing – A Rapid and Low Cost MLST Based Typing Tool for Klebsiella pneumoniae

    PubMed Central

    Andersson, Patiyan; Tong, Steven Y. C.; Bell, Jan M.; Turnidge, John D.; Giffard, Philip M.

    2012-01-01

    Here we report a single nucleotide polymorphism (SNP) based genotyping method for Klebsiella pneumoniae utilising high-resolution melting (HRM) analysis of fragments within the multilocus sequence typing (MLST) loci. The approach is termed mini-MLST or Minim typing and it has previously been applied to Streptococcus pyogenes, Staphylococcus aureus and Enterococcus faecium. Six SNPs were derived from concatenated MLST sequences on the basis of maximisation of the Simpsons Index of Diversity (D). DNA fragments incorporating these SNPs and predicted to be suitable for HRM analysis were designed. Using the assumption that HRM alleles are defined by G+C content, Minim typing using six fragments was predicted to provide a D?=?0.979 against known STs. The method was tested against 202 K. pneumoniae using a blinded approach in which the MLST analyses were performed after the HRM analyses. The HRM-based alleles were indeed in accordance with G+C content, and the Minim typing identified known STs and flagged new STs. The tonB MLST locus was determined to be very diverse, and the two Minim fragments located herein contribute greatly to the resolving power. However these fragments are refractory to amplification in a minority of isolates. Therefore, we assessed the performance of two additional formats: one using only the four fragments located outside the tonB gene (D?=?0.929), and the other using HRM data from these four fragments in conjunction with sequencing of the tonB MLST fragment (D?=?0.995). The HRM assays were developed on the Rotorgene 6000, and the method was shown to also be robust on the LightCycler 480, allowing a 384-well high through-put format. The assay provides rapid, robust and low-cost typing with fully portable results that can directly be related to current MLST data. Minim typing in combination with molecular screening for antibiotic resistance markers can be a powerful surveillance tool kit. PMID:22428067

  7. Redistribution of Carbon Flux toward 2,3-Butanediol Production in Klebsiella pneumoniae by Metabolic Engineering

    PubMed Central

    Jeong, Daun; Yang, Jeongmo; Oh, Min-Kyu; Lee, Jinwon

    2014-01-01

    Klebsiella pneumoniae KCTC2242 has high potential in the production of a high-value chemical, 2,3-butanediol (2,3-BDO). However, accumulation of metabolites such as lactate during cell growth prevent large-scale production of 2,3-BDO. Consequently, we engineered K. pneumoniae to redistribute its carbon flux toward 2,3-BDO production. The ldhA gene deletion and gene overexpression (budA and budB) were conducted to block a pathway that competitively consumes reduced nicotinamide adenine dinucleotide and to redirect carbon flux toward 2,3-BDO biosynthesis, respectively. These steps allowed efficient glucose conversion to 2,3-BDO under slightly acidic conditions (pH 5.5). The engineered strain SGSB105 showed a 40% increase in 2,3-BDO production from glucose compared with that of the host strain, SGSB100. Genes closely related to 2,3-BDO biosynthesis were observed at the gene transcription level by cultivating the SGSB100, SGSB103, SGSB104, and SGSB105 strains under identical growth conditions. Transcription levels for budA, budB, and budC increased approximately 10% during the log phase of cell growth relative to that of SGSB100. Transcription levels of 2,3-BDO genes in SGSB105 remained high during the log and stationary phases. Thus, the carbon flux was redirected toward 2,3-BDO production. Data on batch culture and gene transcription provide insight into improving the metabolic network for 2,3-BDO biosynthesis for industrial applications. PMID:25329548

  8. Genome-Wide Identification of Klebsiella pneumoniae Fitness Genes during Lung Infection

    PubMed Central

    Breen, Paul; Deornellas, Valerie; Mu, Qiao; Zhao, Lili; Wu, Weisheng; Cavalcoli, James D.; Mobley, Harry L. T.

