These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Cytotoxic and Pathogenic Properties of Klebsiella oxytoca Isolated from Laboratory Animals  

E-print Network

Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin ...

Darby, Alison

2

Pleural empyema caused by Klebsiella oxytoca: A case series.  

PubMed

We report on 19 patients from Western Australia of pleural empyema with Klebsiella oxytoca, an organism never before reported in association with this condition. Median age was 65 years, 14/17 (83%) had been in hospital within 30 days prior to diagnosis, 12/18 (67%) had active cancer, 9/17 (53%) had been in intensive care and 7/17 (41%) had prior surgery. Nine patients died at the time of censure, five within 90 days of infection. PMID:25677866

Suthers, Elizabeth; Rosenstengel, Andrew; Hart, Julie; Lewis, Joshua R; Kay, Ian; Waterer, Grant; Lee, Y C Gary; Brims, Fraser

2015-04-01

3

Improvements In Ethanologenic Escherichia Coli and Klebsiella Oxytoca  

SciTech Connect

The current Verenium cellulosic ethanol process is based on the dilute-acid pretreatment of a biomass feedstock, followed by a two-stage fermentation of the pentose sugar-containing hydrolysate by a genetically modified ethanologenic Escherichia coli strain and a separate simultaneous saccharification-fermentation (SSF) of the cellulosic fraction by a genetically modified ethanologenic Klebsiella oxytoca strain and a fungal enzyme cocktail. In order to reduce unit operations and produce a fermentation beer with higher ethanol concentrations to reduce distillation costs, we have proposed to develop a simultaneous saccharification co-fermentation (SScF) process, where the fermentation of the pentose-containing hydrolysate and cellulosic fraction occurs within the same fermentation vessel. In order to accomplish this goal, improvements in the ethanologens must be made to address a number of issues that arise, including improved hydrolysate tolerance, co-fermentation of the pentose and hexose sugars and increased ethanol tolerance. Using a variety of approaches, including transcriptomics, strain adaptation, metagenomics and directed evolution, this work describes the efforts of a team of scientists from Verenium, University of Florida, Massachusetts Institute of Technology and Genomatica to improve the E. coli and K. oxytoca ethanologens to meet these requirements.

Dr. David Nunn

2010-09-30

4

Refactoring the nitrogen fixation gene cluster from Klebsiella oxytoca.  

PubMed

Bacterial genes associated with a single trait are often grouped in a contiguous unit of the genome known as a gene cluster. It is difficult to genetically manipulate many gene clusters because of complex, redundant, and integrated host regulation. We have developed a systematic approach to completely specify the genetics of a gene cluster by rebuilding it from the bottom up using only synthetic, well-characterized parts. This process removes all native regulation, including that which is undiscovered. First, all noncoding DNA, regulatory proteins, and nonessential genes are removed. The codons of essential genes are changed to create a DNA sequence as divergent as possible from the wild-type (WT) gene. Recoded genes are computationally scanned to eliminate internal regulation. They are organized into operons and placed under the control of synthetic parts (promoters, ribosome binding sites, and terminators) that are functionally separated by spacer parts. Finally, a controller consisting of genetic sensors and circuits regulates the conditions and dynamics of gene expression. We applied this approach to an agriculturally relevant gene cluster from Klebsiella oxytoca encoding the nitrogen fixation pathway for converting atmospheric N(2) to ammonia. The native gene cluster consists of 20 genes in seven operons and is encoded in 23.5 kb of DNA. We constructed a "refactored" gene cluster that shares little DNA sequence identity with WT and for which the function of every genetic part is defined. This work demonstrates the potential for synthetic biology tools to rewrite the genetics encoding complex biological functions to facilitate access, engineering, and transferability. PMID:22509035

Temme, Karsten; Zhao, Dehua; Voigt, Christopher A

2012-05-01

5

Hypersensitivity pneumonitis secondary to Klebsiella oxytoca. A new cause of humidifier lung.  

PubMed

A 30-year-old woman developed recurrent episodes of fever, dyspnea, and nonproductive cough after repeated exposure to a home humidifier. The diagnosis of hypersensitivity pneumonitis was confirmed by detection of serum-binding antibodies at significant titer to Klebsiella oxytoca colonizing the humidifier water but not to other potential antigens. This represents a newly recognized cause of hypersensitivity pneumonitis related to exposure to K oxytoca contaminating a commercially available ultrasonic cold air home humidifier. The potential role for these frequently used home humidifier devices in unexplained pulmonary illness is emphasized. PMID:8339664

Kane, G C; Marx, J J; Prince, D S

1993-08-01

6

Cytotoxic and pathogenic properties of Klebsiella oxytoca isolated from laboratory animals.  

PubMed

Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin production in animal isolates of K. oxytoca and its pathogenic properties have not been characterized. Furthermore, neither the identity of the toxin nor a complete repertoire of genes involved in K. oxytoca pathogenesis have been fully elucidated. Here, we showed that several animal isolates of K. oxytoca, including the clinical isolates, produced secreted products in bacterial culture supernatant that display cytotoxicity on HEp-2 and HeLa cells, indicating the ability to produce cytotoxin. Cytotoxin production appears to be regulated by the environment, and soy based product was found to have a strong toxin induction property. The toxin was identified, by liquid chromatography-mass spectrometry and NMR spectroscopy, as low molecular weight heat labile benzodiazepine, tilivalline, previously shown to cause cytotoxicity in several cell lines, including mouse L1210 leukemic cells. Genome sequencing and analyses of a cytotoxin positive K. oxytoca strain isolated from an abscess of a mouse, identified genes previously shown to promote pathogenesis in other enteric bacterial pathogens including ecotin, several genes encoding for type IV and type VI secretion systems, and proteins that show sequence similarity to known bacterial toxins including cholera toxin. To our knowledge, these results demonstrate for the first time, that animal isolates of K. oxytoca, produces a cytotoxin, and that cytotoxin production is under strict environmental regulation. We also confirmed tilivalline as the cytotoxin present in animal K. oxytoca strains. These findings, along with the discovery of a repertoire of genes with virulence potential, provide important insights into the pathogenesis of K. oxytoca. As a novel diagnostic tool, tilivalline may serve as a biomarker for K oxytoca-induced cytotoxicity in humans and animals through detection in various samples from food to diseased samples using LC-MS/MS. Induction of K. oxytoca cytotoxin by consumption of soy may be in part involved in the pathogenesis of gastrointestinal disease. PMID:25057966

Darby, Alison; Lertpiriyapong, Kvin; Sarkar, Ujjal; Seneviratne, Uthpala; Park, Danny S; Gamazon, Eric R; Batchelder, Chara; Cheung, Cheryl; Buckley, Ellen M; Taylor, Nancy S; Shen, Zeli; Tannenbaum, Steven R; Wishnok, John S; Fox, James G

2014-01-01

7

Cytotoxic and Pathogenic Properties of Klebsiella oxytoca Isolated from Laboratory Animals  

PubMed Central

Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin production in animal isolates of K. oxytoca and its pathogenic properties have not been characterized. Furthermore, neither the identity of the toxin nor a complete repertoire of genes involved in K. oxytoca pathogenesis have been fully elucidated. Here, we showed that several animal isolates of K. oxytoca, including the clinical isolates, produced secreted products in bacterial culture supernatant that display cytotoxicity on HEp-2 and HeLa cells, indicating the ability to produce cytotoxin. Cytotoxin production appears to be regulated by the environment, and soy based product was found to have a strong toxin induction property. The toxin was identified, by liquid chromatography-mass spectrometry and NMR spectroscopy, as low molecular weight heat labile benzodiazepine, tilivalline, previously shown to cause cytotoxicity in several cell lines, including mouse L1210 leukemic cells. Genome sequencing and analyses of a cytotoxin positive K. oxytoca strain isolated from an abscess of a mouse, identified genes previously shown to promote pathogenesis in other enteric bacterial pathogens including ecotin, several genes encoding for type IV and type VI secretion systems, and proteins that show sequence similarity to known bacterial toxins including cholera toxin. To our knowledge, these results demonstrate for the first time, that animal isolates of K. oxytoca, produces a cytotoxin, and that cytotoxin production is under strict environmental regulation. We also confirmed tilivalline as the cytotoxin present in animal K. oxytoca strains. These findings, along with the discovery of a repertoire of genes with virulence potential, provide important insights into the pathogenesis of K. oxytoca. As a novel diagnostic tool, tilivalline may serve as a biomarker for K oxytoca-induced cytotoxicity in humans and animals through detection in various samples from food to diseased samples using LC-MS/MS. Induction of K. oxytoca cytotoxin by consumption of soy may be in part involved in the pathogenesis of gastrointestinal disease. PMID:25057966

Sarkar, Ujjal; Seneviratne, Uthpala; Park, Danny S.; Gamazon, Eric R.; Batchelder, Chara; Cheung, Cheryl; Buckley, Ellen M.; Taylor, Nancy S.; Shen, Zeli; Tannenbaum, Steven R.; Wishnok, John S.; Fox, James G.

2014-01-01

8

Recombinant Klebsiella oxytoca strains with improved efficiency in removal of high nitrate loads  

SciTech Connect

Klebsiella oxytoca CECT 4460 removes high nitrate loads from industrial wastewaters without accumulation of nitrite under optimal culture conditions; however, under nonoptimal conditions nitrite accumulates. This situation reflects an in vivo-limited functioning of nitrite reductase in this strain. As a way to overcome this limitation, an increase in the nitrite reductase gene dose in K. oxytoca CECT 4460 was considered. To achieve this, the authors cloned and transferred into this strain the Klebsiella pneumoniae nasB gene, which encodes assimilatory nitrite reductase. The delivery vector was either the wide-host-range plasmid pUPE2, in which the nasB gene is expressed from the Escherichia coli P{sub lac} promoter, or a mini-Tn5-Km vector, which upon random insertion in the host chromosome allowed expression of the nasB gene from an unidentified chromosomal host promoter. The effect of the increase in the dose of the nasB gene in K. oxytoca CECT 4460 on the accumulation of nitrite in the culture medium was tested in two recombinant strains. The results obtained showed that K. oxytoca CECT 4460 bearing pUPE2 accumulated 88% less nitrite than the wild-type strain, while the recombinant strain bearing the K. pneumoniae nasB gene in the host chromosome showed a 25% lower level of nitrite accumulation in the culture medium than that of the wild type.

