Science.gov

Sample records for klebsiella oxytoca bacteria

  1. First Report of Septic Arthritis Caused by Klebsiella oxytoca?

    PubMed Central

    Ménard, Armelle; Harambat, Jérome; Pereyre, Sabine; Pontailler, Jean-Roger; Mégraud, Francis; Richer, Olivier

    2010-01-01

    Klebsiella oxytoca is known to be a pathogen in immunodeficient adults and children. Here we report the first case of a K. oxytoca infection associated with spontaneous arthritis of the knee in a child with no history of immunosuppressive therapy or previous bacterial infections. Despite an initial antibiotic treatment failure, a second treatment led to a cure of the infection with no joint sequelae. PMID:20573877

  2. Cytotoxic and Pathogenic Properties of Klebsiella oxytoca Isolated from Laboratory Animals

    E-print Network

    Darby, Alison

    Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin ...

  3. Improvements In Ethanologenic Escherichia Coli and Klebsiella Oxytoca

    SciTech Connect

    Dr. David Nunn

    2010-09-30

    The current Verenium cellulosic ethanol process is based on the dilute-acid pretreatment of a biomass feedstock, followed by a two-stage fermentation of the pentose sugar-containing hydrolysate by a genetically modified ethanologenic Escherichia coli strain and a separate simultaneous saccharification-fermentation (SSF) of the cellulosic fraction by a genetically modified ethanologenic Klebsiella oxytoca strain and a fungal enzyme cocktail. In order to reduce unit operations and produce a fermentation beer with higher ethanol concentrations to reduce distillation costs, we have proposed to develop a simultaneous saccharification co-fermentation (SScF) process, where the fermentation of the pentose-containing hydrolysate and cellulosic fraction occurs within the same fermentation vessel. In order to accomplish this goal, improvements in the ethanologens must be made to address a number of issues that arise, including improved hydrolysate tolerance, co-fermentation of the pentose and hexose sugars and increased ethanol tolerance. Using a variety of approaches, including transcriptomics, strain adaptation, metagenomics and directed evolution, this work describes the efforts of a team of scientists from Verenium, University of Florida, Massachusetts Institute of Technology and Genomatica to improve the E. coli and K. oxytoca ethanologens to meet these requirements.

  4. Cytotoxic and Pathogenic Properties of Klebsiella oxytoca Isolated from Laboratory Animals

    PubMed Central

    Sarkar, Ujjal; Seneviratne, Uthpala; Park, Danny S.; Gamazon, Eric R.; Batchelder, Chara; Cheung, Cheryl; Buckley, Ellen M.; Taylor, Nancy S.; Shen, Zeli; Tannenbaum, Steven R.; Wishnok, John S.; Fox, James G.

    2014-01-01

    Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin production in animal isolates of K. oxytoca and its pathogenic properties have not been characterized. Furthermore, neither the identity of the toxin nor a complete repertoire of genes involved in K. oxytoca pathogenesis have been fully elucidated. Here, we showed that several animal isolates of K. oxytoca, including the clinical isolates, produced secreted products in bacterial culture supernatant that display cytotoxicity on HEp-2 and HeLa cells, indicating the ability to produce cytotoxin. Cytotoxin production appears to be regulated by the environment, and soy based product was found to have a strong toxin induction property. The toxin was identified, by liquid chromatography-mass spectrometry and NMR spectroscopy, as low molecular weight heat labile benzodiazepine, tilivalline, previously shown to cause cytotoxicity in several cell lines, including mouse L1210 leukemic cells. Genome sequencing and analyses of a cytotoxin positive K. oxytoca strain isolated from an abscess of a mouse, identified genes previously shown to promote pathogenesis in other enteric bacterial pathogens including ecotin, several genes encoding for type IV and type VI secretion systems, and proteins that show sequence similarity to known bacterial toxins including cholera toxin. To our knowledge, these results demonstrate for the first time, that animal isolates of K. oxytoca, produces a cytotoxin, and that cytotoxin production is under strict environmental regulation. We also confirmed tilivalline as the cytotoxin present in animal K. oxytoca strains. These findings, along with the discovery of a repertoire of genes with virulence potential, provide important insights into the pathogenesis of K. oxytoca. As a novel diagnostic tool, tilivalline may serve as a biomarker for K oxytoca-induced cytotoxicity in humans and animals through detection in various samples from food to diseased samples using LC-MS/MS. Induction of K. oxytoca cytotoxin by consumption of soy may be in part involved in the pathogenesis of gastrointestinal disease. PMID:25057966

  5. Contaminated handwashing sinks as the source of a clonal outbreak of KPC-2-producing Klebsiella oxytoca on a hematology ward.

    PubMed

    Leitner, Eva; Zarfel, Gernot; Luxner, Josefa; Herzog, Kathrin; Pekard-Amenitsch, Shiva; Hoenigl, Martin; Valentin, Thomas; Feierl, Gebhard; Grisold, Andrea J; Högenauer, Christoph; Sill, Heinz; Krause, Robert; Zollner-Schwetz, Ines

    2015-01-01

    We investigated sinks as possible sources of a prolonged Klebsiella pneumonia carbapenemase (KPC)-producing Klebsiella oxytoca outbreak. Seven carbapenem-resistant K. oxytoca isolates were identified in sink drains in 4 patient rooms and in the medication room. Investigations for resistance genes and genetic relatedness of patient and environmental isolates revealed that all the isolates harbored the blaKPC-2 and blaTEM-1 genes and were genetically indistinguishable. We describe here a clonal outbreak caused by KPC-2-producing K. oxytoca, and handwashing sinks were a possible reservoir. PMID:25348541

  6. Contaminated Handwashing Sinks as the Source of a Clonal Outbreak of KPC-2-Producing Klebsiella oxytoca on a Hematology Ward

    PubMed Central

    Leitner, Eva; Zarfel, Gernot; Luxner, Josefa; Herzog, Kathrin; Pekard-Amenitsch, Shiva; Hoenigl, Martin; Valentin, Thomas; Feierl, Gebhard; Grisold, Andrea J.; Högenauer, Christoph; Sill, Heinz; Krause, Robert

    2014-01-01

    We investigated sinks as possible sources of a prolonged Klebsiella pneumonia carbapenemase (KPC)-producing Klebsiella oxytoca outbreak. Seven carbapenem-resistant K. oxytoca isolates were identified in sink drains in 4 patient rooms and in the medication room. Investigations for resistance genes and genetic relatedness of patient and environmental isolates revealed that all the isolates harbored the blaKPC-2 and blaTEM-1 genes and were genetically indistinguishable. We describe here a clonal outbreak caused by KPC-2-producing K. oxytoca, and handwashing sinks were a possible reservoir. PMID:25348541

  7. Recombinant Klebsiella oxytoca Strains with Improved Efficiency in Removal of High Nitrate Loads

    PubMed Central

    Piñar, Guadalupe; Ramos, Juan L.

    1998-01-01

    Klebsiella oxytoca CECT 4460 removes high nitrate loads from industrial wastewaters without accumulation of nitrite under optimal culture conditions; however, under nonoptimal conditions nitrite accumulates. This situation reflects an in vivo-limited functioning of nitrite reductase in this strain. As a way to overcome this limitation, an increase in the nitrite reductase gene dose in K. oxytoca CECT 4460 was considered. To achieve this, we cloned and transferred into this strain the Klebsiella pneumoniae nasB gene, which encodes assimilatory nitrite reductase (Lin et al., J. Bacteriol. 176:2551–2559, 1994). The delivery vector was either the wide-host-range plasmid pUPE2, in which the nasB gene is expressed from the Escherichia coli Plac promoter, or a mini-Tn5-Km vector, which upon random insertion in the host chromosome allowed expression of the nasB gene from an unidentified chromosomal host promoter. The effect of the increase in the dose of the nasB gene in K. oxytoca CECT 4460 on the accumulation of nitrite in the culture medium was tested in two recombinant strains. The results obtained showed that K. oxytoca CECT 4460 bearing pUPE2 accumulated 88% less nitrite than the wild-type strain, while the recombinant strain bearing the K. pneumoniae nasB gene in the host chromosome showed a 25% lower level of nitrite accumulation in the culture medium than that of the wild type. PMID:9835599

  8. A study of the prevalence of cytotoxic and non-cytotoxic Klebsiella oxytoca fecal colonization in two patient populations

    PubMed Central

    Smith, Stephen A; Campbell, Sarah J; Webster, Duncan; Curley, Michael; Leddin, Desmond; Forward, Kevin R

    2009-01-01

    BACKGROUND: Klebsiella oxytoca is a cause of antibiotic-associated hemorrhagic colitis. Few reports of the occurrence of K oxytoca within stool exist and there is no gold standard method for its isolation. METHODS: MacConkey agar was modified to culture K oxytoca. Ampicillin was added and adonitol was substituted for lactose. Rectal swabs from 200 patients being screened for vancomycin-resistant enterococci (VRE) and stool specimens from 429 patients who tested negative for Clostridium difficile cytotoxin were cultured. K oxytoca isolates were evaluated for cytotoxicity to HEp-2 cells. Available charts of K oxytoca-positive patients and a convenience sample of 93 K oxytoca-negative patients who underwent testing for C difficile cytotoxicity were reviewed retrospectively for documentation of bloody stool. RESULTS: K oxytoca was isolated from 14 of 200 patients (7.0%) being screened for VRE; only one of the 14 isolates (7.1%) was cytotoxic. The organism was isolated from 42 of 429 patients (9.8%) tested for C difficile cytotoxicity; 10 isolates (23.8%) were cytotoxic. Differences in isolation and cytotoxicity rates between groups were not statistically significant. Two of 13 (15.4%) K oxytoca-positive patients screened for VRE, three of 27 (11.1%) K oxytoca-positive patients tested for C difficile cytotoxicity, and 11 of 93 (11.8%) patients from the convenience sample had documented bloody stool. CONCLUSIONS: A medium that greatly facilitates isolation of K oxytoca was developed. Occurrence of K oxytoca colonization was similar in the two patient populations studied and isolation of cytotoxic K oxytoca was not usually associated with hematochezia. Current understanding of the occurrence and causality of antibiotic-associated hemorrhagic colitis is insufficient for clinical laboratories to begin culturing K oxytoca and testing for cytotoxicity. PMID:21119796

  9. Characterization of Piperacillin/Tazobactam-Resistant Klebsiella oxytoca Recovered from a Nosocomial Outbreak

    PubMed Central

    Fujita, Ai; Kimura, Kouji; Yokoyama, Satoru; Jin, Wanchun; Wachino, Jun-ichi; Yamada, Keiko; Suematsu, Hiroyuki; Yamagishi, Yuka; Mikamo, Hiroshige; Arakawa, Yoshichika

    2015-01-01

    We characterized 12 clinical isolates of Klebsiella oxytoca with the extended-spectrum ?-lactamase (ESBL) phenotype (high minimum inhibitory concentration [MIC] values of ceftriaxone) recovered over 9 months at a university hospital in Japan. To determine the clonality of the isolates, we used pulsed-field gel electrophoresis (PFGE), multi-locus sequence typing (MLST), and PCR analyses to detect blaRBI, which encodes the ?-lactamase RbiA, OXY-2-4 with overproduce-type promoter. Moreover, we performed the isoelectric focusing (IEF) of ?-lactamases, and the determination of the MICs of ?-lactams including piperacillin/tazobactam for 12 clinical isolates and E. coli HB101 with pKOB23, which contains blaRBI, by the agar dilution method. Finally, we performed the initial screening and phenotypic confirmatory tests for ESBLs. Each of the 12 clinical isolates had an identical PFGE pulsotype and MLST sequence type (ST9). All 12 clinical isolates harbored identical blaRBI. The IEF revealed that the clinical isolate produced only one ?-lactamase. E. coli HB101 (pKOB23) and all 12 isolates demonstrated equally resistance to piperacillin/tazobactam (MICs, >128 ?g/ml). The phenotypic confirmatory test after the initial screening test for ESBLs can discriminate ?-lactamase RbiA-producing K. oxytoca from ?-lactamase CTX-M-producing K. oxytoca. Twelve clinical isolates of K. oxytoca, which were recovered from an outbreak at one university hospital, had identical genotypes and produced ?-lactamase RbiA that conferred resistance to piperacillin/tazobactam. In order to detect K. oxytoca isolates that produce RbiA to promote research concerning ?-lactamase RbiA-producing K. oxytoca, the phenotypic confirmatory test after the initial screening test for ESBLs would be useful. PMID:26539828

  10. Enhanced production of (R,R)-2,3-butanediol by metabolically engineered Klebsiella oxytoca.

    PubMed

    Park, Jong Myoung; Rathnasingh, Chelladurai; Song, Hyohak

    2015-10-01

    Microbial fermentation produces a racemic mixture of 2,3-butanediol ((R,R)-BD, (S,S)-BD, and meso-BD), and the compositions and physiochemical properties vary from microorganism to microorganism. Although the meso form is much more difficult to transport and store because of its higher freezing point than those of the optically active forms, most microorganisms capable of producing 2,3-BD mainly yield meso-2,3-BD. Thus, we developed a metabolically engineered (R,R)-2,3-BD overproducing strain using a Klebsiella oxytoca ?ldhA ?pflB strain, which shows an outstanding 2,3-BD production performance with more than 90 % of the meso form. A budC gene encoding 2,3-BD dehydrogenase in the K. oxytoca ?ldhA ?pflB strain was replaced with an exogenous gene encoding (R,R)-2,3-BD dehydrogenase from Paenibacillus polymyxa (K. oxytoca ?ldhA ?pflB ?budC::PBDH strain), and then its expression level was further amplified with using a pBBR1MCS plasmid. The fed-batch fermentation of the K. oxytoca ?ldhA ?pflB ?budC::PBDH (pBBR-PBDH) strain with intermittent glucose feeding allowed the production of 106.7 g/L of (R,R)-2,3-BD [meso-2,3-BD, 9.3 g/L], with a yield of 0.40 g/g and a productivity of 3.1 g/L/h, which should be useful for the industrial application of 2,3-BD. PMID:26275527

  11. Intracellular azo decolorization is coupled with aerobic respiration by a Klebsiella oxytoca strain.

    PubMed

    Yu, Lei; Zhang, Xiao-Yu; Xie, Tian; Hu, Jin-Mei; Wang, Shi; Li, Wen-Wei

    2015-03-01

    Reduction of azo dye methyl red coupled with aerobic respiration by growing cultures of Klebsiella oxytoca GS-4-08 was investigated. In liquid media containing dye and 0.6 % glucose in a mineral salts base, 100 mg l(-1) of the dye are completely removed in 3 h under shaking conditions. The dye cannot be aerobically decolorized by strain GS-4-08 without extra carbon sources, indicating a co-metabolism process. Higher initial dye concentration prolonged the lag phase of the cell growth, but final cell concentrations of each batches reached a same level with range from 6.3 to 7.6 mg l(-1) after the dye adaption period. This strain showed stronger dye tolerance and decolorization ability than many reported strains. Furthermore, a new intracellular oxygen-insensitive azoreductase was isolated from this strain, and the specific activity of enzyme was 0.846 and 0.633 U mg(-1) protein in the presence of NADH and NADPH, respectively. N,N dimethyl-p-phenylenediamine and anthranilic acid were stoichiometrically released from MR dye, indicating the breakage of azo bonds accounts for the intracellular decolorization. Combining the characteristics of azoreductase, the stoichiometry of EMP, and TCA cycle, the electron transfer chain theory of aerobic respiration, and the possible mechanism of aerobic respiration coupled with azo reduction by K. oxytoca GS-4-08 are proposed. This study is expected to provide a sound theoretical basis for the development of the K. oxytoca strain in aerobic process for azo dye containing wastewaters. PMID:25343980

  12. Iron-binding characterization and polysaccharide production by Klebsiella oxytoca strain isolated from mine acid drainage

    PubMed Central

    Baldi, F; Marchetto, D; Battistel, D; Daniele, S; Faleri, C; De Castro, C; Lanzetta, R

    2009-01-01

    Aims: To investigate Klebsiella oxytoca strain BAS-10 growth on ferric citrate under anaerobic conditions for exopolysaccharide (EPS) production and localization on cell followed by the purification and the EPS determination of the iron-binding stability constant to EPS or biotechnological applications. Methods and Results: Klebsiella oxytoca ferments ferric citrate under anaerobic conditions and produces a ferric hydrogel, whereas ferrous ions were formed in solution. During growth, cells precipitate and a hydrogel formation was observed: the organic material was constituted of an EPS bound to Fe(III) ions, this was found by chemical analyses of the iron species and transmission electron microscopy of the cell cultures. Iron binding to EPS was studied by cyclic voltammetric measurements, either directly on the hydrogel or in an aqueous solutions containing Fe(III)-citrate and purified Fe(III)-EPS. From the voltammetric data, the stability constant for the Fe(III)-EPS complex can be assumed to have values of approx. 1012–1013. It was estimated that this is higher than for the Fe(III)-citrate complex. Conclusions: The production of Fe(III)-EPS under anaerobic conditions is a strategy for the strain to survive in mine drainages and other acidic conditions. This physiological feature can be used to produce large amounts of valuable Fe(III)-EPS, starting from a low cost substrate such as Fe(III)-citrate. Significant and Impact of the Study: The data herein demonstrates that an interesting metal-binding molecule can be produced as a novel catalyst for a variety of potential applications and the EPS itself is a valuable source for rhamnose purification. PMID:19508299

  13. Carbapenem-Resistant Strain of Klebsiella oxytoca Harboring Carbapenem-Hydrolyzing ?-Lactamase KPC-2

    PubMed Central

    Yigit, Hesna; Queenan, Anne Marie; Rasheed, J. Kamile; Biddle, James W.; Domenech-Sanchez, Antonio; Alberti, Sebastian; Bush, Karen; Tenover, Fred C.

    2003-01-01

    We investigated a Klebsiella oxytoca isolate demonstrating resistance to imipenem, meropenem, extended-spectrum cephalosporins, and aztreonam. The MICs of both imipenem and meropenem were 32 ?g/ml. The ?-lactamase activity against imipenem and meropenem was inhibited in the presence of clavulanic acid. Isoelectric focusing studies demonstrated five ?-lactamases with pIs of 8.2 (SHV-46), 6.7 (KPC-2), 6.5 (unknown), 6.4 (probable OXY-2), and 5.4 (TEM-1). The presence of the blaSHV and blaTEM genes was confirmed by specific PCR assays and DNA sequence analysis. Transformation and conjugation studies with Escherichia coli showed that the ?-lactamase with a pI of 6.7, Klebsiella pneumoniae carbapenemase-2 (KPC-2), was encoded on an approximately 70-kb conjugative plasmid that also carried SHV-46, TEM-1, and the ?-lactamase with a pI of 6.5. The blaKPC-2 determinant was cloned in E. coli and conferred resistance to imipenem, meropenem, extended-spectrum cephalosporins, and aztreonam. The amino acid sequence of KPC-2 showed a single amino acid difference, S174G, when compared with KPC-1, another carbapenem-hydrolyzing ?-lactamase from K. pneumoniae 1534. Hydrolysis studies showed that purified KPC-2 hydrolyzed not only carbapenems but also penicillins, cephalosporins, and aztreonam. KPC-2 had the highest affinity for meropenem. The kinetic studies revealed that KPC-2 was inhibited by clavulanic acid and tazobactam. An examination of the outer membrane proteins of the parent K. oxytoca strain demonstrated that it expressed detectable levels of OmpK36 (the homolog of OmpC) and a higher-molecular-weight OmpK35 (the homolog of OmpF). Thus, carbapenem resistance in K. oxytoca 3127 is due to production of the Bush group 2f, class A, carbapenem-hydrolyzing ?-lactamase KPC-2. This ?-lactamase is likely located on a transposon that is part of a conjugative plasmid and thus has a very high potential for dissemination. PMID:14638498

  14. Final Technical Report: Genetic Control of Nitrogen Assimilation in Klebsiella oxytoca.

    SciTech Connect

    Valley Stewart

    2007-03-07

    Klebsiella oxytoca, an enterobacterium closely related to Escherichia coli and amenable to molecular genetic analysis, is a long-established model organism for studies of bacterial nitrogen assimilation. Our work concerned utilization of purines, nitrogen-rich compounds that are widespread in the biosphere. This project began with our observation that molybdenum cofactor (chlorate-resistant) mutants can use (hypo)xanthine as sole nitrogen source (Garzón et al., J. Bacteriol. 174:6298, 1992). Since xanthine dehydrogenase is a molybdoenzyme, Klebsiella must use an alternate route for (hypo)xanthine catabolsim. We identified and characterized a cluster of 22 genes that encode the enzymes, permeases and regulators for utilizing hypoxanthine and xanthine as sole nitrogen source. (Hypoxanthine and xanthine arise from deamination of adenine and guanine, respectively.) Growth and complementation tests with insertion mutants, combined with protein sequence comparisons, allow us to assign probable functions for the products of these genes and to deduce the overall pathway. We present genetic evidence that the first two enzymes for the Klebsiella purine utilization pathway have been recruited from pathways involved in catabolism of aromatic compounds. The first, HxaAB enzyme catalyzing (hypo)xanthine oxidation, is related to well-studied aromatic ring hydroxylating oxygenases such as phthalate dioxygenase. The second, HxbA enzyme catalyzing urate hydroxylation, is related to single-component monooxygenases. Thus, the Klebsiella purine utilization pathway has likely experienced non-orthologous gene displacement, substituting these oxygenases for the conventional enzymes, xanthine dehydrogenase and uricase. We also present evidence that transcription of the hxaAB operon is subject to dual regulation: global general nitrogen regulation (Ntr) through an unknown mechanism, and (hypo)xanthine induction mediated by a LysR-type activator.

  15. First Description of KPC-2-Producing Klebsiella oxytoca Isolated from a Pediatric Patient with Nosocomial Pneumonia in Venezuela

    PubMed Central

    Labrador, Indira

    2014-01-01

    During the last decade, carbapenem resistance has emerged among clinical isolates of the Enterobacteriaceae family. This has been increasingly attributed to the production of ?-lactamases capable of hydrolyzing carbapenems. Among these enzymes, Klebsiella pneumoniae carbapenemases (KPCs) are the most frequently and clinically significant class-A carbapenemases. In this report, we describe the first nosocomial KPC-2-producing K. oxytoca isolated from a pediatric patient with pneumonia admitted to the intensive care unit at The Andes University Hospital, Mérida, Venezuela. This strain was resistant to several antibiotics including imipenem, ertapenem, and meropenem but remained susceptible to ciprofloxacin, colistin, and tigecycline. Conjugation assays demonstrated the transferability of all resistance determinants, except aminoglycosides. The isolate LMM-SA26 carried a ~21?kb conjugative plasmid that harbored the blaKPC-2, blaCTX-M-8, and blaTEM-15 genes. Although carbapenem resistance in the Enterobacteriaceae is still unusual in Venezuela, KPCs have a great potential to spread due to their localization on mobile genetic elements. Therefore, rapid detection of KPC-carrying bacteria with phenotypic and confirmatory molecular tests is essential to establish therapeutic options and effective control measures. PMID:25405043

  16. Biosynthesis of Indole-3-Acetic Acid by New Klebsiella oxytoca Free and Immobilized Cells on Inorganic Matrices

    PubMed Central

    Celloto, Valéria R.; Oliveira, Arildo J. B.; Gonçalves, José E.; Watanabe, Cecília S. F.; Matioli, Graciette; Gonçalves, Regina A. C.

    2012-01-01

    While many natural and synthetic compounds exhibit auxin-like activity in bioassays, indole-3-acetic acid (IAA) is recognized as the key auxin in most plants. IAA has been implicated in almost all aspects of plant growth and development and a large array of bacteria have been reported to enhance plant growth. Cells of Klebsiella oxytoca isolated from the rhizosphere of Aspidosperma polyneuron and immobilized by adsorption on different inorganic matrices were used for IAA production. The matrices were prepared by the sol-gel method and the silica-titanium was the most suitable matrix for effective immobilization. In operational stability assays, IAA production was maintained after four cycles of production, obtaining 42.80 ± 2.03??g?mL?1 of IAA in the third cycle, which corresponds to a 54% increase in production in relation to the first cycle, whereas free cells began losing activity after the first cycle. After 90 days of storage at 4°C the immobilized cells showed the slight reduction of IAA production without significant loss of activity. PMID:22623901

  17. Stereochemically specific proton transfer in decarboxylation of 4-hydroxycinnamic acids by 4-hydroxycinnamate decarboxylase from Klebsiella oxytoca.

    PubMed

    Hashidoko, Y; Tahara, S

    1998-11-15

    The stereochemical specificity in the decarboxylation of E-4-hydroxycinnamic acid catalyzed by E-4-hydroxycinnamate decarboxylase (4-HCD) of Klebsiella oxytoca was investigated. Unlike the pyrolytic decarboxylation of 8-deuterated E-4-hydroxycinnamic acid to yield an equimolecular mixture of 8-Z- and 8-E-deuterated 4-hydroxystyrenes, treating 8-deuterated E-4-hydroxycinnamic acid with the enzyme in H2O-based buffer yielded 8-Z-deuterated 4-hydroxystyrene selectively. The specific E-orientation in catalysis and the substrate specificity requiring 4-OH in the substrates suggest that decarboxylation by K. oxytoca 4-HCD occurs via a para-quinone methide intermediate. Stereoselective protonation and the liberation of CO2 by an intermediary molecule are most likely the key reaction steps in the stereochemical specificity of the newly incorporated hydrogen. PMID:9808764

  18. Genome-scale reconstruction and in silico analysis of Klebsiella oxytoca for 2,3-butanediol production

    PubMed Central

    2013-01-01

    Background Klebsiella oxytoca, a Gram-negative, rod-shaped, and facultative anaerobic bacterium, is one of the most promising 2,3-butanediol (2,3-BD) producers. In order to improve the metabolic performance of K. oxytoca as an efficient biofactory, it is necessary to assess its metabolic characteristics with a system-wide scope, and to optimize the metabolic pathways at a systems level. Provision of the complete genome sequence of K. oxytoca enabled the construction of genome-scale metabolic model of K. oxytoca and its in silico analyses. Results The genome-scale metabolic model of K. oxytoca was constructed using the annotated genome with biochemical and physiological information. The stoichiometric model, KoxGSC1457, is composed of 1,457 reactions and 1,099 metabolites. The model was further refined by applying biomass composition equations and comparing in silico results with experimental data based on constraints-based flux analyses. Then, the model was applied to in silico analyses to understand the properties of K. oxytoca and also to improve its capabilities for 2,3-BD production according to genetic and environmental perturbations. Firstly, in silico analysis, which tested the effect of augmenting the metabolic flux pool of 2,3-BD precursors, elucidated that increasing the pyruvate pool is primarily important for 2,3-BD synthesis. Secondly, we performed in silico single gene knockout simulation for 2,3-BD overproduction, and investigated the changes of the in silico flux solution space of a ldhA gene knockout mutant in comparison with that of the wild-type strain. Finally, the KoxGSC1457 model was used to optimize the oxygen levels during fermentation for 2,3-BD production. Conclusions The genome-scale metabolic model, KoxGSC1457, constructed in this study successfully investigated metabolic characteristics of K. oxytoca at systems level. The KoxGSC1457 model could be employed as an useful tool to analyze its metabolic capabilities, to predict its physiological responses according to environmental and genetic perturbations, and to design metabolic engineering strategies to improve its metabolic performance. PMID:23432904

  19. Fermentation of starch by Klebsiella oxytoca P2, containing plasmids with {alpha}-amylase and pullulanase genes

    SciTech Connect

    Santos, V.L. dos; Araujo, E.F.; Barros, E.G. de; Guimaraes, W.V.

    1999-12-20

    Klebsiella oxytoca P2(pC46), an ethanol-producing recombinant, has been evaluated in fermentation of maltose and starch. The maximum ethanol produced by P2(pC46) was 0.34 g ethanol/g maltose and 0.38, 0.40, or 0.36 g ethanol/g starch in fermentation of 1, 2, or 4% starch, representing 68, 71, and 64% the theoretical yield. The pC46 plasmid transformed to cells of K. oxytoca P2 reduced the ethanol production from maltose and starch. In fermentation of starch after its digestion at 60 C for 24 h, in two-step fermentation, the time for maximum ethanol production was reduced to 12--24 h and the theoretical yield was around 90%. The increase in starch concentration resulted in lower {alpha}-amylase activity but in higher pullulanase activity. The high activity and thermostability of the amylolytic enzymes from this transformant suggest that it has a potential for amylolytic enzymes source.

  20. Production of 2,3-butanediol from pretreated corn cob by Klebsiella oxytoca in the presence of fungal cellulase

    SciTech Connect

    Cao, Ningjun; Xia Youkun; Gong, Cheng, S.; Tsao, G.T.

    1997-12-31

    A simple and effective method of treatment of lignocellulosic material was used for the preparation of corn cob for the production of 2,3-butane-diol by Klebsiella oxytoca ATCC 8724 in a simultaneous saccharification and fermentation process. During the treatment, lignin, and alkaline extractives were solubilized and separated from cellulose and hemicellulose fractions by dilute ammonia (10%) steeping. Hemicellulose was then hydrolyzed by dilute hydrochloric acid (1%, w/v) hydrolysis at 100{degrees}C at atmospheric pressure and separated from cellulose fraction. The remaining solid, with 90% of cellulose, was then used as the substrate. A butane-diol concentration of 25 g/L and an ethanol concentration of 7 g/L were produced by K. oxytoca from 80 g/L of corn cob cellulose with a cellulose dosage of 8.5 IFPU/g corn cob cellulose after 72 h of SSF. With only dilute acid hydrolysis, a butanediol production rate of 0.21 g/L/h was obtained that is much lower than the case in which corn cob was treated with ammonia steeping prior to acid hydrolysis. The butanediol production rate for the latter was 0.36 g/L/h. 26 refs., 5 figs., 1 tab.

  1. Genotypes of Klebsiella oxytoca Isolates from Patients with Nosocomial Pneumonia Are Distinct from Those of Isolates from Patients with Antibiotic-Associated Hemorrhagic Colitis

    PubMed Central

    Herzog, Kathrin A. T.; Schneditz, Georg; Leitner, Eva; Feierl, Gebhard; Hoffmann, Karl Martin; Zollner-Schwetz, Ines; Krause, Robert; Gorkiewicz, Gregor

    2014-01-01

    Klebsiella oxytoca acts as a pathobiont in the dysbiotic human intestinal microbiota, causing antibiotic-associated hemorrhagic colitis (AAHC), but it also infects other organs, resulting in pneumonia and urinary tract and skin infections. The virulence of K. oxytoca is still poorly understood. The production of a specific cytotoxin has been linked to AAHC pathogenesis. To investigate the clonal relationships of K. oxytoca with regard to clinical origin and virulence attributes, we established a multilocus sequence typing (MLST) method and analyzed 74 clinical K. oxytoca isolates from asymptomatic carriers and patients with AAHC, respiratory infections, and other infections. The isolates were phenotypically characterized, typed, and compared phylogenetically based on the sequences of seven housekeeping genes. MLST analysis yielded 60 sequence types, 12 of which were represented by more than one isolate. The phylogenetic tree distinguished clusters of K. oxytoca isolates between patients with AAHC and those with respiratory infections. Toxin-positive and -negative strains were observed within one sequence type. Our findings indicate that AAHC isolates share a genetic background. Interestingly, K. oxytoca isolates from nosocomial pneumonia showed a different genetic clustering, suggesting that these strains do not originate from the intestines or that they are specialized for respiratory tract colonization. Our results further indicate a polyphyletic origin and possible horizontal transfer of the genes involved in K. oxytoca cytotoxin production. This work provides evidence that K. oxytoca isolates colonizing the two main clinically relevant habitats (lower gastrointestinal [GI] tract and respiratory tract) of the human host are genetically distinct. Applications of this MLST analysis should help clarify the sources of nosocomial infections. PMID:24599976

  2. Crystal structure of a novel two domain GH78 family ?-rhamnosidase from Klebsiella oxytoca with rhamnose bound

    PubMed Central

    O’Neill, Ellis C; Stevenson, Clare E M; Paterson, Michael J; Rejzek, Martin; Chauvin, Anne-Laure; Lawson, David M; Field, Robert A

    2015-01-01

    The crystal structure of the GH78 family ?-rhamnosidase from Klebsiella oxytoca (KoRha) has been determined at 2.7 Å resolution with rhamnose bound in the active site of the catalytic domain. Curiously, the putative catalytic acid, Asp 222, is preceded by an unusual non-proline cis-peptide bond which helps to project the carboxyl group into the active centre. This KoRha homodimeric structure is significantly smaller than those of the other previously determined GH78 structures. Nevertheless, the enzyme displays ?-rhamnosidase activity when assayed in vitro, suggesting that the additional structural domains found in the related enzymes are dispensible for function. Proteins 2015; 83:1742–1749. © 2015 The Authors. Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc. PMID:25846411

  3. XAS analysis of iron and palladium bonded to a polysaccharide produced anaerobically by a strain of Klebsiella oxytoca.

    PubMed

    Ar?on, Iztok; Paganelli, Stefano; Piccolo, Oreste; Gallo, Michele; Vogel-Mikuš, Katarina; Baldi, Franco

    2015-09-01

    Klebsiella oxytoca BAS-10 ferments citrate to acetic acid and CO2, and secretes a specific exopolysaccharide (EPS), which is able to bind different metallic species. These biomaterials may be used for different biotechnological purposes, including applications as innovative green biogenerated catalysts. In production of biogenerated Pd species, the Fe(III) as ferric citrate is added to anaerobic culture of K.?oxytoca BAS-10, in the presence of palladium species, to increase the EPS secretion and improve Pd-EPS yield. In this process, bi-metallic (FePd-EPS) biomaterials were produced for the first time. The morphology of bi-metallic EPS, and the chemical state of the two metals in the FePd-EPS, are investigated by transmission electron microscopy, Fourier transform infra-red spectroscopy, micro-X-ray fluorescence, and X-ray absorption spectroscopy methods (XANES and EXAFS), and compared with mono-metallic Pd-EPS and Fe-EPS complexes. Iron in FePd-EPS is in the mineralized form of iron oxides/hydroxides, predominantly in the form of Fe(3+), with a small amount of Fe(2+) in the structure, most probably a mixture of different nano-crystalline iron oxides and hydroxides, as in mono-metallic Fe-EPS. Palladium is found as Pd(0) in the form of metallic nanoparticles with face-centred cubic structure in both bi-metallic (FePd-EPS) and mono-metallic (Pd-EPS) species. In bi-metallic species, Pd and Fe nanoparticles agglomerate in larger clusters, but they remain spatially separated. The catalytic ability of bi-metallic species (FePd-EPS) in a hydrodechlorination reaction is improved in comparison with mono-metallic Pd-EPS. PMID:26289273

  4. Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar

    NASA Astrophysics Data System (ADS)

    Moeis, Maelita R.; Berlian, Liska; Suhandono, Sony; Prima, Alex; Komalawati, Eli; Kristianti, Tati

    2014-03-01

    Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5?. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation 325RLDRD329 and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNA sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.

  5. Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar

    SciTech Connect

    Moeis, Maelita R. Berlian, Liska Suhandono, Sony Prima, Alex Komalawati, Eli Kristianti, Tati

    2014-03-24

    Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5?. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation {sup 325}RLDRD{sup 329} and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNA sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.

  6. Antimicrobial activity of essential oils of cultivated oregano (Origanum vulgare), sage (Salvia officinalis), and thyme (Thymus vulgaris) against clinical isolates of Escherichia coli, Klebsiella oxytoca, and Klebsiella pneumoniae

    PubMed Central

    Fournomiti, Maria; Kimbaris, Athanasios; Mantzourani, Ioanna; Plessas, Stavros; Theodoridou, Irene; Papaemmanouil, Virginia; Kapsiotis, Ioannis; Panopoulou, Maria; Stavropoulou, Elisavet; Bezirtzoglou, Eugenia E.; Alexopoulos, Athanasios

    2015-01-01

    Background Oregano (Origanum vulgare), sage (Salvia officinalis), and thyme (Thymus vulgaris) are aromatic plants with ornamental, culinary, and phytotherapeutic use all over the world. In Europe, they are traditionally used in the southern countries, particularly in the Mediterranean region. The antimicrobial activities of the essential oils (EOs) derived from those plants have captured the attention of scientists as they could be used as alternatives to the increasing resistance of traditional antibiotics against pathogen infections. Therefore, significant interest in the cultivation of various aromatic and medicinal plants is recorded during the last years. However, to gain a proper and marketable chemotype various factors during the cultivation should be considered as the geographical morphology, climatic, and farming conditions. In this frame, we have studied the antimicrobial efficiency of the EOs from oregano, sage, and thyme cultivated under different conditions in a region of NE Greece in comparison to the data available in literature. Methods Plants were purchased from a certified supplier, planted, and cultivated in an experimental field under different conditions and harvested after 9 months. EOs were extracted by using a Clevenger apparatus and tested for their antibacterial properties (Minimum inhibitory concentration – MIC) against clinical isolates of multidrug resistant Escherichia coli (n=27), Klebsiella oxytoca (n=7), and Klebsiella pneumoniae (n=16) strains by using the broth microdilution assay. Results Our results showed that the most sensitive organism was K. oxytoca with a mean value of MIC of 0.9 µg/mL for oregano EOs and 8.1 µg/mL for thyme. The second most sensitive strain was K. pneumoniae with mean MIC values of 9.5 µg/mL for thyme and 73.5 µg/mL for oregano EOs. E. coli strains were among the most resistant to EOs antimicrobial action as the observed MICs were 24.8–28.6 µg/mL for thyme and above 125 µg/mL for thyme and sage. Most efficient were the EOs from thyme followed by those of oregano. Conclusions With MIC values above 150 µg/mL, sage EOs did not show any antibacterial efficiency against the majority of the strains. However, no significant differences were observed concerning the antimicrobial action of all EOs originating from irrigated versus non-irrigated cultivated aromatic plants. PMID:25881620

  7. Enhanced 2,3-Butanediol Production by Optimizing Fermentation Conditions and Engineering Klebsiella oxytoca M1 through Overexpression of Acetoin Reductase

    PubMed Central

    Cho, Sukhyeong; Kim, Taeyeon; Woo, Han Min; Lee, Jinwon; Kim, Yunje; Um, Youngsoon

    2015-01-01

    Microbial production of 2,3-butanediol (2,3-BDO) has been attracting increasing interest because of its high value and various industrial applications. In this study, high production of 2,3-BDO using a previously isolated bacterium Klebsiella oxytoca M1 was carried out by optimizing fermentation conditions and overexpressing acetoin reductase (AR). Supplying complex nitrogen sources and using NaOH as a neutralizing agent were found to enhance specific production and yield of 2,3-BDO. In fed-batch fermentations, 2,3-BDO production increased with the agitation speed (109.6 g/L at 300 rpm vs. 118.5 g/L at 400 rpm) along with significantly reduced formation of by-product, but the yield at 400 rpm was lower than that at 300 rpm (0.40 g/g vs. 0.34 g/g) due to acetoin accumulation at 400 rpm. Because AR catalyzing both acetoin reduction and 2,3-BDO oxidation in K. oxytoca M1 revealed more than 8-fold higher reduction activity than oxidation activity, the engineered K. oxytoca M1 overexpressing the budC encoding AR was used in fed-batch fermentation. Finally, acetoin accumulation was significantly reduced by 43% and enhancement of 2,3-BDO concentration (142.5 g/L), yield (0.42 g/g) and productivity (1.47 g/L/h) was achieved compared to performance with the parent strain. This is by far the highest titer of 2,3-BDO achieved by K. oxytoca strains. This notable result could be obtained by finding favorable fermentation conditions for 2,3-BDO production as well as by utilizing the distinct characteristic of AR in K. oxytoca M1 revealing the nature of reductase. PMID:26368397

  8. Effect of pH on the metabolic flux of Klebsiella oxytoca producing 2,3-butanediol in continuous cultures at different dilution rates.

    PubMed

    Park, Changhun; Lu, Mingshou; Yun, Seokhun; Park, Kyungmoon; Lee, Jinwon

    2013-06-01

    The efficiency of the bioconversion process and the achievable end-product concentration decides the economic feasibility of microbial 2,3-butanediol (2,3-BDO) production. In 2,3-BDO production, optimization of culture condition is required for cell growth and metabolism. Also, the pH is an important factor that influences microbial performance. For different microorganisms and substrates, it has been shown that the distribution of the metabolites in 2,3-BDO fermentation is greatly affected by pH, and the optimum pH for 2,3-BDO production seems dependently linked to the particular strain and the substrate employed. Quantification analysis of intracellular metabolites and metabolic flux analysis (MFA) were used to investigate the effect of pH on the Klebsiella oxytoca producing 2,3-BDO and other organic acids. The main objectives of MFA are the estimation of intracellular metabolic fluxes and the identification of rate-limiting step and the key enzymes. This study was conducted under continuous aerobic conditions at different dilution rates (0.1, 0.2, and 0.3 h(-1)) and different pH values (pH 5.5 and 7.0) for the steady-state experimental data. In order to obtain the flux distribution, the extracellular specific rates were calculated from the experimental data using the metabolic network model of K. oxytoca. Intracellular metabolite concentration profiles were generated using ultra-performance liquid chromatography/quadrupole time-of-flight mass spectrometry. PMID:23443450

  9. Adaptative biochemical pathways and regulatory networks in Klebsiella oxytoca BAS-10 producing a biotechnologically relevant exopolysaccharide during Fe(III)-citrate fermentation

    PubMed Central

    2012-01-01

    Background A bacterial strain previously isolated from pyrite mine drainage and named BAS-10 was tentatively identified as Klebsiella oxytoca. Unlikely other enterobacteria, BAS-10 is able to grow on Fe(III)-citrate as sole carbon and energy source, yielding acetic acid and CO2 coupled with Fe(III) reduction to Fe(II) and showing unusual physiological characteristics. In fact, under this growth condition, BAS-10 produces an exopolysaccharide (EPS) having a high rhamnose content and metal-binding properties, whose biotechnological applications were proven as very relevant. Results Further phylogenetic analysis, based on 16S rDNA sequence, definitively confirmed that BAS-10 belongs to K. oxytoca species. In order to rationalize the biochemical peculiarities of this unusual enterobacteriun, combined 2D-Differential Gel Electrophoresis (2D-DIGE) analysis and mass spectrometry procedures were used to investigate its proteomic changes: i) under aerobic or anaerobic cultivation with Fe(III)-citrate as sole carbon source; ii) under anaerobic cultivations using Na(I)-citrate or Fe(III)-citrate as sole carbon source. Combining data from these differential studies peculiar levels of outer membrane proteins, key regulatory factors of carbon and nitrogen metabolism and enzymes involved in TCA cycle and sugar biosynthesis or required for citrate fermentation and stress response during anaerobic growth on Fe(III)-citrate were revealed. The protein differential regulation seems to ensure efficient cell growth coupled with EPS production by adapting metabolic and biochemical processes in order to face iron toxicity and to optimize energy production. Conclusion Differential proteomics provided insights on the molecular mechanisms necessary for anaeorobic utilization of Fe(III)-citrate in a biotechnologically promising enterobacteriun, also revealing genes that can be targeted for the rational design of high-yielding EPS producer strains. PMID:23176641

  10. Saccharification and fermentation of sugar cane bagasse by Klebsiella oxytoca P2 containing chromosomally integrated genes encoding the Zymomonas mobilis ethanol pathway

    SciTech Connect

    Doran, J.B.; Aldrich, H.C.; Ingram, L.O. . Dept. of Microbiology and Cell Science)

    1994-06-20

    Pretreatment of sugar cane bagasse is essential for a simultaneous saccharification and fermentation (SSF) process which uses recombinant Klebsiella oxytoca strain P2 and Genencor Spezyme CE. Strain P2 has been genetically engineered to express Zymomonas mobilis genes encoding the ethanol pathway and retains the native ability to transport and metabolize cellobiose (minimizing the need for extracellular cellobiase). In SSF studies with this organism, both the rate of ethanol production and ethanol yield were limited by saccharification at 10 and 20 filter paper units (FPU) g[sup [minus]1] acid-treated bagasse. Dilute slurries of biomass were converted to ethanol more efficiently (over 72% of theoretical yield) in simple batch fermentations than slurries containing high solids, albeit with the production of lower levels of ethanol. With high solids (i.e., 160 g acid-treated bagasse L[sup [minus]1]), a combination of 20 FPU cellulase g[sup [minus]1] bagasse, preincubation under saccharification conditions, and additional grinding (to reduce particle size) were required to produce ca. 40 g ethanol L[sup [minus]1]. Alternatively, almost 40 g ethanol L[sup [minus]1] was produced with 10 FPU cellulase g[sup [minus]1] bagasse by incorporating a second saccharification step (no further enzyme addition) followed by a second inoculation and short fermentation. In this way, a theoretical ethanol yield of over 70% was achieved with the production of 20 g ethanol 800 FPU[sup [minus]1] of commercial cellulase.

  11. Metabolic Changes in Klebsiella oxytoca in Response to Low Oxidoreduction Potential, as Revealed by Comparative Proteomic Profiling Integrated with Flux Balance Analysis

    PubMed Central

    Zhu, Yan; Li, Dan; Bao, Guanhui; Wang, Shaohua; Mao, Shaoming; Song, Jiangning; Li, Yin

    2014-01-01

    Oxidoreduction potential (ORP) is an important physiological parameter for biochemical production in anaerobic or microaerobic processes. However, the effect of ORP on cellular physiology remains largely unknown, which hampers the design of engineering strategies targeting proteins associated with ORP response. Here we characterized the effect of altering ORP in a 1,3-propanediol producer, Klebsiella oxytoca, by comparative proteomic profiling combined with flux balance analysis. Decreasing the extracellular ORP from ?150 to ?240 mV retarded cell growth and enhanced 1,3-propanediol production. Comparative proteomic analysis identified 61 differentially expressed proteins, mainly involved in carbohydrate catabolism, cellular constituent biosynthesis, and reductive stress response. A hypothetical oxidoreductase (HOR) that catalyzes 1,3-propanediol production was markedly upregulated, while proteins involved in biomass precursor synthesis were downregulated. As revealed by subsequent flux balance analysis, low ORP induced a metabolic shift from glycerol oxidation to reduction and rebalancing of redox and energy metabolism. From the integrated protein expression profiles and flux distributions, we can construct a rational analytic framework that elucidates how (facultative) anaerobes respond to extracellular ORP changes. PMID:24584239

  12. Hexavalent Molybdenum Reduction to Mo-Blue by a Sodium-Dodecyl-Sulfate-Degrading Klebsiella oxytoca Strain DRY14

    PubMed Central

    Halmi, M. I. E.; Zuhainis, S. W.; Yusof, M. T.; Shaharuddin, N. A.; Helmi, W.; Shukor, Y.; Syed, M. A.; Ahmad, S. A.

    2013-01-01

    Bacteria with the ability to tolerate, remove, and/or degrade several xenobiotics simultaneously are urgently needed for remediation of polluted sites. A previously isolated bacterium with sodium dodecyl sulfate- (SDS-) degrading capacity was found to be able to reduce molybdenum to the nontoxic molybdenum blue. The optimal pH, carbon source, molybdate concentration, and temperature supporting molybdate reduction were pH 7.0, glucose at 1.5% (w/v), between 25 and 30?mM, and 25°C, respectively. The optimum phosphate concentration for molybdate reduction was 5?mM. The Mo-blue produced exhibits an absorption spectrum with a maximum peak at 865 nm and a shoulder at 700?nm. None of the respiratory inhibitors tested showed any inhibition to the molybdenum-reducing activity suggesting that the electron transport system of this bacterium is not the site of molybdenum reduction. Chromium, cadmium, silver, copper, mercury, and lead caused approximately 77, 65, 77, 89, 80, and 80% inhibition of the molybdenum-reducing activity, respectively. Ferrous and stannous ions markedly increased the activity of molybdenum-reducing activity in this bacterium. The maximum tolerable concentration of SDS as a cocontaminant was 3?g/L. The characteristics of this bacterium make it a suitable candidate for molybdenum bioremediation of sites cocontaminated with detergent pollutant. PMID:24383052

  13. EFFECTS OF VELOCITY ON THE TRANSPORT OF TWO BACTERIA THROUGH SATURATED SAND. GROUND WATER.

    EPA Science Inventory

    Transport of the bacteria Klebsiella oxytoca and Burkholderia cepacia G4PR1 (G4PR1) was investigated in column experiments conducted under conditions that allowed us to quantify sorption under a range of ground water velocities. Column experiments (33 mm I.D. X 114 mm long colu...

  14. Multi Drug Resistant Klebsiella Isolates in Burn Patients: A Comparative Study

    PubMed Central

    Prakash, S. Kirshna; Siddiqui, Oves

    2015-01-01

    Introduction Infections are the most common complications in the burn patients admitted to the hospitals leading to high morbidity and mortality. Klebsiella is one of the most frequently isolated bacteria from burn wounds. Materials and Methods We studied antimicrobial susceptibility patterns of Klebsiella isolates from burn patients. In this cross- sectional study wound swabs from 1294 patients hospitalized in burnward were collected for bacteriological examination. Antibiotic sensitivity testing of Klebsiella isolates was done by modified Stokes disc diffusion method. Results Out of 883 isolates from 1294 patients 195 were found to be Klebsiella spp. Based on the biochemical properties 153 isolates were Klebsiella pneumoniae, 37 were Klebsiella oxytoca and 5 were others species. In our study we found that 54% of the Klebsiella isolates were multidrug resistant as they were resistant to at least one antibiotic of three or more different groups of antibiotics. [Table/Fig-1]: Isolation of different organism in burn wound infection Bacteria Number Percentage (%) Acinetobacter 70 7.92 Citrobacter 9 1.01 E. coli 125 14.15 Enterobacter 8 0.9 Klebsiella 195 22.08 Morganella 1 0.1 Proteus 71 8.04 Providentia 15 1.6 Pseudomonas 248 28.08 Staphylococcus 141 15.96 Total 883 99.84 Conclusion Rate of isolation of Klebsiella as well as its resistance for commonly used antibiotics is increasing over the time. PMID:26500905

  15. Efficient reduction of the formation of by-products and improvement of production yield of 2,3-butanediol by a combined deletion of alcohol dehydrogenase, acetate kinase-phosphotransacetylase, and lactate dehydrogenase genes in metabolically engineered Klebsiella oxytoca in mineral salts medium.

    PubMed

    Jantama, Kaemwich; Polyiam, Pattharasedthi; Khunnonkwao, Panwana; Chan, Sitha; Sangproo, Maytawadee; Khor, Kirin; Jantama, Sirima Suvarnakuta; Kanchanatawee, Sunthorn

    2015-07-01

    Klebsiella oxytoca KMS005 (?adhE?ackA-pta?ldhA) was metabolically engineered to improve 2,3-butanediol (BDO) yield. Elimination of alcohol dehydrogenase E (adhE), acetate kinase A-phosphotransacetylase (ackA-pta), and lactate dehydrogenase A (ldhA) enzymes allowed BDO production as a primary pathway for NADH re-oxidation, and significantly reduced by-products. KMS005 was screened for the efficient glucose utilization by metabolic evolution. KMS005-73T improved BDO production at a concentration of 23.5±0.5 g/L with yield of 0.46±0.02 g/g in mineral salts medium containing 50 g/L glucose in a shake flask. KMS005-73T also exhibited BDO yields of about 0.40-0.42 g/g from sugarcane molasses, cassava starch, and maltodextrin. During fed-batch fermentation, KMS005-73T produced BDO at a concentration, yield, and overall and specific productivities of 117.4±4.5 g/L, 0.49±0.02 g/g, 1.20±0.05 g/Lh, and 27.2±1.1 g/gCDW, respectively. No acetoin, lactate, and formate were detected, and only trace amounts of acetate and ethanol were formed. The strain also produced the least by-products and the highest BDO yield among other Klebsiella strains previously developed. PMID:25895450

  16. Plugging of a model rock system by using starved bacteria. [Klebsiella pneumoniae

    SciTech Connect

    MacLeod, F.A.; Lappin-Scott, H.M.; Costerton, J.W.

    1988-06-01

    The effects of starvation on bacterial penetration through artificial rock cores were examined. Klebsiella pneumoniae was starved in a simple salts solution for a duration of up to 4 weeks. These cell suspensions were injected into sintered glass bead cores, and the resulting reductions in core permeabilities were recorded. Vegetative cell cultures of K. pneumoniae grown in a sodium citrate medium were injected into other, similar cores, and the reductions in core permeabilities were recorded. The starved cell suspensions did not completely block the core pores, whereas the vegetative cultures reduced core permeability to less than 1%. Scanning electron microscopy of core section infiltrated with either vegetative or starved cells showed that the former produced shallow skin plugs and copious amounts of glycocalyx at the inlet face, whereas the latter produced very little glycocalyx and the cells were distributed evenly throughout the length of the core. The use of a DNA assay to produce a cell distribution profile showed that, compared with the vegetative cells, starved bacteria were able to penetrate deeper into the cores. This was due to the smaller size of the cells and the reduction in biofilm production. This ability of starved bacteria to penetrate further into cores than the normal-size vegetative cells can be usefully applied to selective plugging for enhanced oil recovery. To further test the suitability of starved cells for use in selective plugging, the activities of starved cells present within cores were monitored before and after nutrient stimulation. Our data indicate that with nutrient stimulation, the starved cells lose their metabolic dormancy and produce reductions in core permeability due to cell growth and polymer production.

  17. Vaccination with Klebsiella pneumoniae-derived extracellular vesicles protects against bacteria-induced lethality via both humoral and cellular immunity

    PubMed Central

    Lee, Won-Hee; Choi, Hyun-Il; Hong, Sung-Wook; Kim, Kwang-sun; Gho, Yong Song; Jeon, Seong Gyu

    2015-01-01

    The emergence of multidrug-resistant Klebsiella pneumoniae highlights the need to develop preventive measures to ameliorate Klebsiella infections. Bacteria-derived extracellular vesicles (EVs) are spherical nanometer-sized proteolipids enriched with outer membrane proteins. Gram-negative bacteria-derived EVs have gained interest for use as nonliving complex vaccines. In the present study, we evaluated whether K. pneumoniae-derived EVs confer protection against bacteria-induced lethality. K. pneumoniae-derived EVs isolated from in vitro bacterial culture supernatants induced innate immunity, including the upregulation of co-stimulatory molecule expression and proinflammatory mediator production. EV vaccination via the intraperitoneal route elicited EV-reactive antibodies and interferon-gamma-producing T-cell responses. Three vaccinations with the EVs prevented bacteria-induced lethality. As verified by sera and splenocytes adoptive transfer, the protective effect of EV vaccination was dependent on both humoral and cellular immunity. Taken together, these findings suggest that K. pneumoniae-derived EVs are a novel vaccine candidate against K. pneumoniae infections. PMID:26358222

  18. The study of Nickel Resistant Bacteria (NiRB) isolated from wastewaters polluted with different industrial sources

    PubMed Central

    2014-01-01

    Background Pollution due to the heavy metals is a problem that may have negative consequences on the hydrosphere. One of the best procedures in removing the toxic metals from the environment is using metal resistant bacteria. Results In the present study eight nickel resistant bacteria were isolated from industrial wastewaters. Three of them were selected as the most resistant based on their Maximum tolerable concentration (8, 16 and 24 mM Ni2+). Their identification was done according to morphological, biochemical characteristics and 16SrDNA gene sequencing and they were identified as Cupriavidus sp ATHA3, Klebsiella oxytoca ATHA6 and Methylobacterium sp ATHA7. The accession numbers assigned to ATHA3, ATHA6 and ATHA7 strains are JX120152, JX196648 and JX457333 respectively. The Growth rate of the most resistant isolate, Klebsiella oxytoca strain ATHA6, in the presence of Ni2+ and the reduction in Ni2+ concentration was revealed that K oxytoca ATHA6 could decrease 83 mg/mL of nickel from the medium after 3 days. Conclusion It can be concluded that the identified Ni resistant bacteria could be valuable for the bioremediation of Ni polluted waste water and sewage. PMID:24475932

  19. Cultivable endophytic bacteria from leaf bases of Agave tequilana and their role as plant growth promoters

    PubMed Central

    Martínez-Rodríguez, Julia del C.; la Mora-Amutio, Marcela De; Plascencia-Correa, Luis A.; Audelo-Regalado, Esmeralda; Guardado, Francisco R.; Hernández-Sánchez, Elías; Peña-Ramírez, Yuri J.; Escalante, Adelfo; Beltrán-García, Miguel J.; Ogura, Tetsuya

    2014-01-01

    Agave tequilana Weber var. ‘Azul’ is grown for the production of tequila, inulin and syrup. Diverse bacteria inhabit plant tissues and play a crucial role for plant health and growth. In this study culturable endophytic bacteria were extracted from leaf bases of 100 healthy Agave tequilana plants. In plant tissue bacteria occurred at mean population densities of 3 million CFU/g of fresh plant tissue. Three hundred endophytic strains were isolated and 16s rDNA sequences grouped the bacteria into eight different taxa that shared high homology with other known sequences. Bacterial endophytes were identified as Acinectobacter sp., A. baumanii, A. bereziniae, Cronobacter sakazakii, Enterobacter hormaechei, Bacillus sp. Klebsiella oxytoca, Pseudomonas sp., Enterococcus casseliflavus, Leuconostoc mesenteroides subsp. mesenteroides and Gluconobacter oxydans. Isolates were confirmed to be plant growth promoting bacteria (PGPB) by their capacities for nitrogen fixation, auxin production, phosphate solubilization, or antagonism against Fusarium oxysporum AC132. E. casseliflavus JM47 and K. oxytoca JM26 secreted the highest concentrations of IAA. The endophyte Acinectobacter sp. JM58 exhibited the maximum values for nitrogen fixation and phosphate solubilization index (PSI). Inhibition of fungi was found in Pseudomonas sp. JM9p and K. oxytoca JM26. Bacterial endophytes show promise for use as bio-inoculants for agave cultivation. Use of endophytes to enhance cultivation of agave may be particularly important for plants produced by micropropagation techniques, where native endophytes may have been lost. PMID:25763038

  20. Cultivable endophytic bacteria from leaf bases of Agave tequilana and their role as plant growth promoters.

    PubMed

    Martínez-Rodríguez, Julia del C; De la Mora-Amutio, Marcela; Plascencia-Correa, Luis A; Audelo-Regalado, Esmeralda; Guardado, Francisco R; Hernández-Sánchez, Elías; Peña-Ramírez, Yuri J; Escalante, Adelfo; Beltrán-García, Miguel J; Ogura, Tetsuya

    2014-01-01

    Agave tequilana Weber var. 'Azul' is grown for the production of tequila, inulin and syrup. Diverse bacteria inhabit plant tissues and play a crucial role for plant health and growth. In this study culturable endophytic bacteria were extracted from leaf bases of 100 healthy Agave tequilana plants. In plant tissue bacteria occurred at mean population densities of 3 million CFU/g of fresh plant tissue. Three hundred endophytic strains were isolated and 16s rDNA sequences grouped the bacteria into eight different taxa that shared high homology with other known sequences. Bacterial endophytes were identified as Acinectobacter sp., A. baumanii, A. bereziniae, Cronobacter sakazakii, Enterobacter hormaechei, Bacillus sp. Klebsiella oxytoca, Pseudomonas sp., Enterococcus casseliflavus, Leuconostoc mesenteroides subsp. mesenteroides and Gluconobacter oxydans. Isolates were confirmed to be plant growth promoting bacteria (PGPB) by their capacities for nitrogen fixation, auxin production, phosphate solubilization, or antagonism against Fusarium oxysporum AC132. E. casseliflavus JM47 and K. oxytoca JM26 secreted the highest concentrations of IAA. The endophyte Acinectobacter sp. JM58 exhibited the maximum values for nitrogen fixation and phosphate solubilization index (PSI). Inhibition of fungi was found in Pseudomonas sp. JM9p and K. oxytoca JM26. Bacterial endophytes show promise for use as bio-inoculants for agave cultivation. Use of endophytes to enhance cultivation of agave may be particularly important for plants produced by micropropagation techniques, where native endophytes may have been lost. PMID:25763038

  1. Phosphate solubilizing and indole-3-acetic acid producing bacteria from the soil of Garhwal Himalaya aimed to improve the growth of rice.

    PubMed

    Gusain, Yogendra Singh; Kamal, Ranveer; Mehta, C M; Singh, U S; Sharma, A K

    2015-01-01

    In the present study, soil bacteria from rainfed agriculture field of Garhwal Himalaya, just prior to sowing of summer crop, were isolated and initially tested for solubilization of inorganic phosphate, production of indole acetic acid (IAA) and siderophore. Two bacterial isolates, having efficient P- solubilizing activity in solid medium, were identified using 16S rRNA sequence analysis as Pseudomonas koreensis strainYB1 Arthrobacter nitroguajacolicus strainYB3 and three bacterial isolates, producing high amount of IAA in liquid medium, were identified as Klebsiella oxytoca strainYB2 and two strain of Arthrobacter nitroguajacolicus, strainYB4 and YB5, respectively. In culture medium supplemented with L-Tryptophan, Klebsiella oxytoca produced high amount of IAA (337.44 ?g l(-1)). The selected five bacterial strains were further tested for tricalcium phosphate (TCP) solubilizing abilities at three different incubation temperature viz., 4 degrees C, 10 degrees C and 28 degrees C, under in vitro conditions. At 28 degrees C, three bacterial strains Pseudomonas koreensis, Arthrobacter nitroguajacolicus strainYB4 and Klebsiella oxytoca solubilized the phosphate efficiently. At 10 degrees C only two strains, Pseudomonas koreensis and Arthrobacter nitroguajacolicus strainYB4 solubilized phosphate efficiently as compared to other strains. These five bacterial strains were tested for nitrogen, catalase activity, starch and cellulose hydrolysis as well as growth promotion activity on rice, under controlled conditions. All the five bacterial strains efficiently increased the biomass and phosphorus uptake in Swama and Swarna sub1 varieties of rice. PMID:26536808

  2. Fermentation of polysaccharides by Klebsiella and other facultative bacilli

    SciTech Connect

    Ochuba, G.U.; Von Riesen, V.L.

    1980-05-01

    Fermentations of 10 polysaccharides by species of the family Enterobacteriaceae were examined. Algin, guar, karaya, xanthan, and xylan were not fermented by any of the strains tested. Most of the activity was found in the tribe Klebsielleae. Klebseilla oxytoca fermented amylopectin (97% of the strains studied), carrageenan (100%), inulin (68%), polypectate (100%), and tragacanth (100%). Klebsiella pneumoniae fermented amylopectin (91%), carrageenan (100%), and tragacanth (86%). Carraggeenan was also fermented by Enterobacter aerogenes (100%), Enterobacter agglomerans (63%), Enterobacter cloacae (95%), and pectobacterium (38%). pectobacterium shared polypectate fermentation (100%) with K. oxytoca. With one exception, Serratia strains were negative on all polysaccharides. These results, along with other evidence, indicate that (i) the genus Klebsiella is biochemically the most versatile genus of the tribe, (ii) because of its distinct characteristics, K. oxytoca warrants species designation separate from K. pneumoniae, and (iii) some food additives generally considered indigestible can be metabolized by a few species of facultative bacilli, whereas others appear to be resistant.

  3. Refactoring the nitrogen fixation gene cluster from Klebsiella oxytoca

    E-print Network

    Zhao, Dehua

    Bacterial genes associated with a single trait are often grouped in a contiguous unit of the genome known as a gene cluster. It is difficult to genetically manipulate many gene clusters because of complex, redundant, and ...

  4. Low diversity bacterial community and the trapping activity of metabolites from cultivable bacteria species in the female reproductive system of the Oriental fruit fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae).

    PubMed

    Shi, Zhanghong; Wang, Lili; Zhang, Hongyu

    2012-01-01

    Our goal was to identify the bacteria inhabiting the reproductive system of the female oriental fruit fly, Bactrocera dorsalis (Hendel), and evaluate the chemotaxis of B. dorsalis to the metabolites produced by the bacteria. Based on 16S rRNA-based polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE), 18 operational taxonomic units (OTUs) were assigned to the five bacterial classes Betaproteobacteria, Alphaproteobacteria, Gammaproteobacteria, Bacilli and Actinobacteria. Nine OTUs were assigned to Gammaproteobacteria, which was the most highly represented class. Enterobacteriaceae constituted the dominant family, and within this family, three genera and five species were identified, including Enterobacter sakazakii, Klebsiella oxytoca, Klebsiella pneumoniae, Raoultella terrigena and Enterobacter amnigenus. In this set, the first two species were the dominant components, and the latter three species were the minor ones. Finally, we found that the metabolites produced by R. terrigena, K. oxytoca and K. pneumoniae were attractive to the B. dorsalis adults, and in field studies, B. dorsalis adults were most attracted to K. oxytoca. Collectively, our results suggest that the female reproductive system plays an important role in the transfer of enterobacteria from the gut to fruit. Our data may prompt the development of a female-targeted population control strategy for this fly. PMID:22754363

  5. Surveillance of multidrug resistant uropathogenic bacteria in hospitalized patients in Indian

    PubMed Central

    Mishra, Monali Priyadarsini; Debata, Nagen Kumar; Padhy, Rabindra Nath

    2013-01-01

    Objective To record surveillance, antibiotic resistance of uropathogens of hospitalized patients over a period of 18 months. Methods Urine samples from wards and cabins were used for isolating urinary tract infection (UTI)-causing bacteria that were cultured on suitable selective media and identified by biochemical tests; and their antibiograms were ascertained by Kirby-Bauer's disc diffusion method, in each 6-month interval of the study period, using 18 antibiotics of five different classes. Results From wards and cabins, 1?245 samples were collected, from which 996 strains of bacteria belonging to 11 species were isolated, during April 2011 to September 2012. Two Gram-positive, Staphylococcus aureus (S. aureus) and Enterococcus faecalis (E. faecalis), and nine Gram-negative bacteria, Acinetobacter baumannii, Citrobacter sp., Escherichia coli, Enterobacter aerogenes, Klebsiella pneumoniae, Klebsiella oxytoca, Proteus mirabilis, Proteus vulgaris and Pseudomonas aeruginosa were isolated. Both S. aureus and E. faecalis were vancomycin resistant, and resistant-strains of all pathogens increased in each 6-month period of study. Particularly, all Gram-negatives were resistant to nitrofurantoin and co-trimoxazole, the most preferred antibiotics of empiric therapy for UTI. Conclusions Antibiograms of 11 UTI-causing bacteria recorded in this study indicated moderately higher numbers of strains resistant to each antibiotic studied, generating the fear of precipitating fervent episodes in public health particularly with bacteria, Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae and S. aureus. Moreover, vancomycin resistance in strains of S. aureus and E. faecalis is a matter of concern. PMID:23620859

  6. Klebsiella meningitis. A case report.

    PubMed

    Medhi, N; Goswami, P; Sarma, P; Barkataky, R K; Duarah, R; Saikia, R

    2008-06-01

    Acute bacterial meningitis is a severe CNS infection occurring mostly in infants and older children. Bacterial meningitis caused by gram-negative bacteria is usually fatal. Klebsiella pneumoniae is an uncommon gram-negative bacteria causing meningitis with a poor outcome. Though the commonest presentation of bacterial meningitis is fever, patients usually seek medical attention for uncontrolled seizure and features of raised ICP. The commonest complications of gram-negative bacterial meningitis including Klebsiella meningitis are subdural hygroma / empyema, hydrocephalus, infarcts (both arterial and venous) and cortical blindness due to hypoxic ischaemic insult. MRI is the best modality for evaluating these patients for early diagnosis. Early institution of treatment significantly reduces the mortality and morbidity. We describe a case of acute bacterial meningitis caused by Klebsiella pneumoniae with MR evidence of sinus thrombosis, venous infarcts and subdural hygroma. PMID:24256900

  7. Alimentary Tract Bacteria Isolated and Identified with API-20E and Molecular Cloning Techniques from Australian Tropical Fruit Flies, Bactrocera cacuminata and B. tryoni

    PubMed Central

    Thaochan, N.; Drew, R. A. I.; Hughes, J. M.; Vijaysegaran, S.; Chinajariyawong, A.

    2010-01-01

    Bacteria were isolated from the crop and midgut of field collected Bactrocera cacuminata (Hering) and Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). Two methods were used, firstly isolation onto two types of bacteriological culture media (PYEA and TSA) and identification using the API-20E diagnostic kit, and secondly, analysis of samples using the 16S rRNA gene molecular diagnostic method. Using the API-20E method, 10 genera and 17 species of bacteria in the family Enterobacteriaceae were identified from cultures growing on the nutrient agar. The dominant species in both the crop and midgut were Citrobacter freundii, Enterobacter cloacae and Klebsiella oxytoca. Providencia rettgeri, Klebsiella pneumoniae ssp ozaenae and Serratia marcescens were isolated from B. tryoni only. Using the molecular cloning technique that is based on 16S rRNA gene sequences, five bacteria classes were dignosed — Alpha-, Beta-, Gamma- and Delta- Proteobacteria and Firmicutes — including five families, Leuconostocaceae, Enterococcaceae, Acetobacteriaceae, Comamonadaceae and Enterobacteriaceae. The bacteria affiliated with Firmicutes were found mainly in the crop while the Gammaproteobacteria, especially the family Enterobacteriaceae, was dominant in the midgut. This paper presents results from the first known application of molecular cloning techniques to study bacteria within tephritid species and the first record of Firmicutes bacteria in these flies. PMID:20883132

  8. A comparative study of the type-3 fimbriae of Klebsiella species.

    PubMed

    Old, D C; Tavendale, A; Senior, B W

    1985-10-01

    Type-3 fimbriae isolated from members of five different species of Klebsiella were 4-5 nm in diameter and agglutinated the tannic acid-treated erythrocytes of ox and, in some cases, the untanned erythrocytes of fowl. In sodium dodecyl sulphate-polyacrylamide gel electrophoresis, the type-3 fimbrial proteins had mol. wts in the range 19 500-21 500. Hydrophobic amino acids comprised 39.6% of all the amino acids of the type-3 fimbrial protein of K. oxytoca strain 70/1. The type-1 fimbrial protein of Klebsiella had a mol. wt of c. 18 000 and the type-1 fimbriae were serologically distinct from the type-3 fimbriae. Our results for the type-3 fimbriae of Klebsiella were compared with those of others for morphologically similar and serologically related thin fimbriae of Salmonella and Yersinia. PMID:2864453

  9. Antimicrobial and Herbal Drug Resistance in Enteric Bacteria Isolated from Faecal Droppings of Common House Lizard/Gecko (Hemidactylus frenatus).

    PubMed

    Singh, Bhoj R; Singh, Vidya; Ebibeni, N; Singh, Raj K

    2013-01-01

    From 194 faecal dropping samples of common house geckos collected from offices (60), houses (88), integrated farm units (IFS,18) and hostels, guest houses, and dining rooms of different canteen/mess (HGM, 28), 326 bacterial isolates of enteric bacteria belonging to 17 genera and 34 species were detected. Escherichia coli were the most frequently (39) isolated followed by Citrobacter freundii (33), Klebsiella pneumonia (27), Salmonella indica (12), Enterobacter gergoviae (12), and Ent. agglomerans (11). Other important bacteria isolated from gecko droppings were Listonella damsela (2), Raoultella terrigena (3), S. salamae (2), S. houtenae (3), Edwardsiella tarda (4), Edwardsiella hoshinae (1), and Klebsiella oxytoca (2). Of the 223 isolates tested for antimicrobial drug sensitivity, 27 (12.1%) had multiple drug resistance (MDR). None of the salmonellae or edwardsiellae had MDR however, MDR strains were significantly more common among Escherichia spp. (P = 1.9 × 10(-5)) and isolates from IFS units (P = 3.58 × 10(-23)). The most effective herbal drug, Ageratum conyzoides extract, inhibited growth of only 27.8% of strains tested followed by ethanolic extract of Zanthoxylum rhetsa (13.9%), eucalyptus oil (5.4%), patchouli oil (5.4%), lemongrass oil (3.6%), and sandalwood oil (3.1%), and Artemisia vulgaris essential oil (3.1%). PMID:24223595

  10. Efficacy of surface disinfectant cleaners against emerging highly resistant gram-negative bacteria

    PubMed Central

    2014-01-01

    Background Worldwide, the emergence of multidrug-resistant gram-negative bacteria is a clinical problem. Surface disinfectant cleaners (SDCs) that are effective against these bacteria are needed for use in high risk areas around patients and on multi-touch surfaces. We determined the efficacy of several SDCs against clinically relevant bacterial species with and without common types of multidrug resistance. Methods Bacteria species used were ATCC strains; clinical isolates classified as antibiotic-susceptible; and multi-resistant clinical isolates from Klebsiella oxytoca, Klebsiella pneumoniae, and Serratia marcescens (all OXA-48 and KPC-2); Acinetobacter baumannii (OXA-23); Pseudomonas aeruginosa (VIM-1); and Achromobacter xylosoxidans (ATCC strain). Experiments were carried out according to EN 13727:2012 in quadruplicate under dirty conditions. The five evaluated SDCs were based on alcohol and an amphoteric substance (AAS), an oxygen-releaser (OR), surface-active substances (SAS), or surface-active-substances plus aldehydes (SASA; two formulations). Bactericidal concentrations of SDCs were determined at two different contact times. Efficacy was defined as a log10???5 reduction in bacterial cell count. Results SDCs based on AAS, OR, and SAS were effective against all six species irrespective of the degree of multi-resistance. The SASA formulations were effective against the bacteria irrespective of degree of multi-resistance except for one of the four P. aeruginosa isolates (VIM-1). We found no general correlation between SDC efficacy and degree of antibiotic resistance. Conclusions SDCs were generally effective against gram-negative bacteria with and without multidrug resistance. SDCs are therefore suitable for surface disinfection in the immediate proximity of patients. Single bacterial isolates, however, might have reduced susceptibility to selected biocidal agents. PMID:24885029

  11. Potential virulence of Klebsiella sp. isolates from enteral diets

    PubMed Central

    Pereira, S.C.L.; Vanetti, M.C.D.

    2015-01-01

    We aimed to evaluate the potential virulence of Klebsiella isolates from enteral diets in hospitals, to support nosocomial infection control measures, especially among critical-care patients. Phenotypic determination of virulence factors, such as capsular expression on the external membrane, production of aerobactin siderophore, synthesis of capsular polysaccharide, hemolytic and phospholipase activity, and resistance to antibiotics, which are used therapeutically, were investigated in strains of Klebsiella pneumoniae and K. oxytoca. Modular industrialized enteral diets (30 samples) as used in two public hospitals were analyzed, and Klebsiella isolates were obtained from six (20%) of them. The hypermucoviscous phenotype was observed in one of the K. pneumoniae isolates (6.7%). Capsular serotypes K1 to K6 were present, namely K5 and K4. Under the conditions of this study, no aerobactin production, hemolytic activity or lecithinase activity was observed in the isolates. All isolates were resistant to amoxicillin and ampicillin and sensitive to cefetamet, imipenem, chloramphenicol, gentamicin and sulfamethoxazole-trimethoprim. Most K. pneumoniae isolates (6/7, 85.7%) from hospital B presented with a higher frequency of resistance to the antibiotics tested in this study, and multiple resistance to at least four antibiotics (3/8; 37.5%) compared with isolates from Hospital A. The variations observed in the antibiotic resistance profiles allowed us to classify the Klebsiella isolates as eight antibiotypes. No production of broad-spectrum ?-lactamases was observed among the isolates. Our data favor the hypothesis that Klebsiella isolates from enteral diets are potential pathogens for nosocomial infections. PMID:26176307

  12. Empirical prediction and validation of antibacterial inhibitory effects of various plant essential oils on common pathogenic bacteria.

    PubMed

    Akdemir Evrendilek, Gulsun

    2015-06-01

    In this study, fractional compound composition, antioxidant capacity, and phenolic substance content of 14 plant essential oils-anise (Pimpinella anisum), bay leaves (Laurus nobilis), cinnamon bark (Cinnamomum verum), clove (Eugenia caryophyllata), fennel (Foeniculum vulgare), hop (Humulus lupulus), Istanbul oregano (Origanum vulgare subsp. hirtum), Izmir oregano (Origanum onites), mint (Mentha piperita), myrtus (Myrtus communis), orange peel (Citrus sinensis), sage (Salvia officinalis), thyme (Thymbra spicata), and Turkish oregano (Origanum minutiflorum)--were related to inhibition of 10 bacteria through multiple linear or non-linear (M(N)LR) models-four Gram-positive bacteria of Listeria innocua, coagulase-negative staphylococci, Staphylococcus aureus, and Bacillus subtilis, and six Gram-negative bacteria of Yersinia enterocolitica, Salmonella Enteritidis, Salmonella Typhimurium, Proteus mirabilis, Escherichia coli O157:H7, and Klebsiella oxytoca. A total of 65 compounds with different antioxidant capacity, phenolic substance content and antibacterial properties were detected with 14 plant essential oils. The best-fit M(N)LR models indicated that relative to anise essential oil, the essential oils of oreganos, cinnamon, and thyme had consistently high inhibitory effects, while orange peel essential oil had consistently a low inhibitory effect. Regression analysis indicated that beta-bisabolene (Turkish and Istanbul oreganos), and terpinolene (thyme) were found to be the most inhibitory compounds regardless of the bacteria type tested. PMID:25764982

  13. Klebsiella pneumoniae survives within macrophages by avoiding delivery to lysosomes.

    PubMed

    Cano, Victoria; March, Catalina; Insua, Jose Luis; Aguiló, Nacho; Llobet, Enrique; Moranta, David; Regueiro, Verónica; Brennan, Gerard P; Millán-Lou, Maria Isabel; Martín, Carlos; Garmendia, Junkal; Bengoechea, José A

    2015-11-01

    Klebsiella pneumoniae is an important cause of community-acquired and nosocomial pneumonia. Evidence indicates that Klebsiella might be able to persist intracellularly within a vacuolar compartment. This study was designed to investigate the interaction between Klebsiella and macrophages. Engulfment of K.?pneumoniae was dependent on host cytoskeleton, cell plasma membrane lipid rafts and the activation of phosphoinositide 3-kinase (PI3K). Microscopy studies revealed that K.?pneumoniae resides within a vacuolar compartment, the Klebsiella-containing vacuole (KCV), which traffics within vacuoles associated with the endocytic pathway. In contrast to UV-killed bacteria, the majority of live bacteria did not co-localize with markers of the lysosomal compartment. Our data suggest that K.?pneumoniae triggers a programmed cell death in macrophages displaying features of apoptosis. Our efforts to identify the mechanism(s) whereby K.?pneumoniae prevents the fusion of the lysosomes to the KCV uncovered the central role of the PI3K-Akt-Rab14 axis to control the phagosome maturation. Our data revealed that the capsule is dispensable for Klebsiella intracellular survival if bacteria were not opsonized. Furthermore, the environment found by Klebsiella within the KCV triggered the down-regulation of the expression of cps. Altogether, this study proves evidence that K.?pneumoniae survives killing by macrophages by manipulating phagosome maturation that may contribute to Klebsiella pathogenesis. PMID:26045209

  14. SUSCEPTIBILITY OF CHEMOSTAT-GROWN 'YERSINIA ENTEROCOLITICA' AND 'KLEBSIELLA PNEUMONIAE' TO CHLORINE DIOXIDE

    EPA Science Inventory

    The resistance of bacteria to antimicrobial agents could be influenced by growth environment. The susceptibility of two enteric bacteria, Yersinia enterocolitica and Klebsiella pneumoniae, to chlorine dioxide was investigated. These organisms were grown in a defined medium in a c...

  15. Primers and a specific DNA probe for detecting lactic acid bacteria producing 3-hydroxypropionaldehyde from glycerol in spoiled ciders.

    PubMed

    Claisse, O; Lonvaud-Funel, A

    2001-06-01

    Of the 40 strains isolated from several spoiled ciders where glycerol was degraded, 36 were identified as Lactobacillus collinoides, three were Lactobacillus hilgardii, and one was Lactobacillus mali. However, only 30 L. collinoides and two L. hilgardii could degrade glycerol. The glycerol dehydratase activity was shown. The main product of the transformation was 1.3 propanediol. Two DNA primers GD1 and GD2 were chosen in the region encoding one of the subunits of glycerol dehydratase of Citrobacter freundii, Klebsiella pneumoniae, Klebsiella oxytoca, Salmonella Typhimurium, and Clostridium pasteurianum. A 279-bp amplicon in polymerase chain reaction amplification was obtained with the genomic L. collinoides IOEB 9527 DNA as template. The amino acid sequence deduced from the amplicon DNA sequence showed a very high similarity and identity with the gene of gram-negative and C. pasteurianum species. After labeling, the amplicon was used as DNA probe in dot-blot hybridization with the genomic DNA of all the tested strains. Only strains that could degrade glycerol hybridized. Moreover, polymerase chain reactions using GDI and GD2 revealed only glycerol dehydratase genes of positive L. collinoides and L. hilgardii strains. The primers and the amplicon proved to be suitable and reliable tools to detect the lactic acid bacteria involved in the deterioration of cider. PMID:11403134

  16. Nickel-Resistant Bacteria from Anthropogenically Nickel-Polluted and Naturally Nickel-Percolated Ecosystems

    PubMed Central

    Stoppel, R.; Schlegel, H. G.

