These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Nosocomial Outbreak of Klebsiella pneumoniae Carbapenemase-Producing Klebsiella oxytoca in Austria  

PubMed Central

To date, no outbreak of carbapenemase-producing bacteria has been reported for Austria. While outbreaks of Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae have been increasingly reported, no outbreak caused by KPC-producing Klebsiella oxytoca has been described yet, to the best of our knowledge. We report an outbreak of KPC-producing K. oxytoca. In 5 months, 31 KPC-producing Klebsiella oxytoca strains were isolated from five patients. All patients were admitted to the same medical intensive care unit in Austria. PMID:22290949

Hoenigl, Martin; Valentin, Thomas; Zarfel, Gernot; Wuerstl, Benjamin; Leitner, Eva; Salzer, Helmut J. F.; Posch, Josefa; Krause, Robert

2012-01-01

2

Discrimination of Klebsiella pneumoniae and Klebsiella oxytoca phylogenetic groups and other Klebsiella species by use of amplified fragment length polymorphism.  

PubMed

Bacteria of the genus Klebsiella are opportunistic pathogens responsible for an increasing number of multiresistant infections in hospitals. The two clinically and epidemiologically most important species, Klebsiella pneumoniae and K. oxytoca, have recently been shown to be subdivided into three and two phylogenetic groups, respectively. The aim of this study was an in depth evaluation of the amplified fragment length polymorphism (AFLP) genetic characterization method for epidemiological and phylogenic analyzes of Klebsiella isolates. First, we investigated the variability of AFLP patterns for Klebsiella strains within and between different outbreaks. Second, by use of carefully characterized phylogenetically representative strains, we examined whether different Klebsiella species and phylogenetic groups can be discriminated using AFLP. Twenty-four strains originating from seven presumed outbreaks and 31 non-associated strains were investigated. The AFLP fingerprints of all epidemiologically associated strains showed three or fewer fragment differences, whereas unrelated strains differed by at least four fragments. Cluster analysis of the AFLP data revealed a very high concordance with the phylogenetic assignation of strains based on the gyrA sequence and ribotyping data. The species K. pneumoniae, K. oxytoca, K. terrigena and the possibly synonymous pair K. planticola/K. ornithinolytica each formed a separate cluster. Similarly, strains of the phylogenetic groups of K. pneumoniae and K. oxytoca fell into their corresponding clusters, with only two exceptions. This study provides a preliminary cut-off value for distinguishing epidemiologically non-related Klebsiella isolates based on AFLP data; it confirms the sharp delineation of the recently identified phylogenetic groups, and demonstrates that AFLP is suitable for identification of Klebsiella species and phylogenetic groups. PMID:14759704

Jonas, Daniel; Spitzmüller, Bettina; Daschner, Franz D; Verhoef, Jan; Brisse, Sylvain

2004-01-01

3

Identification of Klebsiella oxytoca using a specific PCR assay targeting the polygalacturonase pehX gene.  

PubMed

Bacteria of the genus Klebsiella are important opportunistic pathogens responsible for nosocomial infections that are increasingly resistant to antimicrobial agents. Distinctive identification of the species K. oxytoca, K. pneumoniae, K. planticola, K. ornithinolytica and K. terrigena is difficult based on phenotypic tests and misidentifications are frequent in routine clinical microbiology. We developed a specific method to discriminate K. oxytoca from the other species of the genus Klebsiella, based on the PCR amplification of the polygalacturonase (pehX) gene. A PCR amplicon of 344 bp was obtained in all 35 K. oxytoca strains tested, but in none of the 29 K. pneumoniae, 12 K. planticola/K. ornithinolytica and 7 K. terrigena strains tested. The test was also negative for polygalacturonate-degrading species of the genus Erwinia. Analysis of 24 strains designated as K. pneumoniae from international collections (NCTC, PZH) revealed previous misidentification of six K. oxytoca strains. Key biochemical tests fully confirmed the pehX PCR results. The new K. oxytoca identification assay should be useful for both clinical and ecological monitoring of K. oxytoca strains, as well as for controlling the previous identification of collection strains. PMID:14527660

Kovtunovych, Gennadiy; Lytvynenko, Tetyana; Negrutska, Valentyna; Lar, Olena; Brisse, Sylvain; Kozyrovska, Natalia

2003-10-01

4

Isolation and characterization of an SDS-degrading Klebsiella oxytoca.  

PubMed

Sodium dodecyl sulfate (SDS) is one of the main components in the detergent and cosmetic industries. Its bioremediation by suitable microorganism has begun to receive greater attention as the amount of SDS usage increases to a point where treatment plants would not be able to cope with the increasing amount of SDS in wastewater. The purpose of this work was to isolate local SDS-degrading bacteria. Screening was carried out by the conventional enrichment-culture technique. Six SDS-degrading bacteria were isolated. Of these isolates, isolate S14 showed the highest degradation of SDS with 90% degradation after three days of incubation. Isolate S14 was tentatively identified as Klebsiella oxytoca strain DRY14 based on carbon utilization profiles using Biolog GN plates and partial 16S rDNA molecular phylogeny. SDS degradation by the bacterium was optimum at 37 degrees 0. Ammonium sulphate; at 2.0 g l(-1), was found to be the best nitrogen source for the growth of strain DRY14. Maximum growth on SDS was observed at pH 7.25. The strain exhibited optimum growth at SDS concentration of 2.0 g l(-1) and was completely inhibited at 10 g l(-1) SDS. At the tolerable initial concentration of 2.0 g l(-1), almost 80% of 2.0 g l(-1) SDS was degraded after 4 days of incubation concomitant with increase in cellular growth. The K(m(app) and V(max(app)) values calculated for the alkylsulfatase from this bacterium were 0.1 mM SDS and 1.07 micromol min(-1) mg(-1) protein, respectively. PMID:20112874

Shukor, M Y; Husin, W S W; Rahman, M F A; Shamaan, N A; Syed, M A

2009-01-01

5

Natural antibiotic susceptibility of Klebsiella pneumoniae, K. oxytoca, K. planticola, K. ornithinolytica and K. terrigena strains.  

PubMed

The natural susceptibility of 221 Klebsiella strains to 71 antibiotics was examined. The strains were isolated from clinical specimens and the environment, and belonged to K. pneumoniae subsp. pneumoniae (n = 40), K. pneumoniae subsp. ozaenae (37), K. pneumoniae subsp. rhinoscleromatis (10), K. oxytoca (44), K. planticola (40), K. ornithinolytica (25) and K. terrigena (25). MIC values were determined by a microdilution procedure in IsoSensitest broth according to the German standard (DIN). All Klebsiella spp. were naturally resistant or intermediate to amoxicillin, ticarcillin and to antibiotics to which other Enterobacteriaceae are also intrinsically resistant. Klebsiella spp. were naturally sensitive or intermediate to several penicillins, all tested cephalosporins, aminoglycosides, quinolones, tetracyclines, trimethoprim, cotrimoxazole, chloramphenicol and nitrofurantoin. K. pneumoniae subsp. ozaenae and subsp. rhinoscleromatis strains were generally more susceptible to antibiotics than strains of other Klebsiella taxa. K pneumoniae subsp. rhinoscleromatis was the most susceptible taxon, being highly susceptible to cefuroxime, anti-folates and naturally intermediate to erythromycin and clarithromycin. K. pneumoniae subsp. ozaenae was most susceptible to glycopeptides. K. oxytoca and K. terrigena strains were least susceptible to cefazoline, cefoperazone and fosfomycin, respectively. The results of the present study describe a database of the natural antimicrobial susceptibility of Klebsiella spp., which can be used for the validation of antibiotic susceptibility results of these bacteria. MIC patterns to beta-lactams indicate the expression of chromosomally encoded class A gamma-lactamases in all the species, including the subspecies of K. pneumoniae. Similar natural susceptibility patterns of K. planticola and K. ornithinolytica to all tested antibiotics support the status of K. ornithinolytica as a biovar of K. planticola. PMID:11339246

Stock, I; Wiedemann, B

2001-05-01

6

Phylogenetic diversity of Klebsiella pneumoniae and Klebsiella oxytoca clinical isolates revealed by randomly amplified polymorphic DNA, gyrA and parC genes sequencing and automated ribotyping.  

PubMed

The infra-specific phylogenetic diversity and genetic structure of both Klebsiella pneumoniae and Klebsiella oxytoca was investigated using a combination of randomly amplified polymorphic DNA (RAPD) analysis, sequencing of gyrA and parC genes, and automated ribotyping. After RAPD analysis with four independent primers of 120 clinical isolates collected from 22 European hospitals in 13 countries, K. pneumoniae isolates fell into three clusters and K. oxytoca isolates fell into two clusters, while Klebsiella planticola isolates formed a sixth cluster. Each cluster was geographically widespread. K. pneumoniae cluster I (KpI) accounted for 80% of the isolates of this species and included reference strains of the three subspecies K. pneumoniae subsp. pneumoniae, K. pneumoniae subsp. ozaenae and K. pneumoniae subsp. rhinoscleromatis. Clusters KpII and KpIII were equally represented, as were the two K. oxytoca clusters. Individualization of each cluster was fully confirmed by phylogenetic analysis of gyrA and parC gene sequences. In addition, sequence data supported the evolutionary separation of K. pneumoniae from a phylogenetic group including K. oxytoca, Klebsiella terrigena, K. planticola and Klebsiella ornithinolytica. Automated ribotyping using Mlu I appeared suitable for identification of each Klebsiella cluster. The adonitol fermentation test was found to be useful for cluster identification in K. pneumoniae, since it was negative in all strains of clusters KpIII and in some KpII strains, but always positive in cluster KpI. The usefulness of gyrA and parC sequence data for population genetics and cluster identification in bacteria was demonstrated, even for the phylogenetic positioning of quinolone-resistant isolates. PMID:11411715

Brisse, S; Verhoef, J

2001-05-01

7

The genes and enzymes for the catabolism of galactitol, D-tagatose, and related carbohydrates in Klebsiella oxytoca M5a1 and other enteric bacteria display convergent evolution.  

PubMed

Enteric bacteria (Enteriobacteriaceae) carry on their single chromosome about 4000 genes that all strains have in common (referred to here as "obligatory genes"), and up to 1300 "facultative" genes that vary from strain to strain and from species to species. In closely related species, obligatory and facultative genes are orthologous genes that are found at similar loci. We have analyzed a set of facultative genes involved in the degradation of the carbohydrates galactitol, D-tagatose, D-galactosamine and N-acetyl-galactosamine in various pathogenic and non-pathogenic strains of these bacteria. The four carbohydrates are transported into the cell by phosphotransferase (PTS) uptake systems, and are metabolized by closely related or even identical catabolic enzymes via pathways that share several intermediates. In about 60% of Escherichia coli strains the genes for galactitol degradation map to a gat operon at 46.8 min. In strains of Salmonella enterica, Klebsiella pneumoniae and K. oxytoca, the corresponding gat genes, although orthologous to their E. coli counterparts, are found at 70.7 min, clustered in a regulon together with three tag genes for the degradation of D-tagatose, an isomer of D-fructose. In contrast, in all the E. coli strains tested, this chromosomal site was found to be occupied by an aga/kba gene cluster for the degradation of D-galactosamine and N-acetyl-galactosamine. The aga/kba and the tag genes were paralogous either to the gat cluster or to the fru genes for degradation of D-fructose. Finally, in more then 90% of strains of both Klebsiella species, and in about 5% of the E. coli strains, two operons were found at 46.8 min that comprise paralogous genes for catabolism of the isomers D-arabinitol (genes atl or dal) and ribitol (genes rtl or rbt). In these strains gat genes were invariably absent from this location, and they were totally absent in S. enterica. These results strongly indicate that these various gene clusters and metabolic pathways have been subject to convergent evolution among the Enterobacteriaceae. This apparently involved recent horizontal gene transfer and recombination events, as indicated by major chromosomal rearrangements found in their immediate vicinity. PMID:15257457

Shakeri-Garakani, A; Brinkkötter, A; Schmid, K; Turgut, S; Lengeler, J W

2004-07-01

8

Engineering Klebsiella oxytoca for efficient 2, 3-butanediol production through insertional inactivation of acetaldehyde dehydrogenase gene  

Microsoft Academic Search

Ethanol was a major byproduct of 2,3-butanediol (2,3-BD) fermentation by Klebsiella oxytoca ME-UD-3. In order to achieve a high efficiency of 2,3-BD production, K. oxytoca mutants deficient in ethanol formation were successfully constructed by replace the aldA gene coding for aldehyde dehydrogenase with a tetracycline resistance cassette. The results suggested that inactivation\\u000a of aldA led to a significantly improved 2,3-BD

Xiao-Jun Ji; He Huang; Jian-Guo Zhu; Lu-Jing Ren; Zhi-Kui Nie; Jun Du; Shuang Li

2010-01-01

9

Identification of acetoin reductases involved in 2,3-butanediol pathway in Klebsiella oxytoca.  

PubMed

The acetoin reductase (AR) of Klebsiella oxytoca is responsible for converting acetoin into 2,3-butanediol (2,3-BDO) during sugar fermentation. Deleting the AR encoding gene (budC) in the 2,3-BDO operon does not block production of 2,3-BDO, as another similar gene exists in addition to budC called diacetyl/acetoin reductase (dar) which shares 53% identity with budC. In the present study, both budC and dar of K. oxytoca were independently cloned and expressed in Escherichia coli along with budA (acetolactate decarboxylase) and budB (acetolactate synthase), which are responsible for converting pyruvate into acetoin. The recombinant E. coli expressing budABC and budAB-dar produced 2,3-BDO from glucose but E. coli expressing only budAB did not and produced acetoin alone. This demonstrates that Dar functions similar to BudC. Mutants of budC, dar, and both genes together were developed in K. oxytoca ?ldhA (lactate dehydrogenase). K. oxytoca ?ldhA ?budC ?dar, deficient in both AR genes, showed reduced 2,3-BDO concentration when compared to K. oxytoca ?ldhA and K. oxytoca ?ldhA ?budC by 84% and 69%, respectively. Interestingly, K. oxytoca ?ldhA ?dar resulted in a significant reduction in the reversible conversion of 2,3-BDO into acetoin than that of K. oxytoca ?ldhA, which was observed in a glucose depleted fermentation culture. In addition, we observed that Dar played a key role in dissimilation of 2,3-BDO in media containing 2,3-BDO alone. PMID:24389066

Yang, Taek Ho; Rathnasingh, Chelladurai; Lee, Hee Jong; Seung, Doyoung

2014-02-20

10

Cytotoxic and Pathogenic Properties of Klebsiella oxytoca Isolated from Laboratory Animals  

PubMed Central

Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin production in animal isolates of K. oxytoca and its pathogenic properties have not been characterized. Furthermore, neither the identity of the toxin nor a complete repertoire of genes involved in K. oxytoca pathogenesis have been fully elucidated. Here, we showed that several animal isolates of K. oxytoca, including the clinical isolates, produced secreted products in bacterial culture supernatant that display cytotoxicity on HEp-2 and HeLa cells, indicating the ability to produce cytotoxin. Cytotoxin production appears to be regulated by the environment, and soy based product was found to have a strong toxin induction property. The toxin was identified, by liquid chromatography-mass spectrometry and NMR spectroscopy, as low molecular weight heat labile benzodiazepine, tilivalline, previously shown to cause cytotoxicity in several cell lines, including mouse L1210 leukemic cells. Genome sequencing and analyses of a cytotoxin positive K. oxytoca strain isolated from an abscess of a mouse, identified genes previously shown to promote pathogenesis in other enteric bacterial pathogens including ecotin, several genes encoding for type IV and type VI secretion systems, and proteins that show sequence similarity to known bacterial toxins including cholera toxin. To our knowledge, these results demonstrate for the first time, that animal isolates of K. oxytoca, produces a cytotoxin, and that cytotoxin production is under strict environmental regulation. We also confirmed tilivalline as the cytotoxin present in animal K. oxytoca strains. These findings, along with the discovery of a repertoire of genes with virulence potential, provide important insights into the pathogenesis of K. oxytoca. As a novel diagnostic tool, tilivalline may serve as a biomarker for K oxytoca-induced cytotoxicity in humans and animals through detection in various samples from food to diseased samples using LC-MS/MS. Induction of K. oxytoca cytotoxin by consumption of soy may be in part involved in the pathogenesis of gastrointestinal disease. PMID:25057966

Sarkar, Ujjal; Seneviratne, Uthpala; Park, Danny S.; Gamazon, Eric R.; Batchelder, Chara; Cheung, Cheryl; Buckley, Ellen M.; Taylor, Nancy S.; Shen, Zeli; Tannenbaum, Steven R.; Wishnok, John S.; Fox, James G.

2014-01-01

11

Detection and spread of oxa-48-producing Klebsiella oxytoca isolates in Istanbul, Turkey.  

PubMed

Five OXA-48 producing Klebsiella oxytoca strains isolated in April-July 2010 were analyzed. Antibiotic susceptibility tests were performed using disc diffusion method and VITEK 2 system. Carbapenemase activity was investigated using the Modified Hodge test. Beta-lactamase genes were detected by PCR and blaOXA-48 was sequenced. Genetic relatedness between K. oxytoca isolates was investigated by pulse-field gel electrophoresis (PFGE). Carbapenemase activity was detected in 5 isolates by Modified Hodge test. Although all strains were resistant to ertapenem and imipenem, only one strain was also resistant to meropenem. BlaOXA-48 in 4 isolates harbored 2 or 3 other ESBL types, namely, blaTEM, blaSHV, blaCTX-M, or blaVEB. PFGE revealed 3 different pulso-types among the K. oxytoca isolates. The presence of OXA-48 carbapenemase in other species of clinical isolates should also be considered. PMID:24964661

Nazik, Hasan; Aydin, Selda; Albayrak, Rüveyda; Bilgi, Esma A; Yildiz, Ismail; Kuvat, Nuray; Kelesoglu, Fatih M; Kelesoglu, Fatih M; Paka?tiçali, Nagehan; Yilmaz, Fadime; Ongen, Betigül

2014-01-01

12

Contaminated Handwashing Sinks as the Source of a Clonal Outbreak of KPC-2-Producing Klebsiella oxytoca on a Hematology Ward.  

PubMed

We investigated sinks as possible sources of a prolonged Klebsiella pneumonia carbapenemase (KPC)-producing Klebsiella oxytoca outbreak. Seven carbapenem-resistant K. oxytoca isolates were identified in sink drains in 4 patient rooms and in the medication room. Investigations for resistance genes and genetic relatedness of patient and environmental isolates revealed that all the isolates harbored the blaKPC-2 and blaTEM-1 genes and were genetically indistinguishable. We describe here a clonal outbreak caused by KPC-2-producing K. oxytoca, and handwashing sinks were a possible reservoir. PMID:25348541

Leitner, Eva; Zarfel, Gernot; Luxner, Josefa; Herzog, Kathrin; Pekard-Amenitsch, Shiva; Hoenigl, Martin; Valentin, Thomas; Feierl, Gebhard; Grisold, Andrea J; Högenauer, Christoph; Sill, Heinz; Krause, Robert; Zollner-Schwetz, Ines

2015-01-01

13

Recombinant Klebsiella oxytoca strains with improved efficiency in removal of high nitrate loads  

SciTech Connect

Klebsiella oxytoca CECT 4460 removes high nitrate loads from industrial wastewaters without accumulation of nitrite under optimal culture conditions; however, under nonoptimal conditions nitrite accumulates. This situation reflects an in vivo-limited functioning of nitrite reductase in this strain. As a way to overcome this limitation, an increase in the nitrite reductase gene dose in K. oxytoca CECT 4460 was considered. To achieve this, the authors cloned and transferred into this strain the Klebsiella pneumoniae nasB gene, which encodes assimilatory nitrite reductase. The delivery vector was either the wide-host-range plasmid pUPE2, in which the nasB gene is expressed from the Escherichia coli P{sub lac} promoter, or a mini-Tn5-Km vector, which upon random insertion in the host chromosome allowed expression of the nasB gene from an unidentified chromosomal host promoter. The effect of the increase in the dose of the nasB gene in K. oxytoca CECT 4460 on the accumulation of nitrite in the culture medium was tested in two recombinant strains. The results obtained showed that K. oxytoca CECT 4460 bearing pUPE2 accumulated 88% less nitrite than the wild-type strain, while the recombinant strain bearing the K. pneumoniae nasB gene in the host chromosome showed a 25% lower level of nitrite accumulation in the culture medium than that of the wild type.

Pinar, G.; Ramos, J.L. [Estacion Experimental del Zaidin--Consejo Superior de Investigaciones Cientificas, Granada (Spain). Dept. of Biochemistry and Molecular and Cellular Biology of Plants

1998-12-01

14

Engineering endoglucanase-secreting strains of ethanologenic Klebsiella oxytoca P2  

Microsoft Academic Search

Klebsiella oxytoca   P2 was developed as a biocatalyst for the simultaneous saccharification and fermentation (SSF) of cellulose by chromosomally\\u000a integrating Zymomonas mobilis genes (pdc, adhB) encoding the ethanol pathway. This strain contains the native ability to transport and metabolize cellobiose, eliminating\\u000a the need to supplement with ?-glucosidase during SSF. To increase the utility of this biocatalyst, we have now chromosomally

S Zhou; L O Ingram

1999-01-01

15

Enterobacterial repetitive intergenic consensus 1R PCR assay for detection of Raoultella sp. isolates among strains identified as Klebsiella oxytoca in the clinical laboratory.  

PubMed

The enterobacterial repetitive intergenic consensus 1R PCR method, which provided recognizable profiles for reference strains of the three species of Raoultella and the two genetic groups of Klebsiella oxytoca, was applied to 19 clinical isolates identified as K. oxytoca. By this method, as confirmed by species-specific gene sequencing, two Raoultella ornithinolytica and two unclassifiable K. oxytoca isolates were identified. PMID:12682174

Granier, Sophie A; Leflon-Guibout, Véronique; Goldstein, Fred W; Nicolas-Chanoine, Marie-Hélène

2003-04-01

16

A study of the prevalence of cytotoxic and non-cytotoxic Klebsiella oxytoca fecal colonization in two patient populations  

PubMed Central

BACKGROUND: Klebsiella oxytoca is a cause of antibiotic-associated hemorrhagic colitis. Few reports of the occurrence of K oxytoca within stool exist and there is no gold standard method for its isolation. METHODS: MacConkey agar was modified to culture K oxytoca. Ampicillin was added and adonitol was substituted for lactose. Rectal swabs from 200 patients being screened for vancomycin-resistant enterococci (VRE) and stool specimens from 429 patients who tested negative for Clostridium difficile cytotoxin were cultured. K oxytoca isolates were evaluated for cytotoxicity to HEp-2 cells. Available charts of K oxytoca-positive patients and a convenience sample of 93 K oxytoca-negative patients who underwent testing for C difficile cytotoxicity were reviewed retrospectively for documentation of bloody stool. RESULTS: K oxytoca was isolated from 14 of 200 patients (7.0%) being screened for VRE; only one of the 14 isolates (7.1%) was cytotoxic. The organism was isolated from 42 of 429 patients (9.8%) tested for C difficile cytotoxicity; 10 isolates (23.8%) were cytotoxic. Differences in isolation and cytotoxicity rates between groups were not statistically significant. Two of 13 (15.4%) K oxytoca-positive patients screened for VRE, three of 27 (11.1%) K oxytoca-positive patients tested for C difficile cytotoxicity, and 11 of 93 (11.8%) patients from the convenience sample had documented bloody stool. CONCLUSIONS: A medium that greatly facilitates isolation of K oxytoca was developed. Occurrence of K oxytoca colonization was similar in the two patient populations studied and isolation of cytotoxic K oxytoca was not usually associated with hematochezia. Current understanding of the occurrence and causality of antibiotic-associated hemorrhagic colitis is insufficient for clinical laboratories to begin culturing K oxytoca and testing for cytotoxicity. PMID:21119796

Smith, Stephen A; Campbell, Sarah J; Webster, Duncan; Curley, Michael; Leddin, Desmond; Forward, Kevin R

2009-01-01

17

Inhibitor-Resistant OXY-2-Derived ?-Lactamase Produced by Klebsiella oxytoca  

PubMed Central

Klebsiella oxytoca strains are generally moderately resistant to amoxicillin and ticarcillin due to the activities of the chromosomally encoded OXY-1 and OXY-2 class A ?-lactamase families. These enzymes have the ability to hydrolyze not only penicillins but also cephalosporins, including cefuroxime, ceftriaxone, and aztreonam, and are inhibited by clavulanic acid. A Klebsiella oxytoca strain was isolated from a culture of blood from a patient who had been treated with amoxicillin-clavulanate (3 g/day) for 10 days 1 month earlier. This strain harbored an unusual phenotype characterized by resistance to amoxicillin-clavulanate. It produced an OXY-2-type ?-lactamase (pI 6.3), as confirmed by PCR amplification with primers specific for the OXY-2-encoding gene. Gene sequencing revealed a point mutation (A?G) corresponding to the amino acid substitution Ser?Gly at position 130. This mutant enzyme was poorly inhibited by inhibitors, and its kinetic constants compared to those of the parent enzyme were characterized by an increased Km value for ticarcillin, with a drastically reduced activity against cephalosporins, as is observed with inhibitor-resistant TEM enzymes. The substitution Ser?Gly-130 was previously described in the inhibitor-resistant ?-lactamase SHV-10 derived from an SHV-5 variant, but this is the first report of such a mutant in OXY enzymes from K. oxytoca. PMID:9736532

Sirot, D.; Labia, R.; Pouedras, P.; Chanal-Claris, C.; Cerceau, C.; Sirot, J.

1998-01-01

18

Production of 2,3-butanediol by a low-acid producing Klebsiella oxytoca NBRF4.  

PubMed

2,3-Butanediol (2,3-BDO) is a value-added chemical with great potential for the industrial production of synthetic rubber, plastic and solvent. For microbial production of 2,3-BDO, in this study, Klebsiella oxytoca NBRF4 was constructed by chemical mutation and screening against NaBr, NaBrO(3) and fluoroacetate. Among metabolic enzymes involved in the production of lactate, acetate and 2,3-BDO, K. oxytoca NBRF4 possessed 1.2 times lower specific activities of lactate dehydrogenase and phosphotransacetylase, and 22% higher specific acetoin reductase activity than the K. oxytoca ATCC43863 control strain. A series of batch fermentations in a defined medium and application of a statistical tool of response surface method led to the determination of optimal culture conditions: 10% dissolved oxygen level, pH 4.3 and 38°C. The actual results of batch fermentation at the optimal conditions using 44 g/L glucose were coincident with the predetermined values: 14.4 g/L 2,3-BDO concentration, 0.32 g/g yield. To increase 2,3-BDO titer, fed-batch fermentation of K. oxytoca NBRF4 was performed by an intermittent feeding of 800 g/L glucose to control its concentration around 5-20 g/L in the culture broth. Finally, 34.2g/L 2,3-BDO concentration and 0.35 g/g yield were obtained without organic acid production in 70 hours of the fed-batch culture, which were 2.4 and 1.2 times higher than those of the batch fermentation using 44 g/L glucose. PMID:22989924

Han, Sung-Hyuk; Lee, Jung-Eun; Park, Kyungmoon; Park, Yong-Cheol

2013-01-25

19

Growth and comparative physiology of Klebsiella oxytoca attached to granular activated carbon particles and in liquid media  

Microsoft Academic Search

Experiments were performed to evaluate the comparative growth and physiology ofKlebsiella oxytoca grown attached to granular activated carbon particles (GAC) and in liquid medium. Laboratory studies showed that when this organism attached to GAC, the growth rate was enhanced more than 10 times in the presence of glutamate, a substrate that adsorbed to the surface. No differences were observed if

David G. Davies; Gordon A. McFeters

1988-01-01

20

Intracellular azo decolorization is coupled with aerobic respiration by a Klebsiella oxytoca strain.  

PubMed

Reduction of azo dye methyl red coupled with aerobic respiration by growing cultures of Klebsiella oxytoca GS-4-08 was investigated. In liquid media containing dye and 0.6 % glucose in a mineral salts base, 100 mg l(-1) of the dye are completely removed in 3 h under shaking conditions. The dye cannot be aerobically decolorized by strain GS-4-08 without extra carbon sources, indicating a co-metabolism process. Higher initial dye concentration prolonged the lag phase of the cell growth, but final cell concentrations of each batches reached a same level with range from 6.3 to 7.6 mg l(-1) after the dye adaption period. This strain showed stronger dye tolerance and decolorization ability than many reported strains. Furthermore, a new intracellular oxygen-insensitive azoreductase was isolated from this strain, and the specific activity of enzyme was 0.846 and 0.633 U mg(-1) protein in the presence of NADH and NADPH, respectively. N,N dimethyl-p-phenylenediamine and anthranilic acid were stoichiometrically released from MR dye, indicating the breakage of azo bonds accounts for the intracellular decolorization. Combining the characteristics of azoreductase, the stoichiometry of EMP, and TCA cycle, the electron transfer chain theory of aerobic respiration, and the possible mechanism of aerobic respiration coupled with azo reduction by K. oxytoca GS-4-08 are proposed. This study is expected to provide a sound theoretical basis for the development of the K. oxytoca strain in aerobic process for azo dye containing wastewaters. PMID:25343980

Yu, Lei; Zhang, Xiao-Yu; Xie, Tian; Hu, Jin-Mei; Wang, Shi; Li, Wen-Wei

2014-10-26

21

Selective production of 2,3-butanediol and acetoin by a newly isolated bacterium Klebsiella oxytoca M1.  

PubMed

A newly isolated bacterium, designated as Klebsiella oxytoca M1, produced 2,3-butanediol (2,3-BDO) or acetoin selectively as a major product depending on temperature in a defined medium. K. oxytoca M1 produced 2,3-BDO mainly (0.32~0.34 g/g glucose) at 30 °C while acetoin was a major product (0.32~0.38 g/g glucose) at 37 °C. To investigate factors affecting product profiles according to temperature, the expression level of acetoin reductase (AR) that catalyzes the conversion of acetoin to 2,3-BDO was analyzed using crude protein extracted from K. oxytoca M1 grown at 30 and 37 °C. The AR expression at 37 °C was 12.8-fold lower than that at 30 °C at the stationary phase and reverse transcription PCR (RT-PCR) analysis of the budC (encoding AR) was also in agreement with the AR expression results. When AR was overexpressed using K. oxytoca M1 harboring pUC18CM-budC, 2,3-BDO became a major product at 37 °C, indicating that the AR expression level was a key factor determining the major product of K. oxytoca M1 at 37 °C. The results in this study demonstrate the feasibility of using K. oxytoca M1 for the production of not only 2,3-BDO but also acetoin as a major product. PMID:23793864

Cho, Sukhyeong; Kim, Kyung Duk; Ahn, Jae-Hyung; Lee, Jinwon; Kim, Seon-Won; Um, Youngsoon

2013-08-01

22

Conversion of xylan to ethanol by ethanologenic strains of Escherichia coli and Klebsiella oxytoca  

SciTech Connect

A two-stage process was evaluated for the fermentation of polymeric feedstocks to ethanol by a single, genetically engineered microorganism. The truncated xylanase gene (xynZ) from the thermophilic bacterium Clostridium thermocellum was fused with the N terminus of lacZ to eliminate secretory signals. This hybrid gene was expressed at high levels in ethanologenic strains of Escherichia coli KO11 and Klebsiella oxytoca M5A1(pLOI555). Large amounts of xylanase (25 to 93 mU/mg of cell protein) accumulated as intracellular products during ethanol production. Cells containing xylanase for saccharification. After cooling, the hydrolysate was fermented to ethanol with the same organism (30C), thereby replenishing the supply of xylanase for a subsequent saccharification. Recombinant E. coli metabolized only xylose, while recombinant K. oxytoca M5A1 metabolized xylose, xylobiose, and xylotriose but not xylotetrose. Derivatives of this latter organism produced large amounts of intracellular xylosidase, and the organism is presumed to transport both xylobiose and xylotriose for intracellular hydrolysis. By using recombinant M5A1, approximately 34% of the maximal theoretical yield of ethanol was obtained from xylan by this two-stage process. The yield appeared to be limited by the digestability of commercial xylan rather than by a lack of sufficient xylanase or by ethanol toxicity. In general form, this two-stage process, which uses a single, genetically engineered microorganism, should be applicable for the production of useful chemicals from a wide range of biomass polymers.

Burchhardt, G.; Ingram, L.O. (Univ. of Florida, Gainesville (United States))

1992-04-01

23

Iron-binding characterization and polysaccharide production by Klebsiella oxytoca strain isolated from mine acid drainage  

PubMed Central

Aims: To investigate Klebsiella oxytoca strain BAS-10 growth on ferric citrate under anaerobic conditions for exopolysaccharide (EPS) production and localization on cell followed by the purification and the EPS determination of the iron-binding stability constant to EPS or biotechnological applications. Methods and Results: Klebsiella oxytoca ferments ferric citrate under anaerobic conditions and produces a ferric hydrogel, whereas ferrous ions were formed in solution. During growth, cells precipitate and a hydrogel formation was observed: the organic material was constituted of an EPS bound to Fe(III) ions, this was found by chemical analyses of the iron species and transmission electron microscopy of the cell cultures. Iron binding to EPS was studied by cyclic voltammetric measurements, either directly on the hydrogel or in an aqueous solutions containing Fe(III)-citrate and purified Fe(III)-EPS. From the voltammetric data, the stability constant for the Fe(III)-EPS complex can be assumed to have values of approx. 1012–1013. It was estimated that this is higher than for the Fe(III)-citrate complex. Conclusions: The production of Fe(III)-EPS under anaerobic conditions is a strategy for the strain to survive in mine drainages and other acidic conditions. This physiological feature can be used to produce large amounts of valuable Fe(III)-EPS, starting from a low cost substrate such as Fe(III)-citrate. Significant and Impact of the Study: The data herein demonstrates that an interesting metal-binding molecule can be produced as a novel catalyst for a variety of potential applications and the EPS itself is a valuable source for rhamnose purification. PMID:19508299

Baldi, F; Marchetto, D; Battistel, D; Daniele, S; Faleri, C; De Castro, C; Lanzetta, R

2009-01-01

24

Final Technical Report: Genetic Control of Nitrogen Assimilation in Klebsiella oxytoca.  

SciTech Connect

Klebsiella oxytoca, an enterobacterium closely related to Escherichia coli and amenable to molecular genetic analysis, is a long-established model organism for studies of bacterial nitrogen assimilation. Our work concerned utilization of purines, nitrogen-rich compounds that are widespread in the biosphere. This project began with our observation that molybdenum cofactor (chlorate-resistant) mutants can use (hypo)xanthine as sole nitrogen source (Garzón et al., J. Bacteriol. 174:6298, 1992). Since xanthine dehydrogenase is a molybdoenzyme, Klebsiella must use an alternate route for (hypo)xanthine catabolsim. We identified and characterized a cluster of 22 genes that encode the enzymes, permeases and regulators for utilizing hypoxanthine and xanthine as sole nitrogen source. (Hypoxanthine and xanthine arise from deamination of adenine and guanine, respectively.) Growth and complementation tests with insertion mutants, combined with protein sequence comparisons, allow us to assign probable functions for the products of these genes and to deduce the overall pathway. We present genetic evidence that the first two enzymes for the Klebsiella purine utilization pathway have been recruited from pathways involved in catabolism of aromatic compounds. The first, HxaAB enzyme catalyzing (hypo)xanthine oxidation, is related to well-studied aromatic ring hydroxylating oxygenases such as phthalate dioxygenase. The second, HxbA enzyme catalyzing urate hydroxylation, is related to single-component monooxygenases. Thus, the Klebsiella purine utilization pathway has likely experienced non-orthologous gene displacement, substituting these oxygenases for the conventional enzymes, xanthine dehydrogenase and uricase. We also present evidence that transcription of the hxaAB operon is subject to dual regulation: global general nitrogen regulation (Ntr) through an unknown mechanism, and (hypo)xanthine induction mediated by a LysR-type activator.

Valley Stewart

2007-03-07

25

Biosynthesis of Indole-3-Acetic Acid by New Klebsiella oxytoca Free and Immobilized Cells on Inorganic Matrices  

PubMed Central

While many natural and synthetic compounds exhibit auxin-like activity in bioassays, indole-3-acetic acid (IAA) is recognized as the key auxin in most plants. IAA has been implicated in almost all aspects of plant growth and development and a large array of bacteria have been reported to enhance plant growth. Cells of Klebsiella oxytoca isolated from the rhizosphere of Aspidosperma polyneuron and immobilized by adsorption on different inorganic matrices were used for IAA production. The matrices were prepared by the sol-gel method and the silica-titanium was the most suitable matrix for effective immobilization. In operational stability assays, IAA production was maintained after four cycles of production, obtaining 42.80 ± 2.03??g?mL?1 of IAA in the third cycle, which corresponds to a 54% increase in production in relation to the first cycle, whereas free cells began losing activity after the first cycle. After 90 days of storage at 4°C the immobilized cells showed the slight reduction of IAA production without significant loss of activity. PMID:22623901

Celloto, Valéria R.; Oliveira, Arildo J. B.; Gonçalves, José E.; Watanabe, Cecília S. F.; Matioli, Graciette; Gonçalves, Regina A. C.

2012-01-01

26

First Description of KPC-2-Producing Klebsiella oxytoca Isolated from a Pediatric Patient with Nosocomial Pneumonia in Venezuela  

PubMed Central

During the last decade, carbapenem resistance has emerged among clinical isolates of the Enterobacteriaceae family. This has been increasingly attributed to the production of ?-lactamases capable of hydrolyzing carbapenems. Among these enzymes, Klebsiella pneumoniae carbapenemases (KPCs) are the most frequently and clinically significant class-A carbapenemases. In this report, we describe the first nosocomial KPC-2-producing K. oxytoca isolated from a pediatric patient with pneumonia admitted to the intensive care unit at The Andes University Hospital, Mérida, Venezuela. This strain was resistant to several antibiotics including imipenem, ertapenem, and meropenem but remained susceptible to ciprofloxacin, colistin, and tigecycline. Conjugation assays demonstrated the transferability of all resistance determinants, except aminoglycosides. The isolate LMM-SA26 carried a ~21?kb conjugative plasmid that harbored the blaKPC-2, blaCTX-M-8, and blaTEM-15 genes. Although carbapenem resistance in the Enterobacteriaceae is still unusual in Venezuela, KPCs have a great potential to spread due to their localization on mobile genetic elements. Therefore, rapid detection of KPC-carrying bacteria with phenotypic and confirmatory molecular tests is essential to establish therapeutic options and effective control measures. PMID:25405043

Labrador, Indira

2014-01-01

27

Fermentation of crystalline cellulose to ethanol by Klebsiella oxytoca containing chromosomally integrated zymomonas mobilis genes  

SciTech Connect

Complete enzymatic hydrolysis of cellulose to glucose is generally required for efficient fermentation to ethanol. This hydrolysis requires endoglucanase, exoglucanase, and cellobiase. The Gram-negative bacterium, Klebsiella oxytoca, contains the native ability to transport and metabolize cellobiose, minimizing the need for extracellular cellobiase. Strain P2 is a recombinant derivative in which the Zymomonas mobilis pdc and adhB genes have been integrated into the chromosome and expressed, directing the metabolism of pyruvate to ethanol. This organism has been evaluated in simultaneous saccharification and fermentation (SSF) experiments to determine optimal conditions and limits of performance. The temperature was varied between 32 and 40{degree}C over a pH range of 5.0-5.8 with 100 g/L crystalline cellulose (Sigmacell 50, Sigma Chemical Company, St. Louis, MO) as the substrate and commercial cellulase (Spezyme CE, South San Francisco, CA). A broad optimum for SSF was observed, with a pH of 5.2-5.5 and temperatures of 32-35{degree}C, which allowed the production of over 44 g of ethanol/L (81-86% of the maximum theoretical yield). Although the rate of ethanol production increased with cellulase, diminishing improvements were observed at enzyme loadings above 10 filter paper units/g of cellulose. 34 refs., 5 figs., 2 tabs.

Doran, J.B.; Ingram, L.O. [Univ. of Florida, Gainesville, FL (United States)

1993-09-01

28

The genes and enzymes for the catabolism of galactitol, D-tagatose, and related carbohydrates in Klebsiella oxytoca M5a1 and other enteric bacteria display convergent evolution  

Microsoft Academic Search

Enteric bacteria (Enteriobacteriaceae) carry on their single chromosome about 4000 genes that all strains have in common (referred to here as “obligatory genes”), and up to 1300 “facultative” genes that vary from strain to strain and from species to species. In closely related species, obligatory and facultative genes are orthologous genes that are found at similar loci. We have analyzed

A. Shakeri-Garakani; A. Brinkkötter; K. Schmid; S. Turgut; J. W. Lengeler

2004-01-01

29

Cytotoxic Effects of Klebsiella oxytoca Strains Isolated from Patients with Antibiotic-Associated Hemorrhagic Colitis or Other Diseases Caused by Infections and from Healthy Subjects? †  

PubMed Central

Antibiotic-associated hemorrhagic colitis (AAHC) is associated with Klebsiella oxytoca. This study analyzed whether cytotoxic properties are linked to specific subtypes of K. oxytoca. Klebsiella isolates from stools of AAHC patients, healthy carriers, and diarrhea patients as well as from infections of other organs were investigated. Cytotoxic effects on human epithelial cells were limited to the species K. oxytoca and were not detectable for any other Klebsiella species. Isolates from AAHC patients and from stools showed the highest proportion of cytotoxic strains. Urinary or respiratory tract isolates exhibited no cytotoxicity. Macrorestriction profiling of strains revealed no genetic relationships of AAHC isolates or the cytotoxic phenotype but identified that different K. oxytoca strains with different cytotoxic behaviors may be prevalent in the same AAHC patient. Under laboratory conditions, cytotoxicity was maximally effective after exponential bacterial growth and then declined despite the continued viability of K. oxytoca cells in culture. Given its capacity to induce AAHC and that a high proportion of stool isolates tested cytotoxin positive, we argue that K. oxytoca should be considered an opportunistic pathogen if detected in stools. The ability to induce disease after antibiotic treatment most likely represents an overgrowth of the toxin-producing bacterium due to an alteration of the normal colonic microflora. PMID:20053860

Joainig, Martina M.; Gorkiewicz, Gregor; Leitner, Eva; Weberhofer, Paul; Zollner-Schwetz, Ines; Lippe, Irmgard; Feierl, Gebhard; Krause, Robert; Hinterleitner, Thomas; Zechner, Ellen L.; Högenauer, Christoph

2010-01-01

30

Differentiation of Raoultella ornithinolytica/planticola and Klebsiella oxytoca clinical isolates by matrix-assisted laser desorption/ionization-time of flight mass spectrometry.  

PubMed

Ninety-nine clinical isolates previously identified as Klebsiella oxytoca were evaluated using matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS). Eight isolates were identified as Raoultella spp., being 5 Raoultella spp. and 3 K. oxytoca, by 16S rRNA sequencing. These isolates were correctly identified by applying the 10% differential rule for the MALDI-TOF MS score values. This approach might be useful to discriminate Raoultella species from K. oxytoca. PMID:23375086

de Jong, Eefje; de Jong, Arjan S; Smidts-van den Berg, Nathalie; Rentenaar, Rob J

2013-04-01

31

Genome-scale reconstruction and in silico analysis of Klebsiella oxytoca for 2,3-butanediol production  

PubMed Central

Background Klebsiella oxytoca, a Gram-negative, rod-shaped, and facultative anaerobic bacterium, is one of the most promising 2,3-butanediol (2,3-BD) producers. In order to improve the metabolic performance of K. oxytoca as an efficient biofactory, it is necessary to assess its metabolic characteristics with a system-wide scope, and to optimize the metabolic pathways at a systems level. Provision of the complete genome sequence of K. oxytoca enabled the construction of genome-scale metabolic model of K. oxytoca and its in silico analyses. Results The genome-scale metabolic model of K. oxytoca was constructed using the annotated genome with biochemical and physiological information. The stoichiometric model, KoxGSC1457, is composed of 1,457 reactions and 1,099 metabolites. The model was further refined by applying biomass composition equations and comparing in silico results with experimental data based on constraints-based flux analyses. Then, the model was applied to in silico analyses to understand the properties of K. oxytoca and also to improve its capabilities for 2,3-BD production according to genetic and environmental perturbations. Firstly, in silico analysis, which tested the effect of augmenting the metabolic flux pool of 2,3-BD precursors, elucidated that increasing the pyruvate pool is primarily important for 2,3-BD synthesis. Secondly, we performed in silico single gene knockout simulation for 2,3-BD overproduction, and investigated the changes of the in silico flux solution space of a ldhA gene knockout mutant in comparison with that of the wild-type strain. Finally, the KoxGSC1457 model was used to optimize the oxygen levels during fermentation for 2,3-BD production. Conclusions The genome-scale metabolic model, KoxGSC1457, constructed in this study successfully investigated metabolic characteristics of K. oxytoca at systems level. The KoxGSC1457 model could be employed as an useful tool to analyze its metabolic capabilities, to predict its physiological responses according to environmental and genetic perturbations, and to design metabolic engineering strategies to improve its metabolic performance. PMID:23432904

2013-01-01

32

Complete Sequences of Two Plasmids in a blaNDM-1-Positive Klebsiella oxytoca Isolate from Taiwan  

PubMed Central

Genetic determinants of a blaNDM-1-positive, multidrug-resistant bacterial isolate that caused active infection was investigated by DNA sequencing. Two plasmids, pKOX_NDM1 and pKOX-R1, were identified for the Klebsiella oxytoca strain E718. Sequence annotation revealed a blaNDM-1 gene in pKOX_NDM1 and two extended-spectrum ?-lactamase producers (blaCTX-M-3 and blaSHV-12) and a wide array of resistance genes in pKOX-R1. These findings highlight the difficulty in treating multidrug-resistant bacterial infections and the potential danger of emerging resistant enterobacteria. PMID:23752513

Huang, Tzu-Wen; Wang, Jann-Tay; Lauderdale, Tsai-Ling; Liao, Tsai-Lien; Lai, Jui-Fen; Tan, Mei-Chen; Lin, Ann-Chi; Chen, Ying-Tsong; Tsai, Shih-Feng

2013-01-01

33

Neonatal intensive care unit outbreak caused by a strain of Klebsiella oxytoca resistant to aztreonam due to overproduction of chromosomal ?-lactamase  

Microsoft Academic Search

Klebsiella oxytoca strains resistant to both aztreonam and ceftriaxone were isolated from six neonates in a neonatal intensive care unit and water reservoirs of two humidifiers attached to the neonatal incubators. These isolates were assumed to be of the same clone because they were characterized by the same antimicrobial susceptibility and pulsed field gel electrophoresis patterns. It was established that

S. H. Jeong; W. M. Kim; C. L. Chang; J. M. Kim; K. Lee; Y. Chong; H. Y. Hwang; Y. W. Baek; H. K. Chung; I. G. Woo; J. Y. Ku

2001-01-01

34

Fermentation of starch by Klebsiella oxytoca P2, containing plasmids with {alpha}-amylase and pullulanase genes  

SciTech Connect

Klebsiella oxytoca P2(pC46), an ethanol-producing recombinant, has been evaluated in fermentation of maltose and starch. The maximum ethanol produced by P2(pC46) was 0.34 g ethanol/g maltose and 0.38, 0.40, or 0.36 g ethanol/g starch in fermentation of 1, 2, or 4% starch, representing 68, 71, and 64% the theoretical yield. The pC46 plasmid transformed to cells of K. oxytoca P2 reduced the ethanol production from maltose and starch. In fermentation of starch after its digestion at 60 C for 24 h, in two-step fermentation, the time for maximum ethanol production was reduced to 12--24 h and the theoretical yield was around 90%. The increase in starch concentration resulted in lower {alpha}-amylase activity but in higher pullulanase activity. The high activity and thermostability of the amylolytic enzymes from this transformant suggest that it has a potential for amylolytic enzymes source.

Santos, V.L. dos; Araujo, E.F.; Barros, E.G. de; Guimaraes, W.V.

1999-12-20

35

Influence of Carbon Source on Nitrate Removal by Nitrate-Tolerant Klebsiella oxytoca CECT 4460 in Batch and Chemostat Cultures  

PubMed Central

The nitrate-tolerant organism Klebsiella oxytoca CECT 4460 tolerates nitrate at concentrations up to 1 M and is used to treat wastewater with high nitrate loads in industrial wastewater treatment plants. We studied the influence of the C source (glycerol or sucrose or both) on the growth rate and the efficiency of nitrate removal under laboratory conditions. With sucrose as the sole C source the maximum specific growth rate was 0.3 h?1, whereas with glycerol it was 0.45 h?1. In batch cultures K. oxytoca cells grown on sucrose or glycerol were able to immediately use sucrose as a sole C source, suggesting that sucrose uptake and metabolism were constitutive. In contrast, glycerol uptake occurred preferentially in glycerol-grown cells. Independent of the preculture conditions, when sucrose and glycerol were added simultaneously to batch cultures, the sucrose was used first, and once the supply of sucrose was exhausted, the glycerol was consumed. Utilization of nitrate as an N source occurred without nitrite or ammonium accumulation when glycerol was used, but nitrite accumulated when sucrose was used. In chemostat cultures K. oxytoca CECT 4460 efficiently removed nitrate without accumulation of nitrate or ammonium when sucrose, glycerol, or mixtures of these two C sources were used. The growth yields and the efficiencies of C and N utilization were determined at different growth rates in chemostat cultures. Regardless of the C source, yield carbon (YC) ranged between 1.3 and 1.0 g (dry weight) per g of sucrose C or glycerol C consumed. Regardless of the specific growth rate and the C source, yield nitrogen (YN) ranged from 17.2 to 12.5 g (dry weight) per g of nitrate N consumed. In contrast to batch cultures, in continuous cultures glycerol and sucrose were utilized simultaneously, although the specific rate of sucrose consumption was higher than the specific rate of glycerol consumption. In continuous cultures double-nutrient-limited growth appeared with respect to the C/N ratio of the feed medium and the dilution rate, so that for a C/N ratio between 10 and 30 and a growth rate of 0.1 h?1 the process led to simultaneous and efficient removal of the C and N sources used. At a growth rate of 0.2 h?1 the zone of double limitation was between 8 and 11. This suggests that the regimen of double limitation is influenced by the C/N ratio and the growth rate. The results of these experiments were validated by pulse assays. PMID:9687459

Piñar, Guadalupe; Kovárová, Karin; Egli, Thomas; Ramos, Juan L.

1998-01-01

36

Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar  

SciTech Connect

Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5?. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation {sup 325}RLDRD{sup 329} and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNA sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.

Moeis, Maelita R., E-mail: sony@sith.itb.ac.id; Berlian, Liska, E-mail: sony@sith.itb.ac.id; Suhandono, Sony, E-mail: sony@sith.itb.ac.id; Prima, Alex, E-mail: sony@sith.itb.ac.id; Komalawati, Eli, E-mail: sony@sith.itb.ac.id; Kristianti, Tati, E-mail: sony@sith.itb.ac.id

2014-03-24

37

Metabolic engineering of Klebsiella oxytoca M5a1 to produce optically pure D-lactate in mineral salts medium.  

PubMed

Klebsiella oxytoca strains were constructed to produce optical pure d-lactate by pH-controlled batch fermentation in mineral salts medium. The alcohol dehydrogenase gene, adhE, and the phospho-transacetylase/acetate kinase A genes, pta-ackA, were deleted from the wild type. KMS002 (?adhE) and KMS004 (?adhE ?pta-ackA) exhibited d-lactate production as a primary pathway for the regeneration of NAD(+). Both strains produced 11-13 g/L of d-lactate in medium containing 2% (w/v) glucose with yields of 0.64-0.71 g/g glucose used. In sugarcane molasses, KMS002 and KMS004 produced 22-24 g/L of d-lactate with yields of 0.80-0.87 g/g total sugars utilized. Both strains also utilized maltodextrin derived from cassava starch and produced d-lactate at a concentration of 33-34 g/L with yields of 0.91-0.92 g/g maltodextrin utilized. These d-lactate yields are higher than those reported for engineered E. coli strains. PMID:22728200

Sangproo, Maytawadee; Polyiam, Pattharasedthi; Jantama, Sirima Suvarnakuta; Kanchanatawee, Sunthorn; Jantama, Kaemwich

2012-09-01

38

Septic shock caused by Klebsiella oxytoca: An autopsy case and a survival case with driving Extracorporeal Membrane Oxygenation.  

PubMed

We report two cases of Klebsiella oxytoca bacteremia. Case 1 was a 56-year-old man who was transferred to our hospital by ambulance due to diarrhea and general fatigue. On arrival, he was clearly conscious. However he was in septic shock. We injected broad spectrum antibacterial agents and started intensive care. Though intensive care included continuous hemodiafiltration (CHDF), he died 22 hours after admission. Case 2 was a 69-year-old man with a history of gastrectomy for gastric cancer. He had been admitted to a previous hospital due to ileus. His ileus tube was removed on the eighth day, and he then developed a fever of 38 ºC on the following day. He went into shock and became unconscious; he was therefore transferred to our hospital. We diagnosed septic shock and disseminated intravascular coagulation (DIC). We injected broad spectrum antibacterial agents, and recombinant thrombomodulin alpha (rTM). Although he was started in intensive care, his hemodynamics were unstable on the day following admission. Extracorporeal membrane oxygenation (ECMO) and intra-aortic balloon pumping (IABP) were started to maintain his hemodynamics. His condition gradually improved, and he was transferred to the previous hospital for rehabilitation on the 28(th) day. ECMO for septic shock in adults is unusual; however ECMO can be introduced even in patients with severe sepsis under careful monitoring. The new anti-DIC agent rTM is useful for safe driving of ECMO in patients with DIC. PMID:24376326

Hagiwara, S; Murata, M; Aoki, M; Kaneko, M; Oshima, K

2013-04-01

39

Isolation and characterization of Klebsiella oxytoca strain degrading crude oil from a Tunisian off-shore oil field.  

PubMed

A facultatively anaerobic, Gram-negative, mesophilic, moderately halotolerant, non-motile, and non-sporulated bacterium, designated strain BSC5 was isolated from an off-shore "Sercina" oil field, located near the Kerkennah island, Tunisia. Yeast extract was not required for growth. Phenotypic characteristics and phylogenetic analysis of the 16S rRNA gene sequence of strain BSC5 revealed that it was related to members of the genus Klebsiella, being most closely related to the type strain of K. oxytoca (99% sequence similarity). Strain BSC5 was capable of using aerobically the crude oil as substrate growth. The growth of strain BSC5 on crude oil was followed by measuring the OD(600 nm) and by enumeration of viable cells at different culture's time. GC-MS analysis showed that strain BSC5 was capable of degrading a wide range of aliphatic hydrocarbons from C(13) to C(30) . The biodegradation rate for n -alkanes reached 44% and 75%, after 20 and 45 days of incubation, respectively. Addition of the synthetic surfactant, Tween 80, accelerated the crude oil degradation. The biodegradation rate for n -alkanes reached 61% and 98%, after 20 and 45 days of incubation, respectively. Moreover, three aromatic compounds, p -hydroxybenzoate, protocatechuate and gentisate, were metabolized completely by strain BSC5 after 24 h, under aerobic conditions. PMID:22144124

Chamkha, Mohamed; Trabelsi, Yosra; Mnif, Sami; Sayadi, Sami

2011-12-01

40

Evaluation of the Clinical and Laboratory Standards Institute phenotypic confirmatory test to detect the presence of extended-spectrum ?-lactamases from 4005 Escherichia coli, Klebsiella oxytoca, Klebsiella pneumoniae and Proteus mirabilis isolates.  

PubMed

A subset of Escherichia coli, Klebsiella oxytoca, Klebsiella pneumoniae and Proteus mirabilis isolates collected for the Study for Monitoring Antimicrobial Resistance Trends that were positive for the Clinical and Laboratory Standards Institute (CLSI) extended-spectrum ?-lactamase (ESBL) phenotypic confirmatory test (n?=?3245) or had an ertapenem MIC of ?0.5 µg ml(-1) (n?=?293), or both (n?=?467), were analysed for ESBL genes. Most ESBL phenotype E. coli or K. pneumoniae possessed an ESBL gene (95.8 and 88.4?%, respectively), and this was 93.1?% if carbapenem-non-susceptible K. pneumoniae were removed. This rate was lower for P. mirabilis (73.4?%) and K. oxytoca (62.5?%). Virtually all ESBL-positive isolates (99.5?%) were cefotaxime non-susceptible [CLSI or European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoints)]. Fewer isolates (82?%) were ceftazidime non-susceptible (CLSI breakpoints). In addition, 21.1?% of E. coli, 25?% of K. oxytoca and 78.7?% of P. mirabilis isolates were ceftazidime susceptible but ESBL positive. This suggests that CLSI breakpoints for ceftazidime are too high to detect ESBLs. The lower EUCAST breakpoints detected ESBLs in E. coli and K. oxytoca better, but 59.6?% of ESBL-positive isolates of P. mirabilis were ceftazidime susceptible. For isolates with ertapenem MICs ?0.5 µg ml(-1), more accurate ESBL phenotype analysis was observed for E. coli and K. pneumoniae (sensitivity >95?% for both, specificity 94.4 and 54.1?%, respectively). If carbapenemase-positive K. pneumoniae were excluded, the specificity increased to 78?%. The positive predictive values for the ESBL phenotypic test with E. coli and K. pneumoniae were 97.6 and 81.8?%, respectively, and negative predictive values were 75.9 and 95.2?%, respectively. We therefore suggest that it would be prudent to confirm phenotypic ESBL-positive P. mirabilis, K. pneumoniae and K. oxytoca with molecular analysis. PMID:24478449

Morrissey, Ian; Bouchillon, Samuel K; Hackel, Meredith; Biedenbach, Douglas J; Hawser, Stephen; Hoban, Daryl; Badal, Robert E

2014-04-01

41

General Nitrogen Regulation of Nitrate Assimilation Regulatory Gene nasR Expression in Klebsiella oxytoca M5al  

PubMed Central

Klebsiella oxytoca can assimilate nitrate and nitrite by using enzymes encoded by the nasFEDCBA operon. Expression of the nasF operon is controlled by general nitrogen regulation (Ntr) via the NtrC transcription activator and by pathway-specific nitrate and nitrite induction via the NasR transcription antiterminator. This paper reports our analysis of nasR gene expression. We constructed strains bearing single-copy ?(nasR-lacZ) operon fusions within the chromosomal rhaBAD-rhaSR locus. The expression of ?rhaBS::[?(nasR-lacZ)] operon fusions was induced about 10-fold during nitrogen-limited growth. Induction was reduced in both ntrC and rpoN null mutants, indicating that Ntr control of nasR gene expression requires the NtrC and ?N (?54) proteins. Sequence inspection of the nasR control region reveals an apparent ?N-dependent promoter but no apparent NtrC protein binding sites. Analysis of site-specific mutations coupled with primer extension analysis authenticated the ?N-dependent nasR promoter. Fusion constructs with only about 70 nucleotides (nt) upstream of the transcription initiation site exhibited patterns of ?-galactosidase expression indistinguishable from ?(nasR-lacZ) constructs with about 470 nt upstream. Expression was independent of the Nac protein, implying that NtrC is a direct activator of nasR transcription. Together, these results indicate that nasR gene expression does not require specific upstream NtrC-binding sequences, as previously noted for argT gene expression in Salmonella typhimurium (G. Schmitz, K. Nikaido, and G. F.-L. Ames, Mol. Gen. Genet. 215:107–117, 1988). PMID:10572131

Wu, Stephen Qitu; Chai, Weihang; Lin, Janine T.; Stewart, Valley

1999-01-01

42

[Research of indole-3-acetic acid biosynthetic pathway of Klebsiella oxytoca SG-11 by HPLC and GC-MS].  

PubMed

The plant growth promoting bacteria are closely associated to plant. The bacteria are used to adhering to plant rhizoplane, promoting plant growth by fixing nitrogen from atmosphere, secreting stimulating substances or producing antagonistic to plant pathogens. It was indicated that the biological nitrogen fixation played an important role in plant growth promoting function. In fact, it was verified recently by overall research that IAA does it. Therefore research of IAA production and biosynthetic pathway of plant growth-promoting bacteria is much more important. The various ways of IAA production indicated the strong or weak promoting function of bacterium to plants in general. The purpose of this paper is to determine whether IAA exists in cultured medium of Klebsiella axytoca SG-11 and biosynthetic pathway of IAA, in order to opimize cultural conditions for IAA production. Klebsiella axytoca SG-11 is a plant growth promoting bacterium, isolated from rice rhizoplane, which can fix nitrogen. The supernatant of SG-11 cultured medium determined by HPLC showed that 47.4 mg/L of IAA existed in LB medium and 1.2 mg/L of IAA, in basal medium. IAA in metabolite was identified by GC/MS as well. The intermediate determination of tryptamine, indole-3-acetamide, tryptophol and indole-3-acetonitrile indirectly indicated that IAA was biosynthesized in a pathway of indole-3-pyruvic acid. Meanwhile, tryptophol in metabolite of SG-11 was verified by GC/MS. The direct intermediates of indole-3-pyruvic acid and indole-3-acetaldehyde in the pathway can not be determined, because both are unstable under normal condition. As reversible conversion existed between indole-3 pyruvic aldehyde and tryptophol, the presence of tryptophol also proved the pathway of indole-3-pyruvic acid in the synthesis of IAA by Klebsiella axytoca SG-11. The results laid basis for further research of plant growth-promoting function of the bacterium. PMID:12541509

Lü, Z X; Song, W

2000-07-01

43

Isolation and molecular characterization of high-performance cellobiose-fermenting spontaneous mutants of ethanologenic Escherichia coli KO11 containing the Klebsiella oxytoca casAB operon.  