    2015-01-01

    ABSTRACT Klebsiella pneumoniae is an urgent public health threat because of resistance to carbapenems, antibiotics of last resort against Gram-negative bacterial infections. Despite the fact that K. pneumoniae is a leading cause of pneumonia in hospitalized patients, the bacterial factors required to cause disease are poorly understood. Insertion site sequencing combines transposon mutagenesis with high-throughput sequencing to simultaneously screen thousands of insertion mutants for fitness defects during infection. Using the recently sequenced K. pneumoniae strain KPPR1 in a well-established mouse model of pneumonia, insertion site sequencing was performed on a pool of >25,000 transposon mutants. The relative fitness requirement of each gene was ranked based on the ratio of lung to inoculum read counts and concordance between insertions in the same gene. This analysis revealed over 300 mutants with at least a 2-fold fitness defect and 69 with defects ranging from 10- to >2,000-fold. Construction of 6 isogenic mutants for use in competitive infections with the wild type confirmed their requirement for lung fitness. Critical fitness genes included those for the synthesis of branched-chain and aromatic amino acids that are essential in mice and humans, the transcriptional elongation factor RfaH, and the copper efflux pump CopA. The majority of fitness genes were conserved among reference strains representative of diverse pathotypes. These results indicate that regulation of outer membrane components and synthesis of amino acids that are essential to its host are critical for K. pneumoniae fitness in the lung. PMID:26060277

  9. Risk factors and clinical significance of ertapenem-resistant Klebsiella pneumoniae in hospitalised patients.

    PubMed

    Orsi, G B; García-Fernández, A; Giordano, A; Venditti, C; Bencardino, A; Gianfreda, R; Falcone, M; Carattoli, A; Venditti, M

    2011-05-01

    Ertapenem-resistant Klebsiella pneumoniae (ER-Kp) is an emerging healthcare-associated pathogen. In order to identify risk factors associated with ER-Kp acquisition, the records of 100 patients from whom K. pneumoniae had been isolated between July 2008 and December 2009 were reviewed. These comprised 38 with ER-Kp (28 infected, 10 colonised) and 62 with ertapenem-susceptible K. pneumoniae (ES-Kp) (43 infected, 19 colonised). Multilocus sequence typing (MSLT) and porin gene investigation performed on 25 ER-Kp strains showed that 24 belonged to the ST37 lineage, expressing a novel OmpK36 variant and not expressing OmpK35. Breakthrough bacteraemia occurred in 13 (52%) of 25 bloodstream infections (BSIs). Among nine ER-Kp BSIs, five were complicated by breakthrough bacteraemia, of which four developed during carbapenem therapy. Among 16 ES-Kp BSIs, breakthrough bacteraemia developed in eight patients (50%), but only one occurred (12%) during carbapenem therapy. Logistic regression analysis showed that carbapenems (odds ratio: 12.9; 95% confidence interval: 3.09-53.7; P < 0.001), second generation cephalosporins (11.8; 1.87-74.4; P < 0.01), endoscopy (5.59; 1.32-23.6; P < 0.02), acute renal failure (5.32; 1.13-25.1; P=0.034) and third generation cephalosporins (4.15; 1.09-15.8; P < 0.01) were independent risk factors for acquisition of ER-Kp. Our findings confirm that prior use of certain antimicrobials, specifically carbapenems and cephalosporins, are primary independent risk factors for colonisation or infection with ER-Kp. PMID:21450365

  10. Klebsiella pneumoniae Outer Membrane Protein A Is Required to Prevent the Activation of Airway Epithelial Cells*

    PubMed Central

    March, Catalina; Moranta, David; Regueiro, Verónica; Llobet, Enrique; Tomás, Anna; Garmendia, Junkal; Bengoechea, José A.