    1995-01-01

    DNA fragments harboring the nickel resistance determinants from bacteria isolated from anthropogenically polluted ecosystems in Europe and Zaire were compared with those harboring the nickel resistance determinants from bacteria isolated from naturally nickel-percolated soils from New Caledonia by DNA-DNA hybridization. The biotinylated DNA probes were derived from the previously described Alcaligenes eutrophus CH34, Alcaligenes xylosoxidans 31A, Alcaligenes denitrificans 4a-2, and Klebsiella oxytoca CCUG 15788 and four new nickel resistance-determining fragments cloned from strains isolated from soils under nickel-hyperaccumulating trees. Nine probes were hybridized with endonuclease-cleaved plasmid and total DNA samples from 56 nickel-resistant strains. Some of the New Caledonian strains were tentatively identified as Acinetobacter, Pseudomonas mendocina, Comamonas, Hafnia alvei, Burkholderia, Arthrobacter aurescens, and Arthrobacter ramosus strains. The DNA of most strains showed homologies to one or several of the following nickel resistance determinants: the cnr and ncc operons of the strains A. eutrophus CH34 and A. xylosoxidans 31A, respectively, the nre operon of strain 31A, and the nickel resistance determinants of K. oxytoca. On the basis of their hybridization reactions the nickel resistance determinants of the strains could be assigned to four groups: (i) cnr/ncc type, (ii) cnr/ncc/nre type, (iii) K. oxytoca type, and (iv) others. The majority of the strains were assigned to the known groups. Among the strains from Belgium and Zaire, exclusively the cnr/ncc and the cnr/ncc/nre types were found. Among the New Caledonian strains all four types were represented. Homologies to the nre operon were found only in combination with the cnr/ncc operon. The homologies to the cnr/ncc operon were the most abundant and were detected alone or together with homologies to the nre operon. Only the DNA of the strains isolated from soil in Scotland and the United States and that of five of the New Caledonian strains did not show any detectable homologies to any of our probes. The nickel resistance fragment isolated from Burkholderia strain 32W-2 was studied in some detail. This 15-kb BamHI fragment conferred resistance to 1 to 5 mM NiCl(inf2) to Escherichia coli and resistance to up to 25 mM NiCl(inf2) to A. eutrophus. It showed strong homologies to both the cnr/ncc operon and the nre operon and conferred strictly regulated (inducible) nickel resistance to A. eutrophus. PMID:16535048

  17. Klebsiella spp. as Nosocomial Pathogens: Epidemiology, Taxonomy, Typing Methods, and Pathogenicity Factors

    PubMed Central

    Podschun, R.; Ullmann, U.

    1998-01-01

    Bacteria belonging to the genus Klebsiella frequently cause human nosocomial infections. In particular, the medically most important Klebsiella species, Klebsiella pneumoniae, accounts for a significant proportion of hospital-acquired urinary tract infections, pneumonia, septicemias, and soft tissue infections. The principal pathogenic reservoirs for transmission of Klebsiella are the gastrointestinal tract and the hands of hospital personnel. Because of their ability to spread rapidly in the hospital environment, these bacteria tend to cause nosocomial outbreaks. Hospital outbreaks of multidrug-resistant Klebsiella spp., especially those in neonatal wards, are often caused by new types of strains, the so-called extended-spectrum-?-lactamase (ESBL) producers. The incidence of ESBL-producing strains among clinical Klebsiella isolates has been steadily increasing over the past years. The resulting limitations on the therapeutic options demand new measures for the management of Klebsiella hospital infections. While the different typing methods are useful epidemiological tools for infection control, recent findings about Klebsiella virulence factors have provided new insights into the pathogenic strategies of these bacteria. Klebsiella pathogenicity factors such as capsules or lipopolysaccharides are presently considered to be promising candidates for vaccination efforts that may serve as immunological infection control measures. PMID:9767057

  18. Volatiles emitted from eight wound-isolated bacteria differentially attract gravid screwworms (Diptera: Calliphoridae) to oviposit.

    PubMed

    Chaudhury, M F; Skoda, S R; Sagel, A; Welch, J B

    2010-05-01

    Bovine blood inoculated with bacteria isolated from screwworm [Cochliomyia hominivorax (Coquerel) (Diptera: Calliphoridae)]-infested animal wounds was tested as an attractant for oviposition for gravid screwworms. Eight species of gram-negative coliform (Enterobacteriaceae) bacteria mixed with bovine blood singly or all species combined and incubated for various times produced volatiles that attracted gravid flies in a cage bioassay in varying numbers. In 15-min duration tests, volatiles from five species of bacteria (Klebsiella oxytoca, Proteus mirabilis, Proteus vulgaris, Providencia rettgeri, and Providencia stuartii) attracted more females than volatiles of the three species (Enterobacter cloacae, Enterobacter sakazakii, and Serratia liquefaciens). In 1-h duration oviposition tests, volatiles from the substrate using the same five species of bacteria attracted more females to oviposit than the other three species. Volatiles from 24-h incubation period elicited least attraction and oviposition whereas volatiles from the 48- and 72-h incubation period resulted in significantly more attraction and oviposition. Attraction and oviposition decreased significantly when the substrates were incubated for 96 h. Volatiles from substrate with all species of bacteria combined attracted a significantly higher percentage of flies to land and oviposit than those from substrates prepared with single species. It is possible that multiple active chemicals present in volatiles of the all-species substrate may act as synergists resulting in greater response than those observed with volatiles from single-species substrate. Before oviposition flies took a bloodmeal from the oviposition substrate. It is possible that the oviposition is moderated by two different factors in screwworm-first, by using a chemical cue to land on a potential oviposition site and second, by using a bloodmeal to stimulate oviposition. PMID:20496582

  19. Technetium-99m distribution into Klebsiella pneumoniae.

    PubMed

    Bernardo-Filho, M; Pereira, J A; Boasquevisque, E M; Hassón-Voloch, A

    1991-01-01

    Bacteria labelled with radionuclide has been the subject of much investigation and has been applied in microbiological research. Technetium-99m (99mTc) may be an alternative radionuclide for the labelling of bacteria employed in various microbiological procedures. This radionuclide is easily available, is not expensive and presents important physical and biological characteristics. 99mTc-labelled bacteria are stable and their cell viability and biological properties are not modified. Study of the distribution of radioactivity in 99mTc-labelled Klebsiella pneumoniae cultures, after homogenization and differential centrifugation of the cells fractions, showed that this radionuclide was present inside the cell, mainly in a ribosomal fraction. Treatment of these fractions with enzymes and detergent revealed a high sensitivity to pronase and Triton X-100. After phenol extraction, a large percentage of radioactivity was detected in the phenol phase. Treatment of the soluble fraction with trichloroacetic acid at different temperatures showed that the concentration of 99mTc in the precipitate was lower at 100 degrees than at 4 degrees C. These results suggest that 99mTc binds mainly to the proteins in Klebsiella pneumoniae. PMID:1816872

  20. Diversity of bacteria nesting the plant cover of north Sinai deserts, Egypt

    PubMed Central

    Hanna, Amira L.; Youssef, Hanan H.; Amer, Wafaa M.; Monib, Mohammed; Fayez, Mohammed; Hegazi, Nabil A.

    2012-01-01

    North Sinai deserts were surveyed for the predominant plant cover and for the culturable bacteria nesting their roots and shoots. Among 43 plant species reported, 13 are perennial (e.g. Fagonia spp., Pancratium spp.) and 30 annuals (e.g. Bromus spp., Erodium spp.). Eleven species possessed rhizo-sheath, e.g. Cyperus capitatus, Panicum turgidum and Trisetaria koelerioides. Microbiological analyses demonstrated: the great diversity and richness of associated culturable bacteria, in particular nitrogen-fixing bacteria (diazotrophs); the majority of bacterial residents were of true and/or putative diazotrophic nature; the bacterial populations followed an increasing density gradient towards the root surfaces; sizeable populations were able to reside inside the root (endorhizosphere) and shoot (endophyllosphere) tissues. Three hundred bacterial isolates were secured from studied spheres. The majority of nitrogen-fixing bacilli isolates belonged to Bacillus megaterium,Bacillus pumilus, Bacillus polymexa,Bacillus macerans,Bacillus circulans and Bacillus licheniformis. The family Enterobacteriaceae represented by Enterobacter agglomerans,Enterobacter sackazakii, Enterobacter cloacae, Serratia adorifera,Serratia liquefaciens and Klebsiella oxytoca. The non-Enterobacteriaceae population was rich in Pantoae spp., Agrobacterium rdiobacter, Pseudomonas vesicularis, Pseudomonas putida, Stenotrophomonas maltophilia, Ochrobactrum anthropi, Sphingomonas paucimobilis and Chrysemonas luteola.Gluconacetobacter diazotrophicus were reported inside root and shoot tissues of a number of tested plants. The dense bacterial populations reported speak well to the very possible significant role played by the endophytic bacterial populations in the survival, in respect of nutrition and health, of existing plants. Such groups of diazotrophs are good candidates, as bio-preparates, to support the growth of future field crops grown in deserts of north Sinai and irrigated by the water of El-Salam canal. PMID:25685397

  1. Duodenal-Mucosal Bacteria Associated with Celiac Disease in Children

    PubMed Central

    Sánchez, Ester; Donat, Ester; Ribes-Koninckx, Carmen; Fernández-Murga, Maria Leonor

    2013-01-01

    Celiac disease (CD) is an immune-mediated enteropathy triggered by the ingestion of cereal gluten proteins. This disorder is associated with imbalances in the gut microbiota composition that could be involved in the pathogenesis of CD. The aim of this study was to characterize the composition and diversity of the cultivable duodenal mucosa-associated bacteria of CD patients and control children. Duodenal biopsy specimens from patients with active disease on a gluten-containing diet (n = 32), patients with nonactive disease after adherence to a gluten-free diet (n = 17), and controls (n = 8) were homogenized and plated on plate count agar, Wilkins-Chalgren agar, brain heart agar, or yeast, Casitone, and fatty acid agar. The isolates were identified by partial 16S rRNA gene sequencing. Renyi diversity profiles showed the highest diversity values for active CD patients, followed by nonactive CD patients and control individuals. Members of the phylum Proteobacteria were more abundant in patients with active CD than in the other child groups, while those of the phylum Firmicutes were less abundant. Members of the families Enterobacteriaceae and Staphylococcaceae, particularly the species Klebsiella oxytoca, Staphylococcus epidermidis, and Staphylococcus pasteuri, were more abundant in patients with active disease than in controls. In contrast, members of the family Streptococcaceae were less abundant in patients with active CD than in controls. Furthermore, isolates of the Streptococcus anginosus and Streptococcus mutans groups were more abundant in controls than in both CD patient groups, regardless of inflammatory status. The findings indicated that the disease is associated with the overgrowth of possible pathobionts that exclude symbionts or commensals that are characteristic of the healthy small intestinal microbiota. PMID:23835180

  2. Duodenal-mucosal bacteria associated with celiac disease in children.

    PubMed

    Sánchez, Ester; Donat, Ester; Ribes-Koninckx, Carmen; Fernández-Murga, Maria Leonor; Sanz, Yolanda

    2013-09-01

    Celiac disease (CD) is an immune-mediated enteropathy triggered by the ingestion of cereal gluten proteins. This disorder is associated with imbalances in the gut microbiota composition that could be involved in the pathogenesis of CD. The aim of this study was to characterize the composition and diversity of the cultivable duodenal mucosa-associated bacteria of CD patients and control children. Duodenal biopsy specimens from patients with active disease on a gluten-containing diet (n = 32), patients with nonactive disease after adherence to a gluten-free diet (n = 17), and controls (n = 8) were homogenized and plated on plate count agar, Wilkins-Chalgren agar, brain heart agar, or yeast, Casitone, and fatty acid agar. The isolates were identified by partial 16S rRNA gene sequencing. Renyi diversity profiles showed the highest diversity values for active CD patients, followed by nonactive CD patients and control individuals. Members of the phylum Proteobacteria were more abundant in patients with active CD than in the other child groups, while those of the phylum Firmicutes were less abundant. Members of the families Enterobacteriaceae and Staphylococcaceae, particularly the species Klebsiella oxytoca, Staphylococcus epidermidis, and Staphylococcus pasteuri, were more abundant in patients with active disease than in controls. In contrast, members of the family Streptococcaceae were less abundant in patients with active CD than in controls. Furthermore, isolates of the Streptococcus anginosus and Streptococcus mutans groups were more abundant in controls than in both CD patient groups, regardless of inflammatory status. The findings indicated that the disease is associated with the overgrowth of possible pathobionts that exclude symbionts or commensals that are characteristic of the healthy small intestinal microbiota. PMID:23835180

  3. Extended-spectrum ?-lactamases in Gram Negative Bacteria

    PubMed Central

    Rawat, Deepti; Nair, Deepthi

    2010-01-01

    Extended-spectrum ?-lactamases (ESBLs) are a group of plasmid-mediated, diverse, complex and rapidly evolving enzymes that are posing a major therapeutic challenge today in the treatment of hospitalized and community-based patients. Infections due to ESBL producers range from uncomplicated urinary tract infections to life-threatening sepsis. Derived from the older TEM is derived from Temoniera, a patient from whom the strain was first isolated in Greece. ?-lactamases, these enzymes share the ability to hydrolyze third-generation cephalosporins and aztreonam and yet are inhibited by clavulanic acid. In addition, ESBL-producing organisms exhibit co-resistance to many other classes of antibiotics, resulting in limitation of therapeutic option. Because of inoculum effect and substrate specificity, their detection is also a major challenge. At present, however, organizations such as the Clinical and Laboratory Standards Institute (formerly the National Committee for Clinical Laboratory Standards) provide guidelines for the detection of ESBLs in Klebsiella pneumoniae, K. oxytoca, Escherichia coli and Proteus mirabilis. In common to all ESBL-detection methods is the general principle that the activity of extended-spectrum cephalosporins against ESBL-producing organisms will be enhanced by the presence of clavulanic acid. Carbapenems are the treatment of choice for serious infections due to ESBL-producing organisms, yet carbapenem-resistant isolates have recently been reported. ESBLs represent an impressive example of the ability of gram-negative bacteria to develop new antibiotic-resistance mechanisms in the face of the introduction of new antimicrobial agents. Thus there is need for efficient infection-control practices for containment of outbreaks; and intervention strategies, e.g., antibiotic rotation to reduce further selection and spread of these increasingly resistant pathogens. PMID:20927289

  4. Enrichment and identification of cellulolytic bacteria from the gastrointestinal tract of Giant African snail, Achatina fulica.

    PubMed

    Pawar, Kiran D; Dar, Mudasir A; Rajput, Bharati P; Kulkarni, Girish J

    2015-02-01

    The cellulolytic bacterial community structure in gastrointestinal (GI) tract of Achatina fulica was studied using culture-independent and -dependent methods by enrichment in carboxymethyl cellulose (CMC). Culture-dependent method indicated that GI tract of snail was dominated by Enterobacteriaceae members. When tested for cellulase activities, all isolates obtained by culture-dependent method showed both or either of CMCase or avicelase activity. Isolate identified as Citrobacter freundii showed highest CMCase and medium avicelase activity. Sequencing of clones from the 16S rRNA gene clone library identified ten operational taxonomic units (OTUs), which were affiliated to Enterobacteriaceae of phylum Gammaproteobacteria. Of these ten OTUs, eight OTUs closely matched with Enterobacter and Klebsiella genera. The most abundant OTU allied to Klebsiella oxytoca accounted for 70 % of the total sequences. The members of Klebsiella and Enterobacter were observed by both methods indicating their dominance among the cellulolytic bacterial community in the GI tract of the snail. PMID:25432338

  5. Population dynamics of bacteria associated with different strains of the pine wood nematode Bursaphelenchus xylophilus after inoculation in maritime pine (Pinus pinaster).

    PubMed

    Roriz, Mariana; Santos, Carla; Vasconcelos, Marta W

    2011-08-01

    For a long time it was thought that Bursaphelenchus xylophilus was the only agent of the pine wilt disease. Recently, it was discovered that there are bacteria associated with the nematodes that contribute to the pathogenesis of this disease, mainly through the release of toxins that promote the death of the pines. Among the species most commonly found, are bacteria belonging to the Bacillus, Pantoea, Pseudomonas and Xanthomonas genera. The main objective of this work was to study the effect of inoculation of maritime pine (Pinus pinaster) with four different nematode isolates, in the bacterial population of nematodes and trees, at different stages of disease progression. The monitoring of progression of disease symptoms was also recorded. Also, the identification of bacteria isolated from the xylem of trees and the surface of nematodes was performed by classical identification methods, by the API20E identification system and by sequencing of bacterial DNA. The results showed that for the symptoms progression, the most striking difference was observed for the pines inoculated with the avirulent isolate, C14-5, which led to a slower and less severe aggravation of symptoms than in pines inoculated with the virulent isolates. In general, it was found that bacterial population, inside the tree, increased with disease progression. A superior bacterial quantity was isolated from pines inoculated with the nematode isolates HF and 20, and, comparatively, few bacteria were isolated from pines inoculated with the avirulent isolate. The identification system API20E was insufficient in the identification of bacterial species; Enterobacter cloacae species was identified in 79% of the isolated bacterial colonies and seven of these colonies could not be identified by this method. Molecular identification methods, through bacterial DNA sequencing, allowed a more reliable identification: eleven different bacterial species within the Bacillus, Citrobacter, Enterobacter, Escherichia, Klebsiella, Paenibacillus, Pantoea and Terribacillus genera were identified. General bacterial diversity increased with the progression of the disease. Bacillus spp. were predominant at the earlier stage of disease progression and Klebsiella oxytoca at the later stages. Furthermore, bacterial species isolated from the surface of nematodes were similar to those isolated from the xylem of pines. In the present work new bacterial species were identified which have never been reported before in this type of study and may be associated with their geographical origin (Portugal). P. pinaster, the pine species used in this study, was different from those commonly grown in Japan and China. Furthermore, it was the first time that bacteria were isolated and identified from an avirulent pine wood nematode isolate. PMID:21570967

  6. Deciphering tissue-induced Klebsiella pneumoniae lipid A structure.

    PubMed

    Llobet, Enrique; Martínez-Moliner, Verónica; Moranta, David; Dahlström, Käthe M; Regueiro, Verónica; Tomás, Anna; Cano, Victoria; Pérez-Gutiérrez, Camino; Frank, Christian G; Fernández-Carrasco, Helena; Insua, José Luis; Salminen, Tiina A; Garmendia, Junkal; Bengoechea, José A

    2015-11-17

    The outcome of an infection depends on host recognition of the pathogen, hence leading to the activation of signaling pathways controlling defense responses. A long-held belief is that the modification of the lipid A moiety of the lipopolysaccharide could help Gram-negative pathogens to evade innate immunity. However, direct evidence that this happens in vivo is lacking. Here we report the lipid A expressed in the tissues of infected mice by the human pathogen Klebsiella pneumoniae. Our findings demonstrate that Klebsiella remodels its lipid A in a tissue-dependent manner. Lipid A species found in the lungs are consistent with a 2-hydroxyacyl-modified lipid A dependent on the PhoPQ-regulated oxygenase LpxO. The in vivo lipid A pattern is lost in minimally passaged bacteria isolated from the tissues. LpxO-dependent modification reduces the activation of inflammatory responses and mediates resistance to antimicrobial peptides. An lpxO mutant is attenuated in vivo thereby highlighting the importance of this lipid A modification in Klebsiella infection biology. Colistin, one of the last options to treat multidrug-resistant Klebsiella infections, triggers the in vivo lipid A pattern. Moreover, colistin-resistant isolates already express the in vivo lipid A pattern. In these isolates, LpxO-dependent lipid A modification mediates resistance to colistin. Deciphering the lipid A expressed in vivo opens the possibility of designing novel therapeutics targeting the enzymes responsible for the in vivo lipid A pattern. PMID:26578797

  7. Klebsiella pneumoniae Bloodstream Infection

    PubMed Central

    Girometti, Nicolò; Lewis, Russell E.; Giannella, Maddalena; Ambretti, Simone; Bartoletti, Michele; Tedeschi, Sara; Tumietto, Fabio; Cristini, Francesco; Trapani, Filippo; Gaibani, Paolo; Viale, Pierluigi

    2014-01-01

    Abstract Multidrug resistance associated with extended-spectrum beta-lactamase (ESBL) and Klebsiella pneumoniae carbapenemase (KPC) among K. pneumoniae is endemic in southern Europe. We retrospectively analyzed the impact of resistance on the appropriateness of empirical therapy and treatment outcomes of K. pneumoniae bloodstream infections (BSIs) during a 2-year period at a 1420-bed tertiary-care teaching hospital in northern Italy. We identified 217 unique patient BSIs, including 92 (42%) KPC-positive, 49 (23%) ESBL-positive, and 1 (0.5%) metallo-beta-lactamase-positive isolates. Adequate empirical therapy was administered in 74% of infections caused by non-ESBL non-KPC strains, versus 33% of ESBL and 23% of KPC cases (p?

  8. Ethanol from lignocellulosic wastes with utilization of recombinant bacteria.

    PubMed

    Katzen, R; Fowler, D E

    1994-01-01

    This article presents the advanced technology that has been developed by BioEnergy International of Gainesville, Florida, utilizing novel recombinant strains of bacteria developed by Lonnie Ingram of the University of Florida. The first commercial applications of these unique fermenting organisms convert 5-carbon sugars, as well as 6-carbon sugars, and oligomers of cellulose (e.g., cellobiose and cellotriose) directly to ethanol. The proposed systems that will be utilized for conversion of agricultural wastes, mixed waste papers, and pulp and paper mill waste in forthcoming commercial installations are now under design. This involves the extensive experience of Raphael Katzen Associates International, Inc. in acid hydrolysis, enzyme production, enzymatic hydrolysis, large-scale fermentation engineering, and distillation/dehydration. Specific examples of this advanced technology will be presented in different applications, namely: 1. Conversion of the hemicellulose content of sugar cane bagasse to 5-carbon sugars by mild-acid prehydrolysis, followed by fermentation of the 5-carbon sugar extract with recombinant Escherichia coli in a commercial installation soon to be under construction in Brazil. This unique process utilizes the surplus hemicellulose fraction of bagasse not required for steam and power generation to produce ethanol, additional to that from the original can juice, which has been converted by conventional sucrose fermentation to ethanol. The process also recovers and converts to ethanol the majority of sucrose normally lost with the bagasse fibers. Resultant beer is enriched in an innovative process to eliminate the need for incremental rectification capacity. 2. Application of this technology to mixed waste paper in Florida, with a moderate loading of newsprint (85% mechanical wood fiber), will involve a mild-acid prehydrolysis, the partial extraction of the 5-carbon sugars produced from hemicellulose as a feedstock for propagation of the recombinant Klebsiella oxytoca bacterium. Included is a facility providing for in-house production of cellulase enzyme, as an active whole broth for direct use in simultaneous saccharification and fermentation (SSF) of the remaining cellulose and residual 5-carbon sugars to ethanol. This is followed by distillation and dehydration in the advanced commercially available low-energy recovery system. 3. Another potential application of this unique technology involves utilization of a variety of wastes from several pulp and paper mills in close proximity, permitting collection of these wastes at low cost and reducing the considerable cost encountered in disposing of such low-energy wet waste.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:8010771

  9. Long-term dissemination of acquired AmpC ?-lactamases among Klebsiella spp. and Escherichia coli in Portuguese clinical settings.

    PubMed

    Freitas, F; Machado, E; Ribeiro, T G; Novais, Â; Peixe, L

    2014-04-01

    We investigated the occurrence, diversity and molecular epidemiology of genes coding for acquired AmpC ?-lactamases (qAmpC) among clinical isolates of Enterobacteriaceae lacking inducible chromosomal AmpCs in Portugal. A total of 675 isolates non-susceptible to broad-spectrum cephalosporins obtained from four hospitals and three community laboratories during a 7-year period (2002-2008) were analysed. The presence of genes coding for qAmpC was investigated by phenotypic criteria, polymerase chain reaction (PCR) and sequencing. Bacterial identification, antibiotic susceptibility testing, conjugation assays and clonal analysis were performed by standard procedures. The presence of bla(qAmpC) genes was detected in 50 % (50/100; 41 Klebsiella pneumoniae, 5 Escherichia coli, 4 Klebsiella oxytoca) of the presumptive qAmpC producers. DHA-1, detected in those species, was the most prevalent qAmpC (94 %, 47/50), being identified since 2003 and throughout the studied period in different institutions. Despite the high clonal diversity observed, three DHA-1-producing Klebsiella spp. clones were more frequently identified. CMY-2 (6 %, 3/50) was observed in B1-E. coli clones. Conjugative transfer was only observed in one (2 %) CMY-2-producing isolate. Most qAmpC producers (94 %, 47/50) co-expressed SHV-type and/or OXA-1 or CTX-M-32 extended-spectrum ?-lactamases (ESBLs). To the authors' knowledge, this is the first description of the molecular epidemiology and the long-term dissemination of qAmpC-producing Enterobacteriaceae in Portuguese clinical settings, highlighting an evolution towards a more complex epidemiological situation regarding cephalosporin resistance in Portugal. PMID:24096741

  10. Klebsiella pneumoniae triggers a cytotoxic effect on airway epithelial cells

    PubMed Central

    2009-01-01

    Background Klebsiella pneumoniae is a capsulated Gram negative bacterial pathogen and a frequent cause of nosocomial infections. Despite its clinical relevance, little is known about the features of the interaction between K. pneumoniae and lung epithelial cells on a cellular level, neither about the role of capsule polysaccharide, one of its best characterised virulence factors, in this interaction. Results The interaction between Klebsiella pneumoniae and cultured airway epithelial cells was analysed. K. pneumoniae infection triggered cytotoxicity, evident by cell rounding and detachment from the substrate. This effect required the presence of live bacteria and of capsule polysaccharide, since it was observed with isolates expressing different amounts of capsule and/or different serotypes but not with non-capsulated bacteria. Cytotoxicity was analysed by lactate dehydrogenase and formazan measurements, ethidium bromide uptake and analysis of DNA integrity, obtaining consistent and complementary results. Moreover, cytotoxicity of non-capsulated strains was restored by addition of purified capsule during infection. While a non-capsulated strain was avirulent in a mouse infection model, capsulated K. pneumoniae isolates displayed different degrees of virulence. Conclusion Our observations allocate a novel role to K. pneumoniae capsule in promotion of cytotoxicity. Although this effect is likely to be associated with virulence, strains expressing different capsule levels were not equally virulent. This fact suggests the existence of other bacterial requirements for virulence, together with capsule polysaccharide. PMID:19650888

  11. Analysis of eight out genes in a cluster required for pectic enzyme secretion by Erwinia chrysanthemi: sequence comparison with secretion genes from other gram-negative bacteria.

    PubMed Central

    Lindeberg, M; Collmer, A

    1992-01-01

    Many extracellular proteins produced by Erwinia chrysanthemi require the out gene products for transport across the outer membrane. In a previous report (S. Y. He, M. Lindeberg, A. K. Chatterjee, and A. Collmer, Proc. Natl. Acad. Sci. USA 88:1079-1083, 1991) cosmid pCPP2006, sufficient for secretion of Erwinia chrysanthemi extracellular proteins by Escherichia coli, was partially sequenced, revealing four out genes sharing high homology with pulH through pulK from Klebsiella oxytoca. The nucleotide sequence of eight additional out genes reveals homology with pulC through pulG, pulL, pulM, pulO, and other genes involved in secretion by various gram-negative bacteria. Although signal sequences and hydrophobic regions are generally conserved between Pul and Out proteins, four out genes contain unique inserts, a pulN homolog is not present, and outO appears to be transcribed separately from outC through outM. The sequenced region was subcloned, and an additional 7.6-kb region upstream was identified as being required for secretion in E. coli. out gene homologs were found on Erwinia carotovora cosmid clone pAKC651 but were not detected in E. coli. The outC-through-outM operon is weakly induced by polygalacturonic acid and strongly expressed in the early stationary phase. The out and pul genes are highly similar in sequence, hydropathic properties, and overall arrangement but differ in both transcriptional organization and the nature of their induction. Images PMID:1429461

  12. Klebsiella pneumoniae inoculants for enhancing plant growth

    DOEpatents

    Triplett, Eric W. (Middleton, WI); Kaeppler, Shawn M. (Oregon, WI); Chelius, Marisa K. (Greeley, CO)

    2008-07-01

    A biological inoculant for enhancing the growth of plants is disclosed. The inoculant includes the bacterial strains Herbaspirillum seropedicae 2A, Pantoea agglomerans P101, Pantoea agglomerans P102, Klebsiella pneumoniae 342, Klebsiella pneumoniae zmvsy, Herbaspirillum seropedicae Z152, Gluconacetobacter diazotrophicus PA15, with or without a carrier. The inoculant also includes strains of the bacterium Pantoea agglomerans and K. pneumoniae which are able to enhance the growth of cereal grasses. Also disclosed are the novel bacterial strains Herbaspirillum seropedicae 2A, Pantoea agglomerans P101 and P102, and Klebsiella pneumoniae 342 and zmvsy.

  13. Development of industrial-medium-required elimination of the 2,3-butanediol fermentation pathway to maintain ethanol yield in an ethanologenic strain of Klebsiella oxytoca.

    PubMed

    Wood, Brent E; Yomano, L P; York, S W; Ingram, L O

    2005-01-01

    Fermentation efficiency and nutrient costs are both significant factors in process economics for the microbial conversion of cellulosic biomass to commodity chemicals such as ethanol. In this study, we have developed a more industrial medium (OUM1) composed of 0.5% corn steep liquor (dry weight basis) supplemented with mineral salts (0.2%), urea (0.06%), and glucose (9%). Although the growth of strain P2 was vigorous in this medium, approximately 14% of substrate carbon was diverted into 2,3-butanediol and acetoin under the low pH conditions needed for optimal cellulase activity during simultaneous saccharification. Deleting the central region of the budAB genes encoding alpha-acetolactate synthase and alpha-acetolactate decarboxylase eliminated the butanediol and acetoin coproducts and increased ethanol yields by 12%. In OUM1 medium at pH 5.2, strain BW21 produced over 4% ethanol in 48 h (0.47 g ethanol per g glucose). Average productivity (48 h), ethanol titer, and ethanol yield for BW21 in OUM1 medium (pH 5.2) exceeded that of the parent (strain P2) in rich laboratory medium (Luria broth). PMID:16209539

  14. Klebsiella pneumoniae: a progression to multidrug resistance 

    E-print Network

    Findlay, Jacqueline

    2012-06-22

    Klebsiella pneumoniae is a common cause of nosocomial and community-acquired infections, and the increasing incidence and prevalence of antibiotic resistant strains is proving to be particularly problematic to clinicians. ...

  15. Klebsiella Species Associated with Bovine Mastitis in Newfoundland

    PubMed Central

    Podder, Milka P.; Rogers, Laura; Daley, Peter K.; Keefe, Greg P.; Whitney, Hugh G.; Tahlan, Kapil

    2014-01-01

    Klebsiella spp. is a common cause of bovine mastitis, but information regarding its molecular epidemiology is lacking from many parts of the world. On using mass spectrometry and partial sequencing of the rpoB gene, it was found that over a one year study, K. variicola and Enterobacter cloacae were misidentified as K. pneumoniae in a small number of clinical mastitis (CM) cases from Newfoundland. Results suggest that the currently used standard biochemical/phenotypic tests lack the sensitivity required to accurately discriminate among the three mentioned Gram negative bacteria. In addition, a single strain of K. variicola was associated with CM from one farm in the study as demonstrated by Random Amplified Polymorphic DNA (RAPD) PCR. To the best of our knowledge, K. variicola, which is normally found in the environment, has not been isolated previously from milk obtained from cows with CM. Therefore, it is possible that K. variicola was not detected in milk samples in the past due to the inability of standard tests to discriminate it from other Klebsiella species. PMID:25180510

  16. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases

    PubMed Central

    Munoz-Price, L Silvia; Poirel, Laurent; Bonomo, Robert A; Schwaber, Mitchell J; Daikos, George L; Cormican, Martin; Cornaglia, Giuseppe; Garau, Javier; Gniadkowski, Marek; Hayden, Mary K; Kumarasamy, Karthikeyan; Livermore, David M; Maya, Juan J; Nordmann, Patrice; Patel, Jean B; Paterson, David L; Pitout, Johann; Villegas, Maria Virginia; Wang, Hui; Woodford, Neil; Quinn, John P

    2015-01-01

    Klebsiella pneumoniae carbapenemases (KPCs) were originally identified in the USA in 1996. Since then, these versatile ?-lactamases have spread internationally among Gram-negative bacteria, especially K pneumoniae, although their precise epidemiology is diverse across countries and regions. The mortality described among patients infected with organisms positive for KPC is high, perhaps as a result of the limited antibiotic options remaining (often colistin, tigecycline, or aminoglycosides). Triple drug combinations using colistin, tigecycline, and imipenem have recently been associated with improved survival among patients with bacteraemia. In this Review, we summarise the epidemiology of KPCs across continents, and discuss issues around detection, present antibiotic options and those in development, treatment outcome and mortality, and infection control. In view of the limitations of present treatments and the paucity of new drugs in the pipeline, infection control must be our primary defence for now. PMID:23969216

  17. Biochemical and Structural Characterization of a Ureidoglycine Aminotransferase in the Klebsiella pneumoniae Uric Acid Catabolic Pathway

    SciTech Connect

    French, Jarrod B.; Ealick, Steven E.

    2010-09-03

    Many plants, fungi, and bacteria catabolize allantoin as a mechanism for nitrogen assimilation. Recent reports have shown that in plants and some bacteria the product of hydrolysis of allantoin by allantoinase is the unstable intermediate ureidoglycine. While this molecule can spontaneously decay, genetic analysis of some bacterial genomes indicates that an aminotransferase may be present in the pathway. Here we present evidence that Klebsiella pneumoniae HpxJ is an aminotransferase that preferentially converts ureidoglycine and an {alpha}-keto acid into oxalurate and the corresponding amino acid. We determined the crystal structure of HpxJ, allowing us to present an explanation for substrate specificity.

  18. Spontaneous spondylodiscitis caused by Klebsiella pneumoniae.

    PubMed

    Kouroussis, C; Georgoulias, V; Souglakos, J; Simvoulakis, E; Karabekios, S; Samonis, G

    1999-01-01

    A rare case of spontaneous spondylodiscitis caused by Klebsiella pneumoniae in a 55-year-old man who presented with thoracolumbar pain is described. Increased erythrocyte sedimentation rate and C-reactive protein level were pertinent laboratory findings. Computed tomography revealed a paravertebral mass and destruction of the 10th and 11th vertebrae. Magnetic resonance imaging (MRI) showed spondylodiscitis in the same area. Culture of a biopsy sample from the mass grew Klebsiella pneumoniae, while histological examination confirmed the inflammation. A combination of ceftazidime, amikacin and ciprofloxacin resulted in disappearance of the pain. Two months later, MRI showed substantial improvement of the lesions. PMID:10624600

  19. Alert for klebsiella pneumoniae septicaemia in piglets.

    PubMed

    2015-09-19

    Outbreaks of piglet septicaemia due to Klebsiella pneumoniae could continue this summerTexel microphthalmiaBotulism in sheepSwine influenza outbreak in late finishersSalmonella Typhimurium infection in pheasant chicksThese are among matters discussed in the Animal and Plant Health Agency's (APHA's) disease surveillance report for May 2015. PMID:26385145

  20. Resistance in antimicrobial photodynamic inactivation of bacteria.

    PubMed

    Maisch, Tim

    2015-08-01

    Antibiotics have increasingly lost their impact to kill bacteria efficiently during the last 10 years. The emergence and dissemination of superbugs with resistance to multiple antibiotic classes have occurred among Gram-positive and Gram-negative strains including Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter strains. These six superbugs can "escape" more or less any single kind of antibiotic treatment. That means bacteria are very good at developing resistance against antibiotics in a short time. One new approach is called photodynamic antimicrobial chemotherapy (PACT) which already has demonstrated an efficient antimicrobial efficacy among multi-resistant bacteria. Until now it has been questionable if bacteria can develop resistance against PACT. This perspective summarises the current knowledge about the susceptibility of bacteria towards oxidative stress and sheds some light on possible strategies of the development of photodynamic inactivation of bacteria (PACT)-induced oxidative stress resistance by bacteria. PMID:26098395

  1. No Carbapenem Resistance in Pneumonia Caused by Klebsiella Species

    PubMed Central

    Yayan, Josef; Ghebremedhin, Beniam; Rasche, Kurt

    2015-01-01

    Abstract Klebsiella species are a common cause of community- and nosocomial-acquired pneumonia. Antibiotic resistance to the class of carbapenem in patients with pneumonia caused by Klebsiella species is unusual. New studies report carbapenem resistance in patients with pneumonia caused by Klebsiella species. This article examines, retrospectively, antibiotic resistance in patients with community- and nosocomial-acquired pneumonia caused by Klebsiella species. The data of all patients with community- and nosocomial-acquired pneumonia caused by Klebsiella species were collected from the hospital charts at the HELIOS Clinic, Witten/Herdecke University, Wuppertal, Germany, within the study period 2004 to 2014. An antibiogram was created from all of the study patients with pneumonia caused by Klebsiella species. Sensitivity and resistance profiles were performed for the different antibiotics that have been consistently used in the treatment of patients with pneumonia caused by Klebsiella species. All demographic, clinical, and laboratory data of all of the patients with pneumonia caused by Klebsiella species were collected from the patients’ records. During the study period of January 1, 2004, to August 12, 2014, 149 patients were identified with community- and nosocomial-acquired pneumonia affected by Klebsiella species. These patients had a mean age of 70.6?±?13 (107 [71.8%, 95% CI 64.6%–79%] men and 42 [28.2%, 95% CI 21%–35.4%] women). In all of the patients with pneumonia caused by Klebsiella species, there was resistance to ampicillin (P?Klebsiella species (75.3%) also showed resistance to piperacillin (P?Klebsiella species showed resistance to imipenem or meropenem (P?Klebsiella species. PMID:25674753

  2. Plasmid-Mediated Antibiotic Resistance and Virulence in Gram-negatives: the Klebsiella pneumoniae Paradigm

    PubMed Central

    Ramirez, Maria S.; Traglia, German M.; Lin, David L.; Tran, Tung; Tolmasky, Marcelo E.

    2015-01-01

    Summary Plasmids harbor genes coding for specific functions including virulence factors and antibiotic resistance that permit bacteria to survive the hostile environment found in the host and resist treatment. Together with other genetic elements such as integrons and transposons, and using a variety of mechanisms, plasmids participate in the dissemination of these traits resulting in the virtual elimination of barriers among different kinds of bacteria. In this article we review the current information about physiology and role in virulence and antibiotic resistance of plasmids from the gram-negative opportunistic pathogen Klebsiella pneumoniae. This bacterium has acquired multidrug resistance and is the causative agent of serious communityand hospital-acquired infections. It is also included in the recently defined ESKAPE group of bacteria that cause most of US hospital infections. PMID:25705573

  3. Complete genome sequence of the lignin-degrading bacterium Klebsiella sp. strain BRL6-2

    PubMed Central

    2014-01-01

    In an effort to discover anaerobic bacteria capable of lignin degradation, we isolated Klebsiella sp. strain BRL6-2 on minimal media with alkali lignin as the sole carbon source. This organism was isolated anaerobically from tropical forest soils collected from the Bisley watershed at the Ridge site in the El Yunque National Forest in Puerto Rico, USA, part of the Luquillo Long-Term Ecological Research Station. At this site, the soils experience strong fluctuations in redox potential and are characterized by cycles of iron oxidation and reduction. Genome sequencing was targeted because of its ability to grow on lignin anaerobically and lignocellulolytic activity via in vitro enzyme assays. The genome of Klebsiella sp. strain BRL6-2 is 5.80 Mbp with no detected plasmids, and includes a relatively small arsenal of genes encoding lignocellulolytic carbohydrate active enzymes. The genome revealed four putative peroxidases including glutathione and DyP-type peroxidases, and a complete protocatechuate pathway encoded in a single gene cluster. Physiological studies revealed Klebsiella sp. strain BRL6-2 to be relatively stress tolerant to high ionic strength conditions. It grows in increasing concentrations of ionic liquid (1-ethyl-3-methyl-imidazolium acetate) up to 73.44 mM and NaCl up to 1.5 M. PMID:25566348

  4. Klebsiella variicola, a novel species with clinical and plant-associated isolates.

    PubMed

    Rosenblueth, Mónica; Martínez, Lucía; Silva, Jesús; Martínez-Romero, Esperanza

    2004-02-01

    A new Klebsiella species, K. variicola, is proposed on the basis of total DNA-DNA hybridization, on the monophyly observed in the phylogenetic analysis derived from the sequences of rpoB, gyrA, mdh, infB, phoE and nifH genes and on distinct phenotypic traits. The bacteria from this new species seem to be genetically isolated from K. pneumoniae strains, do not ferment adonitol and were obtained from plants (such as banana, rice, sugar cane and maize) and hospitals. The type strain is F2R9T (= ATCC BAA-830T = CFNE 2004T). PMID:15053318

  5. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a) Identification....

  6. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a) Identification....

  7. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a) Identification....

  8. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...Klebsiella and provides epidemiological information on these diseases. These organisms can cause serious urinary tract and pulmonary infections, particularly in hospitalized patients. (b) Classification. Class I (general controls)....

  9. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...Klebsiella and provides epidemiological information on these diseases. These organisms can cause serious urinary tract and pulmonary infections, particularly in hospitalized patients. (b) Classification. Class I (general controls)....

  10. Instant Typing Is Essential to Detect Transmission of Extended-Spectrum Beta-Lactamase-Producing Klebsiella Species

    PubMed Central

    Voor in 't holt, Anne F.; Severin, Juliëtte A.; Goessens, Wil H. F.; te Witt, René; Vos, Margreet C.

    2015-01-01

    Background Infections with multidrug-resistant (MDR) microorganisms are an increasing threat to hospitalized patients. Although rapid typing of MDR microorganisms is required to apply targeted prevention measures, technical barriers often prevent this. We aimed to assess whether extended-spectrum beta-lactamase (ESBL)-producing Klebsiella species are transmitted between patients and whether routine, rapid typing is needed. Methods For 43 months, the clonality of all ESBL-producing Klebsiella isolates from patients admitted to Erasmus MC University Medical Center in Rotterdam, the Netherlands was assessed with Raman spectroscopy. A cluster was defined as n ?2 patients who had identical isolates. Primary patients were the first patients in each cluster. Secondary patients were those identified with an isolate clonally related to the isolate of the primary patient. Results Isolates from 132 patients were analyzed. We identified 17 clusters, with 17 primary and 56 secondary patients. Fifty-nine patients had a unique isolate. Patients (n = 15) in four out of the 17 clusters were epidemiologically related. Ten of these 15 patients developed an infection. Conclusions Clonal outbreaks of ESBL-producing Klebsiella species were detected in our hospital. Theoretically, after Raman spectroscopy had detected a cluster of n ?2, six infections in secondary patients could have been prevented. These findings demonstrate that spread of ESBL-producing Klebsiella species occurs, even in a non-outbreak setting, and underscore the need for routine rapid typing of these MDR bacteria. PMID:26317428

  11. Translocatable resistance to mercuric and phenylmercuric ions in soil bacteria

    SciTech Connect

    Radford, A.J.; Oliver, J.; Kelly, W.J.; Reaney, D.C.

    1981-08-01

    Of a sample of 42 grams-negative Hg-resistant bacteria, three (a Pseudomonas fluorescens, a Klebsiella sp. and a Citrobacter sp.) contained translocatable elements conferring resistance to Hgbj (all three) and to Hgbj and phenylmercuric acetate (P. fluorescens). The discovery of transposable phenylmercuric acetate resistance extends the range of known resistance ''transposons'' from heavy metals and antibiotics to organometallic compounds.

  12. Normal anti-Klebsiella lymphocytotoxicity in ankylosing spondylitis

    SciTech Connect

    Kinsella, T.D.; Fritzler, M.J.; Lewkonia, R.M.

    1986-03-01

    We compared in vitro lymphocytotoxicity (LCT) of peripheral blood lymphocytes (PBL), obtained from patients with ankylosing spondylitis (AS) and normal controls (NC). Assays were performed with antibacterial antisera prepared from AS- and NC-derived Klebsiella and coliforms Escherichia coli. LCT assessed by eosin staining was not significantly different in PBL of 12 AS patients and 28 controls when reacted with 3 Klebsiella and 1 E coli antisera. LCT assessed by /sup 51/Cr release was not significantly different for PBL of 20 age- and sex-matched pairs of AS patients and NC when reacted with 3 Klebsiella and 1 E coli antisera. Similarly, LCT-/sup 51/Cr of PBL of 15 matched AS and NC pairs was not significantly different for anti-K21, a serotype putatively implicated in Klebsiella-HLA-B27 antigenic cross-reactivity. Our results do not support the notion of molecular mimicry between Klebsiella and B27 in the pathogenesis of primary AS.

  13. Anti-Biofilm Activity: A Function of Klebsiella pneumoniae Capsular Polysaccharide

    PubMed Central

    Dos Santos Goncalves, Marina; Delattre, Cédric; Balestrino, Damien; Charbonnel, Nicolas; Elboutachfaiti, Redouan; Wadouachi, Anne; Badel, Stéphanie; Bernardi, Thierry; Michaud, Philippe; Forestier, Christiane

    2014-01-01

    Competition and cooperation phenomena occur within highly interactive biofilm communities and several non-biocides molecules produced by microorganisms have been described as impairing biofilm formation. In this study, we investigated the anti-biofilm capacities of an ubiquitous and biofilm producing bacterium, Klebsiella pneumoniae. Cell-free supernatant from K. pneumoniae planktonic cultures showed anti-biofilm effects on most Gram positive bacteria tested but also encompassed some Gram negative bacilli. The anti-biofilm non-bactericidal activity was further investigated on Staphylococcus epidermidis, by determining the biofilm biomass, microscopic observations and agglutination measurement through a magnetic bead-mediated agglutination test. Cell-free extracts from K. pneumoniae biofilm (supernatant and acellular matrix) also showed an influence, although to a lesser extend. Chemical analyses indicated that the active molecule was a high molecular weight polysaccharide composed of five monosaccharides: galactose, glucose, rhamnose, glucuronic acid and glucosamine and the main following sugar linkage residues [?2)-?-l-Rhap-(1?]; [?4)-?-l-Rhap-(1?]; [?-d-Galp-(1?]; [?2,3)-?-d-Galp-(1?]; [?3)-?-d-Galp-(1?] and, [?4)-?-d-GlcAp-(1?]. Characterization of this molecule indicated that this component was more likely capsular polysaccharide (CPS) and precoating of abiotic surfaces with CPS extracts from different serotypes impaired the bacteria-surface interactions. Thus the CPS of Klebsiella would exhibit a pleiotropic activity during biofilm formation, both stimulating the initial adhesion and maturation steps as previously described, but also repelling potential competitors. PMID:24932475

  14. Genomic and Functional Characterization of qnr-Encoding Plasmids from Municipal Wastewater Biosolid Klebsiella pneumoniae Isolates

    PubMed Central

    Kaplan, Ella; Sela, Noa; Doron-Faigenboim, Adi; Navon-Venezia, Shiri; Jurkevitch, Edouard; Cytryn, Eddie

    2015-01-01

    Municipal wastewater treatment facilities are considered to be “hotspots” for antibiotic resistance, since they conjoin high densities of environmental and fecal bacteria with selective pressure in the form of sub-therapeutic concentrations of antibiotics. Discharged effluents and biosolids from these facilities can disseminate antibiotic resistant genes to terrestrial and aquatic environments, potentially contributing to the increasing global trend in antibiotic resistance. This phenomenon is especially pertinent when resistance genes are associated with mobile genetic elements such as conjugative plasmids, which can be transferred between bacterial phyla. Fluoroquinolones are among the most abundant antibiotic compounds detected in wastewater treatment facilities, especially in biosolids, where due to their hydrophobic properties they accumulate to concentrations that may exceed 40 mg/L. Although fluoroquinolone resistance is traditionally associated with mutations in the gyrA/topoisomerase IV genes, there is increasing evidence of plasmid-mediated quinolone resistance, which is primarily encoded on qnr genes. In this study, we sequenced seven qnr-harboring plasmids from a diverse collection of Klebsiella strains, isolated from dewatered biosolids from a large wastewater treatment facility in Israel. One of the plasmids, termed pKPSH-11XL was a large (185.4 kbp), multi-drug resistance, IncF-type plasmid that harbored qnrB and 10 additional antibiotic resistance genes that conferred resistance to five different antibiotic families. It was highly similar to the pKPN3-like plasmid family that has been detected in multidrug resistant clinical Klebsiella isolates. In contrast, the six additional plasmids were much smaller (7–9 Kbp) and harbored a qnrS -type gene. These plasmids were highly similar to each other and closely resembled pGNB2, a plasmid isolated from a German wastewater treatment facility. Comparative genome analyses of pKPSH-11XL and other pKPN3-like plasmids concomitant to phylogenetic analysis of housekeeping genes from host Klebsiella strains, revealed that these plasmids are limited to a predominantly human-associated sub-clade of Klebsiella, suggesting that their host range is very narrow. Conversely, the pGNB2-like plasmids had a much broader host range and appeared to be associated with Klebsiella residing in natural environments. This study suggests that: (A) qnrB-harboring multidrug-resistant pKPN3-like plasmids can endure the rigorous wastewater treatment process and may therefore be disseminated to downstream environments; and (B) that small qnrS-harboring pGNB2-like plasmids are ubiquitous in wastewater treatment facilities and are most likely environmental in origin. PMID:26696974

  15. Two distinct sensing pathways allow recognition of Klebsiella pneumoniae by Dictyostelium amoebae

    PubMed Central

    Lima, Wanessa C; Balestrino, Damien; Forestier, Christiane; Cosson, Pierre

    2013-01-01

    Summary Recognition of bacteria by metazoans is mediated by receptors that recognize different types of microorganisms and elicit specific cellular responses. The soil amoebae Dictyostelium discoideum feeds upon a variable mixture of environmental bacteria, and it is expected to recognize and adapt to various food sources. To date, however, no bacteria-sensing mechanisms have been described. In this study, we isolated a Dictyostelium mutant (fspA KO) unable to grow in the presence of non-capsulated Klebsiella pneumoniae bacteria, but growing as efficiently as wild-type cells in the presence of other bacteria, such as Bacillus subtilis. fspA KO cells were also unable to respond to K. pneumoniae and more specifically to bacterially secreted folate in a chemokinetic assay, while they responded readily to B. subtilis. Remarkably, both WT and fspA KO cells were able to grow in the presence of capsulated LM21 K. pneumoniae, and responded to purified capsule, indicating that capsule recognition may represent an alternative, FspA-independent mechanism for K. pneumoniae sensing. When LM21 capsule synthesis genes were deleted, growth and chemokinetic response were lost for fspA KO cells, but not for WT cells. Altogether, these results indicate that Dictyostelium amoebae use specific recognition mechanisms to respond to different K. pneumoniae elements. PMID:24128258

  16. Extended-Spectrum-Beta-Lactamases, AmpC Beta-Lactamases and Plasmid Mediated Quinolone Resistance in Klebsiella spp. from Companion Animals in Italy

    PubMed Central

    Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S.; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

    2014-01-01

    We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6?)-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6?)-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6?)-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission between pets and humans, especially at household level. PMID:24595207

  17. CHARACTERISTICS OF KLEBSIELLA FROM TEXTILE FINISHING PLANT EFFLUENTS

    EPA Science Inventory

    Klebsiella strains are found in abnormally high numbers in a stream receiving wastewater from a textile finishing plant. Representative strains are randomly selected to determine biochemical, serotype, and virulence patterns. All strains conform to the commonly accepted biochemic...

  18. Outbreak of NDM-1-Producing Klebsiella pneumoniae Causing Neonatal Infection in a Teaching Hospital in Mainland China

    PubMed Central

    Zhang, XiaoYu; Li, XianPing; Yue, HeJia; Li, PengLing; Liu, YaPing; Cao, Wei; Yao, DongMei; Liu, Li; Zhou, XiaoLan; Zheng, Rong; Bo, Tao

    2015-01-01

    The emergence and spread of bacteria carrying the blaNDM-1 gene has become a worldwide concern. Here, we report eight cases of Klebsiella pneumoniae with blaNDM-1 in the neonatal ward of a teaching hospital in mainland China. Multilocus sequence typing showed that seven isolates were clonally related and confirmed them as sequence type 17 (ST17). One isolate belonged to ST433. These findings suggest continuous spread of blaNDM-1 in mainland China and emphasize the need for intensive surveillance and precautions. PMID:25941224

  19. Biofilm formation and Klebsiella pneumoniae liver abscess

    PubMed Central

    Fierer, Joshua

    2012-01-01

    Klebsiella pneumoniae liver abscess is an emerging infectious disease. This syndrome was unknown before the late 1980s when it was first recognized in Taiwan. Over the next two decades it increased in prevalence in Taiwan and was reported from other nations of East Asia. It was then that the rest of the world became aware of this interesting new syndrome. The disease is no longer confined to East Asia, and is now an emerging infection in North America and Europe. How did this come about? We now understand some of the genetic changes that turn commensal E. coli into extra-intestinal pathogens. K pneumoniae is another member of the Enterobacteriaceae that is usually normal flora in the gut, but we know relatively little about how it evolved into an invasive pathogen capable of causing abscesses in normal livers. The phenotype of the liver-invasive strains is hyperviscosity of the polysaccharide capsules, but while the gene that determines that property is required it is not sufficient to create the pathogen, and more research is needed to discover the other virulence genes, and thus to potentially target them therapeutically. PMID:22561156

  20. Metabolism of acrylonitrile by Klebsiella pneumoniae.

    PubMed

    Nawaz, M S; Franklin, W; Campbell, W L; Heinze, T M; Cerniglia, C E

    1991-01-01

    A gram-negative rod-shaped bacterium capable of utilizing acrylonitrile as the sole source of nitrogen was isolated from industrial sewage and identified as Klebsiella pneumoniae. The isolate was capable of utilizing aliphatic nitriles containing 1 to 5 carbon atoms or benzonitrile as the sole source of nitrogen and either acetamide or propionamide as the sole source of both carbon and nitrogen. Gas chromatographic and mass spectral analyses of culture filtrates indicated that K. pneumoniae was capable of hydrolyzing 6.15 mmol of acrylonitrile to 5.15 mmol of acrylamide within 24 h. The acrylamide was hydrolyzed to 1.0 mmol of acrylic acid within 72 h. Another metabolite of acrylonitrile metabolism was ammonia, which reached a maximum concentration of 3.69 mM within 48 h. Nitrile hydratase and amidase, the two hydrolytic enzymes responsible for the sequential metabolism of nitrile compounds, were induced by acrylonitrile. The optimum temperature for nitrile hydratase activity was 55 degrees C and that for amidase was 40 degrees C; both enzymes had pH optima of 8.0. PMID:1953306

  1. Perianal Abscess and Proctitis by Klebsiella pneumoniae

    PubMed Central

    Jeong, Woo Shin; Choi, Sung Youn; Jeong, Eun Haeng; Bang, Ki Bae; Park, Seung Sik; Lee, Dae Sung; Park, Dong Il

    2015-01-01

    Klebsiella pneumoniae (K. pneumoniae) can at times cause invasive infections, especially in patients with diabetes mellitus and a history of alcohol abuse. A 61-year-old man with diabetes mellitus and a history of alcohol abuse presented with abdominal and anal pain for two weeks. After admission, he underwent sigmoidoscopy, which revealed multiple ulcerations with yellowish exudate in the rectum and sigmoid colon. The patient was treated with ciprofloxacin and metronidazole. After one week, follow up sigmoidoscopy was performed owing to sustained fever and diarrhea. The lesions were aggravated and seemed webbed in appearance because of damage to the rectal mucosa. Abdominal computed tomography and rectal magnetic resonance imaging were performed, and showed a perianal and perirectal abscess. The patient underwent laparoscopic sigmoid colostomy and perirectal abscess incision and drainage. Extended-spectrum beta-lactamase-producing K. pneumoniae was identified in pus culture. The antibiotics were switched to ertapenem. He improved after surgery and was discharged. K. pneumoniae can cause rapid invasive infection in patients with diabetes and a history of alcohol abuse. We report the first rare case of proctitis and perianal abscess caused by invasive K. pneumoniae infection. PMID:25691848

  2. The significance of bacteriocin typing of Klebsiella strans.

    PubMed

    Israil, A M

    1981-01-01

    Out of three different methods used for bacteriocin sensitivity typing of Klebsiella strains, the "scarpe and streak" method was the most appropriate tool for its routine use in epidemiologic studies. The method is quite simple, reliable and does not imply any special requirements. Out of 533 Klebsiella strains tested by our set of seven bacteriocins 453 (85%) strains proved to be typable and 100 (15%) nontypable. The number of strains typable by bacteriocins was higher than of those typable by phages. In 14 of 19 outbreaks, the predominance of 1-2 distinct patterns of bacteriocin sensitivity was observed. Two large geographical areas have been delineated by two predominant distinct bacteriocin types of Klebsiella strains, each being observed in a high number of outbreaks as well as in sporadic cases belonging to the same area. Although it was not possible to establish any clear correlation between the pattern of bacteriocin sensitivity and the lysotype or serotype of the strains, The present findings offer strong reason to allow recommendation of the bacteriocin sensitivity pattern as a marker of high epidemiologic significance in monitoring Klebsiella cross-infections. Medical and auxiliary workers could play the role of reservoir to Klebsiella strains and for this reason the hospital personnel has to follow carefully strict procedures for ensuring a valid protection of patients especially when coming into direct contact with neonates, infants and debilitated patients. PMID:7198362

  3. Ribitol Catabolic Pathway in Klebsiella aerogenes

    PubMed Central

    Charnetzky, W. T.; Mortlock, R. P.

    1974-01-01

    In Klebsiella aerogenes W70, there is an inducible pathway for the catabolism of ribitol consisting of at least two enzymes, ribitol dehydrogenase (RDH) and d-ribulokinase (DRK). These two enzymes are coordinately controlled and induced in response to d-ribulose, an intermediate of the pathway. Whereas wild-type K. aerogenes W70 are unable to utilize xylitol as a carbon and energy source, mutants constitutive for the ribitol pathway are able to utilize RDH to oxidize the unusual pentitol, xylitol, to d-xylulose. These mutants are able to grow on xylitol, presumably by utilization of the d-xylulose produced. Mutants constitutive for l-fucose isomerase can utilize the isomerase to convert d-arabinose to d-ribulose. In the presence of d-ribulose, RDH and DRK are induced, and such mutants are thus able to phosphorylate the d-ribulose by using the DRK of the ribitol pathway. Derivatives of an l-fucose isomerase-constitutive mutant were plated on d-arabinose, ribitol, and xylitol to select and identify mutations in the ribitol pathway. Using the transducing phage PW52, we were able to demonstrate genetic linkage of the loci involved. Three-point crosses, using constitutive mutants as donors and RDH?, DRK? double mutants as recipients and selecting for DRK+ transductants on d-arabinose, resulted in DRK+RDH+-constitutive, DRK+RDH+-inducible, and DRK+RDH?-inducible transductants but no detectable DRK+RDH? constitutive transductants, data consistent with the order rbtC-rbtD-rbtK, where rbtC is a control site and rbtD and rbtK correspond to the sites for the sites for the enzymes RDH and DRK, respectively. PMID:4366025

  4. Mapping the Evolution of Hypervirulent Klebsiella pneumoniae

    PubMed Central

    Roe, Chandler C.; Stegger, Marc; Stahlhut, Steen G.; Hansen, Dennis S.; Engelthaler, David M.; Andersen, Paal S.; Driebe, Elizabeth M.; Keim, Paul; Krogfelt, Karen A.

    2015-01-01

    ABSTRACT Highly invasive, community-acquired Klebsiella pneumoniae infections have recently emerged, resulting in pyogenic liver abscesses. These infections are caused by hypervirulent K. pneumoniae (hvKP) isolates primarily of capsule serotype K1 or K2. Hypervirulent K1 isolates belong to clonal complex 23 (CC23), indicating that this clonal lineage has a specific genetic background conferring hypervirulence. Here, we apply whole-genome sequencing to a collection of K. pneumoniae isolates to characterize the phylogenetic background of hvKP isolates with an emphasis on CC23. Most of the hvKP isolates belonged to CC23 and grouped into a distinct monophyletic clade, revealing that CC23 is a unique clonal lineage, clearly distinct from nonhypervirulent strains. Separate phylogenetic analyses of the CC23 isolates indicated that the CC23 lineage evolved recently by clonal expansion from a single common ancestor. Limited grouping according to geographical origin was observed, suggesting that CC23 has spread globally through multiple international transmissions. Conversely, hypervirulent K2 strains clustered in genetically unrelated groups. Strikingly, homologues of a large virulence plasmid were detected in all hvKP clonal lineages, indicating a key role in K. pneumoniae hypervirulence. The plasmid encodes two siderophores, aerobactin and salmochelin, and RmpA (regulator of the mucoid phenotype); all these factors were found to be restricted to hvKP isolates. Genomic comparisons revealed additional factors specifically associated with CC23. These included a distinct variant of a genomic island encoding yersiniabactin, colibactin, and microcin E492. Furthermore, additional novel genomic regions unique to CC23 were revealed which may also be involved in the increased virulence of this important clonal lineage. PMID:26199326

  5. Metabolism of Melamine by Klebsiella terragena

    PubMed Central

    Shelton, D. R.; Karns, J. S.; Mccarty, G. W.; Durham, D. R.

    1997-01-01

    Experiments were conducted to determine the pathway of melamine metabolism by Klebsiella terragena (strain DRS-1) and the effect of added NH(inf4)(sup+) on the rates and extent of melamine metabolism. In the absence of added NH(inf4)(sup+), 1 mM melamine was metabolized concomitantly with growth. Ammeline, ammelide, cyanuric acid, and NH(inf4)(sup+) accumulated transiently in the culture medium to maximal concentrations of 0.012 mM, 0.39 mM, trace levels, and 0.61 mM, respectively. In separate incubations, in which cells were grown on either ammeline or ammelide (in the absence of NH(inf4)(sup+)), ammeline was metabolized without a lag while ammelide metabolism was observed only after 3 h. In the presence of 6 mM added NH(inf4)(sup+) (enriched with 5% (sup15)N), ammeline, ammelide, and cyanuric acid accumulated transiently to maximal concentrations of 0.002 mM, 0.47 mM, and trace levels, respectively, indicating that the added NH(inf4)(sup+) had little effect on the relative rates of triazine metabolism. These data suggest that the primary mode of melamine metabolism by K. terragena is hydrolytic, resulting in successive deaminations of the triazine ring. Use of (sup15)N-enriched NH(inf4)(sup+) allowed estimates of rates of triazine-N mineralization and assimilation of NH(inf4)(sup+)-N versus triazine-N into biomass. A decrease in the percent (sup15)N in the external NH(inf4)(sup+) pool, in conjunction with the accumulation of ammelide and/or triazine-derived NH(inf4)(sup+) in the culture medium, suggests that the initial reactions in the melamine metabolic pathway may occur outside the cytoplasmic membrane. PMID:16535652

  6. Characterization of new biosurfactant produced by Klebsiella sp. Y6-1 isolated from waste soybean oil.

    PubMed

    Lee, Sang-Cheol; Lee, Seung-Jin; Kim, Sun-Hee; Park, In-Hye; Lee, Yong-Seok; Chung, Soo-Yeol; Choi, Yong-Lark

    2008-05-01

    To obtain predominant bacteria degrading crude oil, we isolated some bacteria from waste soybean oil. Isolated bacterial strain had a marked tributyrin (C4:0) degrading activity as developed clear zone around the colony after incubation for 24h at 37 degrees C. It was identified as Klebsiella sp. Y6-1 by analysis of 16S rRNA gene. Crude biosurfactant was extracted from the culture supernatant of Klebsiella sp. Y6-1 by organic solvent (methanol:chloroform:1-butanol) after vacuum freeze drying and the extracted biosurfactant was purified by silica gel column chromatography. When the purified biosurfactant dropped, it formed degrading zone on crude oil plate. When a constituent element of the purified biosurfactant was analyzed by TLC and SDS-PAGE, it was composed of peptides and lipid. The emulsification activity and stability of biosurfactant was measured by using hydrocarbons and crude oil. The emulsification activity and stability of the biosurfactant showed better than the chemically synthesized surfactant. It reduced the surface tension of water from 72 to 32 mN/m at a concentration of 40 mg/l. PMID:17596933

  7. The use of bacteria in conformance control - Initial studies

    SciTech Connect

    MacLeod, F.A.; Lappin-Scott, H.M.; Cusack, F.; Costerton, J.W.

    1988-05-01

    Bacteria respond to nutrient starvation by reducing in size to form ultramicrobacteria (UMB) less than 0.3 ..mu..m in diameter. Work in the authors' laboratory has established that two bacteria, Klebsiella pneumoniae and a Psuedomonas species, isolated from oilwell waters decreased in size when deprived of nutrients. Subsequent restoration of nutrients resulted in the resuscitation of the UMB and they returned to normal size. When injected into model rock cores, the UMB penetrated deeper than the full-sized bacteria. Higher counts of bacteria and carbohydrate production were found around the core inlet with the full-sized bacteria. However, the UMB were located throughout the entire core. This work demonstrates that UMB may provide a new selective plugging technique by virtue of their superior penetration properties throughout solid matrices.

  8. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Klebsiella spp. serological reagents. 866.3340 Section 866.3340 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340...

  9. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Klebsiella spp. serological reagents. 866.3340 Section 866.3340 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340...

  10. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Klebsiella spp. serological reagents. 866.3340 Section 866.3340 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340...

  11. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Klebsiella spp. serological reagents. 866.3340 Section 866.3340 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340...

  12. 21 CFR 866.3340 - Klebsiella spp. serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Klebsiella spp. serological reagents. 866.3340 Section 866.3340 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340...

  13. An outbreak of serious Klebsiella infections related to food blenders.

    PubMed

    Kiddy, K; Josse, E; Griffin, N

    1987-03-01

    An investigation, including environmental sampling, was undertaken after four leukaemic patients on the same hospital ward developed serious infections with Klebsiella aerogenes, capsular type K14. The source of this organism, common to all four patients, was found to be a food blender used for preparing milk-based drinks on the ward. PMID:2883228

  14. Invasion of cultured human epithelial cells by Klebsiella pneumoniae isolated from the urinary tract.

    PubMed Central

    Oelschlaeger, T A; Tall, B D

    1997-01-01

    The mechanisms which enable entry into cultured human epithelial cells by Klebsiella pneumoniae were compared with those of Salmonella typhi Ty2. K. pneumoniae 3091, isolated from a urine sample of a patient with a urinary tract infection, invaded human epithelial cells from the bladder and ileocecum and persisted for days in vitro. Electron microscopic studies demonstrated that K. pneumoniae was always contained in endosomes. The internalization mechanism(s) triggered by K. pneumoniae was studied by invasion assays conducted with different inhibitors that act on prokaryotic and eukaryotic cell structures and processes. Chloramphenicol inhibition of bacterial uptake revealed that bacterial de novo protein synthesis was essential for efficient invasion by K. pneumoniae and S. typhi. Interference with receptor-mediated endocytosis by g-strophanthin or monodansylcadaverine and inhibition of endosome acidification by monensin reduced the number of viable intracellular K. pneumoniae cells, but not S. typhi cells. The depolymerization of microfilaments by cytochalasin D inhibited the uptake of both bacteria. Microtubule depolymerization caused by colchicine, demecolcine, or nocodazole and the stabilization of microtubules with taxol reduced only the invasion ability of K. pneumoniae. S. typhi invasion was unaffected by microtubule depolymerization or stabilization. These data suggest that the internalization mechanism triggered by K. pneumoniae 3091 is strikingly different from the solely microfilament-dependent invasion mechanism exhibited by many of the well-studied enteric bacteria, such as enteroinvasive Escherichia coli, Salmonella, Shigella, and Yersinia strains. PMID:9199471

  15. Bioflocculant produced by Klebsiella sp. MYC and its application in the treatment of oil-field produced water

    NASA Astrophysics Data System (ADS)

    Yue, Lixi; Ma, Chunling; Chi, Zhenming

    2006-10-01

    Seventy-nine strains of bioflocculant-producing bacteria were isolated from 3 activated sludge samples. Among them, strain MYC was found to have the highest and stable flocculating rate for both kaolin clay suspension and oil-field produced water. The bacterial strain was identified as Klebsiella sp. MYC according to its morphological and biochemical characteristics and 16SrDNA sequence. The optimal medium for bioflocculant production by this bacterial strain was composed of cane sugar 20gL-1 KH2PO4 2g L-1, K2HPO45gL-1, (NH4)2SO4 0.2gL-1, urea 0.5 gL-1 and yeast extract 0.5 gL-1, the initial pH being 5.5. When the suspension of kaolin clay was treated with 0.5% of Klebsiella sp. MYC culture broth, the flocculating rate reached more than 90.0% in the presence of 500mgL1 CaCl2, while the flocculating rate for oil-field produced water was near 80.0% in a pH range of 7.0-9.0 with the separation of oil and suspended particles from the oil-field produced water under similar conditions. The environment-friendly nature of the bioflocculant and high flocculating rate of the strain make the bioflocculant produced by Klebsiella sp. MYC an attractive bioflocculant in oil-field produced water treatment.

  16. Bacteriocins as tools in analysis of nosocomial Klebsiella pneumoniae infections.

    PubMed

    Bauernfeind, A; Petermüller, C; Schneider, R

    1981-07-01

    Epidemiological analysis of isolates from nosocomial infections caused by Klebsiella pneumoniae was improved by the use of bacteriocins in addition to capsular serotyping. Screening for bacteriocins produced by 77 reference strains for capsular serotyping identified 39 strains, and 8 of these strains were selected as a typing set. Using this set, we found that 241 to 259 (91%) nonepidemic clinical isolates of K. pneumoniae were inhibited by one or more of the eight producers. Of the most frequent bacteriocin type there were 31 examples (12%). High reproducibility of typing patterns (83.3%) and easy practicability of typing were achieved with a streak-and-point method avoiding the use of suspensions of bacteriocins and the risk of instability. The Klebsiella bacteriocins were active also on Enterobacter and Shigella species and on Escherichia coli strains, but were ineffective on other Enterobacteriacae. PMID:6790566

  17. Seroepidemiology of Klebsiella bacteremic isolates and implications for vaccine development.

    PubMed Central

    Cryz, S J; Mortimer, P M; Mansfield, V; Germanier, R

    1986-01-01

    The frequencies of capsular serotypes among 703 Klebsiella strains isolated from the blood of hospitalized patients were determined. More than 90% of the isolates were typeable, with 69 of the 77 known serotypes being identified. Serotypes 2, 21, and 55, representing 8.9, 7.8, and 4.8% of all the isolates, respectively, were observed at a frequency significantly higher (P less than 0.05) than that for other capsular serotypes. Approximately 43% of the serotypes appeared at a frequency of less than 0.5%. Differences were found when the seroepidemiology of North American and European isolates was compared. The current findings indicate that a capsular polysaccharide-based vaccine against Klebsiella organisms is feasible and should be multivalent, eliciting antibodies directed against the 25 serotypes which make up approximately 70% of all the bacteremic isolates. PMID:3517058

  18. Draft Genome Sequences of Klebsiella variicola Plant Isolates

    PubMed Central

    Martínez-Romero, Esperanza; Silva-Sanchez, Jesús; Barrios, Humberto; Rodríguez-Medina, Nadia; Martínez-Barnetche, Jesús; Téllez-Sosa, Juan; Gómez-Barreto, Rosa Elena

    2015-01-01

    Three endophytic Klebsiella variicola isolates—T29A, 3, and 6A2, obtained from sugar cane stem, maize shoots, and banana leaves, respectively—were used for whole-genome sequencing. Here, we report the draft genome sequences of circular chromosomes and plasmids. The genomes contain plant colonization and cellulases genes. This study will help toward understanding the genomic basis of K. variicola interaction with plant hosts. PMID:26358599

  19. Methanotrophic bacteria.

    PubMed Central

    Hanson, R S; Hanson, T E

    1996-01-01

    Methane-utilizing bacteria (methanotrophs) are a diverse group of gram-negative bacteria that are related to other members of the Proteobacteria. These bacteria are classified into three groups based on the pathways used for assimilation of formaldehyde, the major source of cell carbon, and other physiological and morphological features. The type I and type X methanotrophs are found within the gamma subdivision of the Proteobacteria and employ the ribulose monophosphate pathway for formaldehyde assimilation, whereas type II methanotrophs, which employ the serine pathway for formaldehyde assimilation, form a coherent cluster within the beta subdivision of the Proteobacteria. Methanotrophic bacteria are ubiquitous. The growth of type II bacteria appears to be favored in environments that contain relatively high levels of methane, low levels of dissolved oxygen, and limiting concentrations of combined nitrogen and/or copper. Type I methanotrophs appear to be dominant in environments in which methane is limiting and combined nitrogen and copper levels are relatively high. These bacteria serve as biofilters for the oxidation of methane produced in anaerobic environments, and when oxygen is present in soils, atmospheric methane is oxidized. Their activities in nature are greatly influenced by agricultural practices and other human activities. Recent evidence indicates that naturally occurring, uncultured methanotrophs represent new genera. Methanotrophs that are capable of oxidizing methane at atmospheric levels exhibit methane oxidation kinetics different from those of methanotrophs available in pure cultures. A limited number of methanotrophs have the genetic capacity to synthesize a soluble methane monooxygenase which catalyzes the rapid oxidation of environmental pollutants including trichloroethylene. PMID:8801441

  20. Molecular diversity and genetic organization of antibiotic resistance in Klebsiella species 

    E-print Network

    Younes, Abd El-Gayed Metwaly

    2011-06-27

    Klebsiella spp. are opportunistic pathogens that cause hospital and community acquired infections such as pneumonia, urinary tract infection, septicaemia, soft tissue infections, liver abscess, and meningitis. ...

  1. Ankylosing spondylitis, HLA-B27, and Klebsiella: a study of lymphocyte reactivity of anti-Klebsiella sera.

    PubMed Central

    Singh, B; Milton, J D; Woodrow, J C

    1986-01-01

    Twenty three anti-Klebsiella antisera were tested for their cytotoxic activity and four for their binding capacity for peripheral blood lymphocytes (PBL) from patients with HLA-B27 positive ankylosing spondylitis (AS+B27+) and from B27 positive (AS-B27+) and B27 negative (AS-B27-) healthy individuals. None of the antisera showed specific activity against PBL from any particular group. The antisera tested included two anti-Klebsiella K43 sera provided by an Australian group, who have reported them to be specifically cytotoxic for AS+B27+ PBL, four antisera raised against a Klebsiella K43 strain provided by this group, and an antiserum from another group, who have reported it as having increased binding capacity for AS+B27+ and AS-B27+ PBL compared with AS-B27- PBL. The results of other workers who have attempted to reproduce the results of either group are reviewed and the possible reasons for the repeated failure to confirm the reported findings are discussed. PMID:3485408

  2. CTX-M-Type Extended-Spectrum ?-Lactamase-Producing Klebsiella pneumoniae Isolated from Cases of Bovine Mastitis in Japan

    PubMed Central

    SAISHU, Nobukazu; OZAKI, Hiroichi; MURASE, Toshiyuki

    2014-01-01

    ABSTRACT Three Klebsiella pneumoniae isolates producing extended-spectrum beta-lactamase (ESBL) were obtained from three dairy cows with clinical mastitis in two farms in western Japan. Two of the 3 isolates from cows in different farms were able to transfer plasmids carrying the blaCTX-M-2 gene to Escherichia coli recipient. Pulsed-field gel electrophoresis (PFGE) patterns of the 2 isolates were different from each other, although restricted-fragment patterns of the two conjugative plasmids were similar to each other. Additionally, PCR-based replicon typing revealed that both the plasmids belonged to type Inc.T. These results suggest that ESBL-encoding genes can be distributed in bacteria on dairy farms through the plasmids. PMID:24784438

  3. A new laboratory cultivation of Paramecium bursaria using non-pathogenic bacteria strains.

    PubMed

    Bator, Tomasz

    2010-01-01

    In most studies dealing with the laboratory cultivation of paramecia (Paramecium bursaria), Klebsiella pneumoniae bacteria are used to inoculate the medium. However, Klebsiella pneumoniae is a typical pathogen, and its use is always associated with a risk of infection. The aim of the present research was to examine non-pathogenic bacteria strains as components of the medium for Paramecium bursaria. The paramecia were incubated on lettuce infusions bacterized with different bacteria strains: Bacillus subtilis DSM 10, Bacillus megaterium DSM 32, Escherichia coli DSM 498, Micrococcus luteus DSM 348. A strain derived from the natural habitat of Paramecium bursaria was used as the control one. Experiments were conducted under constant light and in the dark. Paramecia cells were counted under a stereomicroscope on consecutive days of incubation. The obtained results show that the most intensive growth of Paramecium bursaria occurs in the presence of Escherichia coli DSM 498. The use of this strain as a component of the medium allows one to obtain a high number of ciliates regardless of the light conditions. It can be concluded that the Paramecium bursaria cultivation procedure can be modified by using the non-pathogenic bacteria strain Escherichia coli DSM 498 instead of Klebsiella pneumoniae. PMID:20737917

  4. Endocarditis Due to Rare and Fastidious Bacteria

    PubMed Central

    Brouqui, P.; Raoult, D.

    2001-01-01

    The etiologic diagnosis of infective endocarditis is easily made in the presence of continuous bacteremia with gram-positive cocci. However, the blood culture may contain a bacterium rarely associated with endocarditis, such as Lactobacillus spp., Klebsiella spp., or nontoxigenic Corynebacterium, Salmonella, Gemella, Campylobacter, Aeromonas, Yersinia, Nocardia, Pasteurella, Listeria, or Erysipelothrix spp., that requires further investigation to establish the relationship with endocarditis, or the blood culture may be uninformative despite a supportive clinical evaluation. In the latter case, the etiologic agents are either fastidious extracellular or intracellular bacteria. Fastidious extracellular bacteria such as Abiotrophia, HACEK group bacteria, Clostridium, Brucella, Legionella, Mycobacterium, and Bartonella spp. need supplemented media, prolonged incubation time, and special culture conditions. Intracellular bacteria such as Coxiella burnetii cannot be isolated routinely. The two most prevalent etiologic agents of culture-negative endocarditis are C. burnetti and Bartonella spp. Their diagnosis is usually carried out serologically. A systemic pathologic examination of excised heart valves including periodic acid-Schiff (PAS) staining and molecular methods has allowed the identification of Whipple's bacillus endocarditis. Pathologic examination of the valve using special staining, such as Warthin-Starry, Gimenez, and PAS, and broad-spectrum PCR should be performed systematically when no etiologic diagnosis is evident through routine laboratory evaluation. PMID:11148009

  5. Antibiofilm efficacy of silver nanoparticles against biofilm of extended spectrum ?-lactamase isolates of Escherichia coli and Klebsiella pneumoniae

    NASA Astrophysics Data System (ADS)

    Ansari, Mohammad Azam; Khan, Haris M.; Khan, Aijaz A.; Cameotra, Swaranjit Singh; Pal, Ruchita

    2014-10-01

    The ability of bacteria to develop antibiotic resistance and colonize abiotic surfaces by forming biofilms is a major cause of medical implant-associated infections and results in prolonged hospitalization periods and patient mortality. Different approaches have been used for preventing biofilm-related infections in health care settings. Many of these methods have their own demerits that include chemical-based complications; emergent antibiotic-resistant strains, and so on. Silver nanoparticles (AgNPs) are renowned for their influential antimicrobial activity. We demonstrate the biofilm formation by extended spectrum ?-lactamases-producing Escherichia coli and Klebsiella spp. by direct visualization applying tissue culture plate, tube, and Congo red agar methods. Double fluorescent staining for confocal laser scanning microscopy (CLSM) consisted of propidium iodide staining to detect bacterial cells and concanavalin A-fluorescein isothiocyanate staining to detect the exopolysaccharides matrix were used. Scanning electron microscopy observations clearly indicate that AgNPs reduced the surface coverage by E. coli and Klebsiella spp. thus prevent the biofilm formations. Double-staining technique using CLSM provides the visual evidence that AgNPs arrested the bacterial growth and prevent the exopolysaccharides formation. The AgNPs-coated surfaces effectively restricted biofilm formation of the tested bacteria. In our study, we could demonstrate the complete antibiofilm activity AgNPs at a concentration as low as 50 ?g/ml. Our findings suggested that AgNPs can be exploited towards the development of potential antibacterial coatings for various biomedical and environmental applications. These formulations can be used for the treatment of drug-resistant bacterial infections caused by biofilms, at much lower nanosilver loading with higher efficiency.

  6. First Report of Klebsiella pneumoniae-Carbapenemase-3-Producing Escherichia coli ST479 in Poland

    PubMed Central

    Ojdana, Dominika; Sacha, Pawe?; Olsza?ska, Dorota; Majewski, Piotr; Wieczorek, Piotr; Jaworowska, Jadwiga; Sie?ko, Anna; Jurczak, Anna; Tryniszewska, El?bieta

    2015-01-01

    An increase in the antibiotic resistance among members of the Enterobacteriaceae family has been observed worldwide. Multidrug-resistant Gram-negative rods are increasingly reported. The treatment of infections caused by Escherichia coli and other Enterobacteriaceae has become an important clinical problem associated with reduced therapeutic possibilities. Antimicrobial carbapenems are considered the last line of defense against multidrug-resistant Gram-negative bacteria. Unfortunately, an increase of carbapenem resistance due to the production of Klebsiella pneumoniae carbapenemase (KPC) enzymes has been observed. In this study we describe the ability of E. coli to produce carbapenemase enzymes based on the results of the combination disc assay with boronic acid performed according to guidelines established by the European Community on Antimicrobial Susceptibility Testing (EUCAST) and the biochemical Carba NP test. Moreover, we evaluated the presence of genes responsible for the production of carbapenemases (blaKPC, blaVIM, blaIMP, blaOXA-48) and genes encoding other ?-lactamases (blaSHV, blaTEM, blaCTX-M) among E. coli isolate. The tested isolate of E. coli that possessed the blaKPC-3 and blaTEM-34 genes was identified. The tested strain exhibited susceptibility to colistin (0.38??g/mL) and tigecycline (1??g/mL). This is the first detection of blaKPC-3 in an E. coli ST479 in Poland. PMID:26339599

  7. Preliminary investigation of a mice model of Klebsiella pneumoniae subsp. ozaenae induced pneumonia.

    PubMed

    Renois, Fanny; Jacques, Jérôme; Guillard, Thomas; Moret, Hélène; Pluot, Michel; Andreoletti, Laurent; de Champs, Christophe

    2011-11-01

    In the present study, we comparatively assessed the pathophysiological mechanisms developed during lung infection of BALB/C female mice infected by an original wild type Klebsiella pneumoniae subsp. ozaenae strain (CH137) or by a referent subspecies K. pneumoniae. subsp. pneumoniae strain (ATCC10031). The mice infected with 2.10? CFU K. p. subsp. pneumoniae (n = 10) showed transient signs of infection and all of them recovered. All of those infected with 1.10? CFU K. p. subsp. ozaenae (n = 10) developed pneumonia within 24 h and died between 48 and 72 h. Few macrophages, numerous polymorphonuclear cells and lymphocytes were observed in their lungs in opposite to K. p. subsp. pneumoniae. In bronchoalveolar lavage, a significant increase in MIP-2, IL-6, KC and MCP-1 levels was only observed in K. p. subsp. ozaenae infected mice whereas high levels of TNF-? were evidenced with the two subspecies. Our findings indicated a lethal effect of a wild type K. p. subsp. ozaenae strain by acute pneumonia reflecting an insufficient alveolar macrophage response. This model might be of a major interest to comparatively explore the pathogenicity of K. p. subsp ozaenae strains and to further explore the physiopathological mechanisms of gram-negative bacteria induced human pneumonia. PMID:21723409

  8. Klebsiella pneumoniae subsp. pneumoniae–bacteriophage combination from the caecal effluent of a healthy woman

    PubMed Central

    Neve, Horst; Heller, Knut J.; Turton, Jane F.; Mahony, Jennifer; Sanderson, Jeremy D.; Hudspith, Barry; Gibson, Glenn R.; McCartney, Anne L.