PubMed Central

Escherichia coli KO11 was previously constructed to produce ethanol from acid hydrolysates of hemicellulose (pentoses and hexoses) by the chromosomal integration of Zymomonas mobilis genes encoding pyruvate decarboxylase (pdc) and alcohol dehydrogenase (adhB). Klebsiella oxytoca P2 was constructed in an analogous fashion for the simultaneous saccharification and fermentation of cellulose and contains PTS enzymes for cellobiose. In this study, KO11 was further engineered for the fermentation of cellulose by adding the K. oxytoca casAB genes encoding Enzyme IIcellobiose and phospho-beta-glucosidase. Although the two K. oxytoca genes were well expressed in cloning hosts such as DH5 alpha, both were expressed poorly in E. coli KO11, a derivative of E. coli B. Spontaneous mutants which exhibited more than 15-fold-higher specific activities for cellobiose metabolism were isolated. The mutations of these mutants resided in the plasmid rather than the host. Three mutants were characterized by sequence analysis. All contained similar internal deletions which eliminated the casAB promoter and operator regions and placed the lacZ Shine-Dalgarno region immediately upstream from the casA Shine-Dalgarno region. KO11 harboring mutant plasmids (pLOI1908, pLOI1909, or pLOI1910) rapidly fermented cellobiose to ethanol, and the yield was more than 90% of the theoretical yield. Two of these strains were used with commercial cellulase to ferment mixed-waste office paper to ethanol. PMID:9406380

Moniruzzaman, M; Lai, X; York, S W; Ingram, L O

1997-01-01

44

Influence of blocking of 2,3-butanediol pathway on glycerol metabolism for 1,3-propanediol production by Klebsiella oxytoca.  

PubMed

Glycerol metabolism is a typical biological oxidoreductive reaction. 1,3-Propanediol (1,3-PD) is the final product of the reductive branch, while acetate, succinate, lactate, 2,3-butanediol (2,3-BD), and ethanol were produced in the oxidative branch. 2,3-BD, which has similar properties of high boiling point and water solubility with 1,3-PD, not only contests the carbon flow and NADH with 1,3-PD but also serves as an obstacle for obtaining high purity 1,3-PD in downstream processes. In this study, a 2,3-BD pathway-deficient mutant of Klebsiella oxytoca ZG36 was constructed by knocking out the budA gene of the wild-type strain M5al. The results of fed-batch fermentation by ZG36 indicated that the glycerol flux and the distribution of metabolites were altered in the K. oxytoca when the 2,3-BD pathway was blocked. No 2,3-BD was produced, and the activity of ?-acetolactate decarboxylase (?-ALDC) can not be detected in the fermentation processes. The indexes of the 1,3-PD titer, the conversion from glycerol to 1,3-PD, and the productivity per cell dry weight (CDW) increased by 42%, 62%, and 46%, respectively, compared with the M5al, and the yield of the byproducts also increased obviously. The assay of the enzyme activities in the oxidative branch and the reductive branch of the glycerol metabolism, as well as the intracellular redox state, exposited the results logically. PMID:21915590

Zhang, Gang; Yang, Guang; Wang, Xu; Guo, Qingjuan; Li, Ying; Li, Jilun

2012-09-01

45

Effect of pH on the metabolic flux of Klebsiella oxytoca producing 2,3-butanediol in continuous cultures at different dilution rates.  

PubMed

The efficiency of the bioconversion process and the achievable end-product concentration decides the economic feasibility of microbial 2,3-butanediol (2,3-BDO) production. In 2,3-BDO production, optimization of culture condition is required for cell growth and metabolism. Also, the pH is an important factor that influences microbial performance. For different microorganisms and substrates, it has been shown that the distribution of the metabolites in 2,3-BDO fermentation is greatly affected by pH, and the optimum pH for 2,3-BDO production seems dependently linked to the particular strain and the substrate employed. Quantification analysis of intracellular metabolites and metabolic flux analysis (MFA) were used to investigate the effect of pH on the Klebsiella oxytoca producing 2,3-BDO and other organic acids. The main objectives of MFA are the estimation of intracellular metabolic fluxes and the identification of rate-limiting step and the key enzymes. This study was conducted under continuous aerobic conditions at different dilution rates (0.1, 0.2, and 0.3 h(-1)) and different pH values (pH 5.5 and 7.0) for the steady-state experimental data. In order to obtain the flux distribution, the extracellular specific rates were calculated from the experimental data using the metabolic network model of K. oxytoca. Intracellular metabolite concentration profiles were generated using ultra-performance liquid chromatography/quadrupole time-of-flight mass spectrometry. PMID:23443450

Park, Changhun; Lu, Mingshou; Yun, Seokhun; Park, Kyungmoon; Lee, Jinwon

2013-06-01

46

Klebsiella pneumoniae produces no histamine: Raoultella planticola and Raoultella ornithinolytica strains are histamine producers.  

PubMed

Histamine fish poisoning is caused by histamine-producing bacteria (HPB). Klebsiella pneumoniae and Klebsiella oxytoca are the best-known HPB in fish. However, 22 strains of HPB from fish first identified as K. pneumoniae or K. oxytoca by commercialized systems were later correctly identified as Raoultella planticola (formerly Klebsiella planticola) by additional tests. Similarly, five strains of Raoultella ornithinolytica (formerly Klebsiella ornithinolytica) were isolated from fish as new HPB. R. planticola and R. ornithinolytica strains were equal in their histamine-producing capabilities and were determined to possess the hdc genes, encoding histidine decarboxylase. On the other hand, a collection of 61 strains of K. pneumoniae and 18 strains of K. oxytoca produced no histamine. PMID:12089029

Kanki, Masashi; Yoda, Tomoko; Tsukamoto, Teizo; Shibata, Tadayoshi

2002-07-01

47

Characterization of KPC-2-producing Escherichia coli, Citrobacter freundii, Enterobacter cloacae, Enterobacter aerogenes, and Klebsiella oxytoca isolates from a Chinese Hospital.  

PubMed

Twelve nonduplicated KPC-2-producing enterobacterial isolates, including three Escherichia coli, two Citrobacter freundii, two Enterobacter cloacae, four Enterobacter aerogenes, and one Klebsiella oxytoca, were collected from various clinical samples within 18 months (March 2011 to September 2012). Two of the 12 patients died from infections caused by KPC-2-producing pathogens, while the rest of the patients with KPC-2-producing pathogens improved or were cured. The majority of the clinical isolates exhibited a high-level of resistance to oxyimino-cephalosporins and carbapenems, and possessed self-transferable bla(KPC-2)-carrying plasmids with sizes ranging from 20 to 120?kb. Most isolates carried bla(CTX-M) and plasmid-mediated quinolone resistance genes, while some isolates produced 16S rRNA methylases (ArmA or RmtB). The genetic environment of bla(KPC-2) of most clinical strains was consistent with the genetic structure surrounding bla(KPC-2) on the plasmid pKP048, which contains an integration structure of a Tn3-based transposon and partial Tn4401 segment. Inserted fragments (truncated bla(TEM)) were detected upstream of the bla(KPC-2) gene for two E. aerogenes strains. In conclusion, the enterobacterial isolates exhibited sporadic emergence and did not arise by clonal spread at our hospital. The outcome of infections caused by KPC-producing enterobacterial isolates and their mortality were closely associated with the baseline condition of patients. The spread of bla(KPC-2) gene between different enterobacterial species in China was mainly mediated by horizontal transfer of the Tn3-based transposons and not the bla(KPC-2)-carrying plasmids. PMID:24433026

Luo, Yanping; Yang, Jiyong; Ye, Liyan; Guo, Lin; Zhao, Qiang; Chen, Rong; Chen, Yong; Han, Xuelin; Zhao, Jingya; Tian, Shuguang; Han, Li

2014-08-01

48

Hexavalent molybdenum reduction to mo-blue by a sodium-dodecyl-sulfate-degrading Klebsiella oxytoca strain DRY14.  

PubMed

Bacteria with the ability to tolerate, remove, and/or degrade several xenobiotics simultaneously are urgently needed for remediation of polluted sites. A previously isolated bacterium with sodium dodecyl sulfate- (SDS-) degrading capacity was found to be able to reduce molybdenum to the nontoxic molybdenum blue. The optimal pH, carbon source, molybdate concentration, and temperature supporting molybdate reduction were pH 7.0, glucose at 1.5% (w/v), between 25 and 30?mM, and 25°C, respectively. The optimum phosphate concentration for molybdate reduction was 5?mM. The Mo-blue produced exhibits an absorption spectrum with a maximum peak at 865 nm and a shoulder at 700?nm. None of the respiratory inhibitors tested showed any inhibition to the molybdenum-reducing activity suggesting that the electron transport system of this bacterium is not the site of molybdenum reduction. Chromium, cadmium, silver, copper, mercury, and lead caused approximately 77, 65, 77, 89, 80, and 80% inhibition of the molybdenum-reducing activity, respectively. Ferrous and stannous ions markedly increased the activity of molybdenum-reducing activity in this bacterium. The maximum tolerable concentration of SDS as a cocontaminant was 3?g/L. The characteristics of this bacterium make it a suitable candidate for molybdenum bioremediation of sites cocontaminated with detergent pollutant. PMID:24383052

Halmi, M I E; Zuhainis, S W; Yusof, M T; Shaharuddin, N A; Helmi, W; Shukor, Y; Syed, M A; Ahmad, S A

2013-01-01

49

Hexavalent Molybdenum Reduction to Mo-Blue by a Sodium-Dodecyl-Sulfate-Degrading Klebsiella oxytoca Strain DRY14  

PubMed Central

Bacteria with the ability to tolerate, remove, and/or degrade several xenobiotics simultaneously are urgently needed for remediation of polluted sites. A previously isolated bacterium with sodium dodecyl sulfate- (SDS-) degrading capacity was found to be able to reduce molybdenum to the nontoxic molybdenum blue. The optimal pH, carbon source, molybdate concentration, and temperature supporting molybdate reduction were pH 7.0, glucose at 1.5% (w/v), between 25 and 30?mM, and 25°C, respectively. The optimum phosphate concentration for molybdate reduction was 5?mM. The Mo-blue produced exhibits an absorption spectrum with a maximum peak at 865 nm and a shoulder at 700?nm. None of the respiratory inhibitors tested showed any inhibition to the molybdenum-reducing activity suggesting that the electron transport system of this bacterium is not the site of molybdenum reduction. Chromium, cadmium, silver, copper, mercury, and lead caused approximately 77, 65, 77, 89, 80, and 80% inhibition of the molybdenum-reducing activity, respectively. Ferrous and stannous ions markedly increased the activity of molybdenum-reducing activity in this bacterium. The maximum tolerable concentration of SDS as a cocontaminant was 3?g/L. The characteristics of this bacterium make it a suitable candidate for molybdenum bioremediation of sites cocontaminated with detergent pollutant. PMID:24383052

Halmi, M. I. E.; Zuhainis, S. W.; Yusof, M. T.; Shaharuddin, N. A.; Helmi, W.; Shukor, Y.; Syed, M. A.; Ahmad, S. A.

2013-01-01

50

EFFECTS OF VELOCITY ON THE TRANSPORT OF TWO BACTERIA THROUGH SATURATED SAND. GROUND WATER.  

EPA Science Inventory

Transport of the bacteria Klebsiella oxytoca and Burkholderia cepacia G4PR1 (G4PR1) was investigated in column experiments conducted under conditions that allowed us to quantify sorption under a range of ground water velocities. Column experiments (33 mm I.D. X 114 mm long colu...

51

ENUMERATION, TRANSPORT AND SURVIVAL OF BACTERIA ATTACHED TO GRANULAR ACTIVITATED CARBON IN DRINKING WATER  

EPA Science Inventory

The surfaces of granular activated carbon (GAC), sand, and anthracite particles were found to be populated to the same levels with heterotrophic plate count (HPC) bacteria. GAC supported a greater number of Klebsiella oxytoca than the other two filter media. In a study of operati...

52

Bacteria Associated with the Oesophageal Bulb of the Medfly Ceratitis capitata (Diptera:Tephritidae)  

Microsoft Academic Search

Extracellular Gram negative bacteria were found to be commonly associated to the oesophageal bulb of Ceratitis capitata with Klebsiella oxytoca and Enterobacter agglomerans as the most common species. All the isolates tested in vitro, except one, were sensitive to the antibacterial material present on the medfly laid egg surface.

Daniela Marchini; Marco Rosetto; Romano Dallai; Laura Marri

2002-01-01

53

Antibiotic susceptibility, serum response and surface properties of Klebsiella species.  

PubMed

Altogether 130 clinical isolates of five Klebsiella species (K. pneumoniae, K. planticola, K. oxytoca, K. ornithinolytica and K. terrigena) were characterized, for their susceptibility to five antibiotics, for susceptibility to serum bactericidal activity and for their hydrophobic properties. All strains exhibited ampicillin resistance. Ampicillin/sulbactam, gentamicin and ofloxacin showed effectiveness in 63.1, 67.7 and 71.5% of the Klebsiella isolates. K. planticola manifested the highest level of resistance to these antibiotics. The majority of Klebsiella strains (93.9%) were susceptible to cefuroxime. Sixty-four strains (49.2%) were serum resistant and intermediate serum sensitivity was shown by 57 strains (43.8%). A high percentage of serum resistant strains (65%) was found in K. planticola. Moderately hydrophobic properties determined by adherence of bacteria to xylene were demonstrated in 25 strains (19.2%). PMID:11297012

Hostacká, A; Klokocníková

2001-01-01

54

Protective effect of Klebsiella bacteria on lawn grasses under conditions of soil salinization  

NASA Astrophysics Data System (ADS)

The protective effect of the inoculation of lawn grasses grown under conditions of soil salinization with bacteria of the Klebsiella genus ( K. planticola and K. pneumoniae) was demonstrated. It was found that K. pneumoniae improves the plant growth under conditions of a high concentration of sodium chloride. It was also shown that the inoculation of lawn grasses with these bacteria optimizes the morphophysiological parameters of the plants and increases the number of mitoses in the apical parts of the roots, which leads to a less significant decrease in the mitotic index under the impact of salinization. The capacity of K. planticola to penetrate into the plants may favor the activation of protective mechanisms improving the immunological status of the plants and, hence, their tolerance to salinization.

Emtsev, V. T.; Sokolova, A. Ya.; Selitskaya, O. V.

2010-07-01

55

Plugging of a model rock system by using starved bacteria. [Klebsiella pneumoniae  

SciTech Connect

The effects of starvation on bacterial penetration through artificial rock cores were examined. Klebsiella pneumoniae was starved in a simple salts solution for a duration of up to 4 weeks. These cell suspensions were injected into sintered glass bead cores, and the resulting reductions in core permeabilities were recorded. Vegetative cell cultures of K. pneumoniae grown in a sodium citrate medium were injected into other, similar cores, and the reductions in core permeabilities were recorded. The starved cell suspensions did not completely block the core pores, whereas the vegetative cultures reduced core permeability to less than 1%. Scanning electron microscopy of core section infiltrated with either vegetative or starved cells showed that the former produced shallow skin plugs and copious amounts of glycocalyx at the inlet face, whereas the latter produced very little glycocalyx and the cells were distributed evenly throughout the length of the core. The use of a DNA assay to produce a cell distribution profile showed that, compared with the vegetative cells, starved bacteria were able to penetrate deeper into the cores. This was due to the smaller size of the cells and the reduction in biofilm production. This ability of starved bacteria to penetrate further into cores than the normal-size vegetative cells can be usefully applied to selective plugging for enhanced oil recovery. To further test the suitability of starved cells for use in selective plugging, the activities of starved cells present within cores were monitored before and after nutrient stimulation. Our data indicate that with nutrient stimulation, the starved cells lose their metabolic dormancy and produce reductions in core permeability due to cell growth and polymer production.

MacLeod, F.A.; Lappin-Scott, H.M.; Costerton, J.W.

1988-06-01

56

Indole3Acetic Acid (IAA) Production in Symbiotic and Non-Symbiotic Nitrogen-Fixing Bacteria and its Optimization by Taguchi Design  

Microsoft Academic Search

Production of Indole-3-acetic acid (IAA) in 35 different symbiotic and non-symbiotic nitrogen-fixing bacteria strains isolated\\u000a from soil and plant roots was studied and assayed by chromatography and colorimetric methods. These bacteria included Agrobacterium, Paenibacillus, Rhizobium, Klebsiella\\u000a oxytoca, and Azotobacter. The best general medium and synergism effects of isolates for IAA production were investigated. Effects of different variables\\u000a containing physical parameters

Dariush Shokri; Giti Emtiazi

2010-01-01

57

Exopolysaccharide production by nitrogen-fixing bacteria within nodules of Medicago plants exposed to chronic radiation in the Chernobyl exclusion zone  

Microsoft Academic Search

Nitrogen-fixing bacteria isolated from root nodules of Medicago plants growing in the 10 km zone around the Chernobyl nuclear power plant were screened for the production of new water-soluble acidic exopolysaccharides (EPSs). The different strains belonged to the Enteriobacteriaceae family (Enterobacter ludwigii, Raoultella terrigena, Klebsiella oxytoca), except for one which belonged to the Rhizobiaceae family (Sinorhizobium meliloti). All of the bacteria

Nathalie Pawlicki-Jullian; Bernard Courtois; Michelle Pillon; David Lesur; Anne Le Flèche-Mateos; Jean-Claude Laberche; Nadia Goncharova; Josiane Courtois

2010-01-01

58

Influence of Asellus aquaticus on Escherichia coli, Klebsiella pneumoniae, Campylobacter jejuni and naturally occurring heterotrophic bacteria in drinking water.  

PubMed

Water lice, Asellus aquaticus (isopoda), frequently occur in drinking water distribution systems where they are a nuisance to consumers and water utilities. Whether they are solely an aesthetic problem or also affect the microbial water quality is a matter of interest. We studied the influence of A. aquaticus on microbial water quality in non-chlorinated drinking water in controlled laboratory experiments. Pure cultures of the indicator organisms Escherichia coli and Klebsiella pneumoniae and the pathogen Campylobacter jejuni as well as naturally occurring heterotrophic drinking water bacteria (measured as heterotrophic plate counts, HPC) were investigated in microcosms at 7 °C, containing non-sterilised drinking water, drinking water sediment and A. aquaticus collected from a non-chlorinated ground water based drinking water supply system. Concentrations of E. coli, K. pneumoniae and C. jejuni decreased over time, following a first order decay with half lives of 5.3, 18.4 and 1.3 days, respectively. A. aquaticus did not affect survival of indicators and pathogens substantially whereas HPC were influenced by presence of dead A. aquaticus. Growth rates increased with an average of 48% for bacteria grown on R-2A agar and an average of 83% for bacteria grown on yeast extract agar when dead A. aquaticus were present compared to no and living A. aquaticus present. A. aquaticus associated E. coli, K. pneumoniae and C. jejuni were measured (up to 25 per living and 500 per dead A. aquaticus) and so were A. aquaticus associated heterotrophic bacteria (>1.8*10(4) CFU per living and >6*10(4) CFU per dead A. aquaticus). A. aquaticus did not serve as an optimised habitat that increased survival of indicators and pathogens, since A. aquaticus associated E. coli, K. pneumoniae and C. jejuni were only measured as long as the bacteria were also present in the water and sediment. PMID:22884244

Christensen, Sarah C B; Nissen, Erling; Arvin, Erik; Albrechtsen, Hans-Jørgen

2012-10-15

59

A molecular phylogeny of enteric bacteria and implications for a bacterial species concept.  

PubMed

A molecular phylogeny for seven taxa of enteric bacteria (Citrobacter freundii, Enterobacter cloacae, Escherichia coli, Hafnia alvei, Klebsiella oxytoca, Klebsiella pneumoniae, and Serratia plymuthica) was made from multiple isolates per taxa taken from a collection of environmental enteric bacteria. Sequences from five housekeeping genes (gapA, groEL, gyrA, ompA, and pgi) and the 16S rRNA gene were used to infer individual gene trees and were concatenated to infer a composite molecular phylogeny for the species. The isolates from each taxa formed tight species clusters in the individual gene trees, suggesting the existence of 'genotypic' clusters that correspond to traditional species designations. These sequence data and the resulting gene trees and consensus tree provide the first data set with which to assess the utility of the recently proposed core genome hypothesis (CGH). The CGH provides a genetically based approach to applying the biological species concept to bacteria. PMID:14640415

Wertz, J E; Goldstone, C; Gordon, D M; Riley, M A

2003-11-01

60

Fermentation of polysaccharides by Klebsiella and other facultative bacilli  

SciTech Connect

Fermentations of 10 polysaccharides by species of the family Enterobacteriaceae were examined. Algin, guar, karaya, xanthan, and xylan were not fermented by any of the strains tested. Most of the activity was found in the tribe Klebsielleae. Klebseilla oxytoca fermented amylopectin (97% of the strains studied), carrageenan (100%), inulin (68%), polypectate (100%), and tragacanth (100%). Klebsiella pneumoniae fermented amylopectin (91%), carrageenan (100%), and tragacanth (86%). Carraggeenan was also fermented by Enterobacter aerogenes (100%), Enterobacter agglomerans (63%), Enterobacter cloacae (95%), and pectobacterium (38%). pectobacterium shared polypectate fermentation (100%) with K. oxytoca. With one exception, Serratia strains were negative on all polysaccharides. These results, along with other evidence, indicate that (i) the genus Klebsiella is biochemically the most versatile genus of the tribe, (ii) because of its distinct characteristics, K. oxytoca warrants species designation separate from K. pneumoniae, and (iii) some food additives generally considered indigestible can be metabolized by a few species of facultative bacilli, whereas others appear to be resistant.

Ochuba, G.U.; Von Riesen, V.L.

1980-05-01

61

Difficulties in identifying Klebsiella strains of clinical origin.  

PubMed

Two hundred and four strains of Gram-negative bacteria of clinical origin, initially identified as Klebsiella using the API 20 E system, and 10 reference strains were further analysed with the API 20 EC test system and the API 50 CH, API 50 AO, API 50 AA assimilation systems. Four clusters corresponding to the species Klebsiella pneumoniae subsp. pneumoniae, K. oxytoca, K. planticola, and K. terrigena were formed after numerical analysis of 155 selected tests and the 26 most discriminating tests were determined. A comparison was made between conventional identification using the API 20 E system and the results of the numerical analysis. The conventional method resulted in incorrect identification of 13% of the strains tested, especially for the new species: K. planticola and K. terrigena. After numerical analysis, 17 out of 204 strains (8.3%) of clinical origin were identified as K. planticola. Only 1 strain of clinical origin was identified as K. terrigena, and 1 strain as K. ornithinolytica. PMID:1863314

Monnet, D; Freney, J; Brun, Y; Boeufgras, J M; Fleurette, J

1991-01-01

62

Relationship between indole production and differentiation of Klebsiella species: indole-positive and -negative isolates of Klebsiella determined to be clonal.  

PubMed

Klebsiellae are an important cause of nosocomial infections. The two clinically relevant species, Klebsiella pneumoniae and Klebsiella oxytoca, are differentiated by the ability to produce indole from tryptophan, K. oxytoca being indole positive. We report here the detailed biochemical and molecular analysis of two isolates of Klebsiella, cultured from the same urine specimen, that differed only in their ability to produce indole. The two isolates were identical as determined by ribotyping and pulsed-field gel electrophoresis, and they differed from 10 epidemiologically unrelated strains. Probing with the Escherichia coli tryptophanase operon, tna, revealed seven restriction fragment length polymorphisms (RFLP) among the 12 strains. The two index strains had identical RFLP; no single RFLP could account for all of the indole-positive or -negative strains. Thus, the identification of epidemiologically related strains of Klebsiella differing only in indole production may warrant further examination to determine whether the strains are clonal. PMID:8370726

Maslow, J N; Brecher, S M; Adams, K S; Durbin, A; Loring, S; Arbeit, R D

1993-08-01

63

Low Diversity Bacterial Community and the Trapping Activity of Metabolites from Cultivable Bacteria Species in the Female Reproductive System of the Oriental Fruit Fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae)  

PubMed Central

Our goal was to identify the bacteria inhabiting the reproductive system of the female oriental fruit fly, Bactrocera dorsalis (Hendel), and evaluate the chemotaxis of B. dorsalis to the metabolites produced by the bacteria. Based on 16S rRNA-based polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE), 18 operational taxonomic units (OTUs) were assigned to the five bacterial classes Betaproteobacteria, Alphaproteobacteria, Gammaproteobacteria, Bacilli and Actinobacteria. Nine OTUs were assigned to Gammaproteobacteria, which was the most highly represented class. Enterobacteriaceae constituted the dominant family, and within this family, three genera and five species were identified, including Enterobacter sakazakii, Klebsiella oxytoca, Klebsiella pneumoniae, Raoultella terrigena and Enterobacter amnigenus. In this set, the first two species were the dominant components, and the latter three species were the minor ones. Finally, we found that the metabolites produced by R. terrigena, K. oxytoca and K. pneumoniae were attractive to the B. dorsalis adults, and in field studies, B. dorsalis adults were most attracted to K. oxytoca. Collectively, our results suggest that the female reproductive system plays an important role in the transfer of enterobacteria from the gut to fruit. Our data may prompt the development of a female-targeted population control strategy for this fly. PMID:22754363

Shi, Zhanghong; Wang, Lili; Zhang, Hongyu

2012-01-01

64

Refactoring the nitrogen fixation gene cluster from Klebsiella oxytoca  

E-print Network

Bacterial genes associated with a single trait are often grouped in a contiguous unit of the genome known as a gene cluster. It is difficult to genetically manipulate many gene clusters because of complex, redundant, and ...

Zhao, Dehua

65

Digestion of cellulose and xylan by symbiotic bacteria in the intestine of the Indian flying fox (Pteropus giganteus).  

PubMed

Bats (Order Chiroptera) are a widely distributed group of mammals. Pteropus giganteus belongs to the Suborder Megachiroptera. This bat consumes fruits and leaves as their major food. Cellulose and xylan are the major composition of leaves. As they consume leaves in their diet, their digestive tract must contain cellulolytic and xylanolytic bacteria which help in the digestion of cellulose and xylan. The cellulolytic and xylanolytic bacteria were isolated and screened on Berg's agar containing cellulose and xylan. The bacteria isolated were characterized biochemically and found to be Proteus vulgaris, Proteus mirabilis, Citrobacter freundii, Serratia liquefaciens and Klebsiella oxytoca. These bacteria help in digestion of cellulose and xylan in the diet of the bat, P. giganteus. Here we show that leaves are also used as a carbohydrate source by these bats. An insectivorous bat, Hipposideros fulvus, was used as a control and does not possess cellulolytic and xylanolytic bacteria. PMID:15471682

Prem Anand, A Alwin; Sripathi, K

2004-09-01

66

[Effect of culture media on surface and enzymatic activity in Klebsiella species].  

PubMed

The effect of three complex media (KM) [Mueller-Hinton broth (MHB), brain heart infusion (MSI) and proteose peptone (PP)] and one mineral medium (MM) on surface and enzyme activities of five strains Klebsiella species was studied. Klebsiella oxytoca and Klebsiella ornithinolytica had a marked hydrophobic character after growth in MHB, MSI and MM, Klebsiella terrigena only in PP. K. oxytoca and K. ornithinolytica had a higher motility after cultivation in KM compared with MM, the motility of K. terrigena was not affected. The lipolytic activity of all tested strains was highest after growth in MSI and PP. The composition of culture medium affected bacterial parameters tested to a different extent depending on the species. PMID:12184188

Hostacká, A

2002-08-01

67

Recommended Test Panel for Differentiation of Klebsiella Species on the Basis of a Trilateral Interlaboratory Evaluation of 18 Biochemical Tests  

PubMed Central

Klebsiella pneumoniae and Klebsiella oxytoca are the two most frequently encountered Klebsiella species giving rise to infections in humans, but other Klebsiella species can also be found in clinical specimens: Klebsiella ozaenae, Klebsiella rhinoscleromatis, Klebsiella terrigena, Klebsiella planticola, Klebsiella ornithinolytica, and Enterobacter aerogenes (Klebsiella mobilis). However, many of these species are indistinguishable by the conventional methods employed routinely in the clinical microbiological laboratory. Several investigators have suggested various additional tests, but as yet there is no standardized test panel for identifying all Klebsiella species and subspecies. In the present study, performed in three national Klebsiella reference laboratories, we have evaluated a test panel consisting of 18 biochemical tests on 242 strains comprising all Klebsiella species and subspecies. The test panel was designed to identify organisms preliminarily identified as belonging to the genus Klebsiella on the basis of conventional methods or automated identification systems. With the described test panel it is possible to find one or more positive test results differentiating any Klebsiella species, except Klebsiella rhinoscleromatis, from its closest relative. PMID:15297514

Hansen, Dennis S.; Aucken, Hazel M.; Abiola, Titi; Podschun, Rainer

2004-01-01

68

Recommended test panel for differentiation of Klebsiella species on the basis of a trilateral interlaboratory evaluation of 18 biochemical tests.  

PubMed

Klebsiella pneumoniae and Klebsiella oxytoca are the two most frequently encountered Klebsiella species giving rise to infections in humans, but other Klebsiella species can also be found in clinical specimens: Klebsiella ozaenae, Klebsiella rhinoscleromatis, Klebsiella terrigena, Klebsiella planticola, Klebsiella ornithinolytica, and Enterobacter aerogenes (Klebsiella mobilis). However, many of these species are indistinguishable by the conventional methods employed routinely in the clinical microbiological laboratory. Several investigators have suggested various additional tests, but as yet there is no standardized test panel for identifying all Klebsiella species and subspecies. In the present study, performed in three national Klebsiella reference laboratories, we have evaluated a test panel consisting of 18 biochemical tests on 242 strains comprising all Klebsiella species and subspecies. The test panel was designed to identify organisms preliminarily identified as belonging to the genus Klebsiella on the basis of conventional methods or automated identification systems. With the described test panel it is possible to find one or more positive test results differentiating any Klebsiella species, except Klebsiella rhinoscleromatis, from its closest relative. PMID:15297514

Hansen, Dennis S; Aucken, Hazel M; Abiola, Titi; Podschun, Rainer

2004-08-01

69

Phylogenetic analyses of Klebsiella species delineate Klebsiella and Raoultella gen. nov., with description of Raoultella ornithinolytica comb. nov., Raoultella terrigena comb. nov. and Raoultella planticola comb. nov.  

PubMed

The phylogenetic relationships of the type strains of 9 Klebsiella species and 20 species from 11 genera of the family Enterobacteriaceae were investigated by performing a comparative analysis of the sequences of the 16S rRNA and rpoB genes. The sequence data were phylogenetically analysed by the neighbourjoining and parsimony methods. The phylogenetic inference of the sequence comparison confirmed that the genus Klebsiella is heterogeneous and composed of species which form three clusters that also included members of other genera, including Enterobacter aerogenes, Erwinia clusters I and II and Tatumella. Cluster I contained the type strains of Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. rhinoscleromatis and Klebsiella pneumoniae subsp. ozaenae. Cluster II contained Klebsiella ornithinolytica, Klebsiella planticola, Klebsiella trevisanii and Klebsiella terrigena, organisms characterized by growth at 10 degrees C and utilization of L-sorbose as carbon source. Cluster III contained Klebsiella oxytoca. The data from the sequence analyses along with previously reported biochemical and DNA-DNA hybridization data support the division of the genus Klebsiella into two genera and one genogroup. The name Raoultella is proposed as a genus name for species of cluster II and emended definitions of Klebsiella species are proposed. PMID:11411716

Drancourt, M; Bollet, C; Carta, A; Rousselier, P

2001-05-01

70

Cloning of a gene encoding a unique haemolysin from Klebsiella pneumoniae and its potential use as a species-specific gene probe.  

PubMed

A gene, designated khe, that encodes a haemolysin of Klebsiella pneumoniae CMC-1 has been cloned and sequenced. When expressed in Escherichia coli, a unique peptide of approximately 20kDa was identified. Nucleotide sequence analysis predicted a single open reading frame (ORF) of 486bp encoding a 162 amino acid polypeptide with an estimated pI of 6.77. No extensive sequence homology could be identified between khe and any reported sequence at either the nucleotide or amino acid level. Furthermore, DNA hybridizations under high stringency conditions failed to show any cross hybridizations to several bacteria including K. oxytoca, K. planticola, K. terrigena and K. ornithinolytica. These data indicate that we have cloned a unique gene, which is highly conserved among tested K. pneumoniae isolates. PMID:12127794

Yin-Ching, Chuang; Jer-Horng, Su; Ching-Nan, Lin; Ming-Chung, Chang

2002-07-01

71

The activity of antimicrobial peptide S-thanatin is independent on multidrug-resistant spectrum of bacteria.  

PubMed

In this study, the activity of S-thanatin (an analog of antimicrobial peptide derived from thanatin) against different bacterial pathogens frequently which can cause therapeutic problems was tested. The result showed minimal inhibitory concentrations (MICs) of S-thanatin against all isolates of the Escherichia coli, Klebsiella pneumoniae, Enterobacter cloacae, Enterobacter aerogenes, Klebsiella ornithinolytica and Klebsiella oxytoca were in the range of 4-16?g/ml, no matter which antibiotic the bacterial was resistant or susceptible, while almost all MICs to Gram-positive bacterial were >128?g/ml except Enterococcus faecium. S-thanatin was more effective toward Gram-negative strains, especially for Enterobacter and Klebsiella. The MICs of S-thanatin were no significantly different in the same species regardless of antibiotic sensitive or -resistant isolates to single or multiple antibiotic (P>0.05). Likewise, no notable difference could be observed between E. coli, K. pneumoniae, E. cloacae, E. aerogenes, K. ornithinolytica which were sensitive to S-thanatin (P>0.05). It was implied that the antimicrobial activity of S-thanatin was independent on multi-drug resistance spectrum of bacteria. PMID:21453736

Wu, Guoqiu; Li, Xiaofang; Fan, Xiaobo; Wu, Hongbin; Wang, Shenglan; Shen, Zilong; Xi, Tao

2011-06-01

72

Alimentary Tract Bacteria Isolated and Identified with API-20E and Molecular Cloning Techniques from Australian Tropical Fruit Flies, Bactrocera cacuminata and B. tryoni  

PubMed Central

Bacteria were isolated from the crop and midgut of field collected Bactrocera cacuminata (Hering) and Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). Two methods were used, firstly isolation onto two types of bacteriological culture media (PYEA and TSA) and identification using the API-20E diagnostic kit, and secondly, analysis of samples using the 16S rRNA gene molecular diagnostic method. Using the API-20E method, 10 genera and 17 species of bacteria in the family Enterobacteriaceae were identified from cultures growing on the nutrient agar. The dominant species in both the crop and midgut were Citrobacter freundii, Enterobacter cloacae and Klebsiella oxytoca. Providencia rettgeri, Klebsiella pneumoniae ssp ozaenae and Serratia marcescens were isolated from B. tryoni only. Using the molecular cloning technique that is based on 16S rRNA gene sequences, five bacteria classes were dignosed — Alpha-, Beta-, Gamma- and Delta- Proteobacteria and Firmicutes — including five families, Leuconostocaceae, Enterococcaceae, Acetobacteriaceae, Comamonadaceae and Enterobacteriaceae. The bacteria affiliated with Firmicutes were found mainly in the crop while the Gammaproteobacteria, especially the family Enterobacteriaceae, was dominant in the midgut. This paper presents results from the first known application of molecular cloning techniques to study bacteria within tephritid species and the first record of Firmicutes bacteria in these flies. PMID:20883132

Thaochan, N.; Drew, R. A. I.; Hughes, J. M.; Vijaysegaran, S.; Chinajariyawong, A.

2010-01-01

73

Sequencing of 16S rDNA of Klebsiella: taxonomic relations within the genus and to other Enterobacteriaceae.  

PubMed

The 16S rDNAs of 20 strains of Klebsiella were sequenced and used for construction of a phylogenetic tree together with already published Enterobacteriaceae 16S rDNA sequences. The taxonomy within the Klebsiella genus, as reflected by the 16S rDNA tree, was in agreement with existing DNA-DNA hybridisation and numerical taxonomy data, indicating that for Klebsiella, 16S rDNA sequencing is a valid method for identification and taxonomical purposes. Five closely related clusters were found in the Klebsiella genus; Cluster I, K. oxytoca; Cluster II, K. terrigena, Cluster III, K. planticola and K. ornithinolytica; Cluster IV, Enterobacter aerogenes (K. mobilis); and Cluster V, K. pneumoniae. The position of Calymmatobacterium granulomatis within the genus and closest to K. pneumoniae was confirmed. For the species K. oxytoca, data seem to indicate a subdivision into two subspecies. In addition, a biochemically aberrant Klebsiella strain (BEC441) that was included in the analysis could not be assigned to any of the known species, but was found to be closest related to K. oxytoca. Furthermore, the high sequence similarity between the two environmental species K. planticola and K. ornithinolytica does not justify a distinction of the two species. Finally, within a 165-bp stretch of the 16S rDNA sequences, species-specific nucleotides were found. PMID:12635932

Boye, Kit; Hansen, Dennis S

2003-02-01

74

Chemical structure and inhalation toxicity of lipopolysaccharides from bacteria on cotton.  

PubMed Central

Lipopolysaccharides from different bacteria isolated from cotton were purified and chemically analyzed. Their pulmonary toxicity to animals was tested in inhalation tests. Lipopolysaccharides from Agrobacterium and Xanthomonas were shown to differ from the others in that they contained no heptose and no non-hydroxylated fatty acids with a chain length of 12, 14, or 16 carbon atoms. Lipopolysaccharides from Pseudomonas putida, Enterobacter agglomerans, and Klebsiella oxytoca were found to cause an influx of polymorphonuclear leukocytes into the airways. Lipopolysaccharides from Agrobacterium sp. and Xanthomonas sinensis caused no significant invasion. The data point to substances in both the lipid A part and the core part of the lipopolysaccharides being responsible for the capacity to induce leukocyte invasion into the airways. PMID:7000706

Helander, I; Salkinoja-Salonen, M; Rylander, R

1980-01-01

75

21 CFR 866.3340 - Klebsiella spp. serological reagents.  

Code of Federal Regulations, 2011 CFR

...spp. from cultured isolates derived from clinical specimens. The identification aids in the diagnosis of diseases caused by bacteria belonging to the genus Klebsiella and provides epidemiological information on these diseases. These organisms can...

2011-04-01

76

Identification of Clinical Isolates of Indole-Positive and Indole-Negative Klebsiella spp.?  

PubMed Central

Biochemical methods employed to classify bacterial species have limitations and may have contributed to the taxonomic complexity recently reported for the genus Klebsiella. The objective of the present study was to apply a simple biochemical test panel to classify a collection of human Klebsiella isolates. We found that with only three additional tests, it is possible to place most isolates in a defined species. Analysis of a 512-bp sequence of the rpoB gene was used as the reference. A total of 16 conventional and 4 supplementary tests were used to evaluate 122 recent isolates identified as Klebsiella from 120 patients, isolated at the clinical laboratory of a university hospital in Minas Gerais, Brazil. Of these, 102 (84%) isolates were identified as Klebsiella pneumoniae or Klebsiella variicola, 19 (15%) as Klebsiella oxytoca, and 1 (1%) as Raoultella planticola. Enterobacterial repetitive intergenic consensus-PCR typing revealed a diversity of genotypes. rpoB gene sequencing confirmed the phenotypic identification and detected five K. variicola isolates among the K. pneumoniae/K. variicola group. Three additional tests that include growth at 10°C and histamine and d-melezitose assimilation should be considered essential tests for the typing of Klebsiella isolates. PMID:16928968

Alves, Maria Silvana; Dias, Rubens Clayton da Silva; de Castro, Angela Christina Dias; Riley, Lee W.; Moreira, Beatriz Meurer

2006-01-01

77

Carbapenemase-producing Klebsiella pneumoniae  

PubMed Central

The continuing emergence of infections due to multidrug resistant bacteria is a serious public health problem. Klebsiella pneumoniae, which commonly acquires resistance encoded on mobile genetic elements, including ones that encode carbapenemases, is a prime example. K. pneumoniae carrying such genetic material, including both blaKPC and genes encoding metallo-?-lactamases, have spread globally. Many carbapenemase-producing K. pneumoniae are resistant to multiple antibiotic classes beyond ?-lactams, including tetracyclines, aminoglycosides, and fluoroquinolones. The optimal treatment, if any, for infections due to these organisms is unclear but, paradoxically, appears to often require the inclusion of an optimally administered carbapenem. PMID:25343037

Deresinski, Stan

2014-01-01

78

Endogenous Klebsiella pneumoniae endophthalmitis.  

PubMed

Klebsiella pneumonia is a common human pathogen, and endogenous endophthalmitis is a vision-threatening infection presentedwith pain, redness, decreased vision acuity, and intraocular inflammation. Endogenous endophthalmitis caused by Klebsiella pneumoniae is uncommon and usually happens in patients with immunosuppression conditions. Diabetes is a predisposing risk factor, and liver abscess is a major source of Klebsiella pneumonia endogenous endophthalmitis (KPEE). Here, we report a case of KPEE in a patient who lost his vision in one eye after treatment. PMID:24768670

Yin, Wenpeng; Zhou, Haijiang; Li, Chunsheng

2014-10-01

79

Analysis of the 16S-23S rRNA gene internal transcribed spacer region in Klebsiella species.  

PubMed

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types-ITS(none) (without tRNA genes), ITS(glu) [with a tRNA(Glu (UUC)) gene], and ITS(ile+ala) [with tRNA(Ile (GAU)) and tRNA(Ala (UGC)) genes]-were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITS(glu) and ITS(ile+ala). The presence of ITS(none) in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITS(none), from 0.967 to 1.000 for ITS(glu), and from 0.968 to 1.000 for ITS(ile+ala). Interspecies sequence identities range from 0.775 to 0.989 for ITS(none), from 0.798 to 0.997 for ITS(glu), and from 0.712 to 0.985 for ITS(ile+ala). Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

2008-11-01

80

Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species?  

PubMed Central

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

2008-01-01

81

SUSCEPTIBILITY OF CHEMOSTAT-GROWN 'YERSINIA ENTEROCOLITICA' AND 'KLEBSIELLA PNEUMONIAE' TO CHLORINE DIOXIDE  

EPA Science Inventory

The resistance of bacteria to antimicrobial agents could be influenced by growth environment. The susceptibility of two enteric bacteria, Yersinia enterocolitica and Klebsiella pneumoniae, to chlorine dioxide was investigated. These organisms were grown in a defined medium in a c...

82

The antigens contributing to the serological cross-reactions of Proteus antisera with Klebsiella representatives.  

PubMed

Proteus sp. and Klebsiella sp. mainly cause infections of the urinary and respiratory tracts or wounds in humans. The representatives of both genera produce virulence factors like lipopolysaccharide (LPS) or outer membrane proteins (OMPs) having much in common in the structures and/or functions. To check how far this similarity is revealed in the serological cross-reactivity, the bacterial masses of 24 tested Klebsiella sp. strains were tested in ELISA with polyclonal rabbit antisera specific to the representatives of 79 Proteus O serogroups. The strongest reacting systems were selected to Western blot, where the majority of Klebsiella masses reacted in a way characteristic for electrophoretic patterns of proteins. The strongest reactions were obtained for proteins of near 67 and 40kDa and 12.5kDa. Mass spectrometry analysis of the proteins samples of one Proteus sp. and one Klebsiella sp. strain showed the GroEL like protein of a sequence GI number 2980926 to be similar for both strains. In Western blot some Klebsiella sp. masses reacted similarly to the homologous Proteus LPSs. The LPS contribution in the observed reactions of the high molecular-mass LPS species was confirmed for Klebsiella oxytoca 0.062. PMID:25510650

Palusiak, Agata

2015-03-01

83

Extended-spectrum ?-lactamases of Escherichia coli and Klebsiella pneumoniae screened by the VITEK 2 system.  

PubMed

The VITEK 2 automated system (bioMérieux) is one of the most widely used instruments in clinical microbiology laboratories for the identification and evaluation of the susceptibility profiles of bacteria including the detection of extended-spectrum ?-lactamases (ESBLs) produced by Escherichia coli, Klebsiella pneumoniae and Klebsiella oxytoca. Currently, the Clinical and Laboratory Standards Institute recommends the use of ESBL confirmatory tests in addition to standard susceptibility testing. In order to evaluate the accuracy of VITEK 2-positive results regarding clinical isolates of E. coli (n?=?110) and K. pneumoniae (n?=?72), four additional ESBL detection systems were compared: the Phoenix Automated Microbiology System (BD Diagnostic Systems) and the MicroScan WalkAway-96 System (Dade Behring), and two manual systems as confirmatory tests, the Etest (AB Biodisk) and double disc diffusion (DDS) test. Epidemiological data regarding the tested strains were also collected and their susceptibility phenotypes were determined. The four methods resulted in concordant results for 126 of the 182 strains. However, the different tests displayed distinct results: the VITEK 2 system was in disagreement in 23.9?% of cases with DDS, in 15.3?% with Etest, in 23?% with the MicroScan WalkAway-96 System and in 23.6?% with the Phoenix Automated Microbiology System. Epidemiological data indicated that the majority of ESBL-positive E. coli strains were isolated from patients admitted to internal medicine wards (72.7?%), whilst K. pneumoniae ESBL-positive isolates were equally distributed between internal medicine wards (45.8?%) and intensive care units (45.8?%). Most of these strains were isolated from urine. In contrast to ESBL-negative isolates, the ESBL-positive strains displayed multiple drug resistance, namely to quinolones, aminoglycosides and trimethoprim-sulfamethoxazole. No significant resistance to carbapenems was detected. Overall, this study demonstrates the need for a confirmatory test following positive ESBL detection with the VITEK 2 system (panel AST-037), which appears to yield a large number of false-positive results. PMID:21330411

Espinar, Maria José; Rocha, Rita; Ribeiro, Manuela; Gonçalves Rodrigues, Acácio; Pina-Vaz, Cidália

2011-06-01

84

The in vitro effect of imipenem and ofloxacin on enzymic activity of Klebsiella strains.  

PubMed

Fifty seven Klebsiella strains, viz. K. pneumoniae (28), K. planticola (19), K. oxytoca (6), K. ornithinolytica (3) and K. terrigena (1) possessed lipolytic and urealytic activity. The effect of imipenem and ofloxacin at subinhibitory concentrations (sub-MICs) on these enzymic activities of 4 strains was studied. At all the concentrations tested (mainly at 1/4 of the MICs) imipenem enhanced lipase activity manifested by cleavage of the substrate Tween 20. The effect of ofloxacin was strain- and concentration-dependent but in most cases lipolytic activity was also increased. The antibiotics practically did not affect the urease activity of the strains. PMID:11347265

Hostacká, A

2000-01-01

85

Impact of Gram-negative bacteria in interaction with a complex microbial consortium on biogenic amine content and sensory characteristics of an uncooked pressed cheese.  

PubMed

The impact of Gram-negative bacteria on sensory characteristics and production of volatile compounds as well as biogenic amines (BA) in the core of an uncooked pressed type model cheese was investigated in the presence of a defined complex microbial consortium. Eleven strains of Gram-negative bacteria, selected on the basis of their biodiversity and in vitro BA-production ability, were individually tested in a model cheese. Four out of 6 strains of Enterobacteriaceae (Citrobacter freundii UCMA 4217, Klebsiella oxytoca 927, Hafnia alvei B16 and Proteus vulgaris UCMA 3780) reached counts close to 6 log CFU g?¹ in the model cheese. In core of cheeses inoculated with Gram-negative bacteria, only slight differences were observed for microbial counts (Enterococcus faecalis or Lactobacillus plantarum count differences below 1 log CFU g?¹), acetate concentration (differences below 200 mg kg?¹) and texture (greater firmness) in comparison to control cheeses. Cheese core colour, odour and volatile compound composition were not modified. Although ornithine, the precursor of putrescine, was present in all cheeses, putrescine was only detected in cheeses inoculated with H. alvei B16 and never exceeded 2.18 mmol kg?¹ cheese dry matter. Cadaverine was only detected in cheeses inoculated with H. alvei B16, K. oxytoca 927, Halomonas venusta 4C1A or Morganella morganii 3A2A but at lower concentrations (<1.05 mmol kg?¹ cheese dry matter), although lysine was available. Only insignificant amounts of the detrimental BA histamine and tyramine, as well as isopentylamine, tryptamine or phenylethylamine, were produced in the cheese model by any of the Gram-negative strains, including those which produced these BA at high levels in vitro. PMID:22265286

Delbès-Paus, Céline; Pochet, Sylvie; Helinck, Sandra; Veisseire, Philippe; Bord, Cécile; Lebecque, Annick; Coton, Monika; Desmasures, Nathalie; Coton, Emmanuel; Irlinger, Françoise; Montel, Marie-Christine

2012-05-01

86

Antimicrobial Effect of the Triterpene 3?,6?,16?-Trihydroxylup-20(29)-ene on Planktonic Cells and Biofilms from Gram Positive and Gram Negative Bacteria  

PubMed Central

This study evaluated the antimicrobial effect of 3?,6?,16?-trihydroxylup-20(29)-ene (CLF1), a triterpene isolated from Combretum leprosum Mart., in inhibiting the planktonic growth and biofilms of Gram positive bacteria Streptococcus mutans and S. mitis. The antimicrobial activity was assessed by determining the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC). The antibiofilm potential was determined by quantifying total biomass and enumerating biofilm-entrapped viable bacteria. In addition, the acute toxicity of CLF1 on Artemia sp. nauplii was also determined. The results showed that CLF1 was able in inhibiting the growth of S. mutans and S. mitis with MIC and MBC of 7.8??g/mL and 15.6??g/mL, respectively. CLF1 was highly effective on biofilms of both bacteria. Only 7.8??g/mL CLF1 was enough to inhibit by 97% and 90% biomass production of S. mutans and S. mitis, respectively. On the other hand, such effects were not evident on Gram negative Pseudomonas aeruginosa and Klebsiella oxytoca. The toxicity tests showed that the LC50 of CLF1 was 98.19??g/mL. Therefore, CLF1 isolated from C. leprosum may constitute an important natural agent for the development of new therapies for caries and other infectious diseases caused by S. mutans and S. mitis. PMID:25093179

Evaristo, Francisco Flávio Vasconcelos; Albuquerque, Maria Rose Jane R.; dos Santos, Hélcio Silva; Bandeira, Paulo Nogueira; Ávila, Fábio do Nascimento; da Silva, Bruno Rocha; Vasconcelos, Ariana Azevedo; Rabelo, Érica de Menezes; Nascimento-Neto, Luiz Gonzaga; Arruda, Francisco Vassiliepe Sousa; Vasconcelos, Mayron Alves; Carneiro, Victor Alves; Cavada, Benildo Sousa; Teixeira, Edson Holanda

2014-01-01

87

Klebsiella pneumoniae Flocculation Dynamics  

PubMed Central

The bacterial pathogen Klebsiella pneumoniae is a cause of community- and hospital-acquired lung, urinary tract, and blood stream infections. A common contaminant of indwelling catheters, it is theorized that a common infection pathway for this organism is via shedding of aggregates off of biofilm colonies. In an effort to better understand bacterial proliferation in the host bloodstream, we develop a PDE model for the flocculation dynamics of Klebsiella pneumoniae in suspension. Existence and uniqueness results are provided, as well as a brief description of the numerical approximation scheme. We generate artificial data and illustrate the requirements to accurately identify proliferation, aggregation, and fragmentation of flocs in the experimental domain of interest. PMID:18071828

Jackson, T. L.; Taylor, K. A.; Thompson, A. P.; Younger, J. G.

2011-01-01

88

Diversity of bacteria nesting the plant cover of north Sinai deserts, Egypt  

PubMed Central

North Sinai deserts were surveyed for the predominant plant cover and for the culturable bacteria nesting their roots and shoots. Among 43 plant species reported, 13 are perennial (e.g. Fagonia spp., Pancratium spp.) and 30 annuals (e.g. Bromus spp., Erodium spp.). Eleven species possessed rhizo-sheath, e.g. Cyperus capitatus, Panicum turgidum and Trisetaria koelerioides. Microbiological analyses demonstrated: the great diversity and richness of associated culturable bacteria, in particular nitrogen-fixing bacteria (diazotrophs); the majority of bacterial residents were of true and/or putative diazotrophic nature; the bacterial populations followed an increasing density gradient towards the root surfaces; sizeable populations were able to reside inside the root (endorhizosphere) and shoot (endophyllosphere) tissues. Three hundred bacterial isolates were secured from studied spheres. The majority of nitrogen-fixing bacilli isolates belonged to Bacillus megaterium,Bacillus pumilus, Bacillus polymexa,Bacillus macerans,Bacillus circulans and Bacillus licheniformis. The family Enterobacteriaceae represented by Enterobacter agglomerans,Enterobacter sackazakii, Enterobacter cloacae, Serratia adorifera,Serratia liquefaciens and Klebsiella oxytoca. The non-Enterobacteriaceae population was rich in Pantoae spp., Agrobacterium rdiobacter, Pseudomonas vesicularis, Pseudomonas putida, Stenotrophomonas maltophilia, Ochrobactrum anthropi, Sphingomonas paucimobilis and Chrysemonas luteola.Gluconacetobacter diazotrophicus were reported inside root and shoot tissues of a number of tested plants. The dense bacterial populations reported speak well to the very possible significant role played by the endophytic bacterial populations in the survival, in respect of nutrition and health, of existing plants. Such groups of diazotrophs are good candidates, as bio-preparates, to support the growth of future field crops grown in deserts of north Sinai and irrigated by the water of El-Salam canal.

Hanna, Amira L.; Youssef, Hanan H.; Amer, Wafaa M.; Monib, Mohammed; Fayez, Mohammed; Hegazi, Nabil A.

2012-01-01

89

EPIDEMIOLOGICAL STUDY OF 'KLEBSIELLA PNEUMONIAE' AMONG PULP AND PAPER MILL WORKERS  

EPA Science Inventory

This one-year study measured fecal coliform and Klebsiella bacteria densities in several of Wisconsin's pulp and paper mill processing wash waters, treated waters, and waters receiving pulp and paper mill effluent discharge. The isolation of fecal coliform bacteria ranged from as...

90

In-vivo study of the nuclear quadrupole interaction of99Mo (?- 99)Tc in nitrogenase of Klebsiella pneumoniaein nitrogenase of Klebsiella pneumoniae  

NASA Astrophysics Data System (ADS)

We report on the first TDPAC-measurements of the nuclear quadrupole interaction (NQI) of (NQI) of99Mo(?-)99Tc in the nitrogenase of the bacteria Klebsiella pneumoniae. Because nitrogenase is the only Mo-containing enzyme in Klebsiella pneumoniae under the chosen conditions, no further isolation of this enzyme was necessary. The majority of the incorporated99Mo is subjected to a well defined NQI with ?=365(7) Mrad/s, ?=1 and a reorientational correlation time of ?co???10nsec and is attributed to the active site of the FeMo cofactor. During sample preparation we noted a pronounced affinity of the bacteria to99mTc.

Mottner, P.; Lerf, A.; Ni, X.; Butz, T.; Erfkamp, J.; Müller, A.

1990-08-01

91

Effect of Algae and Plant Lectins on Planktonic Growth and Biofilm Formation in Clinically Relevant Bacteria and Yeasts  

PubMed Central

This study aimed to evaluate the abilities of plant and algae lectins to inhibit planktonic growth and biofilm formation in bacteria and yeasts. Initially, ten lectins were tested on Staphylococcus epidermidis, Staphylococcus aureus, Klebsiella oxytoca, Pseudomonas aeruginosa, Candida albicans, and C. tropicalis at concentrations of 31.25 to 250??g/mL. The lectins from Cratylia floribunda (CFL), Vatairea macrocarpa (VML), Bauhinia bauhinioides (BBL), Bryothamnion seaforthii (BSL), and Hypnea musciformis (HML) showed activities against at least one microorganism. Biofilm formation in the presence of the lectins was also evaluated; after 24?h of incubation with the lectins, the biofilms were analyzed by quantifying the biomass (by crystal violet staining) and by enumerating the viable cells (colony-forming units). The lectins reduced the biofilm biomass and/or the number of viable cells to differing degrees depending on the microorganism tested, demonstrating the different characteristics of the lectins. These findings indicate that the lectins tested in this study may be natural alternative antimicrobial agents; however, further studies are required to better elucidate the functional use of these proteins. PMID:24982871

Vasconcelos, Mayron Alves; Arruda, Francisco Vassiliepe Sousa; Carneiro, Victor Alves; Silva, Helton Colares; Nascimento, Kyria Santiago; Sampaio, Alexandre Holanda; Cavada, Benildo; Teixeira, Edson Holanda; Henriques, Mariana

2014-01-01

92

Duodenal-Mucosal Bacteria Associated with Celiac Disease in Children  

PubMed Central

Celiac disease (CD) is an immune-mediated enteropathy triggered by the ingestion of cereal gluten proteins. This disorder is associated with imbalances in the gut microbiota composition that could be involved in the pathogenesis of CD. The aim of this study was to characterize the composition and diversity of the cultivable duodenal mucosa-associated bacteria of CD patients and control children. Duodenal biopsy specimens from patients with active disease on a gluten-containing diet (n = 32), patients with nonactive disease after adherence to a gluten-free diet (n = 17), and controls (n = 8) were homogenized and plated on plate count agar, Wilkins-Chalgren agar, brain heart agar, or yeast, Casitone, and fatty acid agar. The isolates were identified by partial 16S rRNA gene sequencing. Renyi diversity profiles showed the highest diversity values for active CD patients, followed by nonactive CD patients and control individuals. Members of the phylum Proteobacteria were more abundant in patients with active CD than in the other child groups, while those of the phylum Firmicutes were less abundant. Members of the families Enterobacteriaceae and Staphylococcaceae, particularly the species Klebsiella oxytoca, Staphylococcus epidermidis, and Staphylococcus pasteuri, were more abundant in patients with active disease than in controls. In contrast, members of the family Streptococcaceae were less abundant in patients with active CD than in controls. Furthermore, isolates of the Streptococcus anginosus and Streptococcus mutans groups were more abundant in controls than in both CD patient groups, regardless of inflammatory status. The findings indicated that the disease is associated with the overgrowth of possible pathobionts that exclude symbionts or commensals that are characteristic of the healthy small intestinal microbiota. PMID:23835180

Sánchez, Ester; Donat, Ester; Ribes-Koninckx, Carmen; Fernández-Murga, Maria Leonor

2013-01-01

93

Genotoxic Klebsiella pneumoniae in Taiwan  

PubMed Central

Background Colibactin is a nonribosomal peptide-polyketide synthesized by multi-enzyme complexes encoded by the pks gene cluster. Colibactin-producing Escherichia coli have been demonstrated to induce host DNA damage and promote colorectal cancer (CRC) development. In Taiwan, the occurrence of pyogenic liver abscess (PLA) has been suggested to correlate with an increasing risk of CRC, and Klebsiella pneumoniae is the predominant PLA pathogen in Taiwan Methodology/Principal Findings At the asn tRNA loci of the newly sequenced K. pneumoniae 1084 genome, we identified a 208-kb genomic island, KPHPI208, of which a module identical to the E. coli pks colibactin gene cluster was recognized. KPHPI208 consists of eight modules, including the colibactin module and the modules predicted to be involved in integration, conjugation, yersiniabactin production, microcin production, and unknown functions. Transient infection of BALB/c normal liver cells with K. pneumoniae 1084 increased the phosphorylation of histone H2AX, indicating the induction of host DNA damage. Colibactin was required for the genotoxicity of K. pneumoniae 1084, as it was diminished by deletion of clbA gene and restored to the wild type level by trans-complementation with a clbA coding plasmid. Besides, BALB/c mice infected with K. pneumoniae 1084 exhibited enhanced DNA damage in the liver parenchymal cells when compared to the isogenic clbA deletion mutant. By PCR detection, the prevalence of pks-positive K. pneumoniae in Taiwan is 25.6%, which is higher than that reported in Europe (3.5%), and is significantly correlated with K1 type, which predominantly accounted for PLA in Taiwan. Conclusions Our knowledge regarding how bacteria contribute to carcinogenesis has just begun. The identification of genotoxic K. pneumoniae and its genetic components will facilitate future studies to elucidate the molecular basis underlying the link between K. pneumoniae, PLA, and CRC. PMID:24852749

Lai, Yi-Chyi; Lin, Ann-Chi; Chiang, Ming-Ko; Dai, Yu-Han; Hsu, Chih-Chieh; Lu, Min-Chi; Liau, Chun-Yi; Chen, Ying-Tsong

2014-01-01

94

Rapid Identification of Gram-Negative Bacteria with and without CTX-M Extended-Spectrum ?-Lactamase from Positive Blood Culture Bottles by PCR Followed by Microchip Gel Electrophoresis?  