Pinar, G.; Ramos, J.L. [Estacion Experimental del Zaidin--Consejo Superior de Investigaciones Cientificas, Granada (Spain). Dept. of Biochemistry and Molecular and Cellular Biology of Plants

1998-12-01

9

Recombinant Klebsiella oxytoca Strains with Improved Efficiency in Removal of High Nitrate Loads  

PubMed Central

Klebsiella oxytoca CECT 4460 removes high nitrate loads from industrial wastewaters without accumulation of nitrite under optimal culture conditions; however, under nonoptimal conditions nitrite accumulates. This situation reflects an in vivo-limited functioning of nitrite reductase in this strain. As a way to overcome this limitation, an increase in the nitrite reductase gene dose in K. oxytoca CECT 4460 was considered. To achieve this, we cloned and transferred into this strain the Klebsiella pneumoniae nasB gene, which encodes assimilatory nitrite reductase (Lin et al., J. Bacteriol. 176:2551–2559, 1994). The delivery vector was either the wide-host-range plasmid pUPE2, in which the nasB gene is expressed from the Escherichia coli Plac promoter, or a mini-Tn5-Km vector, which upon random insertion in the host chromosome allowed expression of the nasB gene from an unidentified chromosomal host promoter. The effect of the increase in the dose of the nasB gene in K. oxytoca CECT 4460 on the accumulation of nitrite in the culture medium was tested in two recombinant strains. The results obtained showed that K. oxytoca CECT 4460 bearing pUPE2 accumulated 88% less nitrite than the wild-type strain, while the recombinant strain bearing the K. pneumoniae nasB gene in the host chromosome showed a 25% lower level of nitrite accumulation in the culture medium than that of the wild type. PMID:9835599

Piñar, Guadalupe; Ramos, Juan L.

1998-01-01

10

Contaminated handwashing sinks as the source of a clonal outbreak of KPC-2-producing Klebsiella oxytoca on a hematology ward.  

PubMed

We investigated sinks as possible sources of a prolonged Klebsiella pneumonia carbapenemase (KPC)-producing Klebsiella oxytoca outbreak. Seven carbapenem-resistant K. oxytoca isolates were identified in sink drains in 4 patient rooms and in the medication room. Investigations for resistance genes and genetic relatedness of patient and environmental isolates revealed that all the isolates harbored the blaKPC-2 and blaTEM-1 genes and were genetically indistinguishable. We describe here a clonal outbreak caused by KPC-2-producing K. oxytoca, and handwashing sinks were a possible reservoir. PMID:25348541

Leitner, Eva; Zarfel, Gernot; Luxner, Josefa; Herzog, Kathrin; Pekard-Amenitsch, Shiva; Hoenigl, Martin; Valentin, Thomas; Feierl, Gebhard; Grisold, Andrea J; Högenauer, Christoph; Sill, Heinz; Krause, Robert; Zollner-Schwetz, Ines

2015-01-01

11

The structure of the lipopolysaccharide from Klebsiella oxytoca rough mutant R29 (O1-/K29-).  

PubMed

The lipopolysaccharide from Klebsiella oxytoca rough mutant R29 (O1-/K29-) has been isolated and its complete structure has been elucidated by compositional analyses, NMR spectroscopy, and laser-desorption mass spectrometry. The carbohydrate backbone has the structure [formula: see text] of which the GlcN residues (the lipid A backbone) are acylated by 14:(3-OH) (amide-linked) and 12:0, 14:0(3-OH)(ester-linked) fatty acids. PMID:9836453

Süsskind, M; Lindner, B; Weimar, T; Brade, H; Holst, O

1998-11-01

12

Carbapenem-Resistant Strain of Klebsiella oxytoca Harboring Carbapenem-Hydrolyzing  Lactamase KPC2  

Microsoft Academic Search

We investigated a Klebsiella oxytoca isolate demonstrating resistance to imipenem, meropenem, extended- spectrum cephalosporins, and aztreonam. The MICs of both imipenem and meropenem were 32 g\\/ml. The -lactamase activity against imipenem and meropenem was inhibited in the presence of clavulanic acid. Isoelectric focusing studies demonstrated five -lactamases with pIs of 8.2 (SHV-46), 6.7 (KPC-2), 6.5 (un- known), 6.4 (probable OXY-2),

Hesna Yigit; Anne Marie Queenan; J. Kamile Rasheed; James W. Biddle; Antonio Domenech-Sanchez; Sebastian Alberti; Karen Bush; Fred C. Tenover

2003-01-01

13

Isolation and characterization of a Klebsiella oxytoca strain for simultaneous azo-dye anaerobic reduction and bio-hydrogen production.  

PubMed

A facultative anaerobic bacteria strain GS-4-08, isolated from an anaerobic sequence batch reactor for synthetic dye wastewater treatment, was investigated for azo-dye decolorization. This bacterium was identified as a member of Klebsiella oxytoca based on Gram staining, morphology characterization and 16S rRNA gene analysis. It exhibited a good capacity of simultaneous decolorization and hydrogen production in the presence of electron donor. The hydrogen production was less affected even at a high Methyl Orange (MO) concentration of 0.5 mM, indicating a superior tolerability of this strain to MO. This efficient bio-hydrogen production from electron donor can not only avoid bacterial inhibition due to accumulation of volatile fatty acids during MO decolorization, but also can recover considerable energy from dye wastewater. PMID:22086069

Yu, Lei; Li, Wen-Wei; Lam, Michael Hon-Wah; Yu, Han-Qing; Wu, Chao

2012-07-01

14

Intracellular azo decolorization is coupled with aerobic respiration by a Klebsiella oxytoca strain.  

PubMed

Reduction of azo dye methyl red coupled with aerobic respiration by growing cultures of Klebsiella oxytoca GS-4-08 was investigated. In liquid media containing dye and 0.6 % glucose in a mineral salts base, 100 mg l(-1) of the dye are completely removed in 3 h under shaking conditions. The dye cannot be aerobically decolorized by strain GS-4-08 without extra carbon sources, indicating a co-metabolism process. Higher initial dye concentration prolonged the lag phase of the cell growth, but final cell concentrations of each batches reached a same level with range from 6.3 to 7.6 mg l(-1) after the dye adaption period. This strain showed stronger dye tolerance and decolorization ability than many reported strains. Furthermore, a new intracellular oxygen-insensitive azoreductase was isolated from this strain, and the specific activity of enzyme was 0.846 and 0.633 U mg(-1) protein in the presence of NADH and NADPH, respectively. N,N dimethyl-p-phenylenediamine and anthranilic acid were stoichiometrically released from MR dye, indicating the breakage of azo bonds accounts for the intracellular decolorization. Combining the characteristics of azoreductase, the stoichiometry of EMP, and TCA cycle, the electron transfer chain theory of aerobic respiration, and the possible mechanism of aerobic respiration coupled with azo reduction by K. oxytoca GS-4-08 are proposed. This study is expected to provide a sound theoretical basis for the development of the K. oxytoca strain in aerobic process for azo dye containing wastewaters. PMID:25343980

Yu, Lei; Zhang, Xiao-Yu; Xie, Tian; Hu, Jin-Mei; Wang, Shi; Li, Wen-Wei

2015-03-01

15

Purine Utilization by Klebsiella oxytoca M5al: Genes for Ring-Oxidizing and -Opening Enzymes?  

PubMed Central

The enterobacterium Klebsiella oxytoca uses a variety of inorganic and organic nitrogen sources, including purines, nitrogen-rich compounds that are widespread in the biosphere. We have identified a 23-gene cluster that encodes the enzymes for utilizing purines as the sole nitrogen source. Growth and complementation tests with insertion mutants, combined with sequence comparisons, reveal functions for the products of these genes. Here, we report our characterization of 12 genes, one encoding guanine deaminase and the others encoding enzymes for converting (hypo)xanthine to allantoate. Conventionally, xanthine dehydrogenase, a broadly distributed molybdoflavoenzyme, catalyzes sequential hydroxylation reactions to convert hypoxanthine via xanthine to urate. Our results show that these reactions in K. oxytoca are catalyzed by a two-component oxygenase (HpxE-HpxD enzyme) homologous to Rieske nonheme iron aromatic-ring-hydroxylating systems, such as phthalate dioxygenase. Our results also reveal previously undescribed enzymes involved in urate oxidation to allantoin, catalyzed by a flavoprotein monooxygenase (HpxO enzyme), and in allantoin conversion to allantoate, which involves allantoin racemase (HpxA enzyme). The pathway also includes the recently described PuuE allantoinase (HpxB enzyme). The HpxE-HpxD and HpxO enzymes were discovered independently by de la Riva et al. (L. de la Riva, J. Badia, J. Aguilar, R. A. Bender, and L. Baldoma, J. Bacteriol. 190:7892-7903, 2008). Thus, several enzymes in this K. oxytoca purine utilization pathway differ from those in other microorganisms. Isofunctional homologs of these enzymes apparently are encoded by other species, including Acinetobacter, Burkholderia, Pseudomonas, Saccharomyces, and Xanthomonas. PMID:19060149

Pope, Scott D.; Chen, Li-Ling; Stewart, Valley

2009-01-01

16

Modeling 1,2-dichloroethane biodegradation by Klebsiella oxytoca va 8391 immobilized on granulated activated carbon.  

PubMed

A mathematical model of the biodegradation of xenobiotics by microbial cells attached to particles of granulated activated carbon was developed. The model allowed the quantitative evaluation of different characteristics of the biofilm behavior: retarded microbial growth, increased concentration of immobilized cells compared to suspended cultures, potential cell detachment from the solid support and consequent independent growth of free cells. The applicability of the model was demonstrated for our own experimental data for 1,2- dichloroethane (DCA) biodegradation by Klebsiella oxytoca VA 8391 cells attached to granulated activated carbon. Two types of reactors, recirculated batch and continuous flow bioreactor, were studied. It was shown that in all investigated cases, the major contribution to DCA biodegradation was provided by the immobilized cells. Furthermore, immobilized cells were found to tolerate much higher substrate concentration and dilution rates in continuous culture than the free cells. PMID:17690915

Mileva, A; Sapundzhiev, Ts; Beschkov, V

2008-02-01

17

Iron-binding characterization and polysaccharide production by Klebsiella oxytoca strain isolated from mine acid drainage  

PubMed Central

Aims: To investigate Klebsiella oxytoca strain BAS-10 growth on ferric citrate under anaerobic conditions for exopolysaccharide (EPS) production and localization on cell followed by the purification and the EPS determination of the iron-binding stability constant to EPS or biotechnological applications. Methods and Results: Klebsiella oxytoca ferments ferric citrate under anaerobic conditions and produces a ferric hydrogel, whereas ferrous ions were formed in solution. During growth, cells precipitate and a hydrogel formation was observed: the organic material was constituted of an EPS bound to Fe(III) ions, this was found by chemical analyses of the iron species and transmission electron microscopy of the cell cultures. Iron binding to EPS was studied by cyclic voltammetric measurements, either directly on the hydrogel or in an aqueous solutions containing Fe(III)-citrate and purified Fe(III)-EPS. From the voltammetric data, the stability constant for the Fe(III)-EPS complex can be assumed to have values of approx. 1012–1013. It was estimated that this is higher than for the Fe(III)-citrate complex. Conclusions: The production of Fe(III)-EPS under anaerobic conditions is a strategy for the strain to survive in mine drainages and other acidic conditions. This physiological feature can be used to produce large amounts of valuable Fe(III)-EPS, starting from a low cost substrate such as Fe(III)-citrate. Significant and Impact of the Study: The data herein demonstrates that an interesting metal-binding molecule can be produced as a novel catalyst for a variety of potential applications and the EPS itself is a valuable source for rhamnose purification. PMID:19508299

Baldi, F; Marchetto, D; Battistel, D; Daniele, S; Faleri, C; De Castro, C; Lanzetta, R

2009-01-01

18

Retrospective analysis of the genetic diversity of Klebsiella oxytoca isolated in Poland over a 50-year period  

Microsoft Academic Search

Population genetics analyses and determination of the phylogenetic relationships between strains have proven to be extremely\\u000a useful approaches, enabling deeper insights into the epidemiological pattern of bacterial species. There is no longitudinal\\u000a data describing the molecular epidemiology of Klebsiella oxytoca strains that are opportunistic pathogens responsible for an increasing number of multi-resistant infections in hospitals.\\u000a The aim of the present

K. Stojowska; B. Krawczyk; S. Ka?u?ewski; J. Kur

2009-01-01

19

First Description of KPC-2-Producing Klebsiella oxytoca Isolated from a Pediatric Patient with Nosocomial Pneumonia in Venezuela.  