    2015-01-01

    A sample of caecal effluent was obtained from a female patient who had undergone a routine colonoscopic examination. Bacteria were isolated anaerobically from the sample, and screened against the remaining filtered caecal effluent in an attempt to isolate bacteriophages (phages). A lytic phage, named KLPN1, was isolated on a strain identified as Klebsiella pneumoniae subsp. pneumoniae (capsular type K2, rmpA+). This Siphoviridae phage presents a rosette-like tail tip and exhibits depolymerase activity, as demonstrated by the formation of plaque-surrounding haloes that increased in size over the course of incubation. When screened against a panel of clinical isolates of K. pneumoniae subsp. pneumoniae, phage KLPN1 was shown to infect and lyse capsular type K2 strains, though it did not exhibit depolymerase activity on such hosts. The genome of KLPN1 was determined to be 49,037 bp (50.53 %GC) in length, encompassing 73 predicted ORFs, of which 23 represented genes associated with structure, host recognition, packaging, DNA replication and cell lysis. On the basis of sequence analyses, phages KLPN1 (GenBank: KR262148) and 1513 (a member of the family Siphoviridae, GenBank: KP658157) were found to be two new members of the genus “Kp36likevirus.” PMID:26246963

  9. Emergence of Klebsiella pneumoniae clinical isolates producing KPC-2 carbapenemase in Cuba

    PubMed Central

    Quiñones, D; Hart, M; Espinosa, F; Garcia, S; Carmona, Y; Ghosh, S; Urushibara, N; Kawaguchiya, M; Kobayashi, N

    2014-01-01

    The emergence of Klebsiella pneumoniae producing carbapenemase (KPC) has now become a global concern. As a part of a nationwide multicentre surveillance study in Cuba, three K. pneumoniae clinical isolates resistant to carbapenems were detected for a 1-month period (September to October 2011). PCR and sequence analysis revealed that the three strains harboured blaKPC-2. They showed resistance or intermediate susceptibility to expanded-spectrum cephalosporins, other ?-lactams, a ?-lactam/?-lactamase inhibitor combination, and gentamicin. Two strains were susceptible only to colistin, whereas the other strain showing colistin resistance was susceptible to fluoroquinolones. These blaKPC-2-positive K. pneumoniae strains were classified into ST1271 (CC29), a novel clone harbouring blaKPC-2, and were revealed to be genetically identical by PCR-based DNA fingerprinting. The three patients infected with the KPC-producing K. pneumoniae had common risk factors, and had no overseas travel experience outside Cuba, suggesting local acquisition of the resistant pathogen. This is the first report of a KPC-producing K. pneumoniae in Cuba. Although detection of KPC in Enterobacteriaceae is still rare in Cuba, our finding indicated that KPC-producing bacteria are a global concern and highlighted the need to identify these microorganisms in clinical laboratories. PMID:25356357

  10. Klebsiella pneumoniae subsp. pneumoniae-bacteriophage combination from the caecal effluent of a healthy woman.

    PubMed

    Hoyles, Lesley; Murphy, James; Neve, Horst; Heller, Knut J; Turton, Jane F; Mahony, Jennifer; Sanderson, Jeremy D; Hudspith, Barry; Gibson, Glenn R; McCartney, Anne L; van Sinderen, Douwe

    2015-01-01

    A sample of caecal effluent was obtained from a female patient who had undergone a routine colonoscopic examination. Bacteria were isolated anaerobically from the sample, and screened against the remaining filtered caecal effluent in an attempt to isolate bacteriophages (phages). A lytic phage, named KLPN1, was isolated on a strain identified as Klebsiella pneumoniae subsp. pneumoniae (capsular type K2, rmpA (+)). This Siphoviridae phage presents a rosette-like tail tip and exhibits depolymerase activity, as demonstrated by the formation of plaque-surrounding haloes that increased in size over the course of incubation. When screened against a panel of clinical isolates of K. pneumoniae subsp. pneumoniae, phage KLPN1 was shown to infect and lyse capsular type K2 strains, though it did not exhibit depolymerase activity on such hosts. The genome of KLPN1 was determined to be 49,037 bp (50.53 %GC) in length, encompassing 73 predicted ORFs, of which 23 represented genes associated with structure, host recognition, packaging, DNA replication and cell lysis. On the basis of sequence analyses, phages KLPN1 (GenBank: KR262148) and 1513 (a member of the family Siphoviridae, GenBank: KP658157) were found to be two new members of the genus "Kp36likevirus." PMID:26246963

  11. Bacteria Counter

    NASA Technical Reports Server (NTRS)

    1981-01-01

    Science Applications, Inc.'s ATP Photometer makes a rapid and accurate count of the bacteria in a body fluid sample. Instrument provides information on the presence and quantity of bacteria by measuring the amount of light emitted by the reaction between two substances. Substances are ATP adenosine triphosphate and luciferase. The reactants are applied to a human body sample and the ATP Photometer observes the intensity of the light emitted displaying its findings in a numerical output. Total time lapse is usually less than 10 minutes, which represents a significant time savings in comparison of other techniques. Other applications are measuring organisms in fresh and ocean waters, determining bacterial contamination of foodstuffs, biological process control in the beverage industry, and in assay of activated sewage sludge.

  12. Enumeration of potentially pathogenic bacteria from sewage sludges.

    PubMed Central

    Dudley, D J; Guentzel, M N; Ibarra, M J; Moore, B E; Sagik, B P

    1980-01-01

    To ascertain the health risks that may be posed by the land application of sewage sludges, a scheme was devised to determine the types and numbers of pathogenic and potentially pathogenic bacteria present in sludges. A processing treatment was adapted to sludge to give a homogenate which yielded the greatest numbers of viable bacteria. Conventional methods were successful in enumerating Klebsiella, Staphylococcus, gram-negative enteric bacteria, and commonly used indicator organisms. Modifications of conventional methods improved the enumeration of Salmonella, Mycobacterium sp., fluorescent Pseudomonas sp., and Clostridium perfringens. However, Shigella methodology yielded only one isolate. Utilizing the proposed scheme, the population densities of these organisms were estimated in three domestic wastewater sludges. In light of these results, the potential impact of land application of sewage sludges is discussed. PMID:6243900

  13. Citrate uptake in membrane vesicles of Klebsiella aerogenes.

    PubMed Central

    Johnson, C L; Cha, Y A; Stern, J R

    1975-01-01

    In whole cells of Klebsiella aerogenes grown anaerobically on citrate as sole carbon source, citrate uptake is followed by rapid catabolism of the substrate via the inducible citrate fermentation pathway. Membrane vesicles prepared from such cells take up citrate but do not catabolize it. Vesicles process d-lactate dehydrogenase and the Na+-requiring oxalacetate decarboxylase. Citrate is taken up in the presence of Na+, and other monovalent cations, such as NH4+, Rb+, Cs+, or K+, do not substitute for Na+. Li+ appears to act synergistically with Na+. Citrate uptake is inhibited by N-2, cyanide, azide, sulfhydryl reagents, dinitrophenol, fluorcitrate, and hydroxycitrate. PMID:1112775

  14. Modulation of respiratory dendritic cells during Klebsiella pneumonia infection

    PubMed Central

    2013-01-01

    Background Klebsiella pneumoniae is a leading cause of severe hospital-acquired respiratory tract infections and death but little is known regarding the modulation of respiratory dendritic cell (DC) subsets. Plasmacytoid DC (pDC) are specialized type 1 interferon producing cells and considered to be classical mediators of antiviral immunity. Method By using multiparameter flow cytometry analysis we have analysed the modulation of respiratory DC subsets after intratracheal Klebsiella pneumonia infection. Results Data indicate that pDCs and MoDC were markedly elevated in the post acute pneumonia phase when compared to mock-infected controls. Analysis of draining mediastinal lymph nodes revealed a rapid increase of activated CD103+ DC, CD11b+ DC and MoDC within 48 h post infection. Lung pDC identification during bacterial pneumonia was confirmed by extended phenotyping for 120G8, mPDCA-1 and Siglec-H expression and by demonstration of high Interferon-alpha producing capacity after cell sorting. Cytokine expression analysis of ex vivo-sorted respiratory DC subpopulations from infected animals revealed elevated Interferon-alpha in pDC, elevated IFN-gamma, IL-4 and IL-13 in CD103+ DC and IL-19 and IL-12p35 in CD11b+ DC subsets in comparison to CD11c+ MHC-class IIlow cells indicating distinct functional roles. Antigen-specific naive CD4+ T cell stimulatory capacity of purified respiratory DC subsets was analysed in a model system with purified ovalbumin T cell receptor transgenic naive CD4+ responder T cells and respiratory DC subsets, pulsed with ovalbumin and matured with Klebsiella pneumoniae lysate. CD103+ DC and CD11b+ DC subsets represented the most potent naive CD4+ T helper cell activators. Conclusion These results provide novel insight into the activation of respiratory DC subsets during Klebsiella pneumonia infection. The detection of increased respiratory pDC numbers in bacterial pneumonia may indicate possible novel pDC functions with respect to lung repair and regeneration. PMID:24044871

  15. Chemical composition and antibacterial activity of Lavandula coronopifolia essential oil against antibiotic-resistant bacteria.

    PubMed

    Ait Said, L; Zahlane, K; Ghalbane, I; El Messoussi, S; Romane, A; Cavaleiro, C; Salgueiro, L

    2015-01-01

    The aim of this study was to analyse the composition of the essential oil (EO) of Lavandula coronopifolia from Morocco and to evaluate its in vitro antibacterial activity against antibiotic-resistant bacteria isolated from clinical infections. The antimicrobial activity was assessed by a broth micro-well dilution method using multiresistant clinical isolates of 11 pathogenic bacteria: Klebsiella pneumoniae subsp. pneumoniae, Klebsiella ornithinolytica, Escherichia coli, Enterobacter cloacae, Enterobacter aerogenes, Providencia rettgeri, Citrobacter freundii, Hafnia alvei, Salmonella spp., Acinetobacter baumannii and methicillin-resistant Staphylococcus aureus. The main compounds of the oil were carvacrol (48.9%), E-caryophyllene (10.8%) and caryophyllene oxide (7.7%). The oil showed activity against all tested strains with minimal inhibitory concentration (MIC) values ranging between 1% and 4%. For most of the strains, the MIC value was equivalent to the minimal bactericidal concentration value, indicating a clear bactericidal effect of L. coronopifolia EO. PMID:25174508

  16. Molecular Epidemiology of Two Klebsiella pneumoniae Mastitis Outbreaks on a Dairy Farm in New York State?

    PubMed Central

    Munoz, Marcos A.; Welcome, Francis L.; Schukken, Ynte H.; Zadoks, Ruth N.

    2007-01-01

    Klebsiella spp. have become an important cause of clinical mastitis in dairy cows in New York State. We describe the occurrence of two Klebsiella mastitis outbreaks on a single dairy farm. Klebsiella isolates from milk, feces, and environmental sources were compared using random amplified polymorphic DNA (RAPD)-PCR typing. The first mastitis outbreak was caused by a single strain of Klebsiella pneumoniae, RAPD type A, which was detected in milk from eight cows. RAPD type A was also isolated from the rubber liners of milking machine units after milking of infected cows and from bedding in the outbreak pen. Predominance of a single strain could indicate contagious transmission of the organism or exposure of multiple cows to an environmental point source. No new cases with RAPD type A were observed after implementation of intervention measures that targeted the prevention of transmission via the milking machine as well as improvement of environmental hygiene. A second outbreak of Klebsiella mastitis that occurred several weeks later was caused by multiple RAPD types, which rules out contagious transmission and indicates opportunistic infections originating from the environment. The diversity of Klebsiella strains as quantified with Simpson's index of discrimination was significantly higher for isolates from fecal, feed, and water samples than for isolates from milk samples. Several isolates from bedding material that had the phenotypic appearance of Klebsiella spp. were identified as being Raoultella planticola and Raoultella terrigena based on rpoB sequencing. PMID:17928424

  17. Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences

    PubMed Central

    Motalleb, Gholamreza

    2014-01-01

    Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism’s transcriptome is related to its cellular proteome. PMID:24551820

  18. Characterization of RarA, a Novel AraC Family Multidrug Resistance Regulator in Klebsiella pneumoniae

    PubMed Central

    Veleba, Mark; Higgins, Paul G.; Gonzalez, Gerardo; Seifert, Harald

    2012-01-01

    Transcriptional regulators, such as SoxS, RamA, MarA, and Rob, which upregulate the AcrAB efflux pump, have been shown to be associated with multidrug resistance in clinically relevant Gram-negative bacteria. In addition to the multidrug resistance phenotype, these regulators have also been shown to play a role in the cellular metabolism and possibly the virulence potential of microbial cells. As such, the increased expression of these proteins is likely to cause pleiotropic phenotypes. Klebsiella pneumoniae is a major nosocomial pathogen which can express the SoxS, MarA, Rob, and RamA proteins, and the accompanying paper shows that the increased transcription of ramA is associated with tigecycline resistance (M. Veleba and T. Schneiders, Antimicrob. Agents Chemother. 56:4466–4467, 2012). Bioinformatic analyses of the available Klebsiella genome sequences show that an additional AraC-type regulator is encoded chromosomally. In this work, we characterize this novel AraC-type regulator, hereby called RarA (Regulator of antibiotic resistance A), which is encoded in K. pneumoniae, Enterobacter sp. 638, Serratia proteamaculans 568, and Enterobacter cloacae. We show that the overexpression of rarA results in a multidrug resistance phenotype which requires a functional AcrAB efflux pump but is independent of the other AraC regulators. Quantitative real-time PCR experiments show that rarA (MGH 78578 KPN_02968) and its neighboring efflux pump operon oqxAB (KPN_02969_02970) are consistently upregulated in clinical isolates collected from various geographical locations (Chile, Turkey, and Germany). Our results suggest that rarA overexpression upregulates the oqxAB efflux pump. Additionally, it appears that oqxR, encoding a GntR-type regulator adjacent to the oqxAB operon, is able to downregulate the expression of the oqxAB efflux pump, where OqxR complementation resulted in reductions to olaquindox MICs. PMID:22644028

  19. Risk Factors for the First Episode of Klebsiella pneumoniae Resistant to Carbapenems Infection in Critically Ill Patients: A Prospective Study

    PubMed Central

    Mantzarlis, Konstantinos; Makris, Demosthenes; Manoulakas, Efstratios; Karvouniaris, Marios; Zakynthinos, Epaminondas

    2013-01-01

    Objective. To identify risk factors for the first episode of Klebsiella Pneumonia resistant to carbapenems (KPRC) infection in critically ill patients. Design, Setting, and Methods. This prospective cohort study was conducted in a 12-bed general Intensive Care Unit (ICU) in a University Hospital on ICU patients who required mechanical ventilation (MV) for >48 hours during a 12-month period. Clinical and microbiologic data were studied. Characteristics of KPRC patients were compared with those of critically ill patients who presented nonmultidrug resistant (MDR) bacterial infections or no documented infection at all. Results. Twenty-five patients presented KPRC infection, 18 presented non-MDR bacterial infection, and 39 patients presented no infection. Compared to patients without documented infection or infected by non MDR bacteria, patients with KPRC infection had received more frequently or for longer duration antibiotics against Gram-negative bacteria (carbapenems, colistin P < 0.05). Duration of colistin administration prior to KPRC isolation was independently associated with increased frequency of KPRC infection (odds ratio, 1.156 per day; 95% confidence interval, 1.010 to 1.312; P = 0.025). KPRC patients stayed longer in the ICU and received mechanical ventilation and sedation for longer periods and presented increased mortality (P < 0.05). Conclusion. KPRC infection is an emerging problem which might be more common in patients with previous use of antibiotics and especially colistin. PMID:24455733

  20. Distinct but Spatially Overlapping Intestinal Niches for Vancomycin-Resistant Enterococcus faecium and Carbapenem-Resistant Klebsiella pneumoniae

    PubMed Central

    Caballero, Silvia; Carter, Rebecca; Ke, Xu; Sušac, Bože; Leiner, Ingrid M.; Kim, Grace J.; Miller, Liza; Ling, Lilan; Manova, Katia; Pamer, Eric G.

    2015-01-01

    Antibiotic resistance among enterococci and ?-proteobacteria is an increasing problem in healthcare settings. Dense colonization of the gut by antibiotic-resistant bacteria facilitates their spread between patients and also leads to bloodstream and other systemic infections. Antibiotic-mediated destruction of the intestinal microbiota and consequent loss of colonization resistance are critical factors leading to persistence and spread of antibiotic-resistant bacteria. The mechanisms underlying microbiota-mediated colonization resistance remain incompletely defined and are likely distinct for different antibiotic-resistant bacterial species. It is unclear whether enterococci or ?-proteobacteria, upon expanding to high density in the gut, confer colonization resistance against competing bacterial species. Herein, we demonstrate that dense intestinal colonization with vancomycin-resistant Enterococcus faecium (VRE) does not reduce in vivo growth of carbapenem-resistant Klebsiella pneumoniae. Reciprocally, K. pneumoniae does not impair intestinal colonization by VRE. In contrast, transplantation of a diverse fecal microbiota eliminates both VRE and K. pneumoniae from the gut. Fluorescence in situ hybridization demonstrates that VRE and K. pneumoniae localize to the same regions in the colon but differ with respect to stimulation and invasion of the colonic mucus layer. While VRE and K. pneumoniae occupy the same three-dimensional space within the gut lumen, their independent growth and persistence in the gut suggests that they reside in distinct niches that satisfy their specific in vivo metabolic needs. PMID:26334306

  1. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria

    PubMed Central

    Olaitan, Abiola O.; Morand, Serge; Rolain, Jean-Marc

    2014-01-01

    Polymyxins are polycationic antimicrobial peptides that are currently the last-resort antibiotics for the treatment of multidrug-resistant, Gram-negative bacterial infections. The reintroduction of polymyxins for antimicrobial therapy has been followed by an increase in reports of resistance among Gram-negative bacteria. Some bacteria, such as Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii, develop resistance to polymyxins in a process referred to as acquired resistance, whereas other bacteria, such as Proteus spp., Serratia spp., and Burkholderia spp., are naturally resistant to these drugs. Reports of polymyxin resistance in clinical isolates have recently increased, including acquired and intrinsically resistant pathogens. This increase is considered a serious issue, prompting concern due to the low number of currently available effective antibiotics. This review summarizes current knowledge concerning the different strategies bacteria employ to resist the activities of polymyxins. Gram-negative bacteria employ several strategies to protect themselves from polymyxin antibiotics (polymyxin B and colistin), including a variety of lipopolysaccharide (LPS) modifications, such as modifications of lipid A with phosphoethanolamine and 4-amino-4-deoxy-L-arabinose, in addition to the use of efflux pumps, the formation of capsules and overexpression of the outer membrane protein OprH, which are all effectively regulated at the molecular level. The increased understanding of these mechanisms is extremely vital and timely to facilitate studies of antimicrobial peptides and find new potential drugs targeting clinically relevant Gram-negative bacteria. PMID:25505462

  2. Molybdenum accumulation and storage in Klebsiella pneumoniae and Azotobacter vinelandii.

    PubMed Central

    Pienkos, P T; Brill, W J

    1981-01-01

    In Klebsiella pneumoniae, Mo accumulation appeared to be coregulated with nitrogenase synthesis. O2 and NH+4, which repressed nitrogenase synthesis, also prevented Mo accumulation. In Azotobacter vinelandii, Mo accumulation did not appear to be regulated Mo was accumulated to levels much higher than those seen in K. pneumoniae even when nitrogenase synthesis was repressed. Accumulated Mo was bound mainly to a Mo storage protein, and it could act as a supply for the Mo needed in component I synthesis when extracellular Mo had been exhausted. When A. vinelandii was grown in the presence of WO2-(4) rather than MoO2-(4), it synthesized a W-containing analog of the Mo storage protein. The Mo storage protein was purified from both NH+4 and N2-grown cells of A. vinelandii and found to be a tetramer of two pairs of different subunits binding a minimum of 15 atoms of Mo per tetramer. Images PMID:7007348

  3. Stepwise evolution of pandrug-resistance in Klebsiella pneumoniae.

    PubMed

    Zowawi, Hosam M; Forde, Brian M; Alfaresi, Mubarak; Alzarouni, Abdulqadir; Farahat, Yasser; Chong, Teik-Min; Yin, Wai-Fong; Chan, Kok-Gan; Li, Jian; Schembri, Mark A; Beatson, Scott A; Paterson, David L

    2015-01-01

    Carbapenem resistant Enterobacteriaceae (CRE) pose an urgent risk to global human health. CRE that are non-susceptible to all commercially available antibiotics threaten to return us to the pre-antibiotic era. Using Single Molecule Real Time (SMRT) sequencing we determined the complete genome of a pandrug-resistant Klebsiella pneumoniae isolate, representing the first complete genome sequence of CRE resistant to all commercially available antibiotics. The precise location of acquired antibiotic resistance elements, including mobile elements carrying genes for the OXA-181 carbapenemase, were defined. Intriguingly, we identified three chromosomal copies of an ISEcp1-blaOXA-181 mobile element, one of which has disrupted the mgrB regulatory gene, accounting for resistance to colistin. Our findings provide the first description of pandrug-resistant CRE at the genomic level, and reveal the critical role of mobile resistance elements in accelerating the emergence of resistance to other last resort antibiotics. PMID:26478520

  4. Stepwise evolution of pandrug-resistance in Klebsiella pneumoniae

    PubMed Central

    Zowawi, Hosam M.; Forde, Brian M.; Alfaresi, Mubarak; Alzarouni, Abdulqadir; Farahat, Yasser; Chong, Teik-Min; Yin, Wai-Fong; Chan, Kok-Gan; Li, Jian; Schembri, Mark A.; Beatson, Scott A.; Paterson, David L.

    2015-01-01

    Carbapenem resistant Enterobacteriaceae (CRE) pose an urgent risk to global human health. CRE that are non-susceptible to all commercially available antibiotics threaten to return us to the pre-antibiotic era. Using Single Molecule Real Time (SMRT) sequencing we determined the complete genome of a pandrug-resistant Klebsiella pneumoniae isolate, representing the first complete genome sequence of CRE resistant to all commercially available antibiotics. The precise location of acquired antibiotic resistance elements, including mobile elements carrying genes for the OXA-181 carbapenemase, were defined. Intriguingly, we identified three chromosomal copies of an ISEcp1-blaOXA-181 mobile element, one of which has disrupted the mgrB regulatory gene, accounting for resistance to colistin. Our findings provide the first description of pandrug-resistant CRE at the genomic level, and reveal the critical role of mobile resistance elements in accelerating the emergence of resistance to other last resort antibiotics. PMID:26478520

  5. Phagocytic and chemiluminescent responses of mouse peritoneal macrophages to living and killed Salmonella typhimurium and other bacteria

    SciTech Connect

    Tomita, T.; Blumenstock, E.; Kanegasaki, S.

    1981-06-01

    In the presence of luminol, resident as well as thioglycolate-induced and immunized macrophages emitted chemiluminescence more efficiently when the cells were exposed to living Salmonella typhimurium than when they were exposed to the same bacterium killed by ultraviolet light or heat. This phenomenon was observed whether or not the bacterium was opsonized. The different response to living and killed bacteria was also found with Escherichia coli, Pseudomonas aeruginosa, Proteus morganii, and Enterobacter aerogenes, but not with Shigella sonnei, Klebsiella pneumoniae, and Propionibacterium acnes. The results suggest that macrophages respond better to living, motile bacteria than to nonmotile or killed bacteria. The experimental results obtained with motility mutants of S. typhimurium, E. coli, and P. aeruginosa confirm that macrophages exposed to the motile bacteria emit chemiluminescence more efficiently and ingest the motile bacteria at a much faster rate than the nonmotile bacteria.

  6. Identification of Outer Membrane and Exoproteins of Carbapenem-Resistant Multilocus Sequence Type 258 Klebsiella pneumoniae

    PubMed Central

    Brinkworth, Amanda J.; Hammer, Carl H.; Olano, L. Renee; Kobayashi, Scott D.; Chen, Liang; Kreiswirth, Barry N.; DeLeo, Frank R.

    2015-01-01

    Carbapenem-resistant Klebsiella pneumoniae strains have emerged as a cause of life-threatening infections in susceptible individuals (e.g., transplant recipients and critically ill patients). Strains classified as multilocus sequence type (ST) 258 are among the most prominent causes of carbapenem-resistant K. pneumoniae infections worldwide, but the basis for the success of this lineage remains incompletely determined. To gain a more comprehensive view of the molecules potentially involved in the success of ST258, we used a proteomics approach to identify surface-associated and culture supernatant proteins produced by ST258. Protein samples were prepared from varied culture conditions in vitro, and were analyzed by a combination of two-dimensional electrophoresis and liquid chromatography followed by tandem mass spectrometry (LC-MS/MS). We identified a total of 193 proteins in outer membrane preparations from bacteria cultured in Luria-Bertani broth (LB) or RPMI 1640 tissue culture media (RPMI). Compared with LB, several iron-acquisition proteins, including IutA, HmuR, HmuS, CirA, FepA, FitA, FoxA, FhuD, and YfeX, were more highly expressed in RPMI. Of the 177 proteins identified in spent media, only the fimbrial subunit, MrkA, was predicted to be extracellular, a finding that suggests few proteins (or a limited quantity) are freely secreted by ST258. Notably, we discovered 203 proteins not reported in previous K. pneumoniae proteome studies. In silico modeling of proteins with unknown function revealed several proteins with beta-barrel transmembrane structures typical of porins, as well as possible host-interacting proteins. Taken together, these findings contribute several new targets for the mechanistic study of drug-resistance and pathogenesis by ST258 K. pneumoniae isolates. PMID:25893665

  7. Inhibition of Klebsiella ?-Lactamases (SHV-1 and KPC-2) by Avibactam: A Structural Study

    PubMed Central

    Papp-Wallace, Krisztina M.; Bonomo, Robert A.; van den Akker, Focco

    2015-01-01

    ?-Lactamase inhibition is an important clinical strategy in overcoming ?-lactamase-mediated resistance to ?-lactam antibiotics in Gram negative bacteria. A new ?-lactamase inhibitor, avibactam, is entering the clinical arena and promising to be a major step forward in our antibiotic armamentarium. Avibactam has remarkable broad-spectrum activity in being able to inhibit classes A, C, and some class D ?-lactamases. We present here structural investigations into class A ?-lactamase inhibition by avibactam as we report the crystal structures of SHV-1, the chromosomal penicillinase of Klebsiella pneumoniae, and KPC-2, an acquired carbapenemase found in the same pathogen, complexed with avibactam. The 1.80 Å KPC-2 and 1.42 Å resolution SHV-1 ?-lactamase avibactam complex structures reveal avibactam covalently bonded to the catalytic S70 residue. Analysis of the interactions and chair-shaped conformation of avibactam bound to the active sites of KPC-2 and SHV-1 provides structural insights into recently laboratory-generated amino acid substitutions that result in resistance to avibactam in KPC-2 and SHV-1. Furthermore, we observed several important differences in the interactions with amino acid residues, in particular that avibactam forms hydrogen bonds to S130 in KPC-2 but not in SHV-1, that can possibly explain some of the different kinetic constants of inhibition. Our observations provide a possible reason for the ability of KPC-2 ?-lactamase to slowly desulfate avibactam with a potential role for the stereochemistry around the N1 atom of avibactam and/or the presence of an active site water molecule that could aid in avibactam desulfation, an unexpected consequence of novel inhibition chemistry. PMID:26340563

  8. Molecular Analysis of Antibiotic Resistance Determinants and Plasmids in Malaysian Isolates of Multidrug Resistant Klebsiella pneumoniae

    PubMed Central

    Al-Marzooq, Farah; Mohd Yusof, Mohd Yasim; Tay, Sun Tee

    2015-01-01

    Infections caused by multidrug resistant Klebsiella pneumoniae have been increasingly reported in many parts of the world. A total of 93 Malaysian multidrug resistant K. pneumoniae isolated from patients attending to University of Malaya Medical Center, Kuala Lumpur, Malaysia from 2010-2012 were investigated for antibiotic resistance determinants including extended-spectrum beta-lactamases (ESBLs), aminoglycoside and trimethoprim/sulfamethoxazole resistance genes and plasmid replicons. CTX-M-15 (91.3%) was the predominant ESBL gene detected in this study. aacC2 gene (67.7%) was the most common gene detected in aminoglycoside-resistant isolates. Trimethoprim/sulfamethoxazole resistance (90.3%) was attributed to the presence of sul1 (53.8%) and dfrA (59.1%) genes in the isolates. Multiple plasmid replicons (1-4) were detected in 95.7% of the isolates. FIIK was the dominant replicon detected together with 13 other types of plasmid replicons. Conjugative plasmids (1-3 plasmids of ~3-100 kb) were obtained from 27 of 43 K. pneumoniae isolates. An ESBL gene (either CTX-M-15, CTX-M-3 or SHV-12) was detected from each transconjugant. Co-detection with at least one of other antibiotic resistance determinants [sul1, dfrA, aacC2, aac(6?)-Ib, aac(6?)-Ib-cr and qnrB] was noted in most conjugative plasmids. The transconjugants were resistant to multiple antibiotics including ?-lactams, gentamicin and cotrimoxazole, but not ciprofloxacin. This is the first study describing the characterization of plasmids circulating in Malaysian multidrug resistant K. pneumoniae isolates. The results of this study suggest the diffusion of highly diverse plasmids with multiple antibiotic resistance determinants among the Malaysian isolates. Effective infection control measures and antibiotic stewardship programs should be adopted to limit the spread of the multidrug resistant bacteria in healthcare settings. PMID:26203651

  9. Characterization of Type 2 Quorum Sensing in Klebsiella pneumoniae and Relationship with Biofilm Formation

    PubMed Central

    Balestrino, Damien; Haagensen, Janus A. J.; Rich, Chantal; Forestier, Christiane

    2005-01-01

    Quorum sensing is a process by which bacteria communicate by using secreted chemical signaling molecules called autoinducers. Many bacterial species modulate the expression of a wide variety of physiological functions in response to changes in population density by this mechanism. In this study, the opportunistic pathogen Klebsiella pneumoniae was observed to secrete type 2 signaling molecules. A homologue of luxS, the gene required for AI-2 synthesis in Vibrio harveyi, was isolated from the K. pneumoniae genome. A V. harveyi bioassay showed the luxS functionality in K. pneumoniae and its ability to complement the luxS-negative phenotype of Escherichia coli DH5?. Autoinducer activity was detected in the supernatant, and maximum expression of specific messengers detected by quantitative reverse transcription-PCR analysis occurred during the late exponential phase. The highest levels of AI-2 were observed in minimal medium supplemented with glycerol. To determine the potential role of luxS in colonization processes, a K. pneumoniae luxS isogenic mutant was constructed and tested for its capacity to form biofilms in vitro on an abiotic surface and to colonize the intestinal tract in a murine model. No difference was observed in the level of intestinal colonization between the wild-type strain and the luxS mutant. Microscopic analysis of biofilm structures revealed that the luxS mutant was able to form a mature biofilm but with reduced capacities in the development of microcolonies, mostly in the early steps of biofilm formation. These data suggest that a LuxS-dependent signal plays a role in the early stages of biofilm formation by K. pneumoniae. PMID:15805533

  10. Presence of Nitrogen Fixing Klebsiella pneumoniae in the gut of the Formosan Subterranean Termite (Coptotermes formosanus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A gram-negative facultative anaerobic enteric bacterium, Klebsiella pneumoniae was isolated from the hindgut of the Formosan subterranean termite (FST). It was characterized using, Fatty acid methyl ester (FAME) analysis, BIOLOG assay, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-...

  11. Correlation of Klebsiella pneumoniae Comparative Genetic Analyses with Virulence Profiles in a Murine Respiratory Disease Model

    E-print Network

    Fodah, Ramy A.

    Klebsiella pneumoniae is a bacterial pathogen of worldwide importance and a significant contributor to multiple disease presentations associated with both nosocomial and community acquired disease. ATCC 43816 is a well-studied ...

  12. Back To Bacteria.

    ERIC Educational Resources Information Center

    Flannery, Maura C.

    1997-01-01

    Explores new research about bacteria. Discusses bacterial genomes, archaea, unusual environments, evolution, pathogens, bacterial movement, biofilms, bacteria in the body, and a bacterial obsession. Contains 29 references. (JRH)

  13. Prevalence of Extended Spectrum ?-lactamase-Producing Klebsiella pneumoniae in Clinical Isolates

    PubMed Central

    Ali Abdel Rahim, Khalid Abdalla; Ali Mohamed, Ahmed Mohamed

    2014-01-01

    Background: Extended spectrum ?-lactamase (ESBL) are gram-negative bacteria that produce the enzyme, ?-lactamase, which can break down commonly used antibiotics, such as penicillin and cephalosporins, making infections with ESBL producing bacteria more difficult to treat. Extended spectrum ?-lactamase-producing Klebsiella pneumoniae were first reported in 1983 from Germany, and since then a steady increase in resistance against cephalosporins has been seen causing health problems. Objectives: The aim of this study was to determine the prevalence of ESBL in strains of K. pneumoniae isolated from different clinical samples. Patients and Methods: One hundred and thirty isolates of K. pneumoniae were isolated from different clinical specimens from King Khalid hospital, Hafr Elbatin, Kingdom Saudi Arabia. These isolates were then characterized, tested for antimicrobial susceptibility and screened for ESBL production by the MicroScan WalkAway-96 SI System. Extended spectrum ?-lactamase production was confirmed by the phenotypic confirmatory disc diffusion test (PCDDT) and the double disc synergy test (DDST). Results: Overall, 76.9% (100) of the isolates were resistant to cefuroxime, cefepime and cefazolin, 69.23% (90) were resistant to cefotaxime, and 46.15% (60) were resistant to cefoxitin. Extended spectrum ?-lactamase was detected in 53.8% (70) of K. pneumoniae as detected by the MicroScan “WalkAway-96” SI System and 50.07% (66) by PCDDT and 46.15% (60) by DDST. All K. pneumoniae isolates were resistant to ampicillin followed by both piperacillin and mezlocillin 92.30% (120). K. pneumoniae isolates showed high sensitivity to imipenem (15.38%) (20), followed by ertapenem, tetracycline, tigecycline pipracilline/tazobactam and amikacin (23.07%) (30). Conclusions: Our study showed that the prevalence of ESBL-producing K. pneumoniae at King Khalid Hospital was significantly high. Routine detection of ESBL-producing microorganisms is required by each of the laboratory standard detection methods to control the spread of these infections and allow a proper therapeutic strategy. For detection, the phenotypic confirmatory disc diffusion test is simple, sensitive and cost effective. However, there is a need for larger scale drug susceptibility surveillance. PMID:25774279

  14. Klebsiella pneumoniae related community-acquired acute lower respiratory infections in Cambodia: Clinical characteristics and treatment

    PubMed Central

    2012-01-01

    Background In many Asian countries, Klebsiella pneumoniae (KP) is the second pathogen responsible for community-acquired pneumonia. Yet, very little is known about KP etiology in ALRI in Cambodia, a country that has one of the weakest medical infrastructures in the region. We present here the first clinico-radiological description of KP community-acquired ALRI in hospitalized Cambodian patients. Methods Through ALRI surveillance in two provincial hospitals, KP was isolated from sputum and blood cultures, and identified by API20E gallery from patients ? 5 years-old with fever and respiratory symptoms onset ?14 days. Antibiotics susceptibility testing was provided systematically to clinicians when bacteria were isolated. We collected patients' clinical, radiological and microbiological data and their outcome 3 months after discharge. We also compared KP-related with other bacteria-related ALRI to determine risk factors for KP infection. Results From April 2007 to December 2009, 2315 ALRI patients ? 5 years-old were enrolled including 587 whose bacterial etiology could be assigned. Of these, 47 (8.0%) had KP infection; their median age was 55 years and 68.1% were females. Reported prior medication was high (42.5%). Patients' chest radiographs showed pneumonia (61.3% including 39% that were necrotizing), preexisting parenchyma lesions (29.5%) and pleural effusions alone (4.5%) and normal parenchyma (4.5%). Five patients had severe conditions on admission and one patient died during hospitalization. Of the 39 patients that were hospital discharged, 14 died including 12 within 1 month after discharge. Only 13 patients (28%) received an appropriate antibiotherapy. Extended-spectrum beta-lactamases (ESBL) - producing strains were found in 8 (17.0%) patients. Female gender (Odds ratio (OR) 2.1; p = 0.04) and diabetes mellitus (OR 3.1; p = 0.03) were independent risk factors for KP-related ALRI. Conclusions KP ALRI in Cambodia has high fatality rate, are more frequently found in women, and should be considered in diabetic patients. The extremely high frequency of ESBL-producing strains in the study is alarming in the context of uncontrolled antibiotic consumption and in absence of microbiology capacity in most public-sector hospitals. PMID:22233322

  15. Role of Antibiotic Penetration Limitation in Klebsiella pneumoniae Biofilm Resistance to Ampicillin and Ciprofloxacin

    PubMed Central

    Anderl, Jeff N.; Franklin, Michael J.; Stewart, Philip S.

    2000-01-01

    The penetration of two antibiotics, ampicillin and ciprofloxacin, through biofilms developed in an in vitro model system was investigated. The susceptibilities of biofilms and corresponding freely suspended bacteria to killing by the antibiotics were also measured. Biofilms of Klebsiella pneumoniae were developed on microporous membranes resting on agar nutrient medium. The susceptibilities of planktonic cultures and biofilms to 10 times the MIC were determined. Antibiotic penetration through biofilms was measured by assaying the concentration of antibiotic that diffused through the biofilm to an overlying filter disk. Parallel experiments were performed with a mutant K. pneumoniae strain in which ?-lactamase activity was eliminated. For wild-type K. pneumoniae grown in suspension culture, ampicillin and ciprofloxacin MICs were 500 and 0.18 ?g/ml, respectively. The log reductions in the number of CFU of planktonic wild-type bacteria after 4 h of treatment at 10 times the MIC were 4.43 ± 0.33 and 4.14 ± 0.33 for ampicillin and ciprofloxacin, respectively. Biofilms of the same strain were much less susceptible, yielding log reductions in the number of CFU of ?0.06 ± 0.06 and 1.02 ± 0.04 for ampicillin and ciprofloxacin, respectively, for the same treatment. The number of CFU in the biofilms after 24 h of antibiotic exposure was not statistically different from the number after 4 h of treatment. Ampicillin did not penetrate wild-type K. pneumoniae biofilms, whereas ciprofloxacin and a nonreactive tracer (chloride ion) penetrated the biofilms quickly. The concentration of ciprofloxacin reached the MIC throughout the biofilm within 20 min. Ampicillin penetrated biofilms formed by a ?-lactamase-deficient mutant. However, the biofilms formed by this mutant were resistant to ampicillin treatment, exhibiting a 0.18 ± 0.07 log reduction in the number of CFU after 4 h of exposure and a 1.64 ± 0.33 log reduction in the number of CFU after 24 h of exposure. Poor penetration contributed to wild-type biofilm resistance to ampicillin but not to ciprofloxacin. The increased resistance of the wild-type strain to ciprofloxacin and the mutant strain to ampicillin and ciprofloxacin could not be accounted for by antibiotic inactivation or slow diffusion since these antibiotics fully penetrated the biofilms. These results suggest that some other resistance mechanism is involved for both agents. PMID:10858336

  16. Characterization of Siphoviridae phage Z and studying its efficacy against multidrug-resistant Klebsiella pneumoniae planktonic cells and biofilm.

    PubMed

    Jamal, Muhsin; Hussain, Tahir; Das, Chythanya Rajanna; Andleeb, Saadia

    2015-04-01

    Biofilm has many serious consequences for public health and is a major virulence factor contributing to the chronicity of infections. The aim of the current study was to isolate and characterize a bacteriophage that inhibits multidrug-resistant Klebsiella pneumonia (M) in planktonic form as well as biofilm. This phage, designated bacteriophage Z, was isolated from wastewater. Its adsorption rate to its host bacterium was significantly enhanced by MgCl2 and CaCl2. It has a wide range of pH and heat stability. From its one-step growth, latent time and burst size were determined to be 24 min and about 320 virions per cell, respectively. As analysed by transmission electron microscopy, phage Z had an icosahedral head of width 76±10 nm, length 92±14 nm and icosahedron side 38 nm, and a non-contractile tail 200±15 nm long and 14-29 nm wide. It belongs to the family Siphoviridae in the order Caudovirales. Six structural proteins ranging from 18 to 65 kDa in size were revealed by SDS-PAGE. The genome was found to comprise double-stranded DNA with an approximate size of 36 kb. Bacteria were grown in suspension and as biofilms to compare the susceptibility of both phenotypes to the phage lytic action. Phage Z was effective in reducing biofilm biomass after 24 and 48 h, showing more than twofold and threefold reduction, respectively. Biofilm cells and stationary-phase planktonic bacteria were killed at a lower rate than exponential-phase planktonic bacteria. PMID:25681321

  17. Isolation and characterization of heavy metals resistant bacteria from Lagos Lagoon.

    PubMed

    Olukoya, D K; Smith, S I; Ilori, M O

    1997-01-01

    A total of 228 bacteria with an ability to resist toxic heavy metals were isolated from 8 selected sites of the Lagos Lagoon. The bacteria isolated were Staphylococcus sp., Bacillus sp., Pseudomonas sp., Streptococcus sp., Moraxella sp., Escherichia coli, Proteus sp., Klebsiella sp. and Salmonella sp. The heavy metals to which resistance was recorded were mercury, lead, zinc, cobalt, copper and chromium. The lagoon sites from which the highest number of resistant bacteria were isolated were Marina and Ebute-Ero. The heavy metal to which most bacteria were resistant was cobalt, while the least was chromium. The significance of the result is discussed in relation to the Nigerian environment and human health. PMID:9438345

  18. Pneumonia and bacteremia in a golden-headed lion tamarin (Leontopithecus chrysomelas) caused by Klebsiella pneumoniae subsp. pneumoniae during a translocation program of free-ranging animals in Brazil.

    PubMed

    Bueno, Marina G; Iovine, Renata O; Torres, Luciana N; Catão-Dias, José L; Pissinatti, Alcides; Kierulff, Maria C M; Carvalho, Vania M

    2015-05-01

    Klebsiella pneumoniae is an important emerging pathogen in humans, particularly the invasive hypermucoviscosity (HMV) phenotype. In addition, the organism is an important public health concern because of nosocomial infections and antimicrobial resistance. Nonhuman primates in captivity are susceptible to Klebsiella, particularly when a stress factor is involved. Infections vary depending on the species but can cause significant morbidity and mortality in these animals. The objective of this study was to describe a case of bronchopneumonia and bacteremia caused by Klebsiella pneumoniae in a free-ranging golden-headed lion tamarin (Leontopithecus chrysomelas) caught and maintained in quarantine during a translocation program for conservation purposes. An adult male, that had showed emaciation and apathy, was clinically examined and, despite being provided supportive therapy, died 2 days after onset of clinical signs. At postmortem examination, generalized bilateral pneumonia and pericarditis were observed. Tissue samples were fixed in 10% formalin for histology, and pulmonary tissues and cardiac blood were collected for microbiologic diagnostic procedures. Bacteria that were shown to be HMV K. pneumoniae subsp. pneumoniae strains were isolated from the pulmonary fluids and cardiac blood in pure cultures. Severe bronchopneumonia was the main pathological finding. The consequences of the confirmed presence of the HMV phenotype of K. pneumoniae subsp. pneumoniae in this wildlife species for human, animal, and ecosystem health should be determined. These results demonstrate the importance of quarantine and potential pathogen screening during wildlife translocation procedures. PMID:25943130

  19. Report on a transborder spread of carbapenemase-producing bacteria by a patient injured during Euromaidan, Ukraine

    PubMed Central

    Hrabák, J.; Študentová, V.; Adámková, V.; Šemberová, L.; Kabelíková, P.; Hedlová, D.; ?urdová, M.; Zemlickova, H.; Papagiannitsis, C.C.

    2015-01-01

    Spread of carbapenemase-producing bacteria has been described all over the world. This phenomenon may be accelerated by many factors, including wars and natural disasters. In this report, we described an NDM-1-producing Klebsiella pneumonia ST11 recovered from a patient injured during the Maidan revolution in Ukraine. To our knowledge, this is the first report of a carbapenemase-producing Enterobacteriaceae in Ukraine and one of several reports describing wound colonization/infection of humans injured during war. PMID:26594376

  20. Bioelectricity Aware of bacteria

    E-print Network

    Lovley, Derek

    Bioelectricity Aware of bacteria Bacteria of the genus Geobacter carry out anaerobic respiration the mechanism that makes these bacteria conductors of electricity. Researchers have studied this for a population of G. sulfurreducens, endowed with bacteria nanometric filaments (pili) that enable them

  1. Bacteria can promote calcium oxalate crystal growth and aggregation.

    PubMed

    Chutipongtanate, Somchai; Sutthimethakorn, Suchitra; Chiangjong, Wararat; Thongboonkerd, Visith

    2013-03-01

    Our previous report showed that uropathogenic bacteria, e.g., Escherichia coli, are commonly found inside the nidus of calcium oxalate (CaOx) kidney stones and may play pivotal roles in stone genesis. The present study aimed to prove this new hypothesis by direct examining CaOx lithogenic activities of both Gram-negative and Gram-positive bacteria. CaOx was crystallized in the absence (blank control) or presence of 10(5) CFU/ml E. coli, Klebsiella pneumoniae, Staphylococcus aureus, or Streptococcus pneumoniae. Fragmented red blood cell membranes and intact red blood cells were used as positive and negative controls, respectively. The crystal area and the number of aggregates were measured to initially screen for effects of bacteria on CaOx crystal growth and aggregation. The data revealed that all the bacteria tested dramatically increased the crystal area and number of crystal aggregates. Validation assays (spectrophotometric oxalate-depletion assay and an aggregation-sedimentation study) confirmed their promoting effects on both growth (20.17 ± 3.42, 17.55 ± 2.27, 16.37 ± 1.38, and 21.87 ± 0.85 % increase, respectively) and aggregation (57.45 ± 2.08, 51.06 ± 5.51, 55.32 ± 2.08, and 46.81 ± 3.61 % increase, respectively) of CaOx crystals. Also, these bacteria significantly enlarged CaOx aggregates, with the diameter greater than the luminal size of distal tubules, implying that tubular occlusion might occur. Moreover, these bacterial effects were dose-dependent and specific to intact viable bacteria, not intact dead or fragmented bacteria. In summary, intact viable E. coli, K. pneumoniae, S. aureus, and S. pneumoniae had significant promoting effects on CaOx crystal growth and aggregation. This functional evidence supported the hypothesis that various types of bacteria can induce or aggravate metabolic stone disease, particularly the CaOx type. PMID:23334195

  2. Infected Hydatid Cysts Bacteria in Slaughtered Livestock and Their Effects on Protoscoleces Degeneration

    PubMed Central

    Fallah, Mohammad; Kavand, Abdollah; Yousefi Mashouf, Rasoul

    2014-01-01

    Background: The protoscoleces of fertile hydatid cysts are considered as major risks in surgery and producing secondary cysts if rupture the cyst during operation and, cause infecting the dogs with adult worm if eaten by this animal. Bacterial infection of the hydatid fluid can lead to sterilization of the cyst. Objectives: The aim of this study was to determine the bacterial infection rate of livestock hydatid cysts in Hamedan, Iran, and test the isolated bacteria effects on viable protoscoleces, in vitro. Materials and Methods: A total of 5709 slaughtered livestock were inspected to detect the presence of hydatid cysts. The hydatid fluid of all cysts was cultured separately to isolate and identify the bacteria. The effect of isolated bacteria was tested on viable protoscoleces in culture tubes, in vitro. The culture tubes were observed and examined under a light microscope every two hours for 24 hours, and then, after 36 and 48 hours. Results: Infected cysts were found in 74% of animals in Hamedan (46% were calcified and the bacteria was isolated from 52%) and 62% in Borujerd. The isolated bacteria in the infected cysts were as follows: Escherichia coli, E. blattae, Klebsiella pnoumoniae, Proteus mirabilis, Enterobacter aerogenes, coagulase-positive and coagulase-negative Staphylococci, Pseudomonas aeruginosa and Edwardsiella tarda. The protoscoleces incubated with the isolated bacteria totally degenerated, but 55% of the protoscoleces in the control groups were intact and viable even after one week. Conclusions: This study indicated a high percentage of cysts bacterial infections in two provinces of Iran. The common isolated bacteria were E. coli and Klebsiella. The isolated bacteria degenerated the protoscoleces during short-time incubation, in vitro. PMID:25371792

  3. Biochemical parameters of glutamine synthetase from Klebsiella aerogenes.

    PubMed Central

    Bender, R A; Janssen, K A; Resnick, A D; Blumenberg, M; Foor, F; Magasanik, B

    1977-01-01

    The glutamine synthetase (GS) from Klebsiella aerogenes is similar to that from Escherichia coli in several respects: (i) it is repressed by high levels of ammonia in the growth medium; (ii) its biosynthetic activity is greatly reduced by adenylylation; and (iii) adenylylation lowers the pH optimum and alters the response of the enzymes to various inhibitors in the gamma-glutamyl transferase (gammaGT) assay. There are, however, several important differences: (i) the isoactivity point for the adenylylated and non-adenylylated forms in the gammaGT assay occurs at pH 7.55 in K. aerogenes and at pH 7.15 in E. coli; (ii) the non-adenylylated form of the GS from K. aerogenes is stimulated by 60 mM MgCl2 in the gammaGT assay at pH 7.15. A biosynthetic reaction assay that correlates well with number of non-adenylylated enzyme subunits, as determined by the method of Mg2+ inhibition of the gammaGT assay, is described. Finally, we have found that it is necessary to use special methods to harvest growing cells to prevent changes in the adenylylation state of GS from occurring during harvesting. PMID:14104

  4. Structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae

    PubMed Central

    Michalska, Karolina; Cuff, Marianne E.; Tesar, Christine; Feldmann, Brian; Joachimiak, Andrzej

    2011-01-01

    In most organisms, efficient d-galactose utilization requires the highly conserved Leloir pathway that converts d-galactose to d-glucose 1-phosphate. However, in some bacterial and fungal species alternative routes of d-galactose assimilation have been identified. In the so-called De Ley–Doudoroff pathway, d-galactose is metabolized into pyruvate and d-­glyceraldehyde 3-phosphate in five consecutive reactions carried out by specific enzymes. The penultimate step in this pathway involves the phosphorylation of 2-oxo-3-deoxygalactonate to 2-oxo-3-deoxygalactonate 6-phosphate catalyzed by 2-­oxo-3-deoxygalactonate kinase, with ATP serving as a phosphoryl-group donor. Here, a crystal structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae determined at 2.1?Å resolution is reported, the first structure of an enzyme from the De Ley–Doudoroff pathway. Structural comparison indicates that the enzyme belongs to the ASKHA (acetate and sugar kinases/hsc70/actin) family of phosphotransferases. The protein is composed of two ?/? domains, each of which contains a core common to all family members. Additional elements introduced between conserved structural motifs define the unique features of 2-oxo-3-deoxygalactonate kinase and possibly determine the biological function of the protein. PMID:21795809

  5. Properties of Klebsiella phage P13 and associated exopolysaccharide depolymerase

    NASA Astrophysics Data System (ADS)

    Liu, Yang; Li, Guiyang; Mo, Zhaolan; Chai, Zihan; Shang, Anqi; Mou, Haijin

    2013-11-01

    The bacteriophage P13 that infects Klebsiella serotype K13 contains a heat-stable depolymerase capable of effective degradation of exopolysaccharide (EPS) produced by this microorganism. In this study, the titer of phage P13, initially 2.0 × 107 pfu mL-1, was found increasing 20 min after infection and reached 5.0 × 109 pfu mL-1 in 60 min. Accordingly, the enzyme activity of depolymerase approached the maximum 60 min after infection. Treatment at 70°C for 30 min inactivated all the phage, but retained over 90% of the depolymerase activity. Addition of acetone into the crude phage lysate led to precipitation of the protein, with a marked increase in bacterial EPS degradation activity and a rapid drop in the titer of phage. After partial purification by acetone precipitation and ultrafiltration centrifugation, the enzyme was separated from the phage particles, showing two components with enzyme activity on Q-Sepharose Fast Flow. The soluble enzyme had an optimum degradation activity at 60°C and pH 6.5. Transmission electron microscopy demonstrated that the phage P13 particles were spherical with a diameter of 50 nm and a short stumpy tail. It was a doublestrand DNA virus consisting of a nucleic acid molecule of 45976 bp. This work provides an efficient purification operation including thermal treatment and ultrafiltration centrifugation, to dissociate depolymerase from phage particles. The characterization of phage P13 and associated EPS depolymerase is beneficial for further application of this enzyme.

  6. CRYSTAL STRUCTURE ANALYSIS OF A PUTATIVE OXIDOREDUCTASE FROM KLEBSIELLA PNEUMONIAE

    SciTech Connect

    Baig, M.; Brown, A.; Eswaramoorthy, S.; Swaminathan, S.

    2009-01-01

    Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) at Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.

  7. Purification and properties of Klebsiella aerogenes D-arabitol dehydrogenase.

    PubMed Central

    Neuberger, M S; Patterson, R A; Hartley, B S

    1979-01-01

    An Escherichia coli K12 strain was constructed that synthesized elevated quantities of Klebsiella aerogenes D-arabitol dehydrogenase; the enzyme accounted for about 5% of the soluble protein in this strain. Some 280 mg of enzyme was purified from 180 g of cell paste. The purified enzyme was active as a monomer of 46,000 mol.wt. The amino acid composition and kinetic constants of the enzyme for D-arabitol and D-mannitol are reported. The apparent Km for D-mannitol was more than 3-fold that for D-arabitol, whereas the maximum velocities with both substrates were indistinguishable. The enzyme purified from the E. coli K12 construct was indistinguishable by the criteria of molecular weight, electrophoretic mobility in native polyacrylamide gel and D-mannitol/D-arabitol activity ratio from D-arabitol dehydrogenase synthesized in wild-type K. aerogenes. Purified D-arabitol dehydrogenase showed no immunological cross-reaction with K. aerogenes ribitol dehydrogenase. During electrophoresis in native polyacrylamide gels, oxidation by persulphate catalysed the formation of inactive polymeric forms of the enzyme. Dithiothreitol and pre-electrophoresis protected against this polymerization. Images Fig. 1. Fig. 2. PMID:393250

  8. Antibiotic Resistance and Its Transfer Among Clinical and Nonclinical Klebsiella Strains in Botanical Environments †

    PubMed Central

    Talbot, Henry W.; Yamamoto, Deborah K.; Smith, Martin W.; Seidler, Ramon J.

    1980-01-01

    A total of 183 isolates of Klebsiella from drinking water, market vegetables, wood, sawdust, industrial effluents, and human and animal origin were examined for susceptibility to 10 antibacterial agents. Incidence of resistance to two or more antibiotics tested was: 65% of the human clinical isolates, 59% among bovine mastitis, and 24% among the nonclinical isolates. The five different multiple resistance patterns among nonclinically derived Klebsiella were also found among the human and bovine mastitis isolates. Statistical analyses revealed that patterns of resistance among Klebsiella isolates from drinking water, market vegetables, and industrial effluents were highly correlated with each other and with resistance patterns of human clinical isolates. Antibiotic resistance was transferred between Klebsiella growing in two habitat-simulated environments (growing radish plants and aqueous sawdust suspensions). Transconjugants were detected in 5 of 21 and 6 of 21 mating pairs, respectively. Average transconjugants/donor ranged from 10?3 to 10?6 in Penassay broth, from 10?6 to 10?7 on radish plants, and from 10?5 to 10?8 in sawdust suspensions. Although antibiotic resistance transfer under simulated environmental conditions can occur, regrowth of clinical strains is probably the major cause for the widespread occurrence of antibiotic-resistant Klebsiella in the nonclinical environment. PMID:6986852

  9. Effects of the hindlimb-unloading model of spaceflight conditions on resistance of mice to infection with Klebsiella pneumoniae

    NASA Technical Reports Server (NTRS)

    Belay, Tesfaye; Aviles, Hernan; Vance, Monique; Fountain, Kimberly; Sonnenfeld, Gerald

    2002-01-01

    BACKGROUND: It has been well documented in several studies that many immunologic parameters are altered in experimental animals and human subjects who have flown in space. However, it is not fully known whether these immunologic changes could result in increased susceptibility to infection. Hindlimb (antiorthostatic) unloading of rodents has been used successfully to simulate some of the effects of spaceflight on physiologic systems. OBJECTIVE: The objective of this study was to determine the effect of hindlimb unloading on the outcome of Klebsiella pneumoniae infection in mice. METHODS: Hindlimb-unloaded, hindlimb-restrained, and control mice were intraperitoneally infected with one 50% lethal dose of K pneumoniae 2 days after suspension. Mortality and bacterial load in several organs were compared among the groups. RESULTS: Unloaded mice showed significantly increased mortality and reduced mean time to death compared with that seen in the control groups. Kinetics of bacterial growth with smaller infective doses revealed that control mice were able to clear bacteria from the organs after 30 hours. In contrast, unloaded mice had continued bacterial growth at the same time point. CONCLUSION: The results of this study suggest that hindlimb unloading might enhance the dissemination of K pneumoniae, leading to increased mortality. The complex physiologic changes observed during hindlimb unloading, including stress, have a key role in the pathophysiology of this infection.

  10. S-thanatin functionalized liposome potentially targeting on Klebsiella pneumoniae and its application in sepsis mouse model

    PubMed Central

    Fan, Xiaobo; Fan, Juxiang; Wang, Xiyong; Wu, Pengpeng; Wu, Guoqiu

    2015-01-01

    S-thanatin (Ts) was a short antimicrobial peptide with selective antibacterial activity. In this study, we aimed to design a drug carrier with specific bacterial targeting potential. The positively charged Ts was modified onto the liposome surface by linking Ts to the constituent lipids via a PEG linker. The benefits of this design were evaluated by preparing a series of liposomes and comparing their biological effects in vitro and in vivo. The particle size and Zeta potential of the constructed liposomes were measured with a Zetasizer Nano ZS system and a confocal laser scanning microscope. The in vitro drug delivery potential was evaluated by measuring the cellular uptake of encapsulated levofloxacin using HPLC. Ts-linked liposome or its conjugates with quantum dots favored bacterial cells, and increased the bacterial uptake of levofloxacin. In antimicrobial assays, the Ts and levofloxacin combination showed a synergistic effect, and Ts-LPs-LEV exhibited excellent activity against the quality control stain Klebsiella pneumoniae ATCC 700603 and restored the susceptibility of multidrug-resistant K. pneumoniae clinical isolates to levofloxacin in vitro. Furthermore, Ts-LPs-LEV markedly reduced the lethality rate of the septic shock and resulted in rapid bacterial clearance in mouse models receiving clinical multidrug resistant (MDR) isolates. These results suggest that the Ts-functionalized liposome may be a promising antibiotic delivery system for clinical infectious disorders caused by MDR bacteria, in particular the sepsis related diseases. PMID:26578959

  11. Prevalence and characterization of extended-spectrum-?-lactamase-producing Escherichia coli and Klebsiella pneumoniae in ready-to-eat vegetables.

    PubMed

    Kim, Hong-Seok; Chon, Jung-Whan; Kim, Young-Ji; Kim, Dong-Hyeon; Kim, Mu-sang; Seo, Kun-Ho

    2015-08-17

    The objective of this investigation was to determine the prevalence and characteristics of extended-spectrum-?-lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae in ready-to-eat (RTE) vegetables. A total of 189 RTE vegetable samples (91 sprouts and 98 mixed salads) were collected in a retail market in South Korea from October 2012 to February 2013. The prevalence of ESBL-producing E. coli and K. pneumoniae was 10.1%. Of these, 94.7% were from the sprout samples. All isolates were resistant to cefotaxime, and many of the ESBL producers were also resistant to non-?-lactam antibiotics, including gentamicin, trimethoprim/sulfamethoxazole, and ciprofloxacin (73.7%, 63.2%, and 26.3% respectively). TEM-1, SHV-1, -2, -11, -12, -27, -28 and -61, and CTX-M-14, -15 and -55 ?-lactamases were detected alone or in combination. The genetic platforms of all CTX-M producing isolates were ISEcp1-blaCTX-M-orf477 and ISEcp1-blaCTX-M-IS903 in CTX-M groups 1 and 9, respectively. To our knowledge, this is the first report of the prevalence and characterization of ESBL-producing E. coli and K. pneumoniae isolated from RTE vegetables. The results of this study indicate that RTE vegetables, sprouts, in particular, may play a role in spreading antimicrobial resistant bacteria and ESBL genes to humans. PMID:26001064

  12. Direct Detection and Genotyping of Klebsiella pneumoniae Carbapenemases from Urine by Use of a New DNA Microarray Test

    PubMed Central

    Peter, Harald; Berggrav, Kathrine; Thomas, Peter; Pfeifer, Yvonne; Witte, Wolfgang; Templeton, Kate

    2012-01-01

    Klebsiella pneumoniae carbapenemases (KPCs) are considered a serious threat to antibiotic therapy, as they confer resistance to carbapenems, which are used to treat extended-spectrum beta-lactamase (ESBL)-producing bacteria. Here, we describe the development and evaluation of a DNA microarray for the detection and genotyping of KPC genes (blaKPC) within a 5-h period. To test the whole assay procedure (DNA extraction plus a DNA microarray assay) directly from clinical specimens, we compared two commercial DNA extraction kits (the QIAprep Spin miniprep kit [Qiagen] and the urine bacterial DNA isolation kit [Norgen]) for the direct DNA extraction from urine samples (dilution series spiked in human urine). Reliable single nucleotide polymorphism (SNP) typing was demonstrated using 1 × 105 CFU/ml urine for Escherichia coli (Qiagen and Norgen) and 80 CFU/ml urine, on average, for K. pneumoniae (Norgen). This study presents, for the first time, the combination of a new KPC microarray with commercial sample preparation for detecting and genotyping microbial pathogens directly from clinical specimens; this paves the way toward tests providing epidemiological and diagnostic data, enabling better antimicrobial stewardship. PMID:23035190

  13. Heterologous Expression of Aldehyde Dehydrogenase from Saccharomyces cerevisiae in Klebsiella pneumoniae for 3-Hydroxypropionic Acid Production from Glycerol.

    PubMed

    Wang, Kang; Wang, Xi; Ge, Xizhen; Tian, Pingfang

    2012-09-01

    3-Hydroxypropionic acid (3-HP) is a commercially valuable platform compound. Klebsiella pneumoniae has been concerned as an appropriate host for 3-HP production because of its robust capacity to metabolize glycerol. Glycerol conversion to 3-HP in K. pneumoniae comprises two successive reactions: glycerol dehydratase catalyzes glycerol to 3-hydroxypropionaldehyde (3-HPA); aldehyde dehydrogenase catalyzes 3-HPA to 3-HP. Previous studies focusing on inducible expression of aldehyde dehydrogenase have shown defects of high cost of inducer and low catalytic activity due to inclusion body. Here we show a different strategy that a native promoter in the host K. pneumoniae was used to drive the heterologous expression of aldehyde dehydrogenase gene ald4 from Saccharomyces cerevisiae. The 3-HP yield of the recombinant reached a peak of 4.23 g/L at log phase, but it decreased during later period of fermentation. Except the validation of high activity of ald4, particularly, the 3-HP formation was uncovered to be closely coupled with cell division, and the lacking of NAD and ATP at latter fermentation phase became the bottleneck for cell growth and 3-HP accumulation. Furthermore, 3-HP is postulated to be converted to 3-HPA via feedback inhibition or other metabolite via unknown mechanism. Since glycerol dissimilation is a common mechanism in a variety of bacteria, the expression strategy using native promoter and implications may provide significant insight into the metabolic engineering for 3-HP production. PMID:23997342

  14. Bacteria isolated from amoebae/bacteria consortium

    DOEpatents

    Tyndall, Richard L. (Clinton, TN)

    1995-01-01

    New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

  15. Bacteria isolated from amoebae/bacteria consortium

    DOEpatents

    Tyndall, R.L.

    1995-05-30

    New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

  16. Insect Antimicrobial Peptide Complexes Prevent Resistance Development in Bacteria

    PubMed Central

    Chernysh, Sergey; Gordya, Natalia; Suborova, Tatyana

    2015-01-01

    In recent decades much attention has been paid to antimicrobial peptides (AMPs) as natural antibiotics, which are presumably protected from resistance development in bacteria. However, experimental evolution studies have revealed prompt resistance increase in bacteria to any individual AMP tested. Here we demonstrate that naturally occurring compounds containing insect AMP complexes have clear advantage over individual peptide and small molecule antibiotics in respect of drug resistance development. As a model we have used the compounds isolated from bacteria challenged maggots of Calliphoridae flies. The compound isolated from blow fly Calliphora vicina was found to contain three distinct families of cell membrane disrupting/permeabilizing peptides (defensins, cecropins and diptericins), one family of proline rich peptides and several unknown antimicrobial substances. Resistance changes under long term selective pressure of the compound and reference antibiotics cefotaxime, meropenem and polymyxin B were tested using Escherichia coli, Klebsiella pneumonia and Acinetobacter baumannii clinical strains. All the strains readily developed resistance to the reference antibiotics, while no signs of resistance growth to the compound were registered. Similar results were obtained with the compounds isolated from 3 other fly species. The experiments revealed that natural compounds containing insect AMP complexes, in contrast to individual AMP and small molecule antibiotics, are well protected from resistance development in bacteria. Further progress in the research of natural AMP complexes may provide novel solutions to the drug resistance problem. PMID:26177023

  17. Whole genome sequencing of extended-spectrum ?-lactamase producing Klebsiella pneumoniae isolated from a patient in Lebanon

    PubMed Central

    Tokajian, Sima; Eisen, Jonathan A.; Jospin, Guillaume; Farra, Anna; Coil, David A.

    2015-01-01

    Objective: The emergence of extended-spectrum ?-lactamase (ESBL)-producing bacteria is now a critical concern. The ESBL-producing Klebsiella pneumoniae constitutes one of the most common multidrug-resistant (MDR) groups of gram-negative bacteria involved in nosocomial infections worldwide. In this study we report on the molecular characterization through whole genome sequencing of an ESBL-producing K. pneumoniae strain, LAU-KP1, isolated from a stool sample from a patient admitted for a gastrointestinal procedure/surgery at the Lebanese Amrican University Medical Center-Rizk Hospital (LAUMCRH) in Lebanon. Methods: Illumina paired-end libraries were prepared and sequenced, which resulted in 4,220,969 high-quality reads. All sequence processing and assembly were performed using the A5 assembly pipeline. Results: The initial assembly produced 86 contigs, for which no scaffolding was obtained. The final collection of contigs was submitted to GenBank. The final draft genome sequence consists of a combined 5,632,663 bases with 57% G+C content. Automated annotation was performed using the RAST annotation server. Sequencing analysis revealed that the isolate harbored different ?-lactamase genes, including blaoxa?1, blaCTX?M?15, blaSHV?11, and blaTEM?1b. The isolate was also characterized by the concomitant presence of other resistance determinants most notably acc(6?)-lb-cr and qnrb1. The entire plasmid content was also investigated and revealed homology with four major plasmids pKPN-IT, pBS512_2, pRSF1010_SL1344, and pKPN3. Conclusions: The potential role of K. pneumonia as a reservoir for ESBL genes and other resistance determinants is along with the presence of key factors that favor the spread of antimicrobial resistance a clear cause of concern and the problem that Carbapenem-non-susceptible ESBL isolates are posing in hospitals should be reconsidered through systematic exploration and molecular characterization. PMID:25905047

  18. In Silico Analysis of Usher Encoding Genes in Klebsiella pneumoniae and Characterization of Their Role in Adhesion and Colonization

    PubMed Central

    Khater, Fida; Balestrino, Damien; Charbonnel, Nicolas; Dufayard, Jean François; Brisse, Sylvain; Forestier, Christiane

    2015-01-01

    Chaperone/usher (CU) assembly pathway is used by a wide range of Enterobacteriaceae to assemble adhesive surface structures called pili or fimbriae that play a role in bacteria-host cell interactions. In silico analysis revealed that the genome of Klebsiella pneumoniae LM21 harbors eight chromosomal CU loci belonging to ??? and ? clusters. Of these, only two correspond to previously described operons, namely type 1 and type 3-encoding operons. Isogenic usher deletion mutants of K. pneumoniae LM21 were constructed for each locus and their role in adhesion to animal (Intestine 407) and plant (Arabidopsis thaliana) cells, biofilm formation and murine intestinal colonization was investigated. Type 3 pili usher deleted mutant was impaired in all assays, whereas type 1 pili usher deleted mutant only showed attenuation in adhesion to plant cells and in intestinal colonization. The LM21?kpjC mutant was impaired in its capacity to adhere to Arabidopsis cells and to colonize the murine intestine, either alone or in co-inoculation experiments. Deletion of LM21kpgC induced a significant decrease in biofilm formation, in adhesion to animal cells and in colonization of the mice intestine. The LM21?kpaC and LM21?kpeC mutants were only attenuated in biofilm formation and the adhesion abilities to Arabidopsis cells, respectively. No clear in vitro or in vivo effect was observed for LM21?kpbC and LM21?kpdC mutants. The multiplicity of CU loci in K. pneumoniae genome and their specific adhesion pattern probably reflect the ability of the bacteria to adhere to different substrates in its diverse ecological niches. PMID:25751658

  19. Emergence of OXA-48-Producing Klebsiella pneumoniae in Taiwan.

    PubMed

    Ma, Ling; Wang, Jann-Tay; Wu, Tsu-Lan; Siu, L Kristopher; Chuang, Yin-Ching; Lin, Jung-Chung; Lu, Min-Chi; Lu, Po-Liang

    2015-01-01

    The isolation of OXA-48-producing Enterobacteriaceae has increased dramatically in Mediterranean countries in the past 10 years, and has recently emerged in Asia. Between January 2012 and May 2014, a total of 760 carbapenem non-susceptible Klebsiella pneumoniae (CnSKP) isolates were collected during a Taiwan national surveillance. Carbapenemases were detected in 210 CnSKP isolates (27.6%), including 162 KPC-2 (n = 1), KPC-3, KPC-17, and NDM-1 (n = 1 each), OXA-48 (n = 4), IMP-8 (n = 18), and VIM-1 (n = 24). The four blaOXA-48 CnSKP isolates were detected in late 2013. Herein we report the emergence OXA-48-producing K. pneumoniae isolates in Taiwan. PFGE analysis revealed that the four isolates belonged to three different pulsotypes. Three isolates harboured blaCTX-M genes and belonged to MLST type ST11. In addition, the plasmids belonged to the incompatibility group, IncA/C. One isolate belonged to ST116 and the plasmid incompatibility group was non-typeable. The sequence upstream of the blaOXA-48 gene in all four isolates was identical to pKPOXA-48N1, a blaOXA-48-carrying plasmid. This is the first report of OXA-48-producing Enterobacteriaceae in Taiwan and the second report to identify blaOXA-48 on an IncA/C plasmid in K. pneumoniae. Given that three isolates belong to the same pandemic clone (ST11) and possess the IncA/C plasmid and similar plasmid digestion profile that indicated the role of clonal spread or plasmid for dissemination of blaOXA-48 gene, the emergence of OXA-48-producing K. pneumoniae in Taiwan is of great concern. PMID:26414183

  20. Emergence of OXA-48-Producing Klebsiella pneumoniae in Taiwan

    PubMed Central

    Ma, Ling; Wang, Jann-Tay; Wu, Tsu-Lan; Siu, L. Kristopher; Chuang, Yin-Ching; Lin, Jung-Chung; Lu, Min-Chi; Lu, Po-Liang

    2015-01-01

    The isolation of OXA-48-producing Enterobacteriaceae has increased dramatically in Mediterranean countries in the past 10 years, and has recently emerged in Asia. Between January 2012 and May 2014, a total of 760 carbapenem non-susceptible Klebsiella pneumoniae (CnSKP) isolates were collected during a Taiwan national surveillance. Carbapenemases were detected in 210 CnSKP isolates (27.6%), including 162 KPC-2 (n = 1), KPC-3, KPC-17, and NDM-1 (n = 1 each), OXA-48 (n = 4), IMP-8 (n = 18), and VIM-1 (n = 24). The four blaOXA-48 CnSKP isolates were detected in late 2013. Herein we report the emergence OXA-48-producing K. pneumoniae isolates in Taiwan. PFGE analysis revealed that the four isolates belonged to three different pulsotypes. Three isolates harboured blaCTX-M genes and belonged to MLST type ST11. In addition, the plasmids belonged to the incompatibility group, IncA/C. One isolate belonged to ST116 and the plasmid incompatibility group was non-typeable. The sequence upstream of the blaOXA-48 gene in all four isolates was identical to pKPOXA-48N1, a blaOXA-48-carrying plasmid. This is the first report of OXA-48-producing Enterobacteriaceae in Taiwan and the second report to identify blaOXA-48 on an IncA/C plasmid in K. pneumoniae. Given that three isolates belong to the same pandemic clone (ST11) and possess the IncA/C plasmid and similar plasmid digestion profile that indicated the role of clonal spread or plasmid for dissemination of blaOXA-48 gene, the emergence of OXA-48-producing K. pneumoniae in Taiwan is of great concern. PMID:26414183

  1. Fatal cross infection by carbapenem resistant Klebsiella in two liver transplant recipients

    PubMed Central

    Mathers, Amy J.; Cox, Heather L.; Bonatti, Hugo; Kitchel, Brandon; Brassinga, Ann Karen C.; Wispelwey, Brian; Sawyer, Robert G.; Pruett, Timothy L.; Hazen, Kevin C.; Patel, Jean B.; Sifri, Costi D.

    2010-01-01

    Members of the family Enterobacteriaceae including Klebsiella have re-emerged as major pathogens in solid organ transplantation. The recent appearance and dissemination of carbapenemase-producing Enterobacteriaceae in Europe and the northeastern United States represents a major challenge to the treatment of enteric gram-negative bacterial infections in immunocompromised patients; however, few reports have detailed the outcomes of such infections. Here we report two cases of Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella infections in orthotopic liver transplant recipients, which were the index case and initial secondary case for an outbreak of KPC-producing Enterobacteriaceae in our institution. In both instances, the pathogens were initially misidentified as being carbapenem sensitive, the infections recurred after cessation of directed therapy, and the patients ultimately succumbed to their infections. PMID:19254325

  2. CHAPTER IV-2 BACTERIA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Entomopathogenic bacteria provide an alternative to chemical pesticides used in insect control programs. Today, the principal microbial insecticides utilize spore forming bacteria or toxins produced by these bacteria as their active ingredients, either in formulations or by incorporation of toxin g...

  3. Klebsiella pneumonia: An unusual cause of ophthalmia neonatorum in a healthy newborn.

    PubMed

    Kumar, Jaya B; Silverstein, Evan; Wallace, David K

    2015-12-01

    Ophthalmia neonatorum is one of the most common infections during the neonatal period. Chlamydia trachomatis and Neisseria gonorrhoea must be ruled out, given their high virulence and systemic complications. We describe a case of ophthalmia neonatroum from Klebsiella pneumonia. Gram-negative organisms have been reported in hospital-acquired conjunctivitis (HAC), but we are unaware of any published reports of K. pneumonia conjunctivitis in an otherwise healthy full-term infant born in the United States who has received prophylaxis. It is important to promptly identify and treat Klebsiella conjunctivitis because it can lead to severe complications. PMID:26691043

  4. Harvesting energy of interaction between bacteria and bacteriophage in a membrane-less fuel cell.

    PubMed

    Gupta, Ragini; Bekele, Wasihun; Ghatak, Animangsu

    2013-11-01

    When a fuel and oxidant flow in laminar contact through a micro-fluidic channel, a sharp interface appears between the two liquids, which eliminate the need of a proton exchange membrane. This principle has been used to generate potential in a membrane-less fuel cell. This study use such a cell to harvest energy of interaction between a bacteria having negative charge on its surface and a bacteriophage with positive and negative charges on its tail and head, respectively. When Klebsiella pneumoniae (Kp6) and phage (P-Kp6) are pumped through a fuel cell fitted with two copper electrodes placed at its two sides, interaction between these two charged species at the interface results in a constant open circuit potential which varies with concentration of charged species but gets generated for both specific and non-specific bacteria and phage system. Oxygenation of bacteria or phage however diminishes the potential unlike in conventional microbial fuel cells. PMID:24021411

  5. Synthesis of Fe3O4 poly(styrene-glycidyl methacrylate) magnetic porous microspheres and application in the immobilization of Klebsiella sp. FD-3 to reduce Fe(III)EDTA in a NO(x) scrubbing solution.

    PubMed

    Wang, Xiaoyan; Zhou, Zuoming; Jing, Guohua

    2013-02-01

    Magnetic poly(styrene-glycidyl methacrylate) porous microspheres (MPPM) with high magnetic contents were prepared by surfactant reverse micelles and emulsion polymerization of monomers, in which the well-dispersed Fe(3)O(4) nanoparticles were modified by polyethylene glycol (PEG) and oleic acid (OA) respectively. The characterizations showed that both of the OA-MPPM and the PEG-MPPM were ferromagnetic, however, the OA-MPPM was used to immobilize the bacteria for more advantages. Therefore, the effects of monomer ratio, surfactant, crosslinker and amount of Fe(3)O(4) on the structure, morphology and magnetic contents of the OA-MPPM were investigated. Then, the OA-MPPM was utilized to immobilize Klebsiella sp. FD-3, an iron-reducing bacterium for Fe(III)EDTA reduction applied in NO(x) removal. Compared with free bacteria, the immobilized FD-3 showed a better tolerance to the unbeneficial pH and temperature conditions. PMID:23334160

  6. Characterization of nifH mutations of Klebsiella pneumoniae.

    PubMed Central

    Chang, C L; Davis, L C; Rider, M; Takemoto, D J

    1988-01-01

    Nucleotide changes in the nifH gene of Klebsiella pneumoniae were identified by DNA cloning and sequencing of six selected mutant strains. The strains were UN60, C-640-GC----TGC; UN116, C-67-TC----TTC; UN117, G-688-AG----AAG; UN1041, CG-302-C----CAC; UN1678, GC-713-C----GTC; and UN1795, G-439-AG----AAG. Their corresponding amino acid substitutions were UN60, Arg-214----Cys; UN116, Leu-23----Phe; UN117, Glu-230----Lys; UN1041, Arg-101----His; UN1678, Ala-238----Val; and UN1795, Glu-147----Lys. Results from Western and Northern blots of the mutant strains showed significant reductions in both steady-state levels of the accumulated Fe protein and nifH mRNA during derepression in the presence of serine. The relative specific activities of the nitrogenases in strains UN60, UN1041, and UN1795 were less than 2% of the wild type, whereas those in UN116, UN117, and UN1678 were between 28 and 40% of the wild type during enhanced derepression with serine. The residues of Arg-101 (UN1041), Glu-147 (UN1795), and Arg-214 (UN60) were invariant in sequences of a dozen diazotrophs that have been examined thus far. In UN1041, in which Arg-101 of the Fe protein was replaced by His, the Fe protein had a larger apparent molecular weight than that of the other strains on sodium dodecyl sulfate-gel electrophoresis, as detected with rabbit antiserum raised against the C-terminal peptide of the wild-type Fe protein. The reduced levels of nifH mRNA in point mutant strains suggests that nifH (the gene or gene product) may be involved in self-regulation. mRNA transcripts of different sizes were detected when a nifH-specific probe, CCKp2003, was used in the Northern blot hybridization. Images PMID:2457577

  7. Chlorine resistance patterns of bacteria from two drinking water distribution systems.

    PubMed Central

    Ridgway, H F; Olson, B H

    1982-01-01

    The relative chlorine sensitivities of bacteria isolated from chlorinated and unchlorinated drinking water distribution systems were compared by two independent methods. One method measured the toxic effect of free chlorine on bacteria, whereas the other measured the effect of combined chlorine. Bacteria from the chlorinated system were more resistant to both the combined and free forms of chlorine than those from the unchlorinated system, suggesting that there may be selection for more chlorine-tolerant microorganisms in chlorinated waters. Bacteria retained on the surfaces of 2.0-microns Nuclepore membrane filters were significantly more resistant to free chlorine compared to the total microbial population recovered on 0.2-micron membrane filters, presumably because aggregated cells or bacteria attached to suspended particulate matter exhibit more resistance than unassociated microorganisms. In accordance with this hypothesis, scanning electron microscopy of suspended particulate matter from the water samples revealed the presence of attached bacteria. The most resistant microorganisms were able to survive a 2-min exposure to 10 mg of free chlorine per liter. These included gram-positive spore-forming bacilli, actinomycetes, and some micrococci. The most sensitive bacteria were readily killed by chlorine concentrations of 1.0 mg liter-1 or less, and included most gram-positive micrococci, Corynebacterium/Arthrobacter, Klebsiella, Pseudomonas/Alcaligenes, Flavobacterium/Moraxella, and Acinetobacter. Images PMID:7149722

  8. Phenotypic and Molecular Characterization of Multidrug Resistant Klebsiella pneumoniae Isolated from a University Teaching Hospital, China

    PubMed Central

    Liu, Helu; Lü, Dongyue; Liang, Hong; Dou, Yuhong

    2014-01-01

    The multidrug-resistant rate of Klebsiella pneumoniae has risen rapidly worldwide. To better understand the multidrug resistance situation and molecular characterization of Klebsiella pneumoniae, a total of 153 Klebsiella pneumoniae isolates were collected, and drug susceptibility test was performed to detect its susceptibility patterns to 13 kinds of antibiotics. Phenotypic tests for carbapenemases ESBLs and AmpC enzyme-producing strains were performed to detect the resistance phenotype of the isolates. Then PCR amplification and sequencing analysis were performed for the drug resistance determinants. The results showed that 63 strains harbored blaCTX-M gene, and 14 strains harbored blaDHA gene. Moreover, there were 5 strains carrying blaKPC gene, among which 4 strains carried blaCTX-M, blaDHA and blaKPC genes, and these 4 strains were also resistant to imipenem. Our data indicated that drug-resistant Klebsiella pneumoniae were highly prevalent in the hospital. Thus it is warranted that surveillance of epidemiology of those resistant isolates should be a cause for concern, and appropriate drugs should be chosen. PMID:24740167

  9. Immunoproteomic to Analysis the Pathogenicity Factors in Leukopenia Caused by Klebsiella Pneumonia Bacteremia

    PubMed Central

    Liu, Haiyan; Cheng, Zhongle; Song, Wen; Wu, Wenyong; Zhou, Zheng

    2014-01-01

    Incidences of leukopenia caused by bacteremia have increased significantly and it is associated with prolonged hospital stay and increased cost. Immunoproteomic is a promising method to identify pathogenicity factors of different diseases. In the present study, we used immunoproteomic to analysis the pathogenicity factors in leukopenia caused by Klebsiella Pneumonia bacteremia. Approximately 40 protein spots localized in the 4 to 7 pI range were detected on two-dimensional electrophoresis gels, and 6 differentially expressed protein spots between 10 and 170 kDa were identified. Pathogenicity factors including S-adenosylmethionine synthetase, pyruvate dehydrogenase, glutathione synthetase, UDP-galactose-4-epimerase, acetate kinase A and elongation factor tu (EF-Tu). In validation of the pathogenicity factor, we used western blotting to show that Klebsiella pneumonia had higher (EF-Tu) expression when they accompanied by leukopenia rather than leukocytosis. Thus, we report 6 pathogenicity factors of leukopenia caused by Klebsiella pneumonia bacteremia, including 5 housekeeping enzymes and EF-Tu. We suggest EF-Tu could be a potential pathogenicity factor for leukopenia caused by Klebsiella pneumonia. PMID:25330314

  10. Genome Sequences of Klebsiella variicola Isolates from Dairy Animals with Bovine Mastitis from Newfoundland, Canada.

    PubMed

    Davidson, Fraser W; Whitney, Hugh G; Tahlan, Kapil

    2015-01-01

    Klebsiella variicola was recently reported as an emerging and/or previously misidentified species associated with opportunistic infections in humans. Here, we report the draft genome sequences of K. variicola isolates from two animals with clinical mastitis from a dairy farm in Newfoundland, Canada. PMID:26358587

  11. Successful Treatment of Carbapenemase-Producing Pandrug-Resistant Klebsiella pneumoniae Bacteremia.

    PubMed

    Camargo, Jose F; Simkins, Jacques; Beduschi, Thiago; Tekin, Akin; Aragon, Laura; Pérez-Cardona, Armando; Prado, Clara E; Morris, Michele I; Abbo, Lilian M; Cantón, Rafael

    2015-10-01

    New antibiotic options are urgently needed for the treatment of carbapenem-resistant Enterobacteriaceae infections. We report a 64-year-old female with prolonged hospitalization following an intestinal transplant who developed refractory bacteremia due to a serine carbapenemase-producing pandrug-resistant isolate of Klebsiella pneumoniae. After failing multiple antimicrobial regimens, the patient was successfully treated. PMID:26386029

  12. Complete Genome Sequence of Carbapenemase-Producing Klebsiella pneumoniae Myophage Matisse

    PubMed Central

    Provasek, Vincent E.; Lessor, Lauren E.; Cahill, Jesse L.; Rasche, Eric S.