PubMed Central

We evaluated the usefulness of PCR analysis of the 16S-23S rRNA gene internal transcribed spacer (ITS) and the CTX-M extended-spectrum ?-lactamase (ESBL) followed by microchip gel electrophoresis (MGE) for direct identification and CTX-M detection of Gram-negative bacteria (GNB) from positive blood culture bottles. Of 251 GNB isolated from blood cultures containing a single bacterium, 225 (90%) were correctly identified at the species level directly from positive blood culture bottles by comparing the ITS-PCR patterns of the sample strain with those of the control strains. There were no cases of incorrect identification. Limitations encountered included the inability to detect mixed cultures (four bottles) as well as some species (Enterobacter species and Klebsiella oxytoca) demonstrating identical ITS-PCR patterns. A total of 109 ESBL-producing isolates from various clinical materials obtained between January 2005 and December 2008 were examined for blaCTX-M, blaSHV, and blaTEM genes by PCR and sequences of PCR products. CTX-M ESBL was detected in 105 isolates, and SHV ESBL was detected in two isolates. The remaining two isolates (K. oxytoca) were shown to harbor blaOXY. Twenty (19%) of 104 Escherichia coli isolates from blood cultures were suspected to produce ESBL by the combination disk method, and these isolates were shown to harbor CTX-M ESBL by PCR-MGE. The results were obtained within 1.5 h at a calculated cost of $6.50 per specimen. In conclusion, simultaneous detection of ITS length polymorphisms and blaCTX-M by single PCR followed by MGE is useful for rapid, cost-effective, and reliable species-level identification of CTX-M ESBL-producing GNB responsible for bloodstream infections. PMID:21289149

Fujita, Shin-ichi; Yosizaki, Kentaro; Ogushi, Thikako; Uechi, Kouhei; Takemori, Yukiko; Senda, Yasuko

2011-01-01

95

Rapid Identification of Carbapenemase Genes in Gram-Negative Bacteria with an Oligonucleotide Microarray-Based Assay  

PubMed Central

Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well as selected extended (ESBL) and narrow spectrum (NSBL) beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13), blaGIM (2/2), blaKPC (27/27), blaNDM (5/5), blaIMP-2/4/7/8/13/14/15/16/31 (10/10), blaOXA-23 (12/13), blaOXA-40-group (7/7), blaOXA-48-group (32/33), blaOXA-51 (1/1) and blaOXA-58 (1/1). Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16), blaOXA-2 (4/4), blaOXA-9 (33/33), OXA-10 (3/3), blaOXA-51 (25/25), blaOXA-58 (2/2), CTX-M1/M15 (17/17) and blaVIM (1/1)]. In direct comparison to phenotypical identification obtained by VITEK or MALDI-TOF systems, 114 of 117 (97.4%) isolates, including Acinetobacter baumannii (28/28), Enterobacter spec. (5/5), Escherichia coli (4/4), Klebsiella pneumoniae (62/63), Klebsiella oxytoca (0/2), Pseudomonas aeruginosa (12/12), Citrobacter freundii (1/1) and Citrobacter braakii (2/2), were correctly identified by a panel of species specific probes. This assay might be easily extended, adapted and transferred to point of care platforms enabling fast surveillance, rapid detection and appropriate early treatment of infections caused by multiresistant Gram-negative bacteria. PMID:25068267

Braun, Sascha D.; Monecke, Stefan; Thürmer, Alexander; Ruppelt, Antje; Makarewicz, Oliwia; Pletz, Mathias; Reißig, Annett; Slickers, Peter; Ehricht, Ralf

2014-01-01

96

Transposition of IS1397 in the Family Enterobacteriaceae and First Characterization of ISKpn1, a New Insertion Sequence Associated with Klebsiella pneumoniae Palindromic Units  

PubMed Central

IS1397 and ISKpn1 are IS3 family members which are specifically inserted into the loop of palindromic units (PUs). IS1397 is shown to transpose into PUs with sequences close or identical to the Escherichia coli consensus, even in other enterobacteria (Salmonella enterica serovar Typhimurium, Klebsiella pneumoniae, and Klebsiella oxytoca). Moreover, we show that homologous intergenic regions containing PUs constitute IS1397 transpositional hot spots, despite bacterial interspersed mosaic element structures that differ among the three species. ISKpn1, described here for the first time, is specific for PUs from K. pneumoniae, in which we discovered it. A sequence comparison between the two insertion sequences allowed us to define a motif possibly accounting for their specificity. PMID:11443073

Wilde, Caroline; Bachellier, Sophie; Hofnung, Maurice; Clément, Jean-Marie

2001-01-01

97

Transposition of IS1397 in the family Enterobacteriaceae and first characterization of ISKpn1, a new insertion sequence associated with Klebsiella pneumoniae palindromic units.  

PubMed

IS1397 and ISKpn1 are IS3 family members which are specifically inserted into the loop of palindromic units (PUs). IS1397 is shown to transpose into PUs with sequences close or identical to the Escherichia coli consensus, even in other enterobacteria (Salmonella enterica serovar Typhimurium, Klebsiella pneumoniae, and Klebsiella oxytoca). Moreover, we show that homologous intergenic regions containing PUs constitute IS1397 transpositional hot spots, despite bacterial interspersed mosaic element structures that differ among the three species. ISKpn1, described here for the first time, is specific for PUs from K. pneumoniae, in which we discovered it. A sequence comparison between the two insertion sequences allowed us to define a motif possibly accounting for their specificity. PMID:11443073

Wilde, C; Bachellier, S; Hofnung, M; Clément, J M

2001-08-01

98

Hypervirulent (hypermucoviscous) Klebsiella pneumoniae  

PubMed Central

A new hypervirulent (hypermucoviscous) variant of Klebsiella pneumoniae has emerged. First described in the Asian Pacific Rim, it now increasingly recognized in Western countries. Defining clinical features are the ability to cause serious, life-threatening community-acquired infection in younger healthy hosts, including liver abscess, pneumonia, meningitis and endophthalmitis and the ability to metastatically spread, an unusual feature for enteric Gram-negative bacilli in the non-immunocompromised. Despite infecting a healthier population, significant morbidity and mortality occurs. Although epidemiologic features are still being defined, colonization, particularly intestinal colonization, appears to be a critical step leading to infection. However the route of entry remains unclear. The majority of cases described to date are in Asians, raising the issue of a genetic predisposition vs. geospecific strain acquisition. The traits that enhance its virulence when compared with “classical” K. pneumoniae are the ability to more efficiently acquire iron and perhaps an increase in capsule production, which confers the hypermucoviscous phenotype. An objective diagnostic test suitable for routine use in the clinical microbiology laboratory is needed. If/when these strains become increasingly resistant to antimicrobials, we will be faced with a frightening clinical scenario. PMID:23302790

Shon, Alyssa S.; Bajwa, Rajinder P.S.; Russo, Thomas A.

2013-01-01

99

Removal of pathogenic factors from 2,3-butanediol-producing Klebsiella species by inactivating virulence-related wabG gene.  

PubMed

Klebsiella species are the most extensively studied among a number of 2,3-butanediol (2,3-BDO)-producing microorganisms. The ability to metabolize a wide variety of substrates together with the ease of cultivation made this microorganisms particularly promising for the application in industrial-scale production of 2,3-BDO. However, the pathogenic characteristics of encapsulated Klebsiella species are considered to be an obstacle hindering their industrial applications. Here, we removed the virulence factors from three 2,3-BDO-producing strains, Klebsiella pneumoniae KCTC 2242, Klebsiella oxytoca KCTC1686, and K. oxytoca ATCC 43863 through site-specific recombination technique. We generated deletion mutation in wabG gene encoding glucosyltransferase which plays a key role in the synthesis of outer core lipopolysaccharides (LPS) by attaching the first outer core residue D-GalAp to the O-3 position of the L,D-HeppII residue. The morphologies and adhesion properties against epithelial cells were investigated, and the results indicated that the wabG mutant strains were devoid of the outer core LPS and lost the ability to retain capsular structure. The time profile of growth and 2,3-BDO production from K. pneumoniae KCTC 2242 and K. pneumoniae KCTC 2242 ?wabG were analyzed in batch culture with initial glucose concentration of 70 g/l. The growth was not affected by disrupting wabG gene, but the production of 2,3-BDO decreased from 31.27 to 22.44 g/l in mutant compared with that of parental strain. However, the productions of acetoin and lactate from wabG mutant strain were negligible, whereas that from parental strain reached to ~5 g/l. PMID:22832986

Jung, Sung-Geun; Jang, Jun-Ho; Kim, Ah-Young; Lim, Min-Cheol; Kim, Borim; Lee, Jinwon; Kim, Young-Rok

2013-03-01

100

Enrichment and Identification of Cellulolytic Bacteria from the Gastrointestinal Tract of Giant African Snail, Achatina fulica.  

PubMed

The cellulolytic bacterial community structure in gastrointestinal (GI) tract of Achatina fulica was studied using culture-independent and -dependent methods by enrichment in carboxymethyl cellulose (CMC). Culture-dependent method indicated that GI tract of snail was dominated by Enterobacteriaceae members. When tested for cellulase activities, all isolates obtained by culture-dependent method showed both or either of CMCase or avicelase activity. Isolate identified as Citrobacter freundii showed highest CMCase and medium avicelase activity. Sequencing of clones from the 16S rRNA gene clone library identified ten operational taxonomic units (OTUs), which were affiliated to Enterobacteriaceae of phylum Gammaproteobacteria. Of these ten OTUs, eight OTUs closely matched with Enterobacter and Klebsiella genera. The most abundant OTU allied to Klebsiella oxytoca accounted for 70 % of the total sequences. The members of Klebsiella and Enterobacter were observed by both methods indicating their dominance among the cellulolytic bacterial community in the GI tract of the snail. PMID:25432338

Pawar, Kiran D; Dar, Mudasir A; Rajput, Bharati P; Kulkarni, Girish J

2014-11-29

101

Electrophoretic Transfer from Polyacrylamide Gel to Nitrocellulose Sheets, a New Method To Characterize Multilocus Enzyme Genotypes of Klebsiella Strains  

PubMed Central

A new method for multilocus enzyme electrophoresis, based on electrophoretic transfers to nitrocellulose after polyacrylamide-agarose gel electrophoresis was explored. Electrophoretic separation was performed on 1-mm-thick slab gels with 6-?l samples of bacterial extracts and was followed by serial 5-min consecutive transfers. The transferability of 19 metabolic enzymes of Klebsiella strains was studied and allowed the simultaneous examination of one enzyme in the separation gel and at least five enzymes on nitrocellulose sheets. The resolution of enzyme bands was increased on nitrocellulose; thus, well-separated bands were recorded for nucleoside phosphorylase, peptidase, and phosphoglucose isomerase whereas their mobility variants could not be clearly distinguished in the separation gel because of stain diffusion. The study of genetic relationships of 42 strains of Klebsiella pneumoniae and 24 strains of Klebsiella oxytoca demonstrated the reliability of the method, since clustering analysis of electrophoretic types, based on electrophoretic polymorphism of 10 metabolic enzymes, showed two main clusters well correlated with the two species. The 57 electrophoretic types described confirm the usefulness of the method for the study of genetic relationships between closely related strains. Images PMID:16349155

Combe, Marie-Laure; Pons, Jean-Louis; Sesboue, Richard; Martin, Jean-Pierre

1994-01-01

102

Dichotomy between Lactobacillus rhamnosus and Klebsiella pneumoniae on dendritic cell phenotype and function  

Microsoft Academic Search

The reaction of the intestinal immune system to intestinal bacteria shows striking differences between various bacterial strains. Whereas Klebsiella pneumoniae induces a fierce proinflammatory reaction, the probiotic strain Lactobacillus rhamnosus has clear anti-inflammatory effect in gastrointestinal disease and allergy. The molecular basis for this dichotomy is poorly understood but is likely to involve different modulation of antigen-presenting dendritic cells (DC)

Henri Braat; Esther C. de Jong; Jan M. H. van den Brande; Martien L. Kapsenberg; Maikel P. Peppelenbosch; Eric A. F. van Tol; Sander J. H. van Deventer

2004-01-01

103

Ethanol from lignocellulosic wastes with utilization of recombinant bacteria.  

PubMed

This article presents the advanced technology that has been developed by BioEnergy International of Gainesville, Florida, utilizing novel recombinant strains of bacteria developed by Lonnie Ingram of the University of Florida. The first commercial applications of these unique fermenting organisms convert 5-carbon sugars, as well as 6-carbon sugars, and oligomers of cellulose (e.g., cellobiose and cellotriose) directly to ethanol. The proposed systems that will be utilized for conversion of agricultural wastes, mixed waste papers, and pulp and paper mill waste in forthcoming commercial installations are now under design. This involves the extensive experience of Raphael Katzen Associates International, Inc. in acid hydrolysis, enzyme production, enzymatic hydrolysis, large-scale fermentation engineering, and distillation/dehydration. Specific examples of this advanced technology will be presented in different applications, namely: 1. Conversion of the hemicellulose content of sugar cane bagasse to 5-carbon sugars by mild-acid prehydrolysis, followed by fermentation of the 5-carbon sugar extract with recombinant Escherichia coli in a commercial installation soon to be under construction in Brazil. This unique process utilizes the surplus hemicellulose fraction of bagasse not required for steam and power generation to produce ethanol, additional to that from the original can juice, which has been converted by conventional sucrose fermentation to ethanol. The process also recovers and converts to ethanol the majority of sucrose normally lost with the bagasse fibers. Resultant beer is enriched in an innovative process to eliminate the need for incremental rectification capacity. 2. Application of this technology to mixed waste paper in Florida, with a moderate loading of newsprint (85% mechanical wood fiber), will involve a mild-acid prehydrolysis, the partial extraction of the 5-carbon sugars produced from hemicellulose as a feedstock for propagation of the recombinant Klebsiella oxytoca bacterium. Included is a facility providing for in-house production of cellulase enzyme, as an active whole broth for direct use in simultaneous saccharification and fermentation (SSF) of the remaining cellulose and residual 5-carbon sugars to ethanol. This is followed by distillation and dehydration in the advanced commercially available low-energy recovery system. 3. Another potential application of this unique technology involves utilization of a variety of wastes from several pulp and paper mills in close proximity, permitting collection of these wastes at low cost and reducing the considerable cost encountered in disposing of such low-energy wet waste.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:8010771

Katzen, R; Fowler, D E

1994-01-01

104

Frequency assessment of ?-lactamase enzymes in Escherichia coli and Klebsiella isolates in patients with urinary tract infection  

PubMed Central

Background: Production of ?-lactamase enzymes is the most common and important mechanism of resistance in Gram-negative bacteria. The objective of this study was to assess frequency of three main ?-lactamase enzymes, including extended spectrum ?-lactamases (ESBLs), metallo-?-lactamase (MBL), and Klebsiella pneumoniae carbapenemase (KPC) enzymes in Escherichia coli and Klebsiella spp. isolated from nosocomial and community urinary tract infections (UTI). Materials and Methods: In a cross-sectional study from March to December 2012, midstream urine samples were obtained from patients suspicious of UTI who were hospitalized or referred to Al-Zahra Hospital, Isfahan, Iran. Samples were cultured and E. coli and Klebsiella spp. were isolated. Prevalence of ESBLs, KPC, and MBLs producing E. coli and Klebsiella spp. were studied by double-disk (combined-disk), the modified Hodge test and imipenem-ethylenediaminetetraacetic acid combined disc methods respectively. In addition, their antimicrobial susceptibility patterns determined and resistant to carbapenem drugs confirmed by minimum inhibitory concentrations based on E-test method. Results: A total of 1080 E. coli and 484 Klebsiella strains were isolated during study period. Among 720 E. coli and 384 Klebsiella isolates from hospitalized patients, 300 (41.7%) and 198 (51.5%) were ESBLs producers, respectively. In out-patients samples, the rate of ESBLs production was 25% (90/360) and 40% (40/100) in E. coli and Klebsiella isolates, respectively. Prevalence of MBLs producing in hospital E. coli and Klebsiella isolates were 0.3% (2/720) and 2.6% (10/384), and for KPC data were 1.4% (10/720) and 48.4% (186/384), respectively. No MBLs and KPC producing isolate was seen in non-hospital E. coli and Klebsiella isolates except for one non-hospital KPC producing Klebsiella isolate. Conclusion: The result of our study showed high prevalence of ESBLs and KPC, but low prevalence of MBLs in cultured bacteria from urine samples of patients with acute UTI. In addition, KPC was the main carbapenem resistance mechanism in Klebsiella and E. coli isolates. PMID:25002893

Moayednia, Reza; Shokri, Dariush; Mobasherizadeh, Sina; Baradaran, Azar; Fatemi, Seyed Masih; Merrikhi, Alireza

2014-01-01

105

Klebsiella pneumoniae inoculants for enhancing plant growth  

SciTech Connect

A biological inoculant for enhancing the growth of plants is disclosed. The inoculant includes the bacterial strains Herbaspirillum seropedicae 2A, Pantoea agglomerans P101, Pantoea agglomerans P102, Klebsiella pneumoniae 342, Klebsiella pneumoniae zmvsy, Herbaspirillum seropedicae Z152, Gluconacetobacter diazotrophicus PA15, with or without a carrier. The inoculant also includes strains of the bacterium Pantoea agglomerans and K. pneumoniae which are able to enhance the growth of cereal grasses. Also disclosed are the novel bacterial strains Herbaspirillum seropedicae 2A, Pantoea agglomerans P101 and P102, and Klebsiella pneumoniae 342 and zmvsy.

Triplett, Eric W. (Middleton, WI); Kaeppler, Shawn M. (Oregon, WI); Chelius, Marisa K. (Greeley, CO)

2008-07-01

106

Serine utilization by Klebsiella aerogenes.  

PubMed Central

Klebsiella aerogenes was found to contain a specific L-serine dehydrase that was induced by threonine, glycine or leucine, but not by its substrate. Cellular concentrations were sensitive to carbon rather than nitrogen sources in the growth medium. A nonspecific isoleucine-sensitive L-threonine dehydrase supplemented the specific L-serine dehydrase activity. K. aerogenes also contains a leucine-inducible L-threonine dehydrogenase which probably initiated a threonine-utilization pathway in which the serine-specific dehydrate participated. Strains that were altered in their ability to metabolize serine differed in either L-serine dehydrase or L-threonine dehydrase activity. Thus, K. aerogenes growing on L-serine as a sole nitrogen source relies upon two enzymes that metabolize the amino acid as subsidiary functions. PMID:6783624

Vining, L C; Magasanik, B

1981-01-01

107

Screening and characterization of bioflocculant produced by isolated Klebsiella sp.  

PubMed

Sixteen strains of polymer-producing bacteria were isolated from the activated sludge samples taken from two seafood processing plants in Southern Thailand. Their culture broths possessed the ability to flocculate kaolin suspension in the presence of 1% CaCl2. Based on the flocculating activity, the strain S11 was selected and identified to be a Klebsiella sp. using the partial 16S rRNA sequencing method. The growth of the isolated Klebsiella sp. was maximal (1.026 g l-1 dry cell mass) after 1 day cultivation while the highest polymer yield (0.973 g l-1) was achieved after 5 days cultivation. The flocculating activity of the culture broth, however, was highest after 2 days cultivation. The polymer was identified to be an acidic polysaccharide containing neutral sugar and uronic acid as its major and minor components, respectively. Results on the properties of the partially purified polysaccharide from Klebsiella sp. S11 revealed that it consisted of galactose, glucose and mannose in an approximate ratio of 5:2:1. It was soluble in acidic or basic solutions but not in organic solvents. Its molecular mass was greater than 2 x 10(6) Da. Infrared spectra showed the presence of hydroxyl, carboxyl and methoxyl groups in its molecules. Differential scanning calorimetry of the polysaccharide indicated the crystalline melting point (Tm) at 314 degrees C. The optimum dosage of polysaccharide to give the highest flocculating activity was 15 mg l-1 in the presence of 1% CaCl2. PMID:10570817

Dermlim, W; Prasertsan, P; Doelle, H

1999-11-01

108

Biochemical and Structural Characterization of a Ureidoglycine Aminotransferase in the Klebsiella pneumoniae Uric Acid Catabolic Pathway  

SciTech Connect

Many plants, fungi, and bacteria catabolize allantoin as a mechanism for nitrogen assimilation. Recent reports have shown that in plants and some bacteria the product of hydrolysis of allantoin by allantoinase is the unstable intermediate ureidoglycine. While this molecule can spontaneously decay, genetic analysis of some bacterial genomes indicates that an aminotransferase may be present in the pathway. Here we present evidence that Klebsiella pneumoniae HpxJ is an aminotransferase that preferentially converts ureidoglycine and an {alpha}-keto acid into oxalurate and the corresponding amino acid. We determined the crystal structure of HpxJ, allowing us to present an explanation for substrate specificity.

French, Jarrod B.; Ealick, Steven E. (Cornell)

2010-09-03

109

Klebsiella Pneumoniae Associated Extreme Plasmacytosis  

PubMed Central

Infection-associated plasmacytosis is not uncommon; however, marked plasmacytosis in both peripheral blood and bone marrow that mimicks plasma cell leukemia is a very rare condition. We encountered a case of extreme plasmacytosis associated with Klebsiella pneumoniae sepsis in an aplastic anemia patient. A 42-year-old man presented with high fever of 5 days' duration. Hematological analysis revealed severe neutropenia and thrombocytopenia; his white blood cell count was 900/mm3, with 26% of plasma and plasmacytoid cells in peripheral blood. Bone marrow biopsy and aspiration showed 25% cellularity with marked plasmacytosis (80%), highly suggestive of plasma cell leukemia. On the eighth hospital day, K. pneumoniae was identified in blood and sputum cultures. Fever improved after switching antibiotics, although his hematological condition worsened. His bone marrow cellularity (plasma cell proportion) progressively decreased: the values were 25% (80%), 10% (26%), 10% (11%), and < 10% (< 4%) on the 8th, 30th, 60th, and 90th hospital day, respectively. His plasmacytosis was extremely severe but was confirmed to be reactive with polyclonality. The present case represents the first report of strong suspicion of K. pneumoniae sepsis-associated marked plasmacytosis in an aplastic anemia patient. PMID:24475358

Moon, Yeonsook; Jang, Woo Ri; Yi, Hyeon Gyu; Park, In Seo; Nahm, Chung Hyun; Choi, Jong Weon; Kim, Jin Ju

2013-01-01

110

Two-center collaborative evaluation of performance of the BD phoenix automated microbiology system for identification and antimicrobial susceptibility testing of gram-negative bacteria.  

PubMed

The performance of the BD Phoenix Automated Microbiology System (BD Diagnostic Systems, Sparks, MD) was assessed for identification (ID) and antimicrobial susceptibility testing (AST) of the majority of clinically encountered bacterial isolates in a European collaborative two-center trial. A total of 494 bacterial isolates including various species of the Enterobacteriaceae and 110 nonfermentative gram-negative bacteria were investigated: of these, 385 were single patient isolates, and 109 were challenge strains tested at one center. The performance of the Phoenix extended-spectrum beta-lactamase (ESBL) test was also evaluated for 203 strains of Escherichia coli, Klebsiella pneumoniae, and Klebsiella oxytoca included in the study. Forty-two antimicrobial drugs were tested, including members of the following drug classes: aminoglycosides, beta-lactam antibiotics, beta-lactam/beta-lactamase inhibitors, carbapenems, cephems, monobactams, folate antagonists, quinolones, and others. Phoenix system ID results were compared to those of the laboratories' routine ID systems (API 20E and API CHE, ATB ID32E, ID32GN, and VITEK 2 [bioMérieux, Marcy l'Etoile, France]); Phoenix AST results were compared to those of frozen standard broth microdilution (SBM) panels according to NCCLS (now CLSI) guidelines (NCCLS document M100-S9, approved standard M7-A4). Discrepant results were repeated in duplicate. Concordant IDs of 98.4 and 99.1% were observed for the Enterobacteriaceae and the nonfermentative group, respectively. For AST results, the overall essential agreement was 94.2%; the category agreement was 97.3%; and the very major error rate, major error rate, and minor error rate were 1.6, 0.6, and 1.9%, respectively. In terms of ESBL detection, Phoenix results were 98.5% concordant with those of the reference system, with 98.0% sensitivity and 98.7% specificity. In conclusion, the Phoenix ID results showed high agreement with results of the systems to which they were being compared: the AST performance was highly equivalent to that of the SBM reference method, and the system proved to be very accurate for the detection of ESBL producers. PMID:17005752

Menozzi, Maria Grazia; Eigner, Ulrich; Covan, Silvia; Rossi, Sabina; Somenzi, Pietro; Dettori, Giuseppe; Chezzi, Carlo; Fahr, Anne-Marie

2006-11-01

111

Emergence of Resistant Klebsiella pneumoniae in the Intestinal Tract during Successful Treatment of Klebsiella pneumoniae Lung Infection in Rats?  

PubMed Central

Antibiotic treatment of lung infections may lead to the emergence of resistance in the gut flora. Appropriate dosing regimens could mitigate this adverse effect. In gnotobiotic rats harboring intestinal Escherichia coli and Enterococcus faecium populations, a lung infection by Klebsiella pneumoniae was instigated with two different sizes of inoculum to represent an early or a late initiation of antibiotic treatment. The rats were treated with marbofloxacin, an expanded-spectrum fluoroquinolone, by a single-shot administration or a fractionated regimen over 4 days. Intestinal bacterial populations were monitored during and after treatment. At the infection site, bacterial cure without any selection of resistance was observed. Whatever the dosage regimen, fluoroquinolone treatment had a transient negative impact on the E. coli gut population but not on that of E. faecium. The intestinal flora was colonized by the pathogenic lung bacteria, and there was the emergence of intestine-resistant K. pneumoniae, occurring more often in animals treated with a single marbofloxacin dose than with the fractionated dose. Bacterial cure without resistance selection at the infection site with fluoroquinolone treatment can be linked to colonization of the digestive tract by targeted pulmonary bacteria, followed by the emergence of resistance. PMID:20457820

Kesteman, Anne-Sylvie; Perrin-Guyomard, Agnès; Laurentie, Michel; Sanders, Pascal; Toutain, Pierre-Louis; Bousquet-Mélou, Alain

2010-01-01

112

Emergence of resistant Klebsiella pneumoniae in the intestinal tract during successful treatment of Klebsiella pneumoniae lung infection in rats.  

PubMed

Antibiotic treatment of lung infections may lead to the emergence of resistance in the gut flora. Appropriate dosing regimens could mitigate this adverse effect. In gnotobiotic rats harboring intestinal Escherichia coli and Enterococcus faecium populations, a lung infection by Klebsiella pneumoniae was instigated with two different sizes of inoculum to represent an early or a late initiation of antibiotic treatment. The rats were treated with marbofloxacin, an expanded-spectrum fluoroquinolone, by a single-shot administration or a fractionated regimen over 4 days. Intestinal bacterial populations were monitored during and after treatment. At the infection site, bacterial cure without any selection of resistance was observed. Whatever the dosage regimen, fluoroquinolone treatment had a transient negative impact on the E. coli gut population but not on that of E. faecium. The intestinal flora was colonized by the pathogenic lung bacteria, and there was the emergence of intestine-resistant K. pneumoniae, occurring more often in animals treated with a single marbofloxacin dose than with the fractionated dose. Bacterial cure without resistance selection at the infection site with fluoroquinolone treatment can be linked to colonization of the digestive tract by targeted pulmonary bacteria, followed by the emergence of resistance. PMID:20457820

Kesteman, Anne-Sylvie; Perrin-Guyomard, Agnès; Laurentie, Michel; Sanders, Pascal; Toutain, Pierre-Louis; Bousquet-Mélou, Alain

2010-07-01

113

Emergence of New Delhi Metallo-Beta-Lactamase (NDM-1) and Klebsiella pneumoniae Carbapenemase (KPC-2) in South Africa  

PubMed Central

This report documents emergence of New Delhi metallo-beta-lactamase (NDM-1) and Klebsiella pneumoniae carbapenemase (KPC-2) in K. pneumoniae and Enterobacter cloacae in South Africa. NDM-1 producers have not been described in South Africa, and this is the first instance that KPC producers have been identified in Africa. The two patients infected with these carbapenemase-producing bacteria demised. PMID:22116157

Coetzee, Jennifer; Clay, Cornelis G.; Sithole, Sindi; Richards, Guy A.; Poirel, Laurent; Nordmann, Patrice

2012-01-01

114

Complete genome sequence of the lignin-degrading bacterium Klebsiella sp. strain BRL6-2  

PubMed Central

In an effort to discover anaerobic bacteria capable of lignin degradation, we isolated Klebsiella sp. strain BRL6-2 on minimal media with alkali lignin as the sole carbon source. This organism was isolated anaerobically from tropical forest soils collected from the Bisley watershed at the Ridge site in the El Yunque National Forest in Puerto Rico, USA, part of the Luquillo Long-Term Ecological Research Station. At this site, the soils experience strong fluctuations in redox potential and are characterized by cycles of iron oxidation and reduction. Genome sequencing was targeted because of its ability to grow on lignin anaerobically and lignocellulolytic activity via in vitro enzyme assays. The genome of Klebsiella sp. strain BRL6-2 is 5.80 Mbp with no detected plasmids, and includes a relatively small arsenal of genes encoding lignocellulolytic carbohydrate active enzymes. The genome revealed four putative peroxidases including glutathione and DyP-type peroxidases, and a complete protocatechuate pathway encoded in a single gene cluster. Physiological studies revealed Klebsiella sp. strain BRL6-2 to be relatively stress tolerant to high ionic strength conditions. It grows in increasing concentrations of ionic liquid (1-ethyl-3-methyl-imidazolium acetate) up to 73.44 mM and NaCl up to 1.5 M.

2014-01-01

115

Leukotriene B4 Augments Neutrophil Phagocytosis of Klebsiella pneumoniae  

PubMed Central

Neutrophils play a critical role in the clearance of bacteria from the lung and other organs by their capacity for phagocytosis and killing. Previously, we identified an important role for the leukotrienes in rat alveolar macrophage phagocytosis of Klebsiella pneumoniae. In this report, we explored the possibility that the leukotrienes play an important role in phagocytosis by neutrophils as well. Inhibition of endogenous leukotriene synthesis by 5-lipoxygenase knockout in mice or by pharmacologic means in human peripheral blood neutrophils attenuated phagocytosis of opsonized K. pneumoniae. Reduced phagocytosis was also observed in human neutrophils pretreated with a leukotriene B4 receptor but not a cysteinyl-leukotriene receptor antagonist. While leukotriene B4 reconstituted defective phagocytosis in leukotriene-deficient neutrophils and enhanced phagocytosis in neutrophils capable of leukotriene synthesis, leukotriene C4, leukotriene D4, 5-hydroperoxyeicosatetraenoic acid, and 5-oxo-eicosatetraenoic acid were ineffective. To determine the opsonin dependence of the leukotriene B4 augmentation of phagocytosis, we assessed the ability of leukotriene B4 to modulate neutrophil phagocytosis and the adherence of sheep erythrocytes opsonized with immunoglobulin G or the complement fragment C3bi. While leukotriene B4 augmented both Fc receptor- and complement receptor-mediated phagocytosis, increased adherence to leukotriene B4-treated neutrophils was limited to complement opsonized targets. In conclusion, we have identified a novel role for leukotriene B4 in the augmentation of neutrophil phagocytosis mediated by either the Fc or complement receptor. PMID:11254552

Mancuso, Peter; Nana-Sinkam, Patrick; Peters-Golden, Marc

2001-01-01

116

RESEARCH ARTICLE Open Access Klebsiella pneumoniae related community-  

E-print Network

RESEARCH ARTICLE Open Access Klebsiella pneumoniae related community- acquired acute lower, Klebsiella pneumoniae (KP) is the second pathogen responsible for community-acquired pneumonia. Yet, very. Reported prior medication was high (42.5%). Patients' chest radiographs showed pneumonia (61.3% including

Paris-Sud XI, Université de

117

RESEARCH ARTICLE Open Access Comparative analysis of Klebsiella pneumoniae  

E-print Network

RESEARCH ARTICLE Open Access Comparative analysis of Klebsiella pneumoniae genomes identifies Background: Klebsiella pneumoniae strains are pathogenic to animals and humans, in which they are both. pneumoniae isolates of the capsular serotype K2 are among the most virulent. In order to identify novel

Paris-Sud XI, Université de

118

Anti-Biofilm Activity: A Function of Klebsiella pneumoniae Capsular Polysaccharide  

PubMed Central

Competition and cooperation phenomena occur within highly interactive biofilm communities and several non-biocides molecules produced by microorganisms have been described as impairing biofilm formation. In this study, we investigated the anti-biofilm capacities of an ubiquitous and biofilm producing bacterium, Klebsiella pneumoniae. Cell-free supernatant from K. pneumoniae planktonic cultures showed anti-biofilm effects on most Gram positive bacteria tested but also encompassed some Gram negative bacilli. The anti-biofilm non-bactericidal activity was further investigated on Staphylococcus epidermidis, by determining the biofilm biomass, microscopic observations and agglutination measurement through a magnetic bead-mediated agglutination test. Cell-free extracts from K. pneumoniae biofilm (supernatant and acellular matrix) also showed an influence, although to a lesser extend. Chemical analyses indicated that the active molecule was a high molecular weight polysaccharide composed of five monosaccharides: galactose, glucose, rhamnose, glucuronic acid and glucosamine and the main following sugar linkage residues [?2)-?-l-Rhap-(1?]; [?4)-?-l-Rhap-(1?]; [?-d-Galp-(1?]; [?2,3)-?-d-Galp-(1?]; [?3)-?-d-Galp-(1?] and, [?4)-?-d-GlcAp-(1?]. Characterization of this molecule indicated that this component was more likely capsular polysaccharide (CPS) and precoating of abiotic surfaces with CPS extracts from different serotypes impaired the bacteria-surface interactions. Thus the CPS of Klebsiella would exhibit a pleiotropic activity during biofilm formation, both stimulating the initial adhesion and maturation steps as previously described, but also repelling potential competitors. PMID:24932475

Dos Santos Goncalves, Marina; Delattre, Cédric; Balestrino, Damien; Charbonnel, Nicolas; Elboutachfaiti, Redouan; Wadouachi, Anne; Badel, Stéphanie; Bernardi, Thierry; Michaud, Philippe; Forestier, Christiane

2014-01-01

119

The binding of MBL to common bacteria in infectious diseases of children*  

PubMed Central

Objective: To purify Mannan-binding lectin (MBL) from human serum and detect its binding ability to several kinds of bacteria common in infectious diseases of children. Methods: MBL was purified from human serum by affinity chromatography on mannan-Sepharose 4B column. Its binding ability to eight species, 97 strains of bacteria was detected by enzyme-linked lectin assay (ELLA). Results: MBL has different binding ability to bacteria and shows strong binding ability to Klebsiella ornithinolytica and Escherichia coli, but shows relatively lower binding ability to Staphylococcus haemolyticus, Enterobacter cloacae and Staphylococcus epidermidis. To different isolates of Klebsiella pneumoniae, Haemophilus influenzae and Staphylococcus aureus, MBL shows quite different binding ability. Conclusions: MBL has different binding ability to different bacteria, and has relatively stronger binding ability to Gram-negative bacteria. Its binding ability to different isolates of certain kinds of bacteria is quite different. PMID:15593393

Shang, Shi-qiang; Chen, Guo-xian; Shen, Jie; Yu, Xiao-hong; Wang, Ke-yi

2005-01-01

120

Two distinct sensing pathways allow recognition of Klebsiella pneumoniae by Dictyostelium amoebae  

PubMed Central

Summary Recognition of bacteria by metazoans is mediated by receptors that recognize different types of microorganisms and elicit specific cellular responses. The soil amoebae Dictyostelium discoideum feeds upon a variable mixture of environmental bacteria, and it is expected to recognize and adapt to various food sources. To date, however, no bacteria-sensing mechanisms have been described. In this study, we isolated a Dictyostelium mutant (fspA KO) unable to grow in the presence of non-capsulated Klebsiella pneumoniae bacteria, but growing as efficiently as wild-type cells in the presence of other bacteria, such as Bacillus subtilis. fspA KO cells were also unable to respond to K. pneumoniae and more specifically to bacterially secreted folate in a chemokinetic assay, while they responded readily to B. subtilis. Remarkably, both WT and fspA KO cells were able to grow in the presence of capsulated LM21 K. pneumoniae, and responded to purified capsule, indicating that capsule recognition may represent an alternative, FspA-independent mechanism for K. pneumoniae sensing. When LM21 capsule synthesis genes were deleted, growth and chemokinetic response were lost for fspA KO cells, but not for WT cells. Altogether, these results indicate that Dictyostelium amoebae use specific recognition mechanisms to respond to different K. pneumoniae elements. PMID:24128258

Lima, Wanessa C; Balestrino, Damien; Forestier, Christiane; Cosson, Pierre

2013-01-01

121

Binding to and Opsonophagocytic Activity of O-Antigen-Specific Monoclonal Antibodies against Encapsulated and Nonencapsulated Klebsiella pneumoniae Serotype O1 Strains  

PubMed Central

The high mortality of nosocomial infections caused by Klebsiella spp. has acted as a stimulus to develop immunotherapeutic approaches targeted against surface molecules of these bacteria. Since O-antigen-specific antibodies may add to the protective effect of K antisera, we tested the functional and binding capacity of O-antigen-specific monoclonal antibodies (MAbs) raised against different Klebsiella O antigens. The MAbs tested were specific for the O-polysaccharide partial antigens d-galactan II (MAb Ru-O1), d-galactan I (MAb IV/4-5), or core oligosaccharide (MAb V/9-5) of the Klebsiella serogroup O1 antigen. In enzyme-linked immunosorbent assay binding experiments, we found that all MAbs recognized their epitopes on intact capsule-free bacteria; however, binding to encapsulated wild-type strains belonging to different K-antigen serotypes was significantly reduced. The K2 antigen acted as the strongest penetration barrier, while the K7 and K21 antigens allowed some, though diminished, antibody binding. In vitro phagocytic killing experiments showed that MAb Ru-O1 possessed significant opsonizing activity for nonencapsulated O1 serogroup strains and also, to a much lesser extent, for encapsulated strains belonging to the O1:K7 and O1:K21 serotypes. MAbs or antisera specific for the d-galactan II antigen may thus be the most promising agents for further efforts to develop a second-generation Klebsiella hyperimmune globulin comprising both K- and O-antigen specificities. PMID:10768923

Held, Thomas K.; Jendrike, Nina R. M.; Rukavina, Tomislav; Podschun, Rainer; Trautmann, Matthias

2000-01-01

122

Klebsiella singaporensis sp. nov., a novel isomaltulose-producing bacterium.  

PubMed

Cells of strain LX3(T), isolated from soil, were Gram-negative, facultatively anaerobic, non-motile, capsulated and non-endospore-forming straight rods, able to grow at 10 degrees C, unable to produce gas from lactose at 45 degrees C and unable to produce indole. The isolate converted sucrose to isomaltulose and did not produce detectable glucose by-products. The G+C content of the DNA was 56.4 mol%. Furthermore, comparison of 16S rRNA and rpoB gene sequences showed that the isolate clearly belongs to the genus Klebsiella. The closest phylogenetic relative was Klebsiella pneumoniae, there being 99.3 and 97.5 % similarity in 16S rRNA and rpoB gene sequences, respectively. DNA-DNA hybridization analysis demonstrated a very low level of relatedness to other members of the genus Klebsiella, indicating that the isolated strain and other species in the genus Klebsiella were not related at the species level. The isolate could be differentiated from other previously described members of the genus Klebsiella on the basis of phenotypic differences and 16S rRNA and rpoB gene sequence divergence, together with DNA-DNA reassociation data. Therefore, it is proposed that strain LX3(T) (=DSM 16265(T)=JCM 12419(T)) should be classified as the type strain of a novel species of genus Klebsiella, Klebsiella singaporensis sp. nov. PMID:15545446

Li, Xianzhen; Zhang, Daohai; Chen, Feng; Ma, Jie; Dong, Yihu; Zhang, Lianhui

2004-11-01

123

Characterization of Klebsiella sp. strain 10982, a colonizer of humans that contains novel antibiotic resistance alleles and exhibits genetic similarities to plant and clinical Klebsiella isolates.  

PubMed

A unique Klebsiella species strain, 10982, was cultured from a perianal swab specimen obtained from a patient in the University of Maryland Medical Center intensive care unit. Klebsiella sp. 10982 possesses a large IncA/C multidrug resistance plasmid encoding a novel FOX AmpC ?-lactamase designated FOX-10. A novel variant of the LEN ?-lactamase was also identified. Genome sequencing and bioinformatic analysis demonstrated that this isolate contains genes associated with nitrogen fixation, allantoin metabolism, and citrate fermentation. These three gene regions are typically present in either Klebsiella pneumoniae clinical isolates or Klebsiella nitrogen-fixing endophytes but usually not in the same organism. Phylogenomic analysis of Klebsiella sp. 10982 and sequenced Klebsiella genomes demonstrated that Klebsiella sp. 10982 is present on a branch that is located intermediate between the genomes of nitrogen-fixing endophytes and K. pneumoniae clinical isolates. Metabolic features identified in the genome of Klebsiella sp. 10982 distinguish this isolate from other Klebsiella clinical isolates. These features include the nitrogen fixation (nif) gene cluster, which is typically present in endophytic Klebsiella isolates and is absent from Klebsiella clinical isolates. Additionally, the Klebsiella sp. 10982 genome contains genes associated with allantoin metabolism, which have been detected primarily in K. pneumoniae isolates from liver abscesses. Comparative genomic analysis of Klebsiella sp. 10982 demonstrated that this organism has acquired genes conferring new metabolic strategies and novel antibiotic resistance alleles, both of which may enhance its ability to colonize the human body. PMID:24395222

Hazen, Tracy H; Zhao, LiCheng; Sahl, Jason W; Robinson, Gwen; Harris, Anthony D; Rasko, David A; Johnson, J Kristie

2014-01-01

124

Characterization of Klebsiella sp. Strain 10982, a Colonizer of Humans That Contains Novel Antibiotic Resistance Alleles and Exhibits Genetic Similarities to Plant and Clinical Klebsiella Isolates  

PubMed Central

A unique Klebsiella species strain, 10982, was cultured from a perianal swab specimen obtained from a patient in the University of Maryland Medical Center intensive care unit. Klebsiella sp. 10982 possesses a large IncA/C multidrug resistance plasmid encoding a novel FOX AmpC ?-lactamase designated FOX-10. A novel variant of the LEN ?-lactamase was also identified. Genome sequencing and bioinformatic analysis demonstrated that this isolate contains genes associated with nitrogen fixation, allantoin metabolism, and citrate fermentation. These three gene regions are typically present in either Klebsiella pneumoniae clinical isolates or Klebsiella nitrogen-fixing endophytes but usually not in the same organism. Phylogenomic analysis of Klebsiella sp. 10982 and sequenced Klebsiella genomes demonstrated that Klebsiella sp. 10982 is present on a branch that is located intermediate between the genomes of nitrogen-fixing endophytes and K. pneumoniae clinical isolates. Metabolic features identified in the genome of Klebsiella sp. 10982 distinguish this isolate from other Klebsiella clinical isolates. These features include the nitrogen fixation (nif) gene cluster, which is typically present in endophytic Klebsiella isolates and is absent from Klebsiella clinical isolates. Additionally, the Klebsiella sp. 10982 genome contains genes associated with allantoin metabolism, which have been detected primarily in K. pneumoniae isolates from liver abscesses. Comparative genomic analysis of Klebsiella sp. 10982 demonstrated that this organism has acquired genes conferring new metabolic strategies and novel antibiotic resistance alleles, both of which may enhance its ability to colonize the human body. PMID:24395222

Hazen, Tracy H.; Zhao, LiCheng; Sahl, Jason W.; Robinson, Gwen; Harris, Anthony D.

2014-01-01

125

Bacteria Museum  

NSDL National Science Digital Library

Who knew that bacteria had their own virtual museum? Here, visitors will "learn that not all bacteria are harmful, how they are used in industry, that they belong to the oldest living creatures on Earth", and many more interesting facts to discover about the diverse world of bacteria. The "Bacterial Species Files" tab at the top of the page, allows visitors to look up information on 40 different specific bacteria, from Anthrax to Yersinia enterocolitica. The information provided for each bacterium includes photographs, consumer guides, fact sheets, and scientific links. Visitors will find that the "Main Exhibits" tab addresses the basics about bacteria, as well as "Pathogenic Bacteria", "Evolution", "How We Fight Bacteria", and "Food and Water Safety". Visitors will surely enjoy the "Good Bacteria in Food" link found in the Food and Water Safety section, as it explains how some foods benefit from good bacteria, such as Swiss cheese, sausage, sauerkraut, chocolate, and coffee.

126

Lung adenocarcinoma masquerading as refractory Klebsiella pneumoniae.  

PubMed

We report the case of a middle-aged man where a diagnosis of Klebsiella pneumoniae obscured the underlying malignancy. The patient was hospitalised for management of a presumed refractory community-acquired pneumonia with radiological features of right lower lobe consolidation. Bronchoscopy did not identify an endobronchial lesion and washings grew K pneumoniae. CT-guided fine-needle aspirate samples did not detect any malignancy. However, despite appropriate antibiotic treatment there was no improvement in the patient's clinical condition. Consequently, a CT-guided lung core biopsy was performed to obtain more tissue for histopathology, which was diagnostic of primary lung adenocarcinoma. This case highlights the need to continue to investigate a patient who is not progressing as clinically appropriate to their original diagnosis. PMID:24706703

McCartney, Clair; Moghadam, Afshin; Sriram, Krishna B

2014-01-01

127

Capsular Types of Klebsiella pneumoniae Revisited by wzc Sequencing  

PubMed Central

Capsule is an important virulence factor in bacteria. A total of 78 capsular types have been identified in Klebsiella pneumoniae. However, there are limitations in current typing methods. We report here the development of a new genotyping method based on amplification of the variable regions of the wzc gene. Fragments corresponding to the variable region of wzc were amplified and sequenced from 76 documented capsular types of reference or clinical strains. The remaining two capsular types (reference strains K15 and K50) lacked amplifiable wzc genes and were proven to be acapsular. Strains with the same capsular type exhibited ?94% DNA sequence identity across the variable region (CD1-VR2-CD2) of wzc. Strains with distinct K types exhibited <80% DNA sequence identity across this region, with the exception of three pairs of strains: K22/K37, K9/K45, and K52/K79. Strains K22 and K37 shared identical capsular polysaccharide synthesis (cps) genes except for one gene with a difference at a single base which resulted in frameshift mutation. The wzc sequences of K9 and K45 exhibited high DNA sequence similarity but possessed different genes in their cps clusters. K52 and K79 exhibited 89% wzc DNA sequence identity but were readily distinguished from each other at the DNA level; in contrast, strains with the same capsular type as K52 exhibited 100% wzc sequence identity. A total of 29 strains from patients with bacteremia were typed by the wzc system. wzc DNA sequences confirmed the documented capsular type for twenty-eight of these clinical isolates; the remaining strain likely represents a new capsular type. Thus, the wzc genotyping system is a simple and useful method for capsular typing of K. pneumoniae. PMID:24349011

Pan, Yi-Jiun; Lin, Tzu-Lung; Chen, Yen-Hua; Hsu, Chun-Ru; Hsieh, Pei-Fang; Wu, Meng-Chuan; Wang, Jin-Town

2013-01-01

128

21 CFR 866.3340 - Klebsiella spp. serological reagents.  

Code of Federal Regulations, 2010 CFR

... Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a)...

2010-04-01

129

21 CFR 866.3340 - Klebsiella spp. serological reagents.  

Code of Federal Regulations, 2012 CFR

... Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a)...

2012-04-01

130

Klebsiella pneumoniae Infection: A Virulent Cause of Visual Loss  

PubMed Central

Bacterial endophthalmitis is endogenous in 2–6% of cases and is frequently misdiagnosed initially. Klebsiella pneumoniae is being increasingly recognised as an aggressive causative organism, and it is particularly prevalent in Asian populations. We describe the case of a 71-year-old female of Southeast Asian origin with type 2 diabetes mellitus who presented with visual loss secondary to bacterial endophthalmitis and concomitant cerebral abscesses. Imaging revealed the probable primary source of infection to be a liver abscess. She developed retinal detachment and subsequently underwent an evisceration of her right eye. A Klebsiella spp. was identified from the eye tissue by 16S rRNA amplification. Klebsiella pneumoniae endophthalmitis has a characteristic disease phenotype and a particularly aggressive course with poor visual outcomes observed in most cases. This case highlights the risks of metastatic infection including bacterial endophthalmitis in association with Klebsiella infection. PMID:25606041

Soon, Wai Cheong; Pouncey, Anna; Ashley, Elizabeth; Bowen, Elizabeth Frances

2014-01-01

131

'KLEBSIELLA' DENSITIES IN WATERS RECEIVING WOOD PULP EFFLUENTS  

EPA Science Inventory

Surface waters receiving pulp mill effluents were examined for the presence of total coliforms, fecal coliforms, and Salmonella species. Fecal coliforms were biochemically identified as belonging to the Escherichia, Klebsiella or Enterobacter genera. Sixty percent of the isolates...

132

Enumeration andIdentification ofNitrogen-Fixing Bacteria fromForageGrassRoots  

Microsoft Academic Search

Root-soil cores were collected fromforage grasses growingina subtropical region ofTexasandtested foracetylene reduction activity. The population density ofnitrogen-fixing bacteria was measured, usingvarious mediaandincu- bation conditions. Bacteria were confirmed asnitrogen fixing, usingtheacetylene reduction assay,andwere classified according to standardbiochemical and cultural methods. Themajority ofthenitrogen-fixing bacteria isolated fromroots were Enterobacter cloacae orKlebsiella pneumoniae. Root-associated, nitrogen- fixing bacteria were isolated from21of24root-soil cores.Thepopulation densities ofnitrogen-fixing bacteria

SARA F. WRIGHT; R. W. WEAVER

1981-01-01

133

Effects of rotating magnetic field exposure on the functional parameters of different species of bacteria.  

PubMed

Abstract The aim of the present study was to determine the effect of the rotating magnetic field (RMF) on the growth, cell metabolic activity and biofilm formation by S. aureus, E. coli, A. baumannii, P. aeruginosa, S. marcescens, S. mutans, C. sakazakii, K. oxytoca and S. xylosus. Bacteria were exposed to the RMF (RMF magnetic induction B?=?25-34?mT, RMF frequency f?=?5-50?Hz, time of exposure t?=?60?min, temperature of incubation 37?°C). The persistence of the effect of exposure (B?=?34?mT, f?=?50?Hz, t?=?60?min) on bacteria after further incubation (t?=?300?min) was also studied. The work showed that exposure to RMF stimulated the investigated parameters of S. aureus, E. coli, S. marcescens, S. mutans, C. sakazakii, K. oxytoca and S. xylosus, however inhibited cell metabolic activity and biofilm formation by A. baumannii and P. aeruginosa. The results obtained in this study proved, that the RMF, depending on its magnetic induction and frequency can modulate functional parameters of different species of bacteria. PMID:24460420

Fija?kowski, Karol; Nawrotek, Pawe?; Struk, Magdalena; Kordas, Marian; Rakoczy, Rafa?

2014-01-24

134

Clinical and microbiological characteristics of tigecycline non-susceptible Klebsiella pneumoniae bacteremia in Taiwan  

PubMed Central

Background Resistance among Klebsiella pneumoniae to most antibiotics is on the rise. Tigecycline has been considered as one of the few therapeutic options available to treat multidrug-resistant bacteria. We investigated the clinical and microbiological characteristics of tigecycline non-susceptible K. pneumoniae bacteremia. Methods Adult patients with tigecycline non-susceptible K. pneumoniae bacteremia at a medical center in Taiwan over a 3-year period were enrolled. K. pneumoniae isolates were identified by the E-test using criteria set by the US Food and Drug Administration (FDA). Data on the clinical features of patients were collected from medical records. Genes for ?-lactamases, antimicrobial susceptibilities and pulsed-field gel electrophoresis (PFGE) results were determined for all isolates. Results Of 36 patients, 27 had nosocomial bacteremia. Overall 28-day mortality was 38.9%. The MIC50 and MIC90 of tigecycline were 6 and 8 mg/L, respectively. No carbapenemase was detected among the 36 isolates. Twenty isolates carried extended spectrum ?-lactamases and/or DHA-1 genes. No major cluster of isolates was found among the 36 isolates by PFGE. Intensive care unit onset of tigecycline non-susceptible Klebsiella pneumoniae bacteremia was the only independent risk factor for 28-day mortality. Conclusions The high mortality of patients with tigecycline non-susceptible K. pneumoniae bacteremia may suggest a critical problem. Further study to identify the possible risk factors for its development and further investigation of this type of bacteremia is necessary. PMID:24380631

2014-01-01

135

Aeromonas punctata derived depolymerase that disrupts the integrity of Klebsiella pneumoniae capsule: optimization of depolymerase production.  

PubMed

Formation of dense, highly hydrated biofilm structures pose a risk for public and environmental health. Extracellular polymeric substances encompassing biofilms offer 1000-fold greater resistance as compared to the planktonic cells. Using enzymes as anti-biofouling agents, will improve penetration of antimicrobials and increase susceptibility of biofilms to components of immune system. The challenge of using enzymes derived from unrelated bacteria for the degradation of capsular matrix of Klebsiella pneumoniae has not been dealt in the past. Thus, statistical optimization was done to enhance depolymerase production by Aeromonas punctata, directed against the exopolysaccharide matrix of Klebsiella pneumoniae B5055, capable of substituting the available phage borne depolymerase enzyme. Optimization via central composite design (CCD) resulted in 16-fold enhancement in depolymerase yield (166.65?µmoles?ml(-1) ?min(-1) ) over unoptimized medium. Out of the 19 variables, media composition giving maximum expression levels of the enzyme consisted of 1?mg?ml(-1) galactose and ammonium chloride, 1.5?mg?ml(-1) each of capsular polysaccharide (CPS) and magnesium sulfate. Tryptic peptide analysis of the purified 29?kDa band by Matrix assisted laser desorption ionization-time of flight (MALDI-TOF) showed a high homology with a protein of unknown function from Aeromonas cavaie Ae398. Further improvements in the enzyme can lead to its successful development as prophylactic and/or a therapeutic agent. PMID:23996303

Bansal, Shruti; Soni, Sanjeev Kumar; Harjai, Kusum; Chhibber, Sanjay

2014-07-01

136

Extended-Spectrum ?-Lactamase CTX-M-15-Producing Klebsiella pneumoniae of Sequence Type ST274 in Companion Animals  

PubMed Central

Screening of extended-spectrum ?-lactamase (ESBL)-producing Gram-negative bacteria in companion animals living in the Paris area in France identified a high rate of CTX-M-15-producing Klebsiella pneumoniae. Those isolates were recovered during the 2010-2011 period from both infections and asymptomatic colonizations. Sequence typing revealed that most of these isolates belonged to sequence type ST274. Interestingly, the blaCTX-M-15 gene was located on a specific and novel plasmid scaffold. These findings highlight that companion animals may be reservoirs for CTX-M-15-producing K. pneumoniae evolving separately from the human reservoir of CTX-M-15 producers. PMID:23422912

Poirel, Laurent; Ducroz, Sébastien; Boulouis, Henri-Jean; Arné, Pascal; Millemann, Yves

2013-01-01

137

Extended-Spectrum-Beta-Lactamases, AmpC Beta-Lactamases and Plasmid Mediated Quinolone Resistance in Klebsiella spp. from Companion Animals in Italy  

PubMed Central

We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6?)-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6?)-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6?)-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission between pets and humans, especially at household level. PMID:24595207

Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S.; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

2014-01-01

138

Extended-spectrum-beta-lactamases, AmpC beta-lactamases and plasmid mediated quinolone resistance in klebsiella spp. from companion animals in Italy.  

PubMed

We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6')-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6')-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6')-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission between pets and humans, especially at household level. PMID:24595207

Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

2014-01-01

139

Isolation of some pathogenic bacteria from the great spruce bark beetle, Dendroctonus micans and its specific predator, Rhizophagus grandis.  

PubMed

Some bacteria were isolated from Dendroctonus micans and its specific predator, Rhizophagus grandis. Six bacteria from D. micans were identified as Bacillus pumilus, Enterobacter intermedius, Citrobacter freundii, Cellulomonas flavigena, Microbacterium liquefaciens and Enterobacter amnigenus, three bacteria from R. grandis as Klebsiella pneumoniae, Pantoea agglomerans and Serratia grimesii, on the basis of fatty acid methyl ester analysis and carbon utilization profile by using Microbial Identification and Biolog Microplate Systems. Their insecticidal effects were tested on larvae and adults of D. micans. PMID:20336502

Yaman, M; Ertürk, O; Aslan, I

2010-01-01

140

Neonatal Brain Abscess due to Extended-Spectrum Beta-Lactamase Producing Klebsiella pneumoniae  

PubMed Central

Klebsiella pneumoniae (K. pneumoniae) causing brain abscess in newborn infants is rare. Presented herein, is a 27-day-old male neonate who developed two frontal lobe abscesses in association with K. pneumoniae sepsis and meningitis. Antibiotic susceptibility testing utilizing the double-disk synergy method (Cefotaxime and Amoxycillin-Clavulanate) confirmed the extended spectrum beta-lactamase (ESBL) production by the isolate. He was treated simultaneously with antibiotics (Meropenem and Amikacin) and abscess aspiration through the anterior fontanelle, with less than satisfactory outcome. ESBL producing K. pneumoniae brain abscess in neonates is extremely rare in the English literature. Emperical carbapenems and aminoglycoside coverage in neonates with K. pneumoniae sepsis and brain abscess, especially in areas with high rate of ESBL producing bacteria may be warranted. PMID:25584278

Mondal, Monojit; Thapa, Rajoo; Mallick, Debkrishna; Datta, Asok Kumar

2014-01-01

141

Tracking a Hospital Outbreak of Carbapenem-Resistant Klebsiella pneumoniae with Whole-Genome Sequencing  

PubMed Central

The Gram-negative bacteria Klebsiella pneumoniae is a major cause of nosocomial infections, primarily among immunocompromised patients. The emergence of strains resistant to carbapenems has left few treatment options, making infection containment critical. In 2011, the U.S. National Institutes of Health Clinical Center experienced an outbreak of carbapenem-resistant K. pneumoniae that affected 18 patients, 11 of whom died. Whole-genome sequencing was performed on K. pneumoniae isolates to gain insight into why the outbreak progressed despite early implementation of infection control procedures. Integrated genomic and epidemiological analysis traced the outbreak to three independent transmissions from a single patient who was discharged 3 weeks before the next case became clinically apparent. Additional genomic comparisons provided evidence for unexpected transmission routes, with subsequent mining of epidemiological data pointing to possible explanations for these transmissions. Our analysis demonstrates that integration of genomic and epidemiological data can yield actionable insights and facilitate the control of nosocomial transmission. PMID:22914622

Snitkin, Evan S.; Zelazny, Adrian M.; Thomas, Pamela J.; Stock, Frida; Henderson, David K.; Palmore, Tara N.; Segre, Julia A.

2012-01-01

142

Analysis of the Networks Controlling the Antimicrobial-Peptide-Dependent Induction of Klebsiella pneumoniae Virulence Factors ? †  

PubMed Central

Antimicrobial peptides (APs) impose a threat to the survival of pathogens, and it is reasonable to postulate that bacteria have developed strategies to counteract them. Polymyxins are becoming the last resort to treat infections caused by multidrug-resistant Gram-negative bacteria and, similar to APs, they interact with the anionic lipopolysaccharide. Given that polymyxins and APs share the initial target, it is possible that bacterial defense mechanisms against polymyxins will be also effective against host APs. We sought to determine whether exposure to polymyxin will increase Klebsiella pneumoniae resistance to host APs. Indeed, exposure of K. pneumoniae to polymyxin induces cross-resistance not only to polymyxin itself but also to APs present in the airways. Polymyxin treatment upregulates the expression of the capsule polysaccharide operon and the loci required to modify the lipid A with aminoarabinose and palmitate with a concomitant increase in capsule and lipid A species containing such modifications. Moreover, these surface changes contribute to APs resistance and also to polymyxin-induced cross-resistance to APs. Bacterial loads of lipid A mutants in trachea and lungs of intranasally infected mice were lower than those of wild-type strain. PhoPQ, PmrAB, and the Rcs system govern polymyxin-induced transcriptional changes, and there is a cross talk between PhoPQ and the Rcs system. Our findings support the notion that Klebsiella activates a defense program against APs that is controlled by three signaling systems. Therapeutic strategies directed to prevent the activation of this program could be a new approach worth exploring to facilitate the clearance of the pathogen from the airways. PMID:21708987

Llobet, Enrique; Campos, Miguel A.; Giménez, Paloma; Moranta, David; Bengoechea, José A.

2011-01-01

143

Perianal Abscess and Proctitis by Klebsiella pneumoniae  

PubMed Central

Klebsiella pneumoniae (K. pneumoniae) can at times cause invasive infections, especially in patients with diabetes mellitus and a history of alcohol abuse. A 61-year-old man with diabetes mellitus and a history of alcohol abuse presented with abdominal and anal pain for two weeks. After admission, he underwent sigmoidoscopy, which revealed multiple ulcerations with yellowish exudate in the rectum and sigmoid colon. The patient was treated with ciprofloxacin and metronidazole. After one week, follow up sigmoidoscopy was performed owing to sustained fever and diarrhea. The lesions were aggravated and seemed webbed in appearance because of damage to the rectal mucosa. Abdominal computed tomography and rectal magnetic resonance imaging were performed, and showed a perianal and perirectal abscess. The patient underwent laparoscopic sigmoid colostomy and perirectal abscess incision and drainage. Extended-spectrum beta-lactamase-producing K. pneumoniae was identified in pus culture. The antibiotics were switched to ertapenem. He improved after surgery and was discharged. K. pneumoniae can cause rapid invasive infection in patients with diabetes and a history of alcohol abuse. We report the first rare case of proctitis and perianal abscess caused by invasive K. pneumoniae infection.

Jeong, Woo Shin; Choi, Sung Youn; Jeong, Eun Haeng; Bang, Ki Bae; Park, Seung Sik; Lee, Dae Sung; Park, Dong Il

2015-01-01

144

Investigation on American cockroaches medically important bacteria in Khorramshahr hospital, Iran  

PubMed Central

Objective To investigate American cockroaches' infection to various bacteria in Khorramshahr Vali-e-Asr hospital, which was done in 2008. Methods In this descriptive cross-sectional study, 20 American cockroaches were caught via direct collection. Medically important bacteria were extracted from their outer surface of bodies by standard procedures. Results Culturing outer surface wash of cockroaches resulted in the separation of Klebsiella, Pseudomonas, Escherichia coli, Staphylococcus, Proteus and Streptococcus. The main common bacteria were Klebsiella (35%) and Pseudomonas (30%). Also, results of culture media showed that about 90% of cockroaches infected to at least one bacterium. Conclusions American cockroaches can transmit pathogenic and potential pathogenic bacteria, therefore their presence in hospitals may be a sanitation challenge. It is recommended to assess plans in purpose to combat these pests in the hospitals.

Kassiri, Hamid; Kassiri, Ali; Kazemi, Shahnaz

2014-01-01

145

'KLEBSIELLA' OCCURRENCE, SIGNIFICANCE AND DETECTION IN WATER SYSTEMS: A PROGRESS REPORT  

EPA Science Inventory

Frequent occurrence of Klebsiella in coliform colonization problems found in water supply distribution has prompted the development of a new medium (m-Kleb agar) for specific detection. The medium has excellent differential characteristics, and an average 94% Klebsiella recovery ...