PubMed

During the last decade, carbapenem resistance has emerged among clinical isolates of the Enterobacteriaceae family. This has been increasingly attributed to the production of ?-lactamases capable of hydrolyzing carbapenems. Among these enzymes, Klebsiella pneumoniae carbapenemases (KPCs) are the most frequently and clinically significant class-A carbapenemases. In this report, we describe the first nosocomial KPC-2-producing K. oxytoca isolated from a pediatric patient with pneumonia admitted to the intensive care unit at The Andes University Hospital, Mérida, Venezuela. This strain was resistant to several antibiotics including imipenem, ertapenem, and meropenem but remained susceptible to ciprofloxacin, colistin, and tigecycline. Conjugation assays demonstrated the transferability of all resistance determinants, except aminoglycosides. The isolate LMM-SA26 carried a ~21?kb conjugative plasmid that harbored the bla KPC-2, bla CTX-M-8, and bla TEM-15 genes. Although carbapenem resistance in the Enterobacteriaceae is still unusual in Venezuela, KPCs have a great potential to spread due to their localization on mobile genetic elements. Therefore, rapid detection of KPC-carrying bacteria with phenotypic and confirmatory molecular tests is essential to establish therapeutic options and effective control measures. PMID:25405043

Labrador, Indira; Araque, María

2014-01-01

20

First Description of KPC-2-Producing Klebsiella oxytoca Isolated from a Pediatric Patient with Nosocomial Pneumonia in Venezuela  

PubMed Central

During the last decade, carbapenem resistance has emerged among clinical isolates of the Enterobacteriaceae family. This has been increasingly attributed to the production of ?-lactamases capable of hydrolyzing carbapenems. Among these enzymes, Klebsiella pneumoniae carbapenemases (KPCs) are the most frequently and clinically significant class-A carbapenemases. In this report, we describe the first nosocomial KPC-2-producing K. oxytoca isolated from a pediatric patient with pneumonia admitted to the intensive care unit at The Andes University Hospital, Mérida, Venezuela. This strain was resistant to several antibiotics including imipenem, ertapenem, and meropenem but remained susceptible to ciprofloxacin, colistin, and tigecycline. Conjugation assays demonstrated the transferability of all resistance determinants, except aminoglycosides. The isolate LMM-SA26 carried a ~21?kb conjugative plasmid that harbored the blaKPC-2, blaCTX-M-8, and blaTEM-15 genes. Although carbapenem resistance in the Enterobacteriaceae is still unusual in Venezuela, KPCs have a great potential to spread due to their localization on mobile genetic elements. Therefore, rapid detection of KPC-carrying bacteria with phenotypic and confirmatory molecular tests is essential to establish therapeutic options and effective control measures. PMID:25405043

Labrador, Indira

2014-01-01

21

Biosynthesis of Indole-3-Acetic Acid by New Klebsiella oxytoca Free and Immobilized Cells on Inorganic Matrices  

PubMed Central

While many natural and synthetic compounds exhibit auxin-like activity in bioassays, indole-3-acetic acid (IAA) is recognized as the key auxin in most plants. IAA has been implicated in almost all aspects of plant growth and development and a large array of bacteria have been reported to enhance plant growth. Cells of Klebsiella oxytoca isolated from the rhizosphere of Aspidosperma polyneuron and immobilized by adsorption on different inorganic matrices were used for IAA production. The matrices were prepared by the sol-gel method and the silica-titanium was the most suitable matrix for effective immobilization. In operational stability assays, IAA production was maintained after four cycles of production, obtaining 42.80 ± 2.03??g?mL?1 of IAA in the third cycle, which corresponds to a 54% increase in production in relation to the first cycle, whereas free cells began losing activity after the first cycle. After 90 days of storage at 4°C the immobilized cells showed the slight reduction of IAA production without significant loss of activity. PMID:22623901

Celloto, Valéria R.; Oliveira, Arildo J. B.; Gonçalves, José E.; Watanabe, Cecília S. F.; Matioli, Graciette; Gonçalves, Regina A. C.

2012-01-01

22

Cloning, Characterization, and Functional Expression of the Klebsiella oxytoca Xylodextrin Utilization Operon (xynTB) in Escherichia coli†  

PubMed Central

Escherichia coli is being developed as a biocatalyst for bulk chemical production from inexpensive carbohydrates derived from lignocellulose. Potential substrates include the soluble xylodextrins (xyloside, xylooligosaccharide) and xylobiose that are produced by treatments designed to expose cellulose for subsequent enzymatic hydrolysis. Adjacent genes encoding xylobiose uptake and hydrolysis were cloned from Klebsiella oxytoca M5A1 and are functionally expressed in ethanologenic E. coli. The xylosidase encoded by xynB contains the COG3507 domain characteristic of glycosyl hydrolase family 43. The xynT gene encodes a membrane protein containing the MelB domain (COG2211) found in Na+/melibiose symporters and related proteins. These two genes form a bicistronic operon that appears to be regulated by xylose (XylR) and by catabolite repression in both K. oxytoca and recombinant E. coli. Homologs of this operon were found in Klebsiella pneumoniae, Lactobacillus lactis, E. coli, Clostridium acetobutylicum, and Bacillus subtilis based on sequence comparisons. Based on similarities in protein sequence, the xynTB genes in K. oxytoca appear to have originated from a gram-positive ancestor related to L. lactis. Functional expression of xynB allowed ethanologenic E. coli to metabolize xylodextrins (xylosides) containing up to six xylose residues without the addition of enzyme supplements. 4-O-methylglucuronic acid substitutions at the nonreducing termini of soluble xylodextrins blocked further degradation by the XynB xylosidase. The rate of xylodextrin utilization by recombinant E. coli was increased when a full-length xynT gene was included with xynB, consistent with xynT functioning as a symport. Hydrolysis rates were inversely related to xylodextrin chain length, with xylobiose as the preferred substrate. Xylodextrins were utilized more rapidly by recombinant E. coli than K. oxytoca M5A1 (the source of xynT and xynB). XynB exhibited weak arabinosidase activity, 3% that of xylosidase. PMID:14532050

Qian, Yilei; Yomano, L. P.; Preston, J. F.; Aldrich, H. C.; Ingram, L. O.

2003-01-01

23

Complete genome sequence of Klebsiella oxytoca M1, isolated from Manripo area of South Korea.  

PubMed

Here we report the full genome sequence of Klesiella oxytoca M1, isolated from Manripo area of South Korea. The strain K. oxytoca M1 is able to produce either 2,3-butanediol or acetoin selectively by controlling the pH and temperature. PMID:25660421

Shin, Sang Heum; Roh, Hanseong; Kim, Juhyeok; Cho, Sukhyeong; Um, Youngsoon; Lee, Jinwon; Ryu, Yeon-Woo; Chong, Hyonyong; Yang, Kap-Seok

2015-03-20

24

Complete Sequences of Two Plasmids in a blaNDM-1-Positive Klebsiella oxytoca Isolate from Taiwan  

PubMed Central

Genetic determinants of a blaNDM-1-positive, multidrug-resistant bacterial isolate that caused active infection was investigated by DNA sequencing. Two plasmids, pKOX_NDM1 and pKOX-R1, were identified for the Klebsiella oxytoca strain E718. Sequence annotation revealed a blaNDM-1 gene in pKOX_NDM1 and two extended-spectrum ?-lactamase producers (blaCTX-M-3 and blaSHV-12) and a wide array of resistance genes in pKOX-R1. These findings highlight the difficulty in treating multidrug-resistant bacterial infections and the potential danger of emerging resistant enterobacteria. PMID:23752513

Huang, Tzu-Wen; Wang, Jann-Tay; Lauderdale, Tsai-Ling; Liao, Tsai-Lien; Lai, Jui-Fen; Tan, Mei-Chen; Lin, Ann-Chi; Chen, Ying-Tsong; Tsai, Shih-Feng

2013-01-01

25

Improved O2-tolerance in variants of a H2-evolving [NiFe]-hydrogenase from Klebsiella oxytoca HP1.  

PubMed

In this study, we investigated the mechanism of O2 tolerance of Klebsiella oxytoca HP1 H2-evolving hydrogenase 3 (KHyd3) by mutational analysis and three-dimensional structure modeling. Results revealed that certain surface amino acid residues of KHyd3 large subunit, in particular those at the outer entrance of the gas channel, have a visible effect on its oxygen tolerance. Additionally, solution pH, immobilization and O2 partial pressure also affect KHyd3 O2-tolerance to some extent. We propose that the extent of KHyd3 O2-tolerance is determined by a balance between the rate of O2 access to the active center through gas channels and the deoxidation rate of the oxidized active center. Based on our findings, two higher O2-tolerant KHyd3 mutations G300E and G300M were developed. PMID:25747389

Huang, Gang-Feng; Wu, Xiao-Bing; Bai, Li-Ping; Liu, Ke; Jiang, Li-Jing; Long, Min-Nan; Chen, Qing-Xi

2015-04-01

26

Comparative In Vitro Activities of Ciprofloxacin, Clinafloxacin, Gatifloxacin, Levofloxacin, Moxifloxacin, and Trovafloxacin against Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, and Enterobacter aerogenes Clinical Isolates with Alterations in GyrA and ParC Proteins  

Microsoft Academic Search

The in vitro activities of ciprofloxacin, clinafloxacin, gatifloxacin, levofloxacin, moxifloxacin, and trovafloxa- cin were tested against 72 ciprofloxacin-resistant and 28 ciprofloxacin-susceptible isolates of Klebsiella pneu- moniae, Klebsiella oxytoca, Enterobacter cloacae, and Enterobacter aerogenes. Irrespective of the alterations in GyrA and ParC proteins, clinafloxacin exhibited greater activity than all other fluoroquinolones tested against K. pneumoniae and E. aerogenes.

SYLVAIN BRISSE; DANA MILATOVIC; AD C. FLUIT; JAN VERHOEF; NELE MARTIN; SYBILLE SCHEURING; KARL KOHRER; FRANZ-JOSEF SCHMITZ

1999-01-01

27

Removal of nitrate from industrial wastewaters in a pilot plant by nitrate-tolerant Klebsiella oxytoca CECT 4460 and Arthrobacter globiformis CECT 4500  

SciTech Connect

Two strains, a gram-negative bacterium Klebsiella oxytoca CECT 4460 and a gram-positive, mycelium-forming bacterium Arthrobacter globiformis CECT 4500, tolerant to up to 1 M nitrate, were isolated from the grounds of a munitions factory. Under strict aerobic conditions and with appropriate C-sources, growth of these bacteria took place when the nitrate concentration in the medium was below 150 mM. Optimal growth conditions regarding the culture medium composition for the biological removal of nitrate were established in batch cultures. Then, the system was scaled up to a 40-L pilot plant and operated under continuous conditions in a factory with direct waste streams from dinitroethylene glycol production after appropriate dilution with nontreated groundwaters. The level of nitrate in the effluent was below 0.5% of the initial N-load. Nitrite and ammonium were undetectable and the level of the C-source in the effluent was below 50 mg per L. On the basis of these results, the authors conclude that the system worked on site satisfactorily.