    2015-01-01

    Klebsiella pneumoniae is a leading cause of nosocomial infections in the United States. Due to the emergence of multidrug-resistant strains, phages targeting K. pneumoniae may be a useful alternative against this pathogen. Here, we announce the complete genome of K. pneumoniae pseudo-T-even myophage Matisse and describe its features. PMID:26430049

  13. Complete Genome Sequence of Klebsiella pneumoniae Carbapenemase-Producing K. pneumoniae Myophage Miro

    PubMed Central

    Mijalis, Eleni M.; Lessor, Lauren E.; Cahill, Jesse L.; Rasche, Eric S.

    2015-01-01

    Klebsiella pneumoniae is a Gram-negative pathogen frequently associated with antibiotic-resistant nosocomial infections. Bacteriophage therapy against K. pneumoniae may be possible to combat these infections. The following describes the complete genome sequence and key features of the pseudo-T-even K. pneumoniae carbapenemase (KPC)-producing K. pneumoniae myophage Miro. PMID:26430050

  14. Complete Genome Sequence of Klebsiella pneumoniae Carbapenemase-Producing K. pneumoniae Siphophage Sushi

    PubMed Central

    Nguyen, Dat T.; Lessor, Lauren E.; Cahill, Jesse L.; Rasche, Eric S.

    2015-01-01

    Klebsiella pneumoniae is a Gram-negative bacterium in the family Enterobacteriaceae. It is associated with numerous nosocomial infections, including respiratory and urinary tract infections in humans. The following reports the complete genome sequence of K. pneumoniae carbapenemase-producing K. pneumoniae T1-like siphophage Sushi and describes its major features. PMID:26337889

  15. New Delhi metallo-?-lactamase in Klebsiella pneumoniae and Escherichia coli, Canada.

    PubMed

    Mulvey, Michael R; Grant, Jennifer M; Plewes, Katherine; Roscoe, Diane; Boyd, David A

    2011-01-01

    Multidrug-resistant Klebsiella pneumoniae and Escherichia coli isolates harboring New Delhi metallo-?-lactamase (NDM-1) were isolated from a patient who had returned to Canada from India. The NDM-1 gene was found on closely related incompatibility group A/C type plasmids. The occurrence of NDM-1 in North America is a major public health concern. PMID:21192866

  16. Complete genome sequence of a Klebsiella pneumoniae strain isolated from a known cotton insect boll vector

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the...

  17. Neonatal Klebsiella Septicaemia in Ibadan: Implications for Neonatal Care in Developing Countries.

    ERIC Educational Resources Information Center

    Omokhodion, S. I.; And Others

    1993-01-01

    The antecedent events, clinical features, prevalence, and complications of neonatal Klebsiella septicaemia in 73 infants admitted to a special care baby unit in Nigeria are retrospectively reviewed and compared with those of 72 infants who had no risk factors for sepsis admitted to the same unit during the same period. A nosocomial acquisition of…

  18. Genome Sequences of Klebsiella variicola Isolates from Dairy Animals with Bovine Mastitis from Newfoundland, Canada

    PubMed Central

    Davidson, Fraser W.; Whitney, Hugh G.

    2015-01-01

    Klebsiella variicola was recently reported as an emerging and/or previously misidentified species associated with opportunistic infections in humans. Here, we report the draft genome sequences of K. variicola isolates from two animals with clinical mastitis from a dairy farm in Newfoundland, Canada. PMID:26358587

  19. Phenotypic and genotypic characterization of Klebsiella pneumonia recovered from nonhuman primates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Klebsiella pneumoniae is a zoonotic, Gram-negative member of the family Enterobacteriaceae and is the causative agent of nosocomial septicemic, pneumonic, and urinary tract infections. Recently, pathogenic strains of K. pneumoniae sharing a hypermucoviscosity (HMV) phenotype have been attributed to ...

  20. Klebsiella pneumonia, a Microorganism that Approves the Non-linear Responses to Antibiotics and Window Theory after Exposure to Wi-Fi 2.4 GHz Electromagnetic Radiofrequency Radiation

    PubMed Central

    Taheri, M.; Mortazavi, S. M. J.; Moradi, M.; Mansouri, Sh.; Nouri, F.; Mortazavi, S. A. R.; Bahmanzadegan, F.

    2015-01-01

    Background Drug resistance is widely believed to be an increasingly serious threat to global public health. We have previously reported that short term exposure of microorganisms to diagnostic ultrasound waves could significantly alter their sensitivity to antibiotics. In our previous studies, Klebsiella pneumoniae showed major differences in the sensitivity to antibiotics in exposed and non-exposed samples. This study was aimed at investigating the alteration of antibiotic resistance of Klebsiella pneumonia, after exposure to Wi-Fi 2.4 GHz electromagnetic radiofrequency radiation. Materials and Methods In this in vitro study, three replicate agar plates were used for each test. The antibiotic susceptibility test was carried out using disc diffusion method on Mueller Hinton agar plates and the inhibition zones in both control and exposed groups were measured. A common Wi-Fi router was used in this study as the radiofrequency exposure source. Irradiated samples were exposed to Wi-Fi radiofrequency radiation for 3, 4.5 and 8 hours. Results Statistically significant variations of sensitivity to antibiotics were found for all studied antibiotics after 4.5 hours of RF exposure, compared to non-exposed bacteria. Interestingly, the mean diameters of the inhibition zones after 3 hours of exposure were less than those exposed for 4.5 hours. Following this rise in the sensitivity to antibiotics, a fall was observed in the bacteria exposed for 8 hours for all studied antibiotics. Conclusion The findings of this study show a statistically significant rise in the sensitivity of Klebsiella pneumoniae to different antibiotics after 4.5 hours of exposure to 2.4 GHz Wi-Fi radiation, followed by a fall after 8 hours of exposure. These observations can be interpreted by the concept of non-linearity in the responses of Klebsiella pneumoniae to different antibiotics after exposure to electromagnetic radiofrequency radiation. As in this study a minimum level of effect was needed for the induction of adaptive response, these results also confirm the validity of the so-called “window theory”. PMID:26396967

  1. Characterization of CTX-M-Type Extend-Spectrum ?-Lactamase Producing Klebsiella spp. in Kashan, Iran

    PubMed Central

    Afzali, Hasan; Firoozeh, Farzaneh; Amiri, Atena; Moniri, Rezvan; Zibaei, Mohammad

    2015-01-01

    Context: The CTX-M family consists of more than 50 ?-lactamases, which are grouped on the basis of sequences into five subtypes including CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9 and CTX-M-25. Objectives: The current study aimed to detect subtypes of CTX-M extended-spectrum ?-lactamases (ESBLs) among ESBL positive Klebsiella isolates from patients in Kashan, Iran. Materials and Methods: A total of 100 clinical isolates of Klebsiella were collected and the isolates, which showed resistance or reduced susceptibility to cefotaxime, ceftazidime and/or aztreonam by the disk diffusion method were selected. These isolates were identified as ESBL-producing isolates by double disk synergy tests using clavulanic acid, cefotaxime, ceftazidime and aztreonam. The blaCTX-M type determinants were identified by the Polymerase Chain Reaction (PCR) method followed by DNA sequencing. Results: Of the 100 Klebsiella isolates, 41 (41%) demonstrated resistance or reduced susceptibility to ceftazidime and/or aztreonam and 35% (n = 35) were ESBL-producers. Twenty-eight (8o%) of the ESBL-producing isolates carried the blaCTX-M type genes. Based on PCR assays and sequencing of blaCTX-M genes, CTX-M-1, CTX-M-2 and CTX-M-9 were identified in 21 (60%), 15 (42%) and nine (34%) of these isolates, respectively (GenBank accession numbers KJ803828-KJ803829). Conclusions: Our study showed that the frequency of blaCTX-M genes among Klebsiella isolates in our region is at an alarming rate. Also, we found a high prevalence of blaCTX-M-1 ?-lactamase in Klebsiella isolates in Kashan. PMID:26587221

  2. Outcomes and Risk Factors for Mortality among Patients Treated with Carbapenems for Klebsiella spp. Bacteremia

    PubMed Central

    Biehle, Lauren R.; Cottreau, Jessica M.; Thompson, David J.; Filipek, Rachel L.; O’Donnell, J. Nicholas; Lasco, Todd M.; Mahoney, Monica V.; Hirsch, Elizabeth B.

    2015-01-01

    Background Extensive dissemination of carbapenemase-producing Enterobacteriaceae has led to increased resistance among Klebsiella species. Carbapenems are used as a last resort against resistant pathogens, but carbapenemase production can lead to therapy failure. Identification of risk factors for mortality and assessment of current susceptibility breakpoints are valuable for improving patient outcomes. Aim The objective of this study was to evaluate outcomes and risk factors for mortality among patients treated with carbapenems for Klebsiella spp. bacteremia. Methods Patients hospitalized between 2006 and 2012 with blood cultures positive for Klebsiella spp. who received ? 48 hours of carbapenem treatment within 72 hours of positive culture were included in this retrospective study. Patient data were retrieved from electronic medical records. Multivariate logistic regression was used to identify risk factors for 30-day hospital mortality. Results One hundred seven patients were included. The mean patient age was 61.5 years and the median APACHE II score was 13 ± 6.2. Overall, 30-day hospital mortality was 9.3%. After adjusting for confounding variables, 30-day mortality was associated with baseline APACHE II score (OR, 1.17; 95% CI, 1.01–1.35; P = 0.03), length of stay prior to index culture (OR, 1.03; 95% CI, 1.00–1.06; P = 0.04), and carbapenem non-susceptible (imipenem or meropenem MIC > 1 mg/L) infection (OR, 9.08; 95% CI, 1.17–70.51; P = 0.04). Conclusions Baseline severity of illness and length of stay prior to culture were associated with 30-day mortality and should be considered when treating patients with Klebsiella bacteremia. These data support the change in carbapenem breakpoints for Klebsiella species. PMID:26618357

  3. Genomics of Probiotic Bacteria

    NASA Astrophysics Data System (ADS)

    O'Flaherty, Sarah; Goh, Yong Jun; Klaenhammer, Todd R.

    Probiotic bacteria from the Lactobacillus and Bifidobacterium species belong to the Firmicutes and the Actinobacteria phylum, respectively. Lactobacilli are members of the lactic acid bacteria (LAB) group, a broadly defined family of microorganisms that ferment various hexoses into primarily lactic acid. Lactobacilli are typically low G + C gram-positive species which are phylogenetically diverse, with over 100 species documented to date. Bifidobacteria are heterofermentative, high G + C content bacteria with about 30 species of bifidobacteria described to date.

  4. Syntrophic co-culture of Bacillus subtilis and Klebsiella pneumonia for degradation of kraft lignin discharged from rayon grade pulp industry.

    PubMed

    Yadav, Sangeeta; Chandra, Ram

    2015-07-01

    In order to search the degradability of kraft lignin, the potential bacterial strains Bacillus subtilis (GU193980) and Klebsiella pneumoniae (GU193981) were isolated, screened and applied in axenic and co-culture conditions. Results revealed that mixed culture showed better decolorization efficiency (80%) and reduction of pollution parameters (COD 73% and BOD 62%) than axenic culture. This indicated syntrophic growth of these two bacteria rather than any antagonistic effect. The HPLC analysis of degraded samples of kraft lignin has shown the reduction in peak area compared to control, suggesting that decrease in color intensity might be largely attributed to the degradation of lignin by isolated bacteria. Further, the GC-MS analysis showed that most of the compounds detected in control were diminished after bacterial treatment. Further, the seed germination test using Phaseolus aureus has supported the detoxification of bacterial decolorized kraft lignin for environmental safety. All these observations have revealed that the developed bacterial co-culture was capable for the effective degradation and decolorization of lignin containing rayon grade pulp mill wastewater for environmental safety. PMID:26141897

  5. A Dimeric Chlorite Dismutase Exhibits O2-Generating Activity and Acts as a Chlorite Antioxidant in Klebsiella pneumoniae MGH 78578

    PubMed Central

    2015-01-01

    Chlorite dismutases (Clds) convert chlorite to O2 and Cl–, stabilizing heme in the presence of strong oxidants and forming the O=O bond with high efficiency. The enzyme from the pathogen Klebsiella pneumoniae (KpCld) represents a subfamily of Clds that share most of their active site structure with efficient O2-producing Clds, even though they have a truncated monomeric structure, exist as a dimer rather than a pentamer, and come from Gram-negative bacteria without a known need to degrade chlorite. We hypothesized that KpCld, like others in its subfamily, should be able to make O2 and may serve an in vivo antioxidant function. Here, it is demonstrated that it degrades chlorite with limited turnovers relative to the respiratory Clds, in part because of the loss of hypochlorous acid from the active site and destruction of the heme. The observation of hypochlorous acid, the expected leaving group accompanying transfer of an oxygen atom to the ferric heme, is consistent with the more open, solvent-exposed heme environment predicted by spectroscopic measurements and inferred from the crystal structures of related proteins. KpCld is more susceptible to oxidative degradation under turnover conditions than the well-characterized Clds associated with perchlorate respiration. However, wild-type K. pneumoniae has a significant growth advantage in the presence of chlorate relative to a ?cld knockout strain, specifically under nitrate-respiring conditions. This suggests that a physiological function of KpCld may be detoxification of endogenously produced chlorite. PMID:25437493

  6. Bacteria turn tiny gears

    SciTech Connect

    2009-01-01

    Swarms of bacteria turn two 380-micron long gears, opening the possibility of building hybrid biological machines at the microscopic scale. Read more at Wired: http://www.wired.com/wiredscience/2009/12/bacterial-micro-machine/#more-15684 or Scientific American: http://www.scientificamerican.com/article.cfm?id=brownian-motion-bacteria

  7. Bleach vs. Bacteria

    MedlinePLUS

    ... Inside Life Science > Bleach vs. Bacteria Inside Life Science View All Articles | Inside Life Science Home Page Bleach vs. Bacteria By Sharon Reynolds ... For Proteins, Form Shapes Function This Inside Life Science article also appears on LiveScience . Learn about related ...

  8. Bloodstream infections in intensive care unit patients: distribution and antibiotic resistance of bacteria

    PubMed Central

    Russotto, Vincenzo; Cortegiani, Andrea; Graziano, Giorgio; Saporito, Laura; Raineri, Santi Maurizio; Mammina, Caterina; Giarratano, Antonino

    2015-01-01

    Bloodstream infections (BSIs) are among the leading infections in critically ill patients. The case-fatality rate associated with BSIs in patients admitted to intensive care units (ICUs) reaches 35%–50%. The emergence and diffusion of bacteria with resistance to antibiotics is a global health problem. Multidrug-resistant bacteria were detected in 50.7% of patients with BSIs in a recently published international observational study, with methicillin resistance detected in 48% of Staphylococcus aureus strains, carbapenem resistance detected in 69% of Acinetobacter spp., in 38% of Klebsiella pneumoniae, and in 37% of Pseudomonas spp. Prior hospitalization and antibiotic exposure have been identified as risk factors for infections caused by resistant bacteria in different studies. Patients with BSIs caused by resistant strains showed an increased risk of mortality, which may be explained by a higher incidence of inappropriate empirical therapy in different studies. The molecular genetic characterization of resistant bacteria allows the understanding of the most common mechanisms underlying their resistance and the adoption of surveillance measures. Knowledge of epidemiology, risk factors, mechanisms of resistance, and outcomes of BSIs caused by resistant bacteria may have a major influence on global management of ICU patients. The aim of this review is to provide the clinician an update on BSIs caused by resistant bacteria in ICU patients. PMID:26300651

  9. Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

    PubMed Central

    Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

    2001-01-01

    The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the ?70 promoters P1, P4 and P5, to the ?E promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like ?70 promoter and two proximal promoters: a heat-induced ?E-like promoter and a ?70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal ?70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced ?E-like promoter and a ?70 promoter. A second proximal ?70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

  10. Multidrug Resistance in Bacteria

    PubMed Central

    Nikaido, Hiroshi

    2010-01-01

    Large amounts of antibiotics used for human therapy, as well as for farm animals and even for fish in aquaculture, resulted in the selection of pathogenic bacteria resistant to multiple drugs. Multidrug resistance in bacteria may be generated by one of two mechanisms. First, these bacteria may accumulate multiple genes, each coding for resistance to a single drug, within a single cell. This accumulation occurs typically on resistance (R) plasmids. Second, multidrug resistance may also occur by the increased expression of genes that code for multidrug efflux pumps, extruding a wide range of drugs. This review discusses our current knowledge on the molecular mechanisms involved in both types of resistance. PMID:19231985

  11. Bacteria TMDL Projects 

    E-print Network

    Wythe, Kathy

    2007-01-01

    stream_source_info Bacteria TMDL projects.pdf.txt stream_content_type text/plain stream_size 2550 Content-Encoding ISO-8859-1 stream_name Bacteria TMDL projects.pdf.txt Content-Type text/plain; charset=ISO-8859-1 tx H2O... of the projects are listed below. ? Peach CreekWater Quality Improvement Project ? Monitoring and Educational Programs Focused on Bacteria and Nutrient Runoff on Dairy Operations in the LeonWatershed ? Development of the Plum CreekWPP ? Impact of Proper...

  12. Effect of Molybdenum Starvation and Tungsten on the Synthesis of Nitrogenase Components in Klebsiella pneumoniae

    PubMed Central

    Brill, Winston J.; Steiner, Ann L.; Shah, Vinod K.

    1974-01-01

    Klebsiella pneumoniae M5a1 grows well in the presence or absence of molybdenum in media containing excess NH4+. However, growth on N2 is completely dependent on the presence of molybdenum in the medium. Tungstate competes with the molybdate requirement during growth on N2. In molybdenum-depleted medium, neither protein component of nitrogenase is active and neither component can be detected antigenically. These data provide evidence that molybdenum is an inducer of nitrogenase synthesis. PMID:4598014

  13. First Report of Ceftazidime-Avibactam Resistance in a KPC-3-Expressing Klebsiella pneumoniae Isolate.

    PubMed

    Humphries, Romney M; Yang, Shangxin; Hemarajata, Peera; Ward, Kevin W; Hindler, Janet A; Miller, Shelley A; Gregson, Aric

    2015-10-01

    Ceftazidime-avibactam is the first antimicrobial approved by the U.S. FDA for the treatment of carbapenem-resistant Enterobacteriaceae. Avibactam, a non-?-lactam ?-lactamase inhibitor, inactivates class A serine carbapenemases, including Klebsiella pneumoniae carbapenemase (KPC). We report a KPC-producing K. pneumoniae isolate resistant to ceftazidime-avibactam (MIC, 32/4 ?g/ml) from a patient with no prior treatment with ceftazidime-avibactam. PMID:26195508

  14. Community-Acquired Pyelonephritis in Pregnancy Caused by KPC-Producing Klebsiella pneumoniae.

    PubMed

    Khatri, Asma; Naeger Murphy, Nina; Wiest, Peter; Osborn, Melissa; Garber, Kathleen; Hecker, Michelle; Hurless, Kelly; Rudin, Susan D; Jacobs, Michael R; Kalayjian, Robert C; Salata, Robert A; van Duin, David; Perez, Federico; Bonomo, Robert A; Paterson, David L; Harris, Patrick N A

    2015-08-01

    Carbapenem-resistant Enterobacteriaceae (CRE) usually infect patients with significant comorbidities and health care exposures. We present a case of a pregnant woman who developed community-acquired pyelonephritis caused by KPC-producing Klebsiella pneumoniae. Despite antibiotic treatment, she experienced spontaneous prolonged rupture of membranes, with eventual delivery of a healthy infant. This report demonstrates the challenge that CRE may pose to the effective treatment of common infections in obstetric patients, with potentially harmful consequences to maternal and neonatal health. PMID:26185273

  15. Activity of Imipenem against Klebsiella pneumoniae Biofilms In Vitro and In Vivo

    PubMed Central

    Chen, Ping; Seth, Akhil K.; Abercrombie, Johnathan J.; Mustoe, Thomas A.

    2014-01-01

    Encapsulated Klebsiella pneumoniae has emerged as one of the most clinically relevant and more frequently encountered opportunistic pathogens in combat wounds as the result of nosocomial infection. In this report, we show that imipenem displayed potent activity against established K. pneumoniae biofilms under both static and flow conditions in vitro. Using a rabbit ear model, we also demonstrated that imipenem was highly effective against preformed K. pneumoniae biofilms in wounds. PMID:24247132

  16. Capsular Polysaccharide Is Involved in NLRP3 Inflammasome Activation by Klebsiella pneumoniae Serotype K1.

    PubMed

    Hua, Kuo-Feng; Yang, Feng-Ling; Chiu, Hsiao-Wen; Chou, Ju-Ching; Dong, Wei-Chih; Lin, Chien-Nan; Lin, Chai-Yi; Wang, Jin-Town; Li, Lan-Hui; Chiu, Huan-Wen; Chiu, Yi-Chich; Wu, Shih-Hsiung

    2015-09-01

    Klebsiella pneumoniae (strain 43816, K2 serotype) induces interleukin-1? (IL-1?) secretion, but neither the bacterial factor triggering the activation of these inflammasome-dependent responses nor whether they are mediated by NLRP3 or NLRC4 is known. In this study, we identified a capsular polysaccharide (K1-CPS) in K. pneumoniae (NTUH-K2044, K1 serotype), isolated from a primary pyogenic liver abscess (PLA K. pneumoniae), as the Klebsiella factor that induces IL-1? secretion in an NLRP3-, ASC-, and caspase-1-dependent manner in macrophages. K1-CPS induced NLRP3 inflammasome activation through reactive oxygen species (ROS) generation, mitogen-activated protein kinase phosphorylation, and NF-?B activation. Inhibition of both the mitochondrial membrane permeability transition and mitochondrial ROS generation inhibited K1-CPS-mediated NLRP3 inflammasome activation. Furthermore, IL-1? secretion in macrophages infected with PLA K. pneumoniae was shown to depend on NLRP3 but also on NLRC4 and TLR4. In macrophages infected with a K1-CPS deficiency mutant, an lipopolysaccharide (LPS) deficiency mutant, or K1-CPS and LPS double mutants, IL-1? secretion levels were lower than those in cells infected with wild-type PLA K. pneumoniae. Our findings indicate that K1-CPS is one of the Klebsiella factors of PLA K. pneumoniae that induce IL-1? secretion through the NLRP3 inflammasome. PMID:26077758

  17. Competitive adsorption of heavy metals by extracellular polymeric substances extracted from Klebsiella sp. J1.

    PubMed

    Yang, Jixian; Wei, Wei; Pi, Shanshan; Ma, Fang; Li, Ang; Wu, Dan; Xing, Jie

    2015-11-01

    The adsorption of Cu(2+) and Zn(2+) by extracellular polymeric substances (EPS) extracted from Klebsiella sp. J1 and competitive adsorption mechanism were investigated. Equilibrium adsorption capacities of Cu(2+) (1.77mMg(-1)) on Klebsiella sp. J1 EPS were higher than those of Zn(2+) (1.36mMg(-1)) in single systems. The competitive Langmuir and Langmuir-Freundlich isotherm models were proven to be effective in describing the experimental data of binary component system. The three dimensional sorption surfaces of binary component system demonstrated that the presence of Cu(2+) more significantly decreased the sorption of Zn(2+), but the sorption of Cu(2+) was not disturbed by the presence of Zn(2+). FTIR and EEM results revealed the adsorption sites of Cu(2+) entirely overlapped with those of Zn(2+). Cu(2+) and Zn(2+) showed competitive adsorption in binary systems, and Cu(2+) was preferentially adsorbed because of the stronger complexation ability of the protein-like substances in Klebsiella sp. J1 EPS. PMID:26291413

  18. Prevalence of ESBL-Producing Klebsiella pneumoniae Isolates in Tertiary Care Hospital

    PubMed Central

    Sarojamma, Vemula; Ramakrishna, Vadde

    2011-01-01

    Extended-spectrum ? lactamases (ESBLs) continue to be a major challenge in clinical setups world over, conferring resistance to the expanded-spectrum cephalosporins. An attempt was made to study the prevalence of ESBL-producing Klebsiella pneumoniae clinical isolates in a tertiary care hospital in Kurnool. A total of hundred collected isolates of Klebsiella pneumoniae was studied for their susceptibility patterns to various antibiotics and detection of ESBL producers by double disc synergy test (DDST) and phenotypic confirmatory disc diffusion test (PCDDT). Of the 100 isolates tested for their antibiogram, 61% isolates have shown susceptibility to 3rd-generation cepholosporins and 39% were resistant. Amoxycillin showed the highest percentage of resistance followed by tetracyclins and cotrimoxazole. Among 39 resistant isolates of Klebsiella pneumoniae, 17 were ESBL producers detected by DDST and PCDDT. ESBL producers were more in the hospital isolates (28%) compared to community isolates (6%). Maximum percentage of ESBL producers were noticed from blood sample with 57.14%. In the present study, a large number of isolates were found to be multidrug resistant and ESBL producers. PCDDT was found to be better than DDST in the detection of ESBLs. Continued monitoring of drug resistance is necessary in clinical settings for proper disease management. PMID:23724303

  19. Prevalence of ESBL-Producing Klebsiella pneumoniae Isolates in Tertiary Care Hospital.

    PubMed

    Sarojamma, Vemula; Ramakrishna, Vadde

    2011-01-01

    Extended-spectrum ? lactamases (ESBLs) continue to be a major challenge in clinical setups world over, conferring resistance to the expanded-spectrum cephalosporins. An attempt was made to study the prevalence of ESBL-producing Klebsiella pneumoniae clinical isolates in a tertiary care hospital in Kurnool. A total of hundred collected isolates of Klebsiella pneumoniae was studied for their susceptibility patterns to various antibiotics and detection of ESBL producers by double disc synergy test (DDST) and phenotypic confirmatory disc diffusion test (PCDDT). Of the 100 isolates tested for their antibiogram, 61% isolates have shown susceptibility to 3rd-generation cepholosporins and 39% were resistant. Amoxycillin showed the highest percentage of resistance followed by tetracyclins and cotrimoxazole. Among 39 resistant isolates of Klebsiella pneumoniae, 17 were ESBL producers detected by DDST and PCDDT. ESBL producers were more in the hospital isolates (28%) compared to community isolates (6%). Maximum percentage of ESBL producers were noticed from blood sample with 57.14%. In the present study, a large number of isolates were found to be multidrug resistant and ESBL producers. PCDDT was found to be better than DDST in the detection of ESBLs. Continued monitoring of drug resistance is necessary in clinical settings for proper disease management. PMID:23724303

  20. Carbapenemase-Producing Klebsiella pneumoniae in Romania: A Six-Month Survey

    PubMed Central

    Straut, Monica; Usein, Codruta Romanita; Cristea, Dana; Ciontea, Simona; Codita, Irina; Rafila, Alexandru; Nica, Maria; Buzea, Mariana; Baicus, Anda; Ghita, Mihaela Camelia; Nistor, Irina; Tuchilu?, Cristina; Indreas, Marina; Antohe, Felicia; Glasner, Corinna; Grundmann, Hajo; Jasir, Aftab; Damian, Maria

    2015-01-01

    This study presents the first characterization of carbapenem-non-susceptible Klebsiella pneumoniae isolates by means of a structured six-month survey performed in Romania as part of an Europe-wide investigation. Klebsiella pneumoniae clinical isolates from different anatomical sites were tested for antibiotic susceptibility by phenotypic methods and confirmed by PCR for the presence of four carbapenemase genes. Genome macrorestriction fingerprinting with XbaI was used to analyze the relatedness of carbapenemase-producing Klebsiella pneumoniae isolates collected from eight hospitals. Among 75 non-susceptible isolates, 65 were carbapenemase producers. The most frequently identified genotype was OXA-48 (n = 51 isolates), eight isolates were positive for blaNDM-1 gene, four had the blaKPC-2 gene, whereas two were positive for blaVIM-1. The analysis of PFGE profiles of OXA-48 and NDM-1 producing K. pneumoniae suggests inter-hospitals and regional transmission of epidemic clones. This study presents the first description of K. pneumoniae strains harbouring blaKPC-2 and blaVIM-1 genes in Romania. The results of this study highlight the urgent need for the strengthening of hospital infection control measures in Romania in order to curb the further spread of the antibiotic resistance. PMID:26599338

  1. Bacteria in shear flow

    E-print Network

    Marcos, Ph.D. Massachusetts Institute of Technology

    2011-01-01

    Bacteria are ubiquitous and play a critical role in many contexts. Their environment is nearly always dynamic due to the prevalence of fluid flow: creeping flow in soil, highly sheared flow in bodily conduits, and turbulent ...

  2. Indicator For Pseudomonas Bacteria

    NASA Technical Reports Server (NTRS)

    Margalit, Ruth

    1990-01-01

    Characteristic protein extracted and detected. Natural protein marker found in Pseudomonas bacteria. Azurin, protein containing copper readily extracted, purified, and used to prepare antibodies. Possible to develop simple, fast, and accurate test for marker carried out in doctor's office.

  3. Plasmid Mediated Antibiotic Resistance in Isolated Bacteria From Burned Patients

    PubMed Central

    Beige, Fahimeh; Baseri Salehi, Majid; Bahador, Nima; Mobasherzadeh, Sina

    2014-01-01

    Background: Nowadays, the treatment of burned patients is difficult because of the high frequency of infection with antibiotic resistance bacteria. Objectives: This study was conducted to evaluate the level of antibiotic resistance in Gram-negative bacteria and its relation with the existence of plasmid. Materials and Methods: The samples were collected from two hundred twenty hospitalized burned patients in Isfahan burn hospital during a three-month period (March 2012 to June 2012). The samples were isolated and the Gram-negative bacteria were identified using phenotypic method and API 20E System. Antibiotic susceptibility and plasmid profile were determined by standard Agar disc diffusion and plasmid spin column extraction methods. Results: Totally 117 Gram-negative bacteria were isolated, the most common were Pseudomonas aerugionsa (37.6%), P. fluorescens (25.6%), Acinetobacter baumanii (20/5%) and Klebsiella pneumoniae (7.6%), respectively. The isolates showed high frequency of antibiotic resistance against ceftazidime and co-amoxiclave (100%) and low frequency of antibiotic resistance against amikacin with (70%).The results indicated that 60% of the isolates harboured plasmid. On the other hand, the patients infected with A. baumanii and P. aeruginosa were cured (with 60% frequency) whereas, those infected with P. fluorescens were not cured. Hence, probably antibiotic resistance markers of A. baumanii and P. aeruginosa are plasmid mediated; however, P. fluorescens is chromosomally mediated. Conclusions: Based on our findings, P. aerugionsa is a major causative agent of wound infections and amikacin could be considered as a more effective antibiotic for treatment of the burned patients. PMID:25789121

  4. Occurrence of carbapenemase-producing bacteria in coastal recreational waters.

    PubMed

    Montezzi, Lara Feital; Campana, Eloiza Helena; Corrêa, Laís Lisboa; Justo, Livia Helena; Paschoal, Raphael Paiva; da Silva, Isabel Lemos Vieira Dias; Souza, Maria do Carmo Maciel; Drolshagen, Marcia; Picão, Renata Cristina

    2015-02-01

    The spread of carbapenemase-producing Gram-negative rods is an emerging global problem. Although most infections due to carbapenemase producers are limited to healthcare institutions, reports of the occurrence of clinically relevant carbapenemase producers in sewage and polluted rivers are increasingly frequent. Polluted rivers flowing to oceans may contaminate coastal waters with multidrug-resistant bacteria, potentially threatening the safety of recreational activities in these locations. Here we assessed the occurrence of carbapenemase producers in water from touristic beaches located in Rio de Janeiro, Brazil, showing distinct pollution patterns. The presence of enterobacteria was noted, including the predominantly environmental genus Kluyvera spp., producing either Klebsiella pneumoniae carbapenemase (KPC) or Guyana extended-spectrum (GES)-type carbapenemases and often associated with quinolone resistance determinants. An Aeromonas sp. harbouring blaKPC and qnrS was also observed. These findings strengthen the role of aquatic matrices as reservoirs and vectors of clinically relevant antimicrobial-resistant bacteria, with potential to favour the spread of these resistance threats throughout the community. PMID:25499185

  5. Raman spectroscopic differentiation of planktonic bacteria and biofilms.

    PubMed

    Kusi?, Dragana; Kampe, Bernd; Ramoji, Anuradha; Neugebauer, Ute; Rösch, Petra; Popp, Jürgen

    2015-09-01

    Both biofilm formations as well as planktonic cells of water bacteria such as diverse species of the Legionella genus as well as Pseudomonas aeruginosa, Klebsiella pneumoniae, and Escherichia coli were examined in detail by Raman microspectroscopy. Production of various molecules involved in biofilm formation of tested species in nutrient-deficient media such as tap water was observed and was particularly evident in the biofilms formed by six Legionella species. Biofilms of selected species of the Legionella genus differ significantly from the planktonic cells of the same organisms in their lipid amount. Also, all Legionella species have formed biofilms that differ significantly from the biofilms of the other tested genera in the amount of lipids they produced. We believe that the significant increase in the synthesis of this molecular species may be associated with the ability of Legionella species to form biofilms. In addition, a combination of Raman microspectroscopy with chemometric approaches can distinguish between both planktonic form and biofilms of diverse bacteria and could be used to identify samples which were unknown to the identification model. Our results provide valuable data for the development of fast and reliable analytic methods based on Raman microspectroscopy, which can be applied to the analysis of tap water-adapted microorganisms without any cultivation step. PMID:26123442

  6. Cellulolytic activity and structure of symbiotic bacteria in locust guts.

    PubMed

    Su, L-J; Liu, H; Li, Y; Zhang, H-F; Chen, M; Gao, X-H; Wang, F-Q; Song, A-D

    2014-01-01

    Locusts are able to digest the cellulose of Gramineae plants, resulting in their being considered as major crop pests. To illustrate the mechanism involved in cellulose digestion, the cellulolytic activity and zymography in the gut contents of 16 locust species were determined using carboxymethyl cellulose (CMC) as substrate. The diversity of gut symbiotic bacteria was studied using denaturing gradient gel electrophoresis (DGGE). The results showed that high CMC activity was present in Acrididae gut fluid (mean 356.4 U/g proteins). Of the 5 locust species, Oxya chinensis had the highest diversity of intestinal symbiotic bacteria, characterized by the DGGE profile containing more than 20 bands of 16S rRNA. Klebsiella pneumoniae, in the gut of Locusta migratoria manilensis, was identified as the most abundant symbiotic bacterium by DNA sequencing, with a relative abundance of 19.74%. In comparison, Methylobacterium sp was the most dominant species in the Atractomorpha sinensis gut, with a relative abundance of 29.04%. The results indicated that the cellulolytic enzymes and gut microbial communities probably reflected their phylogenetic relationship with different locust species and associated feeding strategies. PMID:25299108

  7. [Prevalence of carbapenemase-producing bacteria in hospitals in Saxony, Germany].

    PubMed

    Ehrhard, I; Karaalp, A-K; Hackel, T; Höll, G; Rodewald, N; Reif, U; Kaase, M; Eckmanns, T; Sydow, W

    2014-04-01

    The presence of pathogenic bacteria with acquired carbapenem resistance constitutes an increasing problem for infection control and infectious disease management. Prompted by an outbreak of infections with Klebsiella pneumoniae producing the carbapenemase KPC-2 at a hospital in Saxony, the Saxon State Ministry of Social Affairs and Consumer Protection (SMS) initiated a point-prevalence survey for carbapenemase-producing gram-negative bacteria. Wards at 53 hospitals in Saxony, mainly intensive care units, were investigated between October 2012 and February 2013. Stool samples and rectal swabs of 1,037 patients were analyzed for the presence of bacteria with resistance against four major groups of antibiotics (4MRGN). Carbapenemase producers were detected in 3 patients [0.3% CI95 (0.0596; 0.843)] and carbapenem-resistant bacteria without carbapenemases were detected in 9 patients [0.9% CI95 (0.397; 1.64)]. Furthermore, antimicrobial susceptibility testing revealed 166 patients [16.0% CI95 (13.82; 18.38)] with extended-spectrum beta-lactamase (ESBL)-producing bacteria. At the time of investigation, K. pneumoniae producing the carbapenemase KPC-2 was diagnosed in 2 patients at one hospital. Moreover, it is necessary to remain vigilant towards other types of carbapenemase producers, as demonstrated by the finding of a Pseudomonas aeruginosa strain harbouring the carbapenemase VIM-1 in another hospital. PMID:24658670

  8. In vitro growth inhibition of mastitis causing bacteria by phenolics and metal chelators

    SciTech Connect

    Chew, B.P.; Tjoelker, L.W.; Tanaka, T.S.

    1985-11-01

    Antimicrobial activities of three phenolic compounds and four metal chelators were tested at 0, 250, 500, and 1000 ppm in vitro against four major mastitis-causing bacteria, Streptococcus agalactiae, Staphylococcus aureus, Klebsiella pnuemoniae, and Escherichia coli. Overall, butylated hydroxyanisole and tert-butylhydroquinone showed the greatest antimicrobial activity. These phenolics were bactericidal at 250 to 500 ppm against all four bacteria tested. The butylated hydroxytoluene was bactericidal against the gram-positive bacteria but was ineffective against the coliforms. At 250 ppm, disodium ethylenediaminetetraacetic acid was bactericidal against the gram-positive bacteria but much less effective against the gram-negatives. However, diethylene-triaminepentaacetic acid was more growth inhibitory than ethylenediaminetetraacetic acid against the gram-negative bacteria and especially against Escherichia coli. All other compounds were generally much less effective or ineffective against all four microorganisms. Therefore, butylated hydroxyanisole, butylated hydroxytoluene, tert-butylhydroquinone, ethylenediaminetetraacetic acid, and diethylenetriaminepentaacetic acid may have practical implications in the prevention or treatment of bovine mastitis.

  9. Prevention of biofilm colonization by Gram-negative bacteria on minocycline-rifampin-impregnated catheters sequentially coated with chlorhexidine.

    PubMed

    Jamal, Mohamed A; Rosenblatt, Joel S; Hachem, Ray Y; Ying, Jiang; Pravinkumar, Egbert; Nates, Joseph L; Chaftari, Anne-Marie P; Raad, Issam I

    2014-01-01

    Resistant Gram-negative bacteria are increasing central-line-associated bloodstream infection threats. To better combat this, chlorhexidine (CHX) was added to minocycline-rifampin (M/R) catheters. The in vitro antimicrobial activity of CHX-M/R catheters against multidrug resistant, Gram-negative Acinetobacter baumannii, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia was tested. M/R and CHX-silver sulfadiazine (CHX/SS) catheters were used as comparators. The novel CHX-M/R catheters were significantly more effective (P < 0.0001) than CHX/SS or M/R catheters in preventing biofilm colonization and showed better antimicrobial durability. PMID:24165191

  10. The fecal bacteria

    USGS Publications Warehouse

    Sadowsky, Michael J., (Edited By); Whitman, Richard L.

    2011-01-01

    The Fecal Bacteria offers a balanced, integrated discussion of fecal bacteria and their presence and ecology in the intestinal tract of mammals, in the environment, and in the food supply. This volume covers their use in examining and assessing water quality in order to offer protection from illnesses related to swimming in or ingesting contaminated water, in addition to discussing their use in engineering considerations of water quality, modeling, monitoring, and regulations. Fecal bacteria are additionally used as indicators of contamination of ready-to-eat foods and fresh produce. The intestinal environment, the microbial community structure of the gut microbiota, and the physiology and genomics of this broad group of microorganisms are explored in the book. With contributions from an internationally recognized group of experts, the book integrates medicine, public health, environmental, and microbiological topics in order to provide a unique, holistic understanding of fecal bacteria. Moreover, it shows how the latest basic science and applied research findings are helping to solve problems and develop effective management strategies. For example, readers will discover how the latest tools and molecular approaches have led to our current understanding of fecal bacteria and enabled us to improve human health and water quality. The Fecal Bacteria is recommended for microbiologists, clinicians, animal scientists, engineers, environmental scientists, food safety experts, water quality managers, and students. It will help them better understand fecal bacteria and use their knowledge to protect human and environmental health. They can also apply many of the techniques and molecular tools discussed in this book to the study of a broad range of microorganisms in a variety of habitats.

  11. Ice-Nucleating Bacteria

    NASA Astrophysics Data System (ADS)

    Obata, Hitoshi

    Since the discovery of ice-nucleating bacteria in 1974 by Maki et al., a large number of studies on the biological characteristics, ice-nucleating substance, ice nucleation gene and frost damage etc. of the bacteria have been carried out. Ice-nucleating bacteria can cause the freezing of water at relatively warm temperature (-2.3°C). Tween 20 was good substrates for ice-nucleating activity of Pseudomonas fluorescens KUIN-1. Major fatty acids of Isolate (Pseudomonas fluorescens) W-11 grown at 30°C were palmitic, cis-9-hexadecenoic and cis-11-octadecenoic which amounted to 90% of the total fatty acids. Sequence analysis shows that an ice nucleation gene from Pseudomonas fluorescens is related to the gene of Pseudomonas syringae.

  12. Paneth cell ablation in the presence of Klebsiella pneumoniae induces necrotizing enterocolitis (NEC)-like injury in the small intestine of immature mice.

    PubMed

    Zhang, Chunxian; Sherman, Michael P; Prince, Lawrence S; Bader, David; Weitkamp, Jörn-Hendrik; Slaughter, James C; McElroy, Steven J

    2012-07-01

    Necrotizing enterocolitis (NEC) is a leading cause of morbidity and mortality in premature infants. During NEC pathogenesis, bacteria are able to penetrate innate immune defenses and invade the intestinal epithelial layer, causing subsequent inflammation and tissue necrosis. Normally, Paneth cells appear in the intestinal crypts during the first trimester of human pregnancy. Paneth cells constitute a major component of the innate immune system by producing multiple antimicrobial peptides and proinflammatory mediators. To better understand the possible role of Paneth cell disruption in NEC, we quantified the number of Paneth cells present in infants with NEC and found that they were significantly decreased compared with age-matched controls. We were able to model this loss in the intestine of postnatal day (P)14-P16 (immature) mice by treating them with the zinc chelator dithizone. Intestines from dithizone-treated animals retained approximately half the number of Paneth cells compared with controls. Furthermore, by combining dithizone treatment with exposure to Klebsiella pneumoniae, we were able to induce intestinal injury and inflammatory induction that resembles human NEC. Additionally, this novel Paneth cell ablation model produces NEC-like pathology that is consistent with other currently used animal models, but this technique is simpler to use, can be used in older animals that have been dam fed, and represents a novel line of investigation to study NEC pathogenesis and treatment. PMID:22328592

  13. Increasing prevalence of vancomycin-resistant Enterococcus faecium, expanded-spectrum cephalosporin-resistant Klebsiella pneumoniae, and imipenem-resistant Pseudomonas aeruginosa in Korea: KONSAR study in 2001.

    PubMed

    Lee, Kyungwon; Jang, Sook-Jin; Lee, Hee-Joo; Ryoo, Namhee; Kim, Myungshin; Hong, Seong-Geun; Chong, Yunsop

    2004-02-01

    The 5th year KONSAR surveillance in 2001 was based on routine test data at 30 participating hospitals. It was of particular interest to find a trend in the resistances of enterococci to vancomycin, of Enterobacteriaceae to the 3rd generation cephalosporin and fluoroquinolone, and of Pseudomonas aeruginosa and acinetobacters to carbapenem. Resistance rates of Gram-positive cocci were: 70% of Staphylococcus aureus to oxacillin; 88% and 16% of Enterococcus faecium to ampicillin and vancomycin, respectively. Seventy-two percent of pneumococci were nonsusceptible to penicillin. The resistance rates of Enterobacteriaceae were: Escherichia coli, 28% to fluoroquinolone; Klebsiella pneumoniae, 27% to ceftazidime, and 20% to cefoxitin; and Enterobacter cloacae, > or =40% to cefotaxime and ceftazidime. The resistance rates of P. aeruginosa were 21% to ceftazidime, 17% to imipenem, and those of the acinetobacters were > or =61% to ceftazidime, aminoglycosides, fluoroquinolone and cotrimoxazole. Thirty-five percent of non-typhoidal salmonellae were ampicillin resistant, and 66% of Haemophilus influenzae were beta-lactamase producers. Notable changes over the 1997-2001 period were: increases in vancomycin-resistant E. faecium, and amikacin- and fluoroquinolone-resistant acinetobacters. With the increasing prevalence of resistant bacteria, nationwide surveillance has become more important for optimal patient management, for the control of nosocomial infection, and for the conservation of the newer antimicrobial agents. PMID:14966334

  14. Further increase of vancomycin-resistant Enterococcus faecium, amikacin- and fluoroquinolone-resistant Klebsiella pneumoniae, and imipenem-resistant Acinetobacter spp. in Korea: 2003 KONSAR surveillance.

    PubMed

    Lee, Kyungwon; Park, Ki Hyung; Jeong, Seok Hoon; Lim, Hwan Sub; Shin, Jong Hee; Yong, Dongeun; Ha, Gyoung-Yim; Chong, Yunsop; KONSAR group

    2006-02-28

    Monitoring temporal trends of antimicrobial resistance can provide useful information for the empirical selection of antimicrobial agents to treat infected patients and for the control of nosocomial infections. In this study, we analyzed antimicrobial resistance of clinically relevant bacteria in 2003 at Korean hospitals and at a commercial laboratory. The following organism-antimicrobial agent resistance combinations were very prevalent: oxacillin-resistant Staphylococcus aureus (68%), expanded-spectrum cephalosporin-resistant Klebsiella pneumoniae (25%), and fluoroquinolone-resistant Escherichia coli (33%), Acinetobacter spp. (58%), and Pseudomonas aeruginosa (40%). Moreover, gradual increases in vancomycin-resistant Enterococcus faecium (20%), cefoxitin-resistant E. coli (10%) and K. pneumoniae (23%), and imipenem-resistant P. aeruginosa (20%) and Acinetobacter spp. (13%) were also observed. The resistance rates of Acinetobacter spp. to most antimicrobial agents at hospitals and at the commercial laboratory were similar. Among the Acinetobacter spp. isolated at a tertiary-care hospital, 46.2% were multidrug-resistant to 9-12 of 13 antimicrobial agents, and 18.3% were panresistant. The exclusion of duplicate isolates at a tertiary-care hospital significantly lowered the proportion of oxacillin-resistant S. aureus, vancomycin-resistant E. faecium, and fluoroquinolone-resistant E. coli. PMID:16502484

  15. Increasing Prevalence of Vancomycin-Resistant Enterococcus faecium, Expanded-Spectrum Cephalosporin-Resistant Klebsiella pneumoniae, and Imipenem-Resistant Pseudomonas aeruginosa in Korea: KONSAR Study in 2001

    PubMed Central

    Lee, Kyungwon; Jang, Sook-Jin; Lee, Hee Joo; Ryoo, Namhee; Kim, Myungshin; Hong, Seong Geun

    2004-01-01

    The 5th year KONSAR surveillance in 2001 was based on routine test data at 30 participating hospitals. It was of particular interest to find a trend in the resistances of enterococci to vancomycin, of Enterobacteriaceae to the 3rd generation cephalosporin and fluoroquinolone, and of Pseudomonas aeruginosa and acinetobacters to carbapenem. Resistance rates of Gram-positive cocci were: 70% of Staphylococcus aureus to oxacillin; 88% and 16% of Enterococcus faecium to ampicillin and vancomycin, respectively. Seventy-two percent of pneumococci were nonsusceptible to penicillin. The resistance rates of Enterobacteriaceae were: Escherichia coli, 28% to fluoroquinolone; Klebsiella pneumoniae, 27% to ceftazidime, and 20% to cefoxitin; and Enterobacter cloacae, ?40% to cefotaxime and ceftazidime. The resistance rates of P. aeruginosa were 21% to ceftazidime, 17% to imipenem, and those of the acinetobacters were ?61% to ceftazidime, aminoglycosides, fluoroquinolone and cotrimoxazole. Thirty-five percent of non-typhoidal salmonellae were ampicillin resistant, and 66% of Haemophilus influenzae were ?-lactamase producers. Notable changes over the 1997-2001 period were: increases in vancomycin-resistant E. faecium, and amikacin- and fluoroquinolone-resistant acinetobacters. With the increasing prevalence of resistant bacteria, nationwide surveillance has become more important for optimal patient management, for the control of nosocomial infection, and for the conservation of the newer antimicrobial agents. PMID:14966334

  16. Further Increase of Vancomycin-Resistant Enterococcus faecium, Amikacin- and Fluoroquinolone-Resistant Klebsiella pneumoniae, and Imipenem-Resistant Acinetobacter spp. in Korea: 2003 KONSAR Surveillance

    PubMed Central

    Lee, Kyungwon; Park, Ki Hyung; Jeong, Seok Hoon; Lim, Hwan Sub; Shin, Jong Hee; Yong, Dongeun; Ha, Gyoung-Yim

    2006-01-01

    Monitoring temporal trends of antimicrobial resistance can provide useful information for the empirical selection of antimicrobial agents to treat infected patients and for the control of nosocomial infections. In this study, we analyzed antimicrobial resistance of clinically relevant bacteria in 2003 at Korean hospitals and at a commercial laboratory. The following organism-antimicrobial agent resistance combinations were very prevalent: oxacillin-resistant Staphylococcus aureus (68%), expanded-spectrum cephalosporin-resistant Klebsiella pneumoniae (25%), and fluoroquinolone-resistant Escherichia coli (33%), Acinetobacter spp. (58%), and Pseudomonas aeruginosa (40%). Moreover, gradual increases in vancomycin-resistant Enterococcus faecium (20%), cefoxitin-resistant E. coli (10%) and K. pneumoniae (23%), and imipenem-resistant P. aeruginosa (20%) and Acinetobacter spp. (13%) were also observed. The resistance rates of Acinetobacter spp. to most antimicrobial agents at hospitals and at the commercial laboratory were similar. Among the Acinetobacter spp. isolated at a tertiary-care hospital, 46.2% were multidrug-resistant to 9-12 of 13 antimicrobial agents, and 18.3% were panresistant. The exclusion of duplicate isolates at a tertiary-care hospital significantly lowered the proportion of oxacillin-resistant S. aureus, vancomycin-resistant E. faecium, and fluoroquinolone-resistant E. coli. PMID:16502484

  17. Phytochemistry and Preliminary Assessment of the Antibacterial Activity of Chloroform Extract of Amburana cearensis (Allemão) A.C. Sm. against Klebsiella pneumoniae Carbapenemase-Producing Strains

    PubMed Central

    Sá, Mirivaldo Barros; Ralph, Maria Taciana; Nascimento, Danielle Cristina Oliveira; Ramos, Clécio Souza; Barbosa, Isvânia Maria Serafin; Sá, Fabrício Bezerra; Lima-Filho, J. V.

    2014-01-01

    The chloroform extract of the stem bark of Amburana cearensis was chemically characterized and tested for antibacterial activity.The extract was analyzed by gas chromatography and mass spectrometry. The main compounds identified were 4-methoxy-3-methylphenol (76.7%), triciclene (3.9%), ?-pinene (1.0%), ?-pinene (2.2%), and 4-hydroxybenzoic acid (3.1%). Preliminary antibacterial tests were carried out against species of distinct morphophysiological characteristics: Escherichia coli, Salmonella enterica Serotype Typhimurium, Pseudomonas aeruginosa, Staphylococcus aureus, Listeria monocytogenes, and Bacillus cereus. The minimum inhibitory concentration (MIC) was determinate in 96-well microplates for the chloroform extract and an analogue of themain compound identified, which was purchased commercially.We have shown that plant's extract was only inhibitory (but not bactericidal) at the maximum concentration of 6900??g/mL against Pseudomonas aeruginosa and Bacillus cereus. Conversely, the analogue 2-methoxy-4-methylphenol produced MICs ranging from215 to 431??g/mL against all bacterial species.New antibacterial assays conducted with such chemical compound against Klebsiella pneumoniae carbapenemase-producing strains have shown similarMICresults and minimumbactericidal concentration (MBC) of 431??g/mL.We conclude that A. cearensis is a good source of methoxy-methylphenol compounds,which could be screened for antibacterial activity againstmultiresistant bacteria fromdifferent species PMID:24772183

  18. Oral DAV131, a charcoal-based adsorbent, inhibits intestinal colonization by ?-lactam-resistant Klebsiella pneumoniae in cefotaxime-treated mice.

    PubMed

    Grall, Nathalie; Massias, Laurent; Nguyen, Thu Thuy; Sayah-Jeanne, Sakina; Ducrot, Nicolas; Chachaty, Elisabeth; de Gunzburg, Jean; Andremont, Antoine

    2013-11-01

    Antibiotics excreted into the intestinal tract, such as broad-spectrum cephalosporins, disrupt the indigenous microflora, affect colonization resistance (CR), and promote intestinal colonization by resistant bacteria. We tested whether oral DAV131, a charcoal-based adsorbent, would prevent colonization by a cefotaxime (CTX)-resistant Klebsiella pneumoniae strain (PUG-2) in CTX-treated mice. Mice received CTX, saline, CTX and DAV131, or saline and DAV131 for 3 days before oral challenge with 10(6) CFU of PUG-2. The fecal CTX concentrations and counts of PUG-2 were assayed. Fecal CTX disappeared when DAV131 was given concomitantly with CTX (P < 0.05), and the area under the curve of PUG-2 fecal density was significantly reduced (P < 0.01). In conclusion, reducing intestinal antibiotic exposure with DAV131 may reduce colonization by resistant strains during treatment compared to treatment with CTX only. This might open new possibilities for decreasing the impact of antibiotics on the intestinal microbiota during treatments. PMID:23959311

  19. Oral DAV131, a Charcoal-Based Adsorbent, Inhibits Intestinal Colonization by ?-Lactam-Resistant Klebsiella pneumoniae in Cefotaxime-Treated Mice

    PubMed Central

    Massias, Laurent; Nguyen, Thu Thuy; Sayah-Jeanne, Sakina; Ducrot, Nicolas; Chachaty, Elisabeth; de Gunzburg, Jean; Andremont, Antoine

    2013-01-01

    Antibiotics excreted into the intestinal tract, such as broad-spectrum cephalosporins, disrupt the indigenous microflora, affect colonization resistance (CR), and promote intestinal colonization by resistant bacteria. We tested whether oral DAV131, a charcoal-based adsorbent, would prevent colonization by a cefotaxime (CTX)-resistant Klebsiella pneumoniae strain (PUG-2) in CTX-treated mice. Mice received CTX, saline, CTX and DAV131, or saline and DAV131 for 3 days before oral challenge with 106 CFU of PUG-2. The fecal CTX concentrations and counts of PUG-2 were assayed. Fecal CTX disappeared when DAV131 was given concomitantly with CTX (P < 0.05), and the area under the curve of PUG-2 fecal density was significantly reduced (P < 0.01). In conclusion, reducing intestinal antibiotic exposure with DAV131 may reduce colonization by resistant strains during treatment compared to treatment with CTX only. This might open new possibilities for decreasing the impact of antibiotics on the intestinal microbiota during treatments. PMID:23959311

  20. Piscidin is Highly Active against Carbapenem-Resistant Acinetobacter baumannii and NDM-1-Producing Klebsiella pneumonia in a Systemic Septicaemia Infection Mouse Model

    PubMed Central

    Pan, Chieh-Yu; Chen, Jian-Chyi; Chen, Te-Li; Wu, Jen-Leih; Hui, Cho-Fat; Chen, Jyh-Yih

    2015-01-01

    This study was designed to investigate the antimicrobial activity of two synthetic antimicrobial peptides from an aquatic organism, tilapia piscidin 3 (TP3) and tilapia piscidin 4 (TP4), in vitro and in a murine sepsis model, as compared with ampicillin, tigecycline, and imipenem. Mice were infected with (NDM-1)-producing K. pneumonia and multi-drug resistant Acinetobacter baumannii, and subsequently treated with TP3, TP4, or antibiotics for different periods of time (up to 168 h). Mouse survival and bacterial colony forming units (CFU) in various organs were measured after each treatment. Toxicity was determined based on observation of behavior and measurement of biochemical parameters. TP3 and TP4 exhibited strong activity against K. pneumonia and A. baumannii in vitro. Administration of TP3 (150 ?g/mouse) or TP4 (50 ?g/mouse) 30 min after infection with K. pneumonia or A. baumannii significantly increased survival in mice. TP4 was more effective than tigecycline at reducing CFU counts in several organs. TP3 and TP4 were shown to be non-toxic, and did not affect mouse behavior. TP3 and TP4 are able at potentiate anti-Acinetobacter baumannii or anti-Klebsiella pneumonia drug activity, reduce bacterial load, and prevent drug resistance, indicating their potential for use in combating multidrug-resistant bacteria. PMID:25874924

  1. Upregulation of transcripts for metabolism in diverse environments is a shared response associated with survival and adaptation of Klebsiella pneumoniae in response to temperature extremes.

    PubMed

    Tripathy, S; Sen, R; Padhi, S K; Mohanty, S; Maiti, N K

    2014-09-01

    Klebsiella pneumoniae being ubiquitous in nature encounters wide differences in environmental condition. The organism's abundance in natural water reservoirs exposed to temperature variation forms the basis of its persistence and spread in the soil and other farm produce. In order to investigate the effect of temperature changes on the survival and adaptation of the bacteria, the transcriptional response of K. pneumoniae subjected to low (20 °C) and high (50 °C) temperature shock were executed using Applied Biosystems SOLiD platform. Approximately, 33 and 34% of protein coding genes expressed in response to 20 and 50 °C, respectively, displayed significant up- or downregulation (p?

  2. A trial with IgY chicken antibodies to eradicate faecal carriage of Klebsiella pneumoniae and Escherichia coli producing extended-spectrum beta-lactamases

    PubMed Central

    Jonsson, Anna-Karin; Larsson, Anders; Tängdén, Thomas; Melhus, Åsa; Lannergård, Anders

    2015-01-01

    Background Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae is an emerging therapeutic challenge, especially in the treatment of urinary tract infections. Following an outbreak of CTX-M-15 Klebsiella pneumoniae in Uppsala, Sweden, an orphan drug trial on IgY chicken antibodies was undertaken in an attempt to eradicate faecal carriage of ESBL-producing K. pneumoniae and Escherichia coli. Methods Hens were immunised with epitopes from freeze-dried, whole-cell bacteria (ESBL-producing K. pneumoniae and E. coli) and recombinant proteins of two K. pneumoniae fimbriae subunits (fimH and mrkD). The egg yolks were processed according to good manufacturing practice and the product was stored at?20°C until used. Using an internal database from the outbreak and the regular laboratory database, faecal carriers were identified and recruited from May 2005 to December 2013. The participants were randomised in a placebo-controlled 1:1 manner. Results From 749 eligible patients, 327 (44%) had deceased, and only 91 (12%) were recruited and signed the informed consent. In the initial screening performed using the polymerase chain reaction, 24 participants were ESBL positive and subsequently randomised and treated with either the study drug or a placebo. The study was powered for 124 participants. Because of a very high dropout rate, the study was prematurely terminated. From the outbreak cohort (n=247), only eight patients were screened, and only one was positive with the outbreak strain in faeces. Conclusions The present study design, using IgY chicken antibodies for the eradication of ESBL-producing K. pneumonia and E. coli, was ineffective in reaching its goal due to high mortality and other factors resulting in a low inclusion rate. Spontaneous eradication of ESBL-producing bacteria was frequently observed in recruited participants, which is consistent with previous reports. PMID:26560861

  3. Loop-mediated isothermal amplification assay targeting the blaCTX-M9 gene for detection of extended spectrum ?-lactamase-producing Escherichia coli and Klebsiella pneumoniae.

    PubMed

    Thirapanmethee, Krit; Pothisamutyothin, Kanokporn; Nathisuwan, Surakit; Chomnawang, Mullika T; Wiwat, Chanpen

    2014-12-01

    Extended-spectrum ?-lactamases (ESBLs) produced by Enterobacteriaceae are one of the resistance mechanisms to most ?-lactam antibiotics. ESBLs are currently a major problem in both hospitals and community settings worldwide. Rapid and reliable means of detecting ESBL-producing bacteria is necessary for identification, prevention and treatment. Loop-mediated isothermal amplification (LAMP) is a technique that rapidly amplifies DNA with high specificity and sensitivity under isothermal conditions. This study was aimed to develop a convenient, accurate and inexpensive method for detecting ESBL-producing bacteria by a LAMP technique. ESBLs-producing Escherichia coli and Klebsiella pneumoniae were isolated from a tertiary hospital in Bangkok, Thailand and reconfirmed by double-disk synergy test. A set of four specific oligonucleotide primers of LAMP for detection of bla(CTX-M9) gene was designed based on bla(CTX-M9) from E. coli (GenBank Accession No. AJ416345). The LAMP reaction was amplified under isothermal temperature at 63°C for 60?min. Ladder-like patterns of band sizes from 226 bp of the bla(CTX-M9) DNA target was observed. The LAMP product was further analyzed by restriction digestion with MboI and TaqI endonucleases. The fragments generated were approximately 168, 177 and 250 bp in size for MboI digestion and 165, 193, 229, 281 and 314 bp for TaqI digestion, which is in agreement with the predicted sizes. The sensitivity of the LAMP technique to bla(CTX-M9) was greater than that of the PCR method by at least 10,000-fold. These results showed that the LAMP primers specifically amplified only the bla(CTX-M9) gene. Moreover, the presence of LAMP amplicon was simply determined by adding SYBR Green I in the reaction. In conclusion, this technique for detection of ESBLs is convenient, reliable and easy to perform routinely in hospitals or laboratory units in developing countries. PMID:25284314

  4. Effect of radiation processing in elimination of Klebsiella pneumoniae from food

    NASA Astrophysics Data System (ADS)

    Gautam, Raj Kamal; Nagar, Vandan; Shashidhar, Ravindranath

    2015-10-01

    Klebsiella pneumoniae has been considered as an important foodborne pathogen which causes severe infections that include meningitis, bronchitis, bacteremia, pneumonia, and urinary tract infections in humans and animals. It is well known to most clinicians as a cause of community-acquired bacterial pneumonia. Klebsiella is an opportunistic pathogen, that primarily attacks neonates, infants, elderly and immuno-compromised patients and therefore impose a serious, emerging public health hazard globally. Contaminated sprouts, vegetables, seafood and other animal meat products are considered as main sources of Klebsiella infection. In the current study, radiation sensitivity of K. pneumoniae MTCC 109 was determined in different food samples. The decimal reduction dose (D10) values of K. pneumoniae MTCC 109 in saline and nutrient broth at 0-4 °C were 0.116±0.009, 0.136±0.005 kGy, respectively. The mixed sprouts, fish and poultry samples were inoculated with K. pneumoniae MTCC 109 and exposed to gamma radiation to evaluate the effectiveness of radiation treatment in the elimination of K. pneumoniae. D10 values of K. pneumoniae in mixed sprouts, poultry and fish samples were found to be 0.142±0.009, 0.125±0.0004 and 0.277±0.012 kGy, respectively. Radiation treatment with a 1.5 kGy dose resulted in the complete elimination of 3.1±1.8×105 CFU/g of K. pneumoniae from these food samples. No recovery of K. pneumoniae was observed in the 1.5 kGy treated samples stored at 4 °C up to 12 days, even after enrichment and selective plating. This study shows that a 1.5 kGy dose of irradiation treatment could lead to the complete elimination of 3.1±1.8×105 CFU/g of K. pneumoniae from mixed sprouts, poultry and fish samples.

  5. Biodegradation of the herbicide trifluralin by bacteria isolated from soil.

    PubMed

    Bellinaso, Maria De Lourdes; Greer, Charles William; Peralba, Maria do Carmo; Henriques, João Antônio Pêgas; Gaylarde, Christine Claire

    2003-03-01

    Trifluralin (alpha,alpha,alpha-trifluoro-2,6-dinitro-N,N-dipropyl-p-toluidine; TFL) is a pre-emergence, soil-incorporated herbicide that has been in agricultural use since the early 1960s and is moderately persistent in soil. The purpose of this study was to isolate and characterise TFL-resistant bacteria from a soil in which this pesticide has been used for the last four decades and to determine their ability to degrade TFL using HPLC. Eight bacteria were isolated by repeated subculture in liquid medium with TFL as carbon source and a ninth (isolate 9) from growth around TFL crystals on solid medium. The bacteria from enriched liquid culture were identified by biochemical tests and 16S rDNA sequencing. In a mineral salts medium with 0.1% succinate, 0.1% yeast extract and 50 mg l(-1) TFL, reductions in the level of pesticide of 24.6% for Klebsiella sp., 16.4% for Herbaspirillum sp., 25.0% and 16.0% for two strains of Bacillus sp. and 21.0% for unidentified isolate number 9 were obtained after 30 days. These were similar to the level obtained using a known TFL-degrading bacterium, Brevundimonas diminuta (NCIMB 10329). Three Pseudomonas sp. and one Bacillus sp. reduced levels by less than 5%. The five positive isolates can be used to study the biochemical and molecular biology of TFL biodegradation with the aim of optimising the degradative ability of one or more of the isolates for future use in bioremediation processes. PMID:19719679

  6. Quinolones Sensitize Gram-Negative Bacteria to Antimicrobial Peptides

    PubMed Central

    Campos, Miguel A.; Morey, Pau; Bengoechea, José A.

    2006-01-01

    The treatment of infections caused by bacteria resistant to the vast majority of antibiotics is a challenge worldwide. Antimicrobial peptides (APs) make up the front line of defense in those areas exposed to microorganisms, and there is intensive research to explore their use as new antibacterial agents. On the other hand, it is known that subinhibitory concentrations of antibiotics affect the expression of numerous bacterial traits. In this work we evaluated whether treatment of bacteria with subinhibitory concentrations of quinolones may alter the sensitivity to APs. A 1-h treatment of Klebsiella pneumoniae with 0.25× the MIC of ciprofloxacin rendered bacteria more sensitive to polymyxins B and E, human neutrophil defensin 1, and ?-defensin 1. Levofloxacin and nalidixic acid at 0.25× the MICs also increased the sensitivity of K. pneumoniae to polymyxin B, whereas gentamicin and ceftazidime at 0.25× the MICs did not have such an effect. Ciprofloxacin also increased the sensitivities of K. pneumoniae ciprofloxacin-resistant strains to polymyxin B. Two other pathogens, Pseudomonas aeruginosa and Haemophilus influenzae, also became more sensitive to polymyxins B and E after treatment with 0.25× the MIC of ciprofloxacin. Incubation with ciprofloxacin did not alter the expression of the K. pneumoniae loci involved in resistance to APs. A 1-N-phenyl-naphthylamine assay showed that ciprofloxacin and levofloxacin increased the permeabilities of the K. pneumoniae and P. aeruginosa outer membranes, while divalent cations antagonized this action. Finally, we demonstrated that ciprofloxacin and levofloxacin increased the binding of APs to the outer membrane by using dansylated polymyxin B. PMID:16801413

  7. Occurrence and regulation of the ferric citrate transport system in Escherichia coli B, Klebsiella pneumoniae, Enterobacter aerogenes, and Photorhabdus luminescens.

    PubMed

    Mahren, Susanne; Schnell, Heidrun; Braun, Volkmar

    2005-11-01

    In Escherichia coli K-12, transcription of the ferric citrate transport genes fecABCDE is initiated by binding of diferric dicitrate to the outer membrane protein FecA which elicits a signaling cascade from the cell surface to the cytoplasm. The FecI sigma factor is only active in the presence of FecR, which transfers the signal across the cytoplasmic membrane. In other bacteria, fecIRA homologues control iron transport gene transcription by siderophores other than citrate. However, in most cases, the FecI homologues are active in the absence of the FecR homologues, which might function as anti-sigma factors. Since not all E. coli strains contain a fec system, we determined the occurrence of fec genes in selected Enterobacteriaceae and the dependence of FecI activity on FecR. Incomplete FecIRA systems were chromosomally encoded in Enterobacter aerogenes strains and plasmid-encoded in K. pneumoniae. E. coli B, Photorhabdus luminescens and one of three Klebsiella pneumoniae strains had a functional FecIRA regulatory system as in E. coli K-12. The cytoplasmic N-terminal FecR fragments caused constitutive FecI activity in the absence of ferric citrate. The PCR-generated mutant FecI(D40G) was inactive and FecI(S15P) was partially active. FecR of E. coli K-12 activated FecI of all tested strains except FecI encoded on the virulence plasmid pLVPK of K. pneumoniae, which differed from E. coli K-12 FecI by having mutations in region 4, which is important for interaction with FecR. The C-terminally truncated FecR homologue of pLVPK was inactive. pLVPK-encoded FecA contains a 38-residue sequence in front of the signal sequence that did not prevent processing and proper integration of FecA into the outer membrane of E. coli and lacks the signaling sequence required for transcription initiation of the fec transport genes, making it induction-incompetent but transport-competent. The evidence indicates that fecIRABCDE genes are acquired by horizontal DNA transfer and can undergo debilitating mutations. PMID:16193283

  8. Toward repurposing ciclopirox as an antibiotic against drug-resistant Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae.

    PubMed

    Carlson-Banning, Kimberly M; Chou, Andrew; Liu, Zhen; Hamill, Richard J; Song, Yongcheng; Zechiedrich, Lynn

    2013-01-01

    Antibiotic-resistant infections caused by gram-negative bacteria are a major healthcare concern. Repurposing drugs circumvents the time and money limitations associated with developing new antimicrobial agents needed to combat these antibiotic-resistant infections. Here we identified the off-patent antifungal agent, ciclopirox, as a candidate to repurpose for antibiotic use. To test the efficacy of ciclopirox against antibiotic-resistant pathogens, we used a curated collection of Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae clinical isolates that are representative of known antibiotic resistance phenotypes. We found that ciclopirox, at 5-15 µg/ml concentrations, inhibited bacterial growth regardless of the antibiotic resistance status. At these same concentrations, ciclopirox reduced growth of Pseudomonas aeruginosa clinical isolates, but some of these pathogens required higher ciclopirox concentrations to completely block growth. To determine how ciclopirox inhibits bacterial growth, we performed an overexpression screen in E. coli. This screen revealed that galE, which encodes UDP-glucose 4-epimerase, rescued bacterial growth at otherwise restrictive ciclopirox concentrations. We found that ciclopirox does not inhibit epimerization of UDP-galactose by purified E. coli GalE; however, ?galU, ?galE, ?rfaI, or ?rfaB mutant strains all have lower ciclopirox minimum inhibitory concentrations than the parent strain. The galU, galE, rfaI, and rfaB genes all encode enzymes that use UDP-galactose or UDP-glucose for galactose metabolism and lipopolysaccharide (LPS) biosynthesis. Indeed, we found that ciclopirox altered LPS composition of an E. coli clinical isolate. Taken together, our data demonstrate that ciclopirox affects galactose metabolism and LPS biosynthesis, two pathways important for bacterial growth and virulence. The lack of any reported fungal resistance to ciclopirox in over twenty years of use in the clinic, its excellent safety profiles, novel target(s), and efficacy, make ciclopirox a promising potential antimicrobial agent to use against multidrug-resistant problematic gram-negative pathogens. PMID:23936064

  9. [Comparison of ertapenem-EMB Agar with traditional methods for screening carbapenem-resistant Klebsiella pneumoniae from rectal swabs].

    PubMed

    Perçin, Duygu; Colako?lu, Selcan; Durmaz, Süleyman; Ekincio?lu, P?nar

    2012-10-01

    Detection of rectal colonization with carbapenem-resistant Klebsiella pneumoniae (CRKP) is the most important step in the infection control protocols in order to prevent infections caused by CRKP which has an increasing incidence all over the world. In this study, it was aimed to compare the detection rate of 2 mg/L ertapenem EMB agar medium with the other methods recommended by various international guidelines. These methods include direct plate method using ertapenem disc, enrichment method in tryptic soy broth containing 2 mg/L ertapenem and the investigation of the predominant betalactamases in the colonized patients. The lowest inoculum detected by different methods was determined by using simulative challenge test prepared for this purpose. The ability to detect CRKP from rectal swabs was evaluated by using the clinical specimens of 801 patients. For all bacteria isolated, carbapenem susceptibility was evaluated by using E-test method, the presence of beta-lactamases was determined by using modified Hodge test (MHT), and the carbapenemase genes were investigated by using multiplex polymerase chain reaction (PCR). The lowest inoculum detected by ertapenem-EMB agar was 50 CFU/mL whereas the lowest inocula were 1 x 105 and 1 x 103, respectively by tryptic soy broth with ertapenem and direct plate method. No resistance gene were identified by PCR in 13 (39.4%) of 33 isolates, whereas blaOXA-48 was detected in 19 (95%) and blaIMP in 1 (5%) of 20 positive isolates. All of the positive strains were resistant to imipenem and ertapenem, while 2 (10%) strains were found to be susceptible to doripenem and meropenem. While MHT was negative in all strains which were negative for resistance genes, all resistance gene positive strains except one blaOXA-48 strain that was also sensitive to doripenem and meropenem, were found to be positive with MHT. According to the results of PCR, the sensitivities of the three methods were found to be 80%. The specificities, positive and negative predictive values were found to be 15.4%, 59% and 33.3% for ertapenem-EMB agar, 23%, 61.5% and 42.9% for broth with ertapenem and 61.5%, 76% and 66.6% for direct plate method, respectively. Average labor time of the methods (isolation + identification + sensitivity + MHT) was determined as 48 hours for ertapenem-EMB agar, whereas it was 96 hours for the other methods. In conclusion, since ertapenem- EMB agar method is a sensitive and rapid method, it can be used safely for the preliminary detection of CRKP without increasing the workload of the laboratory. PMID:23188568

  10. Infection of mice by aerosols of Klebsiella pneumoniae under hyperbaric conditions.

    PubMed Central

    Heckly, R J; Chatigny, M A; Dimmick, R L

    1980-01-01

    Both the physical behavior of aerosols and survival of airborne Serratia marcescens in hyperbaric chambers with a helium-air mixture at 20 atm of pressure was approximately the same as in the system at ambient pressures. Exposure of mice to aerosols of Klebsiella pneumoniae at 1-, 2-, and 17-atm (ca. 101-, 203-, and 1,722-kPa) pressures of helium-oxygen mixture showed that the number of viable organisms constituting a 50% lethal dose was not significantly affected by the hyperbaric conditions. Images PMID:6996616

  11. Differentiation and characterization of Klebsiella pneumoniae strains by pyrolysis-gas-liquid chromatography-mass spectrometry.

    PubMed Central

    Abbey, L E; Highsmith, A K; Moran, T F; Reiner, E J

    1981-01-01

    Nine coded duplicate strains of capsular nontypable Klebsiella pneumoniae were analyzed by pyrolysis-gas-liquid chromatography-mass spectrometry. All duplicate strains were correctly matched, and individual strains, including seven nontypable strains, were clearly distinguishable from one another. The addition of mass spectrometry to the analysis has aided the process of identification and has provided chemical structural information on K. pneumoniae strains. Application of this technique to the identification of some disease outbreaks or nosocomial problems could be of epidemiological importance, especially when conventional methods do not identify the epidemic strain. PMID:7009639

  12. Complete genome sequence of endophytic nitrogen-fixing Klebsiella variicola strain DX120E

    PubMed Central

    2015-01-01

    Klebsiella variicola strain DX120E (=CGMCC 1.14935) is an endophytic nitrogen-fixing bacterium isolated from sugarcane crops grown in Guangxi, China and promotes sugarcane growth. Here we summarize the features of the strain DX120E and describe its complete genome sequence. The genome contains one circular chromosome and two plasmids, and contains 5,718,434 nucleotides with 57.1% GC content, 5,172 protein-coding genes, 25 rRNA genes, 87 tRNA genes, 7 ncRNA genes, 25 pseudo genes, and 2 CRISPR repeats. PMID:26203334

  13. Dissemination of the KPC-2 carbapenemase in non-Klebsiella pneumoniae enterobacterial isolates from Colombia.

    PubMed

    Cuzon, Gaelle; Naas, Thierry; Correa, Adriana; Quinn, John P; Villegas, Maria-Virginia; Nordmann, Patrice

    2013-07-01

    Klebsiella pneumoniae carbapenemase (KPC)-type enzymes have largely disseminated worldwide among K. pneumoniae isolates. In this study, 11 non-K. pneumoniae KPC-producing enterobacterial isolates from four hospitals located in different Colombian cities were genetically investigated. All isolates were multidrug-resistant and harboured the bla(KPC-2) gene along with several other acquired ?-lactamase genes. The bla(KPC-2) gene was associated with transposon Tn4401b inserted in different loci of plasmids varying in size and replicon type. The presence of KPC-2 in different enterobacterial species from different cities within Colombia underlines the spread of KPC beyond K. pneumoniae. PMID:23664581

  14. Synthesis and characterization of bactericidal silver nanoparticles using cultural filtrate of simulated microgravity grown Klebsiella pneumoniae.

    PubMed

    Kalpana, Duraisamy; Lee, Yang Soo

    2013-03-01

    Silver nanoparticles were synthesized by biological method using cultural filtrate of Klebsiella pneumoniae cultured under simulated microgravity and silver nitrate solution as precursor. The nanoparticles exhibited typical plasmon absorption maximum of silver nanoparticles between 405 and 407 nm. Spherical silver nanoparticles were found to have size between 15 and 37 nm by TEM analysis. XRD pattern corresponding to planes (111), (200), (220) (311) revealed the crystalline nature of the biosynthesized silver nanoparticles. FTIR spectrum proposed stabilization of silver nanoparticles by the protein molecules present in the cultural filtrate. The silver nanoparticles exhibited high bactericidal activity against Salmonella enterica, Escherichia coli and moderate bactericidal activity against Streptococcus pyogenes. PMID:23410925

  15. PATHOGENICITY OF BIOFILM BACTERIA

    EPA Science Inventory

    There is a paucity of information concerning any link between the microorganisms commonly found in biofilms of drinking water systems and their impacts on human health. For bacteria, culture-based techniques detect only a limited number of the total microorganisms associated wit...

  16. Culture of Bacteria 

    E-print Network

    Unknown

    2011-08-17

    site located in the lungs of an animal model, thereby enabling detection of fluorescent bacteria during the early stages of infection. In this thesis, I present a contact probe fiber bundle fluorescence micro-endoscope with a range of LED based...