146

Nitrogen-fixing bacteria in Douglas-fir residue decayed by Fomitopsis pinicola  

Microsoft Academic Search

Summary  Colonizing populations of nitrogen-fixing bacteria were measured in various decay stages of Douglas-fir logs infested withFomitopsis pinicola. Numbers of nitrogen-fixers and N-fixation rates in the wood increased as decay progressed. These increase in bacterial populations\\u000a and N-fixing activity appeared related to increases in wood moisture content. Bacteria resemblingClostridium pasteurianum, Clostridium butyricum, andKlebsiella\\/Enterobacter spp. were isolated from the various wood decay

S. D. Spano; M. F. Jurgensen; M. J. Larsen; A. E. Harvey

1982-01-01

147

Hessian fly-associated bacteria: transmission, essentiality, and composition.  

PubMed

Plant-feeding insects have been recently found to use microbes to manipulate host plant physiology and morphology. Gall midges are one of the largest groups of insects that manipulate host plants extensively. Hessian fly (HF, Mayetiola destructor) is an important pest of wheat and a model system for studying gall midges. To examine the role of bacteria in parasitism, a systematic analysis of bacteria associated with HF was performed for the first time. Diverse bacteria were found in different developmental HF stages. Fluorescent in situ hybridization detected a bacteriocyte-like structure in developing eggs. Bacterial DNA was also detected in eggs by PCR using primers targeted to different bacterial groups. These results indicated that HF hosted different types of bacteria that were maternally transmitted to the next generation. Eliminating bacteria from the insect with antibiotics resulted in high mortality of HF larvae, indicating that symbiotic bacteria are essential for the insect to survive on wheat seedlings. A preliminary survey identified various types of bacteria associated with different HF stages, including the genera Enterobacter, Pantoea, Stenotrophomonas, Pseudomonas, Bacillus, Ochrobactrum, Acinetobacter, Alcaligenes, Nitrosomonas, Arcanobacterium, Microbacterium, Paenibacillus, and Klebsiella. Similar bacteria were also found specifically in HF-infested susceptible wheat, suggesting that HF larvae had either transmitted bacteria into plant tissue or brought secondary infection of bacteria to the wheat host. The bacteria associated with wheat seedlings may play an essential role in the wheat-HF interaction. PMID:21858016

Bansal, Raman; Hulbert, Scot; Schemerhorn, Brandi; Reese, John C; Whitworth, R Jeff; Stuart, Jeffrey J; Chen, Ming-Shun

2011-01-01

148

Metabolism of Melamine by Klebsiella terragena  

PubMed Central

Experiments were conducted to determine the pathway of melamine metabolism by Klebsiella terragena (strain DRS-1) and the effect of added NH(inf4)(sup+) on the rates and extent of melamine metabolism. In the absence of added NH(inf4)(sup+), 1 mM melamine was metabolized concomitantly with growth. Ammeline, ammelide, cyanuric acid, and NH(inf4)(sup+) accumulated transiently in the culture medium to maximal concentrations of 0.012 mM, 0.39 mM, trace levels, and 0.61 mM, respectively. In separate incubations, in which cells were grown on either ammeline or ammelide (in the absence of NH(inf4)(sup+)), ammeline was metabolized without a lag while ammelide metabolism was observed only after 3 h. In the presence of 6 mM added NH(inf4)(sup+) (enriched with 5% (sup15)N), ammeline, ammelide, and cyanuric acid accumulated transiently to maximal concentrations of 0.002 mM, 0.47 mM, and trace levels, respectively, indicating that the added NH(inf4)(sup+) had little effect on the relative rates of triazine metabolism. These data suggest that the primary mode of melamine metabolism by K. terragena is hydrolytic, resulting in successive deaminations of the triazine ring. Use of (sup15)N-enriched NH(inf4)(sup+) allowed estimates of rates of triazine-N mineralization and assimilation of NH(inf4)(sup+)-N versus triazine-N into biomass. A decrease in the percent (sup15)N in the external NH(inf4)(sup+) pool, in conjunction with the accumulation of ammelide and/or triazine-derived NH(inf4)(sup+) in the culture medium, suggests that the initial reactions in the melamine metabolic pathway may occur outside the cytoplasmic membrane. PMID:16535652

Shelton, D. R.; Karns, J. S.; Mccarty, G. W.; Durham, D. R.

1997-01-01

149

Bacteria Transformation  

NSDL National Science Digital Library

Students construct paper recombinant plasmids to simulate the methods genetic engineers use to create modified bacteria. They learn what role enzymes, DNA and genes play in the modification of organisms. For the particular model they work on, they isolate a mammal insulin gene and combine it with a bacteria's gene sequence (plasmid DNA) for production of the protein insulin.

National Science Foundation GK-12 and Research Experience for Teachers (RET) Programs,

150

Genome Sequence of Klebsiella pneumoniae Respiratory Isolate IA565  

PubMed Central

Klebsiella pneumoniae is a clinically significant opportunistic bacterial pathogen as well as a normal member of the human microbiota. K. pneumoniae strain IA565 was isolated from a tracheal aspirate at the University of Iowa Hospitals and Clinics. Here, we present the genome sequence of K. pneumoniae IA565. PMID:25212620

Johnson, Jeremiah G.; Spurbeck, Rachel R.; Sandhu, Sukhinder K.

2014-01-01

151

Genome Sequence of Klebsiella pneumoniae Urinary Tract Isolate Top52  

PubMed Central

Klebsiella pneumoniae is a significant cause of nosocomial infections, including ventilator-associated pneumonias and catheter-associated urinary tract infections. K. pneumoniae strain TOP52 #1721 (Top52) was isolated from a woman presenting with acute cystitis and subsequently characterized using various murine models of infection. Here we present the genome sequence of K. pneumoniae Top52. PMID:24994806

Johnson, Jeremiah G.; Spurbeck, Rachel R.; Sandhu, Sukhinder K.

2014-01-01

152

Mast Cell IL-6 Improves Survival From Klebsiella Pneumonia and Sepsis by Enhancing Neutrophil Killing  

PubMed Central

The pleiotropic cytokine interleukin 6 (IL-6) has favorable and harmful effects on survival from bacterial infections. While many innate immune cells produce IL-6, little is known about relevant sources in vivo and the nature of its contributions to host responses to severe bacterial infections. To examine these roles, we subjected mast cell-specific IL-6-deficient mice to the cecal ligation and puncture model of septic peritonitis, finding that survival in these mice is markedly worse than in controls. Following intranasal or intraperitoneal inoculation with Klebsiella pneumoniae, IL-6-/- mice are less likely to survive than wild-type controls and at the time of death have higher numbers of bacteria but not inflammatory cells in lungs and peritoneum. Similarly, mast cell-specific IL-6-deficient mice have diminished survival and higher numbers of K. pneumoniae following intraperitoneal infection. Neutrophils lacking IL-6 have greater numbers of live intracellular K. pneumonia, suggesting impaired intracellular killing contributes to reduced clearance in IL-6-/- mice. These results establish that mast cell IL-6 is a critical mediator of survival following K. pneumoniae infection and sepsis and suggest that IL-6 protects from death by augmenting neutrophil killing of bacteria. PMID:18832718

Sutherland, Rachel E.; Olsen, Joanna S.; McKinstry, Andrew; Villalta, S. Armando; Wolters, Paul J.

2008-01-01

153

Role of Bacterial Surface Structures on the Interaction of Klebsiella pneumoniae with Phagocytes  

PubMed Central

Phagocytosis is a key process of the immune system. The human pathogen Klebsiella pneumoniae is a well known example of a pathogen highly resistant to phagocytosis. A wealth of evidence demonstrates that the capsule polysaccharide (CPS) plays a crucial role in resistance to phagocytosis. The amoeba Dictyostelium discoideum shares with mammalian macrophages the ability to phagocytose and kill bacteria. The fact that K. pneumoniae is ubiquitous in nature and, therefore, should avoid predation by amoebae, poses the question whether K. pneumoniae employs similar means to counteract amoebae and mammalian phagocytes. Here we developed an assay to evaluate K. pneumoniae-D. discoideum interaction. The richness of the growth medium affected the threshold at which the cps mutant was permissive for Dictyostelium and only at lower nutrient concentrations the cps mutant was susceptible to predation by amoebae. Given the critical role of bacterial surface elements on host-pathogen interactions, we explored the possible contribution of the lipopolysaccharide (LPS) and outer membrane proteins (OMPs) to combat phagoyctosis by D. discoideum. We uncover that, in addition to the CPS, the LPS O-polysaccharide and the first core sugar participate in Klebsiella resistance to predation by D. discoideum. K. pneumoniae LPS lipid A decorations are also necessary to avoid predation by amoebae although PagP-dependent palmitoylation plays a more important role than the lipid A modification with aminoarabinose. Mutants lacking OMPs OmpA or OmpK36 were also permissive for D. discoideium growth. Except the LPS O-polysaccharide mutants, all mutants were more susceptible to phagocytosis by mouse alveolar macrophages. Finally, we found a correlation between virulence, using the pneumonia mouse model, and resistance to phagocytosis. Altogether, this work reveals novel K. pneumoniae determinants involved in resistance to phagocytosis and supports the notion that Dictyostelium amoebae might be useful as host model to measure K. pneumoniae virulence and not only phagocytosis. PMID:23457627

Moranta, David; Llobet, Enrique; Pérez-Gutiérrez, Camino; Tomás, Juan M.; Suárez, Teresa; Garmendia, Junkal; Bengoechea, José A.

2013-01-01

154

Medicinal smoke reduces airborne bacteria.  

PubMed

This study represents a comprehensive analysis and scientific validation of our ancient knowledge about the effect of ethnopharmacological aspects of natural products' smoke for therapy and health care on airborne bacterial composition and dynamics, using the Biolog microplate panels and Microlog database. We have observed that 1h treatment of medicinal smoke emanated by burning wood and a mixture of odoriferous and medicinal herbs (havan sámagri=material used in oblation to fire all over India), on aerial bacterial population caused over 94% reduction of bacterial counts by 60 min and the ability of the smoke to purify or disinfect the air and to make the environment cleaner was maintained up to 24h in the closed room. Absence of pathogenic bacteria Corynebacterium urealyticum, Curtobacterium flaccumfaciens, Enterobacter aerogenes (Klebsiella mobilis), Kocuria rosea, Pseudomonas syringae pv. persicae, Staphylococcus lentus, and Xanthomonas campestris pv. tardicrescens in the open room even after 30 days is indicative of the bactericidal potential of the medicinal smoke treatment. We have demonstrated that using medicinal smoke it is possible to completely eliminate diverse plant and human pathogenic bacteria of the air within confined space. PMID:17913417

Nautiyal, Chandra Shekhar; Chauhan, Puneet Singh; Nene, Yeshwant Laxman

2007-12-01

155

Comparative Effects of Carbapenems on Bacterial Load and Host Immune Response in a Klebsiella pneumoniae Murine Pneumonia Model ? †  

PubMed Central

Doripenem is a carbapenem with potent broad-spectrum activity against Gram-negative pathogens, including antibiotic-resistant Enterobacteriaceae. As the incidence of extended-spectrum ?-lactamase (ESBL)-producing Gram-negative bacilli is increasing, it was of interest to examine the in vivo comparative efficacy of doripenem, imipenem, and meropenem against a Klebsiella pneumoniae isolate expressing the TEM-26 ESBL enzyme. In a murine lethal lower respiratory infection model, doripenem reduced the Klebsiella lung burden by 2 log10 CFU/g lung tissue over the first 48 h of the infection. Treatment of mice with meropenem or imipenem yielded reductions of approximately 1.5 log10 CFU/g during this time period. Seven days postinfection, Klebsiella titers in the lungs of treated mice decreased an additional 2 log10 CFU/g relative to those in the lungs of untreated control animals. Lipopolysaccharide (LPS) endotoxin release assays indicated that 6 h postinfection, meropenem- and imipenem-treated animals had 10-fold more endotoxin in lung homogenates and sera than doripenem-treated mice. Following doripenem treatment, the maximum endotoxin release postinfection (6 h) was 53,000 endotoxin units (EU)/ml, which was 2.7- and 6-fold lower than imipenem or meropenem-treated animals, respectively. While the levels of several proinflammatory cytokines increased in both the lungs and sera following intranasal K. pneumoniae inoculation, doripenem treatment, but not meropenem or imipenem treatment, resulted in significantly increased interleukin 6 levels in lung homogenates relative to those in lung homogenates of untreated controls, which may contribute to enhanced neutrophil killing of bacteria in the lung. Histological examination of tissue sections indicated less overall inflammation and tissue damage in doripenem-treated mice, consistent with improved antibacterial efficacy, reduced LPS endotoxin release, and the observed cytokine induction profile. PMID:21135187

Hilliard, Jamese J.; Melton, John L.; Hall, LeRoy; Abbanat, Darren; Fernandez, Jeffrey; Ward, Christine K.; Bunting, Rachel A.; Barron, A.; Lynch, A. Simon; Flamm, Robert K.

2011-01-01

156

Rapid Ertapenem Susceptibility Testing and Klebsiella pneumoniae Carbapenemase Phenotype Detection in Klebsiella pneumoniae Isolates by Use of Automated Microscopy of Immobilized Live Bacterial Cells  

PubMed Central

We evaluated detection of ertapenem (ETP) resistance and Klebsiella pneumoniae carbapenemase (KPC) in 47 Klebsiella pneumoniae isolates using a novel automated microscopy system. Automated microscopy correctly classified 22/23 isolates as ETP resistant and 24/24 as ETP susceptible and correctly classified 21/21 isolates as KPC positive and 26/26 as KPC negative. PMID:24391202

Frobel, Rachel A.; Herrera, Monica L.; Wickes, Brian L.

2014-01-01

157

Emergence of resistant Klebsiella pneumoniae in the intestinal tract during a1 successful treatment of Klebsiella pneumoniae lung infection in rats.2  

E-print Network

1/18 Emergence of resistant Klebsiella pneumoniae in the intestinal tract during a1 successful treatment of Klebsiella pneumoniae lung infection in rats.2 3 Running Title: Intestinal Impact intestinal E. coli and E. faecium populations, a lung infection by K. pneumoniae30 was instigated with two

Paris-Sud XI, Université de

158

Methanotrophic bacteria.  

PubMed Central

Methane-utilizing bacteria (methanotrophs) are a diverse group of gram-negative bacteria that are related to other members of the Proteobacteria. These bacteria are classified into three groups based on the pathways used for assimilation of formaldehyde, the major source of cell carbon, and other physiological and morphological features. The type I and type X methanotrophs are found within the gamma subdivision of the Proteobacteria and employ the ribulose monophosphate pathway for formaldehyde assimilation, whereas type II methanotrophs, which employ the serine pathway for formaldehyde assimilation, form a coherent cluster within the beta subdivision of the Proteobacteria. Methanotrophic bacteria are ubiquitous. The growth of type II bacteria appears to be favored in environments that contain relatively high levels of methane, low levels of dissolved oxygen, and limiting concentrations of combined nitrogen and/or copper. Type I methanotrophs appear to be dominant in environments in which methane is limiting and combined nitrogen and copper levels are relatively high. These bacteria serve as biofilters for the oxidation of methane produced in anaerobic environments, and when oxygen is present in soils, atmospheric methane is oxidized. Their activities in nature are greatly influenced by agricultural practices and other human activities. Recent evidence indicates that naturally occurring, uncultured methanotrophs represent new genera. Methanotrophs that are capable of oxidizing methane at atmospheric levels exhibit methane oxidation kinetics different from those of methanotrophs available in pure cultures. A limited number of methanotrophs have the genetic capacity to synthesize a soluble methane monooxygenase which catalyzes the rapid oxidation of environmental pollutants including trichloroethylene. PMID:8801441

Hanson, R S; Hanson, T E

1996-01-01

159

Klebsiella sp. strain C2A isolated from olive oil mill waste is able to tolerate and degrade tannic acid in very high concentrations.  

PubMed

Four bacterial strains capable of growing in the presence of tannic acid as sole carbon and energy source were isolated from olive mill waste mixtures. 16S rRNA gene sequencing assigned them to the genus Klebsiella. The most efficient strain, Klebsiella sp. strain C2A, was able to degrade 3.5 g L(-1) tannic acid within 35 h with synthesizing gallic acid as main product. The capability of Klebsiella sp. strain C2A to produce tannase was evidenced at high concentrations of tannic acid up to 50 g L(-1) . The bacteria adapted to the toxicity of tannic acids by an increase in the membrane lipid fatty acids degree of saturation, especially in the presence of concentrations higher than 20 g L(-1) . The highly tolerant and adaptable bacterial strain characterized in this study could be used in bioremediation processes of wastes rich in polyphenols such as those derived from olive mills, winery or tanneries. PMID:23521025

Pepi, Milva; Cappelli, Serena; Hachicho, Nancy; Perra, Guido; Renzi, Monia; Tarabelli, Alessandro; Altieri, Roberto; Esposito, Alessandro; Focardi, Silvano E; Heipieper, Hermann J

2013-06-01

160

Magnetotactic Bacteria  

Microsoft Academic Search

Bacteria with motility directed by the local geomagnetic field have been observed in marine sediments. These magnetotactic microorganisms possess flagella and contain novel structured particles, rich in iron, within intracytoplasmic membrane vesicles. Conceivably these particles impart to cells a magnetic moment. This could explain the observed migration of these organisms in fields as weak as 0.5 gauss.

Richard Blakemore

1975-01-01

161

Limiting and controlling carbapenem-resistant Klebsiella pneumoniae  

PubMed Central

Carbapenem-resistant Klebsiella pneumoniae (CRKP) is resistant to almost all antimicrobial agents, is associated with substantial morbidity and mortality, and poses a serious threat to public health. The ongoing worldwide spread of this pathogen emphasizes the need for immediate intervention. This article reviews the global spread and risk factors for CRKP colonization/infection, and provides an overview of the strategy to combat CRKP dissemination. PMID:24353433

Saidel-Odes, Lisa; Borer, Abraham

2014-01-01

162

Endogenous endophthalmitis associated with liver abscess caused by Klebsiella pneumoniae  

Microsoft Academic Search

To report two unusual cases of endogenous endophthalmitis associated with liver abscess caused by Klebsiella pneumoniae. Retrospective, interventional case series. Two patients, known to have type II diabetes mellitus, presented with sudden visual\\u000a loss following several days of abdominal pain. Examinations and investigations revealed endogenous endophthalmitis caused\\u000a by K. pneumoniae. Despite treatment in the form of intravitreal injection of antibiotics

Ammar M. Al-Mahmood; Ghada Y. Al-Binali; Hind AlKatan; Emad B. Abboud; Ahmed M. Abu El-Asrar

2011-01-01

163

Isolation and characterization of Klebsiella pneumoniae unencapsulated mutants  

SciTech Connect

Klebsiella pneumoniae mutants were obtained after UV irradiation and negative selection with anticapsular serum. Unencapsulation, rather than expression of a structurally altered capsule, was found in the mutants. The mutant strains showed no alterations in their outer membrane proteins and lipopolysaccharide, and a great similarity with the wild type in the properties tested (serum resistance, antimicrobial sensitivity, and lipopolysaccharide-specific bacteriophage sensitivity), with the exception of a higher cell surface hydrophobicity and resistance to bacteriophage FC3-9.

Benedi, V.J.; Ciurana, B.; Tomas, J.M.

1989-01-01

164

Endocarditis Due to Rare and Fastidious Bacteria  

PubMed Central

The etiologic diagnosis of infective endocarditis is easily made in the presence of continuous bacteremia with gram-positive cocci. However, the blood culture may contain a bacterium rarely associated with endocarditis, such as Lactobacillus spp., Klebsiella spp., or nontoxigenic Corynebacterium, Salmonella, Gemella, Campylobacter, Aeromonas, Yersinia, Nocardia, Pasteurella, Listeria, or Erysipelothrix spp., that requires further investigation to establish the relationship with endocarditis, or the blood culture may be uninformative despite a supportive clinical evaluation. In the latter case, the etiologic agents are either fastidious extracellular or intracellular bacteria. Fastidious extracellular bacteria such as Abiotrophia, HACEK group bacteria, Clostridium, Brucella, Legionella, Mycobacterium, and Bartonella spp. need supplemented media, prolonged incubation time, and special culture conditions. Intracellular bacteria such as Coxiella burnetii cannot be isolated routinely. The two most prevalent etiologic agents of culture-negative endocarditis are C. burnetti and Bartonella spp. Their diagnosis is usually carried out serologically. A systemic pathologic examination of excised heart valves including periodic acid-Schiff (PAS) staining and molecular methods has allowed the identification of Whipple's bacillus endocarditis. Pathologic examination of the valve using special staining, such as Warthin-Starry, Gimenez, and PAS, and broad-spectrum PCR should be performed systematically when no etiologic diagnosis is evident through routine laboratory evaluation. PMID:11148009

Brouqui, P.; Raoult, D.

2001-01-01

165

Tolerance of anaerobic bacteria to chlorinated solvents.  

PubMed

The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515

Koenig, Joanna C; Groissmeier, Kathrin D; Manefield, Mike J

2014-01-01

166

Tolerance of Anaerobic Bacteria to Chlorinated Solvents  

PubMed Central

The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515

Koenig, Joanna C.; Groissmeier, Kathrin D.; Manefield, Mike J.

2014-01-01

167

Infection with Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae in cancer patients.  

PubMed

Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae (KPC-Kp) is an emergent pathogen in healthcare-associated infections (HAIs). The aim of this study was to describe HAIs due to KPC-Kp, as well as identify mortality risk factors in cancer patients. In patients diagnosed with HAIs due to KPC-Kp between January 2009 and July 2013, we evaluated only the first infection episode of each patient, analyzing mortality separately for patients treated for??48 h with at least one antimicrobial agent proven to display in vitro activity against KPC-Kp. We evaluated variables related to the malignancy, the severity and characteristics of the HAI, and the antimicrobial therapy. We identified 83 HAIs due to KPC-Kp. The 30-day mortality was 57.8 % for all infections and 72.7 % for bacteremic infections. Of the 83 patients, 60 patients received??48 h of appropriate treatment and 44 (53 %) developed bacteremia. Ten patients (12 %) were neutropenic at HAI diagnosis and 33 (39.8 %) had infection at the tumor site. The most common HAI was urinary tract infection, seen in 26 patients (31.3 %), followed by primary bloodstream infection, seen in 24 patients (28.9 %). Forty-four patients (73.3 %) received combination antimicrobial therapy, most often including polymyxin (68.3 %). Risk factors for 30-day mortality are high sequential organ failure assessment (SOFA) score, need for intensive care stay at diagnosis of infection, and acute kidney injury; the removal of invasive devices related to infection and treatment with effective antibiotics for KPC-Kp are protective factors. In cancer patients, high mortality is associated with HAI due to KPC-Kp and mortality risk factors are more often related to acute infection than to the underlying disease. PMID:25169967

Freire, M P; Pierrotti, L C; Filho, H H C; Ibrahim, K Y; Magri, A S G K; Bonazzi, P R; Hajar, L; Diz, M P E; Pereira, J; Hoff, P M; Abdala, E

2015-02-01

168

A New Klebsiella planticola Strain (Cd-1) Grows Anaerobically at High Cadmium Concentrations and Precipitates Cadmium Sulfide  

PubMed Central

Heavy metal resistance by bacteria is a topic of much importance to the bioremediation of contaminated soils and sediments. We report here the isolation of a highly cadmium-resistant Klebsiella planticola strain, Cd-1, from reducing salt marsh sediments. The strain grows in up to 15 mM CdCl2 under a wide range of NaCl concentrations and at acidic or neutral pH. In growth medium amended with thiosulfate, it precipitated significant amounts of cadmium sulfide (CdS), as confirmed by x-absorption spectroscopy. In comparison with various other strains tested, Cd-1 is superior for precipitating CdS in cultures containing thiosulfate. Thus, our results suggest that Cd-1 is a good candidate for the accelerated bioremediation of systems contaminated by high levels of cadmium. PMID:10877810

Sharma, Pramod K.; Balkwill, David L.; Frenkel, Anatoly; Vairavamurthy, Murthy A.

2000-01-01

169

CTX-M-Type Extended-Spectrum ?-Lactamase-Producing Klebsiella pneumoniae Isolated from Cases of Bovine Mastitis in Japan  

PubMed Central

ABSTRACT Three Klebsiella pneumoniae isolates producing extended-spectrum beta-lactamase (ESBL) were obtained from three dairy cows with clinical mastitis in two farms in western Japan. Two of the 3 isolates from cows in different farms were able to transfer plasmids carrying the blaCTX-M-2 gene to Escherichia coli recipient. Pulsed-field gel electrophoresis (PFGE) patterns of the 2 isolates were different from each other, although restricted-fragment patterns of the two conjugative plasmids were similar to each other. Additionally, PCR-based replicon typing revealed that both the plasmids belonged to type Inc.T. These results suggest that ESBL-encoding genes can be distributed in bacteria on dairy farms through the plasmids. PMID:24784438

SAISHU, Nobukazu; OZAKI, Hiroichi; MURASE, Toshiyuki

2014-01-01

170

Bacteria and Foodborne Illness  

MedlinePLUS

... Some parasites and chemicals also cause foodborne illnesses. Bacteria Bacteria are tiny organisms that can cause infections of the GI tract. Not all bacteria are harmful to humans. Some harmful bacteria may ...

171

Antibiofilm efficacy of silver nanoparticles against biofilm of extended spectrum ?-lactamase isolates of Escherichia coli and Klebsiella pneumoniae  

NASA Astrophysics Data System (ADS)

The ability of bacteria to develop antibiotic resistance and colonize abiotic surfaces by forming biofilms is a major cause of medical implant-associated infections and results in prolonged hospitalization periods and patient mortality. Different approaches have been used for preventing biofilm-related infections in health care settings. Many of these methods have their own demerits that include chemical-based complications; emergent antibiotic-resistant strains, and so on. Silver nanoparticles (AgNPs) are renowned for their influential antimicrobial activity. We demonstrate the biofilm formation by extended spectrum ?-lactamases-producing Escherichia coli and Klebsiella spp. by direct visualization applying tissue culture plate, tube, and Congo red agar methods. Double fluorescent staining for confocal laser scanning microscopy (CLSM) consisted of propidium iodide staining to detect bacterial cells and concanavalin A-fluorescein isothiocyanate staining to detect the exopolysaccharides matrix were used. Scanning electron microscopy observations clearly indicate that AgNPs reduced the surface coverage by E. coli and Klebsiella spp. thus prevent the biofilm formations. Double-staining technique using CLSM provides the visual evidence that AgNPs arrested the bacterial growth and prevent the exopolysaccharides formation. The AgNPs-coated surfaces effectively restricted biofilm formation of the tested bacteria. In our study, we could demonstrate the complete antibiofilm activity AgNPs at a concentration as low as 50 ?g/ml. Our findings suggested that AgNPs can be exploited towards the development of potential antibacterial coatings for various biomedical and environmental applications. These formulations can be used for the treatment of drug-resistant bacterial infections caused by biofilms, at much lower nanosilver loading with higher efficiency.

Ansari, Mohammad Azam; Khan, Haris M.; Khan, Aijaz A.; Cameotra, Swaranjit Singh; Pal, Ruchita

2014-10-01

172

Chemical composition and antibacterial activity of Lavandula coronopifolia essential oil against antibiotic-resistant bacteria.  

PubMed

The aim of this study was to analyse the composition of the essential oil (EO) of Lavandula coronopifolia from Morocco and to evaluate its in vitro antibacterial activity against antibiotic-resistant bacteria isolated from clinical infections. The antimicrobial activity was assessed by a broth micro-well dilution method using multiresistant clinical isolates of 11 pathogenic bacteria: Klebsiella pneumoniae subsp. pneumoniae, Klebsiella ornithinolytica, Escherichia coli, Enterobacter cloacae, Enterobacter aerogenes, Providencia rettgeri, Citrobacter freundii, Hafnia alvei, Salmonella spp., Acinetobacter baumannii and methicillin-resistant Staphylococcus aureus. The main compounds of the oil were carvacrol (48.9%), E-caryophyllene (10.8%) and caryophyllene oxide (7.7%). The oil showed activity against all tested strains with minimal inhibitory concentration (MIC) values ranging between 1% and 4%. For most of the strains, the MIC value was equivalent to the minimal bactericidal concentration value, indicating a clear bactericidal effect of L. coronopifolia EO. PMID:25174508

Ait Said, L; Zahlane, K; Ghalbane, I; El Messoussi, S; Romane, A; Cavaleiro, C; Salgueiro, L

2015-03-01

173

The Prevalence of TEM and SHV Genes among Extended-Spectrum Beta-Lactamases Producing Escherichia Coli and Klebsiella Pneumoniae  

PubMed Central

Objective(s) Production of extended-spectrum beta-lactamases (ESBLs) by enteric bacteria continues to be a major problem in hospitals and community. ESBLs producing bacteria cause many serious infections including urinary tract infections, peritonitis, cholangitis and intra-abdominal abscess. The aim of this study was to determine the prevalence of ESBLs producing Escherichia coli and Klebsiella pneumoniae bacteria isolated from clinical samples of patients attending Imam Reza and Ghaem University Hospitals, Mashhad, Northeast of Iran. Materials and Methods During 2009 and 2010, 82 strains of E. coli and 78 strains of K. pneumoniae were isolated from out-patients and hospitalized patients and they were examined by Oxoid combination disk test and PCR methods. Results We found that 43.9% of E. coli and 56.1% of K. pneumoniae produced ESBLs. The frequency of SHV and TEM among the ESBLs producing isolates were 14.4% and 20.6%, respectively. Ratios of ESBLs positive isolates from out-patients to hospitalized patients were 24/33. Conclusion This study shows that the prevalence of ESBLs producing E. coli and K. pneumoniae is high in both study groups (out-patients and hospitalized patients). Therefore it seems that continuous surveillance is essential to monitor the ESBLs producing microorganisms in hospitals and community. PMID:23493850

Zaniani, Fatemeh Riyahi; Meshkat, Zahra; Naderi Nasab, Mahboubeh; Khaje-Karamadini, Mehrangiz; Ghazvini, Kiarash; Rezaee, Abdolrahim; Esmaily, Habibollah; Nabavinia, Maryam Sadat; Darban Hoseini, Mahboubeh

2012-01-01

174

Emergence of Klebsiella pneumoniae clinical isolates producing KPC-2 carbapenemase in Cuba.  

PubMed

The emergence of Klebsiella pneumoniae producing carbapenemase (KPC) has now become a global concern. As a part of a nationwide multicentre surveillance study in Cuba, three K. pneumoniae clinical isolates resistant to carbapenems were detected for a 1-month period (September to October 2011). PCR and sequence analysis revealed that the three strains harboured bla KPC-2. They showed resistance or intermediate susceptibility to expanded-spectrum cephalosporins, other ?-lactams, a ?-lactam/?-lactamase inhibitor combination, and gentamicin. Two strains were susceptible only to colistin, whereas the other strain showing colistin resistance was susceptible to fluoroquinolones. These bla KPC -2-positive K. pneumoniae strains were classified into ST1271 (CC29), a novel clone harbouring bla KPC -2, and were revealed to be genetically identical by PCR-based DNA fingerprinting. The three patients infected with the KPC-producing K. pneumoniae had common risk factors, and had no overseas travel experience outside Cuba, suggesting local acquisition of the resistant pathogen. This is the first report of a KPC-producing K. pneumoniae in Cuba. Although detection of KPC in Enterobacteriaceae is still rare in Cuba, our finding indicated that KPC-producing bacteria are a global concern and highlighted the need to identify these microorganisms in clinical laboratories. PMID:25356357

Quiñones, D; Hart, M; Espinosa, F; Garcia, S; Carmona, Y; Ghosh, S; Urushibara, N; Kawaguchiya, M; Kobayashi, N

2014-07-01

175

Resistance of Klebsiella pneumoniae to the innate immune system of African green monkeys.  

PubMed

In recent years, an emergent Klebsiella pneumoniae hypermucoviscosity (HMV) phenotype has been associated with increased invasiveness and pathogenicity in primates. In this project, bacteria recovered from infected African green monkeys (AGM) (Chlorocebus aethiops sabaeus) were screened for HMV phenotype, and were compared to non-HMV isolates in in vitro, serum, and oxidative-mediated killing assays. Complement-mediated killing was assessed utilizing freshly collected serum from healthy AGM. Oxidative-mediated killing was investigated utilizing sodium hypochlorite and hydrogen peroxide. Compared to non-HMV isolates, HMV isolates were more resistant to serum-mediated and oxidative killing (p<0.05). Phagocytosis resistance was evaluated using AGM peripheral blood monocytes (PBMC), and results indicated that non-HMV isolates associated with the AGM PBMC to a greater extent than HMV isolates (p<0.001). Measurement of lactate dehydrogenase release showed that HMV isolates were more cytotoxic to AGM PBMC than non-HMV isolates (p<0.001). Thus, the hypermucoid phenotype appears to be an important virulence factor that promotes evasion of innate immune defenses. PMID:25614101

Cox, Brandi L; Schiffer, Holly; Dagget, Gregory; Beierschmitt, Amy; Sithole, Fortune; Lee, Elise; Revan, Floyd; Halliday-Simmonds, Iona; Beeler-Marfisi, Janet; Palmour, Roberta; Soto, Esteban

2015-03-23

176

Emergence of Klebsiella pneumoniae clinical isolates producing KPC-2 carbapenemase in Cuba  

PubMed Central

The emergence of Klebsiella pneumoniae producing carbapenemase (KPC) has now become a global concern. As a part of a nationwide multicentre surveillance study in Cuba, three K. pneumoniae clinical isolates resistant to carbapenems were detected for a 1-month period (September to October 2011). PCR and sequence analysis revealed that the three strains harboured blaKPC-2. They showed resistance or intermediate susceptibility to expanded-spectrum cephalosporins, other ?-lactams, a ?-lactam/?-lactamase inhibitor combination, and gentamicin. Two strains were susceptible only to colistin, whereas the other strain showing colistin resistance was susceptible to fluoroquinolones. These blaKPC-2-positive K. pneumoniae strains were classified into ST1271 (CC29), a novel clone harbouring blaKPC-2, and were revealed to be genetically identical by PCR-based DNA fingerprinting. The three patients infected with the KPC-producing K. pneumoniae had common risk factors, and had no overseas travel experience outside Cuba, suggesting local acquisition of the resistant pathogen. This is the first report of a KPC-producing K. pneumoniae in Cuba. Although detection of KPC in Enterobacteriaceae is still rare in Cuba, our finding indicated that KPC-producing bacteria are a global concern and highlighted the need to identify these microorganisms in clinical laboratories. PMID:25356357

Quiñones, D; Hart, M; Espinosa, F; Garcia, S; Carmona, Y; Ghosh, S; Urushibara, N; Kawaguchiya, M; Kobayashi, N

2014-01-01

177

Adhesion of fimbriated nitrogen-fixing enteric bacteria to roots of grasses and cereals  

Microsoft Academic Search

Summary  The role of fimbriae in enterobacterial adhesion to roots of grasses and cereals is discussed. All nitrogen-fixing enteric bacteria isolated in Finland had fimbriae. AllEnterobacter isolates had mannose-binding type-1 fimbriae, whereas most of theKlebsiella isolates had both type-1 and type-3 fimbriae. The strains were isolated from a total of ten different grass species, and no specific association was found between

Timo K. Korhonen; Eeva-Liisa Nurmiaho-Lassila; Tuula Laakso; Kielo Haahtela

1986-01-01

178

PCR-Based Identification of Klebsiella pneumoniae subsp. rhinoscleromatis, the Agent of Rhinoscleroma  

E-print Network

PCR-Based Identification of Klebsiella pneumoniae subsp. rhinoscleromatis, the Agent pneumoniae subsp. rhinoscleromatis. The disease is endemic in tropical and subtropical areas, but its of this study was to develop two simple PCR assays. We took advantage of the fact that all Klebsiella pneumoniae

Paris-Sud XI, Université de

179

Microbiology (1997), 143, 26732683 Printed in Great Britain The Klebsiella pneumoniae cytochrome bd'  

E-print Network

Microbiology (1997), 143, 2673­2683 Printed in Great Britain The Klebsiella pneumoniae cytochrome pneumoniae, where it is expressed under all conditions that permit diazotrophy. In this paper the sequence of the genes encoding this terminal oxidase (cydAB) of Klebsiella pneumoniae and the characterization of a cyd

Merrick, Mike

180

Efflux Pump, the Masked Side of -Lactam Resistance in Klebsiella pneumoniae Clinical Isolates  

E-print Network

Efflux Pump, the Masked Side of Ã?-Lactam Resistance in Klebsiella pneumoniae Clinical Isolates Jean are the well-recognized mechanisms of acquired Ã?-lactam resistance in Klebsiella pneumoniae isolates. However, such mechanisms proved to be absent in K. pneumoniae isolates that are non susceptible to cefoxitin (FOX

Paris-Sud XI, Université de

181

Functions of Some Capsular Polysaccharide Biosynthetic Genes in Klebsiella pneumoniae NTUH K-2044  

E-print Network

Functions of Some Capsular Polysaccharide Biosynthetic Genes in Klebsiella pneumoniae NTUH K-2044, Taiwan Abstract The growing number of Klebsiella pneumoniae infections, commonly acquired in hospitals in the NTUH-2044 strain of the pyogenic liver abscess (PLA) K. pneumoniae has been identified recently

Tsai, Ming-Daw

182

CTX-M-12 ?-Lactamase in a Klebsiella pneumoniae Clinical Isolate in Colombia  

PubMed Central

We describe the detection of the CTX-M-12 ?-lactamase from a clinical isolate of Klebsiella pneumoniae in Colombia. Screening of nosocomial Klebsiella spp. and Escherichia coli isolates from a network of teaching hospitals revealed the presence of CTX-M enzymes in multiple cities. This is the first description of CTX-M in Colombia. PMID:14742223

Villegas, Maria Virginia; Correa, Adriana; Perez, Federico; Zuluaga, Tania; Radice, Marcela; Gutkind, Gabriel; Casellas, José María; Ayala, Juan; Lolans, Karen; Quinn, John P.

2004-01-01

183

High isolation rates of multidrug-resistant bacteria from water and carpets of mosques  

PubMed Central

Objective There is little information regarding the isolation of antimicrobial-resistant potentially pathogenic bacteria from water and carpets of mosques worldwide. The objective of the present investigation is to determine the bacteriological quality of water and carpets of mosques in Elkhomes city in Libya. Methods Potentially pathogenic bacteria were isolated from water samples (n=44) and dust samples from carpets (n=50) of 50 mosques in Elkhomes city, Libya, using standard bacteriological procedures. Susceptibility of isolated bacteria to antimicrobial agents was determined by the disc-diffusion method. Results Of the water samples examined, 12 (27.3%) were positive for Escherichia coli, 10 (22.7%) for Klebsiella spp., and 15 (34.1%) for other enteric bacteria. Of the dust samples of carpets examined, 6 (12%) were positive for E. coli, 33 (66%) for Klebsiella spp., and 30 (60%) for Staphylococcus spp. Multidrug resistance (MDR, resistance to three or more antimicrobial groups) was found among 48.7% (19/37) and 46.9% (30/64) of the examined enterobacteria from water and carpets, respectively, and among 66.7% (20/30) of Staphylococcus spp. from carpets. In addition, methicillin-resistant Staphylococcus aureus (MRSA) was isolated from a carpet of one mosque. Conclusion Presence of multidrug-resistant potentially pathogenic bacteria in examined water and carpets indicate that mosques as communal environments may play a role in the spread of multidrug-resistant bacteria in the community and pose a serious health risk to worshipers. PMID:25128691

Mohamed Ali, Mostafa Mohamed; Alemary, Fuoad; Alrtail, Amna; Rzeg, Moftah M.; Albakush, Abdulla M.; Ghenghesh, Khalifa Sifaw

2014-01-01

184

Modulation of respiratory dendritic cells during Klebsiella pneumonia infection  

PubMed Central

Background Klebsiella pneumoniae is a leading cause of severe hospital-acquired respiratory tract infections and death but little is known regarding the modulation of respiratory dendritic cell (DC) subsets. Plasmacytoid DC (pDC) are specialized type 1 interferon producing cells and considered to be classical mediators of antiviral immunity. Method By using multiparameter flow cytometry analysis we have analysed the modulation of respiratory DC subsets after intratracheal Klebsiella pneumonia infection. Results Data indicate that pDCs and MoDC were markedly elevated in the post acute pneumonia phase when compared to mock-infected controls. Analysis of draining mediastinal lymph nodes revealed a rapid increase of activated CD103+ DC, CD11b+ DC and MoDC within 48 h post infection. Lung pDC identification during bacterial pneumonia was confirmed by extended phenotyping for 120G8, mPDCA-1 and Siglec-H expression and by demonstration of high Interferon-alpha producing capacity after cell sorting. Cytokine expression analysis of ex vivo-sorted respiratory DC subpopulations from infected animals revealed elevated Interferon-alpha in pDC, elevated IFN-gamma, IL-4 and IL-13 in CD103+ DC and IL-19 and IL-12p35 in CD11b+ DC subsets in comparison to CD11c+ MHC-class IIlow cells indicating distinct functional roles. Antigen-specific naive CD4+ T cell stimulatory capacity of purified respiratory DC subsets was analysed in a model system with purified ovalbumin T cell receptor transgenic naive CD4+ responder T cells and respiratory DC subsets, pulsed with ovalbumin and matured with Klebsiella pneumoniae lysate. CD103+ DC and CD11b+ DC subsets represented the most potent naive CD4+ T helper cell activators. Conclusion These results provide novel insight into the activation of respiratory DC subsets during Klebsiella pneumonia infection. The detection of increased respiratory pDC numbers in bacterial pneumonia may indicate possible novel pDC functions with respect to lung repair and regeneration. PMID:24044871

2013-01-01

185

Epidemiology and Outcome of Klebsiella Species Bloodstream Infection: A Population-Based Study  

PubMed Central

OBJECTIVE: To determine incidence rate, seasonal variation, and short- and long-term outcomes of Klebsiella species bloodstream infection (BSI) in a population-based setting. PATIENTS AND METHODS: We identified 127 unique patients in Olmsted County, Minnesota, from January 1, 1998, to December 31, 2007, who had Klebsiella spp BSI. Multivariable Poisson regression was used to examine temporal change and seasonal variation in incidence rate, and Cox proportional hazards regression was used to determine predictors of mortality. RESULTS: The age-adjusted incidence rate of Klebsiella spp BSI per 100,000 person-years was 15.4 (95% confidence interval [CI], 11.6-19.2) in men and 9.4 (95% CI, 7.0-11.8) in women. There was no linear increase in incidence rate of Klebsiella spp BSI during the study period (P=.55). The incidence rate of Klebsiella spp BSI increased at quadratic rate with age (P=.005). No significant difference was noted in incidence rate of Klebsiella spp BSI during the warmest 4 months compared to the rest of the year (incidence rate ratio, 0.97; 95% CI, 0.66-1.38; P=.95). The overall 28-day and 1-year all-cause mortality rates of Klebsiella spp BSI were 14% (95% CI, 9%-22%) and 35% (95% CI, 27%-44%), respectively. Respiratory source of BSI was associated with a higher 28-day mortality (hazard ratio, 4.90; 95% CI, 1.73-13.84; P=.003). CONCLUSION: The incidence rate of Klebsiella spp BSI increased with age. There was no temporal change or seasonal variation in incidence rate of Klebsiella spp BSI during the past decade. The 28-day all-cause mortality rate of Klebsiella spp BSI was relatively low; however, a respiratory source of BSI was associated with a poorer outcome. PMID:20118389

Al-Hasan, Majdi N.; Lahr, Brian D.; Eckel-Passow, Jeanette E.; Baddour, Larry M.

2010-01-01

186

Monitoring and identification of bacteria associated with safety concerns in the manufacture of São Jorge, a Portuguese traditional cheese from raw cow's milk.  

PubMed

The aim of this study was to assess the hygienic quality of raw milk used in the manufacture of São Jorge, a Protected Denomination of Origin Portuguese semihard cheese, as well as to ascertain the sanitary conditions prevailing during its processing. Viable counts of Enterobacteriaceae and Micrococcaceae were accordingly obtained, pertaining to 21 independent batches (including samples of raw milk, curd, and cheeses after 1, 3, and 4 months of ripening), from 7 dairy farms. Standard plate counts (log CFU per milliliter or per gram) ranged from 6.1 to 8.6 in raw milk, whereas they ranged from 7.0 to 8.0 in 4-month-old cheeses. Viable counts of Enterobacteriaceae ranged between 5.9 and 7.0 in raw milk and between 0.0 and 1.3 in 4-month-old cheeses. Species identified within this family encompassed Klebsiella oxytoca, Klebsiella cloacae, Klebsiella pneumoniae, Enterobacter sakazakii, and Escherichia coli; Klebsiella ornithinolytica, Klebsiella terrigena, and Serratia odorifera were detected only in raw milk. No Salmonella whatsoever could be detected in any of the samples. Viable counts of Micrococcaceae ranged between 4.7 and 5.9 and between 1.3 and 3.3 in raw milk and 4-month-old cheeses, respectively. Species identified within this family encompassed Staphylococcus sciuri, Staphylococcus epidermidis, Staphylococcus saprophyticus (which was found mainly in ripened cheeses), and Staphylococcus aureus (which was not detected in 4-month-old cheeses). Accompanying physicochemical analyses included determination of moisture, salt, and pH. Statistical analyses revealed a negative correlation between salt content and viable numbers of Enterobacteriaceae in cheese, whereas in the case of Micrococcaceae, a more negative correlation was found between viable numbers and moisture content than between viable numbers and pH. The results of our study indicate, in general, poor milk handling conditions in all farms, given that the indicators total mesophile and Enterobacteriaceae counts were high, between 100- and 1,000-fold those enforced by international standards pertaining to the matrices in question. However, by the time of regular consumption (i.e., after 4 months of ripening), São Jorge cheeses exhibit low levels of contamination by Enterobacteriaceae and S. aureus, as well as absence of Salmonella. PMID:18522034

Kongo, J Marcelino; Gomes, Ana P; Malcata, F Xavier

2008-05-01

187

Decolorization of synthetic melanoidins-containing wastewater by a bacterial consortium  

Microsoft Academic Search

The presence of melanoidins in molasses wastewater leads to water pollution both due to its dark brown color and its COD contents.\\u000a In this study, a bacterial consortium isolated from waterfall sediment was tested for its decolorization. The identification\\u000a of culturable bacteria by 16S rDNA based approach showed that the consortium composed of Klebsiella oxytoca, Serratia mercescens, Citrobacter sp. and

Suhuttaya Jiranuntipon; Supat Chareonpornwattana; Somsak Damronglerd; Claire Albasi; Marie-Line Delia

2008-01-01

188

Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria  

PubMed Central

Polymyxins are polycationic antimicrobial peptides that are currently the last-resort antibiotics for the treatment of multidrug-resistant, Gram-negative bacterial infections. The reintroduction of polymyxins for antimicrobial therapy has been followed by an increase in reports of resistance among Gram-negative bacteria. Some bacteria, such as Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii, develop resistance to polymyxins in a process referred to as acquired resistance, whereas other bacteria, such as Proteus spp., Serratia spp., and Burkholderia spp., are naturally resistant to these drugs. Reports of polymyxin resistance in clinical isolates have recently increased, including acquired and intrinsically resistant pathogens. This increase is considered a serious issue, prompting concern due to the low number of currently available effective antibiotics. This review summarizes current knowledge concerning the different strategies bacteria employ to resist the activities of polymyxins. Gram-negative bacteria employ several strategies to protect themselves from polymyxin antibiotics (polymyxin B and colistin), including a variety of lipopolysaccharide (LPS) modifications, such as modifications of lipid A with phosphoethanolamine and 4-amino-4-deoxy-L-arabinose, in addition to the use of efflux pumps, the formation of capsules and overexpression of the outer membrane protein OprH, which are all effectively regulated at the molecular level. The increased understanding of these mechanisms is extremely vital and timely to facilitate studies of antimicrobial peptides and find new potential drugs targeting clinically relevant Gram-negative bacteria. PMID:25505462

Olaitan, Abiola O.; Morand, Serge; Rolain, Jean-Marc

2014-01-01

189

Nitrogen fixation by immobilized NIF derepressed Klebsiella pneumoniae cells  

SciTech Connect

In vitro production of ammonia through biological means poses a number of challenges. The organisms should be able to accumulate considerable concentrations of ammonia in the medium. Secondly, nonphotosynthetic organisms must be supplied with high-energy substrates to carry out the fixation reaction. Thirdly, the organisms must be kept in a viable state to produce ammonia over long periods of time. In this article, preliminary results on the production of ammonia by a mutant strain of Klebsiella pneumoniae in continuous reactor systems are discussed. Continuous production of ammonia becomes feasible through the immobilization of the whole microbial cells and then through the use of the resulting catalyst system in a flow-through reactor. The rationale for immobilizing microbial cells and the advantages of such an approach over traditional fermentation processes are briefly described as they relate to the microbial production of ammonia. The microbial cells can be immobilized in such a way that their viability is still maintained in the immobilized state. This, in turn, obviates addition of cofactors, which is often an expensive step associated with immobilized multi-enzyme systems. Reconstituted bovine-hide collagen as the carrier matrix for fixing the cells was the carrier of choice for our work on immobilized Klebsiella cells. Polyacrylamide gels were examined as an alternate carrier matrix but results from this were found to be inferior to those collagen immobilized cell system.

Venkatasubramanian, K.; Toda, Y.

1980-01-01

190

Absorption Coefficient Imaging by Near-Field Scanning Optical Microscopy in Bacteria  

NASA Astrophysics Data System (ADS)

We present a method for obtaining a position-dependent absorption coefficient from near-field scanning optical transmission microscopy. We show that the optical transmission intensity can be combined with the topography, resulting into an absorption coefficient that simplifies the analysis of different materials within a sample. The method is tested with the dye rhodamine 6G, and we show some analysis in biological samples such as bacteria Klebsiella pneumoniae and Pseudomonas aeruginosa . The calculated absorption coefficient images show important details of the bacteria, in particular for P. aeruginosa , in which membrane vesicles are clearly seen.

de Paula, Ana M.; Chaves, Claudilene R.; Silva, Haroldo B.; Weber, Gerald

2003-06-01

191

Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences  

PubMed Central

Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism’s transcriptome is related to its cellular proteome. PMID:24551820

Motalleb, Gholamreza

2014-01-01

192

Phagocytic and chemiluminescent responses of mouse peritoneal macrophages to living and killed Salmonella typhimurium and other bacteria  

SciTech Connect

In the presence of luminol, resident as well as thioglycolate-induced and immunized macrophages emitted chemiluminescence more efficiently when the cells were exposed to living Salmonella typhimurium than when they were exposed to the same bacterium killed by ultraviolet light or heat. This phenomenon was observed whether or not the bacterium was opsonized. The different response to living and killed bacteria was also found with Escherichia coli, Pseudomonas aeruginosa, Proteus morganii, and Enterobacter aerogenes, but not with Shigella sonnei, Klebsiella pneumoniae, and Propionibacterium acnes. The results suggest that macrophages respond better to living, motile bacteria than to nonmotile or killed bacteria. The experimental results obtained with motility mutants of S. typhimurium, E. coli, and P. aeruginosa confirm that macrophages exposed to the motile bacteria emit chemiluminescence more efficiently and ingest the motile bacteria at a much faster rate than the nonmotile bacteria.

Tomita, T.; Blumenstock, E.; Kanegasaki, S.

1981-06-01

193

Acute lung inflammation in Klebsiella pneumoniae B5055-induced pneumonia and sepsis in BALB/c mice: a comparative study.  

PubMed

Lungs play an important role in the body's defense against a variety of pathogens, but this network of immune system-mediated defense can be deregulated during acute pulmonary infections. The present study compares acute lung inflammation occurring during Klebsiella pneumoniae B5055-induced pneumonia and sepsis in BALB/c mice. Pneumonia was induced by intranasal instillation of bacteria (10(4) cfu), while sepsis was developed by placing the fibrin-thrombin clot containing known amount of bacteria (10(2) cfu) into the peritoneal cavity of animals. Mice with sepsis showed 100% mortality within five post-infection days, whereas all the animals with pneumonia survived. In animals suffering from K. pneumoniae B5055-induced pneumonia, all the inflammatory parameters (TNF-?, IL-1?, MPO, MDA, and NO) were found to be maximum till third post-infection day, after that, a decline was observed, whereas in septic animals, all the above-mentioned markers of inflammation kept on increasing. Histopathological study showed presence of alternatively activated alveolar macrophages (or foam cells) in lungs of mice with pneumonia after third post-infection day, which might have contributed to the induction of resolution of inflammation, but no such observation was made in lungs of septic mice. Hence, during pneumonia, controlled activation of macrophages may lead to resolution of inflammation. PMID:20890649

Kumar, Vijay; Chhibber, Sanjay

2011-10-01

194

Back To Bacteria.  

ERIC Educational Resources Information Center

Explores new research about bacteria. Discusses bacterial genomes, archaea, unusual environments, evolution, pathogens, bacterial movement, biofilms, bacteria in the body, and a bacterial obsession. Contains 29 references. (JRH)

Flannery, Maura C.

1997-01-01

195

A multiple antibiotic and serum resistant oligotrophic strain, Klebsiella pneumoniae MB45 having novel dfrA30, is sensitive to ZnO QDs  

PubMed Central

Background The aim of this study was to describe a novel trimethoprim resistance gene cassette, designated dfrA30, within a class 1 integron in a facultatively oligotrophic, multiple antibiotic and human serum resistant test strain, MB45, in a population of oligotrophic bacteria isolated from the river Mahananda; and to test the efficiency of surface bound acetate on zinc oxide quantum dots (ZnO QDs) as bactericidal agent on MB45. Methods Diluted Luria broth/Agar (10-3) media was used to cultivate the oligotrophic bacteria from water sample. Multiple antibiotic resistant bacteria were selected by employing replica plate method. A rapid assay was performed to determine the sensitivity/resistance of the test strain to human serum. Variable region of class 1 integron was cloned, sequenced and the expression of gene coding for antibiotic resistance was done in Escherichia coli JM 109. Identity of culture was determined by biochemical phenotyping and 16S rRNA gene sequence analyses. A phylogenetic tree was constructed based on representative trimethoprim resistance-mediating DfrA proteins retrieved from GenBank. Growth kinetic studies for the strain MB45 were performed in presence of varied concentrations of ZnO QDs. Results and conclusions The facultatively oligotrophic strain, MB45, resistant to human serum and ten antibiotics trimethoprim, cotrimoxazole, ampicillin, gentamycin, netilmicin, tobramycin, chloramphenicol, cefotaxime, kanamycin and streptomycin, has been identified as a new strain of Klebsiella pneumoniae. A novel dfr gene, designated as dfrA30, found integrated in class 1 integron was responsible for resistance to trimethoprim in Klebsiella pneumoniae strain MB45. The growth of wild strain MB45 was 100% arrested at 500 mg/L concentration of ZnO QDs. To our knowledge this is the first report on application of ZnO quantum dots to kill multiple antibiotics and serum resistant K. pneumoniae strain. PMID:21595893

2011-01-01

196

Expansion of ESBL-producing Klebsiella pneumoniae in hospitalized patients: a successful story of international clones (ST15, ST147, ST336) and epidemic plasmids (IncR, IncFIIK).  

PubMed

The aim of this study was to characterize by a multi-level approach extended-spectrum ?-lactamase (ESBL)-producing Enterobacteriaceae isolates other than E. coli from Portuguese hospitals. Eighty-eight ESBL-producing clinical isolates (69 Klebsiella pneumoniae, 13 Enterobacter cloacae complex, 3 Klebsiella oxytoca, 1 Enterobacter asburiae, 1 Proteus mirabilis and 1 Serratia marcescens) recovered from hospitals located in the North (A) or Centre (B, C) regions during two time periods (2006-7 and 2010) were analyzed. Standard methods were used for bacterial identification, antibiotic susceptibility testing, ESBL characterization, clonal (PFGE, MLST) and plasmid (S1-PFGE, I-CeuI-PFGE, replicon typing, hybridization) analysis. Isolates produced mostly CTX-M-15 (47%) or SHV-12 (30%), and less frequently other SHV- (15%; SHV-2, -5, -28, -55, -106) or TEM- (9%; TEM-10, -24, -199)-types, with marked local and temporal variations. The increase of CTX-M-15 and diverse SHV ESBL-types observed in Hospital A was associated with the amplification of multidrug-resistant (MDR) K. pneumoniae epidemic clones (ST15, ST147, ST336). SHV-12 and TEM-type ESBLs were mostly identified in diverse isolates of different Enterobacteriaceae species in Hospitals B and C in 2006-7. Particular plasmid types were linked to blaCTX-M-15 (IncR or non-typeable plasmids), blaSHV-12 (IncR or IncHI2), blaSHV-28/-55/-106 (IncFIIK1 or IncFIIK5), blaTEM-10 (IncL/M) or blaTEM-24 (IncA/C), mostly in epidemic clones. In our country, the amplification of CTX-M-15 and diverse SHV-type ESBL among non-E. coli Enterobacteriaceae is linked to international MDR K. pneumoniae clones (ST15, ST147, ST336) and plasmid types (IncR, IncFIIK). Furthermore, we highlight the potential of IncFIIK plasmids (here firstly associated with blaSHV-2/-28/-55/-106) to disseminate as antibiotic resistance plasmids. PMID:25190354

Rodrigues, Carla; Machado, Elisabete; Ramos, Helena; Peixe, Luísa; Novais, Ângela

2014-11-01

197

Genetic control of arylsulfatase synthesis in Klebsiella aerogenes.  

PubMed

It was shown that at least four genes are specifically responsible for arylsulfatase synthesis in Klebsiella aerogenes. Mutations at chromosome site atsA result in enzymatically inactive arylsulfatase. Mutants showing constitutive synthesis of arylsulfatase (atsR) were isolated by using inorganic sulfate or cysteine as the sulfur source. Another mutation in which repression of arylsulfatase by inorganic sulfate or cysteine could not be relieved by tyramine was determined by genetic analysis to be on the tyramine oxidase gene (tyn). This site was distinguished from the atsC mutation site, which is probably concerned with the action or synthesis of corepressors of arylsulfatase synthesis. Genetic analysis with transducing phage PW52 showed that the order of mutation sites was atsC-atsR-atsA-tynA-tynB. On the basis of these results and previous physiological findings, we propose a new model for regulation of arylsulfatase synthesis. PMID:853036

Murooka, Y; Adachi, T; Okamura, H; Harada, T

1977-04-01

198

Genetic control of arylsulfatase synthesis in Klebsiella aerogenes.  

PubMed Central

It was shown that at least four genes are specifically responsible for arylsulfatase synthesis in Klebsiella aerogenes. Mutations at chromosome site atsA result in enzymatically inactive arylsulfatase. Mutants showing constitutive synthesis of arylsulfatase (atsR) were isolated by using inorganic sulfate or cysteine as the sulfur source. Another mutation in which repression of arylsulfatase by inorganic sulfate or cysteine could not be relieved by tyramine was determined by genetic analysis to be on the tyramine oxidase gene (tyn). This site was distinguished from the atsC mutation site, which is probably concerned with the action or synthesis of corepressors of arylsulfatase synthesis. Genetic analysis with transducing phage PW52 showed that the order of mutation sites was atsC-atsR-atsA-tynA-tynB. On the basis of these results and previous physiological findings, we propose a new model for regulation of arylsulfatase synthesis. PMID:853036

Murooka, Y; Adachi, T; Okamura, H; Harada, T

1977-01-01

199

Metabolism of benzonitrile and butyronitrile by Klebsiella pneumoniae.  

PubMed Central

A strain of Klebsiella pneumoniae that used aliphatic nitriles as the sole source of nitrogen was adapted to benzonitrile as the sole source of carbon and nitrogen. Gas chromatographic and mass spectral analyses of culture filtrates indicated that K. pneumoniae metabolized 8.4 mM benzonitrile to 4.0 mM benzoic acid and 2.7 mM ammonia. In addition, butyronitrile was metabolized to butyramide and ammonia. The isolate also degraded mixtures of benzonitrile and aliphatic nitriles. Cell extracts contained nitrile hydratase and amidase activities. The enzyme activities were higher with butyronitrile and butyramide than with benzonitrile and benzamide, and amidase activities were twofold higher than nitrile hydratase activities. K. pneumoniae appears promising for the bioremediation of sites contaminated with aliphatic and aromatic nitriles. PMID:1539979

Nawaz, M S; Heinze, T M; Cerniglia, C E

1992-01-01

200

Antibiotic Resistance Related to Biofilm Formation in Klebsiella pneumoniae  

PubMed Central

The Gram-negative opportunistic pathogen, Klebsiella pneumoniae, is responsible for causing a spectrum of community-acquired and nosocomial infections and typically infects patients with indwelling medical devices, especially urinary catheters, on which this microorganism is able to grow as a biofilm. The increasingly frequent acquisition of antibiotic resistance by K. pneumoniae strains has given rise to a global spread of this multidrug-resistant pathogen, mostly at the hospital level. This scenario is exacerbated when it is noted that intrinsic resistance to antimicrobial agents dramatically increases when K. pneumoniae strains grow as a biofilm. This review will summarize the findings about the antibiotic resistance related to biofilm formation in K. pneumoniae. PMID:25438022

Vuotto, Claudia; Longo, Francesca; Balice, Maria Pia; Donelli, Gianfranco; Varaldo, Pietro E.

2014-01-01

201

Molybdenum accumulation and storage in Klebsiella pneumoniae and Azotobacter vinelandii.  