Pinar, G.; Ramos, J.L. [Estacion Experimental del Zaidin-Consejo Superior de Investigaciones Cientificas, Granada (Spain). Dept. of Biochemistry and Molecular and Cellular Biology of Plants] [Estacion Experimental del Zaidin-Consejo Superior de Investigaciones Cientificas, Granada (Spain). Dept. of Biochemistry and Molecular and Cellular Biology of Plants; Oliva, J.M.; Sanchez-Barbero, L. [Union Espanola de Explosivos, Madrid (Spain)] [Union Espanola de Explosivos, Madrid (Spain); Calvo, V. [Union Espanola de Explosivos, Burgos (Spain)] [Union Espanola de Explosivos, Burgos (Spain)

1998-06-05

28

Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar  

NASA Astrophysics Data System (ADS)

Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5?. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation 325RLDRD329 and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNA sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.

Moeis, Maelita R.; Berlian, Liska; Suhandono, Sony; Prima, Alex; Komalawati, Eli; Kristianti, Tati

2014-03-01

29

Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar  

SciTech Connect

Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5?. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation {sup 325}RLDRD{sup 329} and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNA sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.

Moeis, Maelita R., E-mail: sony@sith.itb.ac.id; Berlian, Liska, E-mail: sony@sith.itb.ac.id; Suhandono, Sony, E-mail: sony@sith.itb.ac.id; Prima, Alex, E-mail: sony@sith.itb.ac.id; Komalawati, Eli, E-mail: sony@sith.itb.ac.id; Kristianti, Tati, E-mail: sony@sith.itb.ac.id

2014-03-24

30

Wastewater drainage system as an occult reservoir in a protracted clonal outbreak due to metallo-?-lactamase-producing Klebsiella oxytoca.  

PubMed

We describe the epidemiology of a protracted nosocomial clonal outbreak due to multidrug-resistant IMP-8 producing Klebsiella oxytoca (MDRKO) that was finally eradicated by removing an environmental reservoir. The outbreak occurred in the ICU of a Spanish hospital from March 2009 to November 2011 and evolved over four waves. Forty-two patients were affected. First basic (active surveillance, contact precautions and reinforcement of surface cleaning) and later additional control measures (nurse cohorting and establishment of a minimum patient/nurse ratio) were implemented. Screening of ICU staff was repeatedly negative. Initial environmental cultures, including dry surfaces, were also negative. The above measures temporarily controlled cross-transmission but failed to eradicate the epidemic MDRKO strain that reappeared two weeks after the last colonized patients in waves 2 and 3 had been discharged. Therefore, an occult environmental reservoir was suspected. Samples from the drainpipes and traps of a sink were positive; removal of the sink reduced the rate number but did not stop new cases that clustered in a cubicle whose horizontal drainage system was connected with the eliminated sink. The elimination of the horizontal drainage system finally eradicated the outbreak. In conclusion, damp environmental reservoirs (mainly sink drains, traps and the horizontal drainage system) could explain why standard cross-transmission control measures failed to control the outbreak; such reservoirs should be considered even when environmental cultures of surfaces are negative. PMID:23829434

Vergara-López, S; Domínguez, M C; Conejo, M C; Pascual, Á; Rodríguez-Baño, J

2013-11-01

31

Adaptative biochemical pathways and regulatory networks in Klebsiella oxytoca BAS-10 producing a biotechnologically relevant exopolysaccharide during Fe(III)-citrate fermentation  

PubMed Central

Background A bacterial strain previously isolated from pyrite mine drainage and named BAS-10 was tentatively identified as Klebsiella oxytoca. Unlikely other enterobacteria, BAS-10 is able to grow on Fe(III)-citrate as sole carbon and energy source, yielding acetic acid and CO2 coupled with Fe(III) reduction to Fe(II) and showing unusual physiological characteristics. In fact, under this growth condition, BAS-10 produces an exopolysaccharide (EPS) having a high rhamnose content and metal-binding properties, whose biotechnological applications were proven as very relevant. Results Further phylogenetic analysis, based on 16S rDNA sequence, definitively confirmed that BAS-10 belongs to K. oxytoca species. In order to rationalize the biochemical peculiarities of this unusual enterobacteriun, combined 2D-Differential Gel Electrophoresis (2D-DIGE) analysis and mass spectrometry procedures were used to investigate its proteomic changes: i) under aerobic or anaerobic cultivation with Fe(III)-citrate as sole carbon source; ii) under anaerobic cultivations using Na(I)-citrate or Fe(III)-citrate as sole carbon source. Combining data from these differential studies peculiar levels of outer membrane proteins, key regulatory factors of carbon and nitrogen metabolism and enzymes involved in TCA cycle and sugar biosynthesis or required for citrate fermentation and stress response during anaerobic growth on Fe(III)-citrate were revealed. The protein differential regulation seems to ensure efficient cell growth coupled with EPS production by adapting metabolic and biochemical processes in order to face iron toxicity and to optimize energy production. Conclusion Differential proteomics provided insights on the molecular mechanisms necessary for anaeorobic utilization of Fe(III)-citrate in a biotechnologically promising enterobacteriun, also revealing genes that can be targeted for the rational design of high-yielding EPS producer strains. PMID:23176641

2012-01-01

32

Metabolic Changes in Klebsiella oxytoca in Response to Low Oxidoreduction Potential, as Revealed by Comparative Proteomic Profiling Integrated with Flux Balance Analysis  

PubMed Central

Oxidoreduction potential (ORP) is an important physiological parameter for biochemical production in anaerobic or microaerobic processes. However, the effect of ORP on cellular physiology remains largely unknown, which hampers the design of engineering strategies targeting proteins associated with ORP response. Here we characterized the effect of altering ORP in a 1,3-propanediol producer, Klebsiella oxytoca, by comparative proteomic profiling combined with flux balance analysis. Decreasing the extracellular ORP from ?150 to ?240 mV retarded cell growth and enhanced 1,3-propanediol production. Comparative proteomic analysis identified 61 differentially expressed proteins, mainly involved in carbohydrate catabolism, cellular constituent biosynthesis, and reductive stress response. A hypothetical oxidoreductase (HOR) that catalyzes 1,3-propanediol production was markedly upregulated, while proteins involved in biomass precursor synthesis were downregulated. As revealed by subsequent flux balance analysis, low ORP induced a metabolic shift from glycerol oxidation to reduction and rebalancing of redox and energy metabolism. From the integrated protein expression profiles and flux distributions, we can construct a rational analytic framework that elucidates how (facultative) anaerobes respond to extracellular ORP changes. PMID:24584239

Zhu, Yan; Li, Dan; Bao, Guanhui; Wang, Shaohua; Mao, Shaoming; Song, Jiangning; Li, Yin

2014-01-01

33

Characterization of KPC-2-producing Escherichia coli, Citrobacter freundii, Enterobacter cloacae, Enterobacter aerogenes, and Klebsiella oxytoca isolates from a Chinese Hospital.  

PubMed

Twelve nonduplicated KPC-2-producing enterobacterial isolates, including three Escherichia coli, two Citrobacter freundii, two Enterobacter cloacae, four Enterobacter aerogenes, and one Klebsiella oxytoca, were collected from various clinical samples within 18 months (March 2011 to September 2012). Two of the 12 patients died from infections caused by KPC-2-producing pathogens, while the rest of the patients with KPC-2-producing pathogens improved or were cured. The majority of the clinical isolates exhibited a high-level of resistance to oxyimino-cephalosporins and carbapenems, and possessed self-transferable bla(KPC-2)-carrying plasmids with sizes ranging from 20 to 120?kb. Most isolates carried bla(CTX-M) and plasmid-mediated quinolone resistance genes, while some isolates produced 16S rRNA methylases (ArmA or RmtB). The genetic environment of bla(KPC-2) of most clinical strains was consistent with the genetic structure surrounding bla(KPC-2) on the plasmid pKP048, which contains an integration structure of a Tn3-based transposon and partial Tn4401 segment. Inserted fragments (truncated bla(TEM)) were detected upstream of the bla(KPC-2) gene for two E. aerogenes strains. In conclusion, the enterobacterial isolates exhibited sporadic emergence and did not arise by clonal spread at our hospital. The outcome of infections caused by KPC-producing enterobacterial isolates and their mortality were closely associated with the baseline condition of patients. The spread of bla(KPC-2) gene between different enterobacterial species in China was mainly mediated by horizontal transfer of the Tn3-based transposons and not the bla(KPC-2)-carrying plasmids. PMID:24433026

Luo, Yanping; Yang, Jiyong; Ye, Liyan; Guo, Lin; Zhao, Qiang; Chen, Rong; Chen, Yong; Han, Xuelin; Zhao, Jingya; Tian, Shuguang; Han, Li

2014-08-01

34

Hexavalent Molybdenum Reduction to Mo-Blue by a Sodium-Dodecyl-Sulfate-Degrading Klebsiella oxytoca Strain DRY14  

PubMed Central

Bacteria with the ability to tolerate, remove, and/or degrade several xenobiotics simultaneously are urgently needed for remediation of polluted sites. A previously isolated bacterium with sodium dodecyl sulfate- (SDS-) degrading capacity was found to be able to reduce molybdenum to the nontoxic molybdenum blue. The optimal pH, carbon source, molybdate concentration, and temperature supporting molybdate reduction were pH 7.0, glucose at 1.5% (w/v), between 25 and 30?mM, and 25°C, respectively. The optimum phosphate concentration for molybdate reduction was 5?mM. The Mo-blue produced exhibits an absorption spectrum with a maximum peak at 865 nm and a shoulder at 700?nm. None of the respiratory inhibitors tested showed any inhibition to the molybdenum-reducing activity suggesting that the electron transport system of this bacterium is not the site of molybdenum reduction. Chromium, cadmium, silver, copper, mercury, and lead caused approximately 77, 65, 77, 89, 80, and 80% inhibition of the molybdenum-reducing activity, respectively. Ferrous and stannous ions markedly increased the activity of molybdenum-reducing activity in this bacterium. The maximum tolerable concentration of SDS as a cocontaminant was 3?g/L. The characteristics of this bacterium make it a suitable candidate for molybdenum bioremediation of sites cocontaminated with detergent pollutant. PMID:24383052

Halmi, M. I. E.; Zuhainis, S. W.; Yusof, M. T.; Shaharuddin, N. A.; Helmi, W.; Shukor, Y.; Syed, M. A.; Ahmad, S. A.

2013-01-01

35

EFFECTS OF VELOCITY ON THE TRANSPORT OF TWO BACTERIA THROUGH SATURATED SAND. GROUND WATER.  