  17. Aquatic Bacteria Samples

    USGS Multimedia Gallery

    On April 20, 2010, the BP Deepwater Horizon drilling platform collapsed and sank in the Gulf of Mexico, causing one of the largest oil spills in history. One of the big dilemmas in responding to the oil spil is how to clean up the oil itself. One way currently under research is to use bacteria that ...

  18. Antibiotic-Resistant Bacteria.

    ERIC Educational Resources Information Center

    Longenecker, Nevin E.; Oppenheimer, Dan

    1982-01-01

    A study conducted by high school advanced bacteriology students appears to confirm the hypothesis that the incremental administration of antibiotics on several species of bacteria (Escherichia coli, Staphylococcus epidermis, Bacillus sublitus, Bacillus megaterium) will allow for the development of antibiotic-resistant strains. (PEB)

  19. Bacteria-surface interactions

    PubMed Central

    Tuson, Hannah H.; Weibel, Douglas B.

    2013-01-01

    The interaction of bacteria with surfaces has important implications in a range of areas, including bioenergy, biofouling, biofilm formation, and the infection of plants and animals. Many of the interactions of bacteria with surfaces produce changes in the expression of genes that influence cell morphology and behavior, including genes essential for motility and surface attachment. Despite the attention that these phenotypes have garnered, the bacterial systems used for sensing and responding to surfaces are still not well understood. An understanding of these mechanisms will guide the development of new classes of materials that inhibit and promote cell growth, and complement studies of the physiology of bacteria in contact with surfaces. Recent studies from a range of fields in science and engineering are poised to guide future investigations in this area. This review summarizes recent studies on bacteria-surface interactions, discusses mechanisms of surface sensing and consequences of cell attachment, provides an overview of surfaces that have been used in bacterial studies, and highlights unanswered questions in this field. PMID:23930134

  20. Occurrence of Multidrug Resistant Extended Spectrum Beta-Lactamase-Producing Bacteria on Iceberg Lettuce Retailed for Human Consumption

    PubMed Central

    Talreja, Deepa; Rana, Sonia Walia; Walia, Sandeep; Walia, Satish K.

    2015-01-01

    Antibiotic resistance in bacteria is a global problem exacerbated by the dissemination of resistant bacteria via uncooked food, such as green leafy vegetables. New strains of bacteria are emerging on a daily basis with novel expanded antibiotic resistance profiles. In this pilot study, we examined the occurrence of antibiotic resistant bacteria against five classes of antibiotics on iceberg lettuce retailed in local convenience stores in Rochester, Michigan. In this study, 138 morphologically distinct bacterial colonies from 9 iceberg lettuce samples were randomly picked and tested for antibiotic resistance. Among these isolates, the vast majority (86%) demonstrated resistance to cefotaxime, and among the resistant bacteria, the majority showed multiple drug resistance, particularly against cefotaxime, chloramphenicol, and tetracycline. Three bacterial isolates (2.17%) out of 138 were extended spectrum beta-lactamase (ESBL) producers. Two ESBL producers (T1 and T5) were identified as Klebsiella pneumoniae, an opportunistic pathogen with transferable sulfhydryl variable- (SHV-) and TEM-type ESBLs, respectively. The DNA sequence analysis of the blaSHV detected in K. pneumoniae isolate T1 revealed 99% relatedness to blaSHV genes found in clinical isolates. This implies that iceberg lettuce is a potential reservoir of newly emerging and evolving antibiotic resistant bacteria and its consumption poses serious threat to human health. PMID:26064922

  1. Lemierre's Syndrome Caused by Klebsiella pneumoniae in a Diabetic Patient: A Case Report and Review of the Literature

    PubMed Central

    Chuncharunee, Alan

    2015-01-01

    Lemierre's syndrome is characterized by an oropharyngeal infection with internal jugular vein thrombosis followed by metastatic infections in other organs. This infection is usually caused by Fusobacterium spp. In this report, we present a rare case of Klebsiella pneumoniae-associated Lemierre's syndrome in a patient with poorly-controlled diabetes mellitus. The infection was complicated by septic emboli in many organs, which led to the patient's death, despite combined antibiotics, anticoagulant therapy, and surgical intervention. Therein, a literature review was performed for reported cases of Lemierre's syndrome caused by Klebsiella pneumoniae and the results are summarized here. PMID:26279962

  2. Differential effects of catecholamines on in vitro growth of pathogenic bacteria

    NASA Technical Reports Server (NTRS)

    Belay, Tesfaye; Sonnenfeld, Gerald

    2002-01-01

    Supplementation of minimal medium inoculated with bacterial cultures with norepinephrine, epinephrine, dopamine, or isoproterenol resulted in marked increases in growth compared to controls. Norepinephrine and dopamine had the greatest enhancing effects on growth of cultures of Pseudomonas aeruginosa and Klebsiella pneumoniae, while epinephrine and isoproterenol also enhanced growth to a lesser extent. The growth of Escherichia coli in the presence of norepinephrine was greater than growth in the presence of the three other neurochemicals used in the study. Growth of Staphylococcus aureus was also enhanced in the presence of norepinephrine, but not to the same degree as was the growth of gram negative bacteria. Addition of culture supernatants from E. coli cultures that had been grown in the presence of norepinephrine was able to enhance the growth of K. pneumoniae. Addition of the culture supernatant fluid culture from E. coli cultures that had been grown in the presence of norepinephrine did not enhance growth of P. aeruginosa or S. aureus. Culture supernatant fluids from bacteria other than E. coli grown in the presence of norepinephrine were not able to enhance the growth of any bacteria tested. The results suggest that catecholamines can enhance growth of pathogenic bacteria, which may contribute to development of pathogenesis; however, there is no uniform effect of catecholamines on bacterial growth.

  3. Capillary electrophoresis for fast detection of heterogeneous population in colistin-resistant Gram-negative bacteria.

    PubMed

    Sautrey, Guillaume; Duval, Raphaël E; Chevalley, Alicia; Fontanay, Stéphane; Clarot, Igor

    2015-10-01

    It has been shown that diverse strains of bacteria can be separated according to their characteristic surface properties by means of CE. We employed here this analytical technique to the study of colistin-resistance in Gram-negative bacteria, which involves the selection of mutants with modified outer membrane composition resulting in changes of surface cell properties. In the same way as with molecular entities, we performed firstly the validation of an ITP-based CE method for three common pathogenic Gram-negative bacteria namely Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae. Secondly, we compared the electrophoretic profiles of bacterial samples from a colistin-susceptible clinical isolate of K. pneumoniae and from the corresponding colistin-resistant derivative. By a simple CE run taking a few minutes, the coexistence of several bacterial subpopulations in the colistin-resistant derivative was clearly evidenced. This work encourages further research that would allow applications of CE in clinical laboratory for a daily monitoring of bacterial population in cared patients when "last-chance" colistin treatment is initiated against multidrug-resistant bacteria. PMID:26101140

  4. Bacteria associated with crabs from cold waters with emphasis on the occurrence of potential human pathogens.

    PubMed Central

    Faghri, M A; Pennington, C L; Cronholm, L S; Atlas, R M

    1984-01-01

    A diverse array of bacterial species, including several potential human pathogens, was isolated from edible crabs collected in cold waters. Crabs collected near Kodiak Island, Alaska, contained higher levels of bacteria than crabs collected away from regions of human habitation. The bacteria associated with the crabs collected near Kodiak included Yersinia enterocolitica, Klebsiella pneumoniae, and coagulase-negative Staphylococcus species; the pathogenicity of these isolates was demonstrated in mice. Although coliforms were not found, the bacterial species associated with the tissues of crabs collected near Kodiak indicate possible fecal contamination that may have occurred through contact with sewage. Compared with surrounding waters and sediments, the crab tissues contained much higher proportions of gram-positive cocci. As revealed by indirect plate counts and direct scanning electron microscopic observations, muscle and hemolymph tissues contained much lower levels of bacteria than shell and gill tissues. After the death of a crab, however, the numbers of bacteria associated with hemolymph and muscle tissues increased significantly. Microcosm studies showed that certain bacterial populations, e.g., Vibrio cholerae, can be bioaccumulated in crab gill tissues. The results of this study indicate the need for careful review of waste disposal practices where edible crabs may be contaminated with microorganisms that are potential human pathogens and the need for surveillance of shellfish for pathogenic microorganisms that naturally occur in marine ecosystems. Images PMID:6742824

  5. STORMWATER MANAGEMENT MEASURES AND FECAL INDICATOR BACTERIA

    E-print Network

    STORMWATER MANAGEMENT MEASURES AND FECAL INDICATOR BACTERIA BY ROBERT A. WILDEY BA, New College............................................................................................................. 1 Regulatory Limits for Indicator Bacteria................................................................ 2 Indicator Bacteria in the Environment

  6. Genetic analysis of capsular polysaccharide synthesis gene clusters in 79 capsular types of Klebsiella spp

    PubMed Central

    Pan, Yi-Jiun; Lin, Tzu-Lung; Chen, Chun-Tang; Chen, Yi-Yin; Hsieh, Pei-Fang; Hsu, Chun-Ru; Wu, Meng-Chuan; Wang, Jin-Town

    2015-01-01

    A total of 79 capsular types have been reported in Klebsiella spp., whereas capsular polysaccharide synthesis (cps) regions were available in only 22 types. Due to the limitations of serotyping, complete repertoire of cps will be helpful for capsular genotyping. We therefore resolved the rest 57 cps and conducted comparative analysis. Clustering results of 1,515 predicted proteins from cps loci categorized proteins which share similarity into homology groups (HGs) revealing that 77 Wzy polymerases were classified into 56 HGs, which indicate the high specificity of wzy between different types. Accordingly, wzy-based capsular genotyping could differentiate capsule types except for those lacking wzy (K29 and K50), those sharing identical wzy (K22 vs. K37); and should be carefully applied in those exhibited high similarity (K12 vs. K41, K2 vs. K13, K74 vs. K80, K79 vs. KN1 and K30 vs. K69). Comparison of CPS structures in several capsular types that shared similarity in their gene contents implies possible functions of glycosyltransferases. Therefore, our results provide complete set of cps in various types of Klebsiella spp., which enable the understandings of relationship between genes and CPS structures and are useful for identification of documented or new capsular types. PMID:26493302

  7. Efficacy of bacteriophage treatment in murine burn wound infection induced by klebsiella pneumoniae.

    PubMed

    Kumari, Seema; Harjai, Kusum; Chhibber, Sanjay

    2009-06-01

    In the present study, the therapeutic potential of purified and well-characterized bacteriophages was evaluated in thermally injured mice infected with Klebsiella pneumoniae B5055. The efficacy of five Klebsiella phages (Kpn5, Kpn12, Kpn13, Kpn17, and Kpn22) was evaluated on the basis of survival rate, decrease in bacterial counts in different organs of phage-treated animals, and regeneration of skin cells as observed by histopathological examination of phage-treated skin. Toxicity studies performed with all the phages showed them to be non-toxic, as no signs of morbidity and mortality were observed in phage-treated mice. The results of the study indicate that a single dose of phages, intraperitoneally (i.p.) at an MOI of 1.0, resulted in significant decrease in mortality, and this dose was found to be sufficient to completely cure K. pneumoniae infection in the burn wound model. Maximum decrease in bacterial counts in different organs was observed at 72 h post infection. Histopathological examination of skin of phage-treated mice showed complete recovery of burn infection. Kpn5 phage was found to be highly effective among all the phages and equally effective when compared with a cocktail of all the phages. From these results, it can be concluded that phase therapy may have the potential to be used as stand-alone therapy for K.pneumoniae induces burn wound infection, especially in situations where multiple antibiotic-resistant organisms are encountered. PMID:19597322

  8. Biosorption of Cadmium and Manganese Using Free Cells of Klebsiella sp. Isolated from Waste Water

    PubMed Central

    Hou, Yunnan; Cheng, Keke; Li, Zehua; Ma, Xiaohui; Wei, Yahong; Zhang, Lei; Wang, Yao

    2015-01-01

    In the present study, we evaluated a bacterium that was isolated from waste water for its ability to take up cadmium and manganese. The strain, identified both biochemically and by its 16S rRNA gene sequence as Klebsiella, was named Yangling I2 and was found to be highly resistant to heavy metals. Surface characterization of the bacterium via SEM revealed gross morphological changes, with cells appearing as biconcave discs after metal exposure rather than their typical rod shape. The effects of pH, temperature, heavy metal concentration, agitation and biomass concentration on the uptake of Cd(II) and Mn(II) was measured using atomic absorption spectrophotometry. The results showed that the biosorption was most affected by pH and incubation temperature, being maximized at pH 5.0 and 30°C, with absorption capacities of 170.4 and 114.1 mg/g for Cd(II) and Mn(II), respectively. Two models were investigated to compare the cells’ capacity for the biosorption of Cd and Mn, and the Langmuir model based on fuzzy linear regression was found to be close to the observed absorption curves and yield binding constants of 0.98 and 0.86 for Cd and Mn, respectively. This strain of Klebsiella has approximately ten times the absorption capacity reported for other strains and is promising for the removal of heavy metals from waste water. PMID:26505890

  9. News and Research Good Bacteria

    E-print Network

    West, Stuart

    News and Research Good Bacteria Part 2 Article 13 Click here for Probiotics Basics Cooperation Is A No-brainer For Symbiotic Bacteria 9-4-2003 Humans may learn cooperation in kindergarten, but what about bacteria, whose behavior is preprogrammed by their DNA? Some legume plants, which rely

  10. Lipoprotein sorting in bacteria.

    PubMed

    Okuda, Suguru; Tokuda, Hajime

    2011-01-01

    Bacterial lipoproteins are synthesized as precursors in the cytoplasm and processed into mature forms on the cytoplasmic membrane. A lipid moiety attached to the N terminus anchors these proteins to the membrane surface. Many bacteria are predicted to express more than 100 lipoproteins, which play diverse functions on the cell surface. The Lol system, composed of five proteins, catalyzes the localization of Escherichia coli lipoproteins to the outer membrane. Some lipoproteins play vital roles in the sorting of other lipoproteins, lipopolysaccharides, and ?-barrel proteins to the outer membrane. On the basis of results from biochemical, genetic, and structural studies, we discuss the biogenesis of lipoproteins in bacteria, their importance in cellular functions, and the molecular mechanisms underlying efficient sorting of hydrophobic lipoproteins to the outer membrane through the hydrophilic periplasm. PMID:21663440

  11. Manufacture of Probiotic Bacteria

    NASA Astrophysics Data System (ADS)

    Muller, J. A.; Ross, R. P.; Fitzgerald, G. F.; Stanton, C.

    Lactic acid bacteria (LAB) have been used for many years as natural biopreservatives in fermented foods. A small group of LAB are also believed to have beneficial health effects on the host, so called probiotic bacteria. Probiotics have emerged from the niche industry from Asia into European and American markets. Functional foods are one of the fastest growing markets today, with estimated growth to 20 billion dollars worldwide by 2010 (GIA, 2008). The increasing demand for probiotics and the new food markets where probiotics are introduced, challenges the industry to produce high quantities of probiotic cultures in a viable and stable form. Dried concentrated probiotic cultures are the most convenient form for incorporation into functional foods, given the ease of storage, handling and transport, especially for shelf-stable functional products. This chapter will discuss various aspects of the challenges associated with the manufacturing of probiotic cultures.

  12. Reanimation of Ancient Bacteria

    SciTech Connect

    Vreeland, Russell H.

    2009-01-09

    Recent highly publicized experiments conducted on salt crystals taken from the Permian Salado Formation in Southeastern New Mexico have shown that some ancient crystals contain viable microorganisms trapped within fluid inclusions. Stringent geological and microbiological selection criteria were used to select crystals and conduct all sampling. This talk will focus on how each of these lines of data support the conclusion that such isolated bacteria are as old as the rock in which they are trapped. In this case, the isolated microbes are salt tolerant bacilli that grow best in media containing 8% NaCl, and respond to concentrated brines by forming spores. One of the organisms is phylogenetically related to several bacilli, but does have several unique characteristics. This talk will trace the interdisciplinary data and procedures supporting these discoveries, and describe the various isolated bacteria.

  13. Discrimination of selected species of pathogenic bacteria using near-infrared Raman spectroscopy and principal components analysis

    NASA Astrophysics Data System (ADS)

    de Siqueira e Oliveira, Fernanda SantAna; Giana, Hector Enrique; Silveira, Landulfo

    2012-10-01

    A method, based on Raman spectroscopy, for identification of different microorganisms involved in bacterial urinary tract infections has been proposed. Spectra were collected from different bacterial colonies (Gram-negative: Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa and Enterobacter cloacae, and Gram-positive: Staphylococcus aureus and Enterococcus spp.), grown on culture medium (agar), using a Raman spectrometer with a fiber Raman probe (830 nm). Colonies were scraped from the agar surface and placed on an aluminum foil for Raman measurements. After preprocessing, spectra were submitted to a principal component analysis and Mahalanobis distance (PCA/MD) discrimination algorithm. We found that the mean Raman spectra of different bacterial species show similar bands, and S. aureus was well characterized by strong bands related to carotenoids. PCA/MD could discriminate Gram-positive bacteria with sensitivity and specificity of 100% and Gram-negative bacteria with sensitivity ranging from 58 to 88% and specificity ranging from 87% to 99%.

  14. Siboglinid-bacteria endosymbiosis

    PubMed Central

    Fielman, Kevin T; Santos, Scott R; Halanych, Kenneth M

    2008-01-01

    Siboglinid worms are a group of gutless marine annelids which are nutritionally dependent upon endosymbiotic bacteria.1,2 Four major groups of siboglinids are known including vestimentiferans, Osedax spp., frenulates and moniliferans.3–5 Very little is known about the diversity of bacterial endosymbionts associated with frenulate or monoliferan siboglinids. This lack of knowledge is surprising considering the global distribution of siboglinids; this system is likely among the most common symbioses in the deep sea. At least three distinct clades of endosymbiotic ?-proteobacteria associate with siboglinid annelids.6 Frenulates harbor a clade of ?-proteobacteria that are divergent from both the thiotrophic bacteria of vestimentiferans and monoliferans as well as the heterotrophic bacteria of Osedax spp.6,7 We also discuss priorities for future siboglinid research and the need to move beyond descriptive studies. A promising new method, laser-capture microdissection (LCM), allows for the precise excision of tissue regions of interest.8 This method, when used in concert with molecular and genomic techniques, such as Expressed Sequence Tag (EST) surveys using pyrosequencing technology, will likely enable investigations into physiological processes and mechanisms in these symbioses. Furthermore, adopting a comparative approach using different siboglinid groups, such as worms harboring thiotrophic versus methanotrophic endosymbionts, may yield considerable insight into the ecology and evolution of the Siboglinidae. PMID:19704881

  15. Genome Sequence of Klebsiella pneumoniae CICC10011, a Promising Strain for High 2,3-Butanediol Production

    PubMed Central

    Tong, Ying-Jia; Liu, Lu-Gang; Shen, Meng-Qiu

    2015-01-01

    Klebsiella pneumoniae CICC10011, a promising 2,3-butanediol producer, has received much attention because of its high productivity. Here, the first draft genome sequence of this efficient strain may provide the genetic basis for further insights into the metabolic and regulatory mechanisms underlying the production of 2,3-butanediol at a high titer. PMID:26205860

  16. Destruction of single-species biofilms of Escherichia coli or Klebsiella pneumoniae subsp. pneumoniae by dextranase, lactoferrin, and lysozyme

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The activity of dextranase, lactoferrin, lysozyme, and nisin against biofilms composed of either Klebsiella pneumonia or Escherichia coli was examined using the MBEC Assay™. Mature biofilms were treated and then sonicated to remove the adherent biofilm. This material was quantified using a lumines...

  17. Transfer of KPC-2 Carbapenemase from Klebsiella pneumoniae to Escherichia coli in a Patient: First Case in Europe?

    PubMed Central

    Richter, Sara N.; Frasson, Ilaria; Bergo, Cristina; Parisi, Saverio; Cavallaro, Antonietta; Palù, Giorgio

    2011-01-01

    The first case in Europe of Klebsiella pneumoniae carbapenemase (KPC) 2 transfer from K. pneumoniae to Escherichia coli in the same patient is described. KPC-positive plasmids from the two species were identical, indicating horizontal plasmid transfer. Selection of the KPC-producing E. coli strain was triggered by therapy with meropenem. PMID:21411573

  18. Genome Sequence of Klebsiella pneumoniae CICC10011, a Promising Strain for High 2,3-Butanediol Production.

    PubMed

    Tong, Ying-Jia; Ji, Xiao-Jun; Liu, Lu-Gang; Shen, Meng-Qiu; Huang, He

    2015-01-01

    Klebsiella pneumoniae CICC10011, a promising 2,3-butanediol producer, has received much attention because of its high productivity. Here, the first draft genome sequence of this efficient strain may provide the genetic basis for further insights into the metabolic and regulatory mechanisms underlying the production of 2,3-butanediol at a high titer. PMID:26205860

  19. Coproduction of KPC-2 and QnrB19 in Klebsiella pneumoniae ST340 isolate in Brazil.

    PubMed

    Martins, Willames M B S; Almeida, Anna C S; Nicoletti, Adriana G; Cayô, Rodrigo; Gales, Ana C; Alves, Luiz C; Brayner, Fábio B; Vilela, Marinalda A; Morais, Márcia M C

    2015-12-01

    Few reports described the presence of blaKPC and qnr genes in the same isolate. This study reports the combination of blaKPC-2 and qnrB19 genes in Klebsiella pneumoniae ST340 isolate in Brazil. These findings draw attention to this combination in ST340 isolate, which is part of the CC258, disseminated in Latin America. PMID:26458280

  20. Complete Genome Sequence of Klebsiella pneumoniae Strain HKUOPLC, a Cellulose-Degrading Bacterium Isolated from Giant Panda Feces.

    PubMed

    Lu, Matthew Guan-Xi; Jiang, Jingwei; Liu, Lirui; Ma, Angel Po-Yee; Leung, Frederick Chi-Ching

    2015-01-01

    We report here the complete genome sequence of Klebsiella pneumoniae strain HKUOPLC, isolated from a giant panda fecal sample collected from Ocean Park, Hong Kong. The complete genome of this bacterium may contribute to the discovery of efficient cellulose-degrading pathways. PMID:26564041

  1. Complete Genome Sequence of Klebsiella variicola Strain HKUOPLA, a Cellulose-Degrading Bacterium Isolated from Giant Panda Feces.

    PubMed

    Lu, Matthew Guan-Xi; Jiang, Jingwei; Liu, Lirui; Ma, Angel Po-Yee; Leung, Frederick Chi-Ching

    2015-01-01

    We report here the complete genome sequence of Klebsiella variicola strain HKUOPLA, isolated from a giant panda feces sample collected from Ocean Park, Hong Kong. The complete genome of this bacterium may contribute toward the discovery of efficient cellulose-degrading pathways. PMID:26472841

  2. Complete Genome Sequence of Klebsiella variicola Strain HKUOPLA, a Cellulose-Degrading Bacterium Isolated from Giant Panda Feces

    PubMed Central

    Lu, Matthew Guan-Xi; Jiang, Jingwei; Liu, Lirui; Ma, Angel Po-Yee

    2015-01-01

    We report here the complete genome sequence of Klebsiella variicola strain HKUOPLA, isolated from a giant panda feces sample collected from Ocean Park, Hong Kong. The complete genome of this bacterium may contribute toward the discovery of efficient cellulose-degrading pathways. PMID:26472841

  3. In vitro antibacterial potency of Butea monosperma Lam. against 12 clinically isolated multidrug resistant bacteria

    PubMed Central

    Sahu, Mahesh Chandra; Padhy, Rabindra Nath

    2013-01-01

    Objective To investigate the antibacterial activity, using cold and hot extraction procedures with five solvents, petroleum ether, acetone, ethanol, methanol and water to validate medicinal uses of Butea monosperma Lam (B. monosperma) in controlling infections; and to qualitatively estimate phytochemical constituents of leaf-extracts of the plant. Methods The antibacterial activity of leaf-extracts was evaluated by the agar-well diffusion method against clinically isolated 12 Gram-positive and -negative multidrug resistant (MDR) pathogenic bacteria in vitro. Values of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of leaf-extracts against each bacterium were obtained in a 96-well micro-titre plate, by broth dilution micro-titre plate technique. Results The presence of tannins, flavonoids, starch, glycosides and carbohydrates in different leaf extracts was established. Pathogenic bacteria used were, Acinetobacter sp., Chromobacterium violaceum, Citrobacter freundii, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhi, Shigella sp., Enterococcus sp., Staphylococcus aureus (S. aureus), methicillin resistant S. aureus and vancomycin resistant S. aureus, along with standard bacterial strains. These MDR bacteria had been recorded to have significant inhibitions by leaf extracts, obtained by cold and hot extraction procedures with five solvents. In addition, the hot aqueous extract against Enterococcus sp. had the highest inhibition zone-size (21 mm). Ciprofloxacin 30 µg/disc was the positive/reference control and the diluting solvent, 10% dimethyl sulphoxide was the negative control. Recorded MIC values of different extracts ranged between 0.23 and 13.30 mg/mL, and MBC values were 0.52 to 30.00 mg/mL, for these bacteria. Conclusions Leaf-extracts with hot water and ethanol had shown significant antibacterial activity against all bacteria. B. monosperma leaf-extract could be used in treating infectious diseases, caused by the range of tested bacteria, as complementary and alternate medicine.

  4. Toxicological effects of selective herbicides on plant growth promoting activities of phosphate solubilizing Klebsiella sp. strain PS19.

    PubMed

    Ahemad, Munees; Saghir Khan, Md

    2011-02-01

    This study examines the effect of four herbicides, quizalafop-p-ethyl, clodinafop, metribuzin and glyphosate, on plant growth promoting activities like phosphate solubilization, siderophores, indole acetic acid, exo-polysaccharides, hydrogen cyanide and ammonia production by herbicide tolerant Klebsiella sp. strain PS19. The strain was isolated from mustard rhizosphere. The selected herbicides were applied two to three times at the recommended rates. Klebsiella sp. strain PS19 tolerated a concentration of 1600 ?g/ml each of quizalafop-p-ethyl and clodinafop, and 3200 and 2800 ?g/ml of metribuzin and glyphosate, respectively. The activities of Klebsiella sp. strain PS19 observed under in vitro environment were persistent in the presence of all herbicides at lower rates. The plant growth promoting activities even-though decreased regularly, but was not lost completely, as the concentration of each herbicide was increased from the recommended to three times of higher doses. Among all herbicides, quizalafop-p-ethyl, generally, showed maximum toxicity to plant growth promoting activities of Klebsiella sp. strain PS19. As an example, 40, 80 and 120 ?g/l of quizalafop-p-ethyl added to liquid culture Pikovskaya medium, decreased phosphate solubilizing activity of strain PS19 by 93, 95 and 97%, respectively over untreated control. The study revealed that the higher rates of herbicides though decreased the plant growth promoting activity but it did not completely inhibit the metabolic activities of strain PS19. The herbicide tolerance together with growth promoting activities observed under herbicide stress suggests that Klebsiella sp. strain PS19 could be used as bacterial preparation for facilitating the growth and yields of crops even in soils polluted with herbicides. PMID:20721665

  5. Rhodanese activity: a simple and reliable taxonomic tool for gram-negative bacteria.

    PubMed

    Lányi, B

    1982-05-01

    The thiosulphate: cyanide sulphurtransferase (rhodanese) test of Vandenbergh, Bawdon and Berk (1979) has been simplified and 2469 strains from a wide variety of sources representing different biochemical, serological or phage-pattern entities were tested. The percentages of rhondanese-producing strains were: Escherichia coli 98%, Shigella flexneri serovars 1-5%, X and Y 0%, other shigellae 73-100%, Yersinia spp. 0%, Salmonella subgenera I-IV 0%, Citrobacter freundi 16%, Klebsiella 37%, Enterobacter 4%, Hafnia alvei 61%, Proteus spp. 0%, Pseudomonas spp. 98-100%. Rhondanese production by S. flexneri serovar 6 supports the view that this group of bacteria should be removed from S. flexneri and placed in another species of Shigella. PMID:6958873

  6. Isolation and characterization of bacteriocinogenic lactic bacteria from M-Tuba and Tepache, two traditional fermented beverages in México.

    PubMed

    de la Fuente-Salcido, Norma M; Castañeda-Ramírez, José Cristobal; García-Almendárez, Blanca E; Bideshi, Dennis K; Salcedo-Hernández, Rubén; Barboza-Corona, José E

    2015-09-01

    Mexican Tuba (M-Tuba) and Tepache are Mexican fermented beverages prepared mainly with pineapple pulp and coconut palm, respectively. At present, reports on the microbiota and nutritional effects of both beverages are lacking. The purpose of this study was to determine whether M-Tuba and Tepache contain cultivable lactic acid bacteria (LAB) capable of producing bacteriocins. Tepache and M-Tuba contain mesophilic aerobic bacteria, LAB, and yeast. Bacillus subtilis, Listeria monocytogenes, Listeria innocua, Streptococcus agalactiae, Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Salmonella typhimurium, and Salmonella spp, were the microorganisms most susceptible to metabolites produced by bacterial isolates. M-Tuba and Tepache contain bacteria that harbor genes coding for nisin and enterocin, but not pediocin. The presence of Lactococcus lactis and E. faecium in M-Tuba and Tepache, was identified by 16S rDNA. These bacteria produced bacteriocins of ?3.5 kDa and 4.0-4.5 kDa, respectively. Partial purified bacteriocins showed inhibitory effect against Micrococcus luteus, L. monocytogenes, L. innocua, Str. agalactiae, S. aureus, Bacillus cereus, B. subtilis, E. faecalis, and K. pneumoniae. We characterized, for the first time, cultivable microbiota of M-Tuba and Tepache, and specifically, identified candidate lactic bacteria (LAB) present in these beverages that were capable of synthesizing antimicrobial peptides, which collectively could provide food preservative functions. PMID:26405529

  7. Differentiation of 1-aminocyclopropane-1-carboxylate (ACC) deaminase from its homologs is the key for identifying bacteria containing ACC deaminase.

    PubMed

    Li, Zhengyi; Chang, Siping; Ye, Shuting; Chen, Mingyue; Lin, Li; Li, Yuanyuan; Li, Shuying; An, Qianli

    2015-10-01

    1-Aminocyclopropane-1-carboxylate (ACC) deaminase-mediated reduction of ethylene generation in plants under abiotic stresses is a key mechanism by which bacteria can promote plant growth. Misidentification of ACC deaminase and the ACC deaminase structure gene (acdS) can lead to overestimation of the number of bacteria containing ACC deaminase and their function in ecosystems. Previous non-specific amplification of acdS homologs has led to an overestimation of the horizontal transfer of acdS genes. Here, we designed consensus-degenerate hybrid oligonucleotide primers (acdSf3, acdSr3 and acdSr4) based on differentiating the key residues in ACC deaminases from those of homologs for specific amplification of partial acdS genes. PCR amplification, sequencing and phylogenetic analysis identified acdS genes from a wide range of proteobacteria and actinobacteria. PCR amplification and a genomic search did not find the acdS gene in bacteria belonging to Pseudomonas stutzeri or in the genera Enterobacter, Klebsiella or Bacillus. We showed that differentiating the acdS gene and ACC deaminase from their homologs was crucial for the molecular identification of bacteria containing ACC deaminase and for understanding the evolution of the acdS gene. We provide an effective method for screening and identifying bacteria containing ACC deaminase. PMID:26362924

  8. Isolation and characterization of bacteriocinogenic lactic bacteria from M-Tuba and Tepache, two traditional fermented beverages in México

    PubMed Central

    de la Fuente-Salcido, Norma M; Castañeda-Ramírez, José Cristobal; García-Almendárez, Blanca E; Bideshi, Dennis K; Salcedo-Hernández, Rubén; Barboza-Corona, José E

    2015-01-01

    Mexican Tuba (M-Tuba) and Tepache are Mexican fermented beverages prepared mainly with pineapple pulp and coconut palm, respectively. At present, reports on the microbiota and nutritional effects of both beverages are lacking. The purpose of this study was to determine whether M-Tuba and Tepache contain cultivable lactic acid bacteria (LAB) capable of producing bacteriocins. Tepache and M-Tuba contain mesophilic aerobic bacteria, LAB, and yeast. Bacillus subtilis, Listeria monocytogenes, Listeria innocua, Streptococcus agalactiae, Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Salmonella typhimurium, and Salmonella spp, were the microorganisms most susceptible to metabolites produced by bacterial isolates. M-Tuba and Tepache contain bacteria that harbor genes coding for nisin and enterocin, but not pediocin. The presence of Lactococcus lactis and E. faecium in M-Tuba and Tepache, was identified by 16S rDNA. These bacteria produced bacteriocins of ?3.5 kDa and 4.0–4.5 kDa, respectively. Partial purified bacteriocins showed inhibitory effect against Micrococcus luteus, L. monocytogenes, L. innocua, Str. agalactiae, S. aureus, Bacillus cereus, B. subtilis, E. faecalis, and K. pneumoniae. We characterized, for the first time, cultivable microbiota of M-Tuba and Tepache, and specifically, identified candidate lactic bacteria (LAB) present in these beverages that were capable of synthesizing antimicrobial peptides, which collectively could provide food preservative functions. PMID:26405529

  9. The inhibitory effect of Zingiber corallinum Hance essential oil on drug-resistant bacteria and evaluation of its acute toxicity

    PubMed Central

    Yang, Ce; Zhou, Lin-Lin; Wang, Hai-Yan; Huang, Su-Na; Liu, Qing; Hu, Shi-Lin; Li, Ting-Rong; Chen, Yan-Bing; Jiang, Jian-Xin

    2011-01-01

    Summary Background The excessive and irregular use of antibiotics could result in the generation and diffusion of drug-resistant bacteria. The aim of this study was to investigate the inhibitory effect of Zingiber corallinum Hance essential oil (ZCHO) on drug-resistant bacteria, especially on drug-resistant Acinetobacter baumannii. Material/Methods Susceptibility testing was used to evaluate the effect of ZCHO on growth inhibition of drug-resistant bacteria by paper disk method. Mice orally administered with ZCHO were used to observe acute toxicity and to determine median lethal dose (LD50) of ZCHO. Broth dilution method was used to determine minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of ZCHO on drug-resistant Acinetobacter baumannii. Results ZCHO exhibited an obvious inhibitory effect not only on gram-negative drug-resistant bacteria including Escherichia coli, Klebsiella pneumoniae, Enterobacter cloacae and Acinetobacter baumannii, but also on gram-positive drug-resistant bacteria including Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus haemolyticus. The ZCHO containing 79% terpinen-4-ol revealed better bacteriostatic effect than ZCHO with 34% terpinen-4-ol. The LD50 of ZCHO was 1790.427 mg/kg. The MIC and MBC of ZCHO on drug-resistant Acinetobacter baumannii were 1457.81 mg/L. Conclusions ZCHO has obvious bacteriostasis and bactericidal effects, especially against drug-resistant Acinetobacter baumannii. Therefore, ZCHO is a promising natural bioactive component with antibacterial effect and satisfactory safety due to its low toxicity. PMID:21525802

  10. Surface layers of bacteria.

    PubMed Central

    Beveridge, T J; Graham, L L

    1991-01-01

    Since bacteria are so small, microscopy has traditionally been used to study them as individual cells. To this end, electron microscopy has been a most powerful tool for studying bacterial surfaces; the viewing of macromolecular arrangements of some surfaces is now possible. This review compares older conventional electron-microscopic methods with new cryotechniques currently available and the results each has produced. Emphasis is not placed on the methodology but, rather, on the importance of the results in terms of our perception of the makeup and function of bacterial surfaces and their interaction with the surrounding environment. Images PMID:1723487

  11. Bacteria in Solitary Confinement

    PubMed Central

    2014-01-01

    Even in clonal bacterial cultures, individual bacteria can show substantial stochastic variation, leading to pitfalls in the interpretation of data derived from millions of cells in a culture. In this issue of the Journal of Bacteriology, as part of their study on osmoadaptation in a cyanobacterium, Nanatani et al. describe employing an ingenious microfluidic device that gently cages individual cells (J Bacteriol 197:676–687, 2015, http://dx.doi.org/10.1128/JB.02276-14). The device is a welcome addition to the toolkit available to probe the responses of individual cells to environmental cues. PMID:25488297

  12. Plugging of a Model Rock System by Using Starved Bacteria

    PubMed Central

    MacLeod, F. A.; Lappin-Scott, H. M.; Costerton, J. W.

    1988-01-01

    The effects of starvation on bacterial penetration through artificial rock cores were examined. Klebsiella pneumoniae was starved in a simple salts solution for a duration of up to 4 weeks. These cell suspensions were injected into sintered glass bead cores, and the resulting reductions in core permeabilities were recorded. Vegetative cell cultures of K. pneumoniae grown in a sodium citrate medium were injected into other, similar cores, and the reductions in core permeabilities were recorded. The starved cell suspensions did not completely block the core pores, whereas the vegetative cultures reduced core permeability to less than 1%. Scanning electron microscopy of core sections infiltrated with either vegetative or starved cells showed that the former produced shallow “skin” plugs and copious amounts of glycocalyx at the inlet face, whereas the latter produced very little glycocalyx and the cells were distributed evenly throughout the length of the core. The use of a DNA assay to produce a cell distribution profile showed that, compared with the vegetative cells, starved bacteria were able to penetrate deeper into the cores. This was due to the smaller size of the cells and the reduction in biofilm production. This ability of starved bacteria to penetrate further into cores than the normal-size vegetative cells can be usefully applied to selective plugging for enhanced oil recovery. To further test the suitability of starved cells for use in selective plugging, the activities of starved cells present within cores were monitored before and after nutrient stimulation. Our data indicate that with nutrient stimulation, the starved cells lose their metabolic dormancy and produce reductions in core permeability due to cell growth and polymer production. Images PMID:16347647

  13. The establishment of resistance phenotypes for bacteria isolated from outpatients in urine cultures.

    PubMed

    Zugravu, Roxana; Licker, Monica; Berceanu-V?duva, Delia; R?dulescu, Matilda; Ad?mu?, Marcela; Dragomirescu, Liliana; Branea, Dorina; Hogea, Elena; Muntean, Delia; Mihaela, Diana Popa; Moldovan, Roxana; Loredana, Gabriela Popa

    2006-01-01

    From 1911 outpatients, who addressed a Timi?oara private clinical laboratory, from January to December 2005, we collected 1,889 urine cultures, 431 being positive. Bacteria identification was generally done using morphological, cultural, biochemical characters and pathogenicity tests. Sensitivity testing to antimicrobial medical drugs was done by using the classical diffusion Kirby-Bauer method and the automatic analyzer Osiris, also. The main bacteria involved in the etiology of these infections were represented by Enterobacteriaceae, head of the list being Escherichia coli (81.21%), followed by Klebsiella pneumoniae (8.35%) and Proteus mirabilis (3.02%). We also isolated Gram positive cocci (in a much smaller proportion), mainly represented by Enterococcus faecalis (1.16%), Staphylococcus aureus (0.93%), Streptococcus agalactiae, and also Gram negative non-fermentative bacilli, such as Pseudomonas aeruginosa (0.93%) or Acinetobacter baumanii (0.23%). As soon as we performed the sensitivity tests, we divided them in resistance phenotypes: Most of the Enterobacteriaceae were integrated in the wild phenotype, followed by the penicillinase producing phenotype. An E. coli strain (0.29%) and 3 Klebsiella pneumoniae strains (8.33%) were integrated in the large spectrum, multidrug resistant, beta-lactamase producing phenotype, also associated with resistance to fluoroquinolones and aminoglycosides; Non-fermentative bacilli did not present special resistance problems, the four Pseudomonas aeruginosa strains were integrated in the wild phenotype (secreting induced chromosomal cephalosporinase). As for Staphylococcus aureus it was identified a strain having fluoroquinolone resistance, two strains secreting penicillinase and having a K (Nm) phenotype and a strain secreting penicillinase only. Antibiotic resistance represents a major concern for patients, physicians, healthcare managers, and policymakers. The use of antibiotics is closely linked with the development of acquired antibiotic resistance. PMID:18389723

  14. Metabolic Engineering of Klebsiella pneumoniae for the Production of 2-Butanone from Glucose

    PubMed Central

    Chen, Zhen; Sun, He; Huang, Jinhai; Wu, Yao; Liu, Dehua

    2015-01-01

    2-Butanone is an important commodity chemical of wide application in different areas. In this study, Klebsiella pneumoniae was engineered to directly produce 2-butanone from glucose by extending its native 2, 3-butanediol synthesis pathway. To identify the potential enzyme for the efficient conversion of 2, 3-butanediol to 2-butanone, we screened different glycerol dehydratases and diol dehydratases. By introducing the diol dehydratase from Lactobacillus brevis and deleting the ldhA gene encoding lactate dehydrogenase, the engineered K. pneumoniae was able to accumulate 246 mg/L of 2-butanone in shake flask. With further optimization of culture condition, the titer of 2-butanone was increased to 450 mg/L. This study lays the basis for developing an efficient biological process for 2-butanone production. PMID:26465746

  15. Production of optically pure d-lactate from glycerol by engineered Klebsiella pneumoniae strain.

    PubMed

    Feng, Xinjun; Ding, Yamei; Xian, Mo; Xu, Xin; Zhang, Rubing; Zhao, Guang

    2014-11-01

    In this study, glycerol was used to produce optically pure d-lactate by engineered Klebsiella pneumoniae strain. In the recombinant strain, d-lactate dehydrogenase LdhA was overexpressed, and two genes, dhaT and yqhD for biosynthesis of main byproduct 1,3-propanediol, were knocked out. To further improve d-lactate production, the culture condition was optimized and the results demonstrated that aeration rate played an important role in d-lactate production. In microaerobic fed-batch fermentation, the engineered strain accumulated 142.1g/L optically pure d-lactate with a yield of 0.82g/g glycerol, which represented the highest d-lactate production from glycerol so far. This study showed that K. pneumoniae strain has high efficiency to convert glycerol into d-lactate and high potentiality in utilization of crude glycerol from biodiesel industry. PMID:25270041

  16. Glucosyltransferase production by Klebsiella sp. K18 and conversion of sucrose to palatinose using immobilized cells.

    PubMed

    Orsi, Daniela C; Kawaguti, Haroldo Y; Sato, Hélia H

    2009-01-01

    The strain Klebsiella sp. K18 produces the enzyme glucosyltransferase and catalyses the conversion of sucrose to palatinose, an alternative sugar that presents low cariogenicity. Response Surface Methodology was successfully employed to determine the optimal concentration of culture medium components. Maximum glucosyltransferase production (21.78 U mL(-1)) was achieved using the optimized medium composed by sugar cane molasses (80 g L(-1)), bacteriological peptone (7 g L(-1)) and yeast extract (20 g L(-1)), after 8 hours of fermentation at 28°C. The conversion of sucrose to palatinose was studied utilizing immobilized cells in calcium alginate. The effects of the alginate concentration (2-4%), cell mass concentration (20-40%) and substrate concentration (25-45%) were evaluated and the yield of palatinose was approximately 62.5%. PMID:24031319

  17. Intercontinental spread from Israel to Colombia of a KPC-3-producing Klebsiella pneumoniae strain.

    PubMed

    Lopez, J A; Correa, A; Navon-Venezia, S; Correa, A L; Torres, J A; Briceño, D F; Montealegre, M C; Quinn, J P; Carmeli, Y; Villegas, M V

    2011-01-01

    In 2008, an increase in the prevalence of carbapenem-resistant Klebsiella pneumoniae was noted in a 286-bed tertiary case hospital in Colombia, where 84 patients (32 infected and 52 colonized) had positive cultures. The identified index patient came from Israel for a liver transplantation. High level carbapenem resistance was observed. Polymyxin B and tigecycline were the only two antibiotics that remained active. PCR-restriction fragment length polymorphism analysis and sequencing revealed blaKPC-3 in the major clone, which was indistinguishable from the K. pneumoniae carbapenemase-3-producing clone described previously in Israel. This exemplifies the threat posed by the global spread of K. pneumoniae carbapenemase-producing pathogens. PMID:20219078

  18. A Case of Ventriculitis Associated with Renal Abscess Caused by Serotype K1 Klebsiella pneumoniae

    PubMed Central

    Hyun, Ji In; Jeon, Yoon Hee; Kim, Sang Il; Park, Yeon Joon; Kang, Moon Won; Kim, Woohyeon; Jang, Ji Hye

    2014-01-01

    Recently, serotype K1 Klebsiella pneumoniae has been a major agent of an invasive syndrome characterized by liver abscess and its metastatic infection. Extrahepatic infection and its characteristics in patients with renal abscess caused by K. pneumoniae are poorly understood, and few cases of central nervous system infection have been reported. This is a report of 80-year-old woman with uncontrolled type 2 diabetes mellitus with renal abscess caused by serotype K1 K. pneumoniae, complicated with ventriculitis despite of appropriate use of antibiotics. Physicians need to be aware of possibility of metastatic infection in patients with serotype K1 K. pneumoniae infection, if they develop neurologic symptom and focus of infection is still present. PMID:25024876

  19. Production of 2-butanol from crude glycerol by a genetically-engineered Klebsiella pneumoniae strain.

    PubMed

    Oh, Baek-Rock; Heo, Sun-Yeon; Lee, Sung-Mok; Hong, Won-Kyung; Park, Jang Min; Jung, You Ree; Kim, Dae-Hyuk; Sohn, Jung-Hoon; Seo, Jeong-Woo; Kim, Chul Ho

    2014-01-01

    Klebsiella pneumoniae was engineered to produce 2-butanol from crude glycerol as a sole carbon source by expressing acetolactate synthase (ilvIH), keto-acid reducto-isomerase (ilvC) and dihydroxy-acid dehydratase (ilvD) from K. pneumoniae, and ?-ketoisovalerate decarboxylase (kivd) and alcohol dehydrogenase (adhA) from Lactococcus lactis. Engineered K. pneumonia, ?ldhA/pBR-iBO (ilvIH–ilvC–ilvD–kivd–adhA), produced 2-butanol (160 mg l?1) from crude glycerol. To increase the yield of 2-butanol, we eliminated the 2,3-butanediol pathway from the recombinant strain by inactivating ?-acetolactate decarboxylase (adc). This further engineering step improved the yield of 2-butanol from 160 to 320 mg l?1. This represents the first successful attempt to produce 2-butanol from crude glycerol. PMID:24078128

  20. Glucosyltransferase production by Klebsiella sp. K18 and conversion of sucrose to palatinose using immobilized cells

    PubMed Central

    Orsi, Daniela C.; Kawaguti, Haroldo Y.; Sato, Hélia H.

    2009-01-01

    The strain Klebsiella sp. K18 produces the enzyme glucosyltransferase and catalyses the conversion of sucrose to palatinose, an alternative sugar that presents low cariogenicity. Response Surface Methodology was successfully employed to determine the optimal concentration of culture medium components. Maximum glucosyltransferase production (21.78 U mL-1) was achieved using the optimized medium composed by sugar cane molasses (80 g L-1), bacteriological peptone (7 g L-1) and yeast extract (20 g L-1), after 8 hours of fermentation at 28°C. The conversion of sucrose to palatinose was studied utilizing immobilized cells in calcium alginate. The effects of the alginate concentration (2-4%), cell mass concentration (20-40%) and substrate concentration (25-45%) were evaluated and the yield of palatinose was approximately 62.5%. PMID:24031319

  1. Can entropy save bacteria?

    E-print Network

    Suckjoon Jun

    2008-08-29

    This article presents a physical biology approach to understanding organization and segregation of bacterial chromosomes. The author uses a "piston" analogy for bacterial chromosomes in a cell, which leads to a phase diagram for the organization of two athermal chains confined in a closed geometry characterized by two length scales (length and width). When applied to rod-shaped bacteria such as Escherichia coli, this phase diagram predicts that, despite strong confinement, duplicated chromosomes will demix, i.e., there exists a primordial physical driving force for chromosome segregation. The author discusses segregation of duplicating chromosomes using the concentric-shell model, which predicts that newly synthesized DNA will be found in the periphery of the chromosome during replication. In contrast to chromosomes, these results suggest that most plasmids will be randomly distributed inside the cell because of their small sizes. An active partitioning system is therefore required for accurate segregation of low-copy number plasmids. Implications of these results are also sketched, e.g., on the role of proteins, segregation mechanisms for bacteria of diverse shapes, cell cycle of an artificial cell, and evolution.

  2. Molecular Serotyping of Klebsiella Species Isolates by Restriction of the Amplified Capsular Antigen Gene Cluster

    PubMed Central

    Brisse, Sylvain; Issenhuth-Jeanjean, Sylvie; Grimont, Patrick A. D.

    2004-01-01

    The objective of the present work was to develop a molecular method that would enable determination of the capsular serotypes of Klebsiella isolates without the use of antiserum. PCR amplification of the capsular antigen gene cluster (cps) was followed by digestion with the restriction enzyme HincII (cps PCR-restriction fragment length polymorphism [RFLP] analysis). The profiles (C patterns) obtained for 224 strains representing the 77 known K serotypes showed 3 to 13 fragments ranging in size from 0.2 to 4.4 kb. A total of 97 distinct C patterns were obtained; 100% of 61 pairs of samples tested twice showed reproducible C patterns. The C patterns were K-type specific; i.e., the C pattern(s) of any K serotype was distinct from the C patterns of all other K serotypes, with the only exceptions being serotypes K22 and K37, which are known to cross-react. For 12 of 17 K types for which at least two strains were included, C-pattern variations were found among strains with the same K serotype. Therefore, cps PCR-RFLP analysis has a higher discriminatory power than classical K serotyping. C-pattern identity was observed among strains with a given K type that were collected many years apart and from distinct sources, indicating C-pattern stability. Only 4.5% of the strains were nontypeable, because of unsuccessful PCR amplification (whereas 8 to 23% are nontypeable by classical K serotyping). Three of four noncapsulated strains analyzed showed recognizable C patterns. The K serotypes of 18 (82%) of 22 recent Klebsiella pneumoniae clinical isolates could be deduced from their C patterns. In conclusion, cps PCR-RFLP analysis allows determination of the K serotype, while it is easier to perform and more discriminatory than classical serotyping. PMID:15297473

  3. Intermingled Klebsiella pneumoniae Populations Between Retail Meats and Human Urinary Tract Infections

    PubMed Central

    Davis, Gregg S.; Waits, Kara; Nordstrom, Lora; Weaver, Brett; Aziz, Maliha; Gauld, Lori; Grande, Heidi; Bigler, Rick; Horwinski, Joseph; Porter, Stephen; Stegger, Marc; Johnson, James R.; Liu, Cindy M.; Price, Lance B.

    2015-01-01

    Background.?Klebsiella pneumoniae is a common colonizer of the gastrointestinal tract of humans, companion animals, and livestock. To better understand potential contributions of foodborne K. pneumoniae to human clinical infections, we compared K. pneumoniae isolates from retail meat products and human clinical specimens to assess their similarity based on antibiotic resistance, genetic relatedness, and virulence. Methods.?Klebsiella pneumoniae was isolated from retail meats from Flagstaff grocery stores in 2012 and from urine and blood specimens from Flagstaff Medical Center in 2011–2012. Isolates underwent antibiotic susceptibility testing and whole-genome sequencing. Genetic relatedness of the isolates was assessed using multilocus sequence typing and phylogenetic analyses. Extraintestinal virulence of several closely related meat-source and urine isolates was assessed using a murine sepsis model. Results.?Meat-source isolates were significantly more likely to be multidrug resistant and resistant to tetracycline and gentamicin than clinical isolates. Four sequence types occurred among both meat-source and clinical isolates. Phylogenetic analyses confirmed close relationships among meat-source and clinical isolates. Isolates from both sources showed similar virulence in the mouse sepsis model. Conclusions.?Meat-source K. pneumoniae isolates were more likely than clinical isolates to be antibiotic resistant, which could reflect selective pressures from antibiotic use in food-animal production. The close genetic relatedness of meat-source and clinical isolates, coupled with similarities in virulence, suggest that the barriers to transmission between these 2 sources are low. Taken together, our results suggest that retail meat is a potential vehicle for transmitting virulent, antibiotic-resistant K. pneumoniae from food animals to humans. PMID:26206847

  4. Derepression of Mineral Phosphate Solubilization Phenotype by Insertional Inactivation of iclR in Klebsiella pneumoniae

    PubMed Central

    Pandya, Maharshi; Jog, Rahul; G, Naresh Kumar; Rajkumar, Shalini

    2015-01-01

    The mode of succinate mediated repression of mineral phosphate solubilization and the role of repressor in suppressing phosphate solubilization phenotype of two free-living nitrogen fixing Klebsiella pneumoniae strains was studied. Organic acid mediated mineral phosphate solubilization phenotype of oxalic acid producing Klebsiella pneumoniae SM6 and SM11 were transcriptionally repressed by IclR in presence of succinate as carbon source. Oxalic acid production and expression of genes of the glyoxylate shunt (aceBAK) was found only in glucose but not in succinate- and glucose+succinate-grown cells. IclR, repressor of aceBAK operon, was inactivated using an allelic exchange system resulting in derepressed mineral phosphate solubilization phenotype through constitutive expression of the glyoxylate shunt. Insertional inactivation of iclR resulted in increased activity of the glyoxylate shunt enzymes even in succinate-grown cells. An augmented phosphate solubilization up to 54 and 59% soluble phosphate release was attained in glucose+succinate-grown SM6? and SM11? strains respectively, compared to glucose-grown cells, whereas phosphate solubilization was absent or negligible in wildtype cells grown in glucose+succinate. Both wildtype and iclR deletion strains showed similar indole-3-acetic acid production. Wheat seeds inoculated with wildtype SM6 and SM11 improved both root and shoot length by 1.2 fold. However, iclR deletion SM6? and SM11? strains increased root and shoot length by 1.5 and 1.4 folds, respectively, compared to uninoculated controls. The repressor inactivated phosphate solubilizers better served the purpose of constitutive phosphate solubilization in pot experiments, where presence of other carbon sources (e.g., succinate) might repress mineral phosphate solubilization phenotype of wildtype strains. PMID:26381651

  5. Vapor-induced transfer of bacteria in the absence of mechanical disturbances.

    PubMed

    Ayoub, G M; Dahdah, L; Alameddine, I; Malaeb, L

    2014-09-15

    Transfer of bacteria through water vapor generated at moderate temperatures (30-50°C) in passive solar stills, has scarcely been reported. The objective of this research was to investigate whether bacteria in highly humid atmospheres can get transferred through water vapor in the absence of other transfer media to find their way to the distillate. To achieve this objective, passive solar reactors were chosen as the medium for experimentation, and distillation experiments were conducted by spiking a pure bacterial culture (Escherichia coli, Klebsiella pneumonia or Enterococcus faecalis) in low mineralized water vs. highly mineralized water in the dark under moderate temperatures ranges (30-35°C, 40-45°C and 50-55°C). Results showed that bacteria indeed get transferred with the vapor in stills when not exposed to solar U.V. radiation. The trends observed were adequately explained by a zero-modified Hurdle-Poisson model. The numbers of cultivable bacterial colonies transferred were bacterial size, water type and temperature dependent with highest transfers occurring in E. faecalis>E. coli>K. pneumonia at the 40°C range in low mineralized water. Proper management strategies are recommended to achieve complete disinfection in solar stills. PMID:25169809

  6. Atomic Force Microscopy Reveals the Mechanobiology of Lytic Peptide Action on Bacteria.

    PubMed

    Mularski, Anna; Wilksch, Jonathan J; Wang, Huabin; Hossain, Mohammed Akhter; Wade, John D; Separovic, Frances; Strugnell, Richard A; Gee, Michelle L

    2015-06-01

    Increasing rates of antimicrobial-resistant medically important bacteria require the development of new, effective therapeutics, of which antimicrobial peptides (AMPs) are among the promising candidates. Many AMPs are membrane-active, but their mode of action in killing bacteria or in inhibiting their growth remains elusive. This study used atomic force microscopy (AFM) to probe the mechanobiology of a model AMP (a derivative of melittin) on living Klebsiella pneumoniae bacterial cells. We performed in situ biophysical measurements to understand how the melittin peptide modulates various biophysical behaviors of individual bacteria, including the turgor pressure, cell wall elasticity, and bacterial capsule thickness and organization. Exposure of K. pneumoniae to the peptide had a significant effect on the turgor pressure and Young's modulus of the cell wall. The turgor pressure increased upon peptide addition followed by a later decrease, suggesting that cell lysis occurred and pressure was lost through destruction of the cell envelope. The Young's modulus also increased, indicating that interaction with the peptide increased the rigidity of the cell wall. The bacterial capsule did not prevent cell lysis by the peptide, and surprisingly, the capsule appeared unaffected by exposure to the peptide, as capsule thickness and inferred organization were within the control limits, determined by mechanical measurements. These data show that AFM measurements may provide valuable insights into the physical events that precede bacterial lysis by AMPs. PMID:25978768

  7. Phylogenetic diversity and antimicrobial activity of marine bacteria associated with the soft coral Sarcophyton glaucum.

    PubMed

    ElAhwany, Amani M D; Ghozlan, Hanan A; ElSharif, Hafed A; Sabry, Soraya A

    2015-01-01

    Coral reefs are the most biodiverse and biologically productive of all marine ecosystems. Corals harbor diverse and abundant prokaryotic groups. However, little is known about the diversity of coral-associated microorganisms. We used molecular techniques to identify and compare the culturable bacterial assemblages associated with the soft coral Sarcophyton glaucum from the Red sea. Different media were utilized for microbial isolation, and the phylogeny of the culturable bacteria associated with the coral was analyzed based on 16S rDNA sequencing. The coral associated bacteria were found to be representatives within the Gammaproteobacteria, Actinobacteria, and Firmicutes. Antimicrobial activities of twenty bacterial isolates were tested against four pathogenic bacteria (Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Vibrio fluvialis) and three fungi (Penicillium sp., Aspergillus niger, Candida albicans). A relatively high proportion of bacterial strains displayed distinct antibacterial and antifungal activities, suggesting that soft coral-associated microorganisms may aid their host in protection against marine pathogens. Members of genera Bacillus and Pseudomonas had the highest proportion of antimicrobial activity which supported the hypothesis that they might play a protective role in the coral hosts. PMID:23996153

  8. High diversity of nitrogen-fixing bacteria in upper reaches of Heihe River, Northwestern China

    NASA Astrophysics Data System (ADS)

    Tai, X. S.; Mao, W. L.; Liu, G. X.; Chen, T.; Zhang, W.; Wu, X. K.; Long, H. Z.; Zhang, B. G.

    2013-03-01

    Vegetation plays a key role to water conservation in southern Qilian Mountains (Northwestern China), the upper reaches of Heihe River. Nitrogen-fixing bacteria are crucial for vegetation protection because they can supply plants with nitrogen source. Nevertheless, little is known about nitrogen-fixing bacteria in this region. In present study, nifH gene clone libraries were established for detecting the difference of nitrogen-fixing bacterial communities between Potentilla parvifolia shrub and Carex alrofusca meadow in the southern Qilian Mountains. All the identified nitrogen-fixing bacterial clones belonged to Proteobacteria. At the genus level, the Azospirillum sp. was only detected in shrub soil while Thiocapsa sp., Derxiasp., Ectothiorhodospira sp., Mesorhizobium sp., Klebsiella sp., Ensifer sp., Methylocella sp. and Peseudomonas sp. were just detected in meadow soil. Shannon-Wiener index of nifH gene ranged from 1.5 to 2.8 and was higher in meadow soil than shrub soil. Contrarily, the nifH gene copies and CFUs of cultured nitrogen-fixing bacteria ranged from 0.4 × 107 to 6.9 × 107 copies g-1 soil and 0.97 × 106 to 12.78 × 106 g-1 soil, respectively. Furthermore, both of them were lower in meadow soil than shrub soil. Statistical analysis revealed that diversity and copies of nifH gene mostly correlated with aboveground biomass in shrub soil. In meadow soil, nifH gene diversity was principally affected by altitude while copies did by soil available K.

  9. Isolation of Extended Spectrum ?-lactamase (ESBL) Producing Bacteria from Urban Surface Waters in Malaysia

    PubMed Central

    Tissera, Shehani; Lee, Sui Mae

    2013-01-01

    Background: This was a preliminary study to test for the presence of multiple antibiotic-resistant extended spectrum ?-lactamase (ESBL) producing bacteria in Malaysian urban surface waters. Although the literature review revealed several published papers on clinical ESBL isolates in Malaysia, none were found on ESBL isolates obtained from local surface waters Methods: Isolated bacterial species were tested for resistance to cefotaxime, amoxicillin/clavulanate and aztreonam, and susceptibility to imipenem and meropenem using antibiotic susceptibility testing (AST) by disc diffusion. This served as a screening step to detect bacteria that could be potential ESBL species. 16S ribose ribonucleic acid (rRNA) polymerase chain reaction (PCR) testing with two clusters of bla (?-lactamase) gene primers was used to test for the bla genes CTX-M (Groups 1, 2, 9), OXA-1, SHV and TEM. Results: A total of 19 isolates were found, possessing at least one of the bla genes tested for. There was a relatively high occurrence of CTX-M genes (84.2%) among these, followed by TEM genes (47.4%). The isolates were identified as Enterobacteriaceae (89.5%), predominantly Escherichia coli and Klebsiella pneumoniae. Conclusion: There appears to be a high occurrence of ESBL-bacteria in local surface waters, among these being opportunistic pathogens. The persistence and spread of these species in the environment poses a threat to exposed human populations. PMID:23966820

  10. Molecular phylogenetic profiling of gut-associated bacteria in larvae and adults of flesh flies.

    PubMed

    Gupta, A K; Rastogi, G; Nayduch, D; Sawant, S S; Bhonde, R R; Shouche, Y S

    2014-12-01

    Flesh flies of the genus Sarcophaga (Diptera: Sarcophagidae) are carrion-breeding, necrophagous insects important in medical and veterinary entomology as potential transmitters of pathogens to humans and animals. Our aim was to analyse the diversity of gut-associated bacteria in wild-caught larvae and adult flesh flies using culture-dependent and culture-independent methods. Analysis of 16S rRNA gene sequences from cultured isolates and clone libraries revealed bacteria affiliated to Proteobacteria, Actinobacteria, Firmicutes and Bacteroidetes in the guts of larval and adult flesh flies. Bacteria cultured from larval and adult flesh fly guts belonged to the genera Acinetobacter, Bacillus, Budvicia, Citrobacter, Dermacoccus, Enterococcus, Ignatzschineria, Lysinibacillus, Myroides, Pasteurella, Proteus, Providencia and Staphylococcus. Phylogenetic analysis showed clone sequences of the genera Aeromonas, Bacillus, Bradyrhizobium, Citrobacter, Clostridium, Corynebacterium, Ignatzschineria, Klebsiella, Pantoea, Propionibacterium, Proteus, Providencia, Serratia, Sporosarcina, Weissella and Wohlfahrtiimonas. Species of clinically significant genera such as Ignatzschineria and Wohlfahrtiimonas spp. were detected in both larvae and adult flesh flies. Sequence analysis of 16S rRNA gene libraries supported culture-based results and revealed the presence of additional bacterial taxa. This study determined the diversity of gut microbiota in flesh flies, which will bolster the ability to assess microbiological risk associated with the presence of these flies. The present data thereby establish a platform for a much larger study. PMID:24805263

  11. Effect of the inactivation of lactate dehydrogenase, ethanol dehydrogenase, and phosphotransacetylase on 2,3-butanediol production in Klebsiella pneumoniae strain

    PubMed Central

    2014-01-01

    Background 2,3-Butanediol (2,3-BD) is a high-value chemical usually produced petrochemically but which can also be synthesized by some bacteria. To date, Klebsiella pneumoniae is the most powerful 2,3-BD producer which can utilize a wide range of substrates. However, many by-products are also produced by K. pneumoniae, such as ethanol, lactate, and acetate, which negatively regulate the 2,3-BD yield and increase the costs of downstream separation and purification. Results In this study, we constructed K. pneumoniae mutants with lactate dehydrogenase (LDH), acetaldehyde dehydrogenase (ADH), and phosphotransacetylase (PTA) deletion individually by suicide vector conjugation. These mutants showed different behavior of production formation. Knock out of ldhA had little influence on the yield of 2,3-BD, whereas knock out of adhE or pta significantly improved the formation of 2,3-BD. The accumulation of the intermediate of 2,3-BD biosynthesis, acetoin, was decreased in all the mutants. The mutants were then tested in five different carbon sources and increased 2,3-BD was observed. Also a double mutant strain with deletion of adhE and ldhA was constructed which resulted in accelerated fermentation and higher 2,3-BD production. In fed-batch culture this strain achieved more than 100 g/L 2,3-BD from glucose with a relatively high yield of 0.49 g/g. Conclusion 2,3-BD production was dramatically improved with the inactivation of adhE and pta. The inactivation of ldhA could advance faster cell growth and shorter fermentation time. The double mutant strain with deletion of adhE and ldhA resulted in accelerated fermentation and higher 2,3-BD production. These results provide new insights for industrial production of 2,3-BD by K. pneumoniae. PMID:24669952

  12. Detection and Molecular Characterization of Escherichia coli CTX-M-15 and Klebsiella pneumoniae SHV-12 ?-Lactamases from Bovine Mastitis Isolates in the United Kingdom

    PubMed Central

    Maciuca, Iuliana E.; Evans, Nicholas J.; Williams, Helen; Wattret, Andrew; Fick, Jenny C.; Williams, Nicola J.

    2014-01-01

    Recent reports raised concerns about the role that farm stock may play in the dissemination of extended-spectrum ?-lactamase (ESBL)-producing bacteria. This study characterized the ESBLs in two Escherichia coli and three Klebsiella pneumoniae subsp. pneumoniae isolates from cases of clinical bovine mastitis in the United Kingdom. Bacterial culture and sensitivity testing of bovine mastitic milk samples identified Gram-negative cefpodoxime-resistant isolates, which were assessed for their ESBL phenotypes. Conjugation experiments and PCR-based replicon typing (PBRT) were used for characterization of transferable plasmids. E. coli isolates belonged to sequence type 88 (ST88; determined by multilocus sequence typing) and carried blaCTX-M-15 and blaTEM-1, while K. pneumoniae subsp. pneumoniae isolates carried blaSHV-12 and blaTEM-1. Conjugation experiments demonstrated that blaCTX-M-15 and blaTEM-1 were carried on a conjugative plasmid in E. coli, and PBRT identified this to be an IncI1 plasmid. The resistance genes were nontransferable in K. pneumoniae subsp. pneumoniae isolates. Moreover, in the E. coli isolates, an association of ISEcp1 and IS26 with blaCTX-M-15 was found where the IS26 element was inserted upstream of both ISEcp1 and the blaCTX-M promoter, a genetic arrangement highly similar to that described in some United Kingdom human isolates. We report the first cases in Europe of bovine mastitis due to E. coli CTX-M-15 and also of bovine mastitis due to K. pneumoniae subsp. pneumoniae SHV-12 ?-lactamases in the United Kingdom. We also describe the genetic environment of blaCTX-M-15 and highlight the role that IncI1 plasmids may play in the spread and dissemination of ESBL genes, which have been described in both human and cattle isolates. PMID:24247146

  13. Clinical and microbiologic characteristics of adult patients with recurrent bacteraemia caused by extended-spectrum ?-lactamase-producing Escherichia coli or Klebsiella pneumoniae.

    PubMed

    Lee, C-H; Su, L-H; Chen, F-J; Tang, Y-F; Chien, C-C; Liu, J-W

    2015-12-01

    The characteristics of patients with recurrent bacteraemia caused by extended-spectrum ?-lactamase (ESBL)-producing Escherichia coli or Klebsiella pneumoniae (EK) are rarely described. Flomoxef belongs to the cephamycins group and demonstrates in vitro activity against ESBL-producing organisms. Whether flomoxef may be used for the treatment of such infections remains controversial. This retrospective case-control study enrolled adult patients who had bacteraemia caused by ESBL-EK during 2005-2011. Case patients were those who had more than one episode of ESBL-EK bacteraemia. Controls were those who were matched for age and interval time of blood sampling and had only one episode of ESBL-EK bacteraemia with subsequent bacteraemia episodes caused by other non-ESBL-EK bacteria. Pulsed-field gel electrophoresis and microbiologic profiles of the initial and subsequent ESBL-EK isolates were analysed. During the study period, 424 patients were found to have at least one positive blood culture after the first ESBL-EK bacteraemia episode, and 67 (15.8%) had a second episode of ESBL-EK bacteraemia. Bacteraemia resulting from vascular catheter-related infection (odds ratio, 3.24; 95% confidence interval, 1.31-8.05), and definitive therapy with flomoxef (odds ratio, 2.99; 95% confidence interval, 1.10-8.15) were both independent risk factors for the recurrence. Among the 56 patients with available ESBL-EK isolates for analysis, 38 (67.8%) were infected by genetically similar strains. In three of these 38 recurrent ESBL-EK bacteraemia cases caused by an identical strain, the minimum inhibitory concentrations of carbapenem for the subsequent K. pneumoniae isolates were fourfold or higher than the initial isolates. Recurrent bacteraemia was not uncommon in our patients with ESBL-EK bacteraemia, and most of the episodes were caused by identical strains. PMID:26271718

  14. Deep sequencing-based analysis of gene expression in bovine mammary epithelial cells after Staphylococcus aureus, Escherichia coli, and Klebsiella pneumoniae infection.

    PubMed

    Xiu, L; Fu, Y B; Deng, Y; Shi, X J; Bian, Z Y; Ruhan, A; Wang, X

    2015-01-01

    The goal of this study was to characterize the transcriptome of primary bovine mammalian epithelial cells (pBMECs) and to identify candidate genes for response and resistance to Staphylococcus aureus (strain S108), Escherichia coli (strain E23), and Klebsiella pneumoniae (strain K96) infection. Using Solexa sequencing, approximately 4.9 million total sequence tags were obtained from each of the three infected libraries and the control library. Gene Ontology (GO) analysis of the S108-infected pBMECs showed differentially expressed genes (DEGs) were significantly involved in metabolic processes. In E23-infected pBMECs, DEGs were predominantly associated with cell death and programmed cell death GO terms, while in K96-infected pBMECs, DEGs were primarily involved in metabolic processes and in utero embryonic development. Analysis of the cluster of orthologous groups of proteins showed that the S108-infected, E23-infected and K96-infected pBMECs were significantly involved in "Translation, ribosomal structure and biogenesis", "General function prediction only" and "Replication, recombination and repair". The transcriptome sequences were also annotated for KEGG orthology, and it was found that DEGs in S108-infected pBMECs were significantly involved in oxidative phosphorylation and Parkinson's disease. The clustered pathway terms of the DEGs of the E23-infected pBMECs were found to involve the NOD-like receptor signaling pathway and oxidative phosphorylation, while those of the K96-infected pBMECs were primarily involved in oxidative phosphorylation and apoptosis. Our results have identified a number of immune-related genes that showed changes in gene expression after bacterial infection, and provided insight into the interactions between pBMECs and the bacteria. PMID:26681042

  15. Phenotypic switching in bacteria

    NASA Astrophysics Data System (ADS)

    Merrin, Jack

    Living matter is a non-equilibrium system in which many components work in parallel to perpetuate themselves through a fluctuating environment. Physiological states or functionalities revealed by a particular environment are called phenotypes. Transitions between phenotypes may occur either spontaneously or via interaction with the environment. Even in the same environment, genetically identical bacteria can exhibit different phenotypes of a continuous or discrete nature. In this thesis, we pursued three lines of investigation into discrete phenotypic heterogeneity in bacterial populations: the quantitative characterization of the so-called bacterial persistence, a theoretical model of phenotypic switching based on those measurements, and the design of artificial genetic networks which implement this model. Persistence is the phenotype of a subpopulation of bacteria with a reduced sensitivity to antibiotics. We developed a microfluidic apparatus, which allowed us to monitor the growth rates of individual cells while applying repeated cycles of antibiotic treatments. We were able to identify distinct phenotypes (normal and persistent) and characterize the stochastic transitions between them. We also found that phenotypic heterogeneity was present prior to any environmental cue such as antibiotic exposure. Motivated by the experiments with persisters, we formulated a theoretical model describing the dynamic behavior of several discrete phenotypes in a periodically varying environment. This theoretical framework allowed us to quantitatively predict the fitness of dynamic populations and to compare survival strategies according to environmental time-symmetries. These calculations suggested that persistence is a strategy used by bacterial populations to adapt to fluctuating environments. Knowledge of the phenotypic transition rates for persistence may provide statistical information about the typical environments of bacteria. We also describe a design of artificial genetic networks that would implement a more general theoretical model of phenotypic switching. We will use a new cloning strategy in order to systematically assemble a large number of genetic features, such as site-specific recombination components from the R64 plasmid, which invert several coexisting DNA segments. The inversion of these segments would lead to discrete phenotypic transitions inside a living cell. These artificial phenotypic switches can be controlled precisely in experiments and may serve as a benchmark for their natural counterparts.

  16. Immunology Taught by Bacteria

    PubMed Central

    2010-01-01

    Introduction It has been proposed that the innate immune system might discriminate living and virulent pathogens from dead or harmless microbes, but the molecular mechanisms by which this discrimination could occur remain unclear. Although studies of model antigens and adjuvants have illuminated important principles underlying immune responses, the specific immune responses made to living, virulent pathogens can only be discovered by studies of the living, virulent pathogens themselves. Methods and Findings Here, I review what one particular bacterium, Legionella pneumophila, has taught us about the innate immune response. Pathogens differ greatly in the mechanisms they use to invade, replicate within, and transmit among their hosts. However, a theme that emerges is that the pathogenic activities sensed by host cells are conserved among multiple pathogenic bacteria. Conclusion Thus, immunology taught by L. pneumophila may lead to a more general understanding of the host response to infection. PMID:20373001

  17. A direct viable count method for the enumeration of attached bacteria and assessment of biofilm disinfection

    NASA Technical Reports Server (NTRS)

    Yu, F. P.; Pyle, B. H.; McFeters, G. A.

    1993-01-01

    This report describes the adaptation of an in situ direct viable count (in situ DVC) method in biofilm disinfection studies. The results obtained with this technique were compared to two other enumeration methods, the plate count (PC) and conventional direct viable count (c-DVC). An environmental isolate (Klebsiella pneumoniae Kp1) was used to form biofilms on stainless steel coupons in a stirred batch reactor. The in situ DVC method was applied to directly assess the viability of bacteria in biofilms without disturbing the integrity of the interfacial community. As additional advantages, the results were observed after 4 h instead of the 24 h incubation time required for colony formation and total cell numbers that remained on the substratum were enumerated. Chlorine and monochloramine were used to determine the susceptibilities of attached and planktonic bacteria to disinfection treatment using this novel analytical approach. The planktonic cells in the reactor showed no significant change in susceptibility to disinfectants during the period of biofilm formation. In addition, the attached cells did not reveal any more resistance to disinfection than planktonic cells. The disinfection studies of young biofilms indicated that 0.25 mg/l free chlorine (at pH 7.2) and 1 mg/l monochloramine (at pH 9.0) have comparable disinfection efficiencies at 25 degrees C. Although being a weaker disinfectant, monochloramine was more effective in removing attached bacteria from the substratum than free chlorine. The in situ DVC method always showed at least one log higher viable cell densities than the PC method, suggesting that the in situ DVC method is more efficient in the enumeration of biofilm bacteria. The results also indicated that the in situ DVC method can provide more accurate information regarding the cell numbers and viability of bacteria within biofilms following disinfection.

  18. Performance Evaluation of the Verigene Gram-Positive and Gram-Negative Blood Culture Test for Direct Identification of Bacteria and Their Resistance Determinants from Positive Blood Cultures in Hong Kong

    PubMed Central

    Siu, Gilman K. H.; Chen, Jonathan H. K.; Ng, T. K.; Lee, Rodney A.; Fung, Kitty S. C.; To, Sabrina W. C.; Wong, Barry K. C.; Cheung, Sherman; Wong, Ivan W. F.; Tam, Marble M. P.; Lee, Swing S. W.; Yam, W. C.

    2015-01-01

    Background A multicenter study was conducted to evaluate the diagnostic performance and the time to identifcation of the Verigene Blood Culture Test, the BC-GP and BC-GN assays, to identify both Gram-positive and Gram-negative bacteria and their drug resistance determinants directly from positive blood cultures collected in Hong Kong. Methods and Results A total of 364 blood cultures were prospectively collected from four public hospitals, in which 114 and 250 cultures yielded Gram-positive and Gram-negative bacteria, and were tested with the BC-GP and BC-GN assay respectively. The overall identification agreement for Gram-positive and Gram-negative bacteria were 89.6% and 90.5% in monomicrobial cultures and 62.5% and 53.6% in polymicrobial cultures, respectively. The sensitivities for most genus/species achieved at least 80% except Enterococcus spp. (60%), K.oxytoca (0%), K.pneumoniae (69.2%), whereas the specificities for all targets ranged from 98.9% to 100%. Of note, 50% (7/14) cultures containing K.pneumoniae that were missed by the BC-GN assay were subsequently identified as K.variicola. Approximately 5.5% (20/364) cultures contained non-target organisms, of which Aeromonas spp. accounted for 25% and are of particular concern. For drug resistance determination, the Verigene test showed 100% sensitivity for identification of MRSA, VRE and carbapenem resistant Acinetobacter, and 84.4% for ESBL-producing Enterobacteriaceae based on the positive detection of mecA, vanA, blaOXA and blaCTXM respectively. Conclusion Overall, the Verigene test provided acceptable accuracy for identification of bacteria and resistance markers with a range of turnaround time 40.5 to 99.2 h faster than conventional methods in our region. PMID:26431434

  19. Swimming bacteria in liquid crystal

    NASA Astrophysics Data System (ADS)

    Sokolov, Andrey; Zhou, Shuang; Aranson, Igor; Lavrentovich, Oleg

    2014-03-01

    Dynamics of swimming bacteria can be very complex due to the interaction between the bacteria and the fluid, especially when the suspending fluid is non-Newtonian. Placement of swimming bacteria in lyotropic liquid crystal produces a new class of active materials by combining features of two seemingly incompatible constituents: self-propelled live bacteria and ordered liquid crystals. Here we present fundamentally new phenomena caused by the coupling between direction of bacterial swimming, bacteria-triggered flows and director orientations. Locomotion of bacteria may locally reduce the degree of order in liquid crystal or even trigger nematic-isotropic phase transition. Microscopic flows generated by bacterial flagella disturb director orientation. Emerged birefringence patterns allow direct optical observation and quantitative characterization of flagella dynamics. At high concentration of bacteria we observed the emergence of self-organized periodic texture caused by bacteria swimming. Our work sheds new light on self-organization in hybrid bio-mechanical systems and can lead to valuable biomedical applications. Was supported by the US DOE, Office of Basic Energy Sciences, Division of Materials Science and Engineering, under the Contract No. DE AC02-06CH11357.

  20. Microbes in Molecular Biology I. BACTERIA

    E-print Network

    Dever, Jennifer A.

    Acid) Agar selective for Gram-positive bacteria growing bacteria under condi@ons where only4/29/15 1 Microbes in Molecular Biology I. BACTERIA A. Intro B. Pla viruses I. BACTERIA A. introduc@on/overview #12;4/29/15 2 · Bacteria can be grown

  1. Outbreak of Ampicillin/Piperacillin-Resistant Klebsiella Pneumoniae in a Neonatal Intensive Care Unit (NICU): Investigation and Control Measures

    PubMed Central

    Fabbri, Giuliana; Panico, Manuela; Dallolio, Laura; Suzzi, Roberta; Ciccia, Matilde; Sandri, Fabrizio; Farruggia, Patrizia

    2013-01-01

    Klebsiella pneumoniae is a frequent cause of infectious outbreaks in Neonatal Intensive Care Units (NICUs). The aim of this paper is to describe an outbreak occurred in a 13-bed NICU and the control measures adopted in order to interrupt the chain of transmission. We described the microbiological investigations, the NICU staff compliance to the infection control measures by means of a specifically designed check-list and the control measures adopted. Six cases of primary bloodstream infections sustained by ampicillin/piperacillin-resistant Klebsiella pneumoniae were observed over a two-month period. One culture obtained from a 12% saccarose multiple-dose solution allowed the growth of Klebsiella pneumoniae. During the inspections performed by the Hospital Infection Control Team, using the check-list for the evaluation of the NICU staff compliance to the infection control measures, several breaches in the infection control policy were identified and control measures were adopted. In our case the definition of a specific check-list led to the adoption of the correct control measures. Further studies would be helpful in order to develop a standard check-list able to identify critical flows in the adhesion to the guidelines. It could be used in different NICUs and allow to obtain reproducible levels of infection control. PMID:23442560

  2. Airborne bacteria and viruses.

    PubMed

    Cox, C S

    1989-01-01

    Coughing, sneezing, talking, bed-making, turning pages of books, etc. all generate microbial aerosols which are carried and dispersed by air movements. Inhalation of these particles may cause allergic responses but whether or not infectious disease ensues depends in part on the viability and infectivity of the inhaled microbes and their landing sites. Desiccation is experienced by all airborne microbes; gram-negative bacteria and lipid-containing viruses demonstrate phase changes in their outer phospholipid bilayer membranes owing to concomitant changes in water content and/or temperature. These changes most likely lead to cross-linking reactions of associated protein moieties principally at mid to high relative humidity (RH). For lipid-free viruses these reactions of their surface protein moieties occur most rapidly at low RH. Radiation, oxygen, ozone and its reaction products and various pollutants also decrease viability and infectivity through chemical, physical and biological modification to phospholipid, protein and nucleic acid moieties. The extent of damage and the degree of repair together with the efficacy of host defence mechanisms largely controls whether the causative microbes take hold and spread disease via the airborne route. At least indoors, where desiccation is the predominant stress, the general reversibility of membrane-phase changes by vapour-phase rehydration when coupled with efficacious microbial enzymatic repair mechanisms under genetic control, virtually ensures the spread of disease by the aerobiological pathway. PMID:2699673

  3. Risk Factors of Carbapenem-Resistant Klebsiella pneumoniae Infection: A Serious Threat in ICUs

    PubMed Central

    Ulu, Asl?han Candevir; Kurtaran, Behice; Inal, Ay?e Seza; Kömür, Süheyla; Kibar, Filiz; Çiçekdemir, Hatice Yap?c?; Bozkurt, Seval; Gürel, Derya; K?l?ç, Fatma; Yaman, Akgün; Aksu, Hasan Salih Zeki; Ta?ova, Ye?im

    2015-01-01

    Background Nosocomial infections caused by Carbapenem-resistant Klebsiella pneumoniae (CRKP) are increasing. Our aim in this study was to investigate the risk factors of CRKP infections. Material/Methods A retrospective cohort study was performed between 1 January and 31 December 2012 in ICU patients. Data was taken from the hospital infection control database for CRKP. The clinical samples collected from the patients were tested by an automatized system and disk diffusion. SPSS software v11.5 was used for statistical analysis. Results Totally, 105 Klebsiella pneumoniae isolates were found in 2012 and the carbapenem resistance rate was 48%. The first episode of infection was taken into risk factor analysis. Of the 98 patients, 61 (62.2%) were male and the mean and median ages were 30.4±29.8 and 25 (0–93). The length of stay was longer in the resistant group (p=0.026). Mortality was 48% in the whole group and similar between groups (p=0.533). There was a relationship between meropenem and third-generation cephalosporin use and resistance (OR 3.244 (1.193–8.819) and OR: 3.590 (1.056–12.209). The other risk factors in univariate analysis were: Immunosuppression OR: 2.186 (1.754–2.724), nasogastric catheter OR: 3.562 (1.317–9.634), peripheral arterial catheter OR: 2.545 (1.027–6.307), and being admitted to the neurosurgical unit OR: 4.324 (1.110–16.842). The multivariate analysis showed use of third-generation cephalosporin OR: 4.699 (1.292–17.089), nasogastric catheter use OR: 3.983 (1.356–11.698), and being admitted to neurosurgical ICU OR: 4.603 (1.084–19.555) as independent risk factors. Conclusions Restriction of third-generation cephalosporin and carbapenem use and invasive procedures, along with infection control precautions and disinfection policies, may be effective in reducing the carbapenem resistance in ICUs. PMID:25595166

  4. Magnetic Microstructure of Magnetotactic Bacteria by

    E-print Network

    Dunin-Borkowski, Rafal E.