    2011-01-01

    Outer membrane protein A (OmpA) is a class of proteins highly conserved among the Enterobacteriaceae family and throughout evolution. Klebsiella pneumoniae is a capsulated Gram-negative pathogen. It is an important cause of community-acquired and nosocomial pneumonia. Evidence indicates that K. pneumoniae infections are characterized by a lack of an early inflammatory response. Data from our laboratory indicate that K. pneumoniae CPS helps to suppress the host inflammatory response. However, it is unknown whether K. pneumoniae employs additional factors to modulate host inflammatory responses. Here, we report that K. pneumoniae OmpA is important for immune evasion in vitro and in vivo. Infection of A549 and normal human bronchial cells with 52OmpA2, an ompA mutant, increased the levels of IL-8. 52145-?wcaK2ompA, which does not express CPS and ompA, induced the highest levels of IL-8. Both mutants could be complemented. In vivo, 52OmpA2 induced higher levels of tnf?, kc, and il6 than the wild type. ompA mutants activated NF-?B, and the phosphorylation of p38, p44/42, and JNK MAPKs and IL-8 induction was via NF-?B-dependent and p38- and p44/42-dependent pathways. 52OmpA2 engaged TLR2 and -4 to activate NF-?B, whereas 52145-?wcaK2ompA activated not only TLR2 and TLR4 but also NOD1. Finally, we demonstrate that the ompA mutant is attenuated in the pneumonia mouse model. The results of this study indicate that K. pneumoniae OmpA contributes to attenuate airway cell responses. This may facilitate pathogen survival in the hostile environment of the lung. PMID:21278256

  11. Synthesis of a Klebsiella pneumoniae O-antigen heteropolysaccharide (O12) requires an ABC 2 transporter.

    PubMed

    Izquierdo, Luis; Merino, Susana; Regué, Miguel; Rodriguez, Florencia; Tomás, Juan M

    2003-03-01

    A recombinant clone encoding enzymes for Klebsiella pneumoniae O12-antigen lipopolysaccharide (LPS) was found when we screened for serum resistance of a cosmid-based genomic library of K. pneumoniae KT776 (O12:K80) introduced into Escherichia coli DH5alpha. A total of eight open reading frames (ORFs) (wb(O12) gene cluster) were necessary to produce K. pneumoniae O12-antigen LPS in E. coli K-12. A complete analysis of the K. pneumoniae wb(O12) cluster revealed an interesting coincidence with the wb(O4) cluster of Serratia marcescens from ORF5 to ORF8 (or WbbL to WbbA). This prompted us to generate mutants of K. pneumoniae strain KT776 (O12) and to study complementation between the two enterobacterial wb clusters using mutants of S. marcescens N28b (O4) obtained previously. Both wb gene clusters are examples of ABC 2 transporter-dependent pathways for O-antigen heteropolysaccharides. The wzm-wzt genes and the wbbA or wbbB genes were not interchangeable between the two gene clusters despite their high level of similarity. However, introduction of three cognate genes (wzm-wzt-wbbA or wzm-wzt-wbbB) into mutants unable to produce O antigen allowed production of the specific O antigen. The K. pneumoniae O12 WbbL protein performs the same function as WbbL from S. marcescens O4 in either the S. marcescens O4 or E. coli K-12 genetic background. PMID:12591881

  12. Comparative genomics of Klebsiella pneumoniae strains with different antibiotic resistance profiles.

    PubMed

    Kumar, Vinod; Sun, Peng; Vamathevan, Jessica; Li, Yong; Ingraham, Karen; Palmer, Leslie; Huang, Jianzhong; Brown, James R

    2011-09-01

    There is a global emergence of multidrug-resistant (MDR) strains of Klebsiella pneumoniae, a Gram-negative enteric bacterium that causes nosocomial and urinary tract infections. While the epidemiology of K. pneumoniae strains and occurrences of specific antibiotic resistance genes, such as plasmid-borne extended-spectrum ?-lactamases (ESBLs), have been extensively studied, only four complete genomes of K. pneumoniae are available. To better understand the multidrug resistance factors in K. pneumoniae, we determined by pyrosequencing the nearly complete genome DNA sequences of two strains with disparate antibiotic resistance profiles, broadly drug-susceptible strain JH1 and strain 1162281, which is resistant to multiple clinically used antibiotics, including extended-spectrum ?-lactams, fluoroquinolones, aminoglycosides, trimethoprim, and sulfamethoxazoles. Comparative genomic analysis of JH1, 1162281, and other published K. pneumoniae genomes revealed a core set of 3,631 conserved orthologous proteins, which were used for reconstruction of whole-genome phylogenetic trees. The close evolutionary relationship between JH1 and 1162281 relative to other K. pneumoniae strains suggests that a large component of the genetic and phenotypic diversity of clinical isolates is due to horizontal gene transfer. Using curated lists of over 400 antibiotic resistance genes, we identified all of the elements that differentiated the antibiotic profile of MDR strain 1162281 from that of susceptible strain JH1, such as the presence of additional efflux pumps, ESBLs, and multiple mechanisms of fluoroquinolone resistance. Our study adds new and significant DNA sequence data on K. pneumoniae strains and demonstrates the value of whole-genome sequencing in characterizing multidrug resistance in clinical isolates. PMID:21746949