PubMed Central

In Klebsiella pneumoniae, Mo accumulation appeared to be coregulated with nitrogenase synthesis. O2 and NH+4, which repressed nitrogenase synthesis, also prevented Mo accumulation. In Azotobacter vinelandii, Mo accumulation did not appear to be regulated Mo was accumulated to levels much higher than those seen in K. pneumoniae even when nitrogenase synthesis was repressed. Accumulated Mo was bound mainly to a Mo storage protein, and it could act as a supply for the Mo needed in component I synthesis when extracellular Mo had been exhausted. When A. vinelandii was grown in the presence of WO2-(4) rather than MoO2-(4), it synthesized a W-containing analog of the Mo storage protein. The Mo storage protein was purified from both NH+4 and N2-grown cells of A. vinelandii and found to be a tetramer of two pairs of different subunits binding a minimum of 15 atoms of Mo per tetramer. Images PMID:7007348

Pienkos, P T; Brill, W J

1981-01-01

202

Klebsiella pneumoniae liver abscess in an immunocompetent child  

PubMed Central

Klebsiella pneumoniae has emerged as a leading pathogen that causes pyogenic liver abscesses (PLAs) in Korea. K. pneumoniae liver abscess (KLA) is potentially life threatening, and the diagnosis is difficult. In developed countries, PLA is rarely observed in children and is frequently associated with disorders of granulocyte function and previous abdominal infection. We observed a case of KLA in a healthy 12-year-old boy. To our knowledge, this is the first reported case of KLA in an immunocompetent child without an underlying disease in Korea. The patient was treated with percutaneous catheter drainage and antibiotics. The catheter was placed in the intrahepatic abscess for 3 weeks and parenteral antibiotics (ceftriaxone and amikacin) were administered for 4 weeks, followed by oral antibiotics (cefixime) for 2 weeks. We reported this case to raise awareness of KLA in immunocompetent children among physicians, and to review the diagnosis, risk factors, potential complications, and appropriate treatment of KLA. PMID:24223603

Kwon, Jang-Mi; Shim, Jae Won; Kim, Deok Soo; Shim, Jung Yeon; Park, Moon Soo

2013-01-01

203

Metabolism of benzonitrile and butyronitrile by Klebsiella pneumoniae  

SciTech Connect

A strain of Klebsiella pneumoniae that used aliphatic nitriles as the sole source of nitrogen was adapted to benzonitrile as the sole source of carbon and nitrogen. Gas chromatographic and mass spectral analyses of culture filtrates indicated that K. pneumoniae metabolized 8.4 mM benzonitrile to 4.0 mM benzoic acid and 2.7 mM ammonia. In addition, butyronitrile was metabolized to butyramide and ammonia. The isolate also degraded mixtures of benzonitrile and aliphatic nitriles. Cell extracts contained nitrile hydratase and amidase activities. The enzyme activities were higher with butyronitrile and butyramide than with benzonitrile and benzamide, and amidase activities were twofold higher than nitrile hydratase activities. K. pneumoniae appears promising for the bioremediation of sites contaminated with aliphatic and aromatic nitriles.

Nawaz, M.S.; Heinze, T.M.; Cerniglia, C.E. (Food and Drug Administration, Jefferson, AK (United States))

1992-01-01

204

Characterization of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae from Riyadh, Saudi Arabia.  

PubMed

The objectives of this study were to determine the prevalences, genotypes, and clonal relationships of extended-spectrum beta-lactamase (ESBL)-producing strains in 98 Klebsiella pneumoniae isolates from Riyadh. The prevalence of ESBLs in these strains was 37·75%. All isolates that were confirmed to have ESBLs were completely resistant to amoxicillin/clavulanate, aztreonam, cefotaxime, ceftazidime, cefoxitin, and gentamicin and were susceptible to tigecycline, colistin, and imipenem. In total, 16·6, 77, and 91·6% of isolates were resistant to amikacin, ciprofloxacin, and piperacillin/tazobactam, respectively. The prevalences of isolates producing the beta-lactamases SHV, CTX-M, and TEM were 91·9, 86·5, and 54·05%, respectively. The most frequent ESBL gene detected was blaCTX-M-15, which was observed in 75% of isolates. Other frequent ESBL genes were blaSHV-12 (29·73% of isolates) and blaSHV-5 (5·4% of isolates); additionally, blaCTX-M-3, blaCTX-M-27, blaCTX-M-57, and blaCTX-M-82 were each detected in one isolate. Pulsed-field gel electrophoresis (PFGE) analysis revealed the presence of diverse and unrelated clones. The high prevalence of ESBL producers among the strains examined in our study was not due to the spread of a single clone of bacteria. Clone A was detected in six isolates, indicating intra-hospital spread. Our study documented a high prevalence of the CTX-M-15 product in K. pneumoniae and demonstrated that SHV-12 was also highly prevalent. This study represents the first report of CTX-M-3, CTX-M-27, CTX-M-57, and CTX-M-82 beta-lactamases in K. pneumoniae isolates from Saudi Arabia. PMID:24091155

Al-Qahtani, Ahmed A; Al-Agamy, Mohamed H; Ali, Mohamed S; Al-Ahdal, Mohammad N; Aljohi, Mohammad A; Shibl, Atef M

2014-06-01

205

Characterization of Type 2 Quorum Sensing in Klebsiella pneumoniae and Relationship with Biofilm Formation  

PubMed Central

Quorum sensing is a process by which bacteria communicate by using secreted chemical signaling molecules called autoinducers. Many bacterial species modulate the expression of a wide variety of physiological functions in response to changes in population density by this mechanism. In this study, the opportunistic pathogen Klebsiella pneumoniae was observed to secrete type 2 signaling molecules. A homologue of luxS, the gene required for AI-2 synthesis in Vibrio harveyi, was isolated from the K. pneumoniae genome. A V. harveyi bioassay showed the luxS functionality in K. pneumoniae and its ability to complement the luxS-negative phenotype of Escherichia coli DH5?. Autoinducer activity was detected in the supernatant, and maximum expression of specific messengers detected by quantitative reverse transcription-PCR analysis occurred during the late exponential phase. The highest levels of AI-2 were observed in minimal medium supplemented with glycerol. To determine the potential role of luxS in colonization processes, a K. pneumoniae luxS isogenic mutant was constructed and tested for its capacity to form biofilms in vitro on an abiotic surface and to colonize the intestinal tract in a murine model. No difference was observed in the level of intestinal colonization between the wild-type strain and the luxS mutant. Microscopic analysis of biofilm structures revealed that the luxS mutant was able to form a mature biofilm but with reduced capacities in the development of microcolonies, mostly in the early steps of biofilm formation. These data suggest that a LuxS-dependent signal plays a role in the early stages of biofilm formation by K. pneumoniae. PMID:15805533

Balestrino, Damien; Haagensen, Janus A. J.; Rich, Chantal; Forestier, Christiane

2005-01-01

206

Sialic acid involved in hypermucoviscosity phenotype of Klebsiella pneumoniae and associated with resistance to neutrophil phagocytosis.  

PubMed

Klebsiella pneumoniae (KP) with the hypermucoviscosity (HV) phenotype has abundant capsular polysaccharides (CPS) and usually causes an invasive syndrome. Sialic acid (Sia), a component of CPS in KP strains with the HV phenotype, may be anti-phagocytic. Sia-binding immunoglobulin-like lectin-9 (Siglec-9) act as an MHC class-I receptor on neutrophils that recognizes Sia and sends a signal to dampen inflammatory response. Three clinical KP strains with KP-M1 (HV-positive; capsular serotype K1), KP-14 (HV-negative; capsular serotype non-K1/K2), and DT-X (HV-negative; capsular serotype K1) were studied. We assessed total Sia in CPS extracts using enzymatic methods and phagocytosis by neutrophils of neuraminidase-treated bacteria using flow cytometry. Neutrophil killing was evaluated in the presence and absence of antibodies against Siglec-9. The concentration of Sia was significantly higher in the CPS extract of KP-M1 (56.75 ± 6.75 ?mole/10(9) cfu) than in the CPS extract of KP-14 (0.02 ± 0.01 ?mole/10(9) cfu) and DT-X (a negligible value). The KP-M1 (compared with the KP-14 and DT-X) was more resistant to neutrophil phagocytosis. Both the HV phenotype and resistance to phagocytosis of KP-M1 were significantly decreased after Sia removal with neuraminidase treatment. Fluorescence microscopy with an antibody against human Siglec-9 showed attachment of KP-M1 (but were absent of KP-14 and DT-X) to the surface of neutrophils and colocalization with human Siglec-9. Engagement of Siglec-9 via Sia enhanced neutrophils killing of KP-M1 by ex vivo human neutrophils bactericidal activity assay. The result showed that Sia might be a constituent of KP-M1 CPS responsible for HV, thereby contributing to anti-phagocytic activity of this pathogen. PMID:25098744

Lee, Chen-Hsiang; Chang, Chia-Chi; Liu, Jien-Wei; Chen, Rong-Fu; Yang, Kuender D

2014-08-15

207

Activation of IFN-?/STAT/IRF-1 in Hepatic Responses to Klebsiella pneumoniae Infection  

PubMed Central

Background Klebsiella pneumoniae-caused liver abscess (KLA) has become a health problem in Taiwan and is continually reported in other countries. Diabetes mellitus, the most common metabolic disorder, underlies half of the KLA patients in Taiwan. The clinical impact of KLA has been well-documented. Nevertheless, the molecular basis regarding how K. pneumoniae causes liver infection, particularly in diabetic individuals, remains unclear. Methodology/Principle Findings Auto-bioluminescence-expressing K. pneumoniae was inoculated into diabetic mice and age-match naïve control. With the use of in vivo imaging system, translocation of the bioluminescence-expressing K. pneumoniae from intestine to extraintestinal organs, mainly the liver, was noted in 80% of the diabetic mice, whereas the same bacteria causes extraintestinal infections in only 31% of naïve mice. Besides increased morbidity, the severity of hepatic tissue injury was also enhanced in the K. pneumoniae-infected diabetic mice. Upon K. pneumoniae infection, IFN-? production was significantly evoked in the liver. To mediate IFN-? signal, STAT (signal transducers and activators of transcription) 1 and 3 were activated in hepatocytes, and so was the expression of IRF (interferon regulatory factor)-1. Moreover, accumulation of neutrophils which was triggered by prolonged production of IL-1? and MIP-2, and significant increases in the level of active caspase 3 and phospho-eIF2?, were exclusively revealed in the K. pneumoniae-infected diabetic mice. Conclusion The activation of IFN-?/STAT/IRF-1 signaling demonstrated by this work emphasizes the role of IFN-? for mediating the hepatic response to K. pneumoniae infection. PMID:24223208

Lin, Yi-Chun; Lu, Min-Chi; Lin, Chingju; Chiang, Ming-Ko; Jan, Ming-Shiou; Tang, Hui-Ling; Liu, Hsu-Chung; Lin, Wea-Lung; Huang, Chih-Yang; Chen, Chuan-Mu; Lai, Yi-Chyi

2013-01-01

208

Molecular characterization of clinical multidrug-resistant Klebsiella pneumoniae isolates  

PubMed Central

Background Klebsiella pneumoniae is a frequent nosocomial pathogen, with the multidrug-resistant (MDR) K. pneumoniae being a major public health concern, frequently causing difficult-to-treat infections worldwide. The aim of this study was to investigate the molecular characterization of clinical MDR Klebsiella pneumoniae isolates. Methods A total of 27 non-duplicate MDR K. pneumoniae isolates with a CTX-CIP-AK resistance pattern were investigated for the prevalence of antimicrobial resistance genes including extended spectrum ?-lactamase genes (ESBLs), plasmid-mediated quinolone resistance (PMQR) genes, 16S rRNA methylase (16S-RMTase) genes, and integrons by polymerase chain reaction (PCR) amplification and DNA sequencing. Plasmid replicons were typed by PCR-based replicon typing (PBRT). Multi-locus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE) were carried out to characterize the strain relatedness. Results All the isolates co-harbored 3 or more resistance determinants. OqxAB, CTX-M-type ESBLs and RmtB were the most frequent determinants, distributed among19 (70.4%),18 (66.7%) and 8 (29.6%) strains. Fourteen isolates harbored class 1 integrons, with orfD-aacA4 being the most frequent gene cassette array. Class 3 integrons were less frequently identified and contained the gene cassette array of blaGES-1-blaOXA-10-aac(6?)-Ib. IncFII replicon was most commonly found in this collection. One cluster was observed with ?80% similarity among profiles obtained by PFGE, and one sequence type (ST) by MLST, namely ST11, was observed in the cluster. Conclusion K. pneumoniae carbapenemase (KPC)–producing ST11 was the main clone detected. Of particular concern was the high prevalence of multiple resistance determinants, classs I integrons and IncFII plasmid replicon among these MDR strains, which provide advantages for the rapid development of MDR strains. PMID:24884610

2014-01-01

209

A single medium for the isolation of acetylene-reducing (dinitrogen-fixing) bacteria from soils.  

PubMed

A single medium, containing standard basal salts and three common carbon sources (sucrose, mannitol, and sodium lactate) is proposed to replace nitrogen-free media in common use for isolating dinitrogen-fixing bacteria. Eight commonly isolated genera of dinitrogen-fixing bacterial exhibited growth on this combined carbon medium that equalled or bettered growth on other carbon-containing media. Combined carbon medium also yielded the highest counts of putative dinitrogen-fixing bacteria from three southern Alberta soils. A survey of the bacteria isolated aerobically from the Burdett soil on combined carbon agar indicated that, at higher dilutions, 75% of the isolates exhibited acetylene reduction. These bacteria were identified as Azospirillum spp., Bacillus polymyxa, B. macerans, Klebsiella pneumoniae, Erwinia herbicola, and Enterobacter cloacae. The inclusion of yeast extract in combined carbon medium is considered essential to supply organic growth factors and may supply "starter" nitrogen that promotes growth without inhibiting acetylene reduction. PMID:7214234

Rennie, R J

1981-01-01

210

Correlation of Klebsiella pneumoniae Comparative Genetic Analyses with Virulence Profiles in a Murine Respiratory Disease Model  

E-print Network

Klebsiella pneumoniae is a bacterial pathogen of worldwide importance and a significant contributor to multiple disease presentations associated with both nosocomial and community acquired disease. ATCC 43816 is a well-studied ...

Fodah, Ramy A.

211

Presence of Nitrogen Fixing Klebsiella pneumoniae in the gut of the Formosan Subterranean Termite (Coptotermes formosanus)  

Technology Transfer Automated Retrieval System (TEKTRAN)

A gram-negative facultative anaerobic enteric bacterium, Klebsiella pneumoniae was isolated from the hindgut of the Formosan subterranean termite (FST). It was characterized using, Fatty acid methyl ester (FAME) analysis, BIOLOG assay, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-...

212

Studies on N 2 -fixing bacteria associated with the salt-tolerant grass, Leptochloa fusca (L.) Kunth  

Microsoft Academic Search

Summary N2-fixing bacteria were isolated from the rhizosphere of naturally grown salt tolerant grass (Leptochloa fusca). A broad spectrum of diazotrophs was found to be associated with the roots ofL. fusca. the systematic position of the three isolates, NIAB-1, C-2 and Iso-2 was determined by morphological, biochemical and mol % (G+C) DNA contents. Two isolates were identified asKlebsiella pneumoniae (NIAB-1)

Y. Zafar; K. A. Malik; E. G. Niemann

1987-01-01

213

Biodegradation of Chlorimuron-ethyl by the Bacterium Klebsiella jilinsis 2N3  

Microsoft Academic Search

Enrichment culturing of sludge taken from an industrial wastewater treatment pond led to the identification of a bacterium (Klebsiella jilinsis H. Zhang) that degrades chlorimuron-ethyl with high efficiency. Klebsiella jilinsis strain 2N3 grows with chlorimuron-ethyl as the sole nitrogen source at the optimal temperature range of 30–35°C and pH values between 6.0–7.0. In liquid medium, the degradation activity was further

Hao Zhang; Xianghui Zhang; Wenhui Mu; Jiaxiu Wang; Hongyu Pan; Yu Li

2010-01-01

214

2-Microglobulin-Dependent Bacterial Clearance and Survival during Murine Klebsiella pneumoniae Bacteremia  

Microsoft Academic Search

Klebsiella pneumoniae is a leading cause of both community-acquired and nosocomial gram-negative bacterial pneumonia. A significant clinical complication of Klebsiella pulmonary infections is peripheral blood dissem- ination, resulting in a systemic infection concurrent with the localized pulmonary infection. We report here on the critical importance of 2-microglobulin expression during murine K. pneumoniae bacteremia. 2-Micro- globulin knockout mice displayed significantly increased

Anna L. Cogen; Thomas A. Moore

2009-01-01

215

Infected Hydatid Cysts Bacteria in Slaughtered Livestock and Their Effects on Protoscoleces Degeneration  

PubMed Central

Background: The protoscoleces of fertile hydatid cysts are considered as major risks in surgery and producing secondary cysts if rupture the cyst during operation and, cause infecting the dogs with adult worm if eaten by this animal. Bacterial infection of the hydatid fluid can lead to sterilization of the cyst. Objectives: The aim of this study was to determine the bacterial infection rate of livestock hydatid cysts in Hamedan, Iran, and test the isolated bacteria effects on viable protoscoleces, in vitro. Materials and Methods: A total of 5709 slaughtered livestock were inspected to detect the presence of hydatid cysts. The hydatid fluid of all cysts was cultured separately to isolate and identify the bacteria. The effect of isolated bacteria was tested on viable protoscoleces in culture tubes, in vitro. The culture tubes were observed and examined under a light microscope every two hours for 24 hours, and then, after 36 and 48 hours. Results: Infected cysts were found in 74% of animals in Hamedan (46% were calcified and the bacteria was isolated from 52%) and 62% in Borujerd. The isolated bacteria in the infected cysts were as follows: Escherichia coli, E. blattae, Klebsiella pnoumoniae, Proteus mirabilis, Enterobacter aerogenes, coagulase-positive and coagulase-negative Staphylococci, Pseudomonas aeruginosa and Edwardsiella tarda. The protoscoleces incubated with the isolated bacteria totally degenerated, but 55% of the protoscoleces in the control groups were intact and viable even after one week. Conclusions: This study indicated a high percentage of cysts bacterial infections in two provinces of Iran. The common isolated bacteria were E. coli and Klebsiella. The isolated bacteria degenerated the protoscoleces during short-time incubation, in vitro. PMID:25371792

Fallah, Mohammad; Kavand, Abdollah; Yousefi Mashouf, Rasoul

2014-01-01

216

Nitrogenase Activity (Acetylene Reduction) of Root-Associated, Cold-Climate Azospirillum, Enterobacter, Klebsiella, and Pseudomonas Species During Growth on Various Carbon Sources and at Various Partial Pressures of Oxygen  

PubMed Central

A comprehensive view of the diazotrophic bacterial flora of plants requires that attention be paid to the appropriate carbon and oxygen requirements during isolation of the bacteria. Twenty compounds (monosaccharides, disaccharides, polyols, and organic acids) were therefore examined as carbon and energy sources for nitrogenase activity in semisolid stab cultures at pO2 values of 0.21, 0.02, and ?0.002 with 12 strains of diazotrophic root-associated bacteria. With the facultatively anaerobic bacteria of the genera Klebsiella and Enterobacter, the best substrate was sucrose, followed by fructose and mannitol, whereas among the organic acids, only malic and fumaric acids supported any activity. With the obligately aerobic bacteria of the genera Azospirillum and Pseudomonas, disaccharides were not utilized for nitrogen fixation, but several organic acids were accepted in addition to monosaccharides and polyols; malate and glucose were the best substrates. The patterns of the carbon sources utilized for nitrogen fixation were coherent within the species, with the exception of one Klebsiella pneumoniae and one Enterobacter agglomerans strain, both isolated from the same individual grass plant, which were unable to utilize lactose. Anaerobic conditions (pO2 value of ?0.002) were required for maximum nitrogenase activity with the facultatively anaerobic bacteria, with the exception of one strain of E. agglomerans, which required atmospheric oxygen (pO2 value of 0.21). Also, the obligately aerobic diazotrophs required atmospheric oxygen for maximum nitrogenase activity. The maximum specific nitrogenase activities (expressed as micromoles of C2H4 · milligram of bacterial protein?1 · hour?1) noted during the exponential growth phase of the bacteria were the following: 2.68 with Azospirillum lipoferum on malate, 2.41 with K. pneumoniae and 1.58 with E. agglomerans on sucrose, and 0.95 with Pseudomonas sp. on malate. PMID:16346205

Haahtela, Kielo; Kari, Kirsti; Sundman, Veronica

1983-01-01

217

A NEW VARIANT OF FOOD POISONING: ENTEROINVASIVE KLEBSIELLA PNEUMONIAE AND ESCHERICHIA COLI SEPSIS FROM A CONTAMINATED HAMBURGER  

Microsoft Academic Search

For the first time, we report Klebsiella pneumoniae as an enteroinvasive food-borne pathogen transmitted from a hamburger. A 28-year-old previously healthy African-American male ingested a portion of a hamburger from a fast food chain. Symptoms of gastroenteritis rapidly deteriorated to multiorgan failure. Blood and hamburger cultures grew Escherichia coli and Klebsiella pneumoniae. Since Klebsiella had not previously been reported as

Julia M. Sabota; William L. Hoppes; J. Richard Ziegler; Herbert DuPont; John Mathewson; Gregory W. Rutecki

1998-01-01

218

A new variant of food poisoning: enteroinvasive Klebsiella pneumoniae and Escherichia coli sepsis from a contaminated hamburger  

Microsoft Academic Search

For the first time, we report Klebsiella pneumoniae as an enteroinvasive food-borne pathogen transmitted from a hamburger. A 28-year-old previously healthy African-American male ingested a portion of a hamburger from a fast food chain. Symptoms of gastroenteritis rapidly deteriorated to multiorgan failure. Blood and hamburger cultures grew Escherichia coli and Klebsiella pneumoniae. Since Klebsiella had not previously been reported as

Julia M. Sabota; William L. Hoppes; J. Richard Ziegler; Herbert DuPont; John Mathewson; Gregory W. Rutecki

1998-01-01

219

21 CFR 866.3340 - Klebsiella spp. serological reagents.  

Code of Federal Regulations, 2014 CFR

...identification aids in the diagnosis of diseases caused by bacteria belonging to the genus...epidemiological information on these diseases. These organisms can cause serious urinary tract and pulmonary infections, particularly in...

2014-04-01

220

21 CFR 866.3340 - Klebsiella spp. serological reagents.  

Code of Federal Regulations, 2013 CFR

...identification aids in the diagnosis of diseases caused by bacteria belonging to the genus...epidemiological information on these diseases. These organisms can cause serious urinary tract and pulmonary infections, particularly in...

2013-04-01

221

Gram-negative bacteria from the camel tick Hyalomma dromedarii (Ixodidae) and the chicken tick Argas persicus (Argasidae) and their antibiotic sensitivities.  

PubMed

A total of nine species of gram-negative bacteria were isolated from organs and haemolymph of the hard tick Hyalomma (Hyalomma) dromedarii and the soft tick Argas (Persicargas) persicus. Four species namely Serratia liquefaciens, Stenotrophomonas maltophilia, Klebsiella ornithinolytica and Aeromonas hydrophila were isolated from H. dromedarii and five species namely Rahnella aquatilis, Pseudomonas fluorescens, Enterobacter cloacae, Chryseomonas luteola and Chryseobacterium meningosepticum were isolated from A. persicus. Isolated bacteria were identified using the analytical profile index 20E. Disk diffusion test was carried out on all isolated bacteria to determine antibiotic sensitivity of chloramphenicol, amoxillin/clavulanic acid, neomycin, streptomycin, triplesulphur tetracycline and nitrofurantion. The results were discussed. PMID:15880998

Montasser, Ashraf A

2005-04-01

222

[Identification and biological characteristics of strains of psychrophilic bacteria isolated from the diarrhea of polar research workers and from the water of Antarctic lakes].  

PubMed

Bacteria of Klebsiella genus and psychrophylic microbes affiliated by morphological and biochemical properties to Bac. psychrosaccharolyticus were isolated in bacteriological examination of diarrhea in 8 of 14 participants of the 12th Soviet Antarctic expedition. Psychrophylic bacteria isolated from the human intestinal contents possessed pathogenicity signs, i.e. these microbes liquefied gelatine, produced a cytotoxic action in the cells line Hep-2, and caused death of 50% chick embryos in infection with a dose of 5 X 10(8) bacteria. PMID:726745

Dusmukhamedov, N S; Tashpulatov, R Iu; Bondarenko, V M; Pereverzev, N A

1978-11-01

223

L-Glutamine regulates amino acid utilization by intestinal bacteria.  

PubMed

Catabolism of amino acids (AA) by intestinal bacteria greatly affects their bioavailability in the systemic circulation and the health of animals and humans. This study tests the novel hypothesis that L-glutamine regulates AA utilization by luminal bacteria of the small intestine. Pure bacterial strains (Streptococcus sp., Escherichia coli and Klebsiella sp.) and mixed bacterial cultures derived from the jejunum or ileum of pigs were cultured in the presence of 0-5 mM L-glutamine under anaerobic conditions. After 3 h of incubation, samples were taken for the determination of AA utilization. Results showed concentration-dependent increases in the utilization of glutamine in parallel with the increased conversion of glutamine into glutamate in all the bacteria. Complete utilization of asparagine, aspartate and serine was observed in pure bacterial strains after the 3-h incubation. The addition of glutamine reduced the net utilization of asparagine by both jejunal and ileal mixed bacteria. Net utilization of lysine, leucine, valine, ornithine and serine by jejunal or ileal mixed bacteria decreased with the addition of glutamine in a concentration-dependent manner. Collectively, glutamine dynamically modulates the bacterial metabolism of the arginine family of AA as well as the serine and aspartate families of AA and reduced the catabolism of most AA (including nutritionally essential and nonessential AA) in jejunal or ileal mixed bacteria. The beneficial effects of glutamine on gut nutrition and health may involve initiation of the signaling pathways related to AA metabolism in the luminal bacteria of the small intestine. PMID:22451274

Dai, Zhao-Lai; Li, Xi-Long; Xi, Peng-Bin; Zhang, Jing; Wu, Guoyao; Zhu, Wei-Yun

2013-09-01

224

Rapid genotyping of Achromobacter xylosoxidans, Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa and Stenotrophomonas maltophilia isolates using melting curve analysis of RAPD-generated DNA fragments (McRAPD).  

PubMed

Typing of bacteria is important for monitoring newly emerging pathogens and for examining local outbreaks. We evaluated the randomly amplified polymorphic DNA technique in combination with melting curve analysis (McRAPD) of the amplified DNA fragments to genotype isolates from five Gram-negative species, i.e. Achromobacter xylosoxidans, Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa and Stenotrophomonas maltophilia. By determining the melting temperature peaks of the amplified DNA fragments, we were able to distinguish the different genotypes of isolates, as they had been assessed by other genotyping techniques, i.e. agarose gel electrophoresis of RAPD fragments, multilocus sequence typing and/or AFLP™. According to our results, McRAPD may offer the possibility of genotyping a limited number of bacterial isolates, e.g. in case of suspicion of hospital outbreak, via a less costly, more rapid, less laborious and more user-friendly technique than RAPD followed by electrophoresis. PMID:21320595

Deschaght, Pieter; Van Simaey, Leen; Decat, Ellen; Van Mechelen, Els; Brisse, Sylvain; Vaneechoutte, Mario

2011-05-01

225

Bacteria isolated from amoebae/bacteria consortium  

DOEpatents

New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

Tyndall, Richard L. (Clinton, TN)

1995-01-01

226

Bacteria isolated from amoebae/bacteria consortium  

DOEpatents

New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

Tyndall, R.L.

1995-05-30

227

Bacteria Inactivation During Lithotripsy  

NASA Astrophysics Data System (ADS)

The influence of extracorporeal and intracorporeal lithotripsy on the viability of bacteria contained inside artificial kidney stones was investigated in vitro. Two different bacteria were exposed to the action of one extracorporeal shock wave generator and four intracorporeal lithotripters.

del Sol Quintero, María; Mora, Ulises; Gutiérrez, Jorge; Mues, Enrique; Castaño, Eduardo; Fernández, Francisco; Loske, Achim M.

2006-09-01

228

Bleach vs. Bacteria  

MedlinePLUS

... Articles | Inside Life Science Home Page Bleach vs. Bacteria By Sharon Reynolds Posted April 2, 2014 Your ... hypochlorous acid to help kill invading microbes, including bacteria. Researchers funded by the National Institutes of Health ...

229

On the amine oxidases of Klebsiella aerogenes strain W70.  

PubMed

Klebsiella aerogenes W70 was reported previously to produce a membrane-associated tyramine oxidase (TynA) that did not act on 2-phenylethylamine. Subsequently, a gene cloned from K. aerogenes W70 produced a soluble amine oxidase (MaoA) that acted readily on 2-phenylethylamine and tyramine. This enzyme appeared to be equivalent to a 2-phenylethylamine oxidase of Escherichia coli K-12 (MaoA) but was assumed to be the originally described K. aerogenes W70 tyramine oxidase (TynA). However, as described here, whole cells and cell-free extracts of K. aerogenes W70 showed only the tyramine oxidase (TynA) that is inactive against 2-phenylethylamine and not the maoA gene product. It seems that the organism has two amine oxidase genes, tynA and maoA, but only tynA is expressed. Hence, data relating to the expression of the K. aerogenes W70 tynA gene cannot be assumed to apply to the maoA gene of E. coli K-12 because they encode different enzymes. PMID:8997710

Cooper, R A

1997-01-01

230

[Carbapenem-resistant Klebsiella pneumoniae following foreign travel].  

PubMed

This is the first report of 3 patients in whom carbapenemase-producing Klebsiella pneumoniae was identified in the Netherlands following foreign travel. They were a 55-year-old man who had undergone chemotherapy for lung cancer metastases, a 66-year-old woman and a 30-year-old man. The first patient was transferred from a Greek hospital; his isolate belonged to an epidemic clone (multilocus sequence type 258) with a KPC-2 carbapenemase gene. The patient died from pneumonia. The other two patients, who had been travelling around in India, were found to be colonised in the gasto-intestinal tract with different multiresistant K. pneumoniae isolates containing a New Delhi metallo-carbapenemase gene (NDM-1). The rapid emergence and dissemination of Enterobacteriaceae resistant to carbapenems such as imipenem and meropenem poses a considerable threat to clinical patient care and public health. Carbapenemase-producing strains are characterized by resistance to nearly all available beta-lactam antibiotics including cephalosporins and carbapenems. These strains are often also resistant to other classes of antibiotics. Invasive infections by these strains are associated with high morbidity and mortality rates. Adequate microbiological laboratory detection and infection control measures in hospital are pivotal to preventing dissemination in the Dutch healthcare setting. PMID:20858323

Leverstein-van Hall, Maurine A; Stuart, James Cohen; Voets, Guido M; Versteeg, Dik; Roelofsen, Evelien; Fluit, Ad C

2010-01-01

231

Properties of Klebsiella phage P13 and associated exopolysaccharide depolymerase  

NASA Astrophysics Data System (ADS)

The bacteriophage P13 that infects Klebsiella serotype K13 contains a heat-stable depolymerase capable of effective degradation of exopolysaccharide (EPS) produced by this microorganism. In this study, the titer of phage P13, initially 2.0 × 107 pfu mL-1, was found increasing 20 min after infection and reached 5.0 × 109 pfu mL-1 in 60 min. Accordingly, the enzyme activity of depolymerase approached the maximum 60 min after infection. Treatment at 70°C for 30 min inactivated all the phage, but retained over 90% of the depolymerase activity. Addition of acetone into the crude phage lysate led to precipitation of the protein, with a marked increase in bacterial EPS degradation activity and a rapid drop in the titer of phage. After partial purification by acetone precipitation and ultrafiltration centrifugation, the enzyme was separated from the phage particles, showing two components with enzyme activity on Q-Sepharose Fast Flow. The soluble enzyme had an optimum degradation activity at 60°C and pH 6.5. Transmission electron microscopy demonstrated that the phage P13 particles were spherical with a diameter of 50 nm and a short stumpy tail. It was a doublestrand DNA virus consisting of a nucleic acid molecule of 45976 bp. This work provides an efficient purification operation including thermal treatment and ultrafiltration centrifugation, to dissociate depolymerase from phage particles. The characterization of phage P13 and associated EPS depolymerase is beneficial for further application of this enzyme.

Liu, Yang; Li, Guiyang; Mo, Zhaolan; Chai, Zihan; Shang, Anqi; Mou, Haijin

2013-11-01

232

CRYSTAL STRUCTURE ANALYSIS OF A PUTATIVE OXIDOREDUCTASE FROM KLEBSIELLA PNEUMONIAE  

SciTech Connect

Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) at Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.

Baig, M.; Brown, A.; Eswaramoorthy, S.; Swaminathan, S.

2009-01-01

233

Structural and Mechanical Properties of Klebsiella pneumoniae Type 3 Fimbriae? §  

PubMed Central

This study investigated the structural and mechanical properties of Klebsiella pneumoniae type 3 fimbriae, which constitute a known virulence factor for the bacterium. Transmission electron microscopy and optical tweezers were used to understand the ability of the bacterium to survive flushes. An individual K. pneumoniae type 3 fimbria exhibited a helix-like structure with a pitch of 4.1 nm and a three-phase force-extension curve. The fimbria was first nonlinearly stretched with increasing force. Then, it started to uncoil and extended several micrometers at a fixed force of 66 ± 4 pN (n = 22). Finally, the extension of the fimbria shifted to the third phase, with a characteristic force of 102 ± 9 pN (n = 14) at the inflection point. Compared with the P fimbriae and type 1 fimbriae of uropathogenic Escherichia coli, K. pneumoniae type 3 fimbriae have a larger pitch in the helix-like structure and stronger uncoiling and characteristic forces. PMID:21239584

Chen, Feng-Jung; Chan, Chia-Han; Huang, Ying-Jung; Liu, Kuo-Liang; Peng, Hwei-Ling; Chang, Hwan-You; Liou, Gunn-Guang; Yew, Tri-Rung; Liu, Cheng-Hsien; Hsu, Ken Y.; Hsu, Long

2011-01-01

234

Structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae  

PubMed Central

In most organisms, efficient d-galactose utilization requires the highly conserved Leloir pathway that converts d-galactose to d-glucose 1-phosphate. However, in some bacterial and fungal species alternative routes of d-galactose assimilation have been identified. In the so-called De Ley–Doudoroff pathway, d-galactose is metabolized into pyruvate and d-­glyceraldehyde 3-phosphate in five consecutive reactions carried out by specific enzymes. The penultimate step in this pathway involves the phosphorylation of 2-oxo-3-deoxygalactonate to 2-oxo-3-deoxygalactonate 6-phosphate catalyzed by 2-­oxo-3-deoxygalactonate kinase, with ATP serving as a phosphoryl-group donor. Here, a crystal structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae determined at 2.1?Å resolution is reported, the first structure of an enzyme from the De Ley–Doudoroff pathway. Structural comparison indicates that the enzyme belongs to the ASKHA (acetate and sugar kinases/hsc70/actin) family of phosphotransferases. The protein is composed of two ?/? domains, each of which contains a core common to all family members. Additional elements introduced between conserved structural motifs define the unique features of 2-oxo-3-deoxygalactonate kinase and possibly determine the biological function of the protein. PMID:21795809

Michalska, Karolina; Cuff, Marianne E.; Tesar, Christine; Feldmann, Brian; Joachimiak, Andrzej

2011-01-01

235

Communication in Bacteria  

Microsoft Academic Search

Bacteria communicate with one another using chemical signal molecules. As in higher organisms, the information supplied by these molecules is critical for synchronizing the activities of large groups of cells. In bacteria, chemical communication involves producing, re- leasing, detecting, and responding to small hormone-like molecules termed autoinducers. This process, termed quorum sensing, allows bacteria to monitor the environment for other

Christopher M. Waters; Bonnie L. Bassler

236

CHAPTER IV-2 BACTERIA  

Technology Transfer Automated Retrieval System (TEKTRAN)

Entomopathogenic bacteria provide an alternative to chemical pesticides used in insect control programs. Today, the principal microbial insecticides utilize spore forming bacteria or toxins produced by these bacteria as their active ingredients, either in formulations or by incorporation of toxin g...

237

Comparison of Biofilm and Attachment Mechanisms of a Phytopathological and Clinical Isolate of Klebsiella pneumoniae Subsp. pneumoniae  

PubMed Central

Some bacterial species can colonize humans and plants. It is almost impossible to prevent the contact of clinically pathogenic bacteria with food crops, and if they can persist there, they can reenter the human food chain and cause disease. On the leaf surface, microorganisms are exposed to a number of stress factors. It is unclear how they survive in such different environments. By increasing adhesion to diverse substrates, minimizing environmental differences, and providing protection against defence mechanisms, biofilms could provide part of the answer. Klebsiella pneumoniae subsp. pneumoniae is clinically important and also associated with fruit diseases, such as “pineapple fruit collapse.” We aimed to characterize biofilm formation and adhesion mechanisms of this species isolated from pineapple in comparison with a clinical isolate. No differences were found between the two isolates quantitatively or qualitatively. Both tested positive for capsule formation and were hydrophobic, but neither produced adherence fibres, which might account for their relatively weak adhesion compared to the positive control Staphylococcus epidermidis ATCC 35984. Both produced biofilms on glass and polystyrene, more consistently at 40°C than 35°C, confirmed by atomic force and high-vacuum scanning electron microscopy. Biofilm formation was maintained in an acidic environment, which may be relevant phytopathologically. PMID:24222755

Nicolau Korres, Adriana Marcia; Aquije, Gloria Maria de Farias V.; Buss, David S.; Ventura, Jose Aires; Fernandes, Patricia Machado Bueno; Fernandes, Antonio Alberto Ribeiro

2013-01-01

238

Effects of the hindlimb-unloading model of spaceflight conditions on resistance of mice to infection with Klebsiella pneumoniae  

NASA Technical Reports Server (NTRS)

BACKGROUND: It has been well documented in several studies that many immunologic parameters are altered in experimental animals and human subjects who have flown in space. However, it is not fully known whether these immunologic changes could result in increased susceptibility to infection. Hindlimb (antiorthostatic) unloading of rodents has been used successfully to simulate some of the effects of spaceflight on physiologic systems. OBJECTIVE: The objective of this study was to determine the effect of hindlimb unloading on the outcome of Klebsiella pneumoniae infection in mice. METHODS: Hindlimb-unloaded, hindlimb-restrained, and control mice were intraperitoneally infected with one 50% lethal dose of K pneumoniae 2 days after suspension. Mortality and bacterial load in several organs were compared among the groups. RESULTS: Unloaded mice showed significantly increased mortality and reduced mean time to death compared with that seen in the control groups. Kinetics of bacterial growth with smaller infective doses revealed that control mice were able to clear bacteria from the organs after 30 hours. In contrast, unloaded mice had continued bacterial growth at the same time point. CONCLUSION: The results of this study suggest that hindlimb unloading might enhance the dissemination of K pneumoniae, leading to increased mortality. The complex physiologic changes observed during hindlimb unloading, including stress, have a key role in the pathophysiology of this infection.

Belay, Tesfaye; Aviles, Hernan; Vance, Monique; Fountain, Kimberly; Sonnenfeld, Gerald

2002-01-01

239

Direct Detection and Genotyping of Klebsiella pneumoniae Carbapenemases from Urine by Use of a New DNA Microarray Test  

PubMed Central

Klebsiella pneumoniae carbapenemases (KPCs) are considered a serious threat to antibiotic therapy, as they confer resistance to carbapenems, which are used to treat extended-spectrum beta-lactamase (ESBL)-producing bacteria. Here, we describe the development and evaluation of a DNA microarray for the detection and genotyping of KPC genes (blaKPC) within a 5-h period. To test the whole assay procedure (DNA extraction plus a DNA microarray assay) directly from clinical specimens, we compared two commercial DNA extraction kits (the QIAprep Spin miniprep kit [Qiagen] and the urine bacterial DNA isolation kit [Norgen]) for the direct DNA extraction from urine samples (dilution series spiked in human urine). Reliable single nucleotide polymorphism (SNP) typing was demonstrated using 1 × 105 CFU/ml urine for Escherichia coli (Qiagen and Norgen) and 80 CFU/ml urine, on average, for K. pneumoniae (Norgen). This study presents, for the first time, the combination of a new KPC microarray with commercial sample preparation for detecting and genotyping microbial pathogens directly from clinical specimens; this paves the way toward tests providing epidemiological and diagnostic data, enabling better antimicrobial stewardship. PMID:23035190

Peter, Harald; Berggrav, Kathrine; Thomas, Peter; Pfeifer, Yvonne; Witte, Wolfgang; Templeton, Kate

2012-01-01

240

Multisystemic abscesses in African green monkeys (Chlorocebus aethiops) with invasive Klebsiella pneumoniae--identification of the hypermucoviscosity phenotype.  

PubMed

Invasive Klebsiella pneumoniae is an emerging disease of humans characterized by abscesses in the liver or other sites involving bacteria with the unique hypermucoviscosity phenotype. Over several months, 7 African green monkeys in our research colony developed abscess formation in multiple locations and succumbed to disease. K. pneumoniae was identified by bacterial culture in 6 monkeys and immunohistochemistry in 1 additional monkey. All monkeys had been housed in, or had contact with monkeys housed in, 1 animal room in our facility. All affected monkeys had 1 or more abscesses, most notably in the abdomen, but also affecting the lungs, cerebellum, and skin. Abdominal abscesses and associated adhesions entrapped loops of bowel, forming palpable masses. Abdominal masses were located at the root of the mesentery, the ileocecocolic junction, or the pelvic inlet. In 1 case, culture, serotyping, and polymerase chain reaction (PCR) analysis of the bacterial isolate identified K. pneumoniae expressing the hypermucoviscosity phenotype and capsular serotype K2 and determined that the K. pneumonia was genetically rmpA(+)/magA(-). PMID:18424839

Twenhafel, N A; Whitehouse, C A; Stevens, E L; Hottel, H E; Foster, C D; Gamble, S; Abbott, S; Janda, J M; Kreiselmeier, N; Steele, K E

2008-03-01

241

Screening of antibiotic susceptibility to ?-lactam-induced elongation of Gram-negative bacteria based on dielectrophoresis.  

PubMed

We demonstrate a rapid antibiotic susceptibility test (AST) based on the changes in dielectrophoretic (DEP) behaviors related to the ?-lactam-induced elongation of Gram-negative bacteria (GNB) on a quadruple electrode array (QEA). The minimum inhibitory concentration (MIC) can be determined within 2 h by observing the changes in the positive-DEP frequency (pdf) and cell length of GNB under the cefazolin (CEZ) treatment. Escherichia coli and Klebsiella pneumoniae and the CEZ are used as the sample bacteria and antibiotic respectively. The bacteria became filamentous due to the inhibition of cell wall synthesis and cell division and cell lysis occurred for the higher antibiotic dose. According to the results, the pdfs of wild type bacteria decrease to hundreds of kHz and the cell length is more than 10 ?m when the bacterial growth is inhibited by the CEZ treatment. In addition, the growth of wild type bacteria and drug resistant bacteria differ significantly. There is an obvious decrease in the number of wild type bacteria but not in the number of drug resistant bacteria. Thus, the drug resistance of GNB to ?-lactam antibiotics can be rapidly assessed. Furthermore, the MIC determined using dielectrophoresis-based AST (d-AST) was consistent with the results of the broth dilution method. Utilizing this approach could reduce the time needed for bacteria growth from days to hours, help physicians to administer appropriate antibiotic dosages, and reduce the possibility of the occurrence of multidrug resistant (MDR) bacteria. PMID:22404714

Chung, Cheng-Che; Cheng, I-Fang; Chen, Hung-Mo; Kan, Heng-Chuan; Yang, Wen-Horng; Chang, Hsien-Chang

2012-04-01

242

Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.  

PubMed

The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. PMID:24820641

Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching

2014-06-15

243

Multiplex Real-Time PCR Assay for Detection and Classification of Klebsiella pneumoniae Carbapenemase Gene (blaKPC) Variants?  

PubMed Central

Carbapenem resistance mediated by plasmid-borne Klebsiella pneumoniae carbapenemases (KPC) is an emerging problem of significant clinical importance in Gram-negative bacteria. Multiple KPC gene variants (blaKPC) have been reported, with KPC-2 (blaKPC-2) and KPC-3 (blaKPC-3) associated with epidemic outbreaks in New York City and various international settings. Here, we describe the development of a multiplex real-time PCR assay using molecular beacons (MB-PCR) for rapid and accurate identification of blaKPC variants. The assay consists of six molecular beacons and two oligonucleotide primer pairs, allowing for detection and classification of all currently described blaKPC variants (blaKPC-2 to blaKPC-11). The MB-PCR detection limit was 5 to 40 DNA copies per reaction and 4 CFU per reaction using laboratory-prepared samples. The MB-PCR probes were highly specific for each blaKPC variant, and cross-reactivity was not observed using DNA isolated from several bacterial species. A total of 457 clinical Gram-negative isolates were successfully characterized by our MB-PCR assay, with blaKPC-3 and blaKPC-2 identified as the most common types in the New York/New Jersey metropolitan region. The MB-PCR assay described herein is rapid, sensitive, and specific and should be useful for understanding the ongoing evolution of carbapenem resistance in Gram-negative bacteria. As novel blaKPC variants continue to emerge, the MB-PCR assay can be modified in response to epidemiologic developments. PMID:21123529

Chen, Liang; Mediavilla, José R.; Endimiani, Andrea; Rosenthal, Marnie E.; Zhao, Yanan; Bonomo, Robert A.; Kreiswirth, Barry N.

2011-01-01

244

Bacteria Are Everywhere!  

NSDL National Science Digital Library

Students are introduced to the concept of engineering biological organisms and studying their growth to be able to identify periods of fast and slow growth. They learn that bacteria are found everywhere, including on the surfaces of our hands. Student groups study three different conditions under which bacteria are found and compare the growth of the individual bacteria from each source. In addition to monitoring the quantity of bacteria from differ conditions, they record the growth of bacteria over time, which is an excellent tool to study binary fission and the reproduction of unicellular organisms.

AMPS GK-12 Program,

245

Antibiotic resistance and plasmid transfer capacity in biofilm formed with a CTX-M-15-producing Klebsiella pneumoniae isolate  

E-print Network

Klebsiella pneumoniae isolate Claire Hennequin1,2*, Claire Aumeran1,3, Fre´de´ric Robin2,4­7, Ousmane Traore1-producing Klebsiella pneumoniae isolate that was identified during an outbreak involving 16 patients who had. pneumoniae strain was notable for its ability to transfer its plasmid, especially in biofilm conditions

Paris-Sud XI, Université de

246

The Role of Klebsiella in Crohn's Disease with a Potential for the Use of Antimicrobial Measures  

PubMed Central

There is a general consensus that Crohn's disease (CD) develops as the result of immune-mediated tissue damage triggered by infections with intestinal microbial agents. Based on the results of existing microbiological, molecular, and immunological studies, Klebsiella microbe seems to have a key role in the initiation and perpetuation of the pathological damage involving the gut and joint tissues in patients with CD. Six different gastroenterology centres in the UK have reported elevated levels of antibodies to Klebsiella in CD patients. There is a relationship between high intake of starch-containing diet, enhanced growth of gut microbes, and the production of pullulanases by Klebsiella. It is proposed that eradication of these microbes by the use of antibiotics and low starch diet, in addition to the currently used treatment, could help in alleviating or halting the disease process in CD. PMID:24223596

Rashid, Taha; Ebringer, Alan; Wilson, Clyde

2013-01-01

247

Surveillance of carbapenem-resistant Klebsiella pneumoniae: tracking molecular epidemiology and outcomes through a regional network.  

PubMed

Carbapenem resistance in Gram-negative bacteria is on the rise in the United States. A regional network was established to study microbiological and genetic determinants of clinical outcomes in hospitalized patients with carbapenem-resistant (CR) Klebsiella pneumoniae in a prospective, multicenter, observational study. To this end, predefined clinical characteristics and outcomes were recorded and K. pneumoniae isolates were analyzed for strain typing and resistance mechanism determination. In a 14-month period, 251 patients were included. While most of the patients were admitted from long-term care settings, 28% of them were admitted from home. Hospitalizations were prolonged and complicated. Nonsusceptibility to colistin and tigecycline occurred in isolates from 7 and 45% of the patients, respectively. Most of the CR K. pneumoniae isolates belonged to repetitive extragenic palindromic PCR (rep-PCR) types A and B (both sequence type 258) and carried either blaKPC-2 (48%) or blaKPC-3 (51%). One isolate tested positive for blaNDM-1, a sentinel discovery in this region. Important differences between strain types were noted; rep-PCR type B strains were associated with blaKPC-3 (odds ratio [OR], 294; 95% confidence interval [CI], 58 to 2,552; P < 0.001), gentamicin nonsusceptibility (OR, 24; 95% CI, 8.39 to 79.38; P < 0.001), amikacin susceptibility (OR, 11.0; 95% CI, 3.21 to 42.42; P < 0.001), tigecycline nonsusceptibility (OR, 5.34; 95% CI, 1.30 to 36.41; P = 0.018), a shorter length of stay (OR, 0.98; 95% CI, 0.95 to 1.00; P = 0.043), and admission from a skilled-nursing facility (OR, 3.09; 95% CI, 1.26 to 8.08; P = 0.013). Our analysis shows that (i) CR K. pneumoniae is seen primarily in the elderly long-term care population and that (ii) regional monitoring of CR K. pneumoniae reveals insights into molecular characteristics. This work highlights the crucial role of ongoing surveillance of carbapenem resistance determinants. PMID:24798270

van Duin, David; Perez, Federico; Rudin, Susan D; Cober, Eric; Hanrahan, Jennifer; Ziegler, Julie; Webber, Raymond; Fox, Jacqueline; Mason, Pamela; Richter, Sandra S; Cline, Marianne; Hall, Geraldine S; Kaye, Keith S; Jacobs, Michael R; Kalayjian, Robert C; Salata, Robert A; Segre, Julia A; Conlan, Sean; Evans, Scott; Fowler, Vance G; Bonomo, Robert A

2014-07-01

248

Klebsiella pneumoniae Induces an Inflammatory Response in an In Vitro Model of Blood-Retinal Barrier  

PubMed Central

Klebsiella pneumoniae has become an important pathogen in recent years. Although most cases of K. pneumoniae endogenous endophthalmitis occur via hematogenous spread, it is not yet clear which microbial and host factors are responsible for the ability of K. pneumoniae to cross the blood-retinal barrier (BRB). In the present study, we show that in an in vitro model of BRB based on coculturing primary bovine retinal endothelial cells (BREC) and primary bovine retinal pericytes (BRPC), K. pneumoniae infection determines changes of transendothelial electrical resistance (TEER) and permeability to sodium fluorescein. In the coculture model, bacteria are able to stimulate the enzyme activities of endothelial cytosolic and Ca2+-independent phospholipase A2s (cPLA2 and iPLA2). These results were confirmed by the incremental expression of cPLA2, iPLA2, cyclo-oxygenase-1 (COX1), and COX2 in BREC, as well as by cPLA2 phosphorylation. In supernatants of K. pneumoniae-stimulated cocultures, increases in prostaglandin E2 (PGE2), interleukin-6 (IL-6), IL-8, and vascular endothelial growth factor (VEGF) production were found. Incubation with K. pneumoniae in the presence of arachidonoyl trifluoromethyl ketone (AACOCF3) or bromoenol lactone (BEL) caused decreased PGE2 and VEGF release. Scanning electron microscopy and transmission electron microscopy images of BREC and BRPC showed adhesion of K. pneumoniae to the cells, but no invasion occurred. K. pneumoniae infection also produced reductions in pericyte numbers; transfection of BREC cocultured with BRPC and of human retinal endothelial cells (HREC) cocultured with human retinal pericytes (HRPC) with small interfering RNAs (siRNAs) targeted to cPLA2 and iPLA2 restored the pericyte numbers and the TEER and permeability values. Our results show the proinflammatory effect of K. pneumoniae on BREC, suggest a possible mechanism by which BREC and BRPC react to the K. pneumoniae infection, and may provide physicians and patients with new ways of fighting blinding diseases. PMID:24478098

Motta, C.; Salmeri, M.; Anfuso, C. D.; Amodeo, A.; Scalia, M.; Toscano, M. A.; Giurdanella, G.; Alberghina, M.

2014-01-01

249

Surveillance of Carbapenem-Resistant Klebsiella pneumoniae: Tracking Molecular Epidemiology and Outcomes through a Regional Network  

PubMed Central

Carbapenem resistance in Gram-negative bacteria is on the rise in the United States. A regional network was established to study microbiological and genetic determinants of clinical outcomes in hospitalized patients with carbapenem-resistant (CR) Klebsiella pneumoniae in a prospective, multicenter, observational study. To this end, predefined clinical characteristics and outcomes were recorded and K. pneumoniae isolates were analyzed for strain typing and resistance mechanism determination. In a 14-month period, 251 patients were included. While most of the patients were admitted from long-term care settings, 28% of them were admitted from home. Hospitalizations were prolonged and complicated. Nonsusceptibility to colistin and tigecycline occurred in isolates from 7 and 45% of the patients, respectively. Most of the CR K. pneumoniae isolates belonged to repetitive extragenic palindromic PCR (rep-PCR) types A and B (both sequence type 258) and carried either blaKPC-2 (48%) or blaKPC-3 (51%). One isolate tested positive for blaNDM-1, a sentinel discovery in this region. Important differences between strain types were noted; rep-PCR type B strains were associated with blaKPC-3 (odds ratio [OR], 294; 95% confidence interval [CI], 58 to 2,552; P < 0.001), gentamicin nonsusceptibility (OR, 24; 95% CI, 8.39 to 79.38; P < 0.001), amikacin susceptibility (OR, 11.0; 95% CI, 3.21 to 42.42; P < 0.001), tigecycline nonsusceptibility (OR, 5.34; 95% CI, 1.30 to 36.41; P = 0.018), a shorter length of stay (OR, 0.98; 95% CI, 0.95 to 1.00; P = 0.043), and admission from a skilled-nursing facility (OR, 3.09; 95% CI, 1.26 to 8.08; P = 0.013). Our analysis shows that (i) CR K. pneumoniae is seen primarily in the elderly long-term care population and that (ii) regional monitoring of CR K. pneumoniae reveals insights into molecular characteristics. This work highlights the crucial role of ongoing surveillance of carbapenem resistance determinants. PMID:24798270

Perez, Federico; Rudin, Susan D.; Cober, Eric; Hanrahan, Jennifer; Ziegler, Julie; Webber, Raymond; Fox, Jacqueline; Mason, Pamela; Richter, Sandra S.; Cline, Marianne; Hall, Geraldine S.; Kaye, Keith S.; Jacobs, Michael R.; Kalayjian, Robert C.; Salata, Robert A.; Segre, Julia A.; Conlan, Sean; Evans, Scott; Fowler, Vance G.

2014-01-01

250

Bacteria causing respiratory infections in children and their sensitivity to antibiotics.  

PubMed

The author lists the most frequent bacterial agents isolated from the nose and pharynx samples of children that visited the Child Health Centre from 1983 to 1986. The gram-positive bacteria found most often were: Staphylococcus aureus (44% in 1983, 40% in 1986). Streptococcus pneumoniae (6% in 1983, 12% in 1986), and Streptococcus haemolyticus of group "A" (14% in 1983, 19% in 1986). The isolated gram-negative bacteria were: E. coli (14%), Klebsiella enterobacter (8%), and Proteus species and Pseudomonas aeruginosa (2 to 4% [4, 6, 7, 16]). According to the author's analyses Staphylococcus aureus is highly sensitive to cloxacilline (96%, no changes in the 4-year period), then to sulphametoxasol-trimetropin (95%), to lincomycine (85% no change), while to penicillin it is entirely resistant. Streptococcus pneumoniae proved sensitive to ampicillin, lincocine and erythromycin (96%), to cephalosporins (83%) and to sulphamides (85%). Streptococcus haemolyticus from group "A" reacted to penicillin excellently. The greatest sensitivity to gram-negative bacteria E. coli related to aminoglycosides (97%), sulphonamides (96%), chloramphenicol (91%), and to cephalosporines (90%, in 1986 only 60%). Klebsiella enterobacter reacted to aminoglycosides (97%), sulphonamides (92%) and chloramphenicol (83%) and Pseudomonas to aminoglycosides (95%), gentamycin (92%), while to cephalosporines and ampicillin preparations it proved totally resistant. PMID:2291383

Stancic, M A

1990-01-01

251

The nac (nitrogen assimilation control) gene from Klebsiella aerogenes.  

PubMed Central

The Klebsiella aerogenes nac gene, whose product is necessary for nitrogen regulation of a number of operons, was identified and its DNA sequence determined. The nac sequence predicted a protein a 305 amino acids with a strong similarity to members of the LysR family of regulatory proteins, especially OxyR from Escherichia coli. Analysis of proteins expressed in minicells showed that nac is a single-gene operon whose product has an apparent molecular weight of about 32 kDa as measured in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Immediately downstream from nac is a two-gene operon, the first gene of which encodes another member of the LysR family. Upstream from nac is a tRNAAsn gene transcribed divergently from nac. About 60 bp upstream from the nac open reading frame lies a sequence nearly identical to the consensus for sigma 54-dependent promoters, with the conserved GG and GC nucleotides at -26 and -14 relative to the start of transcription. About 130 bp farther upstream (at -153 relative to the start of transcription) is a sequence nearly identical to the transcriptional activator NTRC-responsive enhancer consensus. Another weaker NTRC-binding site is located adjacent to this site (at -133 relative to the start of transcription). Thus, we propose that nac is transcribed by RNA polymerase carrying sigma 54 in response to the nitrogen regulatory (NTR) system. A transposon located between the promoter and the nac ORF prevented NTR-mediated expression of nac, supporting this identification of the promoter sequence. The insertion of over 5 kb of transposon DNA between the enhancer and its target promoter had only a weak effect on enhancer-mediated regulation, suggesting that enhancers may be able to act at a considerable distance on the bacterial chromosome. Images PMID:8458853

Schwacha, A; Bender, R A

1993-01-01

252

Epidemic Klebsiella pneumoniae ST258 Is a Hybrid Strain  

PubMed Central

ABSTRACT Carbapenem-resistant Enterobacteriaceae (CRE), especially Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae, pose an urgent threat in health facilities in the United States and worldwide. K. pneumoniae isolates classified as sequence type 258 (ST258) by multilocus sequence typing are largely responsible for the global spread of KPC. A recent comparative genome study revealed that ST258 K. pneumoniae strains are two distinct genetic clades; however, the molecular origin of ST258 largely remains unknown, and our understanding of the evolution of the two genetic clades is incomplete. Here we compared the genetic structures and single-nucleotide polymorphism (SNP) distributions in the core genomes of strains from two ST258 clades and other STs (ST11, ST442, and ST42). We identified an ~1.1-Mbp region on ST258 genomes that is homogeneous to that of ST442, while the rest of the ST258 genome resembles that of ST11. Our results suggest ST258 is a hybrid clone—80% of the genome originated from ST11-like strains and 20% from ST442-like strains. Meanwhile, we sequenced an ST42 strain that carries the same K-antigen-encoding capsule polysaccharide biosynthesis gene (cps) region as ST258 clade I strains. Comparison of the cps-harboring regions between the ST42 and ST258 strains (clades I and II) suggests the ST258 clade I strains evolved from a clade II strain as a result of cps region replacement. Our findings unravel the molecular evolution history of ST258 strains, an important first step toward the development of diagnostic, therapeutic, and vaccine strategies to combat infections caused by multidrug-resistant K. pneumoniae. PMID:24961694

Chen, Liang; Mathema, Barun; Pitout, Johann D. D.; DeLeo, Frank R.

2014-01-01

253

Understanding the patterns of antibiotic susceptibility of bacteria causing urinary tract infection in West Bengal, India.  