    Magnetic Microstructure of Magnetotactic Bacteria by Electron Holography Rafal E. Dunin microstructure of magnetite nanocrys- tals in magnetotactic bacteria. The magnetite crystals were all single). For example, magnetotactic bacteria contain magnetosomes, which are intracellular, ferri- magnetic crystals

  5. Interactions between Diatoms and Bacteria

    PubMed Central

    Amin, Shady A.; Parker, Micaela S.

    2012-01-01

    Summary: Diatoms and bacteria have cooccurred in common habitats for hundreds of millions of years, thus fostering specific associations and interactions with global biogeochemical consequences. Diatoms are responsible for one-fifth of the photosynthesis on Earth, while bacteria remineralize a large portion of this fixed carbon in the oceans. Through their coexistence, diatoms and bacteria cycle nutrients between oxidized and reduced states, impacting bioavailability and ultimately feeding higher trophic levels. Here we present an overview of how diatoms and bacteria interact and the implications of these interactions. We emphasize that heterotrophic bacteria in the oceans that are consistently associated with diatoms are confined to two phyla. These consistent bacterial associations result from encounter mechanisms that occur within a microscale environment surrounding a diatom cell. We review signaling mechanisms that occur in this microenvironment to pave the way for specific interactions. Finally, we discuss known interactions between diatoms and bacteria and exciting new directions and research opportunities in this field. Throughout the review, we emphasize new technological advances that will help in the discovery of new interactions. Deciphering the languages of diatoms and bacteria and how they interact will inform our understanding of the role these organisms have in shaping the ocean and how these interactions may change in future oceans. PMID:22933565

  6. TSSWCB Bacteria-Related Projects 

    E-print Network

    Wythe, Kathy

    2007-01-01

    stream_source_info TSSWCB bacteria-related projects.pdf.txt stream_content_type text/plain stream_size 2550 Content-Encoding ISO-8859-1 stream_name TSSWCB bacteria-related projects.pdf.txt Content-Type text/plain; charset=ISO-8859... of the projects are listed below. ? Peach CreekWater Quality Improvement Project ? Monitoring and Educational Programs Focused on Bacteria and Nutrient Runoff on Dairy Operations in the LeonWatershed ? Development of the Plum CreekWPP ? Impact of Proper...

  7. Oral versus intravenous antibiotics for patients with Klebsiella pneumoniae liver abscess: study protocol for a randomized controlled trial

    PubMed Central

    2013-01-01

    Background Klebsiella pneumoniae liver abscess is the most common etiology of liver abscess in Singapore and much of Asia, and its incidence is increasing. Current management includes prolonged intravenous antibiotic therapy, but there is limited evidence to guide oral conversion. The implicated K1/K2 capsule strain of Klebsiella pneumoniae is almost universally susceptible to ciprofloxacin, an antibiotic with high oral bioavailability. Our primary aim is to compare the efficacy of early (< one week) step-down to oral antibiotics, to continuing four weeks of intravenous antibiotics, in patients with Klebsiella liver abscess. Methods/design The study is designed as a multi-center randomized open-label active comparator-controlled non-inferiority trial, with a non-inferiority margin of 12%. Eligible participants will be inpatients over the age of 21 with a CT or ultrasound scan suggestive of a liver abscess, and Klebsiella pneumoniae isolated from abscess fluid or blood. Randomization into intervention or active control arms will be performed with a 1:1 allocation ratio. Participants randomized to active control will receive IV ceftriaxone 2 grams daily to complete a total of four weeks of IV antibiotics. Participants randomized to intervention will be immediately converted to oral ciprofloxacin 750 mg twice daily. At Week four, all participants will undergo abdominal imaging and be assessed for clinical response (CRP?Klebsiella liver abscess. A finding of non-inferiority may translate to the wider adoption of a more cost-effective strategy that reduces hospital length of stay and improves patient-centered outcomes and satisfaction. Trial registration Clinical trials gov NCT01723150 PMID:24176222

  8. Positive Autoregulation of mrkHI by the Cyclic Di-GMP-Dependent MrkH Protein in the Biofilm Regulatory Circuit of Klebsiella pneumoniae

    PubMed Central

    Tan, Jason W. H.; Hocking, Dianna M.; Wang, Nancy; Srikhanta, Yogitha N.; Tauschek, Marija; Lithgow, Trevor; Robins-Browne, Roy M.; Yang, Ji; Strugnell, Richard A.

    2015-01-01

    ABSTRACT Klebsiella pneumoniae is an important cause of nosocomial infections, primarily through the formation of surface-associated biofilms to promote microbial colonization on host tissues. Expression of type 3 fimbriae by K. pneumoniae facilitates surface adherence, a process strongly activated by the cyclic di-GMP (c-di-GMP)-dependent transcriptional activator MrkH. In this study, we demonstrated the critical importance of MrkH in facilitating K. pneumoniae attachment on a variety of medically relevant materials and demonstrated the mechanism by which bacteria activate expression of type 3 fimbriae to colonize these materials. Sequence analysis revealed a putative MrkH recognition DNA sequence (“MrkH box”; TATCAA) located in the regulatory region of the mrkHI operon. Mutational analysis, electrophoretic mobility shift assay, and quantitative PCR experiments demonstrated that MrkH binds to the cognate DNA sequence to autoregulate mrkHI expression in a c-di-GMP-dependent manner. A half-turn deletion, but not a full-turn deletion, between the MrkH box and the ?35 promoter element rendered MrkH ineffective in activating mrkHI expression, implying that a direct interaction between MrkH and RNA polymerase exists. In vivo analyses showed that residues L260, R265, N268, C269, E273, and I275 in the C-terminal domain of the RNA polymerase ? subunit are involved in the positive control of mrkHI expression by MrkH and revealed the regions of MrkH required for DNA binding and transcriptional activation. Taken together, the data suggest a model whereby c-di-GMP-dependent MrkH recruits RNA polymerase to the mrkHI promoter to autoactivate mrkH expression. Increased MrkH production subsequently drives mrkABCDF expression when activated by c-di-GMP, leading to biosynthesis of type 3 fimbriae and biofilm formation. IMPORTANCE Bacterial biofilms can cause persistent infections that are refractory to antimicrobial treatments. This study investigated how a commonly encountered hospital-acquired pathogen, Klebsiella pneumoniae, controls the expression of MrkH, the principal regulator of type 3 fimbriae and biofilm formation. We discovered a regulatory circuit whereby MrkH acts as a c-di-GMP-dependent transcriptional activator of both the gene cluster of type 3 fimbriae and the mrkHI operon. In this positive-feedback loop, whereby MrkH activates its own production, K. pneumoniae has evolved a mechanism to ensure rapid MrkH production, expression of type 3 fimbriae, and subsequent biofilm formation under favorable conditions. Deciphering the molecular mechanisms of biofilm formation by bacterial pathogens is important for the development of innovative treatment strategies for biofilm infections. PMID:25733612

  9. Modeling and Robustness Analysis of Biochemical Networks of Glycerol Metabolism by Klebsiella Pneumoniae

    NASA Astrophysics Data System (ADS)

    Ye, Jianxiong; Feng, Enmin; Wang, Lei; Xiu, Zhilong; Sun, Yaqin

    Glycerol bioconversion to 1,3-propanediol (1,3-PD) by Klebsiella pneumoniae (K. pneumoniae) can be characterized by an intricate network of interactions among biochemical fluxes, metabolic compounds, key enzymes and genetic regulatory. To date, there still exist some uncertain factors in this complex network because of the limitation in bio-techniques, especially in measuring techniques for intracellular substances. In this paper, among these uncertain factors, we aim to infer the transport mechanisms of glycerol and 1,3-PD across the cell membrane, which have received intensive interest in recent years. On the basis of different inferences of the transport mechanisms, we reconstruct various metabolic networks correspondingly and subsequently develop their dynamical systems (S-systems). To determine the most reasonable metabolic network from all possible ones, we establish a quantitative definition of biological robustness and undertake parameter identification and robustness analysis for each system. Numerical results show that it is most possible that both glycerol and 1,3-PD pass the cell membrane by active transport and passive diffusion.

  10. Biosynthesis of poly(3-hydroxypropionate) from glycerol using engineered Klebsiella pneumoniae strain without vitamin B12.

    PubMed

    Feng, Xinjun; Xian, Mo; Liu, Wei; Xu, Chao; Zhang, Haibo; Zhao, Guang

    2015-01-01

    Poly(3-hydroxypropionate) (P3HP) is a biodegradable and biocompatible thermoplastic. Previous studies demonstrated that engineered Escherichia coli strains can produce P3HP with supplementation of expensive vitamin B12. The present study examined the production of P3HP from glycerol in the recombinant Klebsiella pneumoniae strain, which naturally synthesizes vitamin B12. The genes glycerol dehydratase and its reactivation factor (dhaB123, gdrA, and gdrB from K. pneumoniae), aldehyde dehydrogenase (aldH from E. coli) were cloned and expressed in K. pneumoniae to produce 3-hydroxypropionate (3HP), with 2 genes (dhaT and yqhD) for biosynthesis of 1,3-propanediol were deleted. To obtain P3HP production, propionyl-CoA synthetase (prpE from E. coli) and polyhydroxyalkanoate synthase (phaC from Ralstonia eutropha) were introduced. Under the appropriate aeration condition, the cell yield and P3HP content were 0.24 g/L and 12.7% (wt/wt [cell dry weight]) respectively along with 2.03 g/L 3HP after 48 h cultivation. Although the yield is relatively low, this study shows the feasibility of producing P3HP in K. pneumoniae from glycerol without vitamin B12 for the first time. The results also suggest that the aeration conditions should be optimized carefully for the efficient production of P3HP. PMID:25621933

  11. Klebsiella: a long way to go towards understanding this enigmatic jet-setter

    PubMed Central

    Broberg, Christopher A.; Palacios, Michelle

    2014-01-01

    Klebsiella pneumoniae is the causative agent of a variety of diseases, including pneumonia, urinary tract infections, septicemia, and the recently recognized pyogenic liver abscesses (PLA). Renewed efforts to identify and understand the bacterial determinants required to cause disease have come about because of the worldwide increase in the isolation of strains resistant to a broad spectrum of antibiotics. The recent increased isolation of carbapenem-resistant strains further reduces the available treatment options. The rapid geographic spread of the resistant isolates and the spread to other pathogens are of particular concern. For many years, the best characterized virulence determinants were capsule, lipopolysaccharide, siderophores, and types 1 and 3 fimbriae. Recent efforts to expand this list include in vivo screens and whole-genome sequencing. However, we still know little about how this bacterium is able to cause disease. Some recent clonal analyses of K. pneumoniae strains indicate that there are distinct clonal groups, some of which may be associated with specific disease syndromes. However, what makes one clonal group more virulent and what changes the disease pattern are not yet clear and remain important questions for the future. PMID:25165563

  12. A novel chemosynthetic peptide with ?-sheet motif efficiently kills Klebsiella pneumoniae in a mouse model

    PubMed Central

    Tan, Shirui; Gan, Changpei; Li, Rongpeng; Ye, Yan; Zhang, Shuang; Wu, Xu; Yang, Yi Yan; Fan, Weimin; Wu, Min

    2015-01-01

    Klebsiella pneumoniae (Kp) is one of the most common pathogens in nosocomial infections and is increasingly becoming multiple drug resistant. However, the molecular pathogenesis of Kp in causing tissue injury and dysregulated host defense remains elusive, further dampening the development of novel therapeutic measures. We have previously screened a series of synthetic antimicrobial beta-sheet forming peptides and identified a peptide (IRIKIRIK; ie, IK8L) with a broad range of bactericidal activity and low cytotoxicity in vitro. Here, employing an animal model, we investigated the antibacterial effects of IK8L in acute infection and demonstrated that peritoneal injection of IK8L to mice down-regulated inflammatory cytokines, alleviated lung injury, and importantly, decreased mortality compared to sham-injected controls. In addition, a math model was used to evaluate in vivo imaging data and predict infection progression in infected live animals. Mechanistically, IK8L can kill Kp by inhibiting biofilm formation and modulating production of inflammatory cytokines through the STAT3/JAK signaling both in vitro and in vivo. Collectively, these findings reveal that IK8L may have potential for preventing or treating Kp infection. PMID:25709431

  13. Role of dihydroxyacetone kinases I and II in the dha regulon of Klebsiella pneumoniae.

    PubMed

    Wei, Dong; Wang, Min; Jiang, Biao; Shi, Jiping; Hao, Jian

    2014-05-10

    Dha regulon is responsible for anaerobic glycerol metabolism and 1,3-propanediol production in Klebsiella pneumoniae. DhaK encodes an ATP-dependent dihydroxyacetone kinase I, whereas dhaK123 encodes a dihydroxyacetone kinase II that uses phosphoenolpyruvate as a phosphate donor. The functions of dihydroxyacetone kinases I and II in K. pneumoniae have not been discriminated. In this study, four individual genes of the two kinases were knocked out, and the metabolic characteristics of these mutants were investigated. DhaK1 or dhaK2 mutation inhibited dha regulon expression. DhaK3 mutation reduced glycerol utilization, and the growth was slower than the wild stain. However, dhaK mutation exerted no significant effects on glycerol metabolism. The metabolic characteristics of these mutants showed that the subunits of dihydroxyacetone kinase II were involved in the regulation of dha regulon expression, similar to the dha regulon of E. coli. Dihydroxyacetone kinase II catalyzed dihydroxyacetone conversion to dihydroxyacetone phosphate, whereas dihydroxyacetone kinase I showed no significant contribution to this reaction. PMID:24583287

  14. Isomaltulose synthase (PalI) of Klebsiella sp. LX3. Crystal structure and implication of mechanism.

    PubMed

    Zhang, Daohai; Li, Nan; Lok, Shee-Mei; Zhang, Lian-Hui; Swaminathan, Kunchithapadam

    2003-09-12

    Isomaltulose synthase from Klebsiella sp. LX3 (PalI, EC 5.4.99.11) catalyzes the isomerization of sucrose to produce isomaltulose (alpha-D-glucosylpyranosyl-1,6-D-fructofuranose) and trehalulose (alpha-D-glucosylpyranosyl-1,1-d-fructofuranose). The PalI structure, solved at 2.2-A resolution with an R-factor of 19.4% and Rfree of 24.2%, consists of three domains: an N-terminal catalytic (beta/alpha)8 domain, a subdomain between N beta 3 and N alpha 3, and a C-terminal domain having seven beta-strands. The active site architecture of PalI is identical to that of other glycoside hydrolase family 13 members, suggesting a similar mechanism in substrate binding and hydrolysis. However, a unique RLDRD motif in the proximity of the active site has been identified and shown biochemically to be responsible for sucrose isomerization. A two-step reaction mechanism for hydrolysis and isomerization, which occurs in the same pocket is proposed based on both the structural and biochemical data. Selected C-terminal truncations have been shown to reduce and even abolish the enzyme activity, consistent with the predicted role of the C-terminal residues in the maintenance of enzyme conformation and active site topology. PMID:12819210

  15. Isomaltulose Synthase from Klebsiella sp. Strain LX3: Gene Cloning and Characterization and Engineering of Thermostability

    PubMed Central

    Zhang, Daohai; Li, Xianzhen; Zhang, Lian-Hui

    2002-01-01

    The gene (palI) encoding isomaltulose synthase (PalI) from a soil bacterial isolate, Klebsiella sp. strain LX3, was cloned and characterized. PalI converts sucrose into isomaltulose, trehalulose, and trace amounts of glucose and fructose. Sequence domain analysis showed that PalI contains an ?-amylase domain and (?/?)8-barrel structures, suggesting that it belongs to the ?-amylase family. Sequence alignment indicated that the five amino acid residues of catalytic importance in ?-amylases and glucosyltransferases (Asp241, Glu295, Asp369, His145, and His368) are conserved in PalI. Purified recombinant PalI displayed high catalytic efficiency, with a Km of 54.6 ± 1.7 mM for sucrose, and maximum activity (approximately 328.0 ± 2.5 U/mg) at pH 6.0 and 35°C. PalI activity was strongly inhibited by Fe3+ and Hg2+ and was enhanced by Mn2+ and Mg2+. The half-life of PalI was 1.8 min at 50°C. Replacement of selected amino acid residues by proline significantly increased the thermostability of PalI. Simultaneous replacement of Glu498 and Arg310 with proline resulted in an 11-fold increase in the half-life of PalI at 50°C. PMID:12039719

  16. Isomaltulose synthase from Klebsiella sp. strain LX3: gene cloning and characterization and engineering of thermostability.

    PubMed

    Zhang, Daohai; Li, Xianzhen; Zhang, Lian-Hui

    2002-06-01

    The gene (palI) encoding isomaltulose synthase (PalI) from a soil bacterial isolate, Klebsiella sp. strain LX3, was cloned and characterized. PalI converts sucrose into isomaltulose, trehalulose, and trace amounts of glucose and fructose. Sequence domain analysis showed that PalI contains an alpha-amylase domain and (beta/alpha)(8)-barrel structures, suggesting that it belongs to the alpha-amylase family. Sequence alignment indicated that the five amino acid residues of catalytic importance in alpha-amylases and glucosyltransferases (Asp(241), Glu(295), Asp(369), His(145), and His(368)) are conserved in PalI. Purified recombinant PalI displayed high catalytic efficiency, with a Km of 54.6 +/- 1.7 mM for sucrose, and maximum activity (approximately 328.0 +/- 2.5 U/mg) at pH 6.0 and 35 degrees C. PalI activity was strongly inhibited by Fe3+ and Hg2+ and was enhanced by Mn2+ and Mg2+. The half-life of PalI was 1.8 min at 50 degrees C. Replacement of selected amino acid residues by proline significantly increased the thermostability of PalI. Simultaneous replacement of Glu(498) and Arg(310) with proline resulted in an 11-fold increase in the half-life of PalI at 50 degrees C. PMID:12039719

  17. Identification of the transcriptional activator controlling the butanediol fermentation pathway in Klebsiella terrigena.

    PubMed Central

    Mayer, D; Schlensog, V; Böck, A

    1995-01-01

    The gene budR, whose product is responsible for induction of the butanediol formation pathway under fermentative growth conditions in Klebsiella terrigena, has been cloned and sequenced. This gene is separated from the budABC operon by a nontranslated region of 106 bp and transcribed in the opposite direction. budR codes for a protein of molecular weight 32,124, the sequence of which exhibits characteristics of regulators belonging to the LysR family. When transferred into the heterologous host Escherichia coli, budR activates expression of budA'-lacZ transcriptional and translational fusions with a regulatory pattern identical to that in K. terrigena, namely, induction by acetate, low pH, and anaerobiosis. Induction by acetate was specific, indicating that it is the physiological inducer. Primer extension analysis located the start site of transcription to two positions, 23 and 24 bp upstream of the budR initiation codon, and also showed that BudR strongly autoregulates its own expression. The products of fhlA, arcA, hip, ntrA, and katF did not influence expression of the bud operon. A mutation in fnr, however, led to a threefold increase in expression, indicating that Fnr acts as a repressor. The results support the notion that BudR coordinates the activity of the energy-conserving, nonreductive, but acidifying acetate formation pathway with the expression of the non-energy-conserving, reductive, but nonacidifying butanediol pathway. PMID:7665514

  18. Consequences of cps mutation of Klebsiella pneumoniae on 1,3-propanediol fermentation.

    PubMed

    Guo, Ni-Ni; Zheng, Zong-Ming; Mai, Yu-Lin; Liu, Hong-Juan; Liu, De-Hua

    2010-03-01

    The filtration in 1,3-propanediol (1,3-PD) downstream process is influenced by the large amounts of capsular polysaccharides (CPS) produced by Klebsiella pneumoniae CGMCC 1.6366. The morphological and fermentation properties were investigated with the CPS-deficient mutant K. pneumoniae CGMCC 1.6366 CPS. Similar biomass was obtained with CGMCC 1.6366, and the mutant strain in batch cultures indicating the cell growth was slightly inhibited by CPS defection. The viscosity of fermentation broth by mutant strain decreased by 27.45%. The flux with ceramic membrane filter was enhanced from 168.12 to 303.6 l h(-1) m(-2), exhibiting the great importance for downstream processing of 1,3-PD fermentation. The products spectrum of mutant isolate changed remarkably regarding to the concentration of fermentation products. The synthesis of important 1,3-PD and 2,3-butanediol was enhanced from 9.73 and 4.06 g l(-1) to 10.37 and 4.77 g l(-1) in batch cultures. The noncapsuled K. pneumoniae provided higher 1,3-PD yield of 0.54 mol mol(-1) than that of encapsuled wild parent in batch cultures. The fed-batch fermentation of mutant strain resulted in 1,3-PD concentration, yield, and productivity of 78.13 g l(-1), 0.53 mol mol(-1), and 1.95 g l(-1) h(-1), respectively. PMID:19936735

  19. Physical, biochemical, and immunological characterization of a thermostable amidase from Klebsiella pneumoniae NCTR 1.

    PubMed Central

    Nawaz, M S; Khan, A A; Bhattacharayya, D; Siitonen, P H; Cerniglia, C E

    1996-01-01

    An amidase capable of degrading acrylamide and aliphatic amides was purified to apparent homogeneity from Klebsiella pneumoniae NCTR 1. The enzyme is a monomer with an apparent molecular weight of 62,000. The pH and temperature optima of the enzyme were 7.0 and 65 degrees C, respectively. The purified amidase contained 11 5,5-dithiobis(2-nitrobenzoate) (DTNB)-titratable sulfhydryl (SH) groups. In the native enzyme 1.0 SH group readily reacted with DTNB with no detectable loss of activity. Titration of the next 3.0 SH groups with DTNB resulted in a loss of activity of more than 70%. The remaining seven inaccessible SH groups could be titrated only in the presence of 8 M guanidine hydrochloride. Titration of SH groups was strongly inhibited by carboxymethylation and KMnO4, suggesting the presence of SH groups at the active site(s). Inductively coupled plasma-atomic emission spectrometry analysis indicated that the native amidase contains 0.33 mol of cobalt and 0.33 mol of iron per mol of the native enzyme. Polyclonal antiserum against K. pneumoniae amidase was raised in rabbits, and immunochemical comparisons were made with amidases from Rhodococcus sp., Mycobacterium smegmatis, Pseudomonas chlororaphis B23, and Methylophilus methylotrophus. The antiserum immunoprecipitated and immunoreacted with the amidases of K. pneumoniae and P. chlororaphis B23. The antiserum failed to immunoreact or immunoprecipitate with other amidases. PMID:8636044

  20. Carbapenemases in Klebsiella pneumoniae and Other Enterobacteriaceae: an Evolving Crisis of Global Dimensions

    PubMed Central

    Tzouvelekis, L. S.; Markogiannakis, A.; Psichogiou, M.; Tassios, P. T.

    2012-01-01

    Summary: The spread of Enterobacteriaceae, primarily Klebsiella pneumoniae, producing KPC, VIM, IMP, and NDM carbapenemases, is causing an unprecedented public health crisis. Carbapenemase-producing enterobacteria (CPE) infect mainly hospitalized patients but also have been spreading in long-term care facilities. Given their multidrug resistance, therapeutic options are limited and, as discussed here, should be reevaluated and optimized. Based on susceptibility data, colistin and tigecycline are commonly used to treat CPE infections. Nevertheless, a review of the literature revealed high failure rates in cases of monotherapy with these drugs, whilst monotherapy with either a carbapenem or an aminoglycoside appeared to be more effective. Combination therapies not including carbapenems were comparable to aminoglycoside and carbapenem monotherapies. Higher success rates have been achieved with carbapenem-containing combinations. Pharmacodynamic simulations and experimental infections indicate that modification of the current patterns of carbapenem use against CPE warrants further attention. Epidemiological data, though fragmentary in many countries, indicate CPE foci and transmission routes, to some extent, whilst also underlining the lack of international collaborative systems that could react promptly and effectively. Fortunately, there are sound studies showing successful containment of CPE by bundles of measures, among which the most important are active surveillance cultures, separation of carriers, and assignment of dedicated nursing staff. PMID:23034326

  1. Butanediol production from cellulose and hemicellulose by Klebsiella pneumoniae grown in sequential coculture with Trichoderma harzianum

    SciTech Connect

    Yu, E.K.C.; Deschatelets, L.; Louis-Seize, G.; Saddler, J.N.

    1985-10-01

    The bioconverison of cellulose and hemicellulose substrates to 2,3-butanediol by a sequential coculture approach was investigated with the cellulolytic fungus Trichoderma harzianum E58 and the fermentative bacterium Klebsiella pneumoniae. Vogel medium optimal for the production of the cellulolytic and xylanolytic enzymes of the fungus was found to be inhibitory to butanediol fermentation. This inhibition appeared to be due to a synergistic effect of various ingredients, particularly the salts, present in the fungal medium. The removal or replacement of such ingredients from Vogel medium led to the relief of fermentation inhibition, but the treatments also resulted in a significant decrease in fungal enzyme production. Resting cells of K. pneumoniae could be used for butanediol production in the fungal medium, indicating that the inhibitory effect on solvent production under such conditions was due to the indirect result of growing inhibition of the bacterial cells. The resting-cell approach could be combined with a fed-batch system for the direct conversion of 8 to 10% (wt/vol) of Solka-Floc or aspenwood xylan to butanediol at over 30% of the theoretical conversion efficiencies.

  2. Clonal dissemination of multilocus sequence type ST15 KPC-2-producing Klebsiella pneumoniae in Bulgaria.

    PubMed

    Markovska, Rumyana; Stoeva, Temenuga; Schneider, Ines; Boyanova, Lyudmila; Popova, Valentina; Dacheva, Daniela; Kaneva, Radka; Bauernfeind, Adolf; Mitev, Vanyo; Mitov, Ivan

    2015-10-01

    A total of 36 consecutive clinical and two fecal-screening carbapenem-resistant Klebsiella pneumoniae isolates from two Bulgarian university hospitals (Varna and Pleven) were investigated. Susceptibility testing, conjugation experiments, and plasmid replicon typing were carried out. Beta-lactamases were characterized by isoelectric focusing, PCR, and sequencing. Clonal relatedness was investigated by RAPD and multilocus sequence typing (MLST). Most of the isolates demonstrated multidrug resistance profile. Amikacin and tigecycline retained good activity with susceptibility rates of 95 and 87%, respectively. The resistance rate to colistin was 63%. Six RAPD- and MLST-types were identified: the dominating MLST-type was ST15 (27 isolates), followed by ST76 (six isolates), and ST1350 (two isolates). ST101, ST258, and ST151 were detected once. All except one of the K. pneumoniae produced KPC-2, mostly in combination with CTX-M-15, while for one isolate (ST101) the enzymes OXA-48 and CTX-M-14 were found. All KPC-2-producing transconjugants revealed the presence of IncFII plasmid. The OXA-48- and CTX-M-14-producing isolate showed the presence of L/M replicon type. The dissemination of KPC-2-producing K.pneumoniae in Bulgaria is mainly due to the sustained spread of successful ST15 clone and to a lesser extent of ST76 clone. This is the first report of OXA-48 producing ST101 K. pneumoniae in Bulgaria. PMID:26303718

  3. Dissemination of clonally related multidrug-resistant Klebsiella pneumoniae in Ireland.

    PubMed

    Morris, D; O'Connor, M; Izdebski, R; Corcoran, M; Ludden, C E; McGRATH, E; Buckley, V; Cryan, B; Gniadkowski, M; Cormican, M

    2016-01-01

    In October 2012, an outbreak of gentamicin-resistant, ciprofloxacin non-susceptible extended-spectrum ?-lactamase (ESBL)-producing Klebsiella pneumoniae occurred in a neonatal intensive care unit in Ireland. In order to determine whether the outbreak strain was more widely dispersed in the country, 137 isolates of K. pneumoniae with this resistance phenotype collected from 17 hospitals throughout Ireland between January 2011 and July 2013 were examined. ESBL production was confirmed phenotypically and all isolates were screened for susceptibility to 19 antimicrobial agents and for the presence of genes encoding bla TEM, bla SHV, bla OXA, and bla CTX-M; 22 isolates were also screened for bla KPC, bla NDM, bla VIM, bla IMP and bla OXA-48 genes. All isolates harboured bla SHV and bla CTX-M and were resistant to ciprofloxacin, gentamicin, nalidixic acid, amoxicillin-clavulanate, and cefpodoxime; 15 were resistant to ertapenem, seven to meropenem and five isolates were confirmed as carbapenemase producers. Pulsed-field gel electrophoresis of all isolates identified 16 major clusters, with two clusters comprising 61% of the entire collection. Multilocus sequence typing of a subset of these isolates identified a novel type, ST1236, a single locus variant of ST48. Data suggest that two major clonal groups, ST1236/ST48 (CG43) and ST15/ST14 (CG15) have been circulating in Ireland since at least January 2011. PMID:26113052

  4. Inhibition of Klebsiella pneumoniae Growth and Capsular Polysaccharide Biosynthesis by Fructus mume

    PubMed Central

    Lin, Tien-Huang; Huang, Su-Hua; Wu, Chien-Chen; Liu, Hsin-Ho; Jinn, Tzyy-Rong; Chen, Yeh; Lin, Ching-Ting

    2013-01-01

    Klebsiella pneumoniae is the predominant pathogen isolated from liver abscess of diabetic patients in Asian countries. With the spread of multiple-drug-resistant K. pneumoniae, there is an increasing need for the development of alternative bactericides and approaches to block the production of bacterial virulence factors. Capsular polysaccharide (CPS), especially from the K1 and K2 serotypes, is considered the major determinant for K. pneumoniae virulence. We found that extracts of the traditional Chinese medicine Fructus mume inhibited the growth of K. pneumoniae strains of both serotypes. Furthermore, Fructus mume decreased the mucoviscosity, and the CPS produced in a dose-dependent manner, thus reducing bacterial resistance to serum killing. Quantitative reverse transcription polymerase chain reaction analyses showed that Fructus mume downregulated the mRNA levels of cps biosynthesis genes in both serotypes, possibly by increasing the intracellular iron concentration in K. pneumoniae. Moreover, citric acid, a major organic acid in Fructus mume extracts, was found to have an inhibitory effect on growth and CPS biosynthesis in K. pneumoniae. Taken together, our results indicate that Fructus mume not only possesses antibacterial activity against highly virulent K. pneumoniae strains but also inhibits bacterial CPS biosynthesis, thereby facilitating pathogen clearance by the host immune system. PMID:24062785

  5. Structure of the core oligosaccharide in the serotype O8 lipopolysaccharide from Klebsiella pneumoniae.

    PubMed Central

    Severn, W B; Kelly, R F; Richards, J C; Whitfield, C

    1996-01-01

    Two classes of mutants with O-antigen-deficient lipopolysaccharides were isolated from the serotype O8 reference strain, belonging to Klebsiella pneumoniae subspecies ozaenae. These mutants were selected by resistance to bacteriophage KO1-2, which recognizes and lyses strains with lipopolysaccharide molecules containing the D-galactan II O antigen. Strain RFK-11 contains a defect in O-antigen synthesis and has a complete core, including the attachment site for O antigen. This mutation is complemented by a plasmid carrying the rfb (O-antigen biosynthesis) gene cluster from the related K. pneumoniae serotype O1. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the lipopolysaccharide from strain RFK-9 has a mobility typical of deep-rough lipopolysaccharide. RFK-9 lipopolysaccharide lacks the attachment site for O antigen. Lipopolysaccharides from strains RFK-9 and RFK-11 were isolated, and their structures were determined by methylation analyses, muclear magnetic resonance spectroscopy, and mass spectroscopy. The deduced O8 core oligosaccharide includes the partial core structure reported for the K. pneumoniae subspecies pneumoniae serotype O1 lipopolysaccharide (M. Süsskind, S. Müller-Leonnies, W. Nimmich, H. Brade, and O. Holst, Carbohydr. Res. 269:C1-7, 1995), consistent with the possibility of a conserved core structure within the species. The core oligosaccharide differs from those of the genera Salmonella and Escherichia by the absence of a hexose-containing outer core, the lack of phosphate residues in the inner core, and the presence of galacturonic acid residues. PMID:8626303

  6. Molecular epidemiology of KPC-2-producing Enterobacteriaceae (non-Klebsiella pneumoniae) isolated from Brazil.

    PubMed

    Tavares, Carolina Padilha; Pereira, Polyana Silva; Marques, Elizabeth de Andrade; Faria, Celio; de Souza, Maria da Penha Araújo Herkenhoff; de Almeida, Robmary; Alves, Carlene de Fátima Morais; Asensi, Marise Dutra; Carvalho-Assef, Ana Paula D'Alincourt

    2015-08-01

    In Brazil, since 2009, there has been an ever increasing widespread of the bla(KPC-2) gene, mainly in Klebsiella pneumoniae. This study aims to assess the molecular epidemiology and genetic background of this gene in Enterobacteriaceae (non-K. pneumoniae) species from 9 Brazilian states between 2009 and 2011. Three hundred eighty-seven isolates were analyzed exhibiting nonsusceptibility to carbapenems, in which the bla(KPC-2) gene was detected in 21.4%. By disk diffusion and E-test, these isolates exhibited high rates of resistance to most of the antimicrobials tested, including tigecycline (45.6% nonsusceptible) and polymyxin B (16.5%), the most resistant species being Enterobacter aerogenes and Enterobacter cloacae. We found great clonal diversity and a variety of bla(KPC-2)-carrying plasmids, all of them exhibiting a partial Tn4401 structure. Therefore, this study demonstrates the dissemination of KPC-2 in 9 Enterobacteriaceae species, including species that were not previously described such as Pantoea agglomerans and Providencia stuartii. PMID:25935630

  7. Virulence of Klebsiella pneumoniae isolates harboring bla KPC-2 carbapenemase gene in a Caenorhabditis elegans model.

    PubMed

    Lavigne, Jean-Philippe; Cuzon, Gaelle; Combescure, Christophe; Bourg, Gisèle; Sotto, Albert; Nordmann, Patrice

    2013-01-01

    Klebsiella pneumoniae carbapenemase (KPC) is a carbapenemase increasingly reported worldwide in Enterobacteriaceae. The aim of this study was to analyze the virulence of several KPC-2-producing K. pneumoniae isolates. The studied strains were (i) five KPC-2 clinical strains from different geographical origins, belonging to different ST-types and possessing plasmids of different incompatibility groups; (ii) seven transformants obtained after electroporation of either these natural KPC plasmids or a recombinant plasmid harboring only the bla KPC-2 gene into reference strains K. pneumoniae ATCC10031/CIP53153; and (iii) five clinical strains cured of plasmids. The virulence of K. pneumoniae isolates was evaluated in the Caenorhabditis elegans model. The clinical KPC producers and transformants were significantly less virulent (LT50: 5.5 days) than K. pneumoniae reference strain (LT50: 4.3 days) (p<0.01). However, the worldwide spread KPC-2 positive K. pneumoniae ST258 strains and reference strains containing plasmids extracted from K. pneumoniae ST258 strains had a higher virulence than KPC-2 strains belonging to other ST types (LT50: 5 days vs. 6 days, p<0.01). The increased virulence observed in cured strains confirmed this trend. The bla KPC-2 gene itself was not associated to increased virulence. PMID:23844109

  8. Characterization of MATE-Type Multidrug Efflux Pumps from Klebsiella pneumoniae MGH78578

    PubMed Central

    Ogawa, Wakano; Minato, Yusuke; Dodan, Hayata; Onishi, Motoyasu; Tsuchiya, Tomofusa; Kuroda, Teruo

    2015-01-01

    We previously described the cloning of genes related to drug resistance from Klebsiella pneumoniae MGH78578. Of these, we identified a putative gene encoding a MATE-type multidrug efflux pump, and named it ketM. Escherichia coli KAM32 possessing ketM on a plasmid showed increased minimum inhibitory concentrations for norfloxacin, ciprofloxacin, cefotaxime, acriflavine, Hoechst 33342, and 4',6-diamidino-2-phenyl indole (DAPI). The active efflux of DAPI was observed in E. coli KAM32 possessing ketM on a plasmid. The expression of mRNA for ketM was observed in K. pneumoniae cells, and we subsequently disrupted ketM in K. pneumoniae ATCC10031. However, no significant changes were observed in drug resistance levels between the parental strain ATCC10031 and ketM disruptant, SKYM. Therefore, we concluded that KetM was a multidrug efflux pump, that did not significantly contribute to intrinsic resistance to antimicrobial chemicals in K. pneumoniae. MATE-type transporters are considered to be secondary transporters; therefore, we investigated the coupling cations of KetM. DAPI efflux by KetM was observed when lactate was added to produce a proton motive force, indicating that KetM effluxed substrates using a proton motive force. However, the weak efflux of DAPI by KetM was also noted when NaCl was added to the assay mixture without lactate. This result suggests that KetM may utilize proton and sodium motive forces. PMID:25807080

  9. Characterization of MATE-type multidrug efflux pumps from Klebsiella pneumoniae MGH78578.

    PubMed

    Ogawa, Wakano; Minato, Yusuke; Dodan, Hayata; Onishi, Motoyasu; Tsuchiya, Tomofusa; Kuroda, Teruo

    2015-01-01

    We previously described the cloning of genes related to drug resistance from Klebsiella pneumoniae MGH78578. Of these, we identified a putative gene encoding a MATE-type multidrug efflux pump, and named it ketM. Escherichia coli KAM32 possessing ketM on a plasmid showed increased minimum inhibitory concentrations for norfloxacin, ciprofloxacin, cefotaxime, acriflavine, Hoechst 33342, and 4',6-diamidino-2-phenyl indole (DAPI). The active efflux of DAPI was observed in E. coli KAM32 possessing ketM on a plasmid. The expression of mRNA for ketM was observed in K. pneumoniae cells, and we subsequently disrupted ketM in K. pneumoniae ATCC10031. However, no significant changes were observed in drug resistance levels between the parental strain ATCC10031 and ketM disruptant, SKYM. Therefore, we concluded that KetM was a multidrug efflux pump, that did not significantly contribute to intrinsic resistance to antimicrobial chemicals in K. pneumoniae. MATE-type transporters are considered to be secondary transporters; therefore, we investigated the coupling cations of KetM. DAPI efflux by KetM was observed when lactate was added to produce a proton motive force, indicating that KetM effluxed substrates using a proton motive force. However, the weak efflux of DAPI by KetM was also noted when NaCl was added to the assay mixture without lactate. This result suggests that KetM may utilize proton and sodium motive forces. PMID:25807080

  10. Properties and expression of a multidrug efflux pump AcrAB-KocC from Klebsiella pneumoniae.

    PubMed

    Li, Dai-Wei; Onishi, Motoyasu; Kishino, Takanori; Matsuo, Taira; Ogawa, Wakano; Kuroda, Teruo; Tsuchiya, Tomofusa

    2008-04-01

    We previously reported that we had cloned genes responsible for multidrug resistance from the chromosomal DNA of Klebsiella pneumoniae MGH78578 using a drug-hypersusceptible Escherichia coli strain as a host. One of the recombinant plasmids pETV6 conferred resistance to host cells against a wide range of antimicrobial agents, dyes and detergents. It was revealed that this plasmid carried the acrBKp gene and a part of the acrAKp gene coding for a multidrug efflux pump belonging to the RND family. We cloned the whole acrAKpBKp operon of K. pneumoniae and characterized the pump. The AcrAB pump utilized TolC as an outer membrane component in cells of E. coli. Elevated energy-dependent efflux of ethidium was observed with cells possessing AcrAKp BKp-TolC. We cloned a gene coding for an ortholog of TolC from chromosomal DNA of K. pneumoniae, and designated it kocC. It seems that the AcrAKpBKp-KocC complex functions as a potent multidrug efflux pump in K. pneumoniae. We observed a higher level of expression of acrAKp in K. pneumoniae MGH78578, a multidrug resistant strain, compared with ATCC10031, a drug susceptible strain. PMID:18379044

  11. Phenotypic and genotypic characterization of Klebsiella pneumoniae isolates recovered from nonhuman primates.

    PubMed

    Soto, Esteban; LaMon, Virginia; Griffin, Matt; Keirstead, Natalie; Beierschmitt, Amy; Palmour, Roberta

    2012-07-01

    Klebsiella pneumoniae is a zoonotic, Gram-negative member of the family Enterobacteriaceae and is the causative agent of nosocomial septicemic, pneumonic, and urinary tract infections. Recently, pathogenic strains of K. pneumoniae sharing a hypermucoviscosity (HMV) phenotype have been attributed to multisystemic abscessation in both human and nonhuman primates. Although K. pneumoniae is a well-recognized zoonotic agent, there is a lack of general information including adequate diagnostic methods or treatments for nonhuman primates. In an effort to increase the body of knowledge of this enigmatic pathogen, K. pneumoniae isolates from African green monkeys (Chlorocebus aethiops sabaeus) on the island of St. Kitts, West Indies were genotypically and phenotypically characterized. Genetic fingerprints generated by PCR-mediated genomic fingerprinting, phenotypic characterization, and antimicrobial susceptibility all identified a high degree of similarity between the HMV and non-HMV K. pneumoniae isolates. The results obtained from this work will help establish a baseline for the development of efficacious diagnostic methods and treatment strategies for both human and nonhuman primates. PMID:22740526

  12. Fine-structure mapping and complementation analysis of nif (nitrogen fixation) genes in Klebsiella pneumoniae.

    PubMed Central

    MacNeil, T; MacNeil, D; Roberts, G P; Supiano, M A; Brill, W J

    1978-01-01

    Four hundred and eighty-nine independent Nif- strains containing 260 point, 130 millimicron-induced, and 99 deletion mutations in nif in the Klebsiella pneumoniae chromosome were isolated. Three hundred and ninety insertion and point mutations were mapped with millimicron-induced deletions carried on 44 plasmids derived from pTM4010, a recombinant R factor containing the his-nif region of K. pneumoniae. The 99 chromosomal deletions in the nif region were mapped with 69 derivatives of pTM4010 carrying insertion and point mutations in nif. Complementation analysis between 84 derivatives of pTM4010 carrying nif mutations and Rec- derivatives of the 390 Nif- mutants identified 14 genes. The nif mutations were ordered into 49 deletion groups with a gene order of his...nifQBALFMVSNEKDHJ. Complementation analysis of millimicron-induced, amber, frameshift, and deletion mutations indicates there are five polycistronic and two monocistronic operons: nifQ nifB, nifA nifL, nifF, nifM nifV nifS, nifN nifE, nifK nifD nifH, and nifJ. Transcription is from right to left in all polycistronic operons. PMID:361693

  13. Pleiotropic effect of his gene mutations on nitrogen fixation in Klebsiella pneumoniae

    PubMed Central

    Jensen, Jens Stougaard; Kennedy, Christina

    1982-01-01

    Several his mutations were found to influence nitrogen fixation in Klebsiella pneumoniae: hisB, hisC, and hisD mutants had 50% of wild-type levels of nitrogenase activity when supplied with 30 ?g or less histidine/ml although this concentration did not limit protein synthesis and the mutants retained a Nif+ plate phenotype. A hisA mutation had a similar but more dramatic effect. At low concentrations of histidine the hisA mutant strain had only 5% of the nitrogenase activity found at high histidine concentration or in a his+ strain, and was also Nif- on low histidine agar plates. Addition of adenine restored nitrogenase activity in the hisA but not the hisB, hisC, or hisD mutants. Low levels of intracellular ATP, a consequence of hisG enzyme activity, correlated with loss of nitrogen-fixing ability in the hisA mutant which failed to sustain nif gene expression under these conditions. Synthesis of other major cell proteins was relatively unaffected indicating that nif gene expression is selectively regulated by the energy status of the organism. ImagesFig. 4. PMID:16453412

  14. A high-resolution genomic analysis of multidrug-resistant hospital outbreaks of Klebsiella pneumoniae.

    PubMed

    Chung The, Hao; Karkey, Abhilasha; Pham Thanh, Duy; Boinett, Christine J; Cain, Amy K; Ellington, Matthew; Baker, Kate S; Dongol, Sabina; Thompson, Corinne; Harris, Simon R; Jombart, Thibaut; Le Thi Phuong, Tu; Tran Do Hoang, Nhu; Ha Thanh, Tuyen; Shretha, Shrijana; Joshi, Suchita; Basnyat, Buddha; Thwaites, Guy; Thomson, Nicholas R; Rabaa, Maia A; Baker, Stephen

    2015-03-01

    Multidrug-resistant (MDR) Klebsiella pneumoniae has become a leading cause of nosocomial infections worldwide. Despite its prominence, little is known about the genetic diversity of K. pneumoniae in resource-poor hospital settings. Through whole-genome sequencing (WGS), we reconstructed an outbreak of MDR K. pneumoniae occurring on high-dependency wards in a hospital in Kathmandu during 2012 with a case-fatality rate of 75%. The WGS analysis permitted the identification of two MDR K. pneumoniae lineages causing distinct outbreaks within the complex endemic K. pneumoniae. Using phylogenetic reconstruction and lineage-specific PCR, our data predicted a scenario in which K. pneumoniae, circulating for 6 months before the outbreak, underwent a series of ward-specific clonal expansions after the acquisition of genes facilitating virulence and MDR. We suggest that the early detection of a specific NDM-1 containing lineage in 2011 would have alerted the high-dependency ward staff to intervene. We argue that some form of real-time genetic characterisation, alongside clade-specific PCR during an outbreak, should be factored into future healthcare infection control practices in both high- and low-income settings. PMID:25712531

  15. Molecular and physiological characterisation of a 3-phytase from soil bacterium Klebsiella sp. ASR1.

    PubMed

    Sajidan, A; Farouk, A; Greiner, R; Jungblut, P; Müller, E-C; Borriss, R

    2004-07-01

    Klebsiella sp. strain ASR1 isolated from an Indonesian rice field is able to hydrolyse myo-inositol hexakis phosphate (phytate). The phytase protein was purified and characterised as a 42 kDa protein accepting phytate, NADP and sugar phosphates as substrates. The corresponding gene (phyK) was cloned from chromosomal DNA using a combined approach of protein and genome analysis, and expressed in Escherichia coli. The recombinant enzyme was identified as a 3-phytase yielding myo-inositol monophosphate, Ins(2)P, as the final product of enzymatic phytate hydrolysis. Based on its amino acid sequence, PhyK appears to be a member of a hitherto unknown subfamily of histidine acid phytate-degrading enzymes with the active site RHGXRXP and HD sequence motifs, and is different from other general phosphatases and phytases. Due to its ability to degrade sodium phytate to the mono phosphate ester, the phyK gene product is an interesting candidate for industrial and agricultural applications to make phytate phosphorous available for plant and animal nutrition. PMID:14727093

  16. Genomic definition of hypervirulent and multidrug-resistant Klebsiella pneumoniae clonal groups.

    PubMed

    Bialek-Davenet, Suzanne; Criscuolo, Alexis; Ailloud, Florent; Passet, Virginie; Jones, Louis; Delannoy-Vieillard, Anne-Sophie; Garin, Benoit; Le Hello, Simon; Arlet, Guillaume; Nicolas-Chanoine, Marie-Hélène; Decré, Dominique; Brisse, Sylvain

    2014-11-01

    Multidrug-resistant and highly virulent Klebsiella pneumoniae isolates are emerging, but the clonal groups (CGs) corresponding to these high-risk strains have remained imprecisely defined. We aimed to identify K. pneumoniae CGs on the basis of genome-wide sequence variation and to provide a simple bioinformatics tool to extract virulence and resistance gene data from genomic data. We sequenced 48 K. pneumoniae isolates, mostly of serotypes K1 and K2, and compared the genomes with 119 publicly available genomes. A total of 694 highly conserved genes were included in a core-genome multilocus sequence typing scheme, and cluster analysis of the data enabled precise definition of globally distributed hypervirulent and multidrug-resistant CGs. In addition, we created a freely accessible database, BIGSdb-Kp, to enable rapid extraction of medically and epidemiologically relevant information from genomic sequences of K. pneumoniae. Although drug-resistant and virulent K. pneumoniae populations were largely nonoverlapping, isolates with combined virulence and resistance features were detected. PMID:25341126

  17. Nosocomial emerging of (VIM1) carbapenemase-producing isolates of Klebsiella pneumoniae in North of Iran

    PubMed Central

    Rajabnia, Ramazan; Asgharpour, Fariba; Ferdosi Shahandashti, Elaheh; Moulana, Zahra

    2015-01-01

    Background and Objectives: The rapid emergence and dissemination of carbapenemase-producing Klebsiella pneumoniae strains and other members of the Enterobacteriaceae poses a considerable threat to the care of hospitalized patients and to public health. The aim of this study was to determine the frequency of metallo-?-lactamases (MBL) and VIM-1 gene in multidrug-resistant strains of K. pneumoniae. Methods: 50 isolates of non – duplicated K. pneumoniae cultured from patients at intensive care units were tested for their susceptibilities to 13 different antibiotics using microbroth dilution assay. Isolates showing resistance to at least one of the carbapenems were checked for production of metallo-?-lactamase (MBLs) using imipenem–EDTA synergy tests. PCR was used to detect the gene encoding VIM-1 metallo-?-lactamase (MBL). Results: Of 50 clinical isolates, 26 (52%) were resistant to imipenem in disk diffusion method. Using imipenem–EDTA synergy tests, production of MBL was detected in 15 (30%) isolates. PCR assay showed that 15 isolates were positive for VIM and these included 10 and 5 isolates showing positive and negative results in phenotypic method of MBL detection test respectively. Amikacin was found as the most effective antibiotic against the MBL producers in this study. Conclusion: The emergence of bla(VIM-1) producing K. pneumoniae in North of Iran is concerning. Microorganisms producing bla(VIM-1) constitute the prevalent multidrug-resistant population of K. pneumoniae in that region. PMID:26622969

  18. Alginate microparticles loaded with lipopolysaccharide subunit antigen for mucosal vaccination against Klebsiella pneumoniae.

    PubMed

    Jain, R R; Mehta, M R; Bannalikar, A R; Menon, M D

    2015-05-01

    Klebsiella pneumoniae (K. pneumoniae) is one of the commonest causes of nosocomial infections in human beings. Since K. pneumoniae infections are air borne type, controlling it by mucosal vaccination through nasal and pulmonary route could be a promising approach in order to simulate the natural infection. New vaccines such as subunit vaccines are safer than traditional vaccines, but they are less immunogenic. Therefore to enhance their immunogenicity, there is a need to develop potent and safe adjuvants and delivery systems. It has been established that micro-particles are one of the most potent adjuvants available for mucosal delivery of vaccines and they do so by improving uptake of encapsulated antigen by antigen presenting cells (APCs). Lipopolysaccharide (LPS), the antigenic fraction was extracted from K. pneumoniae by hot phenol extraction method. LPS loaded sodium alginate microparticles were prepared by emulsion ionic gelation method. Microparticles with particle size less than 5 ?m were obtained. Loading efficiency of the LPS loaded microparticles ranged from 76 to 82 %. Comparative in vivo immunogenicity studies were carried for free LPS and encapsulated LPS, administered via intramuscular, intratracheal and intranasal routes in Swiss albino mice. The study revealed that LPS encapsulated microparticles exhibit greater efficacy when administered by intra-tracheal route as compared to free LPS vaccine. PMID:25737397

  19. Purification and characterization of phytase from Klebsiella pneumoniae 9-3B.

    PubMed

    Escobin-Mopera, Lotis; Ohtani, Midori; Sekiguchi, Sachie; Sone, Teruo; Abe, Ayumi; Tanaka, Michiko; Meevootisom, Vithaya; Asano, Kozo

    2012-05-01

    Phytase, an enzyme that catalyzes the hydrolysis of phytate, was purified from Klebsiella pneumoniae 9-3B. The isolate was preferentially selected in a medium which contains phytate as a sole carbon and phosphate source. Phytic acid was utilized for growth and consequently stimulated phytase production. Phytase production was detected throughout growth and the highest phytase production was observed at the onset of stationary phase. The purification scheme including ion exchange chromatography and gel filtration resulted in a 240 and 2077 fold purification of the enzyme with 2% and 15% recovery of the total activity for liberation of inorganic phosphate and inositol, respectively. The purified phytase was a monomeric protein with an estimated molecular weight of 45kDa based on size exclusion chromatography and SDS-PAGE analyses. The phytase has an optimum pH of 4.0 and optimum temperature of 50°C. The phytase activity was slightly stimulated by Ca(2+) and EDTA and inhibited by Zn(2+) and Fe(2+). The phytase exhibited broad substrate specificity and the K(m) value for phytate was 0.04mM. The enzyme completely hydrolyzed myo-inositol hexakisphosphate (phytate) to myo-inositol and inorganic phosphate. The properties of the enzyme prove that it is a good candidate for the hydrolysis of phytate for industrial applications. PMID:22244916

  20. Production and characteristics of a bioflocculant by Klebsiella pneumoniae YZ-6 isolated from human saliva.

    PubMed

    Luo, Zhengshan; Chen, Li; Chen, Changhong; Zhang, Wei; Liu, Ming; Han, Ye; Zhou, Jiangang

    2014-02-01

    The production and characterization of a bioflocculant, MBF-6, by Klebsiella pneumoniae was investigated. Optimum culture conditions for bioflocculant production were an initial medium pH of 7, an incubation temperature of 30 °C, and an inoculum size of 1% (v/v) of cell density 1.0 × 10(8) cfu/mL. The carbon, nitrogen, and cation sources for optimum bioflocculant production were glucose, peptone, and ZnCl?. The bioflocculant mainly consisted of protein (3.4%) and sugar (95.1%). Fourier transform infrared (FTIR) spectrum revealed the presence of carboxyl and hydroxyl groups while the thermogravimetric analysis (TGA) showed a degradation temperature (T(d)) of 81.4 °C. MBF-6 had a good flocculating rate in kaolin suspension without cation addition and was stable over a wide range of pH and temperature. Investigation on the flocculation efficacy of the characterized MBF-6 for wastewater treatment of dairy, woolen, brewery, and sugar industries suggested it to be effective. PMID:24166103

  1. Comparison of the clinical characteristics and outcomes of Klebsiella pneumoniae and Streptococcus pneumoniae meningitis.

    PubMed

    Jung, Jiwon; Park, Ki-Ho; Park, Seong Yeon; Song, Eun Hee; Lee, Eun Jung; Choi, Seong-Ho; Choo, Eun Ju; Kwak, Yee Gyung; Sung, Heungsup; Kim, Sung-Han; Lee, Sang-Oh; Kim, Mi-Na; Kim, Yang Soo; Woo, Jun Hee; Choi, Sang-Ho

    2015-05-01

    This multicenter, retrospective cohort study compared the clinical characteristics and outcomes of community-acquired Klebsiella pneumoniae meningitis (CA-KPM) with those of community-acquired Streptococcus pneumoniae meningitis (CA-SPM). Eighty-three adult patients, 27 with CA-KPM and 56 with CA-SPM, were included. Diabetes mellitus (48.1% versus 21.4%; P=0.01) and liver cirrhosis (22.2% versus 5.4%; P=0.05) were more commonly associated with CA-KPM. Comatose mental status (40.7% versus 12.5%; P=0.01), septic shock (44.4% versus 8.9%; P<0.001), and concomitant extrameningeal infections (40.7% versus 7.1%; P=0.001) were also more common in the CA-KPM group. The 28-day mortality (44.4% versus 10.7%; P<0.001) and inhospital mortality (51.9% versus 14.3%; P<0.001) were higher in the CA-KPM group. In conclusion, diabetes mellitus and liver cirrhosis are more common in the CA-KPM patients who were also more likely to present with severe manifestations and poor outcomes. PMID:25752203

  2. FeoC from Klebsiella pneumoniae Contains a [4Fe-4S] Cluster

    PubMed Central

    Hsueh, Kuang-Lung; Yu, Liang-Kun; Chen, Yung-Han; Cheng, Ya-Hsin; Hsieh, Yin-Cheng; Ke, Shyue-chu; Hung, Kuo-Wei; Chen, Chun-Jung

    2013-01-01

    Iron is essential for pathogen survival, virulence, and colonization. Feo is suggested to function as the ferrous iron (Fe2+) transporter. The enterobacterial Feo system is composed of 3 proteins: FeoB is the indispensable component and is a large membrane protein likely to function as a permease; FeoA is a small Src homology 3 (SH3) domain protein that interacts with FeoB; FeoC is a winged-helix protein containing 4 conserved Cys residues in a sequence suitable for harboring a putative iron-sulfur (Fe-S) cluster. The presence of an iron-sulfur cluster on FeoC has never been shown experimentally. We report that under anaerobic conditions, the recombinant Klebsiella pneumoniae FeoC (KpFeoC) exhibited hyperfine-shifted nuclear magnetic resonance (NMR) and a UV-visible (UV-Vis) absorbance spectrum characteristic of a paramagnetic center. The electron paramagnetic resonance (EPR) and extended X-ray absorption fine structure (EXAFS) results were consistent only with the [4Fe-4S] clusters. Substituting the cysteinyl sulfur with oxygen resulted in significantly reduced cluster stability, establishing the roles of these cysteines as the ligands for the Fe-S cluster. When exposed to oxygen, the [4Fe-4S] cluster degraded to [3Fe-4S] and eventually disappeared. We propose that KpFeoC may regulate the function of the Feo transporter through the oxygen- or iron-sensitive coordination of the Fe-S cluster. PMID:23955005

  3. A novel chemosynthetic peptide with ?-sheet motif efficiently kills Klebsiella pneumoniae in a mouse model.

    PubMed

    Tan, Shirui; Gan, Changpei; Li, Rongpeng; Ye, Yan; Zhang, Shuang; Wu, Xu; Yang, Yi Yan; Fan, Weimin; Wu, Min

    2015-01-01

    Klebsiella pneumoniae (Kp) is one of the most common pathogens in nosocomial infections and is increasingly becoming multiple drug resistant. However, the molecular pathogenesis of Kp in causing tissue injury and dysregulated host defense remains elusive, further dampening the development of novel therapeutic measures. We have previously screened a series of synthetic antimicrobial beta-sheet forming peptides and identified a peptide (IRIKIRIK; ie, IK8L) with a broad range of bactericidal activity and low cytotoxicity in vitro. Here, employing an animal model, we investigated the antibacterial effects of IK8L in acute infection and demonstrated that peritoneal injection of IK8L to mice down-regulated inflammatory cytokines, alleviated lung injury, and importantly, decreased mortality compared to sham-injected controls. In addition, a math model was used to evaluate in vivo imaging data and predict infection progression in infected live animals. Mechanistically, IK8L can kill Kp by inhibiting biofilm formation and modulating production of inflammatory cytokines through the STAT3/JAK signaling both in vitro and in vivo. Collectively, these findings reveal that IK8L may have potential for preventing or treating Kp infection. PMID:25709431

  4. A high-resolution genomic analysis of multidrug-resistant hospital outbreaks of Klebsiella pneumoniae

    PubMed Central

    Chung The, Hao; Karkey, Abhilasha; Pham Thanh, Duy; Boinett, Christine J; Cain, Amy K; Ellington, Matthew; Baker, Kate S; Dongol, Sabina; Thompson, Corinne; Harris, Simon R; Jombart, Thibaut; Le Thi Phuong, Tu; Tran Do Hoang, Nhu; Ha Thanh, Tuyen; Shretha, Shrijana; Joshi, Suchita; Basnyat, Buddha; Thwaites, Guy; Thomson, Nicholas R; Rabaa, Maia A; Baker, Stephen

    2015-01-01

    Multidrug-resistant (MDR) Klebsiella pneumoniae has become a leading cause of nosocomial infections worldwide. Despite its prominence, little is known about the genetic diversity of K. pneumoniae in resource-poor hospital settings. Through whole-genome sequencing (WGS), we reconstructed an outbreak of MDR K. pneumoniae occurring on high-dependency wards in a hospital in Kathmandu during 2012 with a case-fatality rate of 75%. The WGS analysis permitted the identification of two MDR K. pneumoniae lineages causing distinct outbreaks within the complex endemic K. pneumoniae. Using phylogenetic reconstruction and lineage-specific PCR, our data predicted a scenario in which K. pneumoniae, circulating for 6 months before the outbreak, underwent a series of ward-specific clonal expansions after the acquisition of genes facilitating virulence and MDR. We suggest that the early detection of a specific NDM-1 containing lineage in 2011 would have alerted the high-dependency ward staff to intervene. We argue that some form of real-time genetic characterisation, alongside clade-specific PCR during an outbreak, should be factored into future healthcare infection control practices in both high- and low-income settings. PMID:25712531

  5. Clinical microbiology of coryneform bacteria.

    PubMed Central

    Funke, G; von Graevenitz, A; Clarridge, J E; Bernard, K A

    1997-01-01

    Coryneform bacteria are aerobically growing, asporogenous, non-partially-acid-fast, gram-positive rods of irregular morphology. Within the last few years, there has been a massive increase in the number of publications related to all aspects of their clinical microbiology. Clinical microbiologists are often confronted with making identifications within this heterogeneous group as well as with considerations of the clinical significance of such isolates. This review provides comprehensive information on the identification of coryneform bacteria and outlines recent changes in taxonomy. The following genera are covered: Corynebacterium, Turicella, Arthrobacter, Brevibacterium, Dermabacter. Propionibacterium, Rothia, Exiguobacterium, Oerskovia, Cellulomonas, Sanguibacter, Microbacterium, Aureobacterium, "Corynebacterium aquaticum," Arcanobacterium, and Actinomyces. Case reports claiming disease associations of coryneform bacteria are critically reviewed. Minimal microbiological requirements for publications on disease associations of coryneform bacteria are proposed. PMID:8993861

  6. Geobiology of marine magnetotactic bacteria

    E-print Network

    Simmons, Sheri Lynn

    2006-01-01

    Magnetotactic bacteria (MTB) biomineralize intracellular membrane-bound crystals of magnetite (Fe3O4) or greigite (Fe3S4), and are abundant in the suboxic to anoxic zones of stratified marine environments worldwide. Their ...

  7. Environmental sources of fecal bacteria

    USGS Publications Warehouse

    Byappanahalli, Muruleedhara N.; Ishii, Satoshi

    2011-01-01

    This chapter provides a review of the research on environmental occurrences of faecal indicator bacteria in a variety of terrestrial and aquatic habitats under different geographic and climatic conditions, and discusses how these external sources may affect surface water quality.

  8. The Most Common Detected Bacteria in Sputum of Patients with the Acute Exacerbation of COPD

    PubMed Central

    Cukic, Vesna

    2013-01-01

    Introduction: Acute exacerbation of COPD (AECOPD) may be triggered by infection with bacteria or viruses or by environmental pollutants; the cause of about one-third of exacerbations cannot be identified. Objective: To determine the most common bacteria in sputum culture of patients with AECOPD hospitalized in Intensive care unit of Clinic for pulmonary disease and TB “Podhrastovi” in the 2012. Material and methods: This is a retrospective analysis of sputum bacterial cultures of patients with AECOPD treated in the Intensive care unit of Clinic for pulmonary disease and TB “Podhrastovi” during 2012 .year. Each patient was required to give two sputum for bacterial examination. Each patient was treated with antibiotics prior to admission in Clinic “Podhrastovi”. The results of sputum bacterial culture findings are expressed in absolute number and percentage of examined patients. Results: In 2012, 75 patients with AECOPD were treated in Intensive care unit of Clinic for pulmonary disease and TB“Podhrastovi”. 44 (58.66%) of patients had normal –nonpathogenic – usual bacterial flora isolated in sputum cultures, 31 (41.34%) had a pathogen bacteria in sputum culture as follows: 7 had Streptoccocus pneumoniae, 8 had Klebsiella pneumoniae (2 with Streptococcus pneumoniae, one with Acinetobacter baumani) ,4 Escherichia colli, others are one or two cases with other bacteria. Conclusion: Bacterial airway infections play a great role in many, but not in all, of cases of AECOPD. So there is the need to do a sputum bacterial culture examination in each patient with AECOPD and with appropriate antibiotics to contribute to curing of them. PMID:24511262

  9. Effect of Coliform and Proteus Bacteria on Growth of Staphylococcus aureus1

    PubMed Central

    DiGiacinto, J. V.; Frazier, W. C.

    1966-01-01

    Cultures of coliform and Proteus bacteria, mostly from foods, were tested for their effect on growth of Staphylococcus aureus in Trypticase Soy Broth. Inhibition of the staphylococcus by these competitors increased with increasing proportions of inhibiting (effector) bacteria in the inoculum and decreasing incubation temperatures (37 to 10 C). Time required for 2 × 104 staphylococci to increase to 5 × 106 cells per milliliter, the minimal number assumed to be necessary for food poisoning, varied with the species of effector, the original ratio of effector bacteria to staphylococci in the medium, and the incubation temperature. When the original ratio was 100:1, the staphylococci did not reach 5 × 106 cells per milliliter at 10, 15, 22, or 30 C (with one exception), when growing with cultures representing six species of coliform bacteria and two of Proteus. When the ratio was 1:1, all effectors either greatly delayed the staphylococcus or prevented it from reaching hazardous numbers at 15 C, six of the eight caused a delay of 2 to 3 hr at 22 C, and only Escherichia coli delayed the coccus at 30 C. All effectors were ineffective at 22 and 30 C when original numbers of effectors and staphylococci were in the ratio 1:100. Greatest overall inhibition was by E. coli, E. freundii, and Proteus vulgaris, and these species were more effective than the others at 22 and 30 C. Aerobacter cloacae and Paracolobactrum aerogenoides were more effective at 15 C. In general, results were similar with different strains of a species. Except for Aerobacter aerogenes, Klebsiella sp., and P. aerogenoides, which apparently did not compete for nutrients, inhibition of the staphylococcus was by a combination of antibiotic substances and competition for nutrients. PMID:5330677

  10. The mechanical world of bacteria.

    PubMed

    Persat, Alexandre; Nadell, Carey D; Kim, Minyoung Kevin; Ingremeau, Francois; Siryaporn, Albert; Drescher, Knut; Wingreen, Ned S; Bassler, Bonnie L; Gitai, Zemer; Stone, Howard A

    2015-05-21

    In the wild, bacteria are predominantly associated with surfaces as opposed to existing as free-swimming, isolated organisms. They are thus subject to surface-specific mechanics, including hydrodynamic forces, adhesive forces, the rheology of their surroundings, and transport rules that define their encounters with nutrients and signaling molecules. Here, we highlight the effects of mechanics on bacterial behaviors on surfaces at multiple length scales, from single bacteria to the development of multicellular bacterial communities such as biofilms. PMID:26000479

  11. Cable Bacteria in Freshwater Sediments

    PubMed Central

    Kristiansen, Michael; Frederiksen, Rasmus B.; Dittmer, Anders Lindequist; Bjerg, Jesper Tataru; Trojan, Daniela; Schreiber, Lars; Damgaard, Lars Riis; Schramm, Andreas; Nielsen, Lars Peter

    2015-01-01

    In marine sediments cathodic oxygen reduction at the sediment surface can be coupled to anodic sulfide oxidation in deeper anoxic layers through electrical currents mediated by filamentous, multicellular bacteria of the Desulfobulbaceae family, the so-called cable bacteria. Until now, cable bacteria have only been reported from marine environments. In this study, we demonstrate that cable bacteria also occur in freshwater sediments. In a first step, homogenized sediment collected from the freshwater stream Giber Å, Denmark, was incubated in the laboratory. After 2 weeks, pH signatures and electric fields indicated electron transfer between vertically separated anodic and cathodic half-reactions. Fluorescence in situ hybridization revealed the presence of Desulfobulbaceae filaments. In addition, in situ measurements of oxygen, pH, and electric potential distributions in the waterlogged banks of Giber Å demonstrated the presence of distant electric redox coupling in naturally occurring freshwater sediment. At the same site, filamentous Desulfobulbaceae with cable bacterium morphology were found to be present. Their 16S rRNA gene sequence placed them as a distinct sister group to the known marine cable bacteria, with the genus Desulfobulbus as the closest cultured lineage. The results of the present study indicate that electric currents mediated by cable bacteria could be important for the biogeochemistry in many more environments than anticipated thus far and suggest a common evolutionary origin of the cable phenotype within Desulfobulbaceae with subsequent diversification into a freshwater and a marine lineage. PMID:26116678

  12. Cable Bacteria in Freshwater Sediments.

    PubMed

    Risgaard-Petersen, Nils; Kristiansen, Michael; Frederiksen, Rasmus B; Dittmer, Anders Lindequist; Bjerg, Jesper Tataru; Trojan, Daniela; Schreiber, Lars; Damgaard, Lars Riis; Schramm, Andreas; Nielsen, Lars Peter

    2015-09-01

    In marine sediments cathodic oxygen reduction at the sediment surface can be coupled to anodic sulfide oxidation in deeper anoxic layers through electrical currents mediated by filamentous, multicellular bacteria of the Desulfobulbaceae family, the so-called cable bacteria. Until now, cable bacteria have only been reported from marine environments. In this study, we demonstrate that cable bacteria also occur in freshwater sediments. In a first step, homogenized sediment collected from the freshwater stream Giber Å, Denmark, was incubated in the laboratory. After 2 weeks, pH signatures and electric fields indicated electron transfer between vertically separated anodic and cathodic half-reactions. Fluorescence in situ hybridization revealed the presence of Desulfobulbaceae filaments. In addition, in situ measurements of oxygen, pH, and electric potential distributions in the waterlogged banks of Giber Å demonstrated the presence of distant electric redox coupling in naturally occurring freshwater sediment. At the same site, filamentous Desulfobulbaceae with cable bacterium morphology were found to be present. Their 16S rRNA gene sequence placed them as a distinct sister group to the known marine cable bacteria, with the genus Desulfobulbus as the closest cultured lineage. The results of the present study indicate that electric currents mediated by cable bacteria could be important for the biogeochemistry in many more environments than anticipated thus far and suggest a common evolutionary origin of the cable phenotype within Desulfobulbaceae with subsequent diversification into a freshwater and a marine lineage. PMID:26116678

  13. Bioreporter bacteria for landmine detection

    SciTech Connect

    Burlage, R.S.; Youngblood, T.; Lamothe, D.

    1998-04-01

    Landmines (and other UXO) gradually leak explosive chemicals into the soil at significant concentrations. Bacteria, which have adapted to scavenge low concentrations of nutrients, can detect these explosive chemicals. Uptake of these chemicals results in the triggering of specific bacterial genes. The authors have created genetically recombinant bioreporter bacteria that detect small concentrations of energetic chemicals. These bacteria are genetically engineered to produce a bioluminescent signal when they contact specific explosives. A gene for a brightly fluorescent compound can be substituted for increased sensitivity. By finding the fluorescent bacteria, you find the landmine. Detection might be accomplished using stand-off illumination of the minefield and GPS technology, which would result in greatly reduced risk to the deminers. Bioreporter technology has been proven at the laboratory scale, and will be tested under field conditions in the near future. They have created a bacterial strain that detects sub-micromolar concentrations of o- and p-nitrotoluene. Related bacterial strains were produced using standard laboratory protocols, and bioreporters of dinitrotoluene and trinitrotoluene were produced, screening for activity with the explosive compounds. Response time is dependent on the growth rate of the bacteria. Although frill signal production may require several hours, the bacteria can be applied over vast areas and scanned quickly, producing an equivalent detection speed that is very fast. This technology may be applicable to other needs, such as locating buried explosives at military and ordnance/explosive manufacturing facilities.

  14. Filtrating forms of soil bacteria

    NASA Astrophysics Data System (ADS)

    Van'kova, A. A.; Ivanov, P. I.; Emtsev, V. T.

    2013-03-01

    Filtrating (ultramicroscopic) forms (FF) of bacteria were studied in a soddy-podzolic soil and the root zone of alfalfa plants as part of populations of the most widespread physiological groups of soil bacteria. FF were obtained by filtering soil solutions through membrane filters with a pore diameter of 0.22 ?m. It was established that the greater part of the bacteria in the soil and in the root zone of the plants has an ultramicroscopic size: the average diameter of the cells is 0.3 ?m, and their length is 0.6 ?m, which is significantly less than the cell size of banal bacteria. The number of FF varies within a wide range depending on the physicochemical conditions of the habitat. The FF number's dynamics in the soil is of a seasonal nature; i.e., the number of bacteria found increases in the summer and fall and decreases in the winter-spring period. In the rhizosphere of the alfalfa, over the vegetation period, the number of FF and their fraction in the total mass of the bacteria increase. A reverse tendency is observed in the rhizoplane. The morphological particularities (identified by an electron microscopy) and the nature of the FF indicate their physiological activity.

  15. Thermal inactivation of water-borne pathogenic and indicator bacteria at sub-boiling temperatures.

    PubMed

    Spinks, Anthony T; Dunstan, R H; Harrison, T; Coombes, P; Kuczera, G

    2006-03-01

    The use of harvested rainwater in domestic hot water systems can result in optimised environmental and economic benefits to urban water cycle management, however, the water quality and health risks of such a scenario have not been adequately investigated. Thermal inactivation analyses were carried out on eight species of non-spore-forming bacteria in a water medium at temperatures relevant to domestic hot water systems (55-65 degrees C), and susceptibilities to heat stress were compared using D-values. The D-value was defined as the time required to reduce a bacterial population by 90% or 1 log reduction. The results found that both tested strains of Enterococcus faecalis were the most heat resistant of the bacteria studied, followed by the pathogens Shigella sonnei biotype A and Escherichia coli O157:H7, and the non-pathogenic E. coli O3:H6. Pseudomonas aeruginosa was found to be less resistant to heat, while Salmonella typhimurium, Serratia marcescens, Klebsiella pneumoniae and Aeromonas hydrophila displayed minimal heat resistance capacities. At 65 degrees C, little thermal resistance was demonstrated by any species, with log reductions in concentration occurring within seconds. The results of this study suggested that the temperature range from 55 to 65 degrees C was critical for effective elimination of enteric/pathogenic bacterial components and supported the thesis that hot water systems should operate at a minimum of 60 degrees C. PMID:16524613

  16. Interaction of Rhizosphere Bacteria, Fertilizer, and Vesicular-Arbuscular Mycorrhizal Fungi with Sea Oats †

    PubMed Central

    Will, M. E.; Sylvia, D. M.

    1990-01-01

    Plants must be established quickly on replenished beaches in order to stabilize the sand and begin the dune-building process. The objective of this research was to determine whether inoculation of sea oats (Uniola paniculata L.) with bacteria (indigenous rhizosphere bacteria and N2 fixers) alone or in combination with vesicular-arbuscular mycorrhizal fungi would enhance plant growth in beach sand. At two fertilizer-N levels, Klebsiella pneumoniae and two Azospirillum spp. did not provide the plants with fixed atmospheric N; however, K. pneumoniae increased root and shoot growth. When a sparingly soluble P source (CaHPO4) was added to two sands, K. pneumoniae increased plant growth in sand with a high P content. The phosphorus content of shoots was not affected by bacterial inoculation, indicating that a mechanism other than bacterially enhanced P availability to plants was responsible for the growth increases. When sea oats were inoculated with either K. pneumoniae or Acaligenes denitrificans and a mixed Glomus inoculum, there was no consistent evidence of a synergistic effect on plant growth. Nonetheless, bacterial inoculation increased root colonization by vesicular-arbuscular mycorrhizal fungi when the fungal inoculum consisted of colonized roots but had no effect on colonization when the inoculum consisted of spores alone. K. pneumoniae was found to increase spore germination and hyphal growth of Glomus deserticola compared with the control. The use of bacterial inoculants to enhance establishment of pioneer dune plants warrants further study. PMID:16348236

  17. Chitosan-hyaluronic acid/nano silver composite sponges for drug resistant bacteria infected diabetic wounds.

    PubMed

    Anisha, B S; Biswas, Raja; Chennazhi, K P; Jayakumar, R

    2013-11-01

    The aim of this work was to develop an antimicrobial sponge composed of chitosan, hyaluronic acid (HA) and nano silver (nAg) as a wound dressing for diabetic foot ulcers (DFU) infected with drug resistant bacteria. nAg (5-20 nm) was prepared and characterized. The nanocomposite sponges were prepared by homogenous mixing of chitosan, HA and nAg followed by freeze drying to obtain a flexible and porous structure. The prepared sponges were characterized using SEM and FT-IR. The porosity, swelling, biodegradation and haemostatic potential of the sponges were also studied. Antibacterial activity of the prepared sponges was analysed using Escherichia coli, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa and Klebsiella pneumonia. Chitosan-HA/nAg composite sponges showed potent antimicrobial property against the tested organisms. Sponges containing higher nAg (0.005%, 0.01% and 0.02%) concentrations showed antibacterial activity against MRSA. Cytotoxicity and cell attachment studies were done using human dermal fibroblast cells. The nanocomposite sponges showed a nAg concentration dependent toxicity towards fibroblast cells. Our results suggest that this nanocomposite sponges could be used as a potential material for wound dressing for DFU infected with antibiotic resistant bacteria if the optimal concentration of nAg exhibiting antibacterial action with least toxicity towards mammalian cells is identified. PMID:24060281

  18. One-step species-specific high resolution melting analysis for nosocomial bacteria detection.

    PubMed

    Wong, Yeng Pooi; Chua, Kek Heng; Thong, Kwai Lin

    2014-12-01

    Nosocomial infections are a major public health concern worldwide. Early and accurate identification of nosocomial pathogens which are often multidrug resistant is crucial for prompt treatment. Hence, an alternative real-time polymerase chain reaction coupled with high resolution melting-curve analysis (HRMA) was developed for identification of five nosocomial bacteria. This assay targets species-specific regions of each nosocomial bacteria and produced five distinct melt curves with each representing a particular bacterial species. The melting curves were characterized by peaks of 78.8 ± 0.2 °C for Acinetobacter baumannii, 82.7 ± 0.2 °C for Escherichia coli, 86.3 ± 0.3 °C for Klebsiella pneumoniae, 88.8 ± 0.2 °C for Pseudomonas aeruginosa and 74.6 ± 02 °C for methicillin-resistant Staphylococcus aureus. The assay was able to specifically detect the five bacterial species with an overall detection limit of 2 × 10(-2) ng/?L. In conclusion, the HRM assay developed is a simple and rapid method for identification of the selected nosocomial pathogens. PMID:25307691

  19. The role of nanotechnology in combating multi-drug resistant bacteria.

    PubMed

    Singh, Rajni; Smitha, M S; Singh, Surinder P

    2014-07-01

    The development of antibiotics has played a significant role in combating the dreaded infectious disease such as tuberculosis, pneumonia, typhoid fever and meningitis in 20th century. However, the improper use of antibiotics led to the development of multidrug resistance (MDR) in microbial flora raising a global public health concern of 21st century. This unforeseen threat demands the development of new drugs and strategies for combating antibiotic resistance shown by many microbial species. Recent developments in nanotechnology to engineer nanoparticles with desired physicochemical properties have been projected as a new line of defense against MDR micro-organism. In this review, we summarized and discussed the recent development demonstrating the potential of nanomaterials to evade the MDR. Nanoparticles have shown effective antimicrobial activity against MDR bacteria, such as Acinetobacter baumanii, Pseudomonas aeruginosa, Klebsiella pneumoniae, Mycobacterium tuberculosis, vancomycin resistant enterococci, methicillin-resistant Staphylococcus aureus and others. Furthermore, new strategies like combination of radiation and drugs with nanoparticle that are being explored to potentiate the effectiveness against MDR bacteria have also been summarized. PMID:24757944

  20. Human monoclonal macroglobulins with specificity for Klebsiella K polysaccharides that contain 3,4-pyruvylated-D-galactose and 4,6- pyruvylated-D-galactose

    PubMed Central

    1980-01-01

    Two human IgM myeloma proteins, IgMWEA and IgMMAY, were found to react with agar and Klebsiella polysaccharides that contain pyruvylated D- galactose (DGal). Quantitative precipitin data and precipitin inhibition studies with methyl alpha- and beta-glycosides of 4,6- pyruvylated-D-galactose showed their combining sites to be different, although each was directed against the pyruvylated-D-Gal, one reacting most specifically with Klebsiella polysaccharides with terminal nonreducing beta-linked 2,4 pyruvylated-D-Gal, whereas the other reacted equally well with Klebsiella polysaccharides that contain 3,4 beta-linked and 4,6 alpha-linked terminal nonreducing pyruvylated-DGal. Inhibition studies showed that both sites are directed toward one of the two space isomers of 3,4- or 4,6-pyruvylated DGal, the form in which the methyl group of the pyruvate is equatorial, or endo, and its carboxyl group axial, or exo, to the plane of the acetal ring. Coprecipitation studies showed the combining site of IgMWEA to be located on an (Fab')2 fragment and not on the (Fc)5mu fragment. The monoclonal peak in the serum of IgMMAY was specifically precipitated by Klebsiella polysaccharide. Myeloma proteins with specificities of this type may occur with reasonable frequency in humans and may be a consequence of clonal expansion from inapparent infection, carrier states, or disease produced by various Klebsiella organisms. PMID:6158553

  1. Multiple product inhibition and growth modeling of Clostridium butyricum and Klebsiella pneumoniae in glycerol fermentation

    SciTech Connect

    Zeng, A.P.; Ross, A.; Biebl, H.; Tag, C.; Guenzel, B.; Deckwer, W.D. . Biochemical Engineering Division)

    1994-10-01

    The inhibition potentials of products and substrate on the growth of Clostridium butyricum and Klebsiella pneumoniae in the glycerol fermentation are examined from experimental data and with a mathematical model. Whereas the inhibition potential of externally added and self-produced 1,3-propanediol is essentially the same, butyric acid produced by the culture is more toxic than that externally added. The same seems to apply for acetic acid. The inhibitory effect of butyric acid is due to the total concentration instead of its undissociated form. For acetic acid, it cannot be distinguished between the total concentration and the undissociated form. The inhibition effects of products and substrate in the glycerol fermentation are irrespective of the strains, and, therefore, the same growth model can be used. The maximum product concentrations tolerated are 0.35 g/L for undissociated acetic acid, 10.1 g/L for total butyric acid, 16.6 g/L for ethanol, 71.4 g/L for 1,3-propanediol, and 187.6 g/L for glycerol, which are applicable to C. butyricum and K. pneumoniae growth under a variety of conditions. For 55 steady-states, which were obtained from different types of continuous cultures over a pH range of 5.3--8.5 and under both substrate limitation and substrate excess, the proposed growth model fits the experimental data with an average deviation of 17.0%. The deviation of model description from experimental values reduces of 11.4% if only the steady-states with excessive substrate are considered.