EPA Science Inventory

Transport of the bacteria Klebsiella oxytoca and Burkholderia cepacia G4PR1 (G4PR1) was investigated in column experiments conducted under conditions that allowed us to quantify sorption under a range of ground water velocities. Column experiments (33 mm I.D. X 114 mm long colu...

36

ENUMERATION, TRANSPORT AND SURVIVAL OF BACTERIA ATTACHED TO GRANULAR ACTIVITATED CARBON IN DRINKING WATER  

EPA Science Inventory

The surfaces of granular activated carbon (GAC), sand, and anthracite particles were found to be populated to the same levels with heterotrophic plate count (HPC) bacteria. GAC supported a greater number of Klebsiella oxytoca than the other two filter media. In a study of operati...

37

On the evolution of the sexually transmitted bacteria Haemophilus ducreyi and Klebsiella granulomatis.  

PubMed

Haemophilus ducreyi and Klebsiella (Calymmatobacterium) granulomatis are sexually transmitted bacteria that cause characteristic, persisting ulceration on external genitals called chancroid and granuloma inguinale, respectively. Those ulcers are endemic in developing countries or exist, as does granuloma inguinale, only in some geographic "hot spots."H. ducreyi is placed in the genus Haemophilus (family Pasteurellacae); however, this phylogenetic position is not obvious. The multiple ways in which the bacterium may be adapted to its econiche through specialized nutrient acquisitions; defenses against the immune system; and virulence factors that increase attachment, fitness, and persistence within genital tissue are discussed below. The analysis of K. granulomatis phylogeny demonstrated a high degree of identity with other Klebsiella species, and the name K. granulomatis comb. nov. was proposed. Because of the difficulty in growing this bacterium on artificial media, its characteristics have not been sufficiently defined. More studies are needed to understand bacterial genetics related to the pathogenesis and evolution of K. granulomatis. PMID:22239475

Lagergård, Teresa; Bölin, Ingrid; Lindholm, Leif

2011-08-01

38

Metabolism of tannin-protein complex by facultatively anaerobic bacteria isolated from koala feces  

Microsoft Academic Search

The metabolic pathways involved in degradation of tannin-protein complex (T-PC) were investigated in various facultatively anaerobic bacteria, with specific reference to fecal isolates from the koala including T-PC-degrading enterobacteria (T-PCDE),Streptococcus bovis, Klebsiella pneumoniae, andK. oxytoca. It was demonstrated that T-PCDE andS. bovis biotype I were capable of degrading protein complexed with gallotannin (a hydrolyzable tannin), but not that complexed with

Ro Osawa; Terry P. Walsh; Steven J. Cork

1993-01-01

39

The "other" gram-negative bacteria in mastitis: Klebsiella, serratia, and more.  

PubMed

Mastitis caused by gram-negative infections is of increasing importance on modern and well-managed dairy farms. Without a doubt, E coli tends to be the most important cause of these gram-negative infections when the data are tallied across farms.1 However, more precise investigation of individual farms often reveals a farm-specific infection pattern where a single gram-negative bacterial species predominates. Several farms with a predominance of “other” gram-negative IMIs may be observed. We have shown the presence of outbreaks on individual dairy farms with K pneumoniae, S marcescens, and Enterobacter cloacae. On farms with a predominance of these “other” gram-negative infections, a detailed epidemiologic investigation may reveal the source of these infections. It is quite surprising to identify the difference in host immune response pattern and the associated clinical and subclinical presentations of IMIs due to the different gram-negative organisms. Experimental and field observations would suggest that among the gram-negative bacterial causes of mastitis, Klebsiella spp are causing the most severe cases, closely followed by E coli and then much less clinical severity is observed in Serratia spp and Enterobacter spp cases. The precise mechanisms that would explain the difference in clinical severity are not known, but the most likely explanation appears to be the structure of the lipid A fraction of the LPS of the bacterial species. Important differences in the lipid A fraction of LPS between and within bacterial species are observed. The prevention of IMIs with gram-negative bacteria has components that are generic across species and components that are species specific. Generic prevention may be obtained by improving hygiene and reducing exposure of teat ends to environmental contamination. Also the use of a J5 bacterin is expected to provide some reduction in severity of gram-negative IMIs across bacterial species. Specific prevention programs will depend on the actual transmission behavior of the dominant species causing IMIs in the herd. Several clonal outbreaks of gram-negative bacterial species have been described. In such situations, optimal milking procedures, segregation and culling of infected animals, and targeted treatment would be advisable. Even more specific are the prevention procedures associated with S marcescens outbreaks, where resistance against specific biocides will lead to transmission of infection through teat disinfectants. Removal of these biocides from the cow environment is than essential. Antimicrobial treatment of gram-negative bacteria has often considered to be of limited value and treatment should be more targeted toward cow survival and reduction of clinical symptoms. More recently, extended treatment with a third-generation cephalosporin was reported to be efficacious in the treatment of E coli and Klebsiella spp but not of E cloacae. Further investigations in effective treatment protocols for gram-negative IMIs are warranted. PMID:22664206

Schukken, Ynte; Chuff, Matt; Moroni, Paolo; Gurjar, Abhijit; Santisteban, Carlos; Welcome, Frank; Zadoks, Ruth

2012-07-01

40

Cultivable endophytic bacteria from leaf bases of Agave tequilana and their role as plant growth promoters  

PubMed Central

Agave tequilana Weber var. ‘Azul’ is grown for the production of tequila, inulin and syrup. Diverse bacteria inhabit plant tissues and play a crucial role for plant health and growth. In this study culturable endophytic bacteria were extracted from leaf bases of 100 healthy Agave tequilana plants. In plant tissue bacteria occurred at mean population densities of 3 million CFU/g of fresh plant tissue. Three hundred endophytic strains were isolated and 16s rDNA sequences grouped the bacteria into eight different taxa that shared high homology with other known sequences. Bacterial endophytes were identified as Acinectobacter sp., A. baumanii, A. bereziniae, Cronobacter sakazakii, Enterobacter hormaechei, Bacillus sp. Klebsiella oxytoca, Pseudomonas sp., Enterococcus casseliflavus, Leuconostoc mesenteroides subsp. mesenteroides and Gluconobacter oxydans. Isolates were confirmed to be plant growth promoting bacteria (PGPB) by their capacities for nitrogen fixation, auxin production, phosphate solubilization, or antagonism against Fusarium oxysporum AC132. E. casseliflavus JM47 and K. oxytoca JM26 secreted the highest concentrations of IAA. The endophyte Acinectobacter sp. JM58 exhibited the maximum values for nitrogen fixation and phosphate solubilization index (PSI). Inhibition of fungi was found in Pseudomonas sp. JM9p and K. oxytoca JM26. Bacterial endophytes show promise for use as bio-inoculants for agave cultivation. Use of endophytes to enhance cultivation of agave may be particularly important for plants produced by micropropagation techniques, where native endophytes may have been lost. PMID:25763038

Martínez-Rodríguez, Julia del C.; la Mora-Amutio, Marcela De; Plascencia-Correa, Luis A.; Audelo-Regalado, Esmeralda; Guardado, Francisco R.; Hernández-Sánchez, Elías; Peña-Ramírez, Yuri J.; Escalante, Adelfo; Beltrán-García, Miguel J.; Ogura, Tetsuya

2014-01-01

41

Cultivable endophytic bacteria from leaf bases of Agave tequilana and their role as plant growth promoters.  

PubMed

Agave tequilana Weber var. 'Azul' is grown for the production of tequila, inulin and syrup. Diverse bacteria inhabit plant tissues and play a crucial role for plant health and growth. In this study culturable endophytic bacteria were extracted from leaf bases of 100 healthy Agave tequilana plants. In plant tissue bacteria occurred at mean population densities of 3 million CFU/g of fresh plant tissue. Three hundred endophytic strains were isolated and 16s rDNA sequences grouped the bacteria into eight different taxa that shared high homology with other known sequences. Bacterial endophytes were identified as Acinectobacter sp., A. baumanii, A. bereziniae, Cronobacter sakazakii, Enterobacter hormaechei, Bacillus sp. Klebsiella oxytoca, Pseudomonas sp., Enterococcus casseliflavus, Leuconostoc mesenteroides subsp. mesenteroides and Gluconobacter oxydans. Isolates were confirmed to be plant growth promoting bacteria (PGPB) by their capacities for nitrogen fixation, auxin production, phosphate solubilization, or antagonism against Fusarium oxysporum AC132. E. casseliflavus JM47 and K. oxytoca JM26 secreted the highest concentrations of IAA. The endophyte Acinectobacter sp. JM58 exhibited the maximum values for nitrogen fixation and phosphate solubilization index (PSI). Inhibition of fungi was found in Pseudomonas sp. JM9p and K. oxytoca JM26. Bacterial endophytes show promise for use as bio-inoculants for agave cultivation. Use of endophytes to enhance cultivation of agave may be particularly important for plants produced by micropropagation techniques, where native endophytes may have been lost. PMID:25763038

Martínez-Rodríguez, Julia Del C; la Mora-Amutio, Marcela De; Plascencia-Correa, Luis A; Audelo-Regalado, Esmeralda; Guardado, Francisco R; Hernández-Sánchez, Elías; Peña-Ramírez, Yuri J; Escalante, Adelfo; Beltrán-García, Miguel J; Ogura, Tetsuya

2014-01-01

42

Fermentation of polysaccharides by Klebsiella and other facultative bacilli  

SciTech Connect

Fermentations of 10 polysaccharides by species of the family Enterobacteriaceae were examined. Algin, guar, karaya, xanthan, and xylan were not fermented by any of the strains tested. Most of the activity was found in the tribe Klebsielleae. Klebseilla oxytoca fermented amylopectin (97% of the strains studied), carrageenan (100%), inulin (68%), polypectate (100%), and tragacanth (100%). Klebsiella pneumoniae fermented amylopectin (91%), carrageenan (100%), and tragacanth (86%). Carraggeenan was also fermented by Enterobacter aerogenes (100%), Enterobacter agglomerans (63%), Enterobacter cloacae (95%), and pectobacterium (38%). pectobacterium shared polypectate fermentation (100%) with K. oxytoca. With one exception, Serratia strains were negative on all polysaccharides. These results, along with other evidence, indicate that (i) the genus Klebsiella is biochemically the most versatile genus of the tribe, (ii) because of its distinct characteristics, K. oxytoca warrants species designation separate from K. pneumoniae, and (iii) some food additives generally considered indigestible can be metabolized by a few species of facultative bacilli, whereas others appear to be resistant.

Ochuba, G.U.; Von Riesen, V.L.

1980-05-01

43

Refactoring the nitrogen fixation gene cluster from Klebsiella oxytoca  

E-print Network

Bacterial genes associated with a single trait are often grouped in a contiguous unit of the genome known as a gene cluster. It is difficult to genetically manipulate many gene clusters because of complex, redundant, and ...