PubMed

Urinary tract infection (UTI) is one of the most common infectious diseases at the community level. In order to assess the adequacy of empirical therapy, the susceptibility of antibiotics and resistance pattern of bacteria responsible for UTI in West Bengal, India, were evaluated throughout the period of 2008-2013. The infection reports belonging to all age groups and both sexes were considered. Escherichia coli was the most abundant uropathogen with a prevalence rate of 67.1%, followed by Klebsiella spp. (22%) and Pseudomonas spp. (6%). Penicillin was least effective against UTI-causing E. coli and maximum susceptibility was recorded for the drugs belonging to fourth generation cephalosporins. Other abundant uropathogens, Klebsiella spp., were maximally resistant to broad-spectrum penicillin, followed by aminoglycosides and third generation cephalosporin. The antibiotic resistance pattern of two principal UTI pathogens, E. coli and Klebsiella spp. in West Bengal, appears in general to be similar to that found in other parts of the Globe. Higher than 50% resistance were observed for broad-spectrum penicillin. Fourth generation cephalosporin and macrolides seems to be the choice of drug in treating UTIs in Eastern India. Furthermore, improved maintenance of infection incident logs is needed in Eastern Indian hospitals in order to facilitate regular surveillance of the occurrence of antibiotic resistance patterns, since such levels continue to change. PMID:25278932

Saha, Sunayana; Nayak, Sridhara; Bhattacharyya, Indrani; Saha, Suman; Mandal, Amit K; Chakraborty, Subhanil; Bhattacharyya, Rabindranath; Chakraborty, Ranadhir; Franco, Octavio L; Mandal, Santi M; Basak, Amit

2014-01-01

254

Understanding the patterns of antibiotic susceptibility of bacteria causing urinary tract infection in West Bengal, India  

PubMed Central

Urinary tract infection (UTI) is one of the most common infectious diseases at the community level. In order to assess the adequacy of empirical therapy, the susceptibility of antibiotics and resistance pattern of bacteria responsible for UTI in West Bengal, India, were evaluated throughout the period of 2008–2013. The infection reports belonging to all age groups and both sexes were considered. Escherichia coli was the most abundant uropathogen with a prevalence rate of 67.1%, followed by Klebsiella spp. (22%) and Pseudomonas spp. (6%). Penicillin was least effective against UTI-causing E. coli and maximum susceptibility was recorded for the drugs belonging to fourth generation cephalosporins. Other abundant uropathogens, Klebsiella spp., were maximally resistant to broad-spectrum penicillin, followed by aminoglycosides and third generation cephalosporin. The antibiotic resistance pattern of two principal UTI pathogens, E. coli and Klebsiella spp. in West Bengal, appears in general to be similar to that found in other parts of the Globe. Higher than 50% resistance were observed for broad-spectrum penicillin. Fourth generation cephalosporin and macrolides seems to be the choice of drug in treating UTIs in Eastern India. Furthermore, improved maintenance of infection incident logs is needed in Eastern Indian hospitals in order to facilitate regular surveillance of the occurrence of antibiotic resistance patterns, since such levels continue to change. PMID:25278932

Saha, Sunayana; Nayak, Sridhara; Bhattacharyya, Indrani; Saha, Suman; Mandal, Amit K.; Chakraborty, Subhanil; Bhattacharyya, Rabindranath; Chakraborty, Ranadhir; Franco, Octavio L.; Mandal, Santi M.; Basak, Amit

2014-01-01

255

Comparision of Three Laboratory Tests for Detection of AmpC ? Lactamases in Klebsiella Species and E. Coli  

PubMed Central

Background and Objective: AmpC ? lactamases are one of the important causes of drug resistance in gram negative bacteria. Failure to detect these enzymes in the laboratory has contributed to therapeutic failures but there are till date no standard guideline available. This study was therefore undertaken to evaluate three phenotypic laboratory tests and the inhibitors used in two of the tests to detect AmpC ? lactamases produced by E. coli and Klebsiella species as they are most commonly isolated organisms. Methods: E. coli and Klebsiella isolates from different clinical samples were tested for ESBLs production as per CLSI guidelines and excluded from the study. The non-ESBLs isolates were then screened for AmpC ? lactamases production, by cefoxitin and then confirmed by three different methods, i.e., Disc Potentiation Test (DPT) , Double Disc Synergy Test (DDST) and Modified Three Dimensional Test (M3DT) which in the absence of molecular methods, was taken as the gold standard. Boronic acid and cloxacillin were used as inhibitory agents in the Disc Potentiation and Double Disc synergy Tests. Results: A total of 2,933 isolates were tested out of which 165 isolates were detected as non ESBLs producers,135 (81.82%) when screened for AmpC ? lactamases based on resistance to cefoxitin were labelled as positive. 30 (18.18%) cefoxitin sensitive isolates were labelled as probably non AmpC producers . M3DT, in addition to detecting all the 135 (100%) cefoxitin resistant isolates, also detected 5 (16.67%) cefoxitin sensitive isolates as AmpC producers. Other phenotypic tests, DPT and DDST with different inhibitors like boronic acid and cloxacillin in different potencies were all found to be less sensitive. The best results among these two methods were obtained with DDST using cloxacillin 500?g. Conclusion: In the absence of recommended guidelines for AmpC detection, the study reports, among the tests performed, M3DT as the best phenotypic method for AmpC confirmation, as it is not only the most sensitive but also specific test for AmpC as it rules out the resistance due to other mechanisms like the porin channel. PMID:25120977

Deotale, V.S.; Mendiratta, D.K.; Narang, P.

2014-01-01

256

Susceptibility of multiresistant gram-negative bacteria to fosfomycin and performance of different susceptibility testing methods.  

PubMed

Fosfomycin may be a treatment option for multiresistant Gram-negative bacteria. This study compared susceptibility methods using 94 multiresistant clinical isolates. With agar dilution (AD), susceptibilities were 81%, 7%, 96%, and 100% (CLSI) and 0%, 0%, 96%, and 30% (EUCAST), respectively, for Acinetobacter baumannii, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Enterobacter spp. Categorical agreement between Etest and AD for Enterobacteriaceae and A. baumannii was ?80%. Disk diffusion was adequate only for Enterobacter. CLSI criteria for urine may be adequate for systemic infections. PMID:24323469

Perdigão-Neto, L V; Oliveira, M S; Rizek, C F; Carrilho, C M D M; Costa, S F; Levin, A S

2014-01-01

257

Sequential studies in ankylosing spondylitis. Association of Klebsiella pneumoniae with active disease.  

PubMed Central

A study of 163 patients with ankylosing spondylitis seen on 433 occasions showed that active inflammatory disease was strongly associated with the presence of Klebsiella pneumoniae in the faeces (P less than 0.001). Sequential studies showed that in patients with inactive disease the presence of a positive culture for Klebsiella was associated with the subsequent development of active inflammatory disease (P less than 0.001). These findings support the hypothesis that Kl. pneumoniae may be an initiating agent in ankylosing spondylitis. PMID:348130

Ebringer, R W; Cawdell, D R; Cowling, P; Ebringer, A

1978-01-01

258

Genome Sequences of Two Carbapenemase-Resistant Klebsiella pneumoniae ST258 Isolates.  

PubMed

Klebsiella pneumoniae, an ESKAPE group (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogen, has acquired multiple antibiotic resistance genes and is becoming a serious public health threat. Here, we report the genome sequences of two representative strains of K. pneumoniae from the emerging K. pneumoniae carbapenemase (KPC) outbreak in northeast Ohio belonging to sequence type 258 (ST258) (isolates Kb140 and Kb677, which were isolated from blood and urine, respectively). Both isolates harbor a blaKPC gene, and strain Kb140 carries blaKPC-2, while Kb677 carries blaKPC-3. PMID:24948759

Ramirez, Maria Soledad; Xie, Gang; Johnson, Shannon; Davenport, Karen; van Duin, David; Perez, Federico; Bonomo, Robert A; Chain, Patrick; Tolmasky, Marcelo E

2014-01-01

259

Osteomyelitis due to multiple carbapenemase-producing Gram-negative bacteria: The first case report of a GES-13-producing Pseudomonas aeruginosa isolate in Canada  

PubMed Central

A case of osteomyelitis in an infant following a burn injury sustained in Pakistan caused by a GES-13-producing Pseudomonas aeruginosa (the first reported in Canada) and an OXA-48 producing Klebsiella pneumoniae is described. The present case serves to highlight the importance of international travel as a risk factor for infection with carbapenemase-producing bacteria and the challenges in the laboratory detection of these organisms. PMID:25285131

Sepehri, Shadi; Poliquin, Guillaume; Alfattoh, Nora; Boyd, David; Mulvey, Michael; Denisuik, Andrew; Fanella, Sergio; Karlowsky, James; Walkty, Andrew

2014-01-01

260

Bacteria TMDL Projects  

E-print Network

of the projects are listed below. ? Peach CreekWater Quality Improvement Project ? Monitoring and Educational Programs Focused on Bacteria and Nutrient Runoff on Dairy Operations in the LeonWatershed ? Development of the Plum CreekWPP ? Impact of Proper... Star Healthy Streams * ? Environmental Management of Grazing Lands * *TWRI-managed projects More information on the initiative is available at www.tsswcb.state.tx.us/managementprogram/ initiatives/bacteria. Bacteria Projects Across the State...

Wythe, Kathy

2007-01-01

261

Introduction to Bacteria  

NSDL National Science Digital Library

This science site has students research how bacteria move, where they live, and how they reproduce; learn how bacteria can be helpful or harmful; and create a design illustrating what they have learned about bacteria. Included in the lesson plan are the objectives, needed materials and Web sites, procedures, discussion questions, evaluation, extensions, suggested reading, and vocabulary. Teachers can link to Teaching Tools to create custom worksheets, puzzles, and quizzes. A printable version of the lesson plan can be downloaded. The video Bacteria, Viruses and Allergies can be purchased and comprehension questions and answers can be downloaded.

Discoveryschool.com; Fenichel, Marilyn

2007-12-12

262

Influence of Inoculum Size and Marbofloxacin Plasma Exposure on the Amplification of Resistant Subpopulations of Klebsiella pneumoniae in a Rat Lung Infection Model?  

PubMed Central

We tested the hypothesis that the bacterial load at the infection site could impact considerably on the pharmacokinetic/pharmacodynamic (PK/PD) parameters of fluoroquinolones. Using a rat lung infection model, we measured the influence of different marbofloxacin dosage regimens on selection of resistant bacteria after infection with a low (105 CFU) or a high (109 CFU) inoculum of Klebsiella pneumoniae. For daily fractionated doses of marbofloxacin, prevention of resistance occurred for an area-under-the-concentration-time-curve (AUC)/MIC ratio of 189 h for the low inoculum, whereas for the high inoculum, resistant-subpopulation enrichment occurred for AUC/MIC ratios up to 756 h. For the high-inoculum-infected rats, the AUC/MIC ratio, Cmax/MIC ratio, and time within the mutant selection window (TMSW) were not found to be effective predictors of resistance prevention upon comparison of fractionated and single administrations. An index corresponding to the ratio of the time that the drug concentrations were above the mutant prevention concentration (MPC) over the time that the drug concentrations were within the MSW (T>MPC/TMSW) was the best predictor of the emergence of resistance: a T>MPC/TMSW ratio of 0.54 was associated with prevention of resistance for both fractionated and single administrations. These results suggest that the enrichment of resistant bacteria depends heavily on the inoculum size at the start of an antimicrobial treatment and that classical PK/PD parameters cannot adequately describe the impact of different dosage regimens on enrichment of resistant bacteria. We propose an original index, the T>MPC/TMSW ratio, which reflects the ratio of the time that the less susceptible bacterial subpopulation is killed over the time that it is selected, as a potentially powerful indicator of prevention of enrichment of resistant bacteria. This ratio is valid only if plasma concentrations achieve the MPC. PMID:19738020

Kesteman, Anne-Sylvie; Ferran, Aude A.; Perrin-Guyomard, Agnès; Laurentie, Michel; Sanders, Pascal; Toutain, Pierre-Louis; Bousquet-Mélou, Alain

2009-01-01

263

Influence of inoculum size and marbofloxacin plasma exposure on the amplification of resistant subpopulations of Klebsiella pneumoniae in a rat lung infection model.  

PubMed

We tested the hypothesis that the bacterial load at the infection site could impact considerably on the pharmacokinetic/pharmacodynamic (PK/PD) parameters of fluoroquinolones. Using a rat lung infection model, we measured the influence of different marbofloxacin dosage regimens on selection of resistant bacteria after infection with a low (10(5) CFU) or a high (10(9) CFU) inoculum of Klebsiella pneumoniae. For daily fractionated doses of marbofloxacin, prevention of resistance occurred for an area-under-the-concentration-time-curve (AUC)/MIC ratio of 189 h for the low inoculum, whereas for the high inoculum, resistant-subpopulation enrichment occurred for AUC/MIC ratios up to 756 h. For the high-inoculum-infected rats, the AUC/MIC ratio, C(max)/MIC ratio, and time within the mutant selection window (T(MSW)) were not found to be effective predictors of resistance prevention upon comparison of fractionated and single administrations. An index corresponding to the ratio of the time that the drug concentrations were above the mutant prevention concentration (MPC) over the time that the drug concentrations were within the MSW (T(>MPC)/T(MSW)) was the best predictor of the emergence of resistance: a T(>MPC)/T(MSW) ratio of 0.54 was associated with prevention of resistance for both fractionated and single administrations. These results suggest that the enrichment of resistant bacteria depends heavily on the inoculum size at the start of an antimicrobial treatment and that classical PK/PD parameters cannot adequately describe the impact of different dosage regimens on enrichment of resistant bacteria. We propose an original index, the T(>MPC)/T(MSW) ratio, which reflects the ratio of the time that the less susceptible bacterial subpopulation is killed over the time that it is selected, as a potentially powerful indicator of prevention of enrichment of resistant bacteria. This ratio is valid only if plasma concentrations achieve the MPC. PMID:19738020

Kesteman, Anne-Sylvie; Ferran, Aude A; Perrin-Guyomard, Agnès; Laurentie, Michel; Sanders, Pascal; Toutain, Pierre-Louis; Bousquet-Mélou, Alain

2009-11-01

264

Alkali-resistant bacteria in root canal systems.  

PubMed

The aim of this study was to isolate and identify alkali-resistant bacteria from the dentin of infected root canals. Bacteria from homogenized dentin powder made up from infected root canal walls from human teeth were cultured on buffer-enriched Brain Heart Infusion agar supplemented with 4% sheep blood (BHI-blood agar), adjusted to pH 7.0, 9.0 or 10.0. Incubation took place for 7 days at 37 degrees C in an anaerobic glove box. Bacterial strains selected according to colony and morphology were subcultured in buffer-enriched BHI broth adjusted to pH 9.0, 10.0 or 11.0 to confirm their growth as alkali-resistant bacteria. Polymerase chain reaction amplification using specific primer sets and 16S rDNA sequence analysis was performed for identification of alkali-resistant isolates. In the present study, 37 teeth extracted from 37 patients were used for preparation of the dentin powder samples. Bacteria were detected in 25 samples when standard BHI-blood agars (pH 7.0) were used. Of these, 29 strains from 15 samples were alkali resistant, 25 strains growing at pH 9.0 and 4 at pH 10.0. The alkali-resistant strains included Enterococcus faecium (10 strains) and Enterococcus faecalis (2 strains), Enterobacter cancerogenus (1 strains), Fusobacterium nucleatum (1 strains), Klebsiella ornithinolytica (2 strains), Lactobacillus rhamnosus (2 strains), Streptococcus anginosus (2 strains), Streptococcus constellatus (3 strains), and Streptococcus mitis (2 strains). Three strains were also identified as bacteria of genus Firmicutes or Staphylococcus at the genus level. The present study showed that many bacterial species in infected root canal dentin were alkali-resistant at pH 9.0 and/or pH 10.0, and belonged mainly to the genus Enterococcus. PMID:15491465

Nakajo, K; Nakazawa, F; Iwaku, M; Hoshino, E

2004-12-01

265

Transfer of Carbapenem-Resistant Plasmid from Klebsiella pneumoniae ST258 to Escherichia coli in Patient  

PubMed Central

Klebsiella pneumoniae carbapenemase (KPC) 3–producing Escherichia coli was isolated from a carrier of KPC-3–producing K. pneumoniae. The KPC-3 plasmid was identical in isolates of both species. The patient's gut flora contained a carbapenem-susceptible E. coli strain isogenic with the KPC-3–producing isolate, which suggests horizontal interspecies plasmid transfer. PMID:20507761

Goren, Moran G.; Carmeli, Yehuda; Schwaber, Mitchell J.; Chmelnitsky, Inna; Schechner, Vered

2010-01-01

266

Transfer of carbapenem-resistant plasmid from Klebsiella pneumoniae ST258 to Escherichia coli in patient.  

PubMed

Klebsiella pneumoniae carbapenemase (KPC) 3-producing Escherichia coli was isolated from a carrier of KPC-3-producing K. pneumoniae. The KPC-3 plasmid was identical in isolates of both species. The patient's gut flora contained a carbapenem-susceptible E. coli strain isogenic with the KPC-3-producing isolate, which suggests horizontal interspecies plasmid transfer. PMID:20507761

Goren, Moran G; Carmeli, Yehuda; Schwaber, Mitchell J; Chmelnitsky, Inna; Schechner, Vered; Navon-Venezia, Shiri

2010-06-01

267

1,3-Propanediol Dehydrogenase from Klebsiella pneumoniae: Decameric Quaternary Structure and Possible Subunit Cooperativity  

Microsoft Academic Search

Klebsiella pneumoniae is a nosocomial pathogen frequently isolated from opportunistic infections, especially in clinical environments. In spite of its potential pathogenicity, this microorganism has several metabolic potentials that could be used in biotechnology applications. K. pneumoniae is able to metabolize glycerol as a sole source of carbon and energy. 1,3-Propanediol dehydrogenase is the core of the metabolic pathway for the

David Marcal; Ana Toste Rego; Maria Armenia Carrondo; Francisco J. Enguita

2009-01-01

268

Phenotypic and Molecular Characterization of Multidrug Resistant Klebsiella pneumoniae Isolated from a University Teaching Hospital, China  

PubMed Central

The multidrug-resistant rate of Klebsiella pneumoniae has risen rapidly worldwide. To better understand the multidrug resistance situation and molecular characterization of Klebsiella pneumoniae, a total of 153 Klebsiella pneumoniae isolates were collected, and drug susceptibility test was performed to detect its susceptibility patterns to 13 kinds of antibiotics. Phenotypic tests for carbapenemases ESBLs and AmpC enzyme-producing strains were performed to detect the resistance phenotype of the isolates. Then PCR amplification and sequencing analysis were performed for the drug resistance determinants. The results showed that 63 strains harbored blaCTX-M gene, and 14 strains harbored blaDHA gene. Moreover, there were 5 strains carrying blaKPC gene, among which 4 strains carried blaCTX-M, blaDHA and blaKPC genes, and these 4 strains were also resistant to imipenem. Our data indicated that drug-resistant Klebsiella pneumoniae were highly prevalent in the hospital. Thus it is warranted that surveillance of epidemiology of those resistant isolates should be a cause for concern, and appropriate drugs should be chosen. PMID:24740167

Liu, Helu; Lü, Dongyue; Liang, Hong; Dou, Yuhong

2014-01-01

269

Emergence of clinical Klebsiella pneumoniae producing OXA-232 carbapenemase in Singapore  

PubMed Central

We report the emergence of OXA-232, a newly described OXA-48-like carbapenemase variant, in Southeast Asia. Molecular characterization of eight Klebsiella pneumoniae obtained from local and foreign patients reveals clonality of the isolates. blaOXA-232 was located on a non-conjugative plasmid of 6141 base pairs (GenBank accession number JX423831.1). PMID:25356318

Teo, J W P; Kurup, A; Lin, R T P; Hsien, K T

2013-01-01

270

Multiple-Antibiotic Resistance Mediated by Plasmids and Integrons in Uropathogenic Escherichia coli and Klebsiella pneumoniae  

Microsoft Academic Search

Antibiotic resistance in urinary tract infection (UTI) is a growing public health problem in the world. In this study, a total of 182 uropathogens were isolated from patients with symptoms of urinary tract infection (UTI). Escherichia coli (88%) was the most prevalent isolate, while Klebsiella pneumoniae was recovered from 12% cases. The male\\/female ratio was 1:3. About 56% female and

Taslima Taher Lina; Sabita Rezwana Rahman; Donald James Gomes

2007-01-01

271

Characteristics of healthcare-associated and community-acquired Klebsiella pneumoniae bacteremia in Taiwan  

Microsoft Academic Search

ObjectiveKlebsiella pneumoniae is the major cause of community-onset pyogenic infections in Taiwan. We investigated the clinical features and outcomes of community-acquired (CA) and healthcare-associated (HCA) infections among community-onset K. pneumoniae bacteremia.

Hau-Shin Wu; Fu-Der Wang; Chih-Peng Tseng; Tung-Han Wu; Yi-Tsung Lin

272

Comparison of in vitro activities of meropenem productions on Klebsiella pneumoniae isolated from hospitalized patients  

PubMed Central

Purpose: Antimicrobial activities of meropenem products on Klebsiella pneumoniae isolates were determined. Methods: 212 non-duplicated Klebsiella pneumoniae isolates were examined for in vitro meropenem susceptibility test by using the following disks, which were made from Meronem (AstraZeneca, UK), Exipenem (Exir, Iran) and Meroxan (DAANA, Iran) powders. MIC50 and MIC90 for meropenem antibiotics were determined. Results: Meronem had good activities against most isolates of Klebsiella pneumoniae, and only a few strains had a rather high MIC. Exipenem and Meroxan showed a similar activity with Meronem. Conclusion: Regarding the comparison of two internal generic meropenem products with the external Meronem product have shown that they are equivalents in terms of microbiological activity, as measured using the disk diffusion and MIC. In developing countries, we suggested preparing disks with antibiotic powders that can be an equivalent function in microbiological activity with standard disks. In addition, since it demonstrated significant antimicrobial activity against the Klebsiella pneumoniae. For use of Exipenem and Meroxan in vivo, it would be better to perform additional testing (activity against different species, stability etc.). PMID:25152857

Akhi, Mohammad Taghi; Asghari, Babak; Nahaei, Mohammed Reza; Memar, Mohammad Yousef; Lari, Abdolaziz Rastegar; Naghili, Behrooz; Pirzadeh, Tahereh

2014-01-01

273

Klebsiella pneumoniae Strains Producing Extended-Spectrum ?-Lactamases in Spain: Microbiological and Clinical Features?  

PubMed Central

Extended-spectrum ?-lactamases (ESBL) of the CTX-M, SHV, and TEM families were recognized in 76 (67%), 31 (27%), and 6 (5%) isolates, respectively, among 162 ESBL-producing Klebsiella pneumoniae (ESBL-Kp) strains obtained in a multicenter study in Spain. Predisposing factors for ESBL-Kp acquisition included invasive procedures, mechanical ventilation, and previous antimicrobial use. PMID:21191059

de Alegría, C. Ruiz; Rodríguez-Baño, J.; Cano, M. E.; Hernández-Bello, J. R.; Calvo, J.; Román, E.; Díaz, M. A.; Pascual, A.; Martínez-Martínez, L.

2011-01-01

274

Phenotypic and genotypic characterization of Klebsiella pneumonia recovered from nonhuman primates  

Technology Transfer Automated Retrieval System (TEKTRAN)

Klebsiella pneumoniae is a zoonotic, Gram-negative member of the family Enterobacteriaceae and is the causative agent of nosocomial septicemic, pneumonic, and urinary tract infections. Recently, pathogenic strains of K. pneumoniae sharing a hypermucoviscosity (HMV) phenotype have been attributed to ...

275

Complete genome sequence of a Klebsiella pneumoniae strain isolated from a known cotton insect boll vector  

Technology Transfer Automated Retrieval System (TEKTRAN)

Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the...

276

THERMOTOLERANT NON-FECAL SOURCE 'KLEBSIELLA PNEUMONIAE': VALIDITY OF THE FECAL COLIFORM TEST IN RECREATIONAL WATERS  

EPA Science Inventory

Wisconsin pulp and paper mill processing plants were evaluated for fecal coliform and total Klebsiella (i.e., thermotolerant and thermointolerant) bacterial concentrations. Using the standard fecal coliform test, up to 90 per cent of non-fecal source thermo-tolerant K. pneumoniae...

277

Necrotizing Fasciitis Caused by Hypermucoviscous Klebsiella pneumoniae in a Filipino Female in North America  

PubMed Central

Necrotizing fasciitis caused by Klebsiella pneumoniae has been described in Southeast Asia, but has only recently begun to emerge in North America. The hypermucoviscous strain of K. pneumoniae is a particularly virulent strain known to cause devastatingly invasive infections, including necrotizing fasciitis. Here we present the first known case of necrotizing fasciitis caused by hypermucoviscous K. pneumoniae in North America.

Ng, Daniel; Frazee, Brad

2015-01-01

278

Isolation of a Chromosomal Region of Klebsiella pneumoniae Associated with Allantoin Metabolism and Liver Infection  

Microsoft Academic Search

Klebsiella pneumoniae liver abscess with metastatic complications is an emerging infectious disease in Taiwan. To identify genes associated with liver infection, we used a DNA microarray to compare the tran- scriptional profiles of three strains causing liver abscess and three strains not associated with liver infection. There were 13 clones that showed higher RNA expression levels in the three liver

Huei-Chi Chou; Cha-Ze Lee; Li-Chen Ma; Chi-Tai Fang; Shan-Chwen Chang; Jin-Town Wang

2004-01-01

279

Bacteria turn tiny gears  

SciTech Connect

Swarms of bacteria turn two 380-micron long gears, opening the possibility of building hybrid biological machines at the microscopic scale. Read more at Wired: http://www.wired.com/wiredscience/2009/12/bacterial-micro-machine/#more-15684 or Scientific American: http://www.scientificamerican.com/article.cfm?id=brownian-motion-bacteria

None

2009-01-01

280

The rcsA gene of Klebsiella pneumoniae O1:K20 is involved in expression of the serotype-specific K (capsular) antigen.  

PubMed Central

In Klebsiella pneumoniae, the ability to synthesize large amounts of capsular polysaccharide is an important correlate of virulence. We report the cloning of rcsA from K. pneumoniae serotype O1:K20 and demonstrate that rcsA is involved in the expression of the K antigen capsule. We have determined the nucleotide sequence for the rcsA gene from K. pneumoniae K20 and shown it to be identical to the sequence reported previously for rcsA from strain K21 (Allen et al., J. Gen. Microbiol. 133:331-340, 1987). Southern hybridization results indicate that this gene is widely distributed among different Klebsiella K serotypes. When cloned into Escherichia coli K-12, the K. pneumoniae rcsA gene caused a mucoid phenotype, resulting from the activation of colanic acid synthesis. Activation of colanic acid synthesis was not dependent on growth at low temperatures (less than or equal to 30 degrees C). The K. pneumoniae rcsA gene complemented E. coli K-12 rcsA mutations but could not complement defects in rcsB, suggesting that RcsA may be functionally homologous in these bacteria. The cloned rcsA gene also complemented a defect in nonmucoid strain K20 derivatives that normally produced only trace amounts of K20 antigen and were unable to assemble a wild-type capsular structure. Mutants that were K20-deficient were not complemented. The K antigen capsule of K. pneumoniae therefore joins a growing list of polysaccharide-synthetic systems in which "RcsA-like" proteins are involved. Images PMID:1987069

McCallum, K L; Whitfield, C

1991-01-01

281

Multi-drug resistant gram-negative enteric bacteria isolated from flies at Chengdu Airport, China.  

PubMed

We collected flies from Chengdu Shuangliu International Airport to examine for the presence of bacteria and to determine the sensitivity patterns of those bacteria. A total of 1,228 flies were collected from 6 sites around Chengdu Shuangliu International Airport from April to September 2011. The predominant species was Chrysomya megacephala (n=276, 22.5%). Antimicrobial-resistant gram-negative enteric bacteria (n=48) were isolated from flies using MacConkey agar supplemented with cephalothin (20 microg/ml). These were identified as Escherichia coli (n=37), Klebsiella pneumoniae (n=6), Pseudomonas aeruginosa (n=3) and Aeromonas hydrophila (n=2). All isolated bacteria were tested for resistance to 21 commonly used antimicrobials: amoxicillin (100%), ticarcillin (100%), cephalothin (100%), cefuroxime (100%), ceftazidime 1 (93.8%), piperacillin (93.8%), cefotaxime (89.6%), ticarcillin-clavulanate (81.3%), trimethoprim-sulfamethoxazole (62.5%), ciprofloxacin (54.2%), gentamicin (45.8%), cefepime (39.6%), tobramycin (39.6%), ceftazidime (22.9%), cefoxitin (16.7%), amikacin (16.7%), netilmicin (14.6%), amoxicillin-clavulanate (6.3%) and piperacillin-tazobactam (2.1%). No resistance to meropenem or imipenem was observed. Antibiotic resistance genes among the isolated bacteria were analyzed for by polymerase chain reaction. Thirty of the 48 bacteria with resistance (62.5%) possessed the blaTEM gene. PMID:24450236

Liu, Yang; Yang, Yu; Zhao, Feng; Fan, Xuejun; Zhong, Wei; Qiao, Dairong; Cao, Yi

2013-11-01

282

Penicillinases of Klebsiella pneumoniae and Their Phylogenetic Relationship to Penicillinases Mediated by R Factors  

PubMed Central

On the assumption that the penicillinase determinants on a group of R factors conferring ampicillin resistance have a phylogenetically close relationship to the penicillinase gene of the Klebsiella group, the penicillinases from four strains of K. pneumoniae, GN69, GN1103R?, GN422, and GN118, were purified 230- to 1,000-fold and compared with the known two R-factor-mediated penicillinases. By gel filtration on Sephadex G-75, the molecular weights were estimated to be 17,400, 18,100, 20,000 and 18,300, respectively, which are slightly lower than those of the R-factor penicillinases. The isoelectric points of the Klebsiella penicillinases were not in agreement with those of the R-factor penicillinases. All the enzymes showed a pH optimum between 6.3 to 7.2 and a temperature optimum of 45 C, and those properties, together with behavior towards inhibitors, were about the same as those in the R-factor penicillinases. The substrate specificity and the Michaelis constants of the Klebsiella penicillinases for penicillins and cephaloridine were broadly similar to those of the R-factor penicillinases, however, some variations were found even among the four penicillinases of K. pneumoniae. The reactivities of the four penicillinases of K. pneumoniae with the antiserum against one R-factor penicillinase were tested, and three of the four Klebsiella penicillinases were found to be indistinguishable immunologically from both R-factor penicillinases. The remaining Klebsiella penicillinase, from GN1103R?, showed an immunological partial homology with the R-factor penicillinases. Images PMID:4199503

Sawai, Tetsuo; Yamagishi, Saburo; Mitsuhashi, Susumu

1973-01-01

283

Modeling Klebsiella pneumoniae Pathogenesis by Infection of the Wax Moth Galleria mellonella  

PubMed Central

The implementation of infection models that approximate human disease is essential for understanding pathogenesis at the molecular level and for testing new therapies before they are entered into clinical stages. Insects are increasingly being used as surrogate hosts because they share, with mammals, essential aspects of the innate immune response to infections. We examined whether the larva of the wax moth Galleria mellonella could be used as a host model to conceptually approximate Klebsiella pneumoniae-triggered pneumonia. We report that the G. mellonella model is capable of distinguishing between pathogenic and nonpathogenic Klebsiella strains. Moreover, K. pneumoniae infection of G. mellonella models some of the known features of Klebsiella-induced pneumonia, i.e., cell death associated with bacterial replication, avoidance of phagocytosis by phagocytes, and the attenuation of host defense responses, chiefly the production of antimicrobial factors. Similar to the case for the mouse pneumonia model, activation of innate responses improved G. mellonella survival against subsequent Klebsiella challenge. Virulence factors necessary in the mouse pneumonia model were also implicated in the Galleria model. We found that mutants lacking capsule polysaccharide, lipid A decorations, or the outer membrane proteins OmpA and OmpK36 were attenuated in Galleria. All mutants activated G. mellonella defensive responses. The Galleria model also allowed us to monitor Klebsiella gene expression. The expression levels of cps and the loci implicated in lipid A remodeling peaked during the first hours postinfection, in a PhoPQ- and PmrAB-governed process. Taken together, these results support the utility of G. mellonella as a surrogate host for assessing infections with K. pneumoniae. PMID:23836821

Insua, José Luis; Llobet, Enrique; Moranta, David; Pérez-Gutiérrez, Camino; Tomás, Anna; Garmendia, Junkal

2013-01-01

284

Regulatory role for L-arginine in the utilization of amino acids by pig small-intestinal bacteria.  

PubMed

We recently reported that bacteria from the pig small intestine rapidly utilize and metabolize amino acids (AA). This study investigated the effect of L-arginine on the utilization of AA by pure bacterial strains (Streptococcus sp., Escherichia coli and Klebsiella sp.) and mixed bacterial cultures derived from the pig small intestine. Bacteria were incubated at 37°C for 3 h in anaerobic AA media containing 0-5 mmol/L of arginine to determine the effect of arginine on the bacterial utilization of AA. Amino acids in the medium plus cell extracts were analyzed by high-performance liquid chromatography. Results indicated concentration-dependent increases in the bacterial utilization of arginine and altered fluxes of arginine into ornithine and citrulline in the bacteria. Net glutamine utilization increased in pure bacterial strains with increased concentrations of arginine. With the addition of arginine, net utilization of threonine, glycine, phenylalanine and branched-chain AA increased (P<0.05) in Streptococcus sp. and Klebsiella sp., but decreased in E. coli. Net utilization of lysine, threonine, isoleucine, leucine, glycine and alanine by jejunal or ileal mixed bacteria decreased (P<0.05) with the addition of arginine. Complete utilization of asparagine, aspartate and serine were observed in pig small-intestinal bacteria after 3 h of incubation. Overall, the addition of arginine affected the metabolism of the arginine-family of AA and the serine- and aspartate-family of AA in small-intestinal bacteria and reduced the utilization of most AA in ileal mixed bacteria. These novel findings indicate that arginine exerts its beneficial effects on swine nutrition partially by regulating AA utilization and metabolism in the small-intestinal microbiota. PMID:21928075

Dai, Zhao-Lai; Li, Xi-Long; Xi, Peng-Bin; Zhang, Jing; Wu, Guoyao; Zhu, Wei-Yun

2012-07-01

285

Extracellular melibiose and fructose are intermediates in raffinose catabolism during fermentation to ethanol by engineered enteric bacteria.  

PubMed Central

Contrary to general concepts of bacterial saccharide metabolism, melibiose (25 to 32 g/liter) and fructose (5 to 14 g/liter) accumulated as extracellular intermediates during the catabolism of raffinose (O-alpha-D-galactopyranosyl-1, 6-alpha-D-glucopyranosyl-beta-D-fructofuranoside) (90 g/liter) by ethanologenic recombinants of Escherichia coli B, Klebsiella oxytoca M5A1, and Erwinia chrysanthemi EC16. Both hydrolysis products (melibiose and fructose) were subsequently transported and further metabolized by all three organisms. Raffinose catabolism was initiated by beta-fructosidase; melibiose was subsequently hydrolyzed to galactose and glucose by alpha-galactosidase. Glucose and fructose were completely metabolized by all three organisms, but galactose accumulated in the fermentation broth with EC16(pLOI555) and P2. MM2 (a raffinose-positive E. coli mutant) was the most effective biocatalyst for ethanol production (38 g/liter) from raffinose. All organisms rapidly fermented sucrose (90 g/liter) to ethanol (48 g/liter) at more than 90% of the theoretical yield. During sucrose catabolism, both hydrolysis products (glucose and fructose) were metabolized concurrently by EC16(pLOI555) and P2 without sugar leakage. However, fructose accumulated extracellularly (27 to 28 g/liter) at early stages of fermentation with KO11 and MM2. Sequential utilization of glucose and fructose correlated with a diauxie in base utilization (pH maintenance). The mechanism of sugar escape remains unknown but may involve downhill leakage via permease which transports precursor saccharides or novel sugar export proteins. If sugar escape occurs in nature with wild organisms, it could facilitate the development of complex bacterial communities which are based on the sequence of saccharide catabolism and the hierarchy of sugar utilization. PMID:9068632

Moniruzzaman, M; Lai, X; York, S W; Ingram, L O

1997-01-01

286

A Dimeric Chlorite Dismutase Exhibits O2-Generating Activity and Acts as a Chlorite Antioxidant in Klebsiella pneumoniae MGH 78578.  

PubMed

Chlorite dismutases (Clds) convert chlorite to O2 and Cl(-), stabilizing heme in the presence of strong oxidants and forming the O?O bond with high efficiency. The enzyme from the pathogen Klebsiella pneumoniae (KpCld) represents a subfamily of Clds that share most of their active site structure with efficient O2-producing Clds, even though they have a truncated monomeric structure, exist as a dimer rather than a pentamer, and come from Gram-negative bacteria without a known need to degrade chlorite. We hypothesized that KpCld, like others in its subfamily, should be able to make O2 and may serve an in vivo antioxidant function. Here, it is demonstrated that it degrades chlorite with limited turnovers relative to the respiratory Clds, in part because of the loss of hypochlorous acid from the active site and destruction of the heme. The observation of hypochlorous acid, the expected leaving group accompanying transfer of an oxygen atom to the ferric heme, is consistent with the more open, solvent-exposed heme environment predicted by spectroscopic measurements and inferred from the crystal structures of related proteins. KpCld is more susceptible to oxidative degradation under turnover conditions than the well-characterized Clds associated with perchlorate respiration. However, wild-type K. pneumoniae has a significant growth advantage in the presence of chlorate relative to a ?cld knockout strain, specifically under nitrate-respiring conditions. This suggests that a physiological function of KpCld may be detoxification of endogenously produced chlorite. PMID:25437493

Celis, Arianna I; Geeraerts, Zachary; Ngmenterebo, David; Machovina, Melodie M; Kurker, Richard C; Rajakumar, Kumar; Ivancich, Anabella; Rodgers, Kenton R; Lukat-Rodgers, Gudrun S; DuBois, Jennifer L

2015-01-20

287

Mechanism of nitrogenase switch-off by oxygen. [Klebsiella pneumoniae; Rhodopseudomonas sphaeroides f. sp. denitrificans; Rhodopseudomonas capsulate  

SciTech Connect

Oxygen caused a reversible inhibition (switch-off) of nitrogenase activity in whole cells of four strains of diazotrophs, the facultative anaerobe Klebsiella pneumoniae and three strains of photosynthetic bacteria (Rhodopseudomonas sphaeroides f. sp. denitrificans and Rhodopseudomonas capsulata strians AD2 and BK5). In K. pneumoniae 50% inhibition of acetylene reduction was attained at an O/sub 2/ concentration of 0.37 ..mu..M. Cyanide (90 ..mu..M), which did not affect acetylene reduction but inhibited whole-cell respiration by 60 to 70%, shifted the O/sub 2/ concentration that caused 50% inhibition of nitrogenase activity to 2.9 ..mu..M. A mutant strain of K. pneumoniae, strain AH11, has a respiration rate that is 65 to 75% higher than that of the wild type, but is nitrogenase activity is similar to wild-type activity. Acetylene reduction by whole cells of this mutant was inhibited 50% by 0.20 ..mu..M O/sub 2/. Inhibition by CN/sup -/ of 40 to 50% of the O/sub 2/ uptake in the mutant shifted the O/sub 2/ concentration that caused 50% inhibition of nitrogenase to 1.58 ..mu..M. Thus, when the respiration rates were lower, higher oxygen concentrations were required to inhibit nitrogenase. Reversible inhibition of nitrogenase activity in vivo was caused under anaerobic conditions by other electron acceptors. Addition of 2 mM sulfite to cell suspensions of R. capsulata B10 and R. sphaeroides inhibited nitrogenase activity. Nitrite also inhibited acetylene reduction in whole cells of the photodenitrifier R. sphaeroides but not in R. capsulata B10, which is not capable of enzymatic reduction of NO/sub 2//sup -/. Lower concentrations of NO/sub 2//sup -/ were required to inhibit the activity in NO/sub 3//sup -/-grown cells, which have higher activities of nitrite reductase.

Goldberg, I.; Nadler, V.; Hochman, A.

1987-02-01

288

Inactivation of biofilm bacteria.  

PubMed Central

The current project was developed to examine inactivation of biofilm bacteria and to characterize the interaction of biocides with pipe surfaces. Unattached bacteria were quite susceptible to the variety of disinfectants tested. Viable bacterial counts were reduced 99% by exposure to 0.08 mg of hypochlorous acid (pH 7.0) per liter (1 to 2 degrees C) for 1 min. For monochloramine, 94 mg/liter was required to kill 99% of the bacteria within 1 min. These results were consistent with those found by other investigators. Biofilm bacteria grown on the surfaces of granular activated carbon particles, metal coupons, or glass microscope slides were 150 to more than 3,000 times more resistant to hypochlorous acid (free chlorine, pH 7.0) than were unattached cells. In contrast, resistance of biofilm bacteria to monochloramine disinfection ranged from 2- to 100-fold more than that of unattached cells. The results suggested that, relative to inactivation of unattached bacteria, monochloramine was better able to penetrate and kill biofilm bacteria than free chlorine. For free chlorine, the data indicated that transport of the disinfectant into the biofilm was a major rate-limiting factor. Because of this phenomenon, increasing the level of free chlorine did not increase disinfection efficiency. Experiments where equal weights of disinfectants were used suggested that the greater penetrating power of monochloramine compensated for its limited disinfection activity. These studies showed that monochloramine was as effective as free chlorine for inactivation of biofilm bacteria. The research provides important insights into strategies for control of biofilm bacteria. Images PMID:2849380

LeChevallier, M W; Cawthon, C D; Lee, R G

1988-01-01

289

Transport and bacterial interactions of three bacterial strains in saturated column experiments.  

PubMed

The impact of bacteria-solid and bacteria-bacteria interactions on the transport of Klebsiella oxytoca, Burkholderia cepacia G4PR1, and Pseudomonas sp. #5 was investigated in saturated sand column experiments (L = 114 mm; ø = 33 mm) under constant water velocities (? 5 cm · h(-1)). Bacterial strains were injected into the columns as pulses either individually, simultaneously, or successively. A one-dimensional mathematical model for advective-dispersive transport and for irreversible and reversible bacterial kinetic sorption was used to analyze the bacterial breakthrough curves. Different sorption parameters were obtained for each strain in each of the three experimental setups. In the presence of other bacteria, sorption parameters for B. cepacia G4PR1 remained similar to results from individual experiments, indicating the presence of other bacteria generally had a lesser influence on its migration than for the other bacteria. K. oxytoca is more competitive for the sorption sites when simultaneously injected with the other bacteria. Ps. sp. #5 generally yielded the greatest detachment rates and the least affinity to attach to the sand, indicative of its mobility in groundwater systems. The results of this study clearly indicate both bacteria-solid and bacteria-bacteria interactions influence the migration of bacteria. A more complete understanding of such interactions is necessary to determine potential migration in groundwater systems. PMID:21319738

Stumpp, Christine; Lawrence, John R; Hendry, M Jim; Maloszewski, Piotr

2011-03-15

290

Polyhexamethylene guanidine hydrochloride shows bactericidal advantages over chlorhexidine digluconate against ESKAPE bacteria.  

PubMed

More information regarding the bactericidal properties of polyhexamethylene guanidine hydrochloride (PHMG) against clinically important antibiotic-resistant ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogens needs to be provided for its uses in infection control. The bactericidal properties of PHMG and chlorhexidine digluconate (CHG) were compared based on their minimum inhibitory concentrations (MICs), minimum bactericidal concentrations, and time-course-killing curves against clinically important antibiotic-susceptible and antibiotic-resistant ESKAPE pathogens. Results showed that PHMG exhibited significantly higher bactericidal activities against methicillin-resistant Staphylococcus aureus, carbapenem-resistant Klebsiella pneumoniae, and ceftazidime-resistant Enterobacter spp. than CHG. A slight bactericidal advantage over CHG was obtained against vancomycin-resistant Enterococcus faecium, ciprofloxacin- and levofloxacin-resistant Acinetobacter spp., and multidrug-resistant Pseudomonas aeruginosa. In previous reports, PHMG had higher antimicrobial activity against almost all tested Gram-negative bacteria and several Gram-positive bacteria than CHG using MIC test. These studies support the further development of covalently bound PHMG in sterile-surface materials and the incorporation of PHMG in novel disinfectant formulas. PMID:24888899

Zhou, Zhongxin; Wei, Dafu; Lu, Yanhua

2014-05-31

291

Multidrug Resistance in Bacteria  

PubMed Central

Large amounts of antibiotics used for human therapy, as well as for farm animals and even for fish in aquaculture, resulted in the selection of pathogenic bacteria resistant to multiple drugs. Multidrug resistance in bacteria may be generated by one of two mechanisms. First, these bacteria may accumulate multiple genes, each coding for resistance to a single drug, within a single cell. This accumulation occurs typically on resistance (R) plasmids. Second, multidrug resistance may also occur by the increased expression of genes that code for multidrug efflux pumps, extruding a wide range of drugs. This review discusses our current knowledge on the molecular mechanisms involved in both types of resistance. PMID:19231985

Nikaido, Hiroshi

2010-01-01

292

Toxicological Effects of Selective Herbicides on Plant Growth Promoting Activities of Phosphate Solubilizing Klebsiella sp . Strain PS19  

Microsoft Academic Search

This study examines the effect of four herbicides, quizalafop-p-ethyl, clodinafop, metribuzin and glyphosate, on plant growth promoting activities like phosphate solubilization, siderophores,\\u000a indole acetic acid, exo-polysaccharides, hydrogen cyanide and ammonia production by herbicide tolerant Klebsiella sp. strain PS19. The strain was isolated from mustard rhizosphere. The selected herbicides were applied two to three times\\u000a at the recommended rates. Klebsiella sp.

Munees Ahemad

2011-01-01

293

Transferable resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of Klebsiella pneumoniae and Serratia marcescens  

Microsoft Academic Search

Summary In conjugational crosses, threeKlebsiella pneumoniae strains and oneSerratia marcescens strain have been demonstrated to transfer resistance determinants to newer types of cephalosporins. WhileKlebsiella strains donated cefotaxime, cefamandole and cefuroxime resistance toEscherichia coli K-12 recipients, the genetic analysis of exconjugants after the transfer of plasmids fromSerratia strains toProteus orSalmonella recipients showed that the cefoxitin resistance determinant was also co-transferred. In

H. Knothe; P. Shah; V. Krcmery; M. Antal; S. Mitsuhashi

1983-01-01

294

Bacteria in shear flow  

E-print Network

Bacteria are ubiquitous and play a critical role in many contexts. Their environment is nearly always dynamic due to the prevalence of fluid flow: creeping flow in soil, highly sheared flow in bodily conduits, and turbulent ...

Marcos, Ph.D. Massachusetts Institute of Technology

2011-01-01

295

Bacteria: More Than Pathogens  

NSDL National Science Digital Library

This ActionBioscience lesson plan has students explore the many roles of bacteria, harmful and beneficial. A detailed article written for ActionBioscience by a microbiologist provides background information, which is followed by discussion questions and educational activities designed for middle school to undergraduate biology courses. The Web site also provides carefully selected links for further exploring the topic, including useful sites for student research projects and a lesson: "Bacteria: Friend or Foe?"

Wassenaar, Trudy M.

2008-04-01

296

Complete genome sequence of the N2-fixing broad host range endophyte Klebsiella pneumoniae 342 and virulence predictions verified in mice.  

PubMed

We report here the sequencing and analysis of the genome of the nitrogen-fixing endophyte, Klebsiella pneumoniae 342. Although K. pneumoniae 342 is a member of the enteric bacteria, it serves as a model for studies of endophytic, plant-bacterial associations due to its efficient colonization of plant tissues (including maize and wheat, two of the most important crops in the world), while maintaining a mutualistic relationship that encompasses supplying organic nitrogen to the host plant. Genomic analysis examined K. pneumoniae 342 for the presence of previously identified genes from other bacteria involved in colonization of, or growth in, plants. From this set, approximately one-third were identified in K. pneumoniae 342, suggesting additional factors most likely contribute to its endophytic lifestyle. Comparative genome analyses were used to provide new insights into this question. Results included the identification of metabolic pathways and other features devoted to processing plant-derived cellulosic and aromatic compounds, and a robust complement of transport genes (15.4%), one of the highest percentages in bacterial genomes sequenced. Although virulence and antibiotic resistance genes were predicted, experiments conducted using mouse models showed pathogenicity to be attenuated in this strain. Comparative genomic analyses with the presumed human pathogen K. pneumoniae MGH78578 revealed that MGH78578 apparently cannot fix nitrogen, and the distribution of genes essential to surface attachment, secretion, transport, and regulation and signaling varied between each genome, which may indicate critical divergences between the strains that influence their preferred host ranges and lifestyles (endophytic plant associations for K. pneumoniae 342 and presumably human pathogenesis for MGH78578). Little genome information is available concerning endophytic bacteria. The K. pneumoniae 342 genome will drive new research into this less-understood, but important category of bacterial-plant host relationships, which could ultimately enhance growth and nutrition of important agricultural crops and development of plant-derived products and biofuels. PMID:18654632

Fouts, Derrick E; Tyler, Heather L; DeBoy, Robert T; Daugherty, Sean; Ren, Qinghu; Badger, Jonathan H; Durkin, Anthony S; Huot, Heather; Shrivastava, Susmita; Kothari, Sagar; Dodson, Robert J; Mohamoud, Yasmin; Khouri, Hoda; Roesch, Luiz F W; Krogfelt, Karen A; Struve, Carsten; Triplett, Eric W; Methé, Barbara A

2008-01-01

297

Complete Genome Sequence of the N2-Fixing Broad Host Range Endophyte Klebsiella pneumoniae 342 and Virulence Predictions Verified in Mice  

PubMed Central

We report here the sequencing and analysis of the genome of the nitrogen-fixing endophyte, Klebsiella pneumoniae 342. Although K. pneumoniae 342 is a member of the enteric bacteria, it serves as a model for studies of endophytic, plant-bacterial associations due to its efficient colonization of plant tissues (including maize and wheat, two of the most important crops in the world), while maintaining a mutualistic relationship that encompasses supplying organic nitrogen to the host plant. Genomic analysis examined K. pneumoniae 342 for the presence of previously identified genes from other bacteria involved in colonization of, or growth in, plants. From this set, approximately one-third were identified in K. pneumoniae 342, suggesting additional factors most likely contribute to its endophytic lifestyle. Comparative genome analyses were used to provide new insights into this question. Results included the identification of metabolic pathways and other features devoted to processing plant-derived cellulosic and aromatic compounds, and a robust complement of transport genes (15.4%), one of the highest percentages in bacterial genomes sequenced. Although virulence and antibiotic resistance genes were predicted, experiments conducted using mouse models showed pathogenicity to be attenuated in this strain. Comparative genomic analyses with the presumed human pathogen K. pneumoniae MGH78578 revealed that MGH78578 apparently cannot fix nitrogen, and the distribution of genes essential to surface attachment, secretion, transport, and regulation and signaling varied between each genome, which may indicate critical divergences between the strains that influence their preferred host ranges and lifestyles (endophytic plant associations for K. pneumoniae 342 and presumably human pathogenesis for MGH78578). Little genome information is available concerning endophytic bacteria. The K. pneumoniae 342 genome will drive new research into this less-understood, but important category of bacterial-plant host relationships, which could ultimately enhance growth and nutrition of important agricultural crops and development of plant-derived products and biofuels. PMID:18654632

Fouts, Derrick E.; Tyler, Heather L.; DeBoy, Robert T.; Daugherty, Sean; Ren, Qinghu; Badger, Jonathan H.; Durkin, Anthony S.; Huot, Heather; Shrivastava, Susmita; Kothari, Sagar; Dodson, Robert J.; Mohamoud, Yasmin; Khouri, Hoda; Roesch, Luiz F. W.; Krogfelt, Karen A.; Struve, Carsten; Triplett, Eric W.; Methé, Barbara A.

2008-01-01

298

Aerobic Anoxygenic Phototrophic Bacteria  

PubMed Central

The aerobic anoxygenic phototrophic bacteria are a relatively recently discovered bacterial group. Although taxonomically and phylogenetically heterogeneous, these bacteria share the following distinguishing features: the presence of bacteriochlorophyll a incorporated into reaction center and light-harvesting complexes, low levels of the photosynthetic unit in cells, an abundance of carotenoids, a strong inhibition by light of bacteriochlorophyll synthesis, and the inability to grow photosynthetically under anaerobic conditions. Aerobic anoxygenic phototrophic bacteria are classified in two marine (Erythrobacter and Roseobacter) and six freshwater (Acidiphilium, Erythromicrobium, Erythromonas, Porphyrobacter, Roseococcus, and Sandaracinobacter) genera, which phylogenetically belong to the ?-1, ?-3, and ?-4 subclasses of the class Proteobacteria. Despite this phylogenetic information, the evolution and ancestry of their photosynthetic properties are unclear. We discuss several current proposals for the evolutionary origin of aerobic phototrophic bacteria. The closest phylogenetic relatives of aerobic phototrophic bacteria include facultatively anaerobic purple nonsulfur phototrophic bacteria. Since these two bacterial groups share many properties, yet have significant differences, we compare and contrast their physiology, with an emphasis on morphology and photosynthetic and other metabolic processes. PMID:9729607

Yurkov, Vladimir V.; Beatty, J. Thomas

1998-01-01

299

Lipopolysaccharides in diazotrophic bacteria.  

PubMed

Biological nitrogen fixation (BNF) is a process in which the atmospheric nitrogen (N2) is transformed into ammonia (NH3) by a select group of nitrogen-fixing organisms, or diazotrophic bacteria. In order to furnish the biologically useful nitrogen to plants, these bacteria must be in constant molecular communication with their host plants. Some of these molecular plant-microbe interactions are very specific, resulting in a symbiotic relationship between the diazotroph and the host. Others are found between associative diazotrophs and plants, resulting in plant infection and colonization of internal tissues. Independent of the type of ecological interaction, glycans, and glycoconjugates produced by these bacteria play an important role in the molecular communication prior and during colonization. Even though exopolysaccharides (EPS) and lipochitooligosaccharides (LCO) produced by diazotrophic bacteria and released onto the environment have their importance in the microbe-plant interaction, it is the lipopolysaccharides (LPS), anchored on the external membrane of these bacteria, that mediates the direct contact of the diazotroph with the host cells. These molecules are extremely variable among the several species of nitrogen fixing-bacteria, and there are evidences of the mechanisms of infection being closely related to their structure. PMID:25232535

Serrato, Rodrigo V

2014-01-01

300

Antibacterial effects of Apis mellifera and stingless bees honeys on susceptible and resistant strains of Escherichia coli, Staphylococcus aureus and Klebsiella pneumoniae in Gondar, Northwest Ethiopia  

PubMed Central

Background Honey is a natural substance produced by honeybees and has nutritional and therapeutic uses. In Ethiopia, honeys are used traditionally to treat wounds, respiratory infections and diarrhoea. Recent increase of drug resistant bacteria against the existing antibiotics forced investigators to search for alternative natural remedies and evaluate their potential use on scientific bases. Thus, the aim of this study was to evaluate the antibacterial effects of different types of honeys in Ethiopia which are used traditionally to treat different types of respiratory and gastrointestinal infections. Methods Mueller Hinton agar (70191) diffusion and nutrient broth culture medium assays were performed to determine susceptibility of Staphylococcus aureus (ATCC 25923), Escherichia coli (ATCC 25922) and resistant clinical isolates (Methicillin resistant Staphylococcus aureus(MRSA), Escherichia coli(R) and Klebsiella pneumoniae (R), using honeys of Apis mellifera and stingless bees in northern and north western Ethiopia. Results Honey of the stingless bees produced the highest mean inhibition (22.27?±?3.79 mm) compared to white honey (21.0?±?2.7 mm) and yellow honey (18.0?±?2.3 mm) at 50% (v/v) concentration on all the standard and resistant strains. Stingless bees honey was found to have Minimum Inhibitory Concentration (MIC) of 6.25% (6.25 mg/ml) for 80% of the test organisms compared to 40% for white and yellow Apis mellifera honeys. All the honeys were found to have minimum bactericidal concentration (MBC) of 12.5% (12.5 mg/ml) against all the test organisms. Staphylococcus aureus (ATCC 25923) was susceptible to amoxicillin, methicillin, kanamycine, tetracycline, and vancomycine standard antibiotic discs used for susceptibility tests. Similarly, Escherichia coli (ATCC 25922) was found susceptible for kanamycine, tetracycline and vancomycine. Escherichia coli (ATCC 25922) has not been tested for amoxicillin ampicillin and methicillin. The susceptibility tests performed against Staphylococcus aureus (MRSA), Escherichia coli (R) and Klebsiella pneumoniae (R) using three of methicillin, erythromycin, ampicillin, Penicillin and amoxicillin discs were resistant. But, these drug resistant strains were susceptible to antibacterial agents found in the honeys and inhibited from 16 mm to 20.33 mm. Conclusions Honeys in Ethiopia can be used as therapeutic agents for drug resistant bacteria after pharmaceutical standardization and clinical trials. PMID:24138782

2013-01-01

301

Occurrence of carbapenemase-producing bacteria in coastal recreational waters.  

PubMed

The spread of carbapenemase-producing Gram-negative rods is an emerging global problem. Although most infections due to carbapenemase producers are limited to healthcare institutions, reports of the occurrence of clinically relevant carbapenemase producers in sewage and polluted rivers are increasingly frequent. Polluted rivers flowing to oceans may contaminate coastal waters with multidrug-resistant bacteria, potentially threatening the safety of recreational activities in these locations. Here we assessed the occurrence of carbapenemase producers in water from touristic beaches located in Rio de Janeiro, Brazil, showing distinct pollution patterns. The presence of enterobacteria was noted, including the predominantly environmental genus Kluyvera spp., producing either Klebsiella pneumoniae carbapenemase (KPC) or Guyana extended-spectrum (GES)-type carbapenemases and often associated with quinolone resistance determinants. An Aeromonas sp. harbouring blaKPC and qnrS was also observed. These findings strengthen the role of aquatic matrices as reservoirs and vectors of clinically relevant antimicrobial-resistant bacteria, with potential to favour the spread of these resistance threats throughout the community. PMID:25499185

Montezzi, Lara Feital; Campana, Eloiza Helena; Corrêa, Laís Lisboa; Justo, Livia Helena; Paschoal, Raphael Paiva; da Silva, Isabel Lemos Vieira Dias; Souza, Maria do Carmo Maciel; Drolshagen, Marcia; Picão, Renata Cristina

2015-02-01

302

Detection of Carbapenemase Production in Gram-negative Bacteria  

PubMed Central

The greatest threat to antimicrobial treatment of infections caused by Gram-negative bacteria is the production of carbapenemases. Metallo-beta-lactamases and plasmid-mediated serine carbepenemases like Klebsiella pneumonia carbapenemase are threatening the utility of almost all currently available beta-lactams including carbapenems. Detection of organisms producing carbapenemases can be difficult, because their presence does not always produce a resistant phenotype on conventional disc diffusion or automated susceptibility testing methods. These enzymes are often associated with laboratory reports of false susceptibility to carbapenems which can be potentially fatal. Moreover, most laboratories do not attempt to detect carbapenemases. This may be due to the lack of availability of guidelines and procedures or lack of knowledge and expertise. Because routine susceptibility tests may be unreliable, special tests are required to detect the resistance mechanisms involved. This document describes the standard methodology for detection of various types of carbapenemases, which can be put to use by laboratories working on antimicrobial resistance in Gram-negative bacteria. PMID:25328329

Asthana, Sonal; Mathur, Purva; Tak, Vibhor

2014-01-01

303

Distribution Frequency of Pathogenic Bacteria Isolated from Cutaneus Leishmaniasis Lesions  

PubMed Central

Cutaneous leishmaniasis (CL) is a parasitic disease characterized by single or multiple ulcerations. Secondary bacterial infections are one of the complications that can increase the tissue destruction and the resulting scar. To better determine the incidence of real secondary bacterial infections in CL, we designed the current study. This was a cross-sectional study performed in Skin Diseases and Leishmaniasis Research Centre, Isfahan, Iran. A total of 1,255 patients with confirmed CL enrolled in the study. Sterile swaps were achieved for ulcer exudates and scraping was used for non-ulcerated lesions. All samples were transferred to tryptic soy broth medium. After 24 hr of incubation at 37? they were transferred to eosin methylene blue agar (EMB) and blood agar. Laboratory tests were used to determine the species of bacteria. Among 1,255 confirmed CL patients, 274 (21.8%) had positive cultures for secondary bacterial infections. The bacteria isolated from the lesions were Staphylococcus aureus in 190 cases (69.3%), coagulase negative Staphylococcus in 63 cases (23.0%), E. coli in 10 cases (3.6%), Proteus sp. in 6 cases (2.2%), and Klebsiella sp. in 5 cases (1.9%). The results show that the overall incidence of secondary bacterial infections in the lesions of CL was 21.8%, considerably high. The incidence of secondary bacterial infections was significantly higher in ulcerated lesions compared with non-ulcerated lesions. PMID:18830062

Sadeghian, Giti; Hejazi, SH

2008-01-01

304

Exogenous Alanine and/or Glucose plus Kanamycin Kills Antibiotic-Resistant Bacteria.  

PubMed

Multidrug-resistant bacteria are an increasingly serious threat to human and animal health. However, novel drugs that can manage infections by multidrug-resistant bacteria have proved elusive. Here we show that glucose and alanine abundances are greatly suppressed in kanamycin-resistant Edwardsiella tarda by GC-MS-based metabolomics. Exogenous alanine or glucose restores susceptibility of multidrug-resistant E. tarda to killing by kanamycin, demonstrating an approach to killing multidrug-resistant bacteria. The mechanism underlying this approach is that exogenous glucose or alanine promotes the TCA cycle by substrate activation, which in turn increases production of NADH and proton motive force and stimulates uptake of antibiotic. Similar results are obtained with other Gram-negative bacteria (Vibrio parahaemolyticus, Klebsiella pneumoniae, Pseudomonas aeruginosa) and Gram-positive bacterium (Staphylococcus aureus), and the results are also reproduced in a mouse model for urinary tract infection. This study establishes a functional metabolomics-based strategy to manage infection by antibiotic-resistant bacteria. PMID:25651179

Peng, Bo; Su, Yu-Bin; Li, Hui; Han, Yi; Guo, Chang; Tian, Yao-Mei; Peng, Xuan-Xian

2015-02-01

305

In vitro growth inhibition of mastitis causing bacteria by phenolics and metal chelators  

SciTech Connect

Antimicrobial activities of three phenolic compounds and four metal chelators were tested at 0, 250, 500, and 1000 ppm in vitro against four major mastitis-causing bacteria, Streptococcus agalactiae, Staphylococcus aureus, Klebsiella pnuemoniae, and Escherichia coli. Overall, butylated hydroxyanisole and tert-butylhydroquinone showed the greatest antimicrobial activity. These phenolics were bactericidal at 250 to 500 ppm against all four bacteria tested. The butylated hydroxytoluene was bactericidal against the gram-positive bacteria but was ineffective against the coliforms. At 250 ppm, disodium ethylenediaminetetraacetic acid was bactericidal against the gram-positive bacteria but much less effective against the gram-negatives. However, diethylene-triaminepentaacetic acid was more growth inhibitory than ethylenediaminetetraacetic acid against the gram-negative bacteria and especially against Escherichia coli. All other compounds were generally much less effective or ineffective against all four microorganisms. Therefore, butylated hydroxyanisole, butylated hydroxytoluene, tert-butylhydroquinone, ethylenediaminetetraacetic acid, and diethylenetriaminepentaacetic acid may have practical implications in the prevention or treatment of bovine mastitis.

Chew, B.P.; Tjoelker, L.W.; Tanaka, T.S.

1985-11-01

306

Prevalence and antimicrobial susceptibility of gram-negative bacteria isolated from bovine mastitis between 2003 and 2008 in Korea.  