  2. 1,3-Propanediol production by Escherichia coli expressing genes from the Klebsiella pneumoniae dha regulon

    SciTech Connect

    I-Teh Tong; Hans H. Liao; Cameron, D.C. )

    1991-12-01

    The dha regulon in Klebsiella pneumoniae enables the organism to grown anaerobically on glycerol and produce 1,3-propanediol (1,3-PD). Escherichia coli, which does not have a dha system, is unable to grow anaerobically on glycerol without an exogenous electron acceptor and does not produce 1,3-PD. A genomic library of K. pneumoniae ATCC 25955 constructed in E. coli AG1 was enriched for the ability to grow anaerobically on glycerol and dihydoxyacetone and was screened for the production of 1, 3-PD. The cosmid pTC1 (42.5 kn total with an 18.2-kb major insert) was isolated from a 1,3-PD-producing strain of E. coli and found to possess enzymatic activities associated with four genes of the dha regulon: glycersol dehydratase (dhaB), 1,3-PD oxidoreductase (dhaT), glycerol dehydrogenase (dhaD), and dihydroxyacetone kinase (dhaK). All four activities were inducible by the presence of glycerol. When E. coli AG1/pTC1 was grown on complex medium plus glycerol, the yield of 1, 3-PD from glycerol was 0.46 mol/mol. The major fermentation by-products were formate, acetate, and D-lactate. 1,3-PD is an intermediate in organic synthesis and polymer production. The 1,3-PD fermentation provides a useful model system for studying the interaction of a biochemical pathway in a foreign host and for developing strategies for metabolic pathway engineering.

  3. Distribution of ?-Lactamase Genes Among Carbapenem-Resistant Klebsiella pneumoniae Strains Isolated From Patients in Turkey

    PubMed Central

    Iraz, Meryem; Özad Düzgün, Azer; Sandall?, Cemal; Doymaz, Mehmet Ziya; Akkoyunlu, Yasemin; Saral, Ay?egül; Peleg, Anton Y.; Özgümü?, Osman Birol; Beri?, Fatih ?aban; Karao?lu, Hakan

    2015-01-01

    Background The emergence of carbapenem-resistant Klebsiella pneumoniae poses a serious problem to antibiotic management. We investigated the ?-lactamases in a group of carbapenem-resistant K. pneumoniae clinical isolates from Turkey. Methods Thirty-seven strains of K. pneumoniae isolated from various clinical specimens were analyzed by antimicrobial susceptibility testing, PCR for the detection of ?-lactamase genes, DNA sequencing, and repetitive extragenic palindronic (REP)-PCR analysis. Results All 37 isolates were resistant to ampicillin, ampicillin/sulbactam, piperacillin, piperacillin/tazobactam, ceftazidime, cefoperazone/sulbactam, cefepime, imipenem, and meropenem. The lowest resistance rates were observed for colistin (2.7%), tigecycline (11%), and amikacin (19%). According to PCR and sequencing results, 98% (36/37) of strains carried at least one carbapenemase gene, with 32 (86%) carrying OXA-48 and 7 (19%) carrying NDM-1. No other carbapenemase genes were identified. All strains carried a CTX-M-2-like ?-lactamase, and some carried SHV- (97%), TEM- (9%), and CTX-M-1-like (62%) ?-lactamases. Sequence analysis of blaTEM genes identified a blaTEM-166 with an amino acid change at position 53 (Arg53Gly) from blaTEM-1b, the first report of a mutation in this region. REP-PCR analysis revealed that there were seven different clonal groups, and temporo-spatial links were identified within these groups. Conclusions Combinations of ?-lactamases were found in all strains, with the most common being OXA-48, SHV, TEM, and CTX-M-type (76% of strains). We have reported, for the first time, a high prevalence of the NDM-1 (19%) carbapenemase in carbapenem-resistant K. pneumoniae from Turkey. These enzymes often co-exist with other ?-lactamases, such as TEM, SHV, and CTX-M ?-lactamases. PMID:26354347

  4. Distinct Contributions of Neutrophils and CCR2+ Monocytes to Pulmonary Clearance of Different Klebsiella pneumoniae Strains.

    PubMed

    Xiong, Huizhong; Carter, Rebecca A; Leiner, Ingrid M; Tang, Yi-Wei; Chen, Liang; Kreiswirth, Barry N; Pamer, Eric G

    2015-09-01

    Klebsiella pneumoniae is a common respiratory pathogen, with some strains having developed broad resistance to clinically available antibiotics. Humans can become infected with many different K. pneumoniae strains that vary in genetic background, antibiotic susceptibility, capsule composition, and mucoid phenotype. Genome comparisons have revealed differences between K. pneumoniae strains, but the impact of genomic variability on immune-mediated clearance of pneumonia remains unclear. Experimental studies of pneumonia in mice have used the rodent-adapted 43816 strain of K. pneumoniae and demonstrated that neutrophils are essential for optimal host defense. It remains unclear, however, whether CCR2(+) monocytes contribute to K. pneumoniae clearance from the lung. We selectively depleted neutrophils, CCR2(+) monocytes, or both from immunocompetent mice and determined susceptibility to infection by the 43816 strain and 4 newly isolated clinical K. pneumoniae strains. The clinical K. pneumoniae strains, including one carbapenem-resistant ST258 strain, are less virulent than 43816. Optimal clearance of each of the 5 strains required either neutrophils or CCR2(+) monocytes. Selective neutrophil depletion markedly worsened infection with K. pneumoniae strain 43816 and three clinical isolates but did not increase susceptibility of mice to infection with the carbapenem-resistant K. pneumoniae ST258 strain. Depletion of CCR2(+) monocytes delayed recovery from infection with each of the 5 K. pneumoniae strains, revealing a contribution of these cells to bacterial clearance from the lung. Our findings demonstrate strain-dependent variation in the contributions of neutrophils and CCR2(+) monocytes to clearance of K. pneumoniae pulmonary infection. PMID:26056382

  5. Epidemiology and Molecular Characterization of Bacteremia Due to Carbapenem-Resistant Klebsiella pneumoniae in Transplant Recipients

    PubMed Central

    Clancy, C. J.; Chen, L.; Shields, R. K.; Zhao, Y.; Cheng, S.; Chavda, K. D.; Hao, B.; Hong, J. H.; Doi, Y.; Kwak, E. J.; Silveira, F. P.; Abdel-Massih, R.; Bogdanovich, T.; Humar, A.; Perlin, D. S.; Kreiswirth, B. N.; Hong Nguyen, M.

    2014-01-01

    We conducted a retrospective study of 17 transplant recipients with carbapenem-resistant Klebsiella pneumoniae bacteremia, and described epidemiology, clinical characteristics and strain genotypes. Eighty-eight percent (15/17) of patients were liver or intestinal transplant recipients. Outcomes were death due to septic shock (18%), cure (24%) and persistent (>7 days) or recurrent bacteremia (29% each). Thirty- and 90-day mortality was 18% and 47%, respectively. Patients who were cured received at least one active antimicrobial agent and underwent source control interventions. Forty-one percent (7/17) of patients had intra-abdominal infections; all except one developed persistent/recurrent bacteremia despite drainage. Two patients tolerated persistent bacteremia for >300 days. All patients except one were infected with sequence type 258 (ST258), K. pneumoniae carbapenemase (KPC)-2-producing strains harboring a mutant ompK35 porin gene; the exception was infected with an ST37, KPC-3-producing strain. Seventy-one percent (12/17) of patients were infected with ST258 ompK36 mutant strains. In two patients, persistent bacteremia was caused by two strains with different ompK36 genotypes. Three ompK36 mutations were associated with significantly higher carbapenem minimum inhibitory concentrations than wild-type ompK36. Pulse-field gel electrophoresis identified a single ST258 lineage; serial strains from individual patients were indistinguishable. In conclusion, KPC-K. pneumoniae bacteremia exhibited highly diverse clinical courses following transplantation, and was caused by clonal ST258 strains with different ompK36 genotypes. PMID:24011185

  6. Comparative Genomics of Klebsiella pneumoniae Strains with Different Antibiotic Resistance Profiles?†

    PubMed Central

    Kumar, Vinod; Sun, Peng; Vamathevan, Jessica; Li, Yong; Ingraham, Karen; Palmer, Leslie; Huang, Jianzhong; Brown, James R.

    2011-01-01

    There is a global emergence of multidrug-resistant (MDR) strains of Klebsiella pneumoniae, a Gram-negative enteric bacterium that causes nosocomial and urinary tract infections. While the epidemiology of K. pneumoniae strains and occurrences of specific antibiotic resistance genes, such as plasmid-borne extended-spectrum ?-lactamases (ESBLs), have been extensively studied, only four complete genomes of K. pneumoniae are available. To better understand the multidrug resistance factors in K. pneumoniae, we determined by pyrosequencing the nearly complete genome DNA sequences of two strains with disparate antibiotic resistance profiles, broadly drug-susceptible strain JH1 and strain 1162281, which is resistant to multiple clinically used antibiotics, including extended-spectrum ?-lactams, fluoroquinolones, aminoglycosides, trimethoprim, and sulfamethoxazoles. Comparative genomic analysis of JH1, 1162281, and other published K. pneumoniae genomes revealed a core set of 3,631 conserved orthologous proteins, which were used for reconstruction of whole-genome phylogenetic trees. The close evolutionary relationship between JH1 and 1162281 relative to other K. pneumoniae strains suggests that a large component of the genetic and phenotypic diversity of clinical isolates is due to horizontal gene transfer. Using curated lists of over 400 antibiotic resistance genes, we identified all of the elements that differentiated the antibiotic profile of MDR strain 1162281 from that of susceptible strain JH1, such as the presence of additional efflux pumps, ESBLs, and multiple mechanisms of fluoroquinolone resistance. Our study adds new and significant DNA sequence data on K. pneumoniae strains and demonstrates the value of whole-genome sequencing in characterizing multidrug resistance in clinical isolates. PMID:21746949

  7. Virulent Clones of Klebsiella pneumoniae: Identification and Evolutionary Scenario Based on Genomic and Phenotypic Characterization

    PubMed Central

    Brisse, Sylvain; Fevre, Cindy; Passet, Virginie; Issenhuth-Jeanjean, Sylvie; Tournebize, Régis; Diancourt, Laure; Grimont, Patrick

    2009-01-01

    Klebsiella pneumoniae is found in the environment and as a harmless commensal, but is also a frequent nosocomial pathogen (causing urinary, respiratory and blood infections) and the agent of specific human infections including Friedländer's pneumonia, rhinoscleroma and the emerging disease pyogenic liver abscess (PLA). The identification and precise definition of virulent clones, i.e. groups of strains with a single ancestor that are associated with particular infections, is critical to understand the evolution of pathogenicity from commensalism and for a better control of infections. We analyzed 235 K. pneumoniae isolates of diverse environmental and clinical origins by multilocus sequence typing, virulence gene content, biochemical and capsular profiling and virulence to mice. Phylogenetic analysis of housekeeping genes clearly defined clones that differ sharply by their clinical source and biological features. First, two clones comprising isolates of capsular type K1, clone CC23K1 and clone CC82K1, were strongly associated with PLA and respiratory infection, respectively. Second, only one of the two major disclosed K2 clones was highly virulent to mice. Third, strains associated with the human infections ozena and rhinoscleroma each corresponded to one monomorphic clone. Therefore, K. pneumoniae subsp. ozaenae and K. pneumoniae subsp. rhinoscleromatis should be regarded as virulent clones derived from K. pneumoniae. The lack of strict association of virulent capsular types with clones was explained by horizontal transfer of the cps operon, responsible for the synthesis of the capsular polysaccharide. Finally, the reduction of metabolic versatility observed in clones Rhinoscleromatis, Ozaenae and CC82K1 indicates an evolutionary process of specialization to a pathogenic lifestyle. In contrast, clone CC23K1 remains metabolically versatile, suggesting recent acquisition of invasive potential. In conclusion, our results reveal the existence of important virulent clones associated with specific infections and provide an evolutionary framework for research into the links between clones, virulence and other genomic features in K. pneumoniae. PMID:19319196

  8. Efficacy of Appropriate Antimicrobial Therapy on the Survival of Patients With Carbapenem Nonsusceptible Klebsiella Pneumoniae Infection

    PubMed Central

    Lin, Yi-Tsung; Chuang, Chien; Su, Chin-Fang; Chan, Yu-Jiun; Wang, Lih-Shinn; Huang, Ching-Tai; Chuang, Yin-Ching; Siu, L. Kristopher; Fung, Chang-Phone

    2015-01-01

    Abstract The impact of antimicrobial treatment on the outcome of carbapenem nonsusceptible Klebsiella pneumoniae (CnsKP) infections needs to be elucidated. This nationwide, multicenter study was conducted to evaluate the impact of appropriate antimicrobial therapy on 14-day mortality among patients with CnsKP infection in Taiwan. Patients with CnsKP infections from 11 medical centers and 4 regional hospitals in Taiwan were enrolled in 2013. Carbapenem nonsusceptibility was defined as a minimum inhibitory concentration of ?2?mg/L for imipenem or meropenem. Predictors of 14-day mortality were determined using the Cox proportional regression model. The influence of infection severity on the impact of appropriate use of antimicrobials on 14-day mortality was determined using the Acute Physiology and Chronic Health Evaluation (APACHE) II score. Overall 14-day mortality was 31.8% (49/154). Unadjusted mortality for appropriate antimicrobial therapy was 23.1% (18/78 patients). Appropriate therapy was independently associated with reduced mortality (hazard ratio [HR], 0.44; 95% confidence interval [CI], 0.24–0.80; P?=?0.007). A subgroup analysis revealed that the benefit of appropriate therapy was limited to patients with higher APACHE II scores (HR for patients with scores >15 and ?35, 0.46; 95% CI 0.23–0.92; and for those with scores >35, 0.14; 95% CI, 0.02–0.99). In conclusion, appropriate antimicrobial therapy significantly reduces 14-day mortality for CnsKP infections. Survival benefit is more notable among more severely ill patients. PMID:26287432

  9. Reduction of cyclopropene by NifV- and wild-type nitrogenases from Klebsiella pneumoniae.

    PubMed

    Gemoets, J P; Bravo, M; McKenna, C E; Leigh, G J; Smith, B E

    1989-03-01

    The nitrogenase from wild-type Klebsiella pneumoniae reduces cyclopropene to cyclopropane and propene in the ratio 1:2 at pH 7.5. We show in this paper that the nitrogenase from a nifV mutant of K. pneumoniae also reduces cyclopropene to cyclopropane and propene, but the ratio of products is now 1:1.4. However, both nitrogenases exhibit the same Km for cyclopropene (2.1 x 10(4) +/- 0.2 x 10(4) Pa), considerably more than the Km for the analogous reaction with Azotobacter vinelandii nitrogenase under the same conditions (5.1 x 10(3) Pa). Analysis of the data shows that the different product ratio arises from the slower production of propene compared with cyclopropane by the mutant nitrogenase. During turnover, both nitrogenases use a large proportion of the electron flux for H2 production. CO inhibits the reduction of cyclopropene by both K. pneumoniae proteins, but the mutant nitrogenase exhibits 50% inhibition at approx. 10 Pa, whereas the corresponding value for the wild-type nitrogenase is approx. 110 Pa. However, H2 evolution by the mutant enzyme is much less affected than is cyclopropene reduction. CO inhibition of cyclopropene reduction by the nitrogenases coincides with a relative increase in H2 evolution, so that in the wild-type (but not the mutant) the electron flux is approximately maintained. The cyclopropane/propene production ratios are little affected by the presence of CO within the pressure ranges studied at least up to 50% inhibition. PMID:2650681

  10. Redistribution of Carbon Flux toward 2,3-Butanediol Production in Klebsiella pneumoniae by Metabolic Engineering

    PubMed Central

    Jeong, Daun; Yang, Jeongmo; Oh, Min-Kyu; Lee, Jinwon

    2014-01-01

    Klebsiella pneumoniae KCTC2242 has high potential in the production of a high-value chemical, 2,3-butanediol (2,3-BDO). However, accumulation of metabolites such as lactate during cell growth prevent large-scale production of 2,3-BDO. Consequently, we engineered K. pneumoniae to redistribute its carbon flux toward 2,3-BDO production. The ldhA gene deletion and gene overexpression (budA and budB) were conducted to block a pathway that competitively consumes reduced nicotinamide adenine dinucleotide and to redirect carbon flux toward 2,3-BDO biosynthesis, respectively. These steps allowed efficient glucose conversion to 2,3-BDO under slightly acidic conditions (pH 5.5). The engineered strain SGSB105 showed a 40% increase in 2,3-BDO production from glucose compared with that of the host strain, SGSB100. Genes closely related to 2,3-BDO biosynthesis were observed at the gene transcription level by cultivating the SGSB100, SGSB103, SGSB104, and SGSB105 strains under identical growth conditions. Transcription levels for budA, budB, and budC increased approximately 10% during the log phase of cell growth relative to that of SGSB100. Transcription levels of 2,3-BDO genes in SGSB105 remained high during the log and stationary phases. Thus, the carbon flux was redirected toward 2,3-BDO production. Data on batch culture and gene transcription provide insight into improving the metabolic network for 2,3-BDO biosynthesis for industrial applications. PMID:25329548

  11. Functional study of the novel multidrug efflux pump KexD from Klebsiella pneumoniae.

    PubMed

    Ogawa, Wakano; Onishi, Motoyasu; Ni, Ruiting; Tsuchiya, Tomofusa; Kuroda, Teruo

    2012-05-01

    We cloned a gene, kexD, that provides a multidrug-resistant phenotype from multidrug-resistant Klebsiella pneumoniae MGH78578. The deduced amino acid sequence of KexD is similar to that of the inner membrane protein, RND-type multidrug efflux pump. Introduction of the kexD gene into Escherichia coli KAM32 resulted in a MIC that was higher for erythromycin, novobiocin, rhodamine 6G, tetraphenylphosphonium chloride, and ethidium bromide than that of the control. Intracellular ethidium bromide levels in E. coli cells carrying the kexD gene were lower than that in the control cells under energized conditions, suggesting that KexD is a component of an energy-dependent efflux pump. RND-type pumps typically consist of three components: an inner membrane protein, a periplasmic protein, and an outer membrane protein. We discovered that KexD functions with a periplasmic protein, AcrA, from E. coli and K. pneumoniae, but not with the periplasmic proteins KexA and KexG from K. pneumoniae. KexD was able to utilize either TolC of E. coli or KocC of K. pneumoniae as an outer membrane component. kexD mRNA was not detected in K. pneumoniae MGH78578 or ATCC10031. We isolated erythromycin-resistant mutants from K. pneumoniae ATCC10031, and some showed a multidrug-resistant phenotype similar to the drug resistance pattern of KexD. Two strains of multidrug-resistant mutants were investigated for kexD expression; kexD mRNA levels were increased in these strains. We conclude that changing kexD expression can contribute to the occurrence of multidrug-resistant K. pneumoniae. PMID:22391093

  12. Influence of induced ciprofloxacin resistance on efflux pump activity of Klebsiella pneumoniae *

    PubMed Central

    Zhong, Hai-qin; Zhang, Shun; Pan, Hong; Cai, Ting

    2013-01-01

    Objective: The efflux pump (EP) is one of the major mechanisms of antibiotic resistance in Klebsiella pneumoniae. However, there are few reports on the effect of the abuse of antibiotic use on the activity of EPs. To determine whether the use of low efficacy antibiotics has any effect on the activity of EPs and induces drug resistance in K. pneumoniae, we investigated the effect of ciprofloxacin on the activity of EPs in K. pneumoniae strains. Methods: Sixteen susceptible K. pneumoniae strains were isolated from patients and their minimum inhibitory concentrations (MICs) of ciprofloxacin were measured in the absence and presence of the pump inhibitor carbonyl cyanide m-chlorophenyl hydrazone (CCCP). The strains were then induced with a gradient of ciprofloxacin until the MICs of the strains showed no further increase, to obtain induced resistant strains. The EP activities of the strains before and after induction were compared using EP inhibition and ethidium bromide (EtBr) accumulation assays. Results: The MIC values of the strains were 16?256 times higher after induction than before induction. In the presence of CCCP, the MIC values of 50% of the induced strains were 2?4-fold lower than that in the absence of this inhibitor. The EtBr accumulation assay showed that the fluorescence of EtBr in the induced cells was lower than that in the cells before induction. Conclusions: EPs are widespread in susceptible and drug-resistant K. pneumoniae strains. Induction with ciprofloxacin may increase the activity of EPs in K. pneumoniae. The EtBr accumulation assay is more sensitive than the EP inhibition assay in evaluating the activity of EPs in K. pneumoniae. PMID:24009204

  13. Infections by carbapenem-resistant Klebsiella pneumoniae in SCT recipients: a nationwide retrospective survey from Italy.

    PubMed

    Girmenia, C; Rossolini, G M; Piciocchi, A; Bertaina, A; Pisapia, G; Pastore, D; Sica, S; Severino, A; Cudillo, L; Ciceri, F; Scimè, R; Lombardini, L; Viscoli, C; Rambaldi, A

    2015-02-01

    Infections by carbapenem-resistant Klebsiella pneumoniae (CRKp) represent a challenging problem after SCT. A retrospective survey (January 2010 to July 2013) involving 52 Italian centers was performed to assess the epidemiology and the prognostic factors of CRKp infections in auto- and allo-SCT. Cases of CRKp infection were reported in 53.4% of centers. CRKp infections were documented in 25 auto-SCTs and 87 allo-SCTs, with an incidence of 0.4% (from 0.1% in 2010 to 0.7% in 2013) and 2% (from 0.4% in 2010 to 2.9% in 2013), respectively. A CRKp colonization documented before or after transplant was followed by an infection in 25.8% of auto-SCT and 39.2% of allo-SCT patients. The infection-related mortality rates were 16% and 64.4%, respectively. A pre-transplant CRKp infection (hazard ratio (HR) 0.33, 95% confidence intervals (CIs) 0.15-0.74; P=0.007) and a not CRKp-targeted first-line treatment (HR 2.67, 95% CI 1.43-4.99; P=0.002) were independent factors associated with an increased mortality in allo-SCT patients who developed a CRKp infection. Our study shows challenging findings of CRKp infections in SCT patients in Italy particularly after allo-SCT. The detection of carriers and the definition of early therapeutic strategies represent critical aspects of the management of CRKp infections after SCT. PMID:25310302

  14. Clonal Dissemination of OXA-370-Producing Klebsiella pneumoniae in Rio de Janeiro, Brazil.

    PubMed

    Pereira, Polyana Silva; Borghi, Mirla; de Araújo, Carlos Felipe Machado; Aires, Caio Augusto Martins; Oliveira, Jane Cleide Ribeiro; Asensi, Marise Dutra; Carvalho-Assef, Ana Paula D'Alincourt

    2015-08-01

    Enzymes of the OXA-48 family have become some of the most important beta-lactamases in the world. A new OXA-48 variant (OXA-370) was first described for an Enterobacter hormaechei strain isolated in Rio Grande do Sul (southern region of Brazil) in 2013. Here we report detection of the blaOXA-370 gene in 24 isolates belonging to three Enterobacteriaceae species (22 Klebsiella pneumoniae isolates, 1 Enterobacter cloacae isolate, and 1 Enterobacter aerogenes isolate) collected from five hospitals in Rio de Janeiro, Brazil, in 2013 and 2014. The isolates showed a multidrug resistance profile, and 12.5% were resistant to polymyxin B. Besides blaOXA-370, no other carbapenemase genes were observed by PCR, whereas blaOXA-1 was found in all isolates and 22 isolates (91.6%) possessed blaCTX-M-15. Molecular typing of the K. pneumoniae isolates by pulsed-field gel electrophoresis (PFGE) showed the presence of two clonal groups, i.e., KpA (21 isolates) and KpB (1 isolate). KpA was characterized as sequence type 16 (ST16) and KpB as ST1041 by multilocus sequence typing (MLST). ST16 has been observed for KPC-producing K. pneumoniae in Rio de Janeiro. Plasmid analysis performed with six representative OXA-370-producing isolates showed plasmids harboring the blaOXA-370 gene in all strains, ranging from 25 kb to 150 kb. This study suggests that there is an urgent need to investigate the presence of OXA-370 and dissemination of the K. pneumoniae ST16 clone carrying this gene in Brazil. PMID:25987619

  15. Genome-Wide Identification of Klebsiella pneumoniae Fitness Genes during Lung Infection

    PubMed Central

    Breen, Paul; Deornellas, Valerie; Mu, Qiao; Zhao, Lili; Wu, Weisheng; Cavalcoli, James D.; Mobley, Harry L. T.

    2015-01-01

    ABSTRACT Klebsiella pneumoniae is an urgent public health threat because of resistance to carbapenems, antibiotics of last resort against Gram-negative bacterial infections. Despite the fact that K. pneumoniae is a leading cause of pneumonia in hospitalized patients, the bacterial factors required to cause disease are poorly understood. Insertion site sequencing combines transposon mutagenesis with high-throughput sequencing to simultaneously screen thousands of insertion mutants for fitness defects during infection. Using the recently sequenced K. pneumoniae strain KPPR1 in a well-established mouse model of pneumonia, insertion site sequencing was performed on a pool of >25,000 transposon mutants. The relative fitness requirement of each gene was ranked based on the ratio of lung to inoculum read counts and concordance between insertions in the same gene. This analysis revealed over 300 mutants with at least a 2-fold fitness defect and 69 with defects ranging from 10- to >2,000-fold. Construction of 6 isogenic mutants for use in competitive infections with the wild type confirmed their requirement for lung fitness. Critical fitness genes included those for the synthesis of branched-chain and aromatic amino acids that are essential in mice and humans, the transcriptional elongation factor RfaH, and the copper efflux pump CopA. The majority of fitness genes were conserved among reference strains representative of diverse pathotypes. These results indicate that regulation of outer membrane components and synthesis of amino acids that are essential to its host are critical for K. pneumoniae fitness in the lung. PMID:26060277

  16. Novel Carbapenem-Hydrolyzing ?-Lactamase, KPC-1, from a Carbapenem-Resistant Strain of Klebsiella pneumoniae

    PubMed Central

    Yigit, Hesna; Queenan, Anne Marie; Anderson, Gregory J.; Domenech-Sanchez, Antonio; Biddle, James W.; Steward, Christine D.; Alberti, Sebastian; Bush, Karen; Tenover, Fred C.

    2001-01-01

    A Klebsiella pneumoniae isolate showing moderate to high-level imipenem and meropenem resistance was investigated. The MICs of both drugs were 16 ?g/ml. The ?-lactamase activity against imipenem and meropenem was inhibited in the presence of clavulanic acid. The strain was also resistant to extended-spectrum cephalosporins and aztreonam. Isoelectric focusing studies demonstrated three ?-lactamases, with pIs of 7.2 (SHV-29), 6.7 (KPC-1), and 5.4 (TEM-1). The presence of blaSHV and blaTEM genes was confirmed by specific PCRs and DNA sequence analysis. Transformation and conjugation studies with Escherichia coli showed that the ?-lactamase with a pI of 6.7, KPC-1 (K. pneumoniae carbapenemase-1), was encoded on an approximately 50-kb nonconjugative plasmid. The gene, blaKPC-1, was cloned in E. coli and shown to confer resistance to imipenem, meropenem, extended-spectrum cephalosporins, and aztreonam. The amino acid sequence of the novel carbapenem-hydrolyzing ?-lactamase, KPC-1, showed 45% identity to the pI 9.7 carbapenem-hydrolyzing ?-lactamase, Sme-1, from Serratia marcescens S6. Hydrolysis studies showed that purified KPC-1 hydrolyzed not only carbapenems but also penicillins, cephalosporins, and monobactams. KPC-1 had the highest affinity for meropenem. The kinetic studies also revealed that clavulanic acid and tazobactam inhibited KPC-1. An examination of the outer membrane proteins of the parent K. pneumoniae strain demonstrated that the strain does not express detectable levels of OmpK35 and OmpK37, although OmpK36 is present. We concluded that carbapenem resistance in K. pneumoniae strain 1534 is mainly due to production of a novel Bush group 2f, class A, carbapenem-hydrolyzing ?-lactamase, KPC-1, although alterations in porin expression may also play a role. PMID:11257029

  17. Sublethal Concentrations of Carbapenems Alter Cell Morphology and Genomic Expression of Klebsiella pneumoniae Biofilms

    PubMed Central

    Van Laar, Tricia A.; Chen, Tsute; You, Tao

    2015-01-01

    Klebsiella pneumoniae, a Gram-negative bacterium, is normally associated with pneumonia in patients with weakened immune systems. However, it is also a prevalent nosocomial infectious agent that can be found in infected surgical sites and combat wounds. Many of these clinical strains display multidrug resistance. We have worked with a clinical strain of K. pneumoniae that was initially isolated from a wound of an injured soldier. This strain demonstrated resistance to many commonly used antibiotics but sensitivity to carbapenems. This isolate was capable of forming biofilms in vitro, contributing to its increased antibiotic resistance and impaired clearance. We were interested in determining how sublethal concentrations of carbapenem treatment specifically affect K. pneumoniae biofilms both in morphology and in genomic expression. Scanning electron microscopy showed striking morphological differences between untreated and treated biofilms, including rounding, blebbing, and dimpling of treated cells. Comparative transcriptome analysis using RNA sequencing (RNA-Seq) technology identified a large number of open reading frames (ORFs) differentially regulated in response to carbapenem treatment at 2 and 24 h. ORFs upregulated with carbapenem treatment included genes involved in resistance, as well as those coding for antiporters and autoinducers. ORFs downregulated included those coding for metal transporters, membrane biosynthesis proteins, and motility proteins. Quantitative real-time PCR validated the general trend of some of these differentially regulated ORFs. Treatment of K. pneumoniae biofilms with sublethal concentrations of carbapenems induced a wide range of phenotypic and gene expression changes. This study reveals some of the mechanisms underlying how sublethal amounts of carbapenems could affect the overall fitness and pathogenic potential of K. pneumoniae biofilm cells. PMID:25583711

  18. Carbapenem-Resistant Klebsiella pneumoniae Exhibit Variability in Capsular Polysaccharide and Capsule Associated Virulence Traits

    PubMed Central

    Diago-Navarro, Elizabeth; Chen, Liang; Passet, Virginie; Burack, Seth; Ulacia-Hernando, Amaia; Kodiyanplakkal, Rosy Priya; Levi, Michael H.; Brisse, Sylvain; Kreiswirth, Barry N.; Fries, Bettina C.

    2014-01-01

    Background.?Novel therapies are urgently needed to treat carbapenem-resistant Klebsiella pneumoniae (CR-Kp)-mediated infection, which constitute a major health threat in the United States. In order to assess if it is feasible to develop anticapsular antibodies as a potential novel therapy, it is crucial to first systematically characterize capsular polysaccharide (CPS) and virulence traits in these strains. Methods.?Forty CR-Kp were genotyped by pulsed field gel electrophoresis, multilocus sequence typing (MLST), and molecular capsule typing (C-patterns and wzi sequencing). Their biofilm formation, serum resistance, macrophage-mediated killing, and virulence in Galleria mellonella were compared. MAb (1C9) was generated by co-immunization with 2 CPSs, and cross-reactivity was investigated. Results.?MLST assigned 80% of CR-Kp isolates to the ST258-clone. Molecular capsule typing identified new C-patterns, including C200/wzi-154, which was widely represented and associated with blaKPC-3-bearing strains. Heterogeneity was detected in biofilm formation and macrophage-mediated killing. Differences in serum resistance correlated with virulence in G. mellonella. ST258 strains carrying blaKPC-3 were less virulent than those with blaKPC-2. MAb 1C9 cross-reacted with 58% of CR-Kp CPSs. Conclusions.?CR-Kp ST258 strains exhibit variability of virulence-associated traits. Differences were associated with the type of KPC gene and CPS. Identification of cross-reacting anti-CPS mAbs encourages their development as adjunctive therapy. PMID:24634498

  19. Asian sand dust enhances murine lung inflammation caused by Klebsiella pneumoniae

    SciTech Connect

    He, Miao; Ichinose, Takamichi; Yoshida, Seiichi; Yamamoto, Shoji; Inoue, Ken-ichiro; Takano, Hirohisa; Yanagisawa, Rie; Nishikawa, Masataka; Mori, Ikuko; Sun, Guifan; Shibamoto, Takayuki

    2012-01-15

    Inhaling concomitants from Asian sand dust (ASD) may result in exacerbation of pneumonia by the pathogen. The exacerbating effect of ASD on pneumonia induced by Klebsiella pneumoniae (KP) was investigated in ICR mice. The organic substances adsorbed onto ASD collected from the atmosphere of Iki-island in Japan were excluded by heat treatment at 360 °C for 30 min. ICR mice were instilled intratracheally with ASD at doses of 0.05 mg or 0.2 mg/mouse four times at 2-week intervals (total dose of 0.2 mg or 0.8 mg/mouse) and were administrated with ASD in the presence or absence of KP at the last intratracheal instillation. Pathologically, ASD caused exacerbation of pneumonia by KP as shown by increased inflammatory cells within the bronchiolar and the alveolar compartments. ASD enhanced the neutrophil number dose dependently as well as the expression of cytokines (IL-1?, IL-6, IL-12, IFN-?, TNF-?) and chemokines (KC, MCP-1, MIP-1?) related to KP in BALF. In an in vitro study using RAW264.7 cells, combined treatment of ASD and KP increased gene expression of IL-1?, IL-6, IFN-?, KC, MCP-1, and MIP-1?. The same treatment tended to increase the protein level of IL-1?, TNF-? and MCP-1 in a culture medium compared to each treatment alone. The combined treatment tended to increase the gene expression of Toll-like receptor 2 (TLR2), and NALP3, ASC and caspase-1 compared with KP alone. These results suggest that the exacerbation of pneumonia by ASD + KP was due to the enhanced production of pro-inflammatory mediators via activation of TLR2 and NALP3 inflammasome pathways in alveolar macrophages.

  20. Directed evolution of a second xylitol catabolic pathway in Klebsiella pneumoniae.

    PubMed Central

    Doten, R C; Mortlock, R P

    1984-01-01

    Klebsiella pneumoniae PRL-R3 has inducible catabolic pathways for the degradation of ribitol and D-arabitol but cannot utilize xylitol as a growth substrate. A mutation in the rbtB regulatory gene of the ribitol operon permits the constitutive synthesis of the ribitol catabolic enzymes and allows growth on xylitol. The evolved xylitol catabolic pathway consists of an induced D-arabitol permease system that also transports xylitol, a constitutively synthesized ribitol dehydrogenase that oxidizes xylitol at the C-2 position to produce D-xylulose, and an induced D-xylulokinase from either the D-arabitol or D-xylose catabolic pathway. To investigate the potential of K. pneumoniae to evolve a different xylitol catabolic pathway, strains were constructed which were unable to synthesize ribitol dehydrogenase or either type of D-xylulokinase but constitutively synthesized the D-arabitol permease system. These strains had an inducible L-xylulokinase; therefore, the evolution of an enzyme which oxidized xylitol at the C-4 position to L-xylulose would establish a new xylitol catabolic pathway. Four independent xylitol-utilizing mutants were isolated, each of which had evolved a xylitol-4-dehydrogenase activity. The four dehydrogenases appeared to be identical because they comigrated during nondenaturing polyacrylamide gel electrophoresis. This novel xylitol dehydrogenase was constitutively synthesized, whereas L-xylulokinase remained inducible. Transductional analysis showed that the evolved dehydrogenase was not an altered ribitol or D-arabitol dehydrogenase and that the evolved dehydrogenase structural gene was not linked to the pentitol gene cluster. This evolved dehydrogenase had the highest activity with xylitol as a substrate, a Km for xylitol of 1.4 M, and a molecular weight of 43,000. Images PMID:6378891

  1. OXA-48 carbapenemase-producing Klebsiella pneumoniae isolated from Libyan patients.

    PubMed

    Lafeuille, Emilie; Decré, Dominique; Mahjoub-Messai, Farah; Bidet, Philippe; Arlet, Guillaume; Bingen, Edouard

    2013-12-01

    Six multidrug-resistant Klebsiella pneumoniae isolates were recovered from injured Libyan combatants. Production of carbapenemase was screened by using commercial combination tablets from Rosco combined with a temocillin disk. Polymerase chain reaction (PCR) and sequencing were used to detect several carbapenemase genes and to characterize their genetic environment. Genetic support was studied by mating-out assays. Plasmid size was identified by the KADO method. PCR and sequencing allowed characterization of plasmid scaffold. Genotyping was performed by pulse-field gel electrophoresis (PFGE) and multilocus sequence typing. PCR was used to check for the presence of nine genes linked to virulence in K. pneumoniae. No carbapenemase was identified by Rosco disks, but all isolates showed high-level temocillin resistance. All of them harbored blaOXA-48 in the transposon Tn1999.2, on a self-conjugative plasmid of about 60?kb, similar to pOXA-48. PFGE revealed three clusters in which isolates were genetically related: The first comprised FM9 and FM10, and the second comprised FM1, FM4, and FM5. FM2 formed a third distinct clone. Sequence types ST101, ST11, and ST147 were identified in keeping with PFGE results. The entB, ycfM, ybtS, and mrkD genes were detected in all isolates, and kfu gene was present in the three ST101 strains. This work confirms the current and successful spread of blaOXA-48 by horizontal dissemination of a single IncL/M plasmid through different genetic backbones with strong epidemic potential. It also highlights the need for rapid and reliable phenotypic detection methods. Attempts to link virulence factors and the production of this carbapenemase deserve further studies. PMID:23808959

  2. Quorum quenching activity of Syzygium cumini (L.) Skeels and its anthocyanin malvidin against Klebsiella pneumoniae.

    PubMed

    Gopu, Venkadesaperumal; Kothandapani, Sundar; Shetty, Prathapkumar Halady

    2015-02-01

    Many bacterial species use their intercellular signaling mechanism called quorum sensing (QS), which is found to be implicated in various factors including bacterial pathogenicity and food spoilage. Interrupting the bacterial communication is an attractive strategy to develop novel QS-based antibacterial drugs. Present study is aimed to investigate the quorum sensing inhibitory activity of Syzygium cumini and its anti-biofilm property against opportunistic pathogen using a biosensor strain Chromobacterium violaceum CV026. Ethanol extract of S. cumini was investigated for its anti-QS activity, and the possible active component was identified by docking with LasR receptor protein. Based on docking analysis, methanol extract was enriched for its total anthocyanin (STA) and its effect on QS regulated phenotypes was assessed. STA specifically inhibited the violacein production in C. violaceum; biofilm formation and EPS production in Klebsiella pneumoniae up to 82, 79.94 and 64.29% respectively. Synergistic activity of conventional antibiotics with STA enhanced the susceptibility of K. pneumoniae up to 58.45%. Molecular docking analysis of active components attributes the QSI activity of S. cumini to malvidin. Malvidin exhibited highest ligand binding with LasR receptor protein with docking score more than -7. Effect of malvidin to interrupt the QS regulated phenotypes was also assessed, and it was found to reduce the violacein production, biofilm formation and EPS production of K. pneumoniae in a concentration-dependent manner. These findings suggest that S. cumini can be used as novel QS-based antibacterial/anti-biofilm agent to manage food-borne pathogens and to increase food safety. PMID:25637095

  3. Rapid Detection of K1 Hypervirulent Klebsiella pneumoniae by MALDI-TOF MS

    PubMed Central

    Huang, Yonglu; Li, Jiaping; Gu, Danxia; Fang, Ying; Chan, Edward W.; Chen, Sheng; Zhang, Rong

    2015-01-01

    Hypervirulent strains of Klebsiella pneumoniae (hvKP) are genetic variants of K. pneumoniae which can cause life-threatening community-acquired infection in healthy individuals. Currently, methods for efficient differentiation between classic K. pneumoniae (cKP) and hvKP strains are not available, often causing delay in diagnosis and treatment of hvKP infections. To address this issue, we devised a Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) approach for rapid identification of K1 hvKP strains. Four standard algorithms, genetic algorithm (GA), support vector machine (SVM), supervised neural network (SNN), and quick classifier (QC), were tested for their power to differentiate between K1 and non-K1 strains, among which SVM was the most reliable algorithm. Analysis of the receiver operating characteristic curves of the interest peaks generated by the SVM model was found to confer highly accurate detection sensitivity and specificity, consistently producing distinguishable profiles for K1 hvKP and non-K1 strains. Of the 43 K. pneumoniae modeling strains tested by this approach, all were correctly identified as K1 hvKP and non-K1 capsule type. Of the 20 non-K1 and 17 K1 hvKP validation isolates, the accuracy of K1 hvKP and non-K1 identification was 94.1 and 90.0%, respectively, according to the SVM model. In summary, the MALDI-TOF MS approach can be applied alongside the conventional genotyping techniques to provide rapid and accurate diagnosis, and hence prompt treatment of infections caused by hvKP.

  4. [Genetic resources of nodule bacteria].

    PubMed

    Rumiantseva, M L

    2009-09-01

    Nodule bacteria (rhizobia) form highly specific symbiosis with leguminous plants. The efficiency of accumulation of biological nitrogen depends on molecular-genetic interaction between the host plant and rhizobia. Genetic characteristics of microsymbiotic strains are crucial in developing highly productive and stress-resistant symbiotic pairs: rhizobium strain-host plant cultivar (species). The present review considers the issue of studying genetic resources of nodule bacteria to identify genes and their blocks, responsible for the ability of rhizobia to form highly effective symbiosis in various agroecological conditions. The main approaches to investigation of intraspecific and interspecific genetic and genomic diversity of nodule bacteria are considered, from MLEE analysis to the recent methods of genomic DNA analysis using biochips. The data are presented showing that gene centers of host plants are centers of genetic diversification of nodule bacteria, because the intraspecific polymorphism of genetic markers of the core and the accessory rhizobial genomes is extremely high in them. Genotypic features of trapped and nodule subpopulations of alfalfa nodule bacteria are discussed. A survey of literature showed that the genomes of natural strains in alfalfa gene centers exhibit significant differences in genes involved in control of metabolism, replication, recombination, and the formation of defense response (hsd genes). Natural populations of rhizobia are regarded as a huge gene pool serving as a source of evolutionary innovations. PMID:19824536

  5. Biosynthesis of phosphatidylcholine in bacteria.

    PubMed

    Sohlenkamp, Christian; López-Lara, Isabel M; Geiger, Otto

    2003-03-01

    Phosphatidylcholine (PC) is the major membrane-forming phospholipid in eukaryotes and can be synthesized by either of two pathways, the methylation pathway or the CDP-choline pathway. Many prokaryotes lack PC, but it can be found in significant amounts in membranes of rather diverse bacteria and based on genomic data, we estimate that more than 10% of all bacteria possess PC. Enzymatic methylation of phosphatidylethanolamine via the methylation pathway was thought to be the only biosynthetic pathway to yield PC in bacteria. However, a choline-dependent pathway for PC biosynthesis has been discovered in Sinorhizobium meliloti. In this pathway, PC synthase, condenses choline directly with CDP-diacylglyceride to form PC in one step. A number of symbiotic (Rhizobium leguminosarum, Mesorhizobium loti) and pathogenic (Agrobacterium tumefaciens, Brucella melitensis, Pseudomonas aeruginosa, Borrelia burgdorferi and Legionella pneumophila) bacteria seem to possess the PC synthase pathway and we suggest that the respective eukaryotic host functions as the provider of choline for this pathway. Pathogens entering their hosts through epithelia (Streptococcus pneumoniae, Haemophilus influenzae) require phosphocholine substitutions on their cell surface components that are biosynthetically also derived from choline supplied by the host. However, the incorporation of choline in these latter cases proceeds via choline phosphate and CDP-choline as intermediates. The occurrence of two intermediates in prokaryotes usually found as intermediates in the eukaryotic CDP-choline pathway for PC biosynthesis raises the question whether some bacteria might form PC via a CDP-choline pathway. PMID:12547654

  6. Structure and dynamics of Klebsiella pneumoniae response regulator PmrA in complex with

    E-print Network

    Chen, Sheng-Wei

    DNA give a deep insight into the mechanism of transcription activation A joint research group led into the mechanism of PmrA-activated gene expressions that lead to antibiotics resistance, which was published the mechanism by which bacteria become more resistant to antibiotics. The PmrA/PmrB two-component system

  7. Functional Genomic Screen Identifies Klebsiella pneumoniae Factors Implicated in Blocking Nuclear Factor ?B (NF-?B) Signaling.

    PubMed

    Tomás, Anna; Lery, Leticia; Regueiro, Verónica; Pérez-Gutiérrez, Camino; Martínez, Verónica; Moranta, David; Llobet, Enrique; González-Nicolau, Mar; Insua, Jose L; Tomas, Juan M; Sansonetti, Philippe J; Tournebize, Régis; Bengoechea, José A

    2015-07-01

    Klebsiella pneumoniae is an etiologic agent of community-acquired and nosocomial pneumonia. It has been shown that K. pneumoniae infections are characterized by reduced early inflammatory response. Recently our group has shown that K. pneumoniae dampens the activation of inflammatory responses by antagonizing the activation of the NF-?B canonical pathway. Our results revealed that K. pneumoniae capsule polysaccharide (CPS) was necessary but not sufficient to attenuate inflammation. To identify additional Klebsiella factors required to dampen inflammation, we standardized and applied a high-throughput gain-of-function screen to examine a Klebsiella transposon mutant library. We identified 114 mutants that triggered the activation of NF-?B. Two gene ontology categories accounted for half of the loci identified in the screening: metabolism and transport genes (32% of the mutants) and envelope-related genes (17%). Characterization of the mutants revealed that the lack of the enterobactin siderophore was linked to a reduced CPS expression, which in turn underlined the NF-?B activation induced by the mutant. The lipopolysaccharide (LPS) O-polysaccharide and the pullulanase (PulA) type 2 secretion system (T2SS) are required for full effectiveness of the immune evasion. Importantly, these factors do not play a redundant role. The fact that LPS O-polysaccharide and T2SS mutant-induced responses were dependent on TLR2-TLR4-MyD88 activation suggested that LPS O-polysaccharide and PulA perturbed Toll-like receptor (TLR)-dependent recognition of K. pneumoniae. Finally, we demonstrate that LPS O-polysaccharide and pulA mutants are attenuated in the pneumonia mouse model. We propose that LPS O-polysaccharide and PulA T2SS could be new targets for the design of new antimicrobials. Increasing TLR-governed defense responses might provide also selective alternatives for the management of K. pneumoniae pneumonia. PMID:25971969

  8. Functional Genomic Screen Identifies Klebsiella pneumoniae Factors Implicated in Blocking Nuclear Factor ?B (NF-?B) Signaling*

    PubMed Central

    Tomás, Anna; Lery, Leticia; Regueiro, Verónica; Pérez-Gutiérrez, Camino; Martínez, Verónica; Moranta, David; Llobet, Enrique; González-Nicolau, Mar; Insua, Jose L.; Tomas, Juan M.; Sansonetti, Philippe J.; Tournebize, Régis; Bengoechea, José A.

    2015-01-01

    Klebsiella pneumoniae is an etiologic agent of community-acquired and nosocomial pneumonia. It has been shown that K. pneumoniae infections are characterized by reduced early inflammatory response. Recently our group has shown that K. pneumoniae dampens the activation of inflammatory responses by antagonizing the activation of the NF-?B canonical pathway. Our results revealed that K. pneumoniae capsule polysaccharide (CPS) was necessary but not sufficient to attenuate inflammation. To identify additional Klebsiella factors required to dampen inflammation, we standardized and applied a high-throughput gain-of-function screen to examine a Klebsiella transposon mutant library. We identified 114 mutants that triggered the activation of NF-?B. Two gene ontology categories accounted for half of the loci identified in the screening: metabolism and transport genes (32% of the mutants) and envelope-related genes (17%). Characterization of the mutants revealed that the lack of the enterobactin siderophore was linked to a reduced CPS expression, which in turn underlined the NF-?B activation induced by the mutant. The lipopolysaccharide (LPS) O-polysaccharide and the pullulanase (PulA) type 2 secretion system (T2SS) are required for full effectiveness of the immune evasion. Importantly, these factors do not play a redundant role. The fact that LPS O-polysaccharide and T2SS mutant-induced responses were dependent on TLR2-TLR4-MyD88 activation suggested that LPS O-polysaccharide and PulA perturbed Toll-like receptor (TLR)-dependent recognition of K. pneumoniae. Finally, we demonstrate that LPS O-polysaccharide and pulA mutants are attenuated in the pneumonia mouse model. We propose that LPS O-polysaccharide and PulA T2SS could be new targets for the design of new antimicrobials. Increasing TLR-governed defense responses might provide also selective alternatives for the management of K. pneumoniae pneumonia. PMID:25971969

  9. Klebsiella pneumoniae Increases the Levels of Toll-Like Receptors 2 and 4 in Human Airway Epithelial Cells?

    PubMed Central

    Regueiro, Verónica; Moranta, David; Campos, Miguel A.; Margareto, Javier; Garmendia, Junkal; Bengoechea, José A.

    2009-01-01

    Airway epithelial cells act as the first barrier against pathogens. These cells recognize conserved structural motifs expressed by microbial pathogens via Toll-like receptors (TLRs) expressed on the surface. In contrast to the level of expression in lymphoid cells, the level of expression of TLR2 and TLR4 in airway epithelial cells is low under physiological conditions. Here we explored whether Klebsiella pneumoniae upregulates the expression of TLRs in human airway epithelial cells. We found that the expression of TLR2 and TLR4 by A549 cells and human primary airway cells was upregulated upon infection with K. pneumoniae. The increased expression of TLRs resulted in enhancement of the cellular response upon stimulation with Pam3CSK4 and lipopolysaccharide, which are TLR2 and TLR4 agonists, respectively. Klebsiella-dependent upregulation of TLR expression occurred via a positive I?B?-dependent NF-?? pathway and via negative p38 and p44/42 mitogen-activated protein kinase-dependent pathways. We showed that Klebsiella-induced TLR2 and TLR4 upregulation was dependent on TLR activation. An isogenic capsule polysaccharide (CPS) mutant did not increase TLR2 and TLR4 expression. Purified CPS upregulated TLR2 and TLR4 expression, and polymyxin B did not abrogate CPS-induced TLR upregulation. Although no proteins were detected in the CPS preparation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and colloidal gold staining, we could not rule out the possibility that traces of protein in our CPS preparation could have been responsible, at least in part, for the TLR upregulation. PMID:19015258

  10. Synergetic Antimicrobial Effects of Mixtures of Ethiopian Honeys and Ginger Powder Extracts on Standard and Resistant Clinical Bacteria Isolates

    PubMed Central

    Ewnetu, Yalemwork; Lemma, Wossenseged; Birhane, Nega

    2014-01-01

    Purpose. To evaluate antimicrobial effects of mixtures of Ethiopian honeys and ginger rhizome powder extracts on Staphylococcus aureus (ATCC 25923), Escherichia coli (ATCC 25922), Staphylococcus aureus (MRSA), Escherichia coli (R), and Klebsiella pneumoniae (R). Methods. Agar diffusion and broth assays were performed to determine susceptibility of these standard and resistant clinical bacteria isolates using honey-ginger powder extract mixtures. Results. Honey-ginger powder extract mixtures produced the highest mean inhibition (25.62?mm ± 2.55) compared to the use of honeys (21.63?mm ± 3.30) or ginger extracts (19.23?mm ± 3.42) individually. The ranges of inhibitions produced by honey-ginger extract mixtures on susceptible test organisms (26–30?mm) and resistant strains (range: 19–27?mm) were higher compared to 7–22?mm and 0–14?mm by standard antibiotic discs. Minimum inhibitory concentrations (MIC) of mixture of honeys-ginger extracts were 6.25% (0.625?v/mL) on the susceptible bacteria compared to 75% for resistant clinical isolates. Minimum bactericidal concentration (MBC) of honey-ginger extracts was 12.5% (0.125?g/mL) for all the test organisms. Conclusion. The result of this study showed that honey-ginger powder extract mixtures have the potential to serve as cheap source of antibacterial agents especially for the drug resistant bacteria strains. PMID:24772182

  11. KPC - 3 Klebsiella pneumoniae ST258 clone infection in postoperative abdominal surgery patients in an intensive care setting: analysis of a case series of 30 patients

    PubMed Central

    2013-01-01

    Background Abdominal surgery carries significant morbidity and mortality, which is in turn associated with an enormous use of healthcare resources. We describe the clinical course of 30 Intensive Care Unit (ICU) patients who underwent abdominal surgery and showed severe infections caused by Klebsiella pneumoniae sequence type (ST) 258 producing K. pneumoniae carbapenemase (KPC-Kp). The aim was to evaluate risk factors for mortality and the impact of a combination therapy of colistin plus recommended regimen or higher dosage of tigecycline. Methods A prospective assessment of severe monomicrobial KPC-Kp infections occurring after open abdominal surgery carried out from August 2011 to August 2012 in the same hospital by different surgical teams is presented. Clinical and surgical characteristics, microbiological and surveillance data, factors associated with mortality and treatment regimens were analyzed. A combination regimen of colistin with tigecycline was used. A high dose of tigecycline was administered according to intra-abdominal abscess severity and MICs for tigecycline. Results The mean age of the patients was 56.6?±?15 and their APACHE score on admission averaged 22.72. Twenty out of 30 patients came from the surgical emergency unit. Fifteen patients showed intra-abdominal abscess, eight anastomotic leakage, four surgical site infection (SSI) and three peritonitis. The overall crude ICU mortality rate was 40% (12 out of 30 patients). Twelve of the 30 patients were started on a combination treatment of high-dose tigecycline and intravenous colistin. A significantly lower mortality rate was observed among those patients compared to patients treated with approved dose of tigecycline plus colistin. No adverse events were reported with high doses of tigecycline. Conclusions Critically-ill surgical patients are prone to severe post-surgical infectious complications caused by KPC-Kp. Timely microbiological diagnosis and optimizing antibiotic dosing regimens are essential to prevent worse outcomes. Further studies and well-controlled clinical trials are needed to define the optimal treatment of infections by KPC-Kp and, more generally, carbapenem-resistant bacteria. PMID:23822218

  12. Comparative analysis of the complete genome of KPC-2-producing Klebsiella pneumoniae Kp13 reveals remarkable genome plasticity and a wide repertoire of virulence and resistance mechanisms

    PubMed Central

    2014-01-01

    Background Klebsiella pneumoniae is an important opportunistic pathogen associated with nosocomial and community-acquired infections. A wide repertoire of virulence and antimicrobial resistance genes is present in K. pneumoniae genomes, which can constitute extra challenges in the treatment of infections caused by some strains. K. pneumoniae Kp13 is a multidrug-resistant strain responsible for causing a large nosocomial outbreak in a teaching hospital located in Southern Brazil. Kp13 produces K. pneumoniae carbapenemase (KPC-2) but is unrelated to isolates belonging to ST 258 and ST 11, the main clusters associated with the worldwide dissemination of KPC-producing K. pneumoniae. In this report, we perform a genomic comparison between Kp13 and each of the following three K. pneumoniae genomes: MGH 78578, NTUH-K2044 and 342. Results We have completely determined the genome of K. pneumoniae Kp13, which comprises one chromosome (5.3 Mbp) and six plasmids (0.43 Mbp). Several virulence and resistance determinants were identified in strain Kp13. Specifically, we detected genes coding for six beta-lactamases (SHV-12, OXA-9, TEM-1, CTX-M-2, SHV-110 and KPC-2), eight adhesin-related gene clusters, including regions coding for types 1 (fim) and 3 (mrk) fimbrial adhesins. The rmtG plasmidial 16S rRNA methyltransferase gene was also detected, as well as efflux pumps belonging to five different families. Mutations upstream the OmpK35 porin-encoding gene were evidenced, possibly affecting its expression. SNPs analysis relative to the compared strains revealed 141 mutations falling within CDSs related to drug resistance which could also influence the Kp13 lifestyle. Finally, the genetic apparatus for synthesis of the yersiniabactin siderophore was identified within a plasticity region. Chromosomal architectural analysis allowed for the detection of 13 regions of difference in Kp13 relative to the compared strains. Conclusions Our results indicate that the plasticity occurring at many hierarchical levels (from whole genomic segments to individual nucleotide bases) may play a role on the lifestyle of K. pneumoniae Kp13 and underlie the importance of whole-genome sequencing to study bacterial pathogens. The general chromosomal structure was somewhat conserved among the compared bacteria, and recombination events with consequent gain/loss of genomic segments appears to be driving the evolution of these strains. PMID:24450656

  13. Isolation of an NDM-5-producing ST16 Klebsiella pneumoniae from a Dutch patient without travel history abroad, August 2015.

    PubMed

    Bathoorn, Erik; Rossen, John W; Lokate, Mariëtte; Friedrich, Alexander W; Hammerum, Anette M

    2015-10-15

    A New Delhi Metallo-beta-lactamase-5 (NDM-5)-producing ST16 Klebsiella pneumoniae strain was isolated from a Dutch patient in a long-term care facility without recent travel history abroad. Core genome multilocus sequence typing (cgMLST) revealed that the Dutch isolate was clonally related to isolates detected in four patients in Denmark in 2014. Public health experts and clinicians need to be informed; repetitive screening may be needed in patients without known risk factors for carbapenemases-producing Enterobacteriaceae who have undergone antibiotic treatment. PMID:26537842

  14. Repression of oxalic acid-mediated mineral phosphate solubilization in rhizospheric isolates of Klebsiella pneumoniae by succinate.

    PubMed

    Rajput, Mahendrapal Singh; Naresh Kumar, G; Rajkumar, Shalini

    2013-02-01

    Two strains of Klebsiella (SM6 and SM11) were isolated from rhizospheric soil that solubilized mineral phosphate by secretion of oxalic acid from glucose. Activities of enzymes for periplasmic glucose oxidation (glucose dehydrogenase) and glyoxylate shunt (isocitrate lyase and glyoxylate oxidase) responsible for oxalic acid production were estimated. In presence of succinate, phosphate solubilization was completely inhibited, and the enzymes glucose dehydrogenase and glyoxylate oxidase were repressed. Significant activity of isocitrate lyase, the key enzyme for carbon flux through glyoxylate shunt and oxalic acid production during growth on glucose suggested that it could be inducible in nature, and its inhibition by succinate appeared to be similar to catabolite repression. PMID:23124768

  15. Molybdenum cofactor (chlorate-resistant) mutants of Klebsiella pneumoniae M5al can use hypoxanthine as the sole nitrogen source.

    PubMed Central

    Garzón, A; Li, J; Flores, A; Casadesus, J; Stewart, V

    1992-01-01

    Selection for chlorate resistance yields mol (formerly chl) mutants with defects in molybdenum cofactor synthesis. Complementation and genetic mapping analyses indicated that the Klebsiella pneumoniae mol genes are functionally homologous to those of Escherichia coli and occupy analogous genetic map positions. Hypoxanthine utilization in other organisms requires molybdenum cofactor as a component of xanthine dehydrogenase, and thus most chlorate-resistant mutants cannot use hypoxanthine as a sole source of nitrogen. Surprisingly, the K. pneumoniae mol mutants and the mol+ parent grew equally well with hypoxanthine as the sole nitrogen source, suggesting that K. pneumoniae has a molybdenum cofactor-independent pathway for hypoxanthine utilization. PMID:1400180

  16. Rapid resistome fingerprinting and clonal lineage profiling of carbapenem-resistant Klebsiella pneumoniae isolates by targeted next-generation sequencing.

    PubMed

    Arena, Fabio; Rolfe, P Alexander; Doran, Graeme; Conte, Viola; Gruszka, Sarah; Clarke, Thomas; Adesokan, Yemi; Giani, Tommaso; Rossolini, Gian Maria

    2014-03-01

    Thirty-two carbapenem-resistant Klebsiella pneumoniae isolates, representative of different resistance mechanisms and clonal lineages, were analyzed with the Pathogenica HAI BioDetection system, based on targeted next-generation sequencing (NGS) technology. With most strains, the system simultaneously yielded comprehensive information on relevant ?-lactam resistance determinants and accurate discrimination of clonal lineages, in a shorter time frame and in a less labor-intensive manner than currently available methods for molecular epidemiology analysis. Results supported the usefulness of targeted NGS-based technologies for similar applications. PMID:24403299

  17. Genetic transfer in acidophilic bacteria

    SciTech Connect

    Roberto, F.F.; Glenn, A.W.; Bulmer, D.; Ward, T.E.

    1990-01-01

    There is increasing interest in the use of microorganisms to recover metals from ores, as well as to remove sulfur from coal. These so-called bioleaching processes are mediated by a number of bacteria. The best-studied of these organisms are acidophiles including Thiobacillus and Acidiphilium species. Our laboratory has focused on developing genetic strategies to allow the manipulation of acidophilic bacteria to improve and augment their utility in large scale operations. We have recently been successful in employing conjugation for interbacterial transfer of genetic information, as well as in directly transforming Acidiphilium by use of electroporation. We are now testing the properties of IncPl, IncW and IncQ plasmid vectors in Acidiphilium to determine their relative usefulness in routine manipulation of acidophiles and transfer between organisms. This study also allows us to determine the natural ability of these bacteria to transfer genetic material amongst themselves in their particular environment. 21 refs., 3 figs., 2 tabs.

  18. Sampling for Bacteria in Wells 

    E-print Network

    Lesikar, Bruce J.

    2001-11-15

    stream_source_info pdf_1539.pdf.txt stream_content_type text/plain stream_size 2257 Content-Encoding ISO-8859-1 stream_name pdf_1539.pdf.txt Content-Type text/plain; charset=ISO-8859-1 Sampling for Bacteria in Wells E...-126 11/01 Water samples for bacteria tests must always be col- lected in a sterile container. The procedure for collect- ing a water sample is as follows: 1. Obtain a sterile container from a Health Department Laboratory or contact your local Extension...

  19. In Vitro Antibacterial Activity of Several Plant Extracts and Oils against Some Gram-Negative Bacteria

    PubMed Central

    Al-Mariri, Ayman; Safi, Mazen

    2014-01-01

    Background: Medicinal plants are considered new resources for producing agents that could act as alternatives to antibiotics in the treatment of antibiotic-resistant bacteria. The aim of this study was to evaluate the antibacterial activity of 28 plant extracts and oils against four Gram-negative bacterial species. Methods: Experimental, in vitro, evaluation of the activities of 28 plant extracts and oils as well as some antibiotics against E. coli O157:H7, Yersinia enterocolitica O9, Proteus spp., and Klebsiella pneumoniae was performed. The activity against 15 isolates of each bacterium was determined by disc diffusion method at a concentration of 5%. Microdilution susceptibility assay was used in order to determine the minimal inhibitory concentrations (MICs) of the plant extracts, oils, and antibiotics. Results: Among the evaluated herbs, only Origanum syriacum L., Thymus syriacus Boiss., Syzygium aromaticum L., Juniperus foetidissima Wild, Allium sativum L., Myristica fragrans Houtt, and Cinnamomum zeylanicum L. essential oils and Laurus nobilis L. plant extract showed anti-bacterial activity. The MIC50 values of these products against the Gram-negative organisms varied from 1.5 (Proteus spp. and K. pneumoniae( and 6.25 µl/ml (Yersinia enterocolitica O9 ) to 12.5 µl/ml (E. coli O:157). Conclusion: Among the studied essential oils, O. syriacum L., T. syriacus Boiss., C. zeylanicum L., and S. aromaticum L. essential oils were the most effective. Moreover, Cephalosporin and Ciprofloxacin were the most effective antibiotics against almost all the studied bacteria. Therefore, O. syriacum L., T. syriacus Boiss., C. zeylanicum L., and S. aromaticum L. could act as bactericidal agents against Gram-negative bacteria. PMID:24453392

  20. [Infections of finger and toe nails due to fungi and bacteria].

    PubMed

    Nenoff, P; Paasch, U; Handrick, W

    2014-04-01

    Infections of the finger and the toe nails are most frequently caused by fungi, primarily dermatophytes. Causative agents of tinea unguium are mostly anthropophilic dermatophytes. Both in Germany, and worldwide, Trichophyton rubrum represents the main important causative agent of onychomycoses. Yeasts are isolated from fungal nail infections, both paronychia and onychomycosis far more often than generally expected. This can represent either saprophytic colonization as well as acute or chronic infection of the nail organ. The main yeasts causing nail infections are Candida parapsilosis, and Candida guilliermondii; Candida albicans is only in third place. Onychomycosis due to molds, or so called non-dermatophyte molds (NDM), are being increasingly detected. Molds as cause of an onychomycosis are considered as emerging pathogens. Fusarium species are the most common cause of NDM onychomycosis; however, rare molds like Onychocola canadensis may be found. Bacterial infections of the nails are caused by gram negative bacteria, usually Pseudomonas aeruginosa (recognizable because of green or black coloration of the nails) but also Klebsiella spp. and gram positive bacteria like Staphylococcus aureus. Treatment of onychomycosis includes application of topical antifungal agents (amorolfine, ciclopirox). If more than 50?% of the nail plate is affected or if more than three out of ten nails are affected by the fungal infection, oral treatment using terbinafine (in case of dermatophyte infection), fluconazole (for yeast infections), or alternatively itraconazole are recommended. Bacterial infections are treated topically with antiseptic agents (octenidine), and in some cases with topical antibiotics (nadifloxacin, gentamicin). Pseudomonas infections of the nail organ are treated by ciprofloxacin; other bacteria are treated according to the results of culture and sensitivity testing. PMID:24718510

  1. Manipulating Genetic Material in Bacteria

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Lisa Crawford, a graduate research assistant from the University of Toledo, works with Laurel Karr of Marshall Space Flight Center (MSFC) in the molecular biology laboratory. They are donducting genetic manipulation of bacteria and yeast for the production of large amount of desired protein. Photo credit: NASA/Marshall Space Flight Center (MSFC)

  2. Photosynthetic reaction centers in bacteria

    SciTech Connect

    Norris, J.R. Univ. of Chicago, IL ); Schiffer, M. )

    1990-07-30

    The photochemistry of photosynthesis begins in complexes called reaction centers. These have become model systems to study the fundamental process by which plants and bacteria convert and store solar energy as chemical free energy. In green plants, photosynthesis occurs in two systems, each of which contains a different reaction center, working in series. In one, known as photosystem 1, oxidized nicotinamide adenine dinucleotide phosphate (NADP[sup +]) is reduced to NADPH for use in a series of dark reactions called the Calvin cycle, named for Nobel Laureate Melvin Calvin, by which carbon dioxide is converted into useful fuels such as carbohydrates and sugars. In the other half of the photosynthetic machinery of green plants, called photosystem 2, water is oxidized to produce molecular oxygen. A different form of photosynthesis occurs in photosynthetic bacteria, which typically live at the bottom of ponds and feed on organic debris. Two main types of photosynthetic bacteria exist: purple and green. Neither type liberates oxygen from water. Instead, the bacteria feed on organic media or inorganic materials, such as sulfides, which are easier to reduce or oxidize than carbon dioxide or water. Perhaps in consequence, their photosynthetic machinery is simpler than that of green, oxygen-evolving plants and their primary photochemistry is better understood.

  3. Hydrocarbon degradation by antarctic bacteria

    SciTech Connect

    Cavanagh, J.A.E.; Nichols, P.D.; McMeekin, T.A.; Franzmann, P.D.

    1996-12-31

    Bacterial cultures obtained from sediment samples collected during a trial oil spill experiment conducted at Airport beach, Eastern Antarctica were selectively enriched for n-alkane-degrading and phenanthrenedegrading bacteria. Samples were collected from a control site and sites treated with different hydrocarbon mixtures - Special Antarctic blend (SAB), BP-Visco and orange roughy oils. One set of replicate sites was also treated with water from Organic Lake which had previously been shown to contain hydrocarbon-degrading bacteria. No viable bacteria were obtained from samples collected from sites treated with orange roughy oil. Extensive degradation of n-alkanes by enrichment cultures obtained from sites treated with SAB and BP-Visco occurred at both 25{degrees}C and 10{degrees}C. Extensive degradation of phenanthrene also occurred in enrichment cultures from these sites grown at 25{degrees}C. Concurrent increases of polar lipid in these cultures were also observed. The presence of 1,4-naphthaquinone and 1-naphthol during the growth of the cultures on phenanthrene is unusual and warrants further investigation of the mechanism of phenanthrene-degradation by these Antarctic bacteria.

  4. Three Dimensional Checkerboard Synergy Analysis of Colistin, Meropenem, Tigecycline against Multidrug-Resistant Clinical Klebsiella pneumonia Isolates

    PubMed Central

    Bohnert, Jürgen A.; Pfeifer, Yvonne; Kesselmeier, Miriam; Hagel, Stefan; Pletz, Mathias W.

    2015-01-01

    The spread of carbapenem-non-susceptible Klebsiella pneumoniae strains bearing different resistance determinants is a rising problem worldwide. Especially infections with KPC (Klebsiella pneumoniae carbapenemase) - producers are associated with high mortality rates due to limited treatment options. Recent clinical studies of KPC-blood stream infections revealed that colistin-based combination therapy with a carbapenem and/or tigecycline was associated with significantly decreased mortality rates when compared to colistin monotherapy. However, it remains unclear if these observations can be transferred to K. pneumoniae harboring other mechanisms of carbapenem resistance. A three-dimensional synergy analysis was performed to evaluate the benefits of a triple combination with meropenem, tigecycline and colistin against 20 K. pneumoniae isolates harboring different ?-lactamases. To examine the mechanism behind the clinically observed synergistic effect, efflux properties and outer membrane porin (Omp) genes (ompK35 and ompK36) were also analyzed. Synergism was found for colistin-based double combinations for strains exhibiting high minimal inhibition concentrations against all of the three antibiotics. Adding a third antibiotic did not result in further increased synergistic effect in these strains. Antagonism did not occur. These results support the idea that colistin-based double combinations might be sufficient and the most effective combination partner for colistin should be chosen according to its MIC. PMID:26067824

  5. Three Dimensional Checkerboard Synergy Analysis of Colistin, Meropenem, Tigecycline against Multidrug-Resistant Clinical Klebsiella pneumonia Isolates.

    PubMed

    Stein, Claudia; Makarewicz, Oliwia; Bohnert, Jürgen A; Pfeifer, Yvonne; Kesselmeier, Miriam; Hagel, Stefan; Pletz, Mathias W

    2015-01-01

    The spread of carbapenem-non-susceptible Klebsiella pneumoniae strains bearing different resistance determinants is a rising problem worldwide. Especially infections with KPC (Klebsiella pneumoniae carbapenemase) - producers are associated with high mortality rates due to limited treatment options. Recent clinical studies of KPC-blood stream infections revealed that colistin-based combination therapy with a carbapenem and/or tigecycline was associated with significantly decreased mortality rates when compared to colistin monotherapy. However, it remains unclear if these observations can be transferred to K. pneumoniae harboring other mechanisms of carbapenem resistance. A three-dimensional synergy analysis was performed to evaluate the benefits of a triple combination with meropenem, tigecycline and colistin against 20 K. pneumoniae isolates harboring different ?-lactamases. To examine the mechanism behind the clinically observed synergistic effect, efflux properties and outer membrane porin (Omp) genes (ompK35 and ompK36) were also analyzed. Synergism was found for colistin-based double combinations for strains exhibiting high minimal inhibition concentrations against all of the three antibiotics. Adding a third antibiotic did not result in further increased synergistic effect in these strains. Antagonism did not occur. These results support the idea that colistin-based double combinations might be sufficient and the most effective combination partner for colistin should be chosen according to its MIC. PMID:26067824

  6. The potential of selected South African plants with anti-Klebsiella activity for the treatment and prevention of ankylosing spondylitis.

    PubMed

    Cock, I E; van Vuuren, S F

    2015-02-01

    A wide variety of herbal remedies are used in traditional African medicine to treat inflammatory disorders, including some autoimmune diseases. Thirty-four extracts from 13 South African plant species traditionally used for the treatment of inflammation were investigated for their ability to control a microbial trigger for ankylosing spondylitis (Klebsiella pneumoniae). Twenty-six of the extracts (76.5%) inhibited the growth of K. pneumoniae. Methanol and water extracts of Ballota africana, Carpobrotus edulis leaves, Kigellia africana, Lippia javanica, Pelargonium fasiculata, Syzygium cordatum (including bark), Terminalia pruinoides and Terminalia sericea were effective K. pneumoniae inhibitors, with MIC values <1000 µg/ml. The roots of Tulbaghia violaceae and bark from Warburgia salutaris also demonstrated efficacy. The most potent extracts were examined by RP-HPLC and UV-Vis spectroscopy for the presence of resveratrol. Methanolic extracts of B. africana, C. edulis leaves, L. javanica, T. pruinoides and T. sericea, as well as aqueous B. africana, T. pruinoides and T. sericea extracts, displayed peaks with retention times and UV-Vis spectra consistent with the presence of resveratrol. Resveratrol was generally a minor component, indicating that resveratrol was not solely responsible for the anti-Klebsiella growth inhibitory properties. Plant extracts with K. pneumoniae inhibitory activity were either non-toxic, or of low toxicity in the Artemia (brine shrimp) nauplii bioassay. Their low toxicity and antibiotic bioactivity against K. pneumoniae indicate their potential for both preventing the onset of ankylosing spondylitis and minimising its symptoms once the disease is established. PMID:25412961

  7. Short communication: comparison of virulence factors in Klebsiella pneumoniae strains associated with multiple or single cases of mastitis.

    PubMed

    Kanevsky-Mullarky, I; Nedrow, A J; Garst, S; Wark, W; Dickenson, M; Petersson-Wolfe, C S; Zadoks, R N

    2014-01-01

    Klebsiella pneumoniae mastitis in dairy cattle is generally due to an opportunistic infection from the environment, resulting in large heterogeneity among mastitis-causing strains within a herd. However, in mastitis outbreaks in 4 herds, several strains of K. pneumoniae were identified as the cause of infection in multiple cows, suggesting increased ability to either cause disease or evade host defenses. In this study, differences in capsule formation and immune evasion were compared in 5 pairs of K. pneumoniae strains, where one strain in each pair was associated with multiple cases of mastitis and the other with a single case of mastitis. Production of capsular polysaccharide, ability to evade killing by polymorphonuclear neutrophilic leukocytes (PMNL), and the relationship between the 2 were evaluated for each strain grown in broth or milk. Growth of isolates in skim milk increased capsule size and ability to evade killing by PMNL, depending on strain type. Specifically, strains associated with multiple cases of mastitis had increased capsule size in skim milk. Strains associated with single cases of mastitis were better able to evade killing by PMNL when grown in skim milk. Our results, although preliminary, suggest that the 2 groups of strains may constitute different subpopulations of K. pneumoniae. However, our findings do not indicate that capsule or evasions of killing by PMNL explain increased mastitis outbreaks with Klebsiella. Further work will explain the enhanced ability of some strains to cause mastitis in dairy cows. PMID:24534505

  8. Multidrug-Resistant Escherichia coli and Klebsiella pneumoniae Isolated From Patients in Kashan, Iran

    PubMed Central

    Moini, Atieh Sadat; Soltani, Babak; Taghavi Ardakani, Abbas; Moravveji, Alireza; Erami, Mahzad; Haji Rezaei, Mostafa; Namazi, Mansoor

    2015-01-01

    Background: Escherichia coli and Klebsiella pneumoniae are common human pathogens that cause a wide spectrum of infections. Antimicrobial resistance is a basic obstacle in the management of these infections which has different patterns in various regions. Objectives: In this study, the antibiotic resistance patterns and risk factors for multidrug-resistant (MDR) E. coli and K. pneumoniae were determined. Patients and Methods: In this cross-sectional study, a total of 250 isolates (134 E. coli and 116 K. pneumoniae) were collected and antimicrobial resistances to ampicillin, amoxicillin-clavulanic acid, amikacin, gentamycin, ceftriaxone, ceftazidime, ciprofloxacin and imipenem were evaluated by disc diffusion method and confirmed by E-test. Moreover, risk factors for MDR E. coli and K. pneumoniae were also detected. Results: The mean ages of the culture-positive cases of E. coli and K. pneumoniae were 33.39 ± 24.42 and 36.54 ± 24.66 years, respectively (P = 0.31); 137 (54.8%) cases were male and 113 (45.2%) were female (P = 0.53). Nineteen (14.2%) isolates of E. coli and 12 (10.3%) isolates of K. pneumoniae were sensitive to all the evaluated antibiotics. The prevalence of MDR E. coli and MDR K. pneumoniae was 50% and 46.6%, respectively (P = 0.59). The highest resistance for both strains was to ampicillin and no imipenem resistance was seen. The risk factors for MDR E. coli were admission history during the recent three months (P = 0.043) and antibiotic use in the previous month (P = 0.03); for MDR K. pneumoniae, they were admission in the pediatric ward (P = 0.016), surgical ward (P = 0.019), or gynecology ward (P = 0.12), admission duration of > seven days, and antibiotic use during the past month (P = 0.04). Conclusions: The prevalence of multidrug resistance was high compared with developed countries, and history of admission, antibiotic use, admission duration and admission wards were the risk factors for multidrug resistance. PMID:26587220

  9. Clonal spread of CTX-M-15-producing Klebsiella pneumoniae in a Croatian hospital.

    PubMed

    Vranic-Ladavac, Mirna; Bosnjak, Zrinka; Beader, Natasa; Barisic, Nada; Kalenic, Smilja; Bedenic, Branka

    2010-09-01

    This study was conducted to detect and analyse the presence of extended-spectrum beta-lactamase (ESBL)-producing Klebsiella pneumoniae associated with a nosocomial outbreak at a Croatian hospital. During 2007, 162 K. pneumoniae isolates with reduced susceptibility to third-generation cephalosporins were collected from various hospital units and patient specimens. Most of the strains were isolated from urine (61 %), followed by blood cultures (13 %), wound swabs (13 %), tracheal aspirates (5 %), intra-abdominal abscess aspirates (4 %), intravascular catheters (3 %) and cerebrospinal fluid (1 %). Medical wards were the most important source of the isolates (46 %); 21 % of the isolates originated from surgical intensive-care units. All patients had infections acquired during their stay in hospital. No community-acquired infections were reported. Sixty of these isolates were chosen for further analysis. A double-disc synergy test (DDST) was used to detect ESBLs. MICs were determined by the broth microdilution method according to CLSI guidelines. The transferability of ceftazidime resistance was tested by conjugation (broth mating method). PCR was used to detect alleles encoding ESBL enzymes. Plasmids encoding ESBLs were extracted with the Macherey Nagel Mini kit according to the manufacturer's recommendations. The genotypes of the strains were compared by analysis of banding patterns generated by PFGE of XbaI-digested genomic DNA. ESBLs were found by DDST in all isolates. All strains were resistant to cefuroxime, ceftazidime, cefotaxime, ceftriaxone, aztreonam, piperacillin/tazobactam and ciprofloxacin. There was variable susceptibility/resistance to cefepime and gentamicin. No resistance to ceftazidime/clavulanate and carbapenems was observed. Only six strains transferred resistance to an Escherichia coli recipient strain, with low frequency. All isolates yielded an amplicon of 545 bp with consensus MA primers. Multiplex PCR was positive for group 1 CTX-M beta-lactamases. Sequencing of selected amplicons revealed the presence of bla(CTX-M-15), with coding regions containing identical nucleotide sequences. Similarly to isolates from India, our isolates contained the ISEcpI insertion sequence located upstream of the bla(CTX-M-15) gene, which has recently been demonstrated to mobilize 3'-adjacent genes to transfer between DNA replicons. The isolates contained a large plasmid of approximately 150 kb. The isolates were assigned to five clusters (>85 % similarity), which contained subclusters. The results of this work provided insights into the molecular epidemiology of the spread of ESBLs in K. pneumoniae involved in an outbreak at a Croatian hospital. The hospital antibiotic policy resulted in ceftriaxone being the most heavily prescribed third-generation cephalosporin, which might be expected to select for cefotaximases such as CTX-M-15. PMID:20576749

  10. Killer Pigments in Bacteria: An Ecological Nightmare.

    ERIC Educational Resources Information Center

    Benathen, Isaiah A.; Saccardi, Marion

    2000-01-01

    Describes an alternative to teaching ecology by using bacteria to test competitor survival. Students observe a time-dependent selective killing of other unrelated bacteria by Pseudomonas aeruginosa. (SAH)

  11. Comparison of the energetic efficiencies of hydrogen and oxychemicals formation in Klebsiella pneumoniae and Clostridium butyricum during anaerobic growth on glycerol.