  13. Influence of induced ciprofloxacin resistance on efflux pump activity of Klebsiella pneumoniae *

    PubMed Central

    Zhong, Hai-qin; Zhang, Shun; Pan, Hong; Cai, Ting

    2013-01-01

    Objective: The efflux pump (EP) is one of the major mechanisms of antibiotic resistance in Klebsiella pneumoniae. However, there are few reports on the effect of the abuse of antibiotic use on the activity of EPs. To determine whether the use of low efficacy antibiotics has any effect on the activity of EPs and induces drug resistance in K. pneumoniae, we investigated the effect of ciprofloxacin on the activity of EPs in K. pneumoniae strains. Methods: Sixteen susceptible K. pneumoniae strains were isolated from patients and their minimum inhibitory concentrations (MICs) of ciprofloxacin were measured in the absence and presence of the pump inhibitor carbonyl cyanide m-chlorophenyl hydrazone (CCCP). The strains were then induced with a gradient of ciprofloxacin until the MICs of the strains showed no further increase, to obtain induced resistant strains. The EP activities of the strains before and after induction were compared using EP inhibition and ethidium bromide (EtBr) accumulation assays. Results: The MIC values of the strains were 16?256 times higher after induction than before induction. In the presence of CCCP, the MIC values of 50% of the induced strains were 2?4-fold lower than that in the absence of this inhibitor. The EtBr accumulation assay showed that the fluorescence of EtBr in the induced cells was lower than that in the cells before induction. Conclusions: EPs are widespread in susceptible and drug-resistant K. pneumoniae strains. Induction with ciprofloxacin may increase the activity of EPs in K. pneumoniae. The EtBr accumulation assay is more sensitive than the EP inhibition assay in evaluating the activity of EPs in K. pneumoniae. PMID:24009204

  14. Asian sand dust enhances murine lung inflammation caused by Klebsiella pneumoniae

    SciTech Connect

    He, Miao [Department of Environmental and Occupational Health, College of Public Health, China Medical University, 11001, Shenyang (China)] [Department of Environmental and Occupational Health, College of Public Health, China Medical University, 11001, Shenyang (China); Ichinose, Takamichi; Yoshida, Seiichi [Department of Health Sciences, Oita University of Nursing and Health Sciences, 870-1201, Oita (Japan)] [Department of Health Sciences, Oita University of Nursing and Health Sciences, 870-1201, Oita (Japan); Yamamoto, Shoji; Inoue, Ken-ichiro; Takano, Hirohisa; Yanagisawa, Rie [Pathophysiology Research Team, National Institute for Environmental Studies, 305-8506, Tsukuba, Ibaraki (Japan)] [Pathophysiology Research Team, National Institute for Environmental Studies, 305-8506, Tsukuba, Ibaraki (Japan); Nishikawa, Masataka; Mori, Ikuko [Environmental Chemistry Division, National Institute for Environmental Studies, 305-8506, Tsukuba, Ibaraki (Japan)] [Environmental Chemistry Division, National Institute for Environmental Studies, 305-8506, Tsukuba, Ibaraki (Japan); Sun, Guifan [Department of Environmental and Occupational Health, College of Public Health, China Medical University, 11001, Shenyang (China)] [Department of Environmental and Occupational Health, College of Public Health, China Medical University, 11001, Shenyang (China); Shibamoto, Takayuki, E-mail: tshibamoto@ucdavis.edu [Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States)] [Department of Environmental Toxicology, University of California, Davis, CA 95616 (United States)