Zhao, Dehua

44

Surveillance of multidrug resistant uropathogenic bacteria in hospitalized patients in Indian  

PubMed Central

Objective To record surveillance, antibiotic resistance of uropathogens of hospitalized patients over a period of 18 months. Methods Urine samples from wards and cabins were used for isolating urinary tract infection (UTI)-causing bacteria that were cultured on suitable selective media and identified by biochemical tests; and their antibiograms were ascertained by Kirby-Bauer's disc diffusion method, in each 6-month interval of the study period, using 18 antibiotics of five different classes. Results From wards and cabins, 1?245 samples were collected, from which 996 strains of bacteria belonging to 11 species were isolated, during April 2011 to September 2012. Two Gram-positive, Staphylococcus aureus (S. aureus) and Enterococcus faecalis (E. faecalis), and nine Gram-negative bacteria, Acinetobacter baumannii, Citrobacter sp., Escherichia coli, Enterobacter aerogenes, Klebsiella pneumoniae, Klebsiella oxytoca, Proteus mirabilis, Proteus vulgaris and Pseudomonas aeruginosa were isolated. Both S. aureus and E. faecalis were vancomycin resistant, and resistant-strains of all pathogens increased in each 6-month period of study. Particularly, all Gram-negatives were resistant to nitrofurantoin and co-trimoxazole, the most preferred antibiotics of empiric therapy for UTI. Conclusions Antibiograms of 11 UTI-causing bacteria recorded in this study indicated moderately higher numbers of strains resistant to each antibiotic studied, generating the fear of precipitating fervent episodes in public health particularly with bacteria, Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae and S. aureus. Moreover, vancomycin resistance in strains of S. aureus and E. faecalis is a matter of concern. PMID:23620859

Mishra, Monali Priyadarsini; Debata, Nagen Kumar; Padhy, Rabindra Nath

2013-01-01

45

Selective medium for the isolation and enumeration of Klebsiella spp.  

PubMed Central

A highly selective medium for the enumeration and isolation of Klebsiella pneumoniae and Klebsiella oxytoca was developed in which the typical colonies were convex and 1 to 2 mm in diameter. Their pigment was either a mucoid pink-red color or a more watery pale red with a dark red center. Relatively little colonial growth occurred for any other bacterial genera, and where such colonies did grow, they could be easily differentiated since the form was atypical. The medium already appears to have potential value as a means of assessing the efficiency of treating sewage and monitoring the microbiological quality of vegetables. PMID:3890736

Wong, S H; Cullimore, D R; Bruce, D L

1985-01-01

46

Bacteria on housefly eggs, Musca domestica, suppress fungal growth in chicken manure through nutrient depletion or antifungal metabolites  

NASA Astrophysics Data System (ADS)

Female houseflies, Musca domestica (Diptera: Muscidae), lay their eggs in ephemeral resources such as animal manure. Hatching larvae compete for essential nutrients with fungi that also colonize such resources. Both the well-known antagonistic relationship between bacteria and fungi and the consistent presence of the bacterium Klebsiella oxytoca on housefly eggs led us to hypothesize (1) that K. oxytoca, and possibly other bacteria on housefly eggs, help curtail the growth of fungal resource competitors and (2) that such fungi indeed adversely affect the development of housefly larvae. Bacteria washed from housefly eggs significantly reduced the growth of fungi in chicken manure. Nineteen bacterial strains and ten fungal strains were isolated from housefly eggs or chicken manure, respectively. Co-culturing each of all the possible bacterium-fungus pairs revealed that the bacteria as a group, but no single bacterium, significantly suppressed the growth of all fungal strains tested. The bacteria's adverse effect on fungi is due to resource nutrient depletion and/or the release of antifungal chemicals. Well-established fungi in resources significantly reduced the number of larval offspring that completed development to adult flies.

Lam, Kevin; Thu, Kelsie; Tsang, Michelle; Moore, Margo; Gries, Gerhard

2009-09-01

47

Characterization of Clinical Isolates of Klebsiella pneumoniae from 19 Laboratories Using the National Committee for Clinical Laboratory Standards Extended-Spectrum  Lactamase Detection Methods  

Microsoft Academic Search

Extended-spectrum b-lactamases (ESBLs) are enzymes found in gram-negative bacilli that mediate resis- tance to extended-spectrum cephalosporins and aztreonam. In 1999, the National Committee for Clinical Laboratory Standards (NCCLS) published methods for screening and confirming the presence of ESBLs in Klebsiella pneumoniae, Klebsiella oxytoca, and Escherichia coli. To evaluate the confirmation protocol, we tested 139 isolates of K. pneumoniae that were

CHRISTINE D. STEWARD; J. KAMILE RASHEED; SUSANNAH K. HUBERT; JAMES W. BIDDLE; PATTI M. RANEY; GREGORY J. ANDERSON; PORTIA P. WILLIAMS; KELLEY L. BRITTAIN; ANTONIO OLIVER; FRED C. TENOVER

2001-01-01

48

Characterization of Clinical Isolates of Klebsiella pneumoniae from 19 Laboratories Using the National Committee for Clinical Laboratory Standards Extended-Spectrum bLactamase Detection Methods  

Microsoft Academic Search

Extended-spectrum b-lactamases (ESBLs) are enzymes found in gram-negative bacilli that mediate resis- tance to extended-spectrum cephalosporins and aztreonam. In 1999, the National Committee for Clinical Laboratory Standards (NCCLS) published methods for screening and confirming the presence of ESBLs in Klebsiella pneumoniae, Klebsiella oxytoca, and Escherichia coli. To evaluate the confirmation protocol, we tested 139 isolates of K. pneumoniae that were

CHRISTINE D. STEWARD; J. KAMILE RASHEED; SUSANNAH K. HUBERT; JAMES W. BIDDLE; PATTI M. RANEY; GREGORY J. ANDERSON; PORTIA P. WILLIAMS; KELLEY L. BRITTAIN; ANTONIO OLIVER; JOHN E. MCGOWAN; FRED C. TENOVER

49

Mutations Which Uncouple Transport and Phosphorylation in the D-Mannitol Phosphotransferase System of Escherichia coli K-12 and Klebsiella pneumoniae 1033-5P14  

Microsoft Academic Search

leted. Other mutants expressed truncated mannitol-specific enzymes II (II Mtl ) which lacked the IIA Mtl or IIBA Mtl domain(s), and the mtlA genes originated either from E. coli K-12 or from Klebsiella pneumoniae 1033-5P14. The dalD gene from Klebsiella oxytoca M5a1 was cloned on single-copy plasmids and transformed into the strains described above. This gene encodes an NAD-dependent D-arabinitol

Susanne Otte; Annette Scholle; Sevket Turgut; Joseph W. Lengeler

2003-01-01

50

Carbapenemase-producing Enterobacteriaceae in a tertiary hospital in Madrid, Spain: high percentage of colistin resistance among VIM-1-producing Klebsiella pneumoniae ST11 isolates.  

PubMed

Here we describe the carbapenemase genes, genetic relatedness and antimicrobial susceptibility data of 123 carbapenemase-producing Enterobacteriaceae (CPE) clinical isolates recovered from 2010 to 2012, comprising Klebsiella pneumoniae (n = 79), Klebsiella oxytoca (n = 13), Serratia marcescens (n = 14), Enterobacter cloacae (n = 12), Enterobacter asburiae (n = 4) and Enterobacter aerogenes (n = 1). VIM-1 was the most common carbapenemase (n = 101) followed by KPC-2 (n = 19), OXA-48 (n = 2) and IMP-22 (n = 1). Among the K. pneumoniae isolates, nine sequence types (STs) were identified but two clones were dominant: ST11 (54/79) containing mainly VIM-1-producing isolates; and ST101 (13/79) constituted by KPC-2-producing strains. Pulsed-field gel electrophoresis (PFGE) showed a higher genetic diversity among the remaining Enterobacteriaceae. Amikacin and fosfomycin were the most active agents with 82.9% and 80.5% susceptibility, respectively. Non-susceptibility to tigecycline was detected in 36.5% of strains. Overall, colistin resistance was 24.7% and was as high as 47% in Enterobacter spp. An increase in colistin resistance from 13.5% to 31.7% was observed among K. pneumoniae isolates during the study period. Resistance was focused on ST11 since 83.3% of colistin-resistant strains belonged to this clone. The high level of colistin resistance observed in this study is worrying with respect to the already limited therapeutic options for infections caused by multidrug-resistant Gram-negative bacteria. PMID:24657043

Pena, Irene; Picazo, Juan J; Rodríguez-Avial, Carmen; Rodríguez-Avial, Iciar

2014-05-01

51

21 CFR 866.3340 - Klebsiella spp. serological reagents.  

Code of Federal Regulations, 2011 CFR

...spp. from cultured isolates derived from clinical specimens. The identification aids in the diagnosis of diseases caused by bacteria belonging to the genus Klebsiella and provides epidemiological information on these diseases. These organisms can...

2011-04-01

52

Efficacy of surface disinfectant cleaners against emerging highly resistant gram-negative bacteria  

PubMed Central

Background Worldwide, the emergence of multidrug-resistant gram-negative bacteria is a clinical problem. Surface disinfectant cleaners (SDCs) that are effective against these bacteria are needed for use in high risk areas around patients and on multi-touch surfaces. We determined the efficacy of several SDCs against clinically relevant bacterial species with and without common types of multidrug resistance. Methods Bacteria species used were ATCC strains; clinical isolates classified as antibiotic-susceptible; and multi-resistant clinical isolates from Klebsiella oxytoca, Klebsiella pneumoniae, and Serratia marcescens (all OXA-48 and KPC-2); Acinetobacter baumannii (OXA-23); Pseudomonas aeruginosa (VIM-1); and Achromobacter xylosoxidans (ATCC strain). Experiments were carried out according to EN 13727:2012 in quadruplicate under dirty conditions. The five evaluated SDCs were based on alcohol and an amphoteric substance (AAS), an oxygen-releaser (OR), surface-active substances (SAS), or surface-active-substances plus aldehydes (SASA; two formulations). Bactericidal concentrations of SDCs were determined at two different contact times. Efficacy was defined as a log10???5 reduction in bacterial cell count. Results SDCs based on AAS, OR, and SAS were effective against all six species irrespective of the degree of multi-resistance. The SASA formulations were effective against the bacteria irrespective of degree of multi-resistance except for one of the four P. aeruginosa isolates (VIM-1). We found no general correlation between SDC efficacy and degree of antibiotic resistance. Conclusions SDCs were generally effective against gram-negative bacteria with and without multidrug resistance. SDCs are therefore suitable for surface disinfection in the immediate proximity of patients. Single bacterial isolates, however, might have reduced susceptibility to selected biocidal agents. PMID:24885029

2014-01-01

53

The antigens contributing to the serological cross-reactions of Proteus antisera with Klebsiella representatives.  