    PubMed

    Solomon, B O; Zeng, A P; Biebl, H; Schlieker, H; Posten, C; Deckwer, W D

    1995-04-15

    Data for the anaerobic growth of Klebsiella pneumoniae DSM 2026 and Clostridium butyricum DSM 5431 on glycerol have been analyzed using the concept of material and available electron balances with consideration for hydrogen production. Models for the kinetics of energetic efficiencies of product formation under low residual glycerol are presented. For Klebsiella pneumoniae, the specific rates of electron transfer to the products were mainly significantly dependent on specific growth rate with the exception of ethanol and hydrogen which were also significantly non-growth associated. In the case of Clostridium butyricum, the rates were only growth rate dependent, except for hydrogen formation. The analysis also indicated that the production of 1,3-propanediol by Klebsiella pneumoniae was favoured by limitations other than glycerol limitation, while hydrogen generation was best under low residual glycerol and particularly in the presence of external 1,3-propanediol. Klebsiella pneumoniae appeared to be able to incorporate more of the available electrons of glycerol into hydrogen as compared with the Clostridium butyricum. The study demonstrates the need for properly considering H2 in models describing anaerobic processes. PMID:7755965

  12. Fatal sepsis by Klebsiella pneumoniae in a patient with systemic lupus erythematosus: the importance of postmortem microbiological examination for the ex post diagnosis of infection.

    PubMed

    D'Ovidio, Cristian; Pompilio, Arianna; Crocetta, Valentina; Gherardi, Giovanni; Carnevale, Aldo; Di Bonaventura, Giovanni

    2015-09-01

    The utility of postmortem microbiology has continuously been a topic of controversy. The present study describes a case of fatal sepsis in a patient with systemic lupus erythematosus. Postmortem culture and genotyping analyses allowed us to identify Klebsiella pneumoniae as the cause of sepsis, revealing the inadequateness of antimicrobial therapy. PMID:25676900

  13. Clinical and Molecular Epidemiology of Extended-Spectrum Beta-Lactamase-Producing Klebsiella spp.: A Systematic Review and Meta-Analyses

    PubMed Central

    Hendrik, Tirza C.; Voor in ‘t holt, Anne F.; Vos, Margreet C.

    2015-01-01

    Healthcare-related infections caused by extended-spectrum beta-lactamase (ESBL)-producing Klebsiella spp. are of major concern. To control transmission, deep understanding of the transmission mechanisms is needed. This systematic review aimed to identify risk factors and sources, clonal relatedness using molecular techniques, and the most effective control strategies for ESBL-producing Klebsiella spp. A systematic search of PubMed, Embase, and Outbreak Database was performed. We identified 2771 articles from November 25th, 1960 until April 7th, 2014 of which 148 were included in the systematic review and 23 in a random-effects meta-analysis study. The random-effects meta-analyses showed that underlying disease or condition (odds ratio [OR] = 6.25; 95% confidence interval [CI] = 2.85 to 13.66) generated the highest pooled estimate. ESBL-producing Klebsiella spp. were spread through person-to-person contact and via sources in the environment; we identified both monoclonal and polyclonal presence. Multi-faceted interventions are needed to prevent transmission of ESBL-producing Klebsiella spp. PMID:26485570

  14. Re-engineering bacteria for ethanol production

    SciTech Connect

    Yomano, Lorraine P; York, Sean W; Zhou, Shengde; Shanmugam, Keelnatham; Ingram, Lonnie O

    2014-05-06

    The invention provides recombinant bacteria, which comprise a full complement of heterologous ethanol production genes. Expression of the full complement of heterologous ethanol production genes causes the recombinant bacteria to produce ethanol as the primary fermentation product when grown in mineral salts medium, without the addition of complex nutrients. Methods for producing the recombinant bacteria and methods for producing ethanol using the recombinant bacteria are also disclosed.

  15. MicroReview Bistability in bacteria

    E-print Network

    Mekalanos, John

    MicroReview Bistability in bacteria David Dubnau1 * and Richard Losick2,3 * 1 Public Health 94720, USA. Summary Gene expression in bacteria is traditionally studied from the average behaviour expression in individual cells reveals, however, that populations of genetically identical bacteria

  16. Mechanism of Transcriptional Bursting in Bacteria

    E-print Network

    Li, Tiejun

    Mechanism of Transcriptional Bursting in Bacteria Shasha Chong,1,5 Chongyi Chen,1,2,5 Hao Ge,3 phenomenon has not been understood. Here, we present the mechanism in bacteria. We developed a high. Together, these findings prove that transcriptional bursting of highly ex- pressed genes in bacteria

  17. Luminal Bacteria Recruit CD103+ Dendritic Cells

    E-print Network

    Immunity Article Luminal Bacteria Recruit CD103+ Dendritic Cells into the Intestinal Epithelium@weizmann.ac.il http://dx.doi.org/10.1016/j.immuni.2013.01.009 SUMMARY CD103+ dendritic cells (DCs) carry bacteria from bacteria or presenting bacterial antigens in mesen- tery lymph nodes. We used 2-photon microscopy in live

  18. Drosophila lifespan enhancement by exogenous bacteria

    E-print Network

    Seroude, Laurent

    Drosophila lifespan enhancement by exogenous bacteria Ted Brummel*, Alisa Ching*, Laurent Seroude with customary procedure. The experiments revealed that the presence of bacteria during the first week of adult life can enhance lifespan, despite unchanged food intake. Later in life, the presence of bacteria can

  19. Laser-Based Identification of Pathogenic Bacteria

    ERIC Educational Resources Information Center

    Rehse, Steven J.

    2009-01-01

    Bacteria are ubiquitous in our world. From our homes, to our work environment, to our own bodies, bacteria are the omnipresent although often unobserved companions to human life. Physicists are typically untroubled professionally by the presence of these bacteria, as their study usually falls safely outside the realm of our typical domain. In the…

  20. Simple chamber facilitates chemiluminescent detection of bacteria

    NASA Technical Reports Server (NTRS)

    Marts, E. C.; Wilkins, J. R.

    1970-01-01

    Test chamber enables rapid estimation of bacteria in a test sample through the reaction of luminol and an oxidant with the cytochrome C portion of certain species of bacteria. Intensity of the light emitted in the reaction is a function of the specific bacteria in the test sample.

  1. Genetics of Lactic Acid Bacteria

    NASA Astrophysics Data System (ADS)

    Zagorec, Monique; Anba-Mondoloni, Jamila; Coq, Anne-Marie Crutz-Le; Champomier-Vergès, Marie-Christine

    Many meat (or fish) products, obtained by the fermentation of meat originating from various animals by the flora that naturally contaminates it, are part of the human diet since millenaries. Historically, the use of bacteria as starters for the fermentation of meat, to produce dry sausages, was thus performed empirically through the endogenous micro-biota, then, by a volunteer addition of starters, often performed by back-slopping, without knowing precisely the microbial species involved. It is only since about 50 years that well defined bacterial cultures have been used as starters for the fermentation of dry sausages. Nowadays, the indigenous micro-biota of fermented meat products is well identified, and the literature is rich of reports on the identification of lactic acid bacteria (LAB) present in many traditional fermented products from various geographical origin, obtained without the addition of commercial starters (See Talon, Leroy, & Lebert, 2007, and references therein).

  2. Swimming bacteria power microscopic gears

    SciTech Connect

    Sokolov, Andrey; Apodaca, Mario M.; Grzybowski, Bartosz A.; Aranson, Igor S.

    2010-01-19

    Whereas the laws of thermodynamics prohibit extraction of useful work from the Brownian motion of particles in equilibrium, these motions can be “rectified” under nonequilibrium conditions, for example, in the presence of asymmetric geometrical obstacles. Here, we describe a class of systems in which aerobic bacteria Bacillus subtilis moving randomly in a fluid film power submillimeter gears and primitive systems of gears decorated with asymmetric teeth. The directional rotation is observed only in the regime of collective bacterial swimming and the gears’ angular velocities depend on and can be controlled by the amount of oxygen available to the bacteria. The ability to harness and control the power of collective motions appears an important requirement for further development of mechanical systems driven by microorganisms.

  3. Swimming bacteria power microscopic gears

    PubMed Central

    Sokolov, Andrey; Apodaca, Mario M.; Grzybowski, Bartosz A.; Aranson, Igor S.

    2010-01-01

    Whereas the laws of thermodynamics prohibit extraction of useful work from the Brownian motion of particles in equilibrium, these motions can be “rectified” under nonequilibrium conditions, for example, in the presence of asymmetric geometrical obstacles. Here, we describe a class of systems in which aerobic bacteria Bacillus subtilis moving randomly in a fluid film power submillimeter gears and primitive systems of gears decorated with asymmetric teeth. The directional rotation is observed only in the regime of collective bacterial swimming and the gears’ angular velocities depend on and can be controlled by the amount of oxygen available to the bacteria. The ability to harness and control the power of collective motions appears an important requirement for further development of mechanical systems driven by microorganisms. PMID:20080560

  4. Swimming bacteria power microscopic gears.

    SciTech Connect

    Sokolov, A.; Apodaca, M. M.; Grzybowski, B. A.; Aranson, I. S.; Materials Science Division; Princeton Univ.; Northwestern Univ.

    2010-01-19

    Whereas the laws of thermodynamics prohibit extraction of useful work from the Brownian motion of particles in equilibrium, these motions can be 'rectified' under nonequilibrium conditions, for example, in the presence of asymmetric geometrical obstacles. Here, we describe a class of systems in which aerobic bacteria Bacillus subtilis moving randomly in a fluid film power submillimeter gears and primitive systems of gears decorated with asymmetric teeth. The directional rotation is observed only in the regime of collective bacterial swimming and the gears angular velocities depend on and can be controlled by the amount of oxygen available to the bacteria. The ability to harness and control the power of collective motions appears an important requirement for further development of mechanical systems driven by microorganisms.

  5. Swimming bacteria at complex interfaces

    NASA Astrophysics Data System (ADS)

    Lopez, Diego; Lauga, Eric

    2013-11-01

    Swimming microorganisms such as bacteria often move in confined geometries. Such confinement can be caused by the presence of solid boundaries, free surfaces, or liquid interfaces. It is well established that confinement affects significantly locomotion, generating additional forces and torques on the bacteria. In the presence of a solid boundary (imposing a no-slip condition), microorganisms using helical propulsion undergo circular motion (clockwise in the case of E. coli). Conversely, close to a free (no-shear) surface the circular motion is reversed. However, realistic interfaces are complex, and experimental results do not always agree with theoretical predictions. In this work, we show, using analytical modeling, how different complex interfaces affect a nearby bacterium and modify its swimming kinematics. IUSTI UMR 7343, Polytech Marseille, France.

  6. Anaerobic bacteria from hypersaline environments.

    PubMed Central

    Ollivier, B; Caumette, P; Garcia, J L; Mah, R A

    1994-01-01

    Strictly anaerobic halophiles, namely fermentative, sulfate-reducing, homoacetogenic, phototrophic, and methanogenic bacteria are involved in the oxidation of organic carbon in hypersaline environments. To date, six anaerobic fermentative genera, containing nine species, have been described. Two of them are homoacetogens. Six species belong to the family Haloanaerobiaceae, as indicated by their unique 16S rRNA oligonucleotide sequences. Desulfohalobium retbaense and Desulfovibrio halophilus represent the only two moderately halophilic sulfate reducers so far reported. Among anoxygenic phototrophic anaerobes, a few purple bacteria with optimal growth at salinities between 6 and 11% NaCl have been isolated from hypersaline habitats. They belong to the genera Rhodospirillum, Chromatium, Thiocapsa, and Ectothiorhodospira. The commonest organisms isolated so far are Chromatium salexigens, Thiocapsa halophila, and Rhodospirillum salinarum. Extremely halophilic purple bacteria have most commonly been isolated from alkaline brines and require about 20 to 25% NaCl for optimal growth. They belong to the family Ectothiorodhospiraceae. Their osmoregulation involves synthesis or uptake of compatible solutes such as glycine-betaine that accumulate in their cytoplasm. The existence of methanogens in hypersaline environments is related to the presence of noncompetitive substrates such as methylamines, which originate mainly from the breakdown of osmoregulatory amines. Methanogenesis probably does not contribute to the mineralization of carbohydrates at NaCl concentrations higher than 15%. Above this concentration, sulfate reduction is probably the main way to oxidize H2 (although at rates too low to use up all the H2 formed) and occupies a terminal function kn the degradation of carbohydrates. Three genera and five species of halophilic methylotrophic methanogens have been reported. A bloom of phototrophic bacteria in the marine salterns of Salins-de-Giraud, located on the Mediterranean French coast in the Rhone Delta, is also described. PMID:8177169

  7. Bacteria turn a tiny gear

    SciTech Connect

    2009-01-01

    Thousands of tiny Bacillus subtillis bacteria turn a single gear, just 380 microns across. (A human hair is about 100 microns across.) The method could be used to create micro-machines. Argonne National Laboratory scientist Igor Aronson pioneered this technique. Read more at the New York Times: http://ow.ly/ODfI or at Argonne: http://ow.ly/ODfa Video courtesy Igor Aronson.

  8. The study of adhesive forces between the type-3 fimbriae of Klebsiella pneumoniae and collagen-coated surfaces by using optical tweezers

    NASA Astrophysics Data System (ADS)

    Chan, Chiahan; Fan, Chia-chieh; Huang, Ying-Jung; Peng, Hwei-Ling; Long, Hsu

    2004-10-01

    Adherence to host cells by a bacterial pathogen is a critical step for establishment of infection. It will contribute greatly to the understanding of bacterial pathogenesis by studying the biological force between a single pair of pathogen and host cell. In our experiment, we use a calibrated optical tweezers system to detach a single Klebsiella pneumoniae, the pathogen, from collagen, the host. By gradually increasing the laser power of the optical tweezers until the Klebsiella pneumoniae is detached from the collagen, we obtain the magnitude of the adhesive force between them. This happens when the adhesive force is barely equal to the trapping force provided by the optical tweezers at that specific laser power. This study is important because Klebsiella pneumoniae is an opportunistic pathogen which causes suppurative lesions, urinary and respiratory tract infections. It has been proved that type 3 fimbrial adhesin (mrkD) is strongly associated with the adherence of Klebsiella pneumoniae. Besides, four polymorphic mrkD alleles: namely, mrkDv1, v2, v3, and v4, are typed by using RFLP. In order to investigate the relationship between the structure and the function for each of these variants, DNA fragments encoding the major fimbrial proteins mrkA, mrkB, mrkC are expressed together with any of the four mrkD adhesins in E. coli JM109. Our study shows that the E. coli strain carrying the mrkDv3 fimbriae has the strongest binding activity. This suggests that mrkDv3 is a key factor that enhances the adherence of Klebsiella Pneumoniae to human body.

  9. Chemical signature of magnetotactic bacteria

    PubMed Central

    Amor, Matthieu; Busigny, Vincent; Durand-Dubief, Mickaël; Tharaud, Mickaël; Ona-Nguema, Georges; Gélabert, Alexandre; Alphandéry, Edouard; Menguy, Nicolas; Benedetti, Marc F.; Chebbi, Imène; Guyot, François

    2015-01-01

    There are longstanding and ongoing controversies about the abiotic or biological origin of nanocrystals of magnetite. On Earth, magnetotactic bacteria perform biomineralization of intracellular magnetite nanoparticles under a controlled pathway. These bacteria are ubiquitous in modern natural environments. However, their identification in ancient geological material remains challenging. Together with physical and mineralogical properties, the chemical composition of magnetite was proposed as a promising tracer for bacterial magnetofossil identification, but this had never been explored quantitatively and systematically for many trace elements. Here, we determine the incorporation of 34 trace elements in magnetite in both cases of abiotic aqueous precipitation and of production by the magnetotactic bacterium Magnetospirillum magneticum strain AMB-1. We show that, in biomagnetite, most elements are at least 100 times less concentrated than in abiotic magnetite and we provide a quantitative pattern of this depletion. Furthermore, we propose a previously unidentified method based on strontium and calcium incorporation to identify magnetite produced by magnetotactic bacteria in the geological record. PMID:25624469

  10. Protein signaling via type III secretion pathways in phytopathogenic bacteria

    E-print Network

    109 Protein signaling via type III secretion pathways in phytopathogenic bacteria Mary Beth Mudgett secretion pathway has revealed new mechanisms by which phytopathogenic bacteria infect plants are continually exposed to a number of potentially pathogenic bacteria. Phytopathogenic bacteria, in general

  11. Decellularized human amniotic membrane: more is needed for an efficient dressing for protection of burns against antibiotic-resistant bacteria isolated from burn patients.

    PubMed

    Gholipourmalekabadi, M; Bandehpour, M; Mozafari, M; Hashemi, A; Ghanbarian, H; Sameni, M; Salimi, M; Gholami, M; Samadikuchaksaraei, A

    2015-11-01

    Human amniotic membranes (HAMs) have attracted the attention of burn surgeons for decades due to favorable properties such as their antibacterial activity and promising support of cell proliferation. On the other hand, as a major implication in the health of burn patients, the prevalence of bacteria resistant to multiple antibiotics is increasing due to overuse of antibiotics. The aim of this study was to investigate whether HAMs (both fresh and acellular) are an effective antibacterial agent against antibiotic-resistant bacteria isolated from burn patients. Therefore, a HAM was decellularized and tested for its antibacterial activity. Decellularization of the tissue was confirmed by hematoxylin and eosin (H&E) and 4,6-diamidino-2-phenylindole (DAPI) staining. In addition, the cyto-biocompatibility of the acellular HAM was proven by the cell viability test (3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide, MTT) and scanning electron microscopy (SEM). The resistant bacteria were isolated from burns, identified, and tested for their susceptibility to antibiotics using both the antibiogram and polymerase chain reaction (PCR) techniques. Among the isolated bacteria, three blaIMP gene-positive Pseudomonas aeruginosa strains were chosen for their high resistance to the tested antibiotics. The antibacterial activity of the HAM was also tested for Klebsiella pneumoniae (American Type Culture Collection (ATCC) 700603) as a resistant ATCC bacterium; Staphylococcus aureus (mecA positive); and three standard strains of ATCC bacteria including Escherichia coli (ATCC 25922), Pseudomonas aeruginosa (ATCC 27833), and S. aureus (ATCC 25923). Antibacterial assay revealed that only the latter three bacteria were susceptible to the HAM. All the data obtained from this study suggest that an alternative strategy is required to complement HAM grafting in order to fully protect burns from nosocomial infections. PMID:26048133

  12. Prevalence and Antibiotic Resistance of Gram-Negative Pathogenic Bacteria Species Isolated from Periplaneta americana and Blattella germanica in Varanasi, India

    PubMed Central

    Wannigama, D Leshan; Dwivedi, Rishabh; Zahraei-Ramazani, Alireza

    2014-01-01

    Background Cockroaches are among the medically important pests found within the human habitations that cause serious public health problems. They may harbor a number of pathogenic bacteria on the external surface with antibiotic resistance. Hence, they are regarded as major microbial vectors. This study investigates the prevalence and antibiotic resistance of Gram-negative pathogenic bacteria species isolated from Periplaneta americana and Blattella germanica in Varanasi, India. Methods: Totally, 203 adult cockroaches were collected form 44 households and 52 food-handling establishments by trapping. Bacteriological examination of external surfaces of Pe. americana and Bl. germanica were carried out using standard method and antibiotics susceptibility profiles of the isolates were determined using Kirby-Bauer disc diffusion methods. Results: Among the places, we found that 54% had cockroache infestation in households and 77% in food- handling establishments. There was no significant different between the overall bacteria load of the external surface in Pe. americana (64.04%) and Bl. germanica (35.96%). However the predominant bacteria on cockroaches were Klebsiella pneumonia, Escherichia coli, Enterobacter aerogenes, and Pseudomonas aeruginosa. However, Kl. pneumoniae and Ps. aeruginosa were the most prevalent, drug-resistant strains were isolated from the cockroaches with 100% resistance to sulfamethoxazole/trimethoprim and ampicillin. For individual strains of bacteria, Escherichia coli was found to have multi-resistance to four antibiotic tested, Citrobacter freundii four, Enterobacter aerogenes and Proteus mirabilis to three. Conclusion: Cockroaches are uniformly distributed in domestic environment, which can be a possible vector for transmission of drug-resistant bacteria and food-borne diseases. PMID:25629061

  13. Metastatic abscess formation in a preexisting chest wall tumor: a rare initial presentation of Klebsiella pneumoniae liver abscess.

    PubMed

    Chen, Y-C; Chiu, S-K; Lin, T-Y; Yang, Y; Yeh, K-M

    2013-10-01

    The common infectious agents in the chest wall include Mycobacterium tuberculosis, Actinomyces, fungi, Nocardia, Entamoeba histolytica, and other aerobes and anaerobes. Klebsiella pneumoniae is an uncommon etiological agent. We describe a case of ankylosing spondylitis in a 45-year-old man, who had exhibited a painless lump in the left posterior chest wall for 3 months and who presented with acute-onset pain, erythematous change, and fever in the 2 weeks before admission. Cultures of the blood and chest wall abscess both showed Gram-negative bacilli, which were classified as K. pneumoniae. A contrast-enhanced computed tomography scan of the abdomen revealed a nonenhancing cystic abscess measuring 4.9 × 6.5 × 6.4 cm in segment 6 of the liver and communicating with the chest wall. Drainage of the liver abscess under ultrasound guidance and open surgical drainage of the chest wall abscess combined with adequate antibiotic treatment resolved the abscess. PMID:23526295

  14. Phosphorylation and metabolism of sucrose and its five linkage-isomeric alpha-D-glucosyl-D-fructoses by Klebsiella pneumoniae.

    PubMed

    Thompson, J; Robrish, S A; Pikis, A; Brust, A; Lichtenthaler, F W

    2001-03-22

    Not only sucrose but the five isomeric alpha-D-glucosyl-D-fructoses trehalulose, turanose, maltulose, leucrose, and palatinose are utilized by Klebsiella pneumoniae as energy sources for growth, thereby undergoing phosphorylation by a phosphoenolpyruvate-dependent phosphotransferase system uniformly at 0-6 of the glucosyl moiety. Similarly, maltose, isomaltose, and maltitol, when exposed to these conditions, are phosphorylated regiospecifically at O-6 of their non-reducing glucose portion. The structures of these novel compounds have been established unequivocally by enzymatic analysis, acid hydrolysis, FAB negative-ion spectrometry, and 1H and 13C NMR spectroscopy. In cells of K. pneumoniae, hydrolysis of sucrose 6-phosphate is catalyzed by sucrose 6-phosphate hydrolase from Family 32 of the glycosylhydrolase superfamily. The five 6'-O-phosphorylated alpha-D-glucosyl-fructoses are hydrolyzed by an inducible (approximately 49-50 Kda) phospho-alpha-glucosidase from Family 4 of the glycosylhydrolase superfamily. PMID:11322729

  15. Klebsiella sp. FIRD 2, a TBT-resistant bacterium isolated from contaminated surface sediment along Strait of Johor Malaysia.

    PubMed

    Abubakar, Abdussamad; Mustafa, Muskhazli B; Johari, Wan Lutfi Wan; Zulkifli, Syaizwan Zahmir; Ismail, Ahmad; Mohamat-Yusuff, Ferdaus Binti

    2015-12-15

    A possible tributyltin (TBT)-degrading bacterium isolated from contaminated surface sediment was successfully identified as Klebsiella sp. FIRD 2. It was found to be the best isolate capable of resisting TBT at a concentration of 1000?gL(-1). This was a concentration above the reported contaminated level at the sampling station, 790?gL(-1). Further studies revealed that the isolate was Gram negative and resisted TBT concentrations of up to 1500?gL(-1) in a Minimal Salt Broth without the addition of any carbon source within the first 48h of incubation. It is expected that additional work could be conducted to check the degradation activity of this new isolate and possibly improve the degradation capacity in order to contribute to finding a safe and sustainable remediation solution of TBT contamination. PMID:26434791

  16. Clinical Features and Computed Tomography Characteristics of Non-Klebsiella pneumoniae Liver Abscesses in Elderly (>65 Years) and Nonelderly Patients

    PubMed Central

    Hsiang, Chih-Weim; Liu, Chang-Hsien; Fan, Hsiu-Lung; Ko, Kai-Hsiung; Yu, Chih-Yung; Wang, Hong-Hau; Liao, Wen-I; Hsu, Hsian-He

    2015-01-01

    Purpose To compare the clinical and computed tomography (CT) appearances of liver abscesses caused by non-Klebsiella pneumoniae bacterial pathogens in elderly and nonelderly patients. Materials and Methods Eighty patients with confirmed non-Klebsiella pneumoniae liver abscesses (non-KPLAs) were enrolled and divided into two age groups: elderly (age ?65 years, n=42) and nonelderly (age <65 years, n=38). Diagnosis of non-KPLA was established by pus and/or blood culture. We compared clinical presentations, outcomes, and CT characteristics of the two groups, and performed multivariate analysis for significant variables and receiver-operating-characteristic analysis to determine the cutoff value of abscess diameter for predicting non-KPLA. Results Elderly patients with non-KPLA were associated with a longer hospital stay (p<0.01). Regarding etiology, biliary sources had a strong association in the elderly group (p<0.01), and chronic liver diseases were related to the nonelderly group (p<0.01). Non-KPLAs (52.5%) tended to show a large, multiloculated appearance in the elderly group and were associated with bile duct dilatation (p<0.01), compared with the nonelderly group. The abscess diameter (cutoff value, 5.2 cm; area under the curve, 0.78) between the two groups was predicted. In multivariate analysis, underlying biliary tract disease [odds ratio (OR), 3.58, p<0.05], abscess diameter (OR, 2.40, p<0.05), and multiloculated abscess (OR, 1.19, p<0.01) independently predicted elderly patients with non-KPLA. Conclusion In the elderly patients with non-KPLA, a large, multiloculated abscess with a diameter greater than 5.2 cm was the predominant imaging feature. PMID:25684004

  17. Genomic Epidemiology of an Endoscope-Associated Outbreak of Klebsiella pneumoniae Carbapenemase (KPC)-Producing K. pneumoniae

    PubMed Central

    Marsh, Jane W.; Krauland, Mary G.; Nelson, Jemma S.; Schlackman, Jessica L.; Brooks, Anthony M.; Pasculle, A. William; Shutt, Kathleen A.; Doi, Yohei; Querry, Ashley M.; Muto, Carlene A.; Harrison, Lee H.

    2015-01-01

    Increased incidence of infections due to Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae (KPC-Kp) was noted among patients undergoing endoscopic retrograde cholangiopancreatography (ERCP) at a single hospital. An epidemiologic investigation identified KPC-Kp and non-KPC-producing, extended-spectrum ?-lactamase (ESBL)-producing Kp in cultures from 2 endoscopes. Genotyping was performed on patient and endoscope isolates to characterize the microbial genomics of the outbreak. Genetic similarity of 51 Kp isolates from 37 patients and 3 endoscopes was assessed by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Five patient and 2 endoscope isolates underwent whole genome sequencing (WGS). Two KPC-encoding plasmids were characterized by single molecule, real-time sequencing. Plasmid diversity was assessed by endonuclease digestion. Genomic and epidemiologic data were used in conjunction to investigate the outbreak source. Two clusters of Kp patient isolates were genetically related to endoscope isolates by PFGE. A subset of patient isolates were collected post-ERCP, suggesting ERCP endoscopes as a possible source. A phylogeny of 7 Kp genomes from patient and endoscope isolates supported ERCP as a potential source of transmission. Differences in gene content defined 5 ST258 subclades and identified 2 of the subclades as outbreak-associated. A novel KPC-encoding plasmid, pKp28 helped define and track one endoscope-associated ST258 subclade. WGS demonstrated high genetic relatedness of patient and ERCP endoscope isolates suggesting ERCP-associated transmission of ST258 KPC-Kp. Gene and plasmid content discriminated the outbreak from endemic ST258 populations and assisted with the molecular epidemiologic investigation of an extended KPC-Kp outbreak. PMID:26637170

  18. Impact of pH on bacterial growth and activity of recent fluoroquinolones in pooled urine.

    PubMed

    Erdogan-Yildirim, Zeynep; Burian, Angela; Manafi, Mohammad; Zeitlinger, Markus

    2011-04-01

    Acidification of urine is widely recommended for prevention and treatment of urinary tract infections. We set out to describe the effect of modification of pH on bacterial growth of relevant bacteria as well as on activity of modern fluoroquinolones in urine in vitro. Bacterial growth of Escherichia coli ATCC 25922 and Klebsiella oxytoca ATCC 700324 was determined in pooled human urine adjusted to pH levels between 5.0 and 8.0. Minimal inhibitory concentrations (MICs) and time-kill curves were performed for ciprofloxacin, levofloxacin and moxifloxacin in pH-adjusted urine and Mueller-Hinton Broth (MHB). Uptake of radioactive labeled [C(14)]-ciprofloxacin into bacterial cells was investigated at different pHs. While no difference in bacterial growth of E. coli and K. oxytoca was observed at pH values between 5.0 and 8.0, acidification of urine led to major impairment of antimicrobial activity of all tested fluoroquinolones, indicated by an up to 40-fold increase in MIC compared to MHB and nearly total neutralization of activity in time-kill experiments. The most probable mechanism behind this observation may have been reduced uptake of fluoroquinolones into bacterial cells, as indicated by bacterial uptake of [C(14)]-ciprofloxacin and a reversibility of the effect. The observed reduction in activity of modern fluoroquinolones confirms previous observations from older compounds. PMID:21288486

  19. Cloning of cellobiose phosphoenolpyruvate-dependent phosphotransferase genes: functional expression in recombinant Escherichia coli and identification of a putative binding region for disaccharides.

    PubMed Central

    Lai, X; Davis, F C; Hespell, R B; Ingram, L O

    1997-01-01

    Genomic libraries from nine cellobiose-metabolizing bacteria were screened for cellobiose utilization. Positive clones were recovered from six libraries, all of which encode phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS) proteins. Clones from Bacillus subtilis, Butyrivibrio fibrisolvens, and Klebsiella oxytoca allowed the growth of recombinant Escherichia coli in cellobiose-M9 minimal medium. The K. oxytoca clone, pLOI1906, exhibited an unusually broad substrate range (cellobiose, arbutin, salicin, and methylumbelliferyl derivatives of glucose, cellobiose, mannose, and xylose) and was sequenced. The insert in this plasmid encoded the carboxy-terminal region of a putative regulatory protein, cellobiose permease (single polypeptide), and phospho-beta-glucosidase, which appear to form an operon (casRAB). Subclones allowed both casA and casB to be expressed independently, as evidenced by in vitro complementation. An analysis of the translated sequences from the EIIC domains of cellobiose, aryl-beta-glucoside, and other disaccharide permeases allowed the identification of a 50-amino-acid conserved region. A disaccharide consensus sequence is proposed for the most conserved segment (13 amino acids), which may represent part of the EIIC active site for binding and phosphorylation. PMID:9023916

  20. Cloning of cellobiose phosphoenolpyruvate-dependent phosphotransferase genes: Functional expression in recombinant Escherichia coli and identification of a putative binding region for disaccharides

    SciTech Connect

    Lai, Xiaokuang; Davis, F.C.; Ingram, L.O.; Hespell, R.B.

    1997-02-01

    Genomic libraries from nine cellobiose-metabolizing bacteria were screened for cellobiose utilization. Positive clones were recovered from six libraries, all of which encode phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS) proteins. Clones from Bacillus subtilis, Butyrivibrio fibrisolvens, and Klebsiella oxytoca allowed the growth of recombinant Escherichia coli in cellobiose-M9 minimal medium. The K. oxytoca clone, pLOI1906, exhibited an unusually broad substrate range (cellobiose, arbutin, salicin, and methylumbelliferyl derivatives of glucose, cellobiose, mannose, and xylose) and was sequenced. The insert in this plasmid encoded the carboxy-terminal region of a putative regulatory protein, cellobiose permease (single polypeptide), and phospho-{beta}-glucosidase, which appear to form an operon (casRAB). Subclones allowed both casA and casB to be expressed independently, as evidenced by in vitro complementation. An analysis of the translated sequences from the EIIC domains of cellobiose, aryl-{beta}-glucoside, and other disaccharide permeases allowed the identification of a 50-amino-acid conserved region. A disaccharide consensus sequence is proposed for the most conserved segment (13 amino acids), which may represent part of the EIIC active site for binding and phosphorylation. 63 refs., 4 figs., 4 tabs.

  1. Dissemination of carbapenemases producing Gram negative bacteria in the Middle East

    PubMed Central

    Zahedi bialvaei, Abed; Samadi kafil, Hossein; Ebrahimzadeh Leylabadlo, Hamed; Asgharzadeh, Mohammad; Aghazadeh, Mohammad

    2015-01-01

    The emergence and spread of carbapenemase-producing bacteria, that hydolyze most ?-lactams, including carbapenems, are a major concern of public health system worldwide, particularly in the Middle East area. Since the plasmids harboring resistance genes could be spread across other bacterial populations, detection of carbapenemase-producing organisms has become more problematic. These organisms produce different types of enzymes including the most prevalent types including KPC, VIM, IMP, NDM, and OXA-48. Carbapenemase producers are mostly identified among Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa and Acinetobacter baumannii. This study reviewed almost all papers, which conducted in the Middle East. In order to decrease the spread of resistance, the regional cooperation has been emphasized by the Middle East countries. The highest resistance, which is mediated by KPC has been observed in Afghanistan, Saudi Arabia and Jordan followed by NDM in Pakistan and OXA in Turkey and Pakistan. It is important to mention that the spread of these types have been reported sporadically in the other countries of this area. This review described the widespread carbapenemases in the Middle East area, which have been identified in an alarming rate. PMID:26719779

  2. Bacteria as bullies: effects of linguistic agency assignment in health message.

    PubMed

    Bell, Robert A; McGlone, Matthew S; Dragojevic, Marko

    2014-01-01

    When describing health threats, communicators can assign agency to the threat (e.g., "Hepatitis C has infected 4 million Americans") or to humans (e.g., "Four million Americans have contracted hepatitis C"). In an online experiment, the authors explored how assignment of agency affects perceptions of susceptibility and severity of a health threat, response efficacy, self-efficacy, fear arousal, and intentions to adopt health-protective recommendations. Participants were 719 individuals recruited through Mechanical Turk ( www.mturk.com ), a crowdsource labor market run by Amazon ( www.amazon.com ). The participants were assigned randomly to read 1 of 8 flyers defined by a 2×4 (Agency Assignment×Topic) factorial design. Each flyer examined 1 health threat (E. coli, necrotizing fasciitis, salmonella, or Carbapenem-resistant Klebsiella pneumoniae) and was written in language that emphasized bacterial or human agency. Perceived susceptibility and severity were highest when bacterial agency language was used. Response efficacy, self-efficacy, and fear arousal were not significantly affected by agency assignment. Participants reported stronger intentions to adopt recommendations when bacteria agency language was used, but this effect did not reach conventional standards of significance (p < .051). The authors concluded that health communicators can increase target audiences' perceptions of susceptibility and severity by assigning agency to the threat in question when devising health messages. PMID:24015807

  3. Antimicrobial resistant bacteria among health care workers in intensive care units at Ain Shams University Hospitals.

    PubMed

    Abdel Rahman, Amany Th; Hafez, Shereen F; Abdelhakam, Sara M; Ali-Eldin, Zainab A; Esmat, Ibrahim M E Abd El-Hamid; Elsayed, Marwa S; Aboul-Fotouh, Aisha

    2010-04-01

    Fifty HCWs in ICUs of Internal medicine, Chest, Neonatology and Burn were included in prospective cohort study. Collection of nasal, hand and rectal swabs, proper biochemical identification, culture media and antibiotic sensitivity tests were used to detect Methicillin-resistant Staphylococcus aureus (MRSA); vancomycin-resistant Enterococci (VRE) & extended spectrum beta-lactamase producing gram -ve bacilli (ESBLs). S. aureus was isolated from 34% of HCWs; 28% were nasal carriers, 4% were hand carriers and 2% had S. aureus at both sites. Nasal and hand carriage rates of MRSA were 20% & 4% respectively, with an overall rate of 22%. Gram -ve bacilli were isolated from 8% of HCWs hand swabs & showed Citrobacter koseri, Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa. Hand carriage rate of ESBLs was 2%. Hand contamination with gram -ve bacilli and S. aureus was in 14% of HCWs. VRE carriage rate was 9.5%. ESBLs carriage rate in rectal swabs was 21.43%. K. pneumoniae was the most common ESBLs producing isolate (33.3%), followed by E. coli (18.75%). In combined disc method, aztreonam was the most sensitive (90%) in detecting ESBLs. Burn ICU had highest % of MRSA & ESBLs carriage. Neonatal ICU showed highest % of VRE carriage. An insignificant association was between infection control training or antimicrobial intake and carriage of antimicrobial resistant bacteria. PMID:20503587

  4. Incidence of bacteria of public health interest carried by cockroaches in different food-related environments.

    PubMed

    García, F; Notario, M J; Cabanás, J M; Jordano, R; Medina, L M

    2012-11-01

    The aim of this study was to determine the incidence of bacteria of public health interest transmitted by cockroaches in different food-related environments. From April to November, cockroaches were trapped in 11 buildings in different urban areas of Western Andalusia (Spain): three hotels, four grocery stores, a catering establishment, a food-industry plant, a health center, and a care home. The presence of a number of bacterial species, including Salmonella, in these food-related environments was confirmed; these species included microorganisms listed in European Union regulations, such as Salmonella spp., Enterobacter sakazakii (Cronobacter spp.), and Escherichia coli. A wide variety of species were isolated, some belonging to different genera that have a significant impact on public health and hygiene, such as Enterobacter and Klebsiella. To ensure adequate elimination of these microorganisms in food-related environments, the control of vectors such as Blattella germanica, Periplaneta americana, and Blatta orientalis, together with a thorough review of hygiene strategies, appears to be fundamental. It is clearly essential to compare the results of hygiene regulations implemented in food-related environments. PMID:23270179

  5. Genetic characterization of caffeine degradation by bacteria and its potential applications

    PubMed Central

    Summers, Ryan M; Mohanty, Sujit K; Gopishetty, Sridhar; Subramanian, Mani

    2015-01-01

    The ability of bacteria to grow on caffeine as sole carbon and nitrogen source has been known for over 40 years. Extensive research into this subject has revealed two distinct pathways, N-demethylation and C-8 oxidation, for bacterial caffeine degradation. However, the enzymological and genetic basis for bacterial caffeine degradation has only recently been discovered. This review article discusses the recent discoveries of the genes responsible for both N-demethylation and C-8 oxidation. All of the genes for the N-demethylation pathway, encoding enzymes in the Rieske oxygenase family, reside on 13.2-kb genomic DNA fragment found in Pseudomonas putida?CBB5. A nearly identical DNA fragment, with homologous genes in similar orientation, is found in Pseudomonas sp. CES. Similarly, genes for C-8 oxidation of caffeine have been located on a 25.2-kb genomic DNA fragment of Pseudomonas sp. CBB1. The C-8 oxidation genes encode enzymes similar to those found in the uric acid metabolic pathway of Klebsiella pneumoniae. Various biotechnological applications of these genes responsible for bacterial caffeine degradation, including bio-decaffeination, remediation of caffeine-contaminated environments, production of chemical and fuels and development of diagnostic tests have also been demonstrated. PMID:25678373

  6. Rosmarinic Acid from Eelgrass Shows Nematicidal and Antibacterial Activities against Pine Wood Nematode and Its Carrying Bacteria

    PubMed Central

    Wang, Jingyu; Pan, Xueru; Han, Yi; Guo, Daosen; Guo, Qunqun; Li, Ronggui

    2012-01-01

    Pine wilt disease (PWD), a destructive disease for pine trees, is caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus and additional bacteria. In this study, extracts of Zostera marina showed a high nematicidal activity against PWN and some of the bacteria that it carries. Light yellow crystals were obtained from extracts of Z. marina through solvent extraction, followed by chromatography on AB-8 resin and crystallization. The NMR and HPLC analysis showed that the isolated compound was rosmarinic acid (RosA). RosA showed effective nematicidal activity, of which the LC50 (50% lethal concentration) to PWN at 24 h, 48 h and 72 h was 1.18 mg/g, 1.05 mg/g and 0.95 mg/g, respectively. To get a high yield rate of RosA from Z. marina, single factor experiments and an L9 (34) orthogonal experiment were performed. This extraction process involved 70% ethanol for 3 h at 40 °C. The extraction dosage was 1:50 (w/v). The highest yield of RosA from Zostera was 3.13 mg/g DW (dried weight). The crude extracts of Zostera marina (10 mg/mL) and RosA (1 mg/mL) also showed inhibitory effects to some bacterial strains carried by PWN: Klebsiella sp., Stenotrophomonas maltophilia, Streptomyces sp. and Pantoea agglomerans. The results of these studies provide clues for preparing pesticide to control PWD from Z. marina. PMID:23201594

  7. Isolation and Identification of Endosulfan-Degrading Bacteria and Evaluation of Their Bioremediation in Kor River, Iran

    PubMed Central

    Kafilzadeh, Farshid; Ebrahimnezhad, Moslem; Tahery, Yaghoob

    2014-01-01

    Objectives Endosulfan is a lipophilic insecticide, which causes severe health issues due to its environmental stability, toxicity, and biological reservation in organisms. It is found in the atmosphere, soil, sediments, surface waters, rain, and food in almost equal proportions. The aim of this study was to isolate and identify endosulfan-degrading bacteria from the Kor River and evaluate the possibility of applying bioremediation in reducing environmental pollution in the desired region. Methods Samples of surface sediments and water were collected from three different stations in two seasons (summer and autumn), as these are areas with high agricultural activity. Isolated bacteria were identified by various biochemical tests and morphological characteristics. The amounts of degradation of endosulfan isomers and metabolites produced as a result of biodegradation were then analyzed using gas chromatography/mass spectrometry. Results In this study, the following five bacterial genera were able to degrade endosulfan: Klebsiella, Acinetobacter, Alcaligenes, Flavobacterium, and Bacillus. During biodegradation, metabolites of endosulfan diol, endosulfan lactone, and endosulfan ether were also produced, but these had lesser toxicity compared with the original compound (i.e., endosulfan). Conclusion The five genera isolated can be used as a biocatalyst for bioremediation of endosulfan. PMID:25737830

  8. Isolation and characterization of lipase-producing bacteria in the intestine of the silkworm, Bombyx mori, reared on different forage.

    PubMed

    Feng, Wei; Wang, Xiao-Qiang; Zhou, Wei; Liu, Guang-Ying; Wan, Yong-Ji

    2011-01-01

    The silkworm, Bombyx mori L. (Lepidoptera: Bombycidae), an oligophagous insect that mainly feeds on mulberry leaves, is susceptible to entomopathogen infection when reared with tricuspid cudrania leaves. A total of 56 dominant bacterial strains, classified into 12 phylotypes based on bacteriological properties and analysis of 16S rRNA genes, were isolated from the intestine of the fourth and fifth instar silkworm larvae. Ten and seven phylotypes exist in the intestine of the silkworm larvae reared with mulberry leaves and tricuspid cudrania leaves, respectively. Four of them are common in the intestine of the two treatment groups. By screening their lipolytic ability on a Rhodamine B agar plate, nine lipase-producing bacterial strains were obtained and classified into six genera, including Bacillus, Brevibacterium, Corynebacterium, Staphylococcus, Klebsiella, and Stenotrophomonas. Except for Stenotrophomonas, which is common in both, the other genera only exist in the intestine of the silkworm larvae fed with mulberry leaves. In addition, by culture and fermentation in vitro, the maximum cell density and lipase activity of lipase-producing bacteria were examined at about 48 hours. The results indicate that diet has a significant impact on the gut bacterial community, especially lipase-producing bacteria. We suggest that the difference of lipase-producing bacterial diversity might be related to disease resistance of the silkworm. PMID:22243438

  9. Antibiotic Susceptibility Profile of Bacteria Isolated from Natural Sources of Water from Rural Areas of East Sikkim

    PubMed Central

    Poonia, Shubra; Singh, T. Shantikumar; Tsering, Dechen C.

    2014-01-01

    Background: Contamination of water, food, and environment with antibiotic-resistant bacteria poses a serious public health issue. Objective: The objective was to study the bacterial pollution of the natural sources of water in east Sikkim and to determine the antimicrobial profile of the bacterial isolates. Materials and Methods: A total of 225 samples, 75 each during winter, summer, and monsoon season were collected from the same source in every season for bacteriological analysis by membrane filtration method. Antibiotic susceptibility test was performed using standard disc diffusion method. Results: A total of 19 bacterial species of the genera Escherichia, Klebsiella, Proteus, Salmonella, Shigella, Enterobacter, Citrobacter, Morganella, Pseudomonas, Acinetobacter, Flavobacterium, and Serratia were isolated and their antimicrobial sensitivity tested. Generally, most bacterial isolates except Salmonella and Shigella species were found resistant to commonly used antibiotics such as ampicillin (57.5%), trimethoprim/sulfamethoxaole (39.1%), amoxicillin/clavulanic acid (37.4%), cefixime (34.5%), tetracycline (29.1%), ceftazidime (26.3%), ofloxacin (25.9%), amikacin (8.7%), and gentamicin (2.7%) but sensitive to imipenem and piperacillin/tazobactam. Conclusion: Natural sources of water in east Sikkim are grossly contaminated with bacteria including enteropathogens. The consumption of untreated water from these sources might pose health risk to consumers. PMID:25136156

  10. Multi-bacteria multi-antibiotic testing using surface enhanced Raman spectroscopy (SERS) for urinary tract infection (UTI) diagnosis

    NASA Astrophysics Data System (ADS)

    Hadjigeorgiou, Katerina; Kastanos, Evdokia; Pitris, Costas

    2013-06-01

    The inappropriate use of antibiotics leads to antibiotic resistance, which is a major health care problem. The current method for determination of bacterial susceptibility to antibiotics requires overnight cultures. However most of the infections cannot wait for the results to receive treatment, so physicians administer general spectrum antibiotics. This results in ineffective treatments and aggravates the rising problem of antibiotic resistance. In this work, a rapid method for diagnosis and antibiogram for a bacterial infection was developed using Surface Enhanced Raman Spectroscopy (SERS) with silver nanoparticles. The advantages of this novel method include its rapidness and efficiency which will potentially allow doctors to prescribe the most appropriate antibiotic for an infection. SERS spectra of three species of gram negative bacteria, Escherichia coli, Proteus spp., and Klebsiella spp. were obtained after 0 and 4 hour exposure to the seven different antibiotics. Bacterial strains were diluted in order to reach the concentration of (2x105 cfu/ml), cells/ml which is equivalent to the minimum concentration found in urine samples from UTIs. Even though the concentration of bacteria was low, species classification was achieved with 94% accuracy using spectra obtained at 0 hours. Sensitivity or resistance to antibiotics was predicted with 81%-100% accuracy from spectra obtained after 4 hours of exposure to the different antibiotics. This technique can be applied directly to urine samples, and with the enhancement provided by SERS, this method has the potential to be developed into a rapid method for same day UTI diagnosis and antibiogram.

  11. Gorilla gorilla gorilla gut: a potential reservoir of pathogenic bacteria as revealed using culturomics and molecular tools

    PubMed Central

    Bittar, Fadi; Keita, Mamadou B.; Lagier, Jean-Christophe; Peeters, Martine; Delaporte, Eric; Raoult, Didier

    2014-01-01

    Wild apes are considered to be the most serious reservoir and source of zoonoses. However, little data are available about the gut microbiota and pathogenic bacteria in gorillas. For this propose, a total of 48 fecal samples obtained from 21 Gorilla gorilla gorilla individuals (as revealed via microsatellite analysis) were screened for human bacterial pathogens using culturomics and molecular techniques. By applying culturomics to one index gorilla and using specific media supplemented by plants, we tested 12,800 colonies and identified 147 different bacterial species, including 5 new species. Many opportunistic pathogens were isolated, including 8 frequently associated with human diseases; Mycobacterium bolletii, Proteus mirabilis, Acinetobacter baumannii, Klebsiella pneumoniae, Serratia marcescens, Escherichia coli, Staphylococcus aureus and Clostridium botulinum. The genus Treponema accounted for 27.4% of the total reads identified at the genus level via 454 pyrosequencing. Using specific real-time PCR on 48 gorilla fecal samples, in addition to classical human pathogens, we also observed the fastidious bacteria Bartonella spp. Borrelia spp., Coxiella burnetii and Tropheryma whipplei in the gorilla population. We estimated that the prevalence of these pathogens vary between 4.76% and 85.7%. Therefore, gorillas share many bacterial pathogens with humans suggesting that they could be a reservoir for their emergence. PMID:25417711

  12. Rosmarinic acid from eelgrass shows nematicidal and antibacterial activities against pine wood nematode and its carrying bacteria.

    PubMed

    Wang, Jingyu; Pan, Xueru; Han, Yi; Guo, Daosen; Guo, Qunqun; Li, Ronggui

    2012-12-01

    Pine wilt disease (PWD), a destructive disease for pine trees, is caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus and additional bacteria. In this study, extracts of Zostera marina showed a high nematicidal activity against PWN and some of the bacteria that it carries. Light yellow crystals were obtained from extracts of Z. marina through solvent extraction, followed by chromatography on AB-8 resin and crystallization. The NMR and HPLC analysis showed that the isolated compound was rosmarinic acid (RosA). RosA showed effective nematicidal activity, of which the LC?? (50% lethal concentration) to PWN at 24 h, 48 h and 72 h was 1.18 mg/g, 1.05 mg/g and 0.95 mg/g, respectively. To get a high yield rate of RosA from Z. marina, single factor experiments and an L? (3?) orthogonal experiment were performed. This extraction process involved 70% ethanol for 3 h at 40 °C. The extraction dosage was 1:50 (w/v). The highest yield of RosA from Zostera was 3.13 mg/g DW (dried weight). The crude extracts of Zostera marina (10 mg/mL) and RosA (1 mg/mL) also showed inhibitory effects to some bacterial strains carried by PWN: Klebsiella sp., Stenotrophomonas maltophilia, Streptomyces sp. and Pantoea agglomerans. The results of these studies provide clues for preparing pesticide to control PWD from Z. marina. PMID:23201594

  13. Inactivation of Gram-Negative Bacteria by Low-Pressure RF Remote Plasma Excited in N2-O2 Mixture and SF6 Gases

    PubMed Central

    Al-Mariri, Ayman; Saloum, Saker; Mrad, Omar; Swied, Ghayath; Alkhaled, Bashar

    2013-01-01

    The role of low-pressure RF plasma in the inactivation of Escherichia coli O157, Klebsiella pneumoniae, Proteus mirabilis, and Enterobacter sakazakii using N2-O2 and SF6 gases was assessed. 1×109 colony-forming units (CFUs) of each bacterial isolate were placed on three polymer foils. The effects of pressure, power, distance from the source, and exposure time to plasma gases were optimized. The best conditions to inactivate the four bacteria were a 91%N2-9%O2 mixture and a 30-minute exposure time. SF6 gas was more efficient for all the tested isolates in as much as the treatment time was reduced to only three minutes. Therefore, low-pressure plasma could be used to sterilize heat and/or moisture-sensitive medical instruments. PMID:24293788

  14. Immunological investigation of the distribution of cytochromes related to the two terminal oxidases of Escherichia coli in other gram-negative bacteria.

    PubMed

    Kranz, R G; Gennis, R B

    1985-02-01

    Monospecific antibodies were raised against the two terminal oxidase complexes of the aerobic respiratory chain of Escherichia coli. These are the cytochrome d and cytochrome o complexes. The antibodies were used to check for the occurrence of cross-reactive antigens in membrane preparations from a variety of gram-negative bacteria by rocket immunoelectrophoresis and immunoblotting techniques. With these criteria, proteins closely related to the cytochrome d complex of E. coli appeared to be widely distributed. Among the strains containing cytochrome d-related material were Serratia marcescens, Photobacterium phosphoreum, Salmonella typhimurium, Klebsiella pneumoniae, and Azotobacter vinelandii. The data suggest that the d-type terminal oxidase in many of these strains is associated in a complex with b-type and a1-type cytochromes, as has been found to be the case in E. coli. K. pneumoniae and S. typhimurium were also shown to have material cross-reactive to the E. coli cytochrome o complex. PMID:2981822

  15. Bacteria detection instrument and method

    NASA Technical Reports Server (NTRS)

    Renner, W.; Fealey, R. D. (inventors)

    1972-01-01

    A method and apparatus for screening a sample fluid for bacterial presence are disclosed wherein the fluid sample is mixed with culture media of sufficient quantity to permit bacterial growth in order to obtain a test solution. The concentration of oxygen dissolved in the test solution is then monitored using the potential difference between a reference electrode and a noble metal electrode which are in contact with the test solution. The change in oxygen concentration which occurs during a period of time as indicated by the electrode potential difference is compared with a detection criterion which exceeds the change which would occur absent bacteria.

  16. Genetics of acidophilic, heterotrophic bacteria

    SciTech Connect

    Ward, T.E.; Bruhn, D.F.; Watkins, C.S.; Rowland, M.L.; Bulmer, D.K.; Winston, V.

    1988-01-01

    The genetic characteristics of members of the genus Acidiphilium are poorly understood. As part of our study of the genetics of these bacteria, a search was made for an inducible, lysogenic bacteriophage. Such a bacteriophage has been discovered. Several properties of the phage have been investigated. The phage has a lambdoid morphology and is somewhat larger than lambda. A variety of factors which affect phage stability have been investigated. The bacteriophage infects several of the strains that have been tested. Study of this bacteriophage should greatly increase our understanding of genetic mechanisms in Acidiphilium. 23 refs., 3 figs., 1 tab.

  17. Turning Bacteria Suspensions into Superfluids

    NASA Astrophysics Data System (ADS)

    López, Héctor Matías; Gachelin, Jérémie; Douarche, Carine; Auradou, Harold; Clément, Eric

    2015-07-01

    The rheological response under simple shear of an active suspension of Escherichia coli is determined in a large range of shear rates and concentrations. The effective viscosity and the time scales characterizing the bacterial organization under shear are obtained. In the dilute regime, we bring evidence for a low-shear Newtonian plateau characterized by a shear viscosity decreasing with concentration. In the semidilute regime, for particularly active bacteria, the suspension displays a "superfluidlike" transition where the viscous resistance to shear vanishes, thus showing that, macroscopically, the activity of pusher swimmers organized by shear is able to fully overcome the dissipative effects due to viscous loss.

  18. Bacteria and vampirism in cinema.

    PubMed

    Castel, O; Bourry, A; Thévenot, S; Burucoa, C

    2013-09-01

    A vampire is a non-dead and non-alive chimerical creature, which, according to various folklores and popular superstitions, feeds on blood of the living to draw vital force. Vampires do not reproduce by copulation, but by bite. Vampirism is thus similar to a contagious disease contracted by intravascular inoculation with a suspected microbial origin. In several vampire films, two real bacteria were staged, better integrated than others in popular imagination: Yersinia pestis and Treponema pallidum. Bacillus vampiris was created for science-fiction. These films are attempts to better define humans through one of their greatest fears: infectious disease. PMID:23916557

  19. Molecular characteristics of carbapenem-resistant gram-negative bacteria in southern China.

    PubMed

    Zheng, Fen; Sun, Jingjing; Cheng, Cancan; Rui, Yongyu

    2015-04-01

    A total of 368 nonreplicate gram-negative bacteria with resistance to imipenem or meropenem were collected to search for carbapenemase genes, class 1 integrons, and insertion sequence with common region 1 (ISCR1). The carbapenemase genes blaIMP-4, blaKPC-2, and blaNDM-1 were found in two Enterobacteriaceae and seven Pseudomonas aeruginosa isolates, nine Klebsiella pneumoniae isolates, and seven Enterobacteriaceae and two Acinetobacter spp. isolates. The class D OXA-type carbapenemase genes blaOXA-23-like, blaOXA-24-like, blaOXA-58, and blaOXA-51-like were detected in 59 (34.9%), 2 (1.2%), 16 (9.5%), and 126 (74.6%) Acinetobacter strains. This is the first description of blaNDM-1 in Enterobacter hormaechei and Acinetobacter genomic species 13TU. Of the integrase-positive strains, 135 (90.0%) Acinetobacter spp., 22 (61.1%) P. aeruginosa, and 14 (100%) Enterobacteriaceae isolates were identified by five, ten, and four different gene cassette arrays, respectively. Three novel gene cassette arrays aadB-aadA1, dfrA25, and dfrA16-aadA2 were reported for the first time in some species. Of the ISCR1-positive strains, the nonfermentative strains (102 Acinetobacter spp. and 13 P. aeruginosa. isolates) contained the same arrangement blaPER-1-putative glutathione-S-transferase-novel type ABC transporter, and three Enterobacteriaceae isolates harbored three different arrangements. Four distinct complex class 1 integron structures were observed. The complex class 1 integron detected in New Delhi, metallo-?-lactamase (NDM-1)-producing E. hormaechei, was found to coexist in the NDM-1-carrying plasmid. Our results suggested that we should pay more attention to the strict implementation of infection control measures and active antibiotic resistance surveillance to avoid the rapid spread or outbreak of carbapenemase-producing gram-negative bacteria. PMID:25469995

  20. M2b Monocytes Provoke Bacterial Pneumonia and Gut Bacteria-Associated Sepsis in Alcoholics.

    PubMed

    Tsuchimoto, Yusuke; Asai, Akira; Tsuda, Yasuhiro; Ito, Ichiaki; Nishiguchi, Tomoki; Garcia, Melanie C; Suzuki, Sumihiro; Kobayashi, Makiko; Higuchi, Kazuhide; Suzuki, Fujio

    2015-12-01

    Chronic alcohol consumption markedly impairs host antibacterial defense against opportunistic infections. ?-irradiated NOD-SCID IL-2R?(null) mice inoculated with nonalcoholic PBMCs (control PBMC chimeras) resisted Klebsiella pneumonia and gut bacteria-associated sepsis, whereas the chimeras created with alcoholic PBMCs (alcoholic PBMC chimeras) were very susceptible to these infections. M1 monocytes (IL-12(+)IL-10(-)CD163(-)CD14(+) cells), major effector cells in antibacterial innate immunity, were not induced by a bacterial Ag in alcoholic PBMC cultures, and M2b monocytes (CCL1(+)CD163(+)CD14(+) cells), which predominated in alcoholic PBMCs, were shown to be inhibitor cells on the Ag-stimulated monocyte conversion from quiescent monocytes to M1 monocytes. CCL1, which functions to maintain M2b macrophage properties, was produced by M2b monocytes isolated from alcoholic PBMCs. These M2b monocytes reverted to quiescent monocytes (IL-12(-)IL-10(-)CCL1(-)CD163(-)CD14(+) cells) in cultures supplemented with CCL1 antisense oligodeoxynucleotide, and the subsequent quiescent monocytes easily converted to M1 monocytes under bacterial Ag stimulation. Alcoholic PBMC chimeras treated with CCL1 antisense oligodeoxynucleotide were resistant against pulmonary infection by K. pneumoniae and sepsis stemming from enterococcal translocation. These results indicate that a majority of monocytes polarize to an M2b phenotype in association with alcohol abuse, and this polarization contributes to the increased susceptibility of alcoholics to gut and lung infections. Bacterial pneumonia and gut bacteria-associated sepsis, frequently seen in alcoholics, can be controlled through the polarization of macrophage phenotypes. PMID:26525287

  1. Exposure to airborne Gram-negative bacteria, dust and endotoxin in paper factories.

    PubMed

    Prazmo, Zofia; Dutkiewicz, Jacek; Skórska, Czes?awa; Sitkowska, Jolanta; Cholewa, Grazyna

    2003-01-01

    Air samples for determination of the concentration of Gram-negative bacteria, dust and endotoxin were collected at 10 sites in 2 large pulp and paper mills (paper factories) located in northern Poland, of which one (plant "A") was an older type facility while the other (plant "B") was a modern, fully automated factory with an effective ventilatory system. In both factories paper was produced from wood chips derived mostly from Scots pine. The concentrations of Gram-negative bacteria in the air of examined factories were within a range of 11.0-310.0 cfu/m(3), being greatest in the old type factory "A" at the initial stages of production cycle comprising handling of chips and pulp production. The mean value for these sites (246.9 cfu/m(3)) was significantly greater (t-test, p < 0.01) compared to final stages of paper production in the same factory (mean 32.1 cfu/m(3)) and to corresponding stages of chip handling in the modern "B" factory (mean 94.4 cfu/m(3)). The values of the respirable fraction of airborne Gram-negative flora were at most sites within a range of 40.0-56.9%. The species of the family Enterobacteriaceacae, mostly belonging to the genera Enterobacter, Pantoea, Rahnella and Klebsiella, distinctly prevailed in the air of the examined factories. Altogether, 19 species or genera of Gram-negative bacteria were identified in the collected air samples, out of these 9 were reported as having allergenic, immunotoxic and/or infectious properties. The concentration of dust in the air of paper factories ranged from 0.13-3.9 mg/m(3) and never exceeded the safe level. The concentration of bacterial endotoxin in the air of paper factories varied within a fairly wide range of 0.0042-2.5 micro g/m(3). At 4 sites associated with initial chip handling and pulp production large concentrations of airborne endotoxin between 0.2-2.5 micro g/m(3) were found, significantly exceeding suggested safe levels. In conclusion, despite Gram-negative bacteria occur in the air of paper mills in relatively low concentrations which never exceeded the value of 1,000 cfu/m(3) proposed as safe level, they may exert adverse effects on exposed workers, as evidenced by high concentrations of airborne endotoxin and the presence of numerous potentially pathogenic species. Thus, these microorganisms pose a potential risk of respiratory disease for the workers of pulp and paper mills, in particular for those engaged in handling of wood chips and production of pulp. PMID:12852739

  2. Genetic manipulation of acidophilic bacteria

    SciTech Connect

    Ward, T.E.; Rowland, M.L.; Glenn, A.W.; Watkins, C.S.; Bruhn, D.F.; Bulmer, D.; Roberto, F.F.

    1989-01-01

    Thiobacillus ferrooxidans is important in leaching of metals from mineral ores and in the removal of pyritic sulfur from coal. It is also intimately involved in production of acid mine drainage. Other acidophilic bacteria, including members of the genus Acidiphilium, are usually present in the same environments as T. ferrooxidans, and there is evidence to suggest that these acidophilic heterotrophs may increase the rate of T. ferrooxidans' attack on inorganic sulfides. Our laboratory is studying the genetic characteristics of these acidophilic bacteria and developing techniques for introducing desirable genes into them. Several endogenous plasmids from Acidiphilium strains have been cloned into E. coli vectors. Some of the resulting plasmids are able to confer antibiotic resistance to Acidiphilium after transformation by electroporation. In addition, a broad-host range plasmid conferring resistance to tetracycline has been introduced into Acidiphilium strains by electroporation. This same plasmid, has also been transferred to Acidiphilium from E. coli directly by conjugation. A temperate bacteriophage which infects a number of Acidiphilium isolates has been discovered and partially characterized. It has a lambdoid morphology and a genome of approximately 97 kb, comprised of double-stranded DNA which is probably modified. 16 refs., 2 figs., 4 tabs.

  3. Money and transmission of bacteria

    PubMed Central

    2013-01-01

    Money is one of the most frequently passed items in the world. The aim of this study was to ascertain the survival status of bacteria including Staphylococcus aureus, Escherichia coli, and Vancomycin- Resistant Enterococci (VRE) on banknotes from different countries and the transmission of bacteria to people who come in contact with the banknotes. The survival rate was highest for the Romanian Leu yielding all three microorganisms used after both three and six hours of drying. Furthermore, the Leu was the only banknote to yield VRE after one day of drying. Other currencies either enabled the survival of Extended-Spectrum Beta-Lactamases (ESBL) and VRE (e.g. Euro), but not of MRSA, or the other way round (e.g. US Dollar). While a variety of factors such as community hygiene levels, people’s behaviour, and antimicrobial resistance rates at community level obviously have influence on the transmission of resistant microorganisms, the type of banknote-paper may be an additional variable to consider. PMID:23985137

  4. Money and transmission of bacteria.

    PubMed

    Gedik, Habip; Voss, Timothy A; Voss, Andreas

    2013-01-01

    Money is one of the most frequently passed items in the world. The aim of this study was to ascertain the survival status of bacteria including Staphylococcus aureus, Escherichia coli, and Vancomycin- Resistant Enterococci (VRE) on banknotes from different countries and the transmission of bacteria to people who come in contact with the banknotes. The survival rate was highest for the Romanian Leu yielding all three microorganisms used after both three and six hours of drying. Furthermore, the Leu was the only banknote to yield VRE after one day of drying. Other currencies either enabled the survival of Extended-Spectrum Beta-Lactamases (ESBL) and VRE (e.g. Euro), but not of MRSA, or the other way round (e.g. US Dollar). While a variety of factors such as community hygiene levels, people's behaviour, and antimicrobial resistance rates at community level obviously have influence on the transmission of resistant microorganisms, the type of banknote-paper may be an additional variable to consider. PMID:23985137

  5. Transformation of gram positive bacteria by sonoporation

    DOEpatents

    Yang, Yunfeng; Li, Yongchao

    2014-03-11

    The present invention provides a sonoporation-based method that can be universally applied for delivery of compounds into Gram positive bacteria. Gram positive bacteria which can be transformed by sonoporation include, for example, Bacillus, Streptococcus, Acetobacterium, and Clostridium. Compounds which can be delivered into Gram positive bacteria via sonoporation include nucleic acids (DNA or RNA), proteins, lipids, carbohydrates, viruses, small organic and inorganic molecules, and nano-particles.

  6. Managing Bacteria Pollution in Texas Waters 

    E-print Network

    Wythe, Kathy

    2007-01-01

    Wythe tx H2O | pg. 2 BACTERIA MANAGING tx H2O | pg. 3 IN TEXAS WATERS POLLUTION Managing Bacteria Pollution in Texas Waters tx H2O | pg. 4 W ith 310 water bodies in Texas failing to meetwater quality standards because of bacteria,managing bacteria... pollution is commanding the attention of water agencies, researchers and stake- holders across Texas. These water bodies are listed in the 2006 Texas Water Quality Inventory and 303(d) List for failing to meet the standards designed to protect...

  7. Coryneform bacteria associated with canine otitis externa.

    PubMed

    Aalbæk, Bent; Bemis, David A; Schjærff, Mette; Kania, Stephen A; Frank, Linda A; Guardabassi, Luca

    2010-10-26

    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10 cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other bacteria, mainly Staphylococcus pseudintermedius alone (n=5) or in combination with Malassezia pachydermatis (n=5). Some coryneform isolates displayed resistance to fusidic acid or enrofloxacin, two antimicrobial agents commonly used for the treatment of otitis externa in dogs. The frequency of isolation of coryneform bacteria was 16% among 55 cases of canine otitis externa examined at the Danish hospital during 2007. In contrast, detectable levels of coryneform bacteria were not demonstrated in samples from the acustic meatus of 35 dogs with apparently healthy ears, attending the hospital during the same year. On basis of the current knowledge, these coryneform bacteria should be regarded as potential secondary pathogens able to proliferate in the environment of an inflamed ear canal. PMID:20434850

  8. Spectroscopic diagnostics for bacteria in biologic sample

    DOEpatents

    El-Sayed, Mostafa A. (Atlanta, GA); El-Sayed, Ivan H. (Somerville, MA)

    2002-01-01

    A method to analyze and diagnose specific bacteria in a biologic sample using spectroscopy is disclosed. The method includes obtaining the spectra of a biologic sample of a non-infected patient for use as a reference, subtracting the reference from the spectra of an infected sample, and comparing the fingerprint regions of the resulting differential spectrum with reference spectra of bacteria in saline. Using this diagnostic technique, specific bacteria can be identified sooner and without culturing, bacteria-specific antibiotics can be prescribed sooner, resulting in decreased likelihood of antibiotic resistance and an overall reduction of medical costs.

  9. Survival of soil bacteria during prolonged desiccation.

    NASA Technical Reports Server (NTRS)

    Chen, M.; Alexander, M.

    1973-01-01

    A determination was made of the kinds and numbers of bacteria surviving when two soils were maintained in the laboratory under dry conditions for more than half a year. Certain non-spore-forming bacteria were found to survive in the dry condition for long periods. A higher percentage of drought-tolerant than drought-sensitive bacteria was able to grow at low water activities. When they were grown in media with high salt concentrations, bacteria generally became more tolerant of prolonged drought and they persisted longer. The percent of cells in a bacterial population that remained viable when exposed to drought stress varied with the stage of growth.

  10. Biosorption of Pb(II) Ions by Klebsiella sp. 3S1 Isolated from a Wastewater Treatment Plant: Kinetics and Mechanisms Studies

    PubMed Central

    Muñoz, Antonio Jesús; Espínola, Francisco; Moya, Manuel; Ruiz, Encarnación

    2015-01-01

    Lead biosorption by Klebsiella sp. 3S1 isolated from a wastewater treatment plant was investigated through a Rotatable Central Composite Experimental Design. The optimisation study indicated the following optimal values of operating variables: 0.4?g/L of biosorbent dosage, pH 5, and 34°C. According to the results of the kinetic studies, the biosorption process can be described by a two-step process, one rapid, almost instantaneous, and one slower, both contributing significantly to the overall biosorption; the model that best fits the experimental results was pseudo-second order. The equilibrium studies showed a maximum lead uptake value of 140.19?mg/g according to the Langmuir model. The mechanism study revealed that lead ions were bioaccumulated into the cytoplasm and adsorbed on the cell surface. The bacterium??Klebsiella sp. 3S1 has a good potential in the bioremoval of lead in an inexpensive and effective process. PMID:26504824

  11. Outbreak of colonization by carbapenemase-producing Klebsiella pneumoniae in a neonatal intensive care unit: Investigation, control measures and assessment.

    PubMed

    Zhou, Jiong; Li, Guiping; Ma, Xiaojun; Yang, Qiwen; Yi, Jie

    2015-10-01

    We describe an outbreak of carbapenemase-producing Klebsiella pneumoniae in a neonatal intensive care unit and assess the effect of infection control measures. Our assessment indicates that active surveillance culture is very useful in identifying multidrug-resistant organisms and its prevention from transmission. Besides contact precaution, environment disinfection, good compliance of hand hygiene, and single-room isolation is very important for preventing transmission of carbapenemase-producing K pneumoniae isolates. PMID:26149749

  12. Biochemical Characterization of VIM-39, a VIM-1-Like Metallo-?-Lactamase Variant from a Multidrug-Resistant Klebsiella pneumoniae Isolate from Greece.

    PubMed

    Papagiannitsis, Costas C; Pollini, Simona; De Luca, Filomena; Rossolini, Gian Maria; Docquier, Jean-Denis; Hrabák, Jaroslav

    2015-12-01

    VIM-39, a VIM-1-like metallo-?-lactamase variant (VIM-1 Thr33Ala His224Leu) was identified in a clinical isolate of Klebsiella pneumoniae belonging to sequence type 147. VIM-39 hydrolyzed ampicillin, cephalothin, and imipenem more efficiently than did VIM-1 and VIM-26 (a VIM-1 variant with the His224Leu substitution) because of higher turnover rates. PMID:26369975

  13. Single Bacteria as Turing Machines

    NASA Astrophysics Data System (ADS)

    Bos, Julia; Zang, Qiucen; Vyawahare, Saurabh; Austin, Robert

    2014-03-01

    In Allan Turing's famous 1950 paper on Computing Machinery and Intelligence, he started with the provocative statement: ``I propose to consider the question, `Can machines think?' This should begin with definitions of the meaning of the terms `machine' and `think'.'' In our own work on exploring the way that organisms respond to stress and evolve, it seems at times as if they come to remarkably fast solutions to problems, indicating some sort of very clever computational machinery. I'll discuss how it would appear that bacteria can indeed create a form of a Turing Machine, the first example of a computer, and how they might use this algorithm to do rapid evolution to solve a genomics problem.

  14. Cell Size Regulation in Bacteria

    NASA Astrophysics Data System (ADS)

    Amir, Ariel

    2014-05-01

    Various bacteria such as the canonical gram negative Escherichia coli or the well-studied gram positive Bacillus subtilis divide symmetrically after they approximately double their volume. Their size at division is not constant, but is typically distributed over a narrow range. Here, we propose an analytically tractable model for cell size control, and calculate the cell size and interdivision time distributions, as well as the correlations between these variables. We suggest ways of extracting the model parameters from experimental data, and show that existing data for E. coli supports partial size control, and a particular explanation: a cell attempts to add a constant volume from the time of initiation of DNA replication to the next initiation event. This hypothesis accounts for the experimentally observed correlations between mother and daughter cells as well as the exponential dependence of size on growth rate.

  15. Clinical Usefulness of the 2010 Clinical and Laboratory Standards Institute Revised Breakpoints for Cephalosporin Use in the Treatment of Bacteremia Caused by Escherichia coli or Klebsiella spp.

    PubMed Central

    Ku, Nam Su; Chung, Hae-Sun; Choi, Jun Yong; Yong, Dongeun; Lee, Kyungwon; Kim, June Myung; Chong, Yunsop

    2015-01-01

    We investigated the clinical usefulness of the revised 2010 Clinical and Laboratory Standards Institute (CLSI) breakpoints for Escherichia coli and Klebsiella spp. Of 2,623 patients with bacteremia caused by E. coli or Klebsiella spp., 573 who had been treated appropriately with cephalosporin based on the CLSI 2009 guidelines were enrolled. There were no differences in the rates of treatment failure or mortality between the appropriately and inappropriately treated groups according to the CLSI 2010 guidelines. Additionally, in the matched case-control analysis, the treatment failure rate was higher in bacteremic patients with extended-spectrum ?-lactamase- (ESBL-) producing but cephalosporin-susceptible organisms than in those with ESBL-nonproducing isolates when patients with urinary tract infections were excluded (44% and 0%, resp., P = 0.026). In patients with bacteremia caused by E. coli or Klebsiella spp., the revised CLSI 2010 guidelines did not lead to poorer outcomes. However, ESBL production appeared to be associated with poor clinical outcomes in patients with bacteremia from sources other than the urinary tract. PMID:25793209

  16. Phenotypic and Molecular Characterization of Plasmid Mediated AmpC ?-Lactamases among Escherichia coli, Klebsiella spp., and Proteus mirabilis Isolated from Urinary Tract Infections in Egyptian Hospitals

    PubMed Central

    Helmy, Mai M.; Wasfi, Reham

    2014-01-01

    The incidence of resistance by Enterobacteriaceae to ?-lactam/?-lactamase inhibitors combination is increasing in Egypt. Three phenotypic techniques, comprising AmpC disk diffusion and inhibition dependent methods using phenylboronic acid (PBA) and cloxacillin, were compared to PCR based method for detection of plasmid mediated AmpC ?-lactamase in common urinary tract isolates. A total of 143 isolates, including E. coli, Klebsiella pneumonia, and Proteus mirabilis, were collected from urinary tract infections cases in Egyptian hospitals. Plasmid encoded AmpC genes were detected by PCR in 88.46% of cefoxitin resistant isolates. The most prevalent AmpC gene family was CIT including CMY-2, CMY-4, and two CMY-2 variants. The second prevalent gene was DHA-1 which was detected in E. coli and Klebsiella pneumonia. The genes EBC, FOX, and MOX were also detected but in small percentage. Some isolates were identified as having more than one pAmpC gene. The overall sensitivity and specificity of phenotypic tests for detection of AmpC ?-lactamase showed that AmpC disk diffusion and inhibition dependent method by cloxacillin were the most sensitive and the most specific disk tests. PCR remains the gold standard for detection of AmpC ?-lactamases. This study represents the first report of CMY-2 variants of CMY-42 and CMY-102 ?-lactamase-producing E. coli, Klebsiella pneumonia, and Proteus mirabilis isolates in Egypt. PMID:25003107

  17. Travel-Related Carbapenemase-Producing Gram-Negative Bacteria in Alberta, Canada: the First 3 Years

    PubMed Central

    Peirano, Gisele; Ahmed-Bentley, Jasmine; Fuller, Jeff; Rubin, Joseph E.

    2014-01-01

    We describe here the characteristics of Alberta, Canada, patients with infections or colonizations with carbapenemase-producing Gram-negative bacteria during 2010 to 2013 that were linked to recent travel outside Canada. Antimicrobial susceptibility was determined by broth microdilution, and isolates were characterized using PCR, sequencing, and multilocus sequencing typing. A broth mating study was used to assess the transferability of resistance plasmids, which were subsequently characterized. All the patients (n = 12) included in our study had contact with a health care system while abroad. Most of the patients presented with urinary tract infections (UTIs) and were admitted to hospitals within weeks after their return to Alberta. Secondary spread occurred in 1 case, resulting in the death of another patient. The carbapenemase-producing bacteria (n = 17) consisted of Escherichia coli (sequence type 101 [ST101], ST365, ST405, and ST410) with NDM-1, Klebsiella pneumoniae (ST15, ST16, ST147, ST258, ST340, ST512, and ST972) with NDM-1, OXA-181, KPC-2, and KPC-3, Acinetobacter baumannii with OXA-23, Providencia rettgeri with NDM-1, Enterobacter cloacae with KPC-2, and Citrobacter freundii with NDM-1. The blaNDM-1 gene was associated with various narrow- (i.e., IncF) and broad- (i.e., IncA/C and IncL/M) host-range plasmids with different addiction factors. Our results show that NDM-producing K. pneumoniae, belonging to a variety of sequence types with different plasmid scaffolds, are regularly imported from India into Alberta. Clinical microbiology laboratories should remain vigilant in detecting bacteria with carbapenemases. PMID:24599977

  18. A Designed Experiments Approach to Optimization of Automated Data Acquisition during Characterization of Bacteria with MALDI-TOF Mass Spectrometry

    PubMed Central

    Zhang, Lin; Borror, Connie M.; Sandrin, Todd R.

    2014-01-01

    MALDI-TOF MS has been shown capable of rapidly and accurately characterizing bacteria. Highly reproducible spectra are required to ensure reliable characterization. Prior work has shown that spectra acquired manually can have higher reproducibility than those acquired automatically. For this reason, the objective of this study was to optimize automated data acquisition to yield spectra with reproducibility comparable to those acquired manually. Fractional factorial design was used to design experiments for robust optimization of settings, in which values of five parameters (peak selection mass range, signal to noise ratio (S:N), base peak intensity, minimum resolution and number of shots summed) commonly used to facilitate automated data acquisition were varied. Pseudomonas aeruginosa was used as a model bacterium in the designed experiments, and spectra were acquired using an intact cell sample preparation method. Optimum automated data acquisition settings (i.e., those settings yielding the highest reproducibility of replicate mass spectra) were obtained based on statistical analysis of spectra of P. aeruginosa. Finally, spectrum quality and reproducibility obtained from non-optimized and optimized automated data acquisition settings were compared for P. aeruginosa, as well as for two other bacteria, Klebsiella pneumoniae and Serratia marcescens. Results indicated that reproducibility increased from 90% to 97% (p-value0.002) for P. aeruginosa when more shots were summed and, interestingly, decreased from 95% to 92% (p-value 0.013) with increased threshold minimum resolution. With regard to spectrum quality, highly reproducible spectra were more likely to have high spectrum quality as measured by several quality metrics, except for base peak resolution. Interaction plots suggest that, in cases of low threshold minimum resolution, high reproducibility can be achieved with fewer shots. Optimization yielded more reproducible spectra than non-optimized settings for all three bacteria. PMID:24662978

  19. Detection of Enterobacter sakazakii and other pathogens associated with infant formula powder by use of a DNA microarray.

    PubMed

    Wang, Min; Cao, Boyang; Gao, Qili; Sun, Yamin; Liu, Pei; Feng, Lu; Wang, Lei

    2009-10-01

    Pathogen detection is critical to the process of generating and testing powdered infant formula (PIF). An obstacle associated with PIF microbial surveillance is that most current procedures are time-consuming and labor-intensive. We have developed a rapid, DNA microarray-based detection technique to identify 10 different pathogenic bacteria associated with PIF contamination based on the 16S-23S rRNA gene internal transcribed spacer (ITS) sequences and wzy (O antigen polymerase) gene. Using this procedure, Enterobacter sakazakii, Salmonella enterica, Klebsiella pneumoniae, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus, and Escherichia coli O157 were identified. One hundred eighty-five strains were used to validate the microarray assay (including 134 target pathogen strains and 51 closely related bacteria). Twenty-seven probes reproducibly detected multiple pathogens with high specificity and sensitivity (0.100 ng genomic DNA or 10(4) CFU/ml). Twenty-one real PIF samples were tested by the microarray with 100% accuracy. The data presented reveal that the designed oligonucleotide microarray is a promising method for basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. PMID:19641057

  20. Detection of Enterobacter sakazakii and Other Pathogens Associated with Infant Formula Powder by Use of a DNA Microarray? †

    PubMed Central

    Wang, Min; Cao, Boyang; Gao, Qili; Sun, Yamin; Liu, Pei; Feng, Lu; Wang, Lei

    2009-01-01

    Pathogen detection is critical to the process of generating and testing powdered infant formula (PIF). An obstacle associated with PIF microbial surveillance is that most current procedures are time-consuming and labor-intensive. We have developed a rapid, DNA microarray-based detection technique to identify 10 different pathogenic bacteria associated with PIF contamination based on the 16S-23S rRNA gene internal transcribed spacer (ITS) sequences and wzy (O antigen polymerase) gene. Using this procedure, Enterobacter sakazakii, Salmonella enterica, Klebsiella pneumoniae, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus, and Escherichia coli O157 were identified. One hundred eighty-five strains were used to validate the microarray assay (including 134 target pathogen strains and 51 closely related bacteria). Twenty-seven probes reproducibly detected multiple pathogens with high specificity and sensitivity (0.100 ng genomic DNA or 104 CFU/ml). Twenty-one real PIF samples were tested by the microarray with 100% accuracy. The data presented reveal that the designed oligonucleotide microarray is a promising method for basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. PMID:19641057