    2012-01-15

    Inhaling concomitants from Asian sand dust (ASD) may result in exacerbation of pneumonia by the pathogen. The exacerbating effect of ASD on pneumonia induced by Klebsiella pneumoniae (KP) was investigated in ICR mice. The organic substances adsorbed onto ASD collected from the atmosphere of Iki-island in Japan were excluded by heat treatment at 360 °C for 30 min. ICR mice were instilled intratracheally with ASD at doses of 0.05 mg or 0.2 mg/mouse four times at 2-week intervals (total dose of 0.2 mg or 0.8 mg/mouse) and were administrated with ASD in the presence or absence of KP at the last intratracheal instillation. Pathologically, ASD caused exacerbation of pneumonia by KP as shown by increased inflammatory cells within the bronchiolar and the alveolar compartments. ASD enhanced the neutrophil number dose dependently as well as the expression of cytokines (IL-1?, IL-6, IL-12, IFN-?, TNF-?) and chemokines (KC, MCP-1, MIP-1?) related to KP in BALF. In an in vitro study using RAW264.7 cells, combined treatment of ASD and KP increased gene expression of IL-1?, IL-6, IFN-?, KC, MCP-1, and MIP-1?. The same treatment tended to increase the protein level of IL-1?, TNF-? and MCP-1 in a culture medium compared to each treatment alone. The combined treatment tended to increase the gene expression of Toll-like receptor 2 (TLR2), and NALP3, ASC and caspase-1 compared with KP alone. These results suggest that the exacerbation of pneumonia by ASD + KP was due to the enhanced production of pro-inflammatory mediators via activation of TLR2 and NALP3 inflammasome pathways in alveolar macrophages.

  15. Epidemiology and Molecular Characterization of Bacteremia Due to Carbapenem-Resistant Klebsiella pneumoniae in Transplant Recipients

    PubMed Central

    Clancy, C. J.; Chen, L.; Shields, R. K.; Zhao, Y.; Cheng, S.; Chavda, K. D.; Hao, B.; Hong, J. H.; Doi, Y.; Kwak, E. J.; Silveira, F. P.; Abdel-Massih, R.; Bogdanovich, T.; Humar, A.; Perlin, D. S.; Kreiswirth, B. N.; Hong Nguyen, M.

    2014-01-01

    We conducted a retrospective study of 17 transplant recipients with carbapenem-resistant Klebsiella pneumoniae bacteremia, and described epidemiology, clinical characteristics and strain genotypes. Eighty-eight percent (15/17) of patients were liver or intestinal transplant recipients. Outcomes were death due to septic shock (18%), cure (24%) and persistent (>7 days) or recurrent bacteremia (29% each). Thirty- and 90-day mortality was 18% and 47%, respectively. Patients who were cured received at least one active antimicrobial agent and underwent source control interventions. Forty-one percent (7/17) of patients had intra-abdominal infections; all except one developed persistent/recurrent bacteremia despite drainage. Two patients tolerated persistent bacteremia for >300 days. All patients except one were infected with sequence type 258 (ST258), K. pneumoniae carbapenemase (KPC)-2-producing strains harboring a mutant ompK35 porin gene; the exception was infected with an ST37, KPC-3-producing strain. Seventy-one percent (12/17) of patients were infected with ST258 ompK36 mutant strains. In two patients, persistent bacteremia was caused by two strains with different ompK36 genotypes. Three ompK36 mutations were associated with significantly higher carbapenem minimum inhibitory concentrations than wild-type ompK36. Pulse-field gel electrophoresis identified a single ST258 lineage; serial strains from individual patients were indistinguishable. In conclusion, KPC-K. pneumoniae bacteremia exhibited highly diverse clinical courses following transplantation, and was caused by clonal ST258 strains with different ompK36 genotypes. PMID:24011185

  16. Multiplex PCR for Identification of Two Capsular Types in Epidemic KPC-Producing Klebsiella pneumoniae Sequence Type 258 Strains

    PubMed Central

    Chen, Liang; Chavda, Kalyan D.; Findlay, Jacqueline; Peirano, Gisele; Hopkins, Katie; Pitout, Johann D. D.; Bonomo, Robert A.; Woodford, Neil; DeLeo, Frank R.