PubMed

Proteus sp. and Klebsiella sp. mainly cause infections of the urinary and respiratory tracts or wounds in humans. The representatives of both genera produce virulence factors like lipopolysaccharide (LPS) or outer membrane proteins (OMPs) having much in common in the structures and/or functions. To check how far this similarity is revealed in the serological cross-reactivity, the bacterial masses of 24 tested Klebsiella sp. strains were tested in ELISA with polyclonal rabbit antisera specific to the representatives of 79 Proteus O serogroups. The strongest reacting systems were selected to Western blot, where the majority of Klebsiella masses reacted in a way characteristic for electrophoretic patterns of proteins. The strongest reactions were obtained for proteins of near 67 and 40 kDa and 12.5 kDa. Mass spectrometry analysis of the proteins samples of one Proteus sp. and one Klebsiella sp. strain showed the GroEL like protein of a sequence GI number 2980926 to be similar for both strains. In Western blot some Klebsiella sp. masses reacted similarly to the homologous Proteus LPSs. The LPS contribution in the observed reactions of the high molecular-mass LPS species was confirmed for Klebsiella oxytoca 0.062. PMID:25510650

Palusiak, Agata

2015-03-01

54

Novel methylotrophic bacteria isolated from the River Thames (London, UK).  

PubMed

Enrichment and elective culture for methylotrophs from sediment of the River Thames in central London yielded a diversity of pure cultures representing several genera of Gram-negative and Gram-positive bacteria, which were mainly of organisms not generally regarded as typically methylotrophic. Substrates leading to successful isolations included methanol, monomethylamine, dimethylamine, trimethylamine, methanesulfonate and dimethylsulfone. Several isolates were studied in detail and shown by their biochemical and morphological properties and 16S rRNA gene sequencing to be Sphingomonas melonis strain ET35, Mycobacterium fluoranthenivorans strain DSQ3, Rhodococcus erythropolis strain DSQ4, Brevibacterium casei strain MSQ5, Klebsiella oxytoca strains MMA/F and MMA/1, Pseudomonas mendocina strain TSQ4, and Flavobacterium sp. strains MSA/1 and MMA/2. The results show that facultative methylotrophy is present across a wide range of Bacteria, suggesting that turnover of diverse C(1)-compounds is of much greater microbiological and environmental significance than is generally thought. The origins of the genes encoding the enzymes of methylotrophy in diverse heterotrophs need further study, and could further our understanding of the phylogeny and antiquity of methylotrophic systems. PMID:18681896

Boden, Rich; Thomas, Elizabeth; Savani, Parita; Kelly, Donovan P; Wood, Ann P

2008-12-01

55

Endogenous Klebsiella pneumoniae endophthalmitis.  

PubMed

Klebsiella pneumonia is a common human pathogen, and endogenous endophthalmitis is a vision-threatening infection presentedwith pain, redness, decreased vision acuity, and intraocular inflammation. Endogenous endophthalmitis caused by Klebsiella pneumoniae is uncommon and usually happens in patients with immunosuppression conditions. Diabetes is a predisposing risk factor, and liver abscess is a major source of Klebsiella pneumonia endogenous endophthalmitis (KPEE). Here, we report a case of KPEE in a patient who lost his vision in one eye after treatment. PMID:24768670

Yin, Wenpeng; Zhou, Haijiang; Li, Chunsheng

2014-10-01

56

Empirical prediction and validation of antibacterial inhibitory effects of various plant essential oils on common pathogenic bacteria.  

PubMed

In this study, fractional compound composition, antioxidant capacity, and phenolic substance content of 14 plant essential oils-anise (Pimpinella anisum), bay leaves (Laurus nobilis), cinnamon bark (Cinnamomum verum), clove (Eugenia caryophyllata), fennel (Foeniculum vulgare), hop (Humulus lupulus), Istanbul oregano (Origanum vulgare subsp. hirtum), Izmir oregano (Origanum onites), mint (Mentha piperita), myrtus (Myrtus communis), orange peel (Citrus sinensis), sage (Salvia officinalis), thyme (Thymbra spicata), and Turkish oregano (Origanum minutiflorum)-were related to inhibition of 10 bacteria through multiple linear or non-linear (M(N)LR) models-four Gram-positive bacteria of Listeria innocua, coagulase-negative staphylococci, Staphylococcus aureus, and Bacillus subtilis, and six Gram-negative bacteria of Yersinia enterocolitica, Salmonella Enteritidis, Salmonella Typhimurium, Proteus mirabilis, Escherichia coli O157:H7, and Klebsiella oxytoca. A total of 65 compounds with different antioxidant capacity, phenolic substance content and antibacterial properties were detected with 14 plant essential oils. The best-fit M(N)LR models indicated that relative to anise essential oil, the essential oils of oreganos, cinnamon, and thyme had consistently high inhibitory effects, while orange peel essential oil had consistently a low inhibitory effect. Regression analysis indicated that beta-bisabolene (Turkish and Istanbul oreganos), and terpinolene (thyme) were found to be the most inhibitory compounds regardless of the bacteria type tested. PMID:25764982

Akdemir Evrendilek, Gulsun

2015-06-01

57

Phenotypic characterization of human pathogenic bacteria in fish from the coastal waters of South West Cameroon: public health implications.  

PubMed

Increasing economic and recreational opportunities, attractive scenery and a perception of a better quality of life are luring people to the coast. Unfortunately, these activities together with the commensurate increase in population in the area inevitably result in pollution of coastal waters with excessive microorganisms and other pollutants. Microbial pollutants not only contaminate the coastal water but also aquatic food sources, thus posing a health risk to consumers. Fish is a major source of protein in Cameroon, especially in the coastal areas. In this study, we investigated the microbiological quality of fish from the Limbe and Tiko beaches in South West Cameroon from May to October 2007. We isolated human pathogenic bacteria from three anatomic sites (skin, gills, intestine) of 50 fish (150 specimens) and investigated their susceptibility patterns to a battery of antibiotics. Data were analyzed statistically using chi2 with significance set at p < .05. Eleven bacterial species were identified, including Escherichia coli type 1 (20.8%), Citrobacter fruendii (16.4%), Proteus vulgaris (13%), Klebsiella pneumoniae (12.1%), Klebsiella ozaenae (7.7%), Enterobacter cloacae (7.2%), Klebsiella oxytoca (5.8%), Serratia marcescens (4.8%), Serratia odorifera (4.8%), Hafnia alvei (4.4%) and Proteus penneri (2.9%). More contaminated fish were found at Limbe beach than at Tiko beach (61.4% versus 38.6%, respectively (p < .05)). When ranking contamination with respect to anatomic site, skin was the most contaminated (40.6%) specimen and gills the least (28.5%). Ciprofloxacillin, ofloxacillin, and cotrimoxazole were the most effective antibiotics against all isolates, exhibiting 100% sensitivity. Almost half of the isolates (45.7%) were resistant to ampicillin. The results of our study demonstrate that fish from the coastal waters of South West Cameroon are a source of human pathogenic and opportunistic bacteria; hence this finding has public health implications. PMID:19658320

Akoachere, Jane-Francis T K; Bughe, Rhoda N; Oben, Benedicta O; Ndip, Lucy M; Ndip, Roland N

2009-01-01

58

Impact of Gram-negative bacteria in interaction with a complex microbial consortium on biogenic amine content and sensory characteristics of an uncooked pressed cheese.  

PubMed

The impact of Gram-negative bacteria on sensory characteristics and production of volatile compounds as well as biogenic amines (BA) in the core of an uncooked pressed type model cheese was investigated in the presence of a defined complex microbial consortium. Eleven strains of Gram-negative bacteria, selected on the basis of their biodiversity and in vitro BA-production ability, were individually tested in a model cheese. Four out of 6 strains of Enterobacteriaceae (Citrobacter freundii UCMA 4217, Klebsiella oxytoca 927, Hafnia alvei B16 and Proteus vulgaris UCMA 3780) reached counts close to 6 log CFU g?¹ in the model cheese. In core of cheeses inoculated with Gram-negative bacteria, only slight differences were observed for microbial counts (Enterococcus faecalis or Lactobacillus plantarum count differences below 1 log CFU g?¹), acetate concentration (differences below 200 mg kg?¹) and texture (greater firmness) in comparison to control cheeses. Cheese core colour, odour and volatile compound composition were not modified. Although ornithine, the precursor of putrescine, was present in all cheeses, putrescine was only detected in cheeses inoculated with H. alvei B16 and never exceeded 2.18 mmol kg?¹ cheese dry matter. Cadaverine was only detected in cheeses inoculated with H. alvei B16, K. oxytoca 927, Halomonas venusta 4C1A or Morganella morganii 3A2A but at lower concentrations (<1.05 mmol kg?¹ cheese dry matter), although lysine was available. Only insignificant amounts of the detrimental BA histamine and tyramine, as well as isopentylamine, tryptamine or phenylethylamine, were produced in the cheese model by any of the Gram-negative strains, including those which produced these BA at high levels in vitro. PMID:22265286

Delbès-Paus, Céline; Pochet, Sylvie; Helinck, Sandra; Veisseire, Philippe; Bord, Cécile; Lebecque, Annick; Coton, Monika; Desmasures, Nathalie; Coton, Emmanuel; Irlinger, Françoise; Montel, Marie-Christine

2012-05-01

59

Phage Associated Bacteriocins Reveal a Novel Mechanism for Bacteriocin Diversification in Klebsiella  

Microsoft Academic Search

Ninety-six isolates of Klebsiellapneumoniae and K.oxytoca were recovered from wild mammals in Australia. 14.6% of these bacteria produce killing phenotypes that suggest the production of bacteriocin toxins. Cloning and sequencing of the gene clusters encoding two of these killing phenotypes revealed two instances of a bacteriocin associated with a bacteriophage gene, the first such genetic organization described. The newly identified

Milind Chavan; Hamid Rafi; John Wertz; Carla Goldstone; Margaret A. Riley

2005-01-01

60

Antimicrobial Effect of the Triterpene 3?,6?,16?-Trihydroxylup-20(29)-ene on Planktonic Cells and Biofilms from Gram Positive and Gram Negative Bacteria  

PubMed Central

This study evaluated the antimicrobial effect of 3?,6?,16?-trihydroxylup-20(29)-ene (CLF1), a triterpene isolated from Combretum leprosum Mart., in inhibiting the planktonic growth and biofilms of Gram positive bacteria Streptococcus mutans and S. mitis. The antimicrobial activity was assessed by determining the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC). The antibiofilm potential was determined by quantifying total biomass and enumerating biofilm-entrapped viable bacteria. In addition, the acute toxicity of CLF1 on Artemia sp. nauplii was also determined. The results showed that CLF1 was able in inhibiting the growth of S. mutans and S. mitis with MIC and MBC of 7.8??g/mL and 15.6??g/mL, respectively. CLF1 was highly effective on biofilms of both bacteria. Only 7.8??g/mL CLF1 was enough to inhibit by 97% and 90% biomass production of S. mutans and S. mitis, respectively. On the other hand, such effects were not evident on Gram negative Pseudomonas aeruginosa and Klebsiella oxytoca. The toxicity tests showed that the LC50 of CLF1 was 98.19??g/mL. Therefore, CLF1 isolated from C. leprosum may constitute an important natural agent for the development of new therapies for caries and other infectious diseases caused by S. mutans and S. mitis. PMID:25093179

Evaristo, Francisco Flávio Vasconcelos; Albuquerque, Maria Rose Jane R.; dos Santos, Hélcio Silva; Bandeira, Paulo Nogueira; Ávila, Fábio do Nascimento; da Silva, Bruno Rocha; Vasconcelos, Ariana Azevedo; Rabelo, Érica de Menezes; Nascimento-Neto, Luiz Gonzaga; Arruda, Francisco Vassiliepe Sousa; Vasconcelos, Mayron Alves; Carneiro, Victor Alves; Cavada, Benildo Sousa; Teixeira, Edson Holanda

2014-01-01

61

Klebsiella: Harmless to Problematic  

Microsoft Academic Search

BACKGROUND: Klebsiella pneumoniae (KPNE), previously an innocuous bug in our pediatric burn unit, changed its characteristics recently. A 13-year-old male was admitted from Mexico with a third-degree 60% TBSA flame burn. We isolated from his burn wound tracheal aspirate, banked autograft skin, and grew a KPNE sensitive only to Amikacin and Gentamycin. Over the next 3 months, this organism was

L. McCoy; E. Carino; A. Sanford; J. Heggers

2004-01-01

62

Prospective observational study of Klebsiella bacteremia in 230 patients: outcome for antibiotic combinations versus monotherapy.  