PubMed

The objective of this study was to assess trends in the prevalence and distribution of gram-negative bacteria isolated from bovine mastitis and their antimicrobial susceptibilities during a 6-yr period between 2003 and 2008 in Korea. Escherichia coli, Pseudomonas fluorescens, Klebsiella pneumoniae, Enterobacter cloacae, Acinetobacter lwoffi/junii, Pseudomonas aeruginosa, and Serratia marcescens were the most commonly observed pathogens during this period. Generally, gram-negative bacteria showed low susceptibilities to most of the antimicrobials tested in this study, except amikacin and gentamicin. Although these 2 aminoglycosides were broadly active against gram-negative bacteria, less than half of those bacteria showed susceptibilities to streptomycin. The beta-lactams, except piperacillin, had the lowest activity among antimicrobials tested in this study. Susceptibilities to chloramphenicol and trimethoprim were fairy high in all genera of gram-negative bacteria, except Acinetobacter spp. and Pseudomonas spp., whereas relatively high resistance to tetracycline was observed uniformly among gram-negative bacteria. There was no significant change in the prevalence of bacterial and the proportion of antimicrobial resistance among gram-negative bacteria isolates during a 6-yr period. PMID:19389959

Nam, H M; Lim, S K; Kang, H M; Kim, J M; Moon, J S; Jang, K C; Kim, J M; Joo, Y S; Jung, S C

2009-05-01

307

Pathogenicity of Aeromonas hydrophila, Klebsiella pneumoniae, and Proteus mirabilis to Brown Tree Frogs (Litoria ewingii)  

PubMed Central

Bacterial dermatosepticemia, a systemic infectious bacterial disease of frogs, can be caused by several opportunistic gram-negative bacterial species including Aeromonas hydrophila, Chryseobacterium indologenes, Chryseobacterium meningosepticum, Citrobacter freundii, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa, and Serratia liquifaciens. Here we determined the pathogenicity of 3 bacterial species (Aeromonas hydrophila, Klebsiella pneumoniae, and Proteus mirabilis) associated with an outbreak of fatal dermatosepticemia in New Zealand Litoria ewingii frogs. A bath challenge method was used to expose test frogs to individual bacterial species (2 × 107 cfu/mL in pond water); control frogs were exposed to uninfected pond water. None of the control frogs or those exposed to A. hydrophila or P. mirabilis showed any morbidity or mortality. Morbidity and mortality was 40% among frogs exposed to K. pneumonia, and the organism was reisolated from the hearts, spleens, and livers of affected animals. PMID:20412685

Schadich, Ermin; Cole, Anthony LJ

2010-01-01

308

Biosynthesis of selenium nanoparticles using Klebsiella pneumoniae and their recovery by a simple sterilization process  

PubMed Central

The use of biologically derived metal nanoparticles for various proposes is going to be an issue of considerable importance; thus, appropriate methods should be developed and tested for the biological synthesis and recovery of these nanoparticles from bacterial cells. In this research study, a strain of Klebsiella pneumoniae was tested for its ability to synthesize elemental selenium nanoparticles from selenium chloride. A broth of Klebsiella pneumoniae culture containing selenium nanoparticles was subjected to sterilization at 121oC and 17 psi for 20 minutes. Released selenium nanoparticles ranged in size from 100 to 550 nm, with an average size of 245 nm. Our study also showed that no chemical changes occurred in selenium nanoparticles during the wet heat sterilization process. Therefore, the wet heat sterilization process can be used successfully to recover elemental selenium from bacterial cells. PMID:24031517

Fesharaki, Parisa Jafari; Nazari, Pardis; Shakibaie, Mojtaba; Rezaie, Sassan; Banoee, Maryam; Abdollahi, Mohammad; Shahverdi, Ahmad Reza

2010-01-01

309

Biochemical characterization of E. coli transconjugants with plasmids derived from Klebsiella pneumoniae.  

PubMed

Sixty-three strains of E. coli transconjugants derived from E. coli K12 J62-1 containing plasmids derived from Klebsiella pneumoniae, were examined for the presence of phenotypic markers other than antibiotic resistance. This investigation was carried out using API 50CHE and API ZYM tests. Beta-glucosidase was found in 63/63 J62-1 transconjugants. Dulcitol dehydrogenase was present in 92.1% while beta-galactosidase was present in 70% of transconjugants. None of the three enzymes were present in the recipient. Dulcitol dehydrogenase was present only in the transconjugants and is absent from the donors and recipient. The transconjugants, cured of their antibiotic resistant plasmids retained dulcitol dehydrogenase activity. The Klebsiella donors were not cured of antibiotic resistance by the curing process. PMID:3895456

Bow, H

1985-03-01

310

Prevention of biofilm colonization by Gram-negative bacteria on minocycline-rifampin-impregnated catheters sequentially coated with chlorhexidine.  

PubMed

Resistant Gram-negative bacteria are increasing central-line-associated bloodstream infection threats. To better combat this, chlorhexidine (CHX) was added to minocycline-rifampin (M/R) catheters. The in vitro antimicrobial activity of CHX-M/R catheters against multidrug resistant, Gram-negative Acinetobacter baumannii, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia was tested. M/R and CHX-silver sulfadiazine (CHX/SS) catheters were used as comparators. The novel CHX-M/R catheters were significantly more effective (P < 0.0001) than CHX/SS or M/R catheters in preventing biofilm colonization and showed better antimicrobial durability. PMID:24165191

Jamal, Mohamed A; Rosenblatt, Joel S; Hachem, Ray Y; Ying, Jiang; Pravinkumar, Egbert; Nates, Joseph L; Chaftari, Anne-Marie P; Raad, Issam I

2014-01-01

311

Prevention of Biofilm Colonization by Gram-Negative Bacteria on Minocycline-Rifampin-Impregnated Catheters Sequentially Coated with Chlorhexidine  

PubMed Central

Resistant Gram-negative bacteria are increasing central-line-associated bloodstream infection threats. To better combat this, chlorhexidine (CHX) was added to minocycline-rifampin (M/R) catheters. The in vitro antimicrobial activity of CHX-M/R catheters against multidrug resistant, Gram-negative Acinetobacter baumannii, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia was tested. M/R and CHX-silver sulfadiazine (CHX/SS) catheters were used as comparators. The novel CHX-M/R catheters were significantly more effective (P < 0.0001) than CHX/SS or M/R catheters in preventing biofilm colonization and showed better antimicrobial durability. PMID:24165191

Jamal, Mohamed A.; Rosenblatt, Joel S.; Hachem, Ray Y.; Ying, Jiang; Pravinkumar, Egbert; Nates, Joseph L.; Chaftari, Anne-Marie P.

2014-01-01

312

Community-Acquired Klebsiella pneumoniae Central Nervous System Infections in Adults in Singapore  

Microsoft Academic Search

A series of successfully managed community-acquired Klebsiella pneumoniae infections of the central nervous system (CNS) that occurred in six non-neurosurgical adult patients in Singapore over a 2-year period is reported. Three patients had abscesses that were drained, and three had meningitis; all were treated with third-generation cephalosporins. All six patients were middle-aged adults, three of whom were food handlers. Clinicians

A. G. Habib; P. A. Tambyah

2003-01-01

313

Effect of Iron Deprivation on the Production of Siderophores and Outer Membrane Proteins in Klebsiella aerogenes  

Microsoft Academic Search

The outer membrane (OM) protein profile of Klebsiella aerogenes grown in an iron rich chemically defined medium (Fe+CDM) showed three major proteins of 32.5, 35.5 and 39.0 kDal. The 35.5 and 39-0 kDal proteins were non-covalently associated with peptidoglycan. At least six new iron regulated outer membrane proteins (IRMP) of 69, 70, 73, 75, 78 and 83 kDal, which were

PAUL WILLIAMS; MICHAEL R. W. BROWN; PETER A. LAMBERT

1984-01-01

314

The Klebsiella pneumoniae wabG Gene: Role in Biosynthesis of the Core Lipopolysaccharide and Virulence  

Microsoft Academic Search

To determine the function of the wabG gene in the biosynthesis of the core lipopolysaccharide (LPS) of Klebsiella pneumoniae, we constructed wabG nonpolar mutants. Data obtained from the comparative chemical and structural analysis of LPS samples obtained from the wild type, the mutant strain, and the complemented mutant demonstrated that the wabG gene is involved in attachment to -L-glycero-D-manno-heptopyranose II

Luis Izquierdo; Nuria Coderch; Nuria Pique; Emiliano Bedini; Maria Michela Corsaro; Susana Merino; Sandra Fresno; Juan M. Tomas; Miguel Regue

2003-01-01

315

Klebsiella pneumoniae Carbapenemase-Producing Enterobacteriaceae Testing Susceptible to Cefepime by Reference Methods  

PubMed Central

?-Lactam susceptibility of 499 Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacteriaceae, determined by reference broth microdilution, demonstrated that 14.4% of isolates were categorized as cefepime susceptible according to current CLSI breakpoints. Ceftazidime- and meropenem-susceptible isolates were also observed (2.6 and 3.0%, respectively). Cefepime-susceptible KPC-producing isolates may confuse laboratory staff and clinicians in their therapeutic choices. PMID:23616458

Jones, Ronald N.; Mendes, Rodrigo E.; Castanheira, Mariana

2013-01-01

316

Oxygen sensitivity of the nifLA promoter of Klebsiella pneumoniae  

SciTech Connect

Oxygen sensitivity of the nifLA promoter of Klebsiella pneumoniae has been demonstrated. Studies on the oxygen regulation of nifB-lacZ and nifH-lacZ fusions in the presence of the nifLA operon, which contains either an intact or a deleted nifL gene, indicate that possible both the nifL promoter and the nifL product are responsible for nif repression by oxygen.

Kong, Q.T.; Wu, Q.L.; Ma, Z.F.; Shen, S.C.

1986-05-01

317

Evaluation of Techniques for Detection of Carbapenem-Resistant Klebsiella pneumoniae in Stool Surveillance Cultures  

Microsoft Academic Search

Screening for gastrointestinal colonization with multidrug-resistant nosocomial pathogens is an important component of infection control protocols. In the New York City region, carbapenem-resistant Klebsiella pneu- moniae strains, which harbor the KPC carbapenem-hydrolyzing -lactamase, have rapidly emerged. The potential utility of screening medium, which involved using 10-g imipenem disks, was investigated. The method of placing a sample from a fecal surveillance

D. Landman; J. K. Salvani; S. Bratu; J. Quale

2005-01-01

318

Novel VIM Metallo-?-Lactamase Variant, VIM-24, from a Klebsiella pneumoniae Isolate from Colombia?  

PubMed Central

We report the emergence of a novel VIM variant (VIM-24) in a Klebsiella pneumoniae isolate in Colombia. The isolate displays MICs for carbapenems below the resistance breakpoints, posing a real challenge for its detection. The blaVIM-24 gene was located within a class 1 integron carried on a large plasmid. Further studies are needed to clarify its epidemiological and clinical impact. PMID:21282438

Montealegre, Maria Camila; Correa, Adriana; Briceño, David F.; Rosas, Natalia C.; De La Cadena, Elsa; Ruiz, Sory J.; Mojica, Maria F.; Camargo, Ruben Dario; Zuluaga, Ivan; Marin, Adriana; Quinn, John P.; Villegas, Maria Virginia

2011-01-01

319

Identification and Differentiation of Carbapenemases in Klebsiella Pneumoniae: A Phenotypic Test Evaluation Study from Jaipur, India  

PubMed Central

Background: Carbapenem resistance is one of the major threats faced in antimicrobial treatment of infections caused by gram negative organisms. In recent years, carbapenem resistance has emerged in Klebsiella pneumoniae isolates due to acquisition of carbapenemases which belong to Ambler class A KPC type enzymes or to Ambler class B metallo-?-lactamases (MBL). Routine lab detection of carbapenemase producing K. pneumoniae isolates is crucial, both for a therapeutic management and an efficient infection control. Materials and Methods: A study was conducted on 60 carbapenem resistant Klebsiella pneumoniae strains which were isolated from various clinical samples over a period of one year (September 2010-August 2011), at a tertiary care hospital in Jaipur. Phenotypic confirmatory test was done by using discs of Meropenem alone and those with phenyl boronic acid (PBA) or Ethylenediaminetetraacetic acid (EDTA) or both, for detection of carbapenemase production and differentiation of KPC and MBL enzymes. Results: Of the 60 carbapenem resistant Klebsiella pneumoniae isolates, 53 (88.33%) were found to be MBL producers, 4(6.66%) were found to be MBL and KPC co-producers and the rest of the 3(5%) isolates were negative for both MBL and KPC production, as was seen by combined disc testing. Conclusion: The combined disc test is a simple test which can be used for differentiation of carbapenemases and it can be easily incorporated in routine microbiology lab testing. PMID:25177562

2014-01-01

320

wzi Gene Sequencing, a Rapid Method for Determination of Capsular Type for Klebsiella Strains  

PubMed Central

Pathogens of the genus Klebsiella have been classified into distinct capsular (K) types for nearly a century. K typing of Klebsiella species still has important applications in epidemiology and clinical microbiology, but the serological method has strong practical limitations. Our objective was to evaluate the sequencing of wzi, a gene conserved in all capsular types of Klebsiella pneumoniae that codes for an outer membrane protein involved in capsule attachment to the cell surface, as a simple and rapid method for the prediction of K type. The sequencing of a 447-nucleotide region of wzi distinguished the K-type reference strains with only nine exceptions. A reference wzi sequence database was created by the inclusion of multiple strains representing K types associated with high virulence and multidrug resistance. A collection of 119 prospective clinical isolates of K. pneumoniae were then analyzed in parallel by wzi sequencing and classical K typing. Whereas K typing achieved typeability for 81% and discrimination for 94.4% of the isolates, these figures were 98.1% and 98.3%, respectively, for wzi sequencing. The prediction of K type once the wzi allele was known was 94%. wzi sequencing is a rapid and simple method for the determination of the K types of most K. pneumoniae clinical isolates. PMID:24088853

Passet, Virginie; Haugaard, Anita Björk; Babosan, Anamaria; Kassis-Chikhani, Najiby; Struve, Carsten; Decré, Dominique

2013-01-01

321

Characterization of the gene cluster involved in allantoate catabolism and its transcriptional regulation by the RpiR-type repressor HpxU in Klebsiella pneumoniae.  

PubMed

Bacteria, fungi, and plants have metabolic pathways for the utilization of nitrogen present in purine bases. In Klebsiella pneumoniae, the genes responsible for the assimilation of purine ring nitrogen are distributed in three separated clusters. We characterized the gene cluster involved in the metabolism of allantoate (genes KPN_01761 to KPN_01771). The functional assignments of HpxK, as an allantoate amidohydrolase, and of HpxU, as a regulator involved in the control of allantoate metabolism, were assessed experimentally. Gene hpxU encodes a repressor of the RpiR family that mediates the regulation of this system by allantoate. In this study, the binding of HpxU to the hpxF promoter and to the hpxU-hpxW intergenic region containing the divergent promoter for these genes was evidenced by electrophoretic mobility shift assays. Allantoate released the HpxU repressor from its target operators whereas other purine intermediate metabolites, such as allantoin and oxamate, failed to induce complex dissociation. Sequence alignment of the four HpxU identified operators identified TGAA-N8-TTCA as the consensus motif recognized by the HpxU repressor. PMID:24568032

Guzmán, Karla; Campos, Evangelina; Aguilera, Laura; Toloza, Lorena; Giménez, Rosa; Aguilar, Juan; Baldoma, Laura; Badia, Josefa

2013-09-01

322

Phytochemistry and Preliminary Assessment of the Antibacterial Activity of Chloroform Extract of Amburana cearensis (Allemão) A.C. Sm. against Klebsiella pneumoniae Carbapenemase-Producing Strains  

PubMed Central

The chloroform extract of the stem bark of Amburana cearensis was chemically characterized and tested for antibacterial activity.The extract was analyzed by gas chromatography and mass spectrometry. The main compounds identified were 4-methoxy-3-methylphenol (76.7%), triciclene (3.9%), ?-pinene (1.0%), ?-pinene (2.2%), and 4-hydroxybenzoic acid (3.1%). Preliminary antibacterial tests were carried out against species of distinct morphophysiological characteristics: Escherichia coli, Salmonella enterica Serotype Typhimurium, Pseudomonas aeruginosa, Staphylococcus aureus, Listeria monocytogenes, and Bacillus cereus. The minimum inhibitory concentration (MIC) was determinate in 96-well microplates for the chloroform extract and an analogue of themain compound identified, which was purchased commercially.We have shown that plant's extract was only inhibitory (but not bactericidal) at the maximum concentration of 6900??g/mL against Pseudomonas aeruginosa and Bacillus cereus. Conversely, the analogue 2-methoxy-4-methylphenol produced MICs ranging from215 to 431??g/mL against all bacterial species.New antibacterial assays conducted with such chemical compound against Klebsiella pneumoniae carbapenemase-producing strains have shown similarMICresults and minimumbactericidal concentration (MBC) of 431??g/mL.We conclude that A. cearensis is a good source of methoxy-methylphenol compounds,which could be screened for antibacterial activity againstmultiresistant bacteria fromdifferent species PMID:24772183

Sá, Mirivaldo Barros; Ralph, Maria Taciana; Nascimento, Danielle Cristina Oliveira; Ramos, Clécio Souza; Barbosa, Isvânia Maria Serafin; Sá, Fabrício Bezerra; Lima-Filho, J. V.

2014-01-01

323

Efficacy of pivmecillinam for treatment of lower urinary tract infection caused by extended-spectrum ?-lactamase-producing Escherichia coli and Klebsiella pneumoniae.  

PubMed

To evaluate the clinical and bacteriological efficacy of pivmecillinam against lower urinary tract infection (UTI) caused by extended-spectrum ?-lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae, patients treated for lower UTI with pivmecillinam (n=8) were studied. Patients treated with nitrofurantoin (n=3) and trimethoprim (n=3) or a combination of these agents with pivmecillinam (n=3) were included as a control group. Antimicrobial susceptibility was determined with EUCAST methodology. Bacteriologic cure was defined as <10(3) CFU/ml at follow-up (30 days), and clinical cure as resolved UTI symptoms after completed treatment. All patients receiving pivmecillinam had good clinical response (8/8), but bacteriological cure rates were low (2/8). However, none of the patients with persisting bacteriuria had a relapse of UTI symptoms within 6 months. All isolates were susceptible to the given antimicrobial. Most isolates belonged to the CTX-M-1 group (n=11, 65%) or CTX-M-9-group (n=4, 24%). Four E. coli isolates belonged to the international clone O25b-ST131 (25%). In conclusion, pivmecillinam had good clinical activity against lower UTI caused by ESBL-producing Enterobacteriaceae, but bacteriological cure rates were low. The persistent bacteriuria appears to be of little clinical importance, but larger clinical studies are needed to determine the usefulness of pivmecillinam in infections caused by ESBL-producing bacteria. PMID:22204597

Titelman, Emilia; Iversen, Aina; Kalin, Mats; Giske, Christian G

2012-04-01

324

Molecular epidemiology of extended-spectrum beta-lactamase (ESBL)-positive Klebsiella pneumoniae from bloodstream infections and risk factors for mortality.  

PubMed

The prevalence of extended-spectrum beta-lactamase (ESBL)-positive Klebsiella pneumoniae is growing worldwide. Infections with these bacteria are suspected to be related to increased mortality. We aimed to estimate the distribution of ESBL genotypes and to assess the impact on mortality associated with ESBL positivity in cases of bloodstream infection (BSI) due to K. pneumoniae. We performed a cohort study on patients with K. pneumoniae BSI between 2008 and 2011. Presence of ESBL genes was analyzed by PCR and sequencing. Risk factors for mortality were analyzed by Cox-proportional hazard regression. We identified 286 ESBL-negative (81%) and 66 (19%) ESBL-positive cases. 97% (n = 64) of the ESBL-positive isolates were susceptible for meropenem. The most common ESBL genotypes were CTX-M-15 (60%), SHV-5 (27%) and CTX-M-3 (5%). Significant risk factors for mortality were chronic pulmonary disease (HR 1.747) and moderate/severe renal disease (HR 2.572). ESBL positivity was not associated with increased mortality. PMID:25224765

Gürntke, Stephan; Kohler, Christian; Steinmetz, Ivo; Pfeifer, Yvonne; Eller, Christoph; Gastmeier, Petra; Schwab, Frank; Leistner, Rasmus

2014-12-01

325

Aquatic Bacteria Samples  

USGS Multimedia Gallery

On April 20, 2010, the BP Deepwater Horizon drilling platform collapsed and sank in the Gulf of Mexico, causing one of the largest oil spills in history. One of the big dilemmas in responding to the oil spil is how to clean up the oil itself. One way currently under research is to use bacteria that ...

2010-06-14

326

bacteria driven polymerization  

E-print Network

12/20/2007 1 Motion of bacteria driven by actin polymerization forces Michael C. DeSantis Physics.B. Alberts) Examples of other intracellular pathogens propelled by actoclampins (actin filament (+)-end by actin polymerization. Cell signaling and its influence by actin polymerization transitions

Wang, Yan Mei

327

PCR-RFLP analysis of the diversity of phytate-degrading bacteria in the Tibetan Plateau.  

PubMed

Phytases play a very important role in increasing phytate digestion and reducing phosphorus pollution in the environment, and phytate-degrading bacteria have a ubiquitous distribution in the environment. Due to its extremely harsh environment, the Tibetan Plateau breeds possibly abundant, extreme microorganisms. In this research, 67 phytate-degrading bacteria were isolated from different habitats in the Tibetan Plateau. Among all isolates, 40.3% were screened from farmland, 25.3% from wetland, 4.5% from saline-alkaline soil, 7.5% from hot springs, and 22.4% from lawns, which showed that the distribution of the phytate-degrading bacteria varied with habitats. By the PCR-RFLP method, 16 different species were identified and named, 4 of which are reported for the first time as phytate-degrading bacteria, that is, Uncultured Enterococcus sp. GYPB01, Bacillaceae bacterium strain GYPB05, Endophytic bacterium strain GYPB16, and Shigella dysenteria strain GYPB22. Through the assay of phytase activity of 16 strains, Klebsiella sp. strain GYPB15 displayed the highest capability of phytase production. Through analysis of the optimum pH, the optimum temperature, and the thermal stability of enzyme from 16 strains, some especial phytate-degrading bacteria were obtained. Our findings clearly indicate a good relation between the composition of the soils from the different environments in the Tibetan Plateau and populations of cultivable phytate-degrading bacteria. Moreover, extreme harsh soils are logically the best soils in which to find some strains of phytate-degrading bacteria for exploiting in the fields of biotechnology and industry. PMID:23586748

Miao, Yu-Zhi; Xu, Hui; Fei, Bao-Jin; Qiao, Dai-Rong; Cao, Yi

2013-04-01

328

Levels of bacteria, fungi, and endotoxin in bulk and aerosolized corn silage.  

PubMed Central

Three samples of silage taken from the surface of a silo and from depths of 20 and 45 cm in the silo were studied for identification of the potential agents causing symptoms of organic dust toxic syndrome. The samples were examined by dilution plating before and after aerosolization in an acoustical dust generator. Aerosol samples were collected by liquid impinger and filter cassettes. The samples were examined for total aerobic bacteria, anaerobic bacteria, gram-negative bacteria, lactobacilli, listeriae, thermophilic actinomycetes, fungi, and endotoxin. Very high levels of total aerobic bacteria and fungi were found in the surface sample (up to 10(9) CFU/g in the bulk sample and up to 10(9) CFU/m3 after aerosolization), whereas the corresponding values from the deepest site were 100 to 50,000 times lower. Aspergillus fumigatus predominated among the fungi, whereas Bacillus and gram-negative organisms (Pseudomonas, Alcaligenes, Citrobacter, and Klebsiella species) prevailed among bacteria. Thermophilic actinomycetes occurred in numbers up to 10(7) CFU/g in the bulk samples, whereas anaerobic bacteria, lactobacilli, and listeriae were only few or absent. The concentration of endotoxin was high in the surface sample (up to 211.4 Endotoxin Units/mg) and about 200-fold lower in the sample from the deepest site. The results show that contact with dust from the surface of silage carries the risk of exposure to high concentrations of microorganisms, of which A. fumigatus and endotoxin-producing bacteria are the most probable disease agents. PMID:2757375

Dutkiewicz, J; Olenchock, S A; Sorenson, W G; Gerencser, V F; May, J J; Pratt, D S; Robinson, V A

1989-01-01

329

Bacteria associated with crabs from cold waters with emphasis on the occurrence of potential human pathogens.  

PubMed Central

A diverse array of bacterial species, including several potential human pathogens, was isolated from edible crabs collected in cold waters. Crabs collected near Kodiak Island, Alaska, contained higher levels of bacteria than crabs collected away from regions of human habitation. The bacteria associated with the crabs collected near Kodiak included Yersinia enterocolitica, Klebsiella pneumoniae, and coagulase-negative Staphylococcus species; the pathogenicity of these isolates was demonstrated in mice. Although coliforms were not found, the bacterial species associated with the tissues of crabs collected near Kodiak indicate possible fecal contamination that may have occurred through contact with sewage. Compared with surrounding waters and sediments, the crab tissues contained much higher proportions of gram-positive cocci. As revealed by indirect plate counts and direct scanning electron microscopic observations, muscle and hemolymph tissues contained much lower levels of bacteria than shell and gill tissues. After the death of a crab, however, the numbers of bacteria associated with hemolymph and muscle tissues increased significantly. Microcosm studies showed that certain bacterial populations, e.g., Vibrio cholerae, can be bioaccumulated in crab gill tissues. The results of this study indicate the need for careful review of waste disposal practices where edible crabs may be contaminated with microorganisms that are potential human pathogens and the need for surveillance of shellfish for pathogenic microorganisms that naturally occur in marine ecosystems. Images PMID:6742824

Faghri, M A; Pennington, C L; Cronholm, L S; Atlas, R M

1984-01-01

330

Differential effects of catecholamines on in vitro growth of pathogenic bacteria  

NASA Technical Reports Server (NTRS)

Supplementation of minimal medium inoculated with bacterial cultures with norepinephrine, epinephrine, dopamine, or isoproterenol resulted in marked increases in growth compared to controls. Norepinephrine and dopamine had the greatest enhancing effects on growth of cultures of Pseudomonas aeruginosa and Klebsiella pneumoniae, while epinephrine and isoproterenol also enhanced growth to a lesser extent. The growth of Escherichia coli in the presence of norepinephrine was greater than growth in the presence of the three other neurochemicals used in the study. Growth of Staphylococcus aureus was also enhanced in the presence of norepinephrine, but not to the same degree as was the growth of gram negative bacteria. Addition of culture supernatants from E. coli cultures that had been grown in the presence of norepinephrine was able to enhance the growth of K. pneumoniae. Addition of the culture supernatant fluid culture from E. coli cultures that had been grown in the presence of norepinephrine did not enhance growth of P. aeruginosa or S. aureus. Culture supernatant fluids from bacteria other than E. coli grown in the presence of norepinephrine were not able to enhance the growth of any bacteria tested. The results suggest that catecholamines can enhance growth of pathogenic bacteria, which may contribute to development of pathogenesis; however, there is no uniform effect of catecholamines on bacterial growth.

Belay, Tesfaye; Sonnenfeld, Gerald

2002-01-01

331

Anaerobic bacteria grow within Candida albicans biofilms and induce biofilm formation in suspension cultures.  

PubMed

The human microbiome contains diverse microorganisms, which share and compete for the same environmental niches. A major microbial growth form in the human body is the biofilm state, where tightly packed bacterial, archaeal, and fungal cells must cooperate and/or compete for resources in order to survive. We examined mixed biofilms composed of the major fungal species of the gut microbiome, Candida albicans, and each of five prevalent bacterial gastrointestinal inhabitants: Bacteroides fragilis, Clostridium perfringens, Escherichia coli, Klebsiella pneumoniae, and Enterococcus faecalis. We observed that biofilms formed by C. albicans provide a hypoxic microenvironment that supports the growth of two anaerobic bacteria, even when cultured in ambient oxic conditions that are normally toxic to the bacteria. We also found that coculture with bacteria in biofilms induces massive gene expression changes in C. albicans, including upregulation of WOR1, which encodes a transcription regulator that controls a phenotypic switch in C. albicans, from the "white" cell type to the "opaque" cell type. Finally, we observed that in suspension cultures, C. perfringens induces aggregation of C. albicans into "mini-biofilms," which allow C. perfringens cells to survive in a normally toxic environment. This work indicates that bacteria and C. albicans interactions modulate the local chemistry of their environment in multiple ways to create niches favorable to their growth and survival. PMID:25308076

Fox, Emily P; Cowley, Elise S; Nobile, Clarissa J; Hartooni, Nairi; Newman, Dianne K; Johnson, Alexander D

2014-10-20

332

Investigation of the antibacterial activity of a short cationic peptide against multidrug-resistant Klebsiella pneumoniae and Salmonella typhimurium strains and its cytotoxicity on eukaryotic cells.  

PubMed

With the growing microbial resistance to conventional antimicrobial agents, the development of novel and alternative therapeutic strategies are vital. During recent years novel peptide antibiotics with broad spectrum activity against many Gram-positive and Gram-negative bacteria have been developed. In this study, antibacterial activity of CM11 peptide (WKLFKKILKVL-NH2), a short cecropin-melittin hybrid peptide, is evaluated against antibiotic-resistant strains of Klebsiella pneumoniae and Salmonella typhimurium as two important pathogenic bacteria. To appraise the antibacterial activity, minimal inhibitory concentration (MIC), minimal bactericidal concentration (MBC) and bactericidal killing assay were utilized with different concentrations (2-128 mg/L) of peptide. To evaluate cytotoxic effect of peptide, viability of RAJI, Hela, SP2/0, CHO, LNCAP cell lines and primary murine macrophage cells were also investigated with MTT assay in different concentrations (3-24 and 0.5-16 mg/L, respectively). MICs of K. pneumoniae and S. typhimurium isolates were in range of 8-16 and 4-16 mg/L, respectively. In bactericidal killing assay no colonies were observed at 2X MIC for K. pneumoniae and S. typhimurium isolates after 80-90 min, respectively. Despite the fact that CM11 reveals no significant cytotoxicity on RAJI, Hela, SP2/0, and CHO cell lines beneath 6 mg/L at first 24 and 48 h, the viability of LNCAP cells are about 50 % at 3 mg/L, which indicates strong cytotoxicity of the peptide. In addition, macrophage toxicity by MTT assay showed that LD50 of CM11 peptide is 12 ?M (16 mg/L) after 48 h while in this concentration after 24 h macrophage viability was about 70 %. PMID:24323118

Moghaddam, Mehrdad Moosazadeh; Barjini, Kamal Azizi; Ramandi, Mahdi Fasihi; Amani, Jafar

2014-05-01

333

Rapid discrimination of klebsiella pneumoniae carbapenemase 2 - producing and non-producing klebsiella pneumoniae strains using near-infrared spectroscopy (NIRS) and multivariate analysis.  

PubMed

Klebsiella pneumoniae Carbapenemase (KPC-2)-producing and non-producing Klebsiella pneumoniae (KP) have rapidly disseminated worldwide, challenging the diagnostics of Gram-negative infections. We evaluate the potential of a novel non-destructive and rapid method based on Near-Infrared Spectroscopic (NIRS) and multivariate analysis for distinguishing KPC-2 - producing and non-producing KP. Thirty-nine NIRS spectra (24 KPC-2-producing KP, 15 KPC-2 non-producing KP) were acquired; different pre-processing methods such as baseline correction, derivative and Savitzky-Golay smoothing were performed. A spectral region fingerprint was achieved after using genetic algorithm-linear discriminant analysis (GA-LDA) and successive projection algorithm (SPA-LDA) algorithms for variable selection. The variables selected were then used for discriminating the microorganisms.Accuracy test results including sensitivity and specificity were determined. Sensitivity in KPC-2 producing and non-producing KP categories was 66.7% and 75%, respectively, using a SPA-LDA model with 66 wavenumbers. The resulting GA-LDA model successfully classified both microorganisms with respect to their "fingerprints" using only 39 wavelengths. Sensitivity in KPC-2 producing category was moderate(?66.7%) using a GA-LDA model. However, sensitivity in KPC-2 non-producing category using GA-LDA accurately predicted the correct class (with 100% accuracy). As100% accuracy was achieved, this novel approach identifies potential biochemical markers that may have a relation with microbial functional roles and means of rapid identification of KPC-2 producing and non-producing KP strains. PMID:25618648

Marques, Aline S; Moraes, Edgar P; Júnior, Miguel A A; Moura, Andrew D; Neto, Valter F A; Neto, Renato M; Lima, Kássio M G

2015-03-01

334

Chromosomal and plasmid encoded drug resistances of a Klebsiella pneumoniae UTI 2 strain isolated from urine of a post-operative patient  

Microsoft Academic Search

The multi drug resistance Klebsiella pneumoniae in urinary tract infection is a common clinical problem in developing country like India. Use of random antibiotics, resulting\\u000a multi drug resistance development, creates difficulties for treatment. In our present study, we investigated a strain of Klebsiella pneumoniae UTI 2 with multiple drug resistance, which was isolated from urine of a post operative woman

Soumik Barman; Dipak Kumar Hens; Hemanta Koley; Swapan Kumar Niyogi; Ranajit Kumar

2008-01-01

335

Influence of Inoculum Size and Marbofloxacin Plasma Exposure on the Amplification of1 Resistant Subpopulations of Klebsiella pneumoniae in a Rat Lung Infection Model.2  

E-print Network

Resistant Subpopulations of Klebsiella pneumoniae in a Rat Lung Infection Model.2 3 Anne-Sylvie Kesteman1 of Klebsiella pneumoniae. For daily fractionated doses of marbofloxacin, the23 prevention of resistance occurred In infections such as pneumonia, the burden of microorganisms can become quite high40 and may frequently exceed

Paris-Sud XI, Université de

336

A new variant of food poisoning: enteroinvasive Klebsiella pneumoniae and Escherichia coli sepsis from a contaminated hamburger.  

PubMed

For the first time, we report Klebsiella pneumoniae as an enteroinvasive food-borne pathogen transmitted from a hamburger. A 28-year-old previously healthy African-American male ingested a portion of a hamburger from a fast food chain. Symptoms of gastroenteritis rapidly deteriorated to multiorgan failure. Blood and hamburger cultures grew Escherichia coli and Klebsiella pneumoniae. Since Klebsiella had not previously been reported as enteroinvasive, the isolates were compared. Full biochemical profiles, antimicrobial sensitivity, plasmid profile, and toxin assay by DNA hybridization probe were completely concordant. The patient survived the episode of food-borne sepsis. Deliberate or inadvertent employee contamination of food products with feces may be a potential source of life-threatening food-borne illness. PMID:9448190

Sabota, J M; Hoppes, W L; Ziegler, J R; DuPont, H; Mathewson, J; Rutecki, G W

1998-01-01

337

Alterations in peptidoglycan chemical composition associated with rod-to-sphere transition in a conditional mutant of Klebsiella pneumoniae.  

PubMed Central

Klebsiella pneumoniae Mir M7 is a spontaneous parentless morphology mutant which grows as cocci at pH 7 and as rods at pH 5.8. This strain has been characterized as defective in lateral wall formation (at pH7). Data suggest that the cell wall is mainly made up of poles of the rods (G. Satta, R. Fontana, P. Canepari, and G. Botta, J. Bacteriol. 137:727--734, 1979). In this work the isolation and the biochemical properties of the peptidoglycan of both Mir M7 rods and cocci and a nonconditional rod-shaped Mir M7 revertant (strain Mir A12) are described. The peptidoglycan of Mir M7 (both rods and cocci) and Mir A12 strains carried covalently bound proteins which could be easily removed by pronase treatment in Mir M7 rods and Mir A12 cells, but not in Mir M7 round cells. However, when the sodium dodecyl sulfate-insoluble residues of Mir M7 cocci were pretreated with ethylenediaminetetraacetic acid (EDTA), pronase digestion removed the covalently bound proteins, and pure peptidoglycan was obtained. EDTA treatment of the rigid layer of Mir M7 cocci removed amounts of Mg2+ and Ca2+, which were 10- and 50-fold higher, respectively, than the amount liberated from the rigid layer of Mir M7 rods and Mir A12 cells. Amino acid composition was qualitatively similar in both strains, but Mir M7 cocci contained a higher amount of alanine and glucosamine. Mir M7 cocci contained approximately 50% less peptidoglycan than rods. Under electron microscopy, the rigid layer of the Mir M7 rods and Mir A12 cells appeared to be rod-shaped and their shape remained unchanged after EDTA and pronase treatment. On the contrary, the Mir M7 cocci rigid layer appeared to be round, and after EDTA treatment it collapsed and lost any definite morphology. In spite of these alterations, the peptidoglycan of Mir M7 cocci still appeared able to determine the shape of the cell and protect it from osmotic shock and mechanical damages. The accumluation of divalent cations appeared necessary for the peptidoglycan to acquire sufficient rigidity for shape determination and cell protection. We concluded that the coccal shape in Mir M7 cells is not due to loss of cell wall rigidity but is a consequence of the formation of a round peptidoglycan molecule. The possibility that the alterations found in the Mir M7 cocci rigid layer may reflect natural differences in the biochemical composition of the septa and lateral wall of normally shaped bacteria is discussed. Images PMID:113382

Fontana, R; Canepari, P; Satta, G

1979-01-01

338

Toward repurposing ciclopirox as an antibiotic against drug-resistant Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae.  

PubMed

Antibiotic-resistant infections caused by gram-negative bacteria are a major healthcare concern. Repurposing drugs circumvents the time and money limitations associated with developing new antimicrobial agents needed to combat these antibiotic-resistant infections. Here we identified the off-patent antifungal agent, ciclopirox, as a candidate to repurpose for antibiotic use. To test the efficacy of ciclopirox against antibiotic-resistant pathogens, we used a curated collection of Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae clinical isolates that are representative of known antibiotic resistance phenotypes. We found that ciclopirox, at 5-15 µg/ml concentrations, inhibited bacterial growth regardless of the antibiotic resistance status. At these same concentrations, ciclopirox reduced growth of Pseudomonas aeruginosa clinical isolates, but some of these pathogens required higher ciclopirox concentrations to completely block growth. To determine how ciclopirox inhibits bacterial growth, we performed an overexpression screen in E. coli. This screen revealed that galE, which encodes UDP-glucose 4-epimerase, rescued bacterial growth at otherwise restrictive ciclopirox concentrations. We found that ciclopirox does not inhibit epimerization of UDP-galactose by purified E. coli GalE; however, ?galU, ?galE, ?rfaI, or ?rfaB mutant strains all have lower ciclopirox minimum inhibitory concentrations than the parent strain. The galU, galE, rfaI, and rfaB genes all encode enzymes that use UDP-galactose or UDP-glucose for galactose metabolism and lipopolysaccharide (LPS) biosynthesis. Indeed, we found that ciclopirox altered LPS composition of an E. coli clinical isolate. Taken together, our data demonstrate that ciclopirox affects galactose metabolism and LPS biosynthesis, two pathways important for bacterial growth and virulence. The lack of any reported fungal resistance to ciclopirox in over twenty years of use in the clinic, its excellent safety profiles, novel target(s), and efficacy, make ciclopirox a promising potential antimicrobial agent to use against multidrug-resistant problematic gram-negative pathogens. PMID:23936064

Carlson-Banning, Kimberly M; Chou, Andrew; Liu, Zhen; Hamill, Richard J; Song, Yongcheng; Zechiedrich, Lynn

2013-01-01

339

News and Research Good Bacteria  

E-print Network

News and Research Good Bacteria Part 2 Article 13 Click here for Probiotics Basics Cooperation Is A No-brainer For Symbiotic Bacteria 9-4-2003 Humans may learn cooperation in kindergarten, but what about bacteria, whose behavior is preprogrammed by their DNA? Some legume plants, which rely

West, Stuart

340

Nasopharyngeal colonization by potentially pathogenic bacteria found in healthy semi-captive wild-born chimpanzees in Uganda.  

PubMed

Information on the chimpanzee nasopharygeal colonization in captive sanctuaries and in the wild is rare. This study was undertaken to establish the nasopharygeal colonization and potential bacterial pathogens in sanctuary chimpanzees as a basis for improving chimpanzee and employee health. Nasopharygeal colonization of 39 healthy chimpanzees were analyzed by microbiological cultivation method and polymerase chain reaction (PCR) targeting the bacterial 16S rRNA gene. We report four major phyla dominated by Proteobacteria (50%), Fermicutes (35.7%), Bacteriodes (7.1%), and Cynobacteria (7.1%) in healthy semi-captive chimpanzees. Further classification based on 7-base oligomers revealed the following genera: Streptococcus, Veillonella, Neisseria, Prevotella, Kingella and unclassified Cynobacteria, Actinobacillus, Bacteriodes and Pasteurellaceae. On microbiological cultivation we were able to identify and characterize some of the bacteria to species level as Klebsiella pneumonie and Pseudomonas aeruginosa being dominant bacteria with 54.7% and 50% colonization, respectively. Of these, Streptococcus, Neisseria, Klebsiella, and Haemophillus have representatives known to potentially cause severe respiratory disease. Our data present important information on chimpanzee nasopharygeal colonization as a guide to understanding disease processes and pharmaceutical therapies required for improving the health of chimpanzees. The results from this study will guide the processes to improve procedures for routine management of sanctuary chimpanzees and use it as a basis for evaluation of future reintroduction possibilities. PMID:24395648

Mugisha, Lawrence; Köndgen, Sophie; Kaddu-Mulindwa, Deogratias; Gaffikin, Lynne; Leendertz, Fabian H

2014-02-01

341

Isolation and characterization of agar-degrading endophytic bacteria from plants.  

PubMed

Agar is a polysaccharide extracted from the cell walls of some macro-algaes. Among the reported agarases, most of them come from marine environment. In order to better understand different sources of agarases, it is important to search new non-marine native ones. In this study, seven agar-degrading bacteria were first isolated from the tissues of plants, belonging to three genera, i.e., Paenibacillus sp., Pseudomonas sp., and Klebsiella sp. Among them, the genus Klebsiella was first reported to have agarolytic ability and the genus Pseudomonas was first isolated from non-marine environment with agarase activity. Besides, seven strains were characterized by investigating the growth and agarase production in the presence of various polysaccharides. The results showed that they could grow on several polysaccharides such as araban, carrageenan, chitin, starch, and xylan. Besides, they could also produce agarase in the presence of different polysaccharides other than agar. Extracellular agarases from seven strains were further analyzed by SDS-PAGE combined with activity staining and estimated to be 75 kDa which has great difference from most reported agarases. PMID:25331792

Song, Tao; Zhang, Weijia; Wei, Congchong; Jiang, Tengfei; Xu, Hui; Cao, Yi; Cao, Yu; Qiao, Dairong

2015-02-01

342

Two class II D-tagatose-bisphosphate aldolases from enteric bacteria.  

PubMed

Escherichia coli, Salmonella enterica, Klebsiella pneumoniaeand Klebsiella oxytocawere found to contain two D-tagatose 1,6-bisphosphate (TagBP)-specific aldolases involved in catabolism of galactitol (genes gatY gatZ) and of N-acetyl-galactosamine and D-galactosamine (genes kbaY kbaZ,also called agaY agaZ). The two aldolases were closely related (> or = 53.8% identical amino acids) and could substitute for each other in vivo. The catalytic subunits GatY or KbaY alone were sufficient to show aldolase activity. Although substantially shorter than other aldolases (285 amino acids, instead of 358 and 349 amino acids), these subunits contained most or all of the residues that have been identified as essential in substrate/product recognition and catalysis for class II aldolases. In contrast to these, both aldolases required subunits GatZ or KbaZ (420 amino acids) for full activity and for good in vivo and in vitro stability. The Z subunits alone did not show any aldolase activity. Close relatives of these new TagBP aldolases were found in several gram-negative and gram-positive bacteria, e.g., Streptomyces coelicolor. PMID:11976750

Brinkkötter, Andreas; Shakeri-Garakani, Ansiah; Lengeler, Joseph W

2002-05-01

343

Reanimation of Ancient Bacteria  

SciTech Connect

Recent highly publicized experiments conducted on salt crystals taken from the Permian Salado Formation in Southeastern New Mexico have shown that some ancient crystals contain viable microorganisms trapped within fluid inclusions. Stringent geological and microbiological selection criteria were used to select crystals and conduct all sampling. This talk will focus on how each of these lines of data support the conclusion that such isolated bacteria are as old as the rock in which they are trapped. In this case, the isolated microbes are salt tolerant bacilli that grow best in media containing 8% NaCl, and respond to concentrated brines by forming spores. One of the organisms is phylogenetically related to several bacilli, but does have several unique characteristics. This talk will trace the interdisciplinary data and procedures supporting these discoveries, and describe the various isolated bacteria.

Russell Vreeland

2009-01-09

344

Bacteria, food, and cancer  

PubMed Central

Gut microbes are essential components of the human organism—helping us metabolize food into energy, produce micronutrients, and shape our immune systems. Having a particular pattern of gut microbes is also increasingly being linked to medical conditions including obesity, inflammatory bowel disease, and diabetes. Recent studies now indicate that our resident intestinal bacteria may also play a critical role in determining one's risk of developing cancer, ranging from protection against cancer to promoting its initiation and progression. Gut bacteria are greatly influenced by diet and in this review we explore evidence that they may be the missing piece that explains how dietary intake influences cancer risk, and discuss possible prevention and treatment strategies. PMID:21876723

Rooks, Michelle G.

2011-01-01

345

Manufacture of Probiotic Bacteria  

NASA Astrophysics Data System (ADS)

Lactic acid bacteria (LAB) have been used for many years as natural biopreservatives in fermented foods. A small group of LAB are also believed to have beneficial health effects on the host, so called probiotic bacteria. Probiotics have emerged from the niche industry from Asia into European and American markets. Functional foods are one of the fastest growing markets today, with estimated growth to 20 billion dollars worldwide by 2010 (GIA, 2008). The increasing demand for probiotics and the new food markets where probiotics are introduced, challenges the industry to produce high quantities of probiotic cultures in a viable and stable form. Dried concentrated probiotic cultures are the most convenient form for incorporation into functional foods, given the ease of storage, handling and transport, especially for shelf-stable functional products. This chapter will discuss various aspects of the challenges associated with the manufacturing of probiotic cultures.

Muller, J. A.; Ross, R. P.; Fitzgerald, G. F.; Stanton, C.

346

Population structure of KPC-producing Klebsiella pneumoniae isolates from midwestern U.S. hospitals.  

PubMed

Genome sequencing of carbapenem-resistant Klebsiella pneumoniae isolates from regional U.S. hospitals was used to characterize strain diversity and the bla(KPC) genetic context. A phylogeny based on core single-nucleotide variants (SNVs) supports a division of sequence type 258 (ST258) into two distinct groups. The primary differences between the groups are in the capsular polysaccharide locus (cps) and their plasmid contents. A strict association between clade and KPC variant was found. The bla(KPC) gene was found on variants of two plasmid backbones. This study indicates that highly similar K. pneumoniae subpopulations coexist within the same hospitals over time. PMID:24913165

Wright, Meredith S; Perez, Federico; Brinkac, Lauren; Jacobs, Michael R; Kaye, Keith; Cober, Eric; van Duin, David; Marshall, Steven H; Hujer, Andrea M; Rudin, Susan D; Hujer, Kristine M; Bonomo, Robert A; Adams, Mark D

2014-08-01

347

Accuracy of different methods for susceptibility testing of gentamicin with KPC carbapenemase-producing Klebsiella pneumoniae.  

PubMed

Performance of Vitek2, Etest, and TREK broth microdilution (BMD) panels was evaluated versus reference CLSI BMD for gentamicin susceptibility testing with 57 bloodstream isolates of KPC-producing Klebsiella pneumoniae. Compared with reference BMD, the Essential Agreement and Categorical Agreement for TREK panels, Vitek2, and Etest were 91.2%, 31.6%, and 61.4%, respectively, and 86%, 21%, and 52.6%, respectively. Four very major discrepancies occurred with Vitek2. In these 4 strains, gentamicin resistance was associated with the presence of an armA aminoglycoside resistance determinant. PMID:25533616

Arena, Fabio; Giani, Tommaso; Vaggelli, Guendalina; Terenzi, Giovanni; Pecile, Patrizia; Rossolini, Gian Maria

2015-02-01

348

Infection of mice by aerosols of Klebsiella pneumoniae under hyperbaric conditions.  

PubMed Central

Both the physical behavior of aerosols and survival of airborne Serratia marcescens in hyperbaric chambers with a helium-air mixture at 20 atm of pressure was approximately the same as in the system at ambient pressures. Exposure of mice to aerosols of Klebsiella pneumoniae at 1-, 2-, and 17-atm (ca. 101-, 203-, and 1,722-kPa) pressures of helium-oxygen mixture showed that the number of viable organisms constituting a 50% lethal dose was not significantly affected by the hyperbaric conditions. Images PMID:6996616

Heckly, R J; Chatigny, M A; Dimmick, R L

1980-01-01

349

Klebsiella pneumoniae producing KPC carbapenemase in a district general hospital in the UK.  

PubMed

We report two patients with multidrug-resistant KPC-carbapenemase-producing Klebsiella pneumoniae urinary tract infections. A bla(KPC-2) gene was detected in both of the isolates by polymerase chain reaction and sequencing. The isolates had identical pulsed-field gel electrophoresis patterns and belonged to sequence type ST11. The index patient probably acquired the KPC-producing strain while in hospital in Curaçao, with subsequent nosocomial transmission to the second patient occurring in our hospital. We describe the interventions that were taken to prevent its further spread within the acute Trust and the community. PMID:21641083

Virgincar, N; Iyer, S; Stacey, A; Maharjan, S; Pike, R; Perry, C; Wyeth, J; Woodford, N

2011-08-01

350

Complete Nucleotide Sequence of Klebsiella pneumoniae Multiresistance Plasmid pJHCMW1  

Microsoft Academic Search

The multiresistance plasmid pJHCMW1, harbored by a clinical Klebsiella pneumoniae strain isolated from a neonate with meningitis, was sequenced. A circular sequence of 11,354 bp was generated, of which 7,993 bp make up Tn1331, a transposon including the antibiotic resistance genes aac(6)-Ib, aadA1, blaOXA-9, and blaTEM-1. The gene aac(6)-Ib is included in a gene cassette, and both aadA1 and blaOXA-9

Renee Sarno; Glen McGillivary; David J. Sherratt; Luis A. Actis; Marcelo E. Tolmasky

2002-01-01

351

Outbreak of NDM-1-Producing Klebsiella pneumoniae in a Neonatal Unit in Colombia  

PubMed Central

Six multiresistant, NDM-1-producing Klebsiella pneumoniae strains were recovered from an outbreak that affected six neonatal patients in a Colombian hospital. Molecular analysis showed that all of the isolates harbored the blaNDM-1, qnrA, and intI1 genes and were clonally related. Multilocus sequence typing showed that the isolates belonged to a new sequence type (ST1043) that was different from the sequence types that had previously been reported. This is the first report of NDM-1-producing isolates in South America. PMID:23357776

Olarte Escobar, Narda María; Castro-Cardozo, Betsy; Valderrama Márquez, Ismael Alberto; Garzón Aguilar, Martha Isabel; Martinez de la Barrera, Leslie; Barrero Barreto, Esther Rocio; Marquez-Ortiz, Ricaurte Alejandro; Moncada Guayazán, Maria Victoria; Vanegas Gómez, Natasha

2013-01-01

352

Tigecycline therapy for carbapenem-resistant Klebsiella pneumoniae (CRKP) bacteriuria leads to tigecycline resistance.  

PubMed

Carbapenem-resistant Klebsiella pneumoniae (CRKP) is an increasing global threat. Here, we describe the prevalence and impact of tigecycline use in a cohort of patients with CRKP bacteriuria nested within a multicentre, prospective study. In the 21-month study period, 260 unique patients were included. Tigecycline was given to 80 (31%) patients. The use of tigecycline during the index hospitalization was significantly associated with the subsequent development of tigecycline resistance in the same patient (OR, 6.13; 95% CI, 1.15-48.65; p 0.03). In conclusion, the use of tigecycline with CRKP bacteriuria is common, and is associated with the subsequent development of tigecycline resistance. PMID:24931918

van Duin, D; Cober, E D; Richter, S S; Perez, F; Cline, M; Kaye, K S; Kalayjian, R C; Salata, R A; Evans, S R; Fowler, V G; Bonomo, R A

2014-12-01

353

First Report of KPC-2 Carbapenemase-Producing Klebsiella pneumoniae in Japan  

PubMed Central

We investigated a novel Japanese isolate of sequence type 11 (ST11), the Klebsiella pneumoniae carbapenemase-2 (KPC-2)-producing K. pneumoniae strain Kp3018, which was previously obtained from a patient treated at a Brazilian hospital. This strain was resistant to various antibiotic classes, including carbapenems, and harbored the gene blaKPC-2, which was present on the transferable plasmid of ca. 190 kb, in addition to the blaCTX-M-15 gene. Furthermore, the ca. 2.3-kb sequences (ISKpn8-blaKPC-2–ISKpn6-like), encompassing blaKPC-2, were found to be similar to those of K. pneumoniae strains from China. PMID:24566171

Takahashi, Rieko; Sawabe, Etsuko; Koyano, Saho; Takahashi, Yutaka; Shima, Mari; Ushizawa, Hiroto; Fujie, Toshihide; Tosaka, Naoki; Kato, Yuko; Moriya, Kyoji; Tohda, Shuji; Tojo, Naoko; Koike, Ryuji; Kubota, Tetsuo

2014-01-01

354

Citrate substitutes for homocitrate in nitrogenase of a nifV mutant of Klebsiella pneumoniae  

SciTech Connect

An organic acid extracted from purified dinitrogenase isolated from a nifV mutant of Klebsiella pneumoniae has been identified as citric acid. H{sub 2} evolution by the citrate-containing dinitrogenase is partially inhibited by CO, and by some substrates for nitrogenase. The response of maximum velocities to changes in pH for both the wild-type and the NifV{sup {minus}} dinitrogenase was compared. No substantial differences between the enzymes were observed, but there are minor differences. Both enzymes are stable in the pH range 4.8-10, but the enzyme activities dropped dramatically below pH 6.2.

Liang, Jihong; Madden, M.; Shah, V.K.; Burris, R.H. (Univ. of Wisconsin, Madison (USA))

1990-09-18

355

Discrimination of selected species of pathogenic bacteria using near-infrared Raman spectroscopy and principal components analysis  

NASA Astrophysics Data System (ADS)

A method, based on Raman spectroscopy, for identification of different microorganisms involved in bacterial urinary tract infections has been proposed. Spectra were collected from different bacterial colonies (Gram-negative: Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa and Enterobacter cloacae, and Gram-positive: Staphylococcus aureus and Enterococcus spp.), grown on culture medium (agar), using a Raman spectrometer with a fiber Raman probe (830 nm). Colonies were scraped from the agar surface and placed on an aluminum foil for Raman measurements. After preprocessing, spectra were submitted to a principal component analysis and Mahalanobis distance (PCA/MD) discrimination algorithm. We found that the mean Raman spectra of different bacterial species show similar bands, and S. aureus was well characterized by strong bands related to carotenoids. PCA/MD could discriminate Gram-positive bacteria with sensitivity and specificity of 100% and Gram-negative bacteria with sensitivity ranging from 58 to 88% and specificity ranging from 87% to 99%.

de Siqueira e Oliveira, Fernanda SantAna; Giana, Hector Enrique; Silveira, Landulfo

2012-10-01

356

Glacial Lake Hides Bacteria  

NSDL National Science Digital Library

This article highlights the published work of a geomicrobiology research team led by Eric Gaidos from the University of Hawaii and Brian Lanoil, from the University of California, Riverside. This group reports the identification of bacteria from an Icelandic sub-glacial lake, and how the collection and description of these microorganisms immured within glacial ice and sub-surface water serve as a model in the search for extra-terrestrial life.

Peplow, Mark

2010-03-01

357

QUORUM SENSING IN BACTERIA  

Microsoft Academic Search

? Abstract Quorum sensing is the regulation of gene expression in response to fluctuations in cell-population density. Quorum sensing bacteria produce and release chemical signal molecules called autoinducers that increase in concentration as a function of cell density. The detection of a minimal threshold stimulatory con- centration of an autoinducer leads to an alteration in gene expression. Gram-positive and Gram-negative

Melissa B. Miller; Bonnie L. Bassler

2001-01-01

358

Glacial lake hides bacteria  

NSDL National Science Digital Library

This article highlights the published work of a geomicrobiology research team led by Eric Gaidos from the University of Hawaii and Brian Lanoil, from the University of California, Riverside. This group reports the identification of bacteria from an Icelandic sub-glacial lake, and how the collection and description of these microorganisms immured within glacial ice and sub-surface water serve as a model in the search for extra-terrestrial life.

Peplow, Mark; Online, Bioed

359

Siboglinid-bacteria endosymbiosis  

PubMed Central

Siboglinid worms are a group of gutless marine annelids which are nutritionally dependent upon endosymbiotic bacteria.1,2 Four major groups of siboglinids are known including vestimentiferans, Osedax spp., frenulates and moniliferans.3–5 Very little is known about the diversity of bacterial endosymbionts associated with frenulate or monoliferan siboglinids. This lack of knowledge is surprising considering the global distribution of siboglinids; this system is likely among the most common symbioses in the deep sea. At least three distinct clades of endosymbiotic ?-proteobacteria associate with siboglinid annelids.6 Frenulates harbor a clade of ?-proteobacteria that are divergent from both the thiotrophic bacteria of vestimentiferans and monoliferans as well as the heterotrophic bacteria of Osedax spp.6,7 We also discuss priorities for future siboglinid research and the need to move beyond descriptive studies. A promising new method, laser-capture microdissection (LCM), allows for the precise excision of tissue regions of interest.8 This method, when used in concert with molecular and genomic techniques, such as Expressed Sequence Tag (EST) surveys using pyrosequencing technology, will likely enable investigations into physiological processes and mechanisms in these symbioses. Furthermore, adopting a comparative approach using different siboglinid groups, such as worms harboring thiotrophic versus methanotrophic endosymbionts, may yield considerable insight into the ecology and evolution of the Siboglinidae. PMID:19704881

Fielman, Kevin T; Santos, Scott R; Halanych, Kenneth M

2008-01-01

360

Living bacteria in silica gels  

NASA Astrophysics Data System (ADS)

The encapsulation of enzymes within silica gels has been extensively studied during the past decade for the design of biosensors and bioreactors. Yeast spores and bacteria have also been recently immobilized within silica gels where they retain their enzymatic activity, but the problem of the long-term viability of whole cells in an inorganic matrix has never been fully addressed. It is a real challenge for the development of sol-gel processes. Generic tests have been performed to check the viability of Escherichia coli bacteria in silica gels. Surprisingly, more bacteria remain culturable in the gel than in an aqueous suspension. The metabolic activity of the bacteria towards glycolysis decreases slowly, but half of the bacteria are still viable after one month. When confined within a mineral environment, bacteria do not form colonies. The exchange of chemical signals between isolated bacteria rather than aggregates can then be studied, a point that could be very important for 'quorum sensing'.

Nassif, Nadine; Bouvet, Odile; Noelle Rager, Marie; Roux, Cécile; Coradin, Thibaud; Livage, Jacques

2002-09-01

361

In vitro antibacterial potency of Butea monosperma Lam. against 12 clinically isolated multidrug resistant bacteria  

PubMed Central

Objective To investigate the antibacterial activity, using cold and hot extraction procedures with five solvents, petroleum ether, acetone, ethanol, methanol and water to validate medicinal uses of Butea monosperma Lam (B. monosperma) in controlling infections; and to qualitatively estimate phytochemical constituents of leaf-extracts of the plant. Methods The antibacterial activity of leaf-extracts was evaluated by the agar-well diffusion method against clinically isolated 12 Gram-positive and -negative multidrug resistant (MDR) pathogenic bacteria in vitro. Values of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of leaf-extracts against each bacterium were obtained in a 96-well micro-titre plate, by broth dilution micro-titre plate technique. Results The presence of tannins, flavonoids, starch, glycosides and carbohydrates in different leaf extracts was established. Pathogenic bacteria used were, Acinetobacter sp., Chromobacterium violaceum, Citrobacter freundii, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhi, Shigella sp., Enterococcus sp., Staphylococcus aureus (S. aureus), methicillin resistant S. aureus and vancomycin resistant S. aureus, along with standard bacterial strains. These MDR bacteria had been recorded to have significant inhibitions by leaf extracts, obtained by cold and hot extraction procedures with five solvents. In addition, the hot aqueous extract against Enterococcus sp. had the highest inhibition zone-size (21 mm). Ciprofloxacin 30 µg/disc was the positive/reference control and the diluting solvent, 10% dimethyl sulphoxide was the negative control. Recorded MIC values of different extracts ranged between 0.23 and 13.30 mg/mL, and MBC values were 0.52 to 30.00 mg/mL, for these bacteria. Conclusions Leaf-extracts with hot water and ethanol had shown significant antibacterial activity against all bacteria. B. monosperma leaf-extract could be used in treating infectious diseases, caused by the range of tested bacteria, as complementary and alternate medicine.