    2014-01-01

    We developed a multiplex PCR assay capable of identifying two capsular polysaccharide synthesis sequence types (sequence type 258 [ST258] cps-1 and cps-2) in epidemic Klebsiella pneumoniae ST258 strains. The assay performed with excellent sensitivity (100%) and specificity (100%) for identifying cps types in 60 ST258 K. pneumoniae sequenced isolates. The screening of 419 ST258 clonal isolates revealed a significant association between cps type and K. pneumoniae carbapenemase (KPC) variant: cps-1 is largely associated with KPC-2, while cps-2 is primarily associated with KPC-3. PMID:24733470

  17. Multiplex real-time PCR for detection of an epidemic KPC-producing Klebsiella pneumoniae ST258 clone.

    PubMed

    Chen, Liang; Chavda, Kalyan D; Mediavilla, José R; Zhao, Yanan; Fraimow, Henry S; Jenkins, Stephen G; Levi, Michael H; Hong, Tao; Rojtman, Albert D; Ginocchio, Christine C; Bonomo, Robert A; Kreiswirth, Barry N

    2012-06-01

    We describe a multiplex real-time PCR assay capable of identifying both the epidemic Klebsiella pneumoniae ST258 clone and bla(KPC) carbapenemase genes in a single reaction. The assay displayed excellent sensitivity (100%) and specificity (100%) for identification of ST258 clone and bla(KPC) in a collection of 75 K. pneumoniae isolates comprising 41 sequence types. Our results suggest that this assay is an effective tool for surveillance of this clone among carbapenem-resistant K. pneumoniae clinical isolates. PMID:22450983

  18. Multiplex PCR for identification of two capsular types in epidemic KPC-producing Klebsiella pneumoniae sequence type 258 strains.

    PubMed

    Chen, Liang; Chavda, Kalyan D; Findlay, Jacqueline; Peirano, Gisele; Hopkins, Katie; Pitout, Johann D D; Bonomo, Robert A; Woodford, Neil; DeLeo, Frank R; Kreiswirth, Barry N

    2014-07-01

    We developed a multiplex PCR assay capable of identifying two capsular polysaccharide synthesis sequence types (sequence type 258 [ST258] cps-1 and cps-2) in epidemic Klebsiella pneumoniae ST258 strains. The assay performed with excellent sensitivity (100%) and specificity (100%) for identifying cps types in 60 ST258 K. pneumoniae sequenced isolates. The screening of 419 ST258 clonal isolates revealed a significant association between cps type and K. pneumoniae carbapenemase (KPC) variant: cps-1 is largely associated with KPC-2, while cps-2 is primarily associated with KPC-3. PMID:24733470

  19. Multiplex Real-Time PCR for Detection of an Epidemic KPC-Producing Klebsiella pneumoniae ST258 Clone

    PubMed Central

    Chen, Liang; Chavda, Kalyan D.; Mediavilla, José R.; Zhao, Yanan; Fraimow, Henry S.; Jenkins, Stephen G.; Levi, Michael H.; Hong, Tao; Rojtman, Albert D.; Ginocchio, Christine C.; Bonomo, Robert A.

    2012-01-01

    We describe a multiplex real-time PCR assay capable of identifying both the epidemic Klebsiella pneumoniae ST258 clone and blaKPC carbapenemase genes in a single reaction. The assay displayed excellent sensitivity (100%) and specificity (100%) for identification of ST258 clone and blaKPC in a collection of 75 K. pneumoniae isolates comprising 41 sequence types. Our results suggest that this assay is an effective tool for surveillance of this clone among carbapenem-resistant K. pneumoniae clinical isolates. PMID:22450983

  20. Activity of Antimicrobial Combinations against KPC-2-Producing Klebsiella pneumoniae in a Rat Model and Time-Kill Assay.

    PubMed

    Toledo, Paula Virginia Michelon; Aranha Junior, Ayrton Alves; Arend, Lavinia Nery; Ribeiro, Vanessa; Zavascki, Alexandre Prehn; Tuon, Felipe Francisco

    2015-07-01

    This study evaluated the efficacy of tigecycline (TIG), polymyxin B (PMB), and meropenem (MER) in 80 rats challenged with Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae infection. A time-kill assay was performed with the same strain. Triple therapy and PMB+TIG were synergistic, promoted 100% survival, and produced negative peritoneal cultures, while MER+TIG showed lower survival and higher culture positivity than other regimens (P = 0.018) and was antagonistic. In vivo and in vitro studies showed that combined regimens, except MER+TIG, were more effective than monotherapies for this KPC-producing strain. PMID:25896686