Sahu, Mahesh Chandra; Padhy, Rabindra Nath

2013-01-01

362

Phg1/TM9 Proteins Control Intracellular Killing of Bacteria by Determining Cellular Levels of the Kil1 Sulfotransferase in Dictyostelium  

PubMed Central

Dictyostelium discoideum has largely been used to study phagocytosis and intracellular killing of bacteria. Previous studies have shown that Phg1A, Kil1 and Kil2 proteins are necessary for efficient intracellular killing of Klebsiella bacteria. Here we show that in phg1a KO cells, cellular levels of lysosomal glycosidases and lysozyme are decreased, and lysosomal pH is increased. Surprisingly, overexpression of Kil1 restores efficient killing in phg1a KO cells without correcting these lysosomal anomalies. Conversely, kil1 KO cells are defective for killing, but their enzymatic content and lysosomal pH are indistinguishable from WT cells. The killing defect of phg1a KO cells can be accounted for by the observation that in these cells the stability and the cellular amount of Kil1 are markedly reduced. Since Kil1 is the only sulfotransferase characterized in Dictyostelium, an (unidentified) sulfated factor, defective in both phg1a and kil1 KO cells, may play a key role in intracellular killing of Klebsiella bacteria. In addition, Phg1B plays a redundant role with Phg1A in controlling cellular amounts of Kil1 and intracellular killing. Finally, cellular levels of Kil1 are unaffected in kil2 KO cells, and Kil1 overexpression does not correct the killing defect of kil2 KO cells, suggesting that Kil2 plays a distinct role in intracellular killing. PMID:23301051

Le Coadic, Marion; Froquet, Romain; Lima, Wanessa C.; Dias, Marco; Marchetti, Anna; Cosson, Pierre

2013-01-01

363

Adult Klebsiella pneumoniae meningitis in Qatar: clinical pattern of ten cases  

PubMed Central

Objective To describe the clinical presentation, underlying diseases, antimicrobial susceptibility, treatment and outcome of Klebsiella pneumoniae meningitis patients. Methods This retrospective study involved all patients with 15 years of age or older who admitted to Hamad General Hospital with culture proven Klebsiella pneumoniae meningitis from January 1, 2007 to December 31, 2012. Results A total of ten cases were identified (nine males and one female). Their mean age was (43.3±12.8) years. Eight patients (80%) had nosocomial meningitis with neurosurgery being the most frequent associated condition. Fever and altered consciousness were the most frequent symptom. Cerebrospinal fluid showed elevated protein and glucose levels. Gram stain showed Gram-negative rods in 50% of cases, while positive cerebrospinal fluid culture results were found in all patients. Multidrug resistance was observed in two cases, and all patients had received appropriate empirical and definitive antibiotic treatments. The mean duration of intravenous antimicrobial treatment was (19.3±7.0) d and all patients with external ventricular drains underwent removal of the device, while in-hospital mortality was 50%. Conclusions The number of cases was too small to come up with therapeutic and prognostic conclusions. Further large-scale prospective study is needed. PMID:25183339

Khan, Fahmi Yousef; Abukhattab, Mohammed; AbuKamar, Mohammed; Anand, Deshmukh

2014-01-01

364

Extended-Spectrum ?-lactamase (ESBL) producing Enterobacter aerogenes phenotypically misidentified as Klebsiella pneumoniae or K. terrigena  

PubMed Central

Background Enterobacter aerogenes and Klebsiella pneumoniae are common isolates in clinical microbiology and important as producers of extended spectrum ?-lactamases (ESBL). The discrimination between both species, which is routinely based on biochemical characteristics, is generally accepted to be straightforward. Here we report that genotypically unrelated strains of E. aerogenes can be misidentified as K. pneumoniae by routine laboratories using standard biochemical identification and using identification automates. Results Ten clinical isolates, identified as K. pneumoniae or K. terrigena with the routinely used biochemical tests and with API-20E, were identified as E. aerogenes by tDNA-PCR – an identification that was confirmed by 16S rRNA gene sequencing for five of these isolates. Misidentification also occurred when using the automated identification systems Vitek 2 and Phoenix, and was due to delayed positivity for ornithine decarboxylase and motility. Subculture and prolonged incubation resulted in positive results for ornithine decarboxylase and for motility. It could be shown by RAPD-analysis that the E. aerogenes strains belonged to different genotypes. Conclusions Clinical E. aerogenes isolates can be easily misidentified as Klebsiella due to delayed positivity for ornithine decarboxylase and motility. The phenomenon may be widespread, since it was shown to occur among genotypically unrelated strains from different hospitals and different isolation dates. A useful clue for correct identification is the presence of an inducible ?-lactamase, which is highly unusual for K. pneumoniae. In several instances, the use of genotypic techniques like tDNA-PCR may circumvent problems of phenotypic identification. PMID:15619329

Claeys, Geert; De Baere, Thierry; Wauters, Georges; Vandecandelaere, Patricia; Verschraegen, Gerda; Muylaert, An; Vaneechoutte, Mario

2004-01-01

365

The function of lactic acid bacteria and brine solutions on biogenic amine formation by foodborne pathogens in trout fillets.  

PubMed

The influences of lactic acid bacteria and brine solutions on the biogenic amine formation by Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Enterococus faecalis, Pseudomonas aeruginosa, Listeria monocytogenes, Aeromonas hydrophila and Salmonella paratyphi A in fermented trout fillets were investigated. Fish fillets were divided into four groups, group 1 without any lactic acid bacteria inoculation, group 2 and group 3 with different salt concentration inoculated with lactic acid bacteria and food-borne pathogens, and group 4 inoculated with lactic acid bacteria and food-borne pathogens without a salt solution. The histamine content in trout fillets in group 4 was found to be more than 10mg/100g, while the other groups contained less than 7.5mg/100g. The highest tyramine production was found for group 1 and group 3, ranging from 3 to 18mg/100g. Lactic acid bacteria did not seem to play an important role on biogenic amine production by food borne pathogens, while adding brine solution on fillets has inhibitory effects on some of the biogenic amines. PMID:25212358

Kuley, Esmeray; Ozogul, Fatih; Ozogul, Yesim; Akyol, Ismail

2011-12-01

366

Effect of oxytetracycline-medicated feed on antibiotic resistance of gram-negative bacteria in catfish ponds.  

PubMed Central

The effect of oxytetracycline-medicated feeds on antibiotic resistance in gram-negative bacteria from fish intestines and water in catfish ponds was investigated. In experiments in the fall and spring, using ponds with no previous history of antibiotic usage, percentages of tetracycline-resistant bacteria in catfish intestines obtained from medicated ponds increased significantly after 10 days of treatment. In the fall, resistance of the intestinal and aquatic bacteria returned to pretreatment levels within 21 days after treatment. In the spring, resistance declined after treatment but remained higher than pretreatment levels for at least 21 days in intestinal bacteria and for 5 months in aquatic bacteria. Plesiomonas shigelloides, Aeromonas hydrophila, and Citrobacter freundii were isolated frequently in both spring and fall; Escherichia coli, Klebsiella pneumoniae, Edwardsiella tarda, and Enterobacter spp. were isolated primarily in the spring. Oxytetracycline treatment did not affect the distribution of bacterial species in the fall but may have accelerated a shift toward greater prevalence of members of the family Enterobacteriaceae in the spring. Multiple antibiotic resistance did not appear to be elicited by oxytetracycline treatment. PMID:7793953

DePaola, A; Peeler, J T; Rodrick, G E

1995-01-01

367

The inhibitory effect of Zingiber corallinum Hance essential oil on drug-resistant bacteria and evaluation of its acute toxicity  

PubMed Central

Summary Background The excessive and irregular use of antibiotics could result in the generation and diffusion of drug-resistant bacteria. The aim of this study was to investigate the inhibitory effect of Zingiber corallinum Hance essential oil (ZCHO) on drug-resistant bacteria, especially on drug-resistant Acinetobacter baumannii. Material/Methods Susceptibility testing was used to evaluate the effect of ZCHO on growth inhibition of drug-resistant bacteria by paper disk method. Mice orally administered with ZCHO were used to observe acute toxicity and to determine median lethal dose (LD50) of ZCHO. Broth dilution method was used to determine minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of ZCHO on drug-resistant Acinetobacter baumannii. Results ZCHO exhibited an obvious inhibitory effect not only on gram-negative drug-resistant bacteria including Escherichia coli, Klebsiella pneumoniae, Enterobacter cloacae and Acinetobacter baumannii, but also on gram-positive drug-resistant bacteria including Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus haemolyticus. The ZCHO containing 79% terpinen-4-ol revealed better bacteriostatic effect than ZCHO with 34% terpinen-4-ol. The LD50 of ZCHO was 1790.427 mg/kg. The MIC and MBC of ZCHO on drug-resistant Acinetobacter baumannii were 1457.81 mg/L. Conclusions ZCHO has obvious bacteriostasis and bactericidal effects, especially against drug-resistant Acinetobacter baumannii. Therefore, ZCHO is a promising natural bioactive component with antibacterial effect and satisfactory safety due to its low toxicity. PMID:21525802

Yang, Ce; Zhou, Lin-Lin; Wang, Hai-Yan; Huang, Su-Na; Liu, Qing; Hu, Shi-Lin; Li, Ting-Rong; Chen, Yan-Bing; Jiang, Jian-Xin

2011-01-01

368

The First Report of Drug Resistant Bacteria Isolated from the Brown-Banded Cockroach, Supella longipalpa, in Ahvaz, South-western Iran  

PubMed Central

Background The brown-banded cockroach, Supella longipalpa is known as a carrier of pathogenic bacteria in urban environments, but its role is not well documented regarding the carriage of antibiotic-resistant pathogenic bacteria in Iran. The aim of this study was to determine the resistance bacteria isolated from the brown-banded cockroach in Ahvaz, south west of Iran. Methods: Totally 39 cockroaches were collected from kitchen area of houses and identified. All specimens were cultured to isolate the bacterial agents on blood agar and MacConky agar media. The microorganisms were identified using necessary differential and biochemical tests. Antimicrobial susceptibility tests were performed for isolated organisms by Kirby-Bauer’s disk diffusion according to NCLI guideline, using 18 antibiotics. Results: From the 39 collected S. langipalpa, 179 bacterial agents were isolated, 92 of alimentary ducts and 87 of external body surfaces. Isolated bacteria from cockroaches were identified as Enterobacter spp., Klebsiella spp., Citrobacter spp., Escherichia coli, Salmonella spp., Proteus spp., coagulase negative staphylococci, Serratia marcescens, Staphylococcus aureus, and Bacillus species. The pattern resistance rates were determined for gram negative bacilli and gram positive cocci regarding 18 antibiotics. Conclusion: The brown-banded cockroach can be involved in the spread of drug resistant bacteria and increases the possibility of contacting human environment to drug resistant bacteria. Therefore, the potential of removing this insect should be improved. This is the first original report of drug resistant bacteria isolated from the brown-banded cockroach of Iran.

Vazirianzadeh, Babak; Dehghani, Rouhullah; Mehdinejad, Manijeh; Sharififard, Mona; Nasirabadi, Nersi

2014-01-01

369

Unacylated tridecaptin A? acts as an effective sensitiser of Gram-negative bacteria to other antibiotics.  

PubMed

A derivative of the linear cationic lipopeptide tridecaptin A?missing the N-terminal lipophilic acyl group, termed H-TriA?, is devoid of antimicrobial activity but is extremely effective at sensitising Gram-negative bacteria to certain antibiotics. H-TriA?has low cytotoxicity compared with the natural peptide and in low concentrations it can substantially lower the minimum inhibitory concentration (MIC) of some antibiotics against strains of Escherichia coli, Campylobacter jejuni and Klebsiella pneumoniae. In particular, the MIC of rifampicin was lowered 256-512-fold against K. pneumoniae strains using low concentrations of H-TriA?. H-TriA?does not exert its synergistic effect through partial membrane lysis, but does bind to model bacterial membranes in a manner akin to the natural peptide. Formation of this stable secondary structure on the outer membrane may account for the observed synergistic activity. PMID:25315408

Cochrane, Stephen A; Vederas, John C

2014-12-01

370

Bacteria on closed-boll and commercially harvested cotton.  

PubMed Central

The bacterial content of specially treated cottons used by other investigators to test human pulmonary responses to cotton dust was examined. Cotton from Lubbock, Tex. and Stoneville, Miss. were either (i) harvested by machine and handled as commercial bale cotton, (ii) harvested as closed bolls with bracts intact and opened under special conditions, (iii) harvested as closed bolls, with bracts being removed and opened under special conditions, or (iv) harvested by (stoneville only). Bacillus spp. were isolated from all samples and predominated in cotton from Stoneville. Enterobacter agglomerans was isolated from all but one sample, the Stoneville closed-boll bract-removed cotton, and predominated in Lubbock samples. Aerogenic and anaerogenic biogroups of E. agglomerans were isolated; only aerogenic strain b of E. agglomerans was present in samples from both locations. Klebsiella ozaenae and K. pneumoniae were isolated only from Lubbock samples. Cotton from Lubbock yielded 100 to 1,000 times more bacteria, both total and gram negative, than did comparably treated cotton from Stoneville. Thus, differences in growing and processing conditions at the two locations were associated with large differences in the bacterial content of the cotton, but harvesting green bolls and removing bracts had little effect. The bacterial content of Stoneville washed cotton, and it paralleled the differences reported (Boehlecke et al., Am. Rev. Respir, Dis. 123:152, 1981) in pulmonary function responses when subjects were exposed to dust (0.6 mg/m3) from these two cottons. Levels of gram-negative and total bacteria on all samples were comparable to those previously reported for field-weathered cottons from various locations throughout the world. PMID:6751230

Millner, P D; Ericson, K E; Marsh, P B

1982-01-01

371

Effect of low-dose gaseous ozone on pathogenic bacteria  

PubMed Central

Background Treatment of chronically infected wounds is a challenge, and bacterial environmental contamination is a growing issue in infection control. Ozone may have a role in these situations. The objective of this study was to determine whether a low dose of gaseous ozone/oxygen mixture eliminates pathogenic bacteria cultivated in Petri dishes. Methods A pilot study with 6 bacterial strains was made using different concentrations of ozone in an ozone-oxygen mixture to determine a minimally effective dose that completely eliminated bacterial growth. The small and apparently bactericidal gaseous dose of 20 ?g/mL ozone/oxygen (1:99) mixture, applied for 5min under atmospheric pressure was selected. In the 2nd phase, eight bacterial strains with well characterized resistance patterns were evaluated in vitro using agar-blood in adapted Petri dishes (105 bacteria/dish). The cultures were divided into 3 groups: 1- ozone-oxygen gaseous mixture containing 20 ?g of O3/mL for 5 min; 2- 100% oxygen for 5 min; 3- baseline: no gas was used. Results The selected ozone dose was applied to the following eight strains: Escherichia coli, oxacillin-resistant Staphylococcus aureus, oxacillin-susceptible Staphylococcus aureus, vancomycin-resistant Enterococcus faecalis, extended-spectrum beta-lactamase-producing Klebsiella pneumoniae, carbapenem-resistant Acinetobacter baumannii, Acinetobacter baumannii susceptible only to carbapenems, and Pseudomonas aeruginosa susceptible to imipenem and meropenem. All isolates were completely inhibited by the ozone-oxygen mixture while growth occurred in the other 2 groups. Conclusion A single topical application by nebulization of a low ozone dose completely inhibited the growth of all potentially pathogenic bacterial strains with known resistance to antimicrobial agents. PMID:23249441

2012-01-01

372

Draft Genome Sequences of Klebsiella pneumoniae Clinical Type Strain ATCC 13883 and Three Multidrug-Resistant Clinical Isolates  

PubMed Central

Klebsiella pneumoniae is a Gram-negative human pathogen capable of causing hospital-acquired infections with an increasing risk to human health. The total DNA from four clinically relevant strains was sequenced to >100× coverage, providing high-quality genome assemblies for K. pneumoniae strains ATCC 13883, KP4640, 101488, and 101712. PMID:25593250

Arivett, Brock A.; Ream, David C.; Fiester, Steven E.; Mende, Katrin; Murray, Clinton K.; Thompson, Mitchell G.; Kanduru, Shrinidhi; Summers, Amy M.; Roth, Amanda L.; Zurawski, Daniel V.

2015-01-01

373

Draft Genome Sequences of Klebsiella pneumoniae Clinical Type Strain ATCC 13883 and Three Multidrug-Resistant Clinical Isolates.  

PubMed

Klebsiella pneumoniae is a Gram-negative human pathogen capable of causing hospital-acquired infections with an increasing risk to human health. The total DNA from four clinically relevant strains was sequenced to >100× coverage, providing high-quality genome assemblies for K. pneumoniae strains ATCC 13883, KP4640, 101488, and 101712. PMID:25593250

Arivett, Brock A; Ream, David C; Fiester, Steven E; Mende, Katrin; Murray, Clinton K; Thompson, Mitchell G; Kanduru, Shrinidhi; Summers, Amy M; Roth, Amanda L; Zurawski, Daniel V; Actis, Luis A

2015-01-01

374

Extended-spectrum ?-lactamase-producing Klebsiella pneumoniae in a neonatal intensive care unit: risk factors for infection and colonization  

Microsoft Academic Search

An outbreak of extended spectrum ?-lactamase-producing Klebsiella pneumoniae (ESBLKp) infections in a neonatal intensive care unit (NICU) prompted a prospective investigation of colonization and infection with this pathogen. From August 1, 1997 to May 30, 1999, neonates admitted to the NICU for more than 24h were screened for ESBLKp acquisition. Neonatal gastrointestinal screening was performed by means of faecal sampling

C. L Pessoa-Silva; B Meurer Moreira; V Câmara Almeida; B Flannery; M. C Almeida Lins; J. L Mello Sampaio; L Martins Teixeira; L. E Vaz Miranda; L. W Riley; J. L Gerberding

2003-01-01

375

Metabolic and energetic aspects of the growth of Klebsiella aerogenes NCTC 418 on glucose in anaerobic chemostat culture  

Microsoft Academic Search

Klebsiella aerogenes NCTC 418 was cultured anaerobically in chemostat cultures (pH 6.8; 35° C) under carbon, phosphate-, ammonia-, sulphate- and potassium-limited conditions with glucose as the sole carbon- and energy source. The rates of uptake of glucose and excretion of fermentation products were quantitatively determined and carbon, hydrogen- and oxygen balances were constructed with recoveries better than 90%.

M. J. Teixeira de Mattos; D. W. Tempest

1983-01-01

376

Is multiresistant Klebsiella pneumoniae New Delhi metallo-beta-lactamase (NDM-1) a new threat for kidney transplant recipients?  

PubMed

Urinary tract infections (UTIs) are the most frequent infections among kidney transplant (KT) patients. This case documents the emergence of New Delhi metallo-beta-lactamase (NDM-1) Klebsiella pneumonia--a factor of recurrent post-KT UTI, leading to graft loss. Spreading globally, and multidrug resistant, NDM-1 may become a great threat to transplant patients all over the world. PMID:25242796

Karczewski, M; Tomczak, H; Piechocka-Idasiak, I; Cichanska, L; Adamska, Z; Stronka, M

2014-09-01

377

Septic Shock Caused by Klebsiella pneumoniae Carbapenemase-Producing Enterobacter gergoviae in a Neutropenic Patient with Leukemia  

PubMed Central

We present the first reported infection caused by Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacter gergoviae. The patient had leukemia and neutropenia and died of septic shock from KPC-producing E. gergoviae bacteremia. The emergence of KPCs in additional species of Enterobacteriaceae is alarming and may disproportionately affect patients with hematologic malignancies. PMID:23761145

Jenkins, Stephen G.; Chen, Liang; Helfgott, David; Feldman, Eric J.; Kreiswirth, Barry N.; Schuetz, Audrey N.

2013-01-01

378

Complete Genome Sequence of a Klebsiella pneumoniae Isolate with Chromosomally Encoded Carbapenem Resistance and Colibactin Synthesis Loci  

PubMed Central

Klebsiella pneumoniae is an important nosocomial pathogen, and multidrug-resistant strains have become a worldwide concern. Here, we report the complete genome of a K. pneumoniae isolate with chromosomally integrated blaKPC genes and a colibactin synthesis locus. PMID:25540345

Deming, Clayton; Tsai, Yu-Chih; Lau, Anna F.; Dekker, John P.; Korlach, Jonas; Segre, Julia A.

2014-01-01

379

Draft Whole-Genome Sequence of OXA-48-Producing Multidrug-Resistant Klebsiella pneumoniae KP_ST11_OXA-48  

PubMed Central

We present the draft genome sequence of a blood culture isolate of OXA-48-producing Klebsiella pneumoniae (sequence type 11 [ST11]) obtained in the course of a hospital outbreak in Spain. Sequence analysis showed 121 genes related to antibiotic and antiseptic resistance, including blaOXA-48, which was located in an IncL/M plasmid. PMID:25081259

Villa, Jennifer; Viedma, Esther; Brañas, Patricia; Mingorance, Jesús

2014-01-01

380

The Influence of Dissolved Oxygen Concentration on the Respiration and Glucose Metabolism of Klebsiella aerogenes during Growth  

Microsoft Academic Search

SUMMARY The influence of dissolved oxygen concentration on the metabolism and respiration of growing Klebsiella aerogenes NCTC 8017 was studied by means of a continuous-flow culture technique. Different dissolved oxygen tensions (equivalent partial pressures) were obtained by varying the partial pressure of oxygen in the gas phase. The respiration rate (oxygen uptake rate per unit mass organism) was independent of

D. E. F. HARRISON; S. J. PIRT

1967-01-01

381

Destruction of single-species biofilms of Escherichia coli or Klebsiella pneumoniae subsp. pneumoniae by dextranase, lactoferrin, and lysozyme  

Technology Transfer Automated Retrieval System (TEKTRAN)

The activity of dextranase, lactoferrin, lysozyme, and nisin against biofilms composed of either Klebsiella pneumonia or Escherichia coli was examined using the MBEC Assay™. Mature biofilms were treated and then sonicated to remove the adherent biofilm. This material was quantified using a lumines...

382

Identification of putative plant pathogenic determinants from a draft genome sequence of an opportunistic klebsiella pneumoniae strain  

Technology Transfer Automated Retrieval System (TEKTRAN)

Klebsiella pneumoniae has been known historically as a causal agent of bacterial pneumonia. More recently, K. pneumoniaerepresentatives have been shown to have a broad ecological distribution and are recognized nitrogen-fixers. Previously, we demonstrated the capacity of K. pneumoniae strain Kp 5-1R...

383

Genome Sequence of an Extensively Drug-Resistant Strain of Klebsiella pneumoniae, Strain YN-1, with Carbapenem Resistance  

PubMed Central

The emergence and spread of multidrug-resistant (MDR) Klebsiella pneumoniae has been regarded as one of the major challenges among health care-associated infections worldwide. Here, we report the draft genome sequence of an extensively drug-resistant (XDR) K. pneumoniae strain isolated in 2013 from Yunnan Province, China. PMID:25573939

Tan, Hong-Li; Wang, Yong; Cheng, Xue-Qin; Huang, Yan-Mei; Liu, Wei

2015-01-01

384

Can entropy save bacteria?  

E-print Network

This article presents a physical biology approach to understanding organization and segregation of bacterial chromosomes. The author uses a "piston" analogy for bacterial chromosomes in a cell, which leads to a phase diagram for the organization of two athermal chains confined in a closed geometry characterized by two length scales (length and width). When applied to rod-shaped bacteria such as Escherichia coli, this phase diagram predicts that, despite strong confinement, duplicated chromosomes will demix, i.e., there exists a primordial physical driving force for chromosome segregation. The author discusses segregation of duplicating chromosomes using the concentric-shell model, which predicts that newly synthesized DNA will be found in the periphery of the chromosome during replication. In contrast to chromosomes, these results suggest that most plasmids will be randomly distributed inside the cell because of their small sizes. An active partitioning system is therefore required for accurate segregation of low-copy number plasmids. Implications of these results are also sketched, e.g., on the role of proteins, segregation mechanisms for bacteria of diverse shapes, cell cycle of an artificial cell, and evolution.

Suckjoon Jun

2008-08-29

385

RNA localization in bacteria.  

PubMed

One of the most important discoveries in the field of microbiology in the last two decades is that bacterial cells have intricate subcellular organization. This understanding has emerged mainly from the depiction of spatial and temporal organization of proteins in specific domains within bacterial cells, e.g., midcell, cell poles, membrane and periplasm. Because translation of bacterial RNA molecules was considered to be strictly coupled to their synthesis, they were not thought to specifically localize to regions outside the nucleoid. However, the increasing interest in RNAs, including non-coding RNAs, encouraged researchers to explore the spatial and temporal localization of RNAs in bacteria. The recent technological improvements in the field of fluorescence microscopy allowed subcellular imaging of RNAs even in the tiny bacterial cells. It has been reported by several groups, including ours that transcripts may specifically localize in such cells. Here we review what is known about localization of RNA and of the pathways that determine RNA fate in bacteria, and discuss the possible cues and mechanisms underlying these distribution patterns. PMID:25482897

Buskila, Avi-Ad Avraam; Kannaiah, Shanmugapriya; Amster-Choder, Orna

2014-08-01

386

Molecular phylogenetic profiling of gut-associated bacteria in larvae and adults of flesh flies.  

PubMed

Flesh flies of the genus Sarcophaga (Diptera: Sarcophagidae) are carrion-breeding, necrophagous insects important in medical and veterinary entomology as potential transmitters of pathogens to humans and animals. Our aim was to analyse the diversity of gut-associated bacteria in wild-caught larvae and adult flesh flies using culture-dependent and culture-independent methods. Analysis of 16S rRNA gene sequences from cultured isolates and clone libraries revealed bacteria affiliated to Proteobacteria, Actinobacteria, Firmicutes and Bacteroidetes in the guts of larval and adult flesh flies. Bacteria cultured from larval and adult flesh fly guts belonged to the genera Acinetobacter, Bacillus, Budvicia, Citrobacter, Dermacoccus, Enterococcus, Ignatzschineria, Lysinibacillus, Myroides, Pasteurella, Proteus, Providencia and Staphylococcus. Phylogenetic analysis showed clone sequences of the genera Aeromonas, Bacillus, Bradyrhizobium, Citrobacter, Clostridium, Corynebacterium, Ignatzschineria, Klebsiella, Pantoea, Propionibacterium, Proteus, Providencia, Serratia, Sporosarcina, Weissella and Wohlfahrtiimonas. Species of clinically significant genera such as Ignatzschineria and Wohlfahrtiimonas spp. were detected in both larvae and adult flesh flies. Sequence analysis of 16S rRNA gene libraries supported culture-based results and revealed the presence of additional bacterial taxa. This study determined the diversity of gut microbiota in flesh flies, which will bolster the ability to assess microbiological risk associated with the presence of these flies. The present data thereby establish a platform for a much larger study. PMID:24805263

Gupta, A K; Rastogi, G; Nayduch, D; Sawant, S S; Bhonde, R R; Shouche, Y S

2014-12-01

387

Phylogenetic diversity and antimicrobial activity of marine bacteria associated with the soft coral Sarcophyton glaucum.  

PubMed

Coral reefs are the most biodiverse and biologically productive of all marine ecosystems. Corals harbor diverse and abundant prokaryotic groups. However, little is known about the diversity of coral-associated microorganisms. We used molecular techniques to identify and compare the culturable bacterial assemblages associated with the soft coral Sarcophyton glaucum from the Red sea. Different media were utilized for microbial isolation, and the phylogeny of the culturable bacteria associated with the coral was analyzed based on 16S rDNA sequencing. The coral associated bacteria were found to be representatives within the Gammaproteobacteria, Actinobacteria, and Firmicutes. Antimicrobial activities of twenty bacterial isolates were tested against four pathogenic bacteria (Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Vibrio fluvialis) and three fungi (Penicillium sp., Aspergillus niger, Candida albicans). A relatively high proportion of bacterial strains displayed distinct antibacterial and antifungal activities, suggesting that soft coral-associated microorganisms may aid their host in protection against marine pathogens. Members of genera Bacillus and Pseudomonas had the highest proportion of antimicrobial activity which supported the hypothesis that they might play a protective role in the coral hosts. PMID:23996153

ElAhwany, Amani M D; Ghozlan, Hanan A; ElSharif, Hafed A; Sabry, Soraya A

2015-01-01

388

High diversity of nitrogen-fixing bacteria in upper reaches of Heihe River, Northwestern China  

NASA Astrophysics Data System (ADS)

Vegetation plays a key role to water conservation in southern Qilian Mountains (Northwestern China), the upper reaches of Heihe River. Nitrogen-fixing bacteria are crucial for vegetation protection because they can supply plants with nitrogen source. Nevertheless, little is known about nitrogen-fixing bacteria in this region. In present study, nifH gene clone libraries were established for detecting the difference of nitrogen-fixing bacterial communities between Potentilla parvifolia shrub and Carex alrofusca meadow in the southern Qilian Mountains. All the identified nitrogen-fixing bacterial clones belonged to Proteobacteria. At the genus level, the Azospirillum sp. was only detected in shrub soil while Thiocapsa sp., Derxiasp., Ectothiorhodospira sp., Mesorhizobium sp., Klebsiella sp., Ensifer sp., Methylocella sp. and Peseudomonas sp. were just detected in meadow soil. Shannon-Wiener index of nifH gene ranged from 1.5 to 2.8 and was higher in meadow soil than shrub soil. Contrarily, the nifH gene copies and CFUs of cultured nitrogen-fixing bacteria ranged from 0.4 × 107 to 6.9 × 107 copies g-1 soil and 0.97 × 106 to 12.78 × 106 g-1 soil, respectively. Furthermore, both of them were lower in meadow soil than shrub soil. Statistical analysis revealed that diversity and copies of nifH gene mostly correlated with aboveground biomass in shrub soil. In meadow soil, nifH gene diversity was principally affected by altitude while copies did by soil available K.

Tai, X. S.; Mao, W. L.; Liu, G. X.; Chen, T.; Zhang, W.; Wu, X. K.; Long, H. Z.; Zhang, B. G.

2013-03-01

389

Characterisation of aerobically grown non-spore-forming bacteria from paper mill pulps containing recycled fibres.  

PubMed

A total of 179 non-spore-forming bacteria aerobically growing on Nutrient Agar, Plate Count Agar or in specific enrichment conditions for salmonella, campylobacteria, listeria, yersinia or staphylococci, were isolated from 16 untreated paper mill pulps. After phenotypical screening the isolates were characterised by automated ribotyping and partial sequencing of the 16S rRNA gene. They could be divided into seven taxonomical classes representing 63 taxa (species): actinobacteria (11 species), bacilli (7), flavobacteria (3) alphaproteobacteria (10), betaproteobacteria (5), gammaproteobacteria (25) and sphingobacteria (2). Most of the gammaproteobacteria were enterobacteria, mainly species of the genera Enterobacter (7 species, 7 samples/3 mills) and Klebsiella (5 species, 6 samples/3 mills). Other commonly occurring bacteria were most closely related to Microbacterium barkeri (7 samples/3 mills), Cloacibacterium normanense (6 samples/2 mills), Pseudoxanthomonas taiwanensis (5 samples/2 mills) and Sphingobacterium composti (5 samples/1 mill). Sporadic isolates of Listeria innocua, L. monocytogenes, Enterococcus casseliflavus and Staphylococcus warneri were detected, from which only L. monocytogenes is considered to be a food pathogen. No isolates of the genera Campylobacter, Salmonella or Yersinia were detected. The detected bacteria may be harmful in process control, but the load of food pathogens with recycled fibres to paper machines is insignificant. Faecal contamination of the pulp samples was not indicated. PMID:18820960

Suihko, Maija-Liisa; Skyttä, Eija

2009-01-01

390

Distribution and drug resistance of pathogenic bacteria isolated from cancer hospital in 2013  

PubMed Central

Objective To understand distribution and drug resistance of pathogenic bacteria from a specialized cancer hospital in 2013 in order to provide a basis for rational clinical antimicrobial agents. Methods Pathogenic bacteria identification and drug sensitivity tests were performed with a VITEK 2 compact automatic identification system and data were analyzed using WHONET5.6 software. Results Of the 1,378 strains tested, 980 were Gram-negative bacilli, accounting for 71.1%, in which Klebsiella pneumonia, Escherichia coli and Pseudomonas aeruginosa were the dominant strains. We found 328 Gram-positive coccus, accounting for 23.8%, in which the amount of Staphylococcus aureus was the highest. We identified 46 fungi, accounting for 4.1%. According to the departmental distribution within the hospital, the surgical departments isolated the major strains, accounting for 49.7%. According to disease types, lung cancer, intestinal cancer and esophagus cancer were the top three, accounting for 20.9%, 17.3% and 14.2%, respectively. No strains were resistant to imipenem, ertapenem or vancomycin. Conclusions Pathogenic bacteria isolated from the specialized cancer hospital have different resistance rates compared to commonly used antimicrobial agents; therefore antimicrobial agents to reduce the morbidity and mortality of infections should be used.

Liu, Linjuan; Li, Qi; Zhang, Qingyun; Wang, Guohong; Xu, Guobin

2014-01-01

391

Gram-Negative Bacteria That Produce Carbapenemases Causing Death Attributed to Recent Foreign Hospitalization  

PubMed Central

Overseas travel, as a risk factor for the acquisition of infections due to antimicrobial-resistant organisms, has recently been linked to carbapenemase-producing Gram-negative bacteria. Multiresistant Klebsiella pneumoniae, Escherichia coli, and Acinetobacter baumannii strains were isolated from a wound of a Canadian patient with a recent history of hospitalization in India. This resulted in the initiation of outbreak management that included surveillance cultures. Epidemiological and molecular investigations showed that NDM-1-producing K. pneumoniae ST16 and OXA-23-producing A. baumannii ST10 strains were transmitted to 5 other patients, resulting in the colonization of 4 patients and the death of 1 patient due to septic shock caused by the OXA-23-producing A. baumannii strain. The high rate of false positivity of the screening cultures resulted in additional workloads and increased costs for infection control and clinical laboratory work. We believe that this is the first report of an infection with carbapenemase-producing Gram-negative bacteria resulting in death attributed to a patient with recent foreign hospitalization. We recommend routine rectal and wound screening for colonization with multiresistant bacteria for patients who have recently been admitted to hospitals outside Canada. PMID:23612195

Ahmed-Bentley, Jasmine; Chandran, A. Uma; Joffe, A. Mark; French, Desiree; Peirano, Gisele

2013-01-01

392

Isolation of Extended Spectrum ?-lactamase (ESBL) Producing Bacteria from Urban Surface Waters in Malaysia  

PubMed Central

Background: This was a preliminary study to test for the presence of multiple antibiotic-resistant extended spectrum ?-lactamase (ESBL) producing bacteria in Malaysian urban surface waters. Although the literature review revealed several published papers on clinical ESBL isolates in Malaysia, none were found on ESBL isolates obtained from local surface waters Methods: Isolated bacterial species were tested for resistance to cefotaxime, amoxicillin/clavulanate and aztreonam, and susceptibility to imipenem and meropenem using antibiotic susceptibility testing (AST) by disc diffusion. This served as a screening step to detect bacteria that could be potential ESBL species. 16S ribose ribonucleic acid (rRNA) polymerase chain reaction (PCR) testing with two clusters of bla (?-lactamase) gene primers was used to test for the bla genes CTX-M (Groups 1, 2, 9), OXA-1, SHV and TEM. Results: A total of 19 isolates were found, possessing at least one of the bla genes tested for. There was a relatively high occurrence of CTX-M genes (84.2%) among these, followed by TEM genes (47.4%). The isolates were identified as Enterobacteriaceae (89.5%), predominantly Escherichia coli and Klebsiella pneumoniae. Conclusion: There appears to be a high occurrence of ESBL-bacteria in local surface waters, among these being opportunistic pathogens. The persistence and spread of these species in the environment poses a threat to exposed human populations. PMID:23966820

Tissera, Shehani; Lee, Sui Mae

2013-01-01

393

Vapor-induced transfer of bacteria in the absence of mechanical disturbances.  

PubMed

Transfer of bacteria through water vapor generated at moderate temperatures (30-50°C) in passive solar stills, has scarcely been reported. The objective of this research was to investigate whether bacteria in highly humid atmospheres can get transferred through water vapor in the absence of other transfer media to find their way to the distillate. To achieve this objective, passive solar reactors were chosen as the medium for experimentation, and distillation experiments were conducted by spiking a pure bacterial culture (Escherichia coli, Klebsiella pneumonia or Enterococcus faecalis) in low mineralized water vs. highly mineralized water in the dark under moderate temperatures ranges (30-35°C, 40-45°C and 50-55°C). Results showed that bacteria indeed get transferred with the vapor in stills when not exposed to solar U.V. radiation. The trends observed were adequately explained by a zero-modified Hurdle-Poisson model. The numbers of cultivable bacterial colonies transferred were bacterial size, water type and temperature dependent with highest transfers occurring in E. faecalis>E. coli>K. pneumonia at the 40°C range in low mineralized water. Proper management strategies are recommended to achieve complete disinfection in solar stills. PMID:25169809

Ayoub, G M; Dahdah, L; Alameddine, I; Malaeb, L

2014-09-15

394

Azithromycin, fluoroquinolone and chloramphenicol resistance of non-chlamydia conjunctival bacteria in rural community of Ethiopia  

PubMed Central

Aim: To determine profiles of non-chlamydia conjunctival bacteria and their antimicrobial susceptibility from adults who underwent trachomatous trichiasis surgery in rural areas of Ethiopia. Materials and Methods: A cross-sectional study was conducted in rural districts in West Gojjam administrative zone. Conjunctival swabs were collected during surgery and transported using Stuart transport broth (Oxoid, UK). Antibiotic susceptibility of conjunctival isolates was determined using the Kirby-Bauer disc-diffusion method. Results: Non-chlamydia pathogenic bacteria were recovered from conjunctiva of 438 (31%) participants before treatment. The isolated conjunctival bacteria were Staphylococcus aureus, coagulase-negative Staphylococci, Streptococcus group (A, C, F and G), Enterococci, Streptococcus pneumoniae, Moraxella spp., Escherichia coli, Citrobacter spp., Proteus spp., Klebsiella spp., Pseudomonas spp. and Enterobacter spp. Overall, resistance rates of 57.8% to azithromycin and 68.5% to chloramphenicol were found. However, 86-94.4% sensitivity was demonstrated to ciprofloxacin and norfloxacin. Moderate sensitivity rates (61.8-78.4%) were observed to ceftriaxone, tetracycline and cotrimoxazole. Conclusion: Fluoroquinolones that have activity against the majority of bacterial isolates were potent at in vitro. However, unacceptably high levels of resistance to azithromycin and chloramphenicol in rural community indicated a need for further study and antimicrobial resistance surveillance. PMID:23571246

Abera, Bayeh; Kibret, Mulugeta

2014-01-01

395

Bioinspired magneto-optical bacteria.  

PubMed

"Two-in-one" magneto-optical bacteria have been produced using the probiotic Lactobacillus fermentum for the first time. We took advantage of two features of bacteria to synthesize this novel and bifunctional nanostructure: their metal-reducing properties, to produce gold nanoparticles, and their capacity to incorporate iron oxide nanoparticles at their external surface. The magneto-optical bacteria survive the process and behave as a magnet at room temperature. PMID:25068183

Carmona, Fernando; Martín, Miguel; Gálvez, Natividad; Dominguez-Vera, Jose M

2014-08-18

396

TSSWCB Bacteria-Related Projects  

E-print Network

of the projects are listed below. ? Peach CreekWater Quality Improvement Project ? Monitoring and Educational Programs Focused on Bacteria and Nutrient Runoff on Dairy Operations in the LeonWatershed ? Development of the Plum CreekWPP ? Impact of Proper... Star Healthy Streams * ? Environmental Management of Grazing Lands * *TWRI-managed projects More information on the initiative is available at www.tsswcb.state.tx.us/managementprogram/ initiatives/bacteria. Bacteria Projects Across the State...

Wythe, Kathy

2007-01-01

397

A liver abscess deprived a healthy adult of eyesight: endogenous endophthalmitis associated with a pyogenic liver abscess caused by serotype K1 Klebsiella pneumonia.  

PubMed

Klebsiella pneumonia usually causes urinary tract infections, pneumonia, and other infectious diseases in hospitalized and immunocompromised patients. Among the types of Klebsiella pneumonia, serotype K1 is known to be a highly virulent pathogen. We herein report the case of a healthy 63-year-old man with a pyogenic liver abscess and bilateral endogenous endophthalmitis caused by serotype K1 Klebsiella pneumonia. Although the patient received percutaneous abscess drainage and antibiotic therapy, he lost his eyesight. To improve the poor prognoses of ocular complications, providing both an earlier diagnosis and treatment is critical. PMID:23583997

Maruno, Takahisa; Ooiwa, Yoko; Takahashi, Ken; Kodama, Yuzo; Takakura, Shunji; Ichiyama, Satoshi; Chiba, Tsutomu

2013-01-01

398

A direct viable count method for the enumeration of attached bacteria and assessment of biofilm disinfection  

NASA Technical Reports Server (NTRS)

This report describes the adaptation of an in situ direct viable count (in situ DVC) method in biofilm disinfection studies. The results obtained with this technique were compared to two other enumeration methods, the plate count (PC) and conventional direct viable count (c-DVC). An environmental isolate (Klebsiella pneumoniae Kp1) was used to form biofilms on stainless steel coupons in a stirred batch reactor. The in situ DVC method was applied to directly assess the viability of bacteria in biofilms without disturbing the integrity of the interfacial community. As additional advantages, the results were observed after 4 h instead of the 24 h incubation time required for colony formation and total cell numbers that remained on the substratum were enumerated. Chlorine and monochloramine were used to determine the susceptibilities of attached and planktonic bacteria to disinfection treatment using this novel analytical approach. The planktonic cells in the reactor showed no significant change in susceptibility to disinfectants during the period of biofilm formation. In addition, the attached cells did not reveal any more resistance to disinfection than planktonic cells. The disinfection studies of young biofilms indicated that 0.25 mg/l free chlorine (at pH 7.2) and 1 mg/l monochloramine (at pH 9.0) have comparable disinfection efficiencies at 25 degrees C. Although being a weaker disinfectant, monochloramine was more effective in removing attached bacteria from the substratum than free chlorine. The in situ DVC method always showed at least one log higher viable cell densities than the PC method, suggesting that the in situ DVC method is more efficient in the enumeration of biofilm bacteria. The results also indicated that the in situ DVC method can provide more accurate information regarding the cell numbers and viability of bacteria within biofilms following disinfection.

Yu, F. P.; Pyle, B. H.; McFeters, G. A.

1993-01-01

399

Glucosyltransferase production by Klebsiella sp. K18 and conversion of sucrose to palatinose using immobilized cells  

PubMed Central

The strain Klebsiella sp. K18 produces the enzyme glucosyltransferase and catalyses the conversion of sucrose to palatinose, an alternative sugar that presents low cariogenicity. Response Surface Methodology was successfully employed to determine the optimal concentration of culture medium components. Maximum glucosyltransferase production (21.78 U mL-1) was achieved using the optimized medium composed by sugar cane molasses (80 g L-1), bacteriological peptone (7 g L-1) and yeast extract (20 g L-1), after 8 hours of fermentation at 28°C. The conversion of sucrose to palatinose was studied utilizing immobilized cells in calcium alginate. The effects of the alginate concentration (2-4%), cell mass concentration (20-40%) and substrate concentration (25-45%) were evaluated and the yield of palatinose was approximately 62.5%. PMID:24031319

Orsi, Daniela C.; Kawaguti, Haroldo Y.; Sato, Hélia H.

2009-01-01

400

Clonal dissemination of Klebsiella pneumoniae ST258 harbouring KPC-2 in Argentina.  

PubMed

The present work describes the abrupt emergence of Klebsiella pneumoniae carbapenemase (KPC) and characterizes the first 79 KPC-producing enterobacteria from Argentina (isolated from 2006 to 2010). The emergence of bla(KPC-2) was characterized by two patterns of dispersion: the first was the sporadic occurrence in diverse enterobacteria from distant geographical regions, harbouring plasmids of different incompatibility groups and bla(KPC-2) in an unusual genetic environment flanked by ISKpn8-?bla(TEM-1) and ISKpn6-like. bla(KPC-2) was associated with IncL/M transferable plasmids; the second was the abrupt clonal spread of K. pneumoniae ST258 harbouring bla(KPC-2) in Tn4401a. PMID:21851480

Gomez, S A; Pasteran, F G; Faccone, D; Tijet, N; Rapoport, M; Lucero, C; Lastovetska, O; Albornoz, E; Galas, M; Melano, R G; Corso, A; Petroni, A

2011-10-01

401

IMP-Producing Carbapenem-Resistant Klebsiella pneumoniae in the United States ?  

PubMed Central

The emergence and spread of carbapenem-resistant Enterobacteriaceae (CRE) producing acquired carbapenemases have created a global public health crisis. In the United States, CRE producing the Klebsiella pneumoniae carbapenemase (KPC) are increasingly common and are endemic in some regions. Metallo-?-lactamase (MBL)-producing CRE have recently been reported in the United States among patients who received medical care in countries where such organisms are common. Here, we describe three carbapenem-resistant K. pneumoniae isolates recovered from pediatric patients at a single U.S. health care facility, none of whom had a history of international travel. The isolates were resistant to carbapenems but susceptible to aztreonam, trimethoprim-sulfamethoxazole, and fluoroquinolones. The three isolates were closely related to each other by pulsed-field gel electrophoresis and contained a common plasmid. PCR and sequence analysis confirmed that these isolates produce IMP-4, an MBL carbapenemase not previously published as present among Enterobacteriaceae in the United States. PMID:21998425

Limbago, Brandi M.; Rasheed, J. Kamile; Anderson, Karen F.; Zhu, Wenming; Kitchel, Brandon; Watz, Nancy; Munro, Susan; Gans, Hayley; Banaei, Niaz; Kallen, Alex J.

2011-01-01

402

A Case of Ventriculitis Associated with Renal Abscess Caused by Serotype K1 Klebsiella pneumoniae  

PubMed Central

Recently, serotype K1 Klebsiella pneumoniae has been a major agent of an invasive syndrome characterized by liver abscess and its metastatic infection. Extrahepatic infection and its characteristics in patients with renal abscess caused by K. pneumoniae are poorly understood, and few cases of central nervous system infection have been reported. This is a report of 80-year-old woman with uncontrolled type 2 diabetes mellitus with renal abscess caused by serotype K1 K. pneumoniae, complicated with ventriculitis despite of appropriate use of antibiotics. Physicians need to be aware of possibility of metastatic infection in patients with serotype K1 K. pneumoniae infection, if they develop neurologic symptom and focus of infection is still present. PMID:25024876

Hyun, Ji In; Jeon, Yoon Hee; Kim, Sang Il; Park, Yeon Joon; Kang, Moon Won; Kim, Woohyeon; Jang, Ji Hye

2014-01-01

403

[A case of Klebsiella pneumoniae infection causing a buccal abscess complicated with multiple lung abscesses].  

PubMed

A 51 year-old man fitted with a dental prosthesis was hospitalized with buccal swelling, fever and chest pain. Laboratory data showed marked inflammatory changes, and chest radiography and CT scanning revealed small nodular shadows within the lung. A diagnosis of multiple lung abscesses secondary to a buccal abscess possibly caused by the prosthesis was made from needle aspiration biopsies of the lung nodules and of a buccal lesion. Klebsiella pneumoniae was isolated from these lesions and from a blood culture. The patient was successfully treated with antibiotics and by surgical drainage of the buccal abscess. It is important to note that the patient was immunodeficient at the time as a result of diabetes and alcohol intoxication. PMID:11019572

Kosugi, E; Yoshida, K; Aoike, N; Shimizu, K; Higa, M; Sakai, N; Nakamura, Y; Uchida, K; Tateda, K

2000-07-01

404

Structural and kinetic insights into the mechanism of 5-hydroxyisourate hydrolase from Klebsiella pneumoniae  

SciTech Connect

The stereospecific oxidative degradation of uric acid to (S)-allantoin has recently been demonstrated to proceed via two unstable intermediates and requires three separate enzymatic reactions. The second step of this reaction, the conversion of 5-hydroxyisourate (HIU) to 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline, is catalyzed by HIU hydrolase (HIUH). The high-resolution crystal structure of HIUH from the opportunistic pathogen Klebsiella pneumoniae (KpHIUH) has been determined. KpHIUH is a homotetrameric protein that, based on sequence and structural similarity, belongs to the transthyretin-related protein family. In addition, the steady-state kinetic parameters for this enzyme and four active-site mutants have been measured. These data provide valuable insight into the functional roles of the active-site residues. Based upon the structural and kinetic data, a mechanism is proposed for the KpHIUH-catalyzed reaction.

French, Jarrod B.; Ealick, Steven E. (Cornell)

2011-07-19

405

X-linked agammaglobulinemia combined with juvenile idiopathic arthritis and invasive Klebsiella pneumoniae polyarticular septic arthritis.  

PubMed

X-linked agammaglobulinemia (XLA) is a primary immunodeficiency disease caused by mutations in the Bruton's tyrosine kinase (BTK) gene. XLA can also present in combination with juvenile idiopathic arthritis (JIA), the major chronic rheumatologic disease in children. We report herein the first known case of a juvenile patient diagnosed with XLA combined with JIA that later developed into invasive Klebsiella pneumoniae polyarticular septic polyarthritis. An additional comprehensive review of XLA combined with JIA and invasive K. pneumoniae septic arthritis is also presented. XLA was identified by the detection of BTK mutations while the diagnosis of JIA was established by clinical and laboratory assessments. Septic arthritis caused by invasive K. pneumoniae was confirmed by culturing of the synovia and gene detection of the isolates. Invasive K. pneumoniae infections can not only result in liver abscesses but also septic arthritis, although this is rare. XLA combined with JIA may contribute to invasive K. pneumoniae infection. PMID:24567239

Zhu, Zaihua; Kang, Yuli; Lin, Zhenlang; Huang, Yanjing; Lv, Huoyang; Li, Yasong

2015-02-01

406

Production of optically pure d-lactate from glycerol by engineered Klebsiella pneumoniae strain.  

PubMed

In this study, glycerol was used to produce optically pure d-lactate by engineered Klebsiella pneumoniae strain. In the recombinant strain, d-lactate dehydrogenase LdhA was overexpressed, and two genes, dhaT and yqhD for biosynthesis of main byproduct 1,3-propanediol, were knocked out. To further improve d-lactate production, the culture condition was optimized and the results demonstrated that aeration rate played an important role in d-lactate production. In microaerobic fed-batch fermentation, the engineered strain accumulated 142.1g/L optically pure d-lactate with a yield of 0.82g/g glycerol, which represented the highest d-lactate production from glycerol so far. This study showed that K. pneumoniae strain has high efficiency to convert glycerol into d-lactate and high potentiality in utilization of crude glycerol from biodiesel industry. PMID:25270041

Feng, Xinjun; Ding, Yamei; Xian, Mo; Xu, Xin; Zhang, Rubing; Zhao, Guang

2014-11-01

407

Phytochemical Screening and Antimicrobial Activity of Some Medicinal Plants Against Multi-drug Resistant Bacteria from Clinical Isolates  

PubMed Central

The in vitro antibacterial activity of various solvents and water extracts of aloe vera, neem, bryophyllum, lemongrass, tulsi, oregano, rosemary and thyme was assessed on 10 multi-drug resistant clinical isolates from both Gram-positive and Gram-negative bacteria and two standard strains including Staphylococcus aureus ATCC 25923 and Escherichia coli ATCC 25922. The zone of inhibition as determined by agar well diffusion method varied with the plant extract, the solvent used for extraction, and the organism tested. Klebsiella pneumoniae 2, Escherichia coli 3 and Staphylococcus aureus 3 were resistant to the plant extracts tested. Moreover, water extracts did not restrain the growth of any tested bacteria. Ethanol and methanol extracts were found to be more potent being capable of exerting significant inhibitory activities against majority of the bacteria investigated. Staphylococcus aureus 1 was the most inhibited bacterial isolate with 24 extracts (60%) inhibiting its growth whereas Escherichia coli 2 exhibited strong resistance being inhibited by only 11 extracts (28%). The results obtained in the agar diffusion plates were in fair correlation with that obtained in the minimum inhibitory concentration tests. The minimum inhibitory concentration of tulsi, oregano, rosemary and aloe vera extracts was found in the range of 1.56-6.25 mg/ml for the multi-drug resistant Staphylococcus aureus isolates tested whereas higher values (6.25-25 mg/ml) were obtained against the multi-drug resistant isolates Klebsiella pneumoniae 1 and Escherichia coli 1 and 2. Qualitative phytochemical analysis demonstrated the presence of tannins and saponins in all plants tested. Thin layer chromatography and bioautography agar overlay assay of ethanol extracts of neem, tulsi and aloe vera indicated flavonoids and tannins as major active compounds against methicillin-resistant Staphylococcus aureus. PMID:23716873

Dahiya, Praveen; Purkayastha, Sharmishtha

2012-01-01

408

Successful treatment of a patient with ventriculoperitoneal shunt-associated meningitis caused by extended-spectrum ?-lactamase-producing Klebsiella pneumoniae.  

PubMed

Bacterial meningitis is responsible for significant morbidity and mortality worldwide, despite that modern antibiotics effectively penetrate cerebrospinal fluid to eradicate bacteria. A clinical suspicion of bacterial meningitis should be recognized early for the rapid diagnostic workup. Bacterial meningitis associated with ventriculoperitoneal shunt (VPS) is not uncommon and infrequently presents as abdominal symptoms and signs. Infections of the central nervous system caused by extended-spectrum ?-lactamase-producing Klebsiella pneumoniae (ESBL-KP) are extremely rare, and such multiple drug-resistant pathogens frequently cause inappropriate treatments and mortality. ?-Lactamases are bacterial enzymes that inactivate ?-lactam antimicrobial agents. The increased prevalence of ESBL-producing organism infections has become a worldwide problem. Timely and appropriate treatment is important to reduce mortality and morbidity of infections caused by ESBL-producing organisms. Here, we report a 61-year-old male patient who underwent VPS implantation for consequent hydrocephalus following spontaneous intracranial hemorrhage six months before this presentation. He was admitted for intermittent fever and right lower quadrant abdominal pain, and he was initially managed as acute appendicitis with its typical presentation. Finally, he was diagnosed VPS-associated meningitis caused by ESBL-KP. This patient was successfully treated with the combination of meropenem, a carbapenem antibiotic that is the drug of choice for treating ESBL-producing organisms, and high-dose fosfomycin, a phosphonic acid derivative antibiotic that is effective in treating some drug-resistant pathogens. In the present report, we emphasize the clinical presentations of catheter-related meningitis and risk factors for infections caused by ESBL-producing pathogens. Antibiotic combination therapy can provide synergistic effect and maximize anti-bacterial activity in ESBL-KP meningitis. PMID:25142281

Tseng, Yu-Chen; Kan, Li-Ping; Huang, Li-Yueh; Yin, Ti; Yang, Ya-Sung; Lin, Jung-Chung; Siu, L Kristopher

2014-01-01

409

YjcC, a c-di-GMP Phosphodiesterase Protein, Regulates the Oxidative Stress Response and Virulence of Klebsiella pneumoniae CG43  

PubMed Central

This study shows that the expression of yjcC, an in vivo expression (IVE) gene, and the stress response regulatory genes soxR, soxS, and rpoS are paraquat inducible in Klebsiella pneumoniae CG43. The deletion of rpoS or soxRS decreased yjcC expression, implying an RpoS- or SoxRS-dependent control. After paraquat or H2O2 treatment, the deletion of yjcC reduced bacterial survival. These effects could be complemented by introducing the ?yjcC mutant with the YjcC-expression plasmid pJR1. The recombinant protein containing only the YjcC-EAL domain exhibited phosphodiesterase (PDE) activity; overexpression of yjcC has lower levels of cyclic di-GMP. The yjcC deletion mutant also exhibited increased reactive oxygen species (ROS) formation, oxidation damage, and oxidative stress scavenging activity. In addition, the yjcC deletion reduced capsular polysaccharide production in the bacteria, but increased the LD50 in mice, biofilm formation, and type 3 fimbriae major pilin MrkA production. Finally, a comparative transcriptome analysis showed 34 upregulated and 29 downregulated genes with the increased production of YjcC. The activated gene products include glutaredoxin I, thioredoxin, heat shock proteins, chaperone, and MrkHI, and proteins for energy metabolism (transporters, cell surface structure, and transcriptional regulation). In conclusion, the results of this study suggest that YjcC positively regulates the oxidative stress response and mouse virulence but negatively affects the biofilm formation and type 3 fimbriae expression by altering the c-di-GMP levels after receiving oxidative stress signaling inputs. PMID:23935824

Huang, Ching-Jou; Wang, Zhe-Chong; Huang, Hsi-Yuan; Huang, Hsien-Da; Peng, Hwei-Ling

2013-01-01

410

A Long-Term Low-Frequency Hospital Outbreak of KPC-Producing Klebsiella pneumoniae Involving Intergenus Plasmid Diffusion and a Persisting Environmental Reservoir  

PubMed Central

Background To study the molecular characteristics of a long-term, low frequency outbreak of blaKPC-2 in a low prevalence setting involving the hospital environment. Methodology/Principal Findings KPC-producing bacteria were screened by selective chromogenic agar and Real-Time PCR. The presence of antibiotic resistance genes was ascribed by PCRs and subsequent sequencing, and the KPC-producing isolates were phylogenetically typed using PFGE and multi-locus sequence typing. BlaKPC-2-plasmids were identified and analysed by S1-nuclease-PFGE hybridization and PCR based replicon typing. A ?97 kb IncFII plasmid was seen to carry blaKPC-2 in all of the clinical isolates, in one of the isolates recovered from screened patients (1/136), and in the Klebsiella pneumoniae and Enterobacter asburiae isolates recovered from the environment (sinks) in one intensive care unit. The K. pneumoniae strain ST258 was identified in 6 out of 7 patients. An intergenus spread to E. asburiae and an interspecies spread to two different K. pneumoniae clones (ST27 and ST461) of the blaKPC-2 plasmid was discovered. K. pneumoniae ST258 and genetically related E. asburiae strains were found in isolates of both human and environmental origins. Conclusions/Significance We document a clonal transmission of the K. pneumoniae ST258 strain, and an intergenus plasmid diffusion of the IncFII plasmid carrying blaKPC-2 in this outbreak. A major reservoir in the patient population could not be unveiled. However, the identification of a persisting environmental reservoir of strains with molecular determinants linked to human isolates, suggests a possible role of the environment in the maintenance of this long-term outbreak. PMID:23536849

Tofteland, Ståle; Naseer, Umaer; Lislevand, Jan Helge; Sundsfjord, Arnfinn; Samuelsen, Ørjan

2013-01-01

411

Detection and Molecular Characterization of Escherichia coli CTX-M-15 and Klebsiella pneumoniae SHV-12 ?-Lactamases from Bovine Mastitis Isolates in the United Kingdom  

PubMed Central

Recent reports raised concerns about the role that farm stock may play in the dissemination of extended-spectrum ?-lactamase (ESBL)-producing bacteria. This study characterized the ESBLs in two Escherichia coli and three Klebsiella pneumoniae subsp. pneumoniae isolates from cases of clinical bovine mastitis in the United Kingdom. Bacterial culture and sensitivity testing of bovine mastitic milk samples identified Gram-negative cefpodoxime-resistant isolates, which were assessed for their ESBL phenotypes. Conjugation experiments and PCR-based replicon typing (PBRT) were used for characterization of transferable plasmids. E. coli isolates belonged to sequence type 88 (ST88; determined by multilocus sequence typing) and carried blaCTX-M-15 and blaTEM-1, while K. pneumoniae subsp. pneumoniae isolates carried blaSHV-12 and blaTEM-1. Conjugation experiments demonstrated that blaCTX-M-15 and blaTEM-1 were carried on a conjugative plasmid in E. coli, and PBRT identified this to be an IncI1 plasmid. The resistance genes were nontransferable in K. pneumoniae subsp. pneumoniae isolates. Moreover, in the E. coli isolates, an association of ISEcp1 and IS26 with blaCTX-M-15 was found where the IS26 element was inserted upstream of both ISEcp1 and the blaCTX-M promoter, a genetic arrangement highly similar to that described in some United Kingdom human isolates. We report the first cases in Europe of bovine mastitis due to E. coli CTX-M-15 and also of bovine mastitis due to K. pneumoniae subsp. pneumoniae SHV-12 ?-lactamases in the United Kingdom. We also describe the genetic environment of blaCTX-M-15 and highlight the role that IncI1 plasmids may play in the spread and dissemination of ESBL genes, which have been described in both human and cattle isolates. PMID:24247146

Maciuca, Iuliana E.; Evans, Nicholas J.; Williams, Helen; Wattret, Andrew; Fick, Jenny C.; Williams, Nicola J.

2014-01-01

412

Detection and molecular characterization of Escherichia coli CTX-M-15 and Klebsiella pneumoniae SHV-12 ?-lactamases from bovine mastitis isolates in the United Kingdom.  

PubMed

Recent reports raised concerns about the role that farm stock may play in the dissemination of extended-spectrum ?-lactamase (ESBL)-producing bacteria. This study characterized the ESBLs in two Escherichia coli and three Klebsiella pneumoniae subsp. pneumoniae isolates from cases of clinical bovine mastitis in the United Kingdom. Bacterial culture and sensitivity testing of bovine mastitic milk samples identified Gram-negative cefpodoxime-resistant isolates, which were assessed for their ESBL phenotypes. Conjugation experiments and PCR-based replicon typing (PBRT) were used for characterization of transferable plasmids. E. coli isolates belonged to sequence type 88 (ST88; determined by multilocus sequence typing) and carried blaCTX-M-15 and blaTEM-1, while K. pneumoniae subsp. pneumoniae isolates carried blaSHV-12 and blaTEM-1. Conjugation experiments demonstrated that blaCTX-M-15 and blaTEM-1 were carried on a conjugative plasmid in E. coli, and PBRT identified this to be an IncI1 plasmid. The resistance genes were nontransferable in K. pneumoniae subsp. pneumoniae isolates. Moreover, in the E. coli isolates, an association of ISEcp1 and IS26 with blaCTX-M-15 was found where the IS26 element was inserted upstream of both ISEcp1 and the blaCTX-M promoter, a genetic arrangement highly similar to that described in some United Kingdom human isolates. We report the first cases in Europe of bovine mastitis due to E. coli CTX-M-15 and also of bovine mastitis due to K. pneumoniae subsp. pneumoniae SHV-12 ?-lactamases in the United Kingdom. We also describe the genetic environment of blaCTX-M-15 and highlight the role that IncI1 plasmids may play in the spread and dissemination of ESBL genes, which have been described in both human and cattle isolates. PMID:24247146

Timofte, Dorina; Maciuca, Iuliana E; Evans, Nicholas J; Williams, Helen; Wattret, Andrew; Fick, Jenny C; Williams, Nicola J

2014-01-01

413

Genomic Epidemiology of Klebsiella pneumoniae in Italy and Novel Insights into the Origin and Global Evolution of Its Resistance to Carbapenem Antibiotics.  

PubMed

Klebsiella pneumoniae is at the forefront of antimicrobial resistance for Gram-negative pathogenic bacteria, as strains resistant to third-generatio