PubMed

Combination antimicrobial agent therapy has been advocated for treatment of gram-negative bacteremia, including that caused by Klebsiella spp. We performed a prospective, observational, 10-hospital collaborative study to evaluate the efficacy of antibiotic combination therapy versus that of monotherapy for 230 consecutive patients with Klebsiella bacteremia. The species involved were K. pneumoniae (82%), K. oxytoca (15%), and K. ozaenae (0.4%). Of the bacteremias, 26% were polymicrobial in nature. A total of 53% of cases were nosocomial infections. The most common portals were the urinary tract (28%), biliary tract (12%), lung (10%), and abdomen (9%). Some 49 and 51% of the patients had received monotherapy and antibiotic combination therapy (beta-lactam plus aminoglycoside), respectively; 14-day mortalities in the two groups were 20 and 18%, respectively. However, for the subgroup of patients who experienced hypotension within 72 h prior to or on the day of the positive blood culture, those patients who received combination therapy experienced significantly lower mortality (24%) than did those who received monotherapy (50%). We conclude that monotherapy with an antibiotic that is active in vitro against Klebsiella (beta-lactam or aminoglycoside) is sufficient therapy for less severely ill patients (immunocompetent, urinary tract portal, mentally alert, normal vital signs). On the other hand, for severely ill patients who experience hypotension, antibiotic combination therapy with a beta-lactam and an aminoglycoside agent is preferred. PMID:1482131

Korvick, J A; Bryan, C S; Farber, B; Beam, T R; Schenfeld, L; Muder, R R; Weinbaum, D; Lumish, R; Gerding, D N; Wagener, M M

1992-12-01

63

Diversity of bacteria nesting the plant cover of north Sinai deserts, Egypt  

PubMed Central

North Sinai deserts were surveyed for the predominant plant cover and for the culturable bacteria nesting their roots and shoots. Among 43 plant species reported, 13 are perennial (e.g. Fagonia spp., Pancratium spp.) and 30 annuals (e.g. Bromus spp., Erodium spp.). Eleven species possessed rhizo-sheath, e.g. Cyperus capitatus, Panicum turgidum and Trisetaria koelerioides. Microbiological analyses demonstrated: the great diversity and richness of associated culturable bacteria, in particular nitrogen-fixing bacteria (diazotrophs); the majority of bacterial residents were of true and/or putative diazotrophic nature; the bacterial populations followed an increasing density gradient towards the root surfaces; sizeable populations were able to reside inside the root (endorhizosphere) and shoot (endophyllosphere) tissues. Three hundred bacterial isolates were secured from studied spheres. The majority of nitrogen-fixing bacilli isolates belonged to Bacillus megaterium,Bacillus pumilus, Bacillus polymexa,Bacillus macerans,Bacillus circulans and Bacillus licheniformis. The family Enterobacteriaceae represented by Enterobacter agglomerans,Enterobacter sackazakii, Enterobacter cloacae, Serratia adorifera,Serratia liquefaciens and Klebsiella oxytoca. The non-Enterobacteriaceae population was rich in Pantoae spp., Agrobacterium rdiobacter, Pseudomonas vesicularis, Pseudomonas putida, Stenotrophomonas maltophilia, Ochrobactrum anthropi, Sphingomonas paucimobilis and Chrysemonas luteola.Gluconacetobacter diazotrophicus were reported inside root and shoot tissues of a number of tested plants. The dense bacterial populations reported speak well to the very possible significant role played by the endophytic bacterial populations in the survival, in respect of nutrition and health, of existing plants. Such groups of diazotrophs are good candidates, as bio-preparates, to support the growth of future field crops grown in deserts of north Sinai and irrigated by the water of El-Salam canal. PMID:25685397

Hanna, Amira L.; Youssef, Hanan H.; Amer, Wafaa M.; Monib, Mohammed; Fayez, Mohammed; Hegazi, Nabil A.

2012-01-01

64

Diversity of bacteria nesting the plant cover of north Sinai deserts, Egypt.  

PubMed

North Sinai deserts were surveyed for the predominant plant cover and for the culturable bacteria nesting their roots and shoots. Among 43 plant species reported, 13 are perennial (e.g. Fagonia spp., Pancratium spp.) and 30 annuals (e.g. Bromus spp., Erodium spp.). Eleven species possessed rhizo-sheath, e.g. Cyperus capitatus, Panicum turgidum and Trisetaria koelerioides. Microbiological analyses demonstrated: the great diversity and richness of associated culturable bacteria, in particular nitrogen-fixing bacteria (diazotrophs); the majority of bacterial residents were of true and/or putative diazotrophic nature; the bacterial populations followed an increasing density gradient towards the root surfaces; sizeable populations were able to reside inside the root (endorhizosphere) and shoot (endophyllosphere) tissues. Three hundred bacterial isolates were secured from studied spheres. The majority of nitrogen-fixing bacilli isolates belonged to Bacillus megaterium, Bacillus pumilus, Bacillus polymexa, Bacillus macerans, Bacillus circulans and Bacillus licheniformis. The family Enterobacteriaceae represented by Enterobacter agglomerans, Enterobacter sackazakii, Enterobacter cloacae, Serratia adorifera, Serratia liquefaciens and Klebsiella oxytoca. The non-Enterobacteriaceae population was rich in Pantoae spp., Agrobacterium rdiobacter, Pseudomonas vesicularis, Pseudomonas putida, Stenotrophomonas maltophilia, Ochrobactrum anthropi, Sphingomonas paucimobilis and Chrysemonas luteola. Gluconacetobacter diazotrophicus were reported inside root and shoot tissues of a number of tested plants. The dense bacterial populations reported speak well to the very possible significant role played by the endophytic bacterial populations in the survival, in respect of nutrition and health, of existing plants. Such groups of diazotrophs are good candidates, as bio-preparates, to support the growth of future field crops grown in deserts of north Sinai and irrigated by the water of El-Salam canal. PMID:25685397

Hanna, Amira L; Youssef, Hanan H; Amer, Wafaa M; Monib, Mohammed; Fayez, Mohammed; Hegazi, Nabil A

2013-01-01

65

Effect of algae and plant lectins on planktonic growth and biofilm formation in clinically relevant bacteria and yeasts.  

PubMed

This study aimed to evaluate the abilities of plant and algae lectins to inhibit planktonic growth and biofilm formation in bacteria and yeasts. Initially, ten lectins were tested on Staphylococcus epidermidis, Staphylococcus aureus, Klebsiella oxytoca, Pseudomonas aeruginosa, Candida albicans, and C. tropicalis at concentrations of 31.25 to 250? ? g/mL. The lectins from Cratylia floribunda (CFL), Vatairea macrocarpa (VML), Bauhinia bauhinioides (BBL), Bryothamnion seaforthii (BSL), and Hypnea musciformis (HML) showed activities against at least one microorganism. Biofilm formation in the presence of the lectins was also evaluated; after 24?h of incubation with the lectins, the biofilms were analyzed by quantifying the biomass (by crystal violet staining) and by enumerating the viable cells (colony-forming units). The lectins reduced the biofilm biomass and/or the number of viable cells to differing degrees depending on the microorganism tested, demonstrating the different characteristics of the lectins. These findings indicate that the lectins tested in this study may be natural alternative antimicrobial agents; however, further studies are required to better elucidate the functional use of these proteins. PMID:24982871

Vasconcelos, Mayron Alves; Arruda, Francisco Vassiliepe Sousa; Carneiro, Victor Alves; Silva, Helton Colares; Nascimento, Kyria Santiago; Sampaio, Alexandre Holanda; Cavada, Benildo; Teixeira, Edson Holanda; Henriques, Mariana; Pereira, Maria Olivia

2014-01-01

66

Effect of Algae and Plant Lectins on Planktonic Growth and Biofilm Formation in Clinically Relevant Bacteria and Yeasts  

PubMed Central

This study aimed to evaluate the abilities of plant and algae lectins to inhibit planktonic growth and biofilm formation in bacteria and yeasts. Initially, ten lectins were tested on Staphylococcus epidermidis, Staphylococcus aureus, Klebsiella oxytoca, Pseudomonas aeruginosa, Candida albicans, and C. tropicalis at concentrations of 31.25 to 250??g/mL. The lectins from Cratylia floribunda (CFL), Vatairea macrocarpa (VML), Bauhinia bauhinioides (BBL), Bryothamnion seaforthii (BSL), and Hypnea musciformis (HML) showed activities against at least one microorganism. Biofilm formation in the presence of the lectins was also evaluated; after 24?h of incubation with the lectins, the biofilms were analyzed by quantifying the biomass (by crystal violet staining) and by enumerating the viable cells (colony-forming units). The lectins reduced the biofilm biomass and/or the number of viable cells to differing degrees depending on the microorganism tested, demonstrating the different characteristics of the lectins. These findings indicate that the lectins tested in this study may be natural alternative antimicrobial agents; however, further studies are required to better elucidate the functional use of these proteins. PMID:24982871

Vasconcelos, Mayron Alves; Arruda, Francisco Vassiliepe Sousa; Carneiro, Victor Alves; Silva, Helton Colares; Nascimento, Kyria Santiago; Sampaio, Alexandre Holanda; Cavada, Benildo; Teixeira, Edson Holanda; Henriques, Mariana

2014-01-01

67

Duodenal-Mucosal Bacteria Associated with Celiac Disease in Children  

PubMed Central

Celiac disease (CD) is an immune-mediated enteropathy triggered by the ingestion of cereal gluten proteins. This disorder is associated with imbalances in the gut microbiota composition that could be involved in the pathogenesis of CD. The aim of this study was to characterize the composition and diversity of the cultivable duodenal mucosa-associated bacteria of CD patients and control children. Duodenal biopsy specimens from patients with active disease on a gluten-containing diet (n = 32), patients with nonactive disease after adherence to a gluten-free diet (n = 17), and controls (n = 8) were homogenized and plated on plate count agar, Wilkins-Chalgren agar, brain heart agar, or yeast, Casitone, and fatty acid agar. The isolates were identified by partial 16S rRNA gene sequencing. Renyi diversity profiles showed the highest diversity values for active CD patients, followed by nonactive CD patients and control individuals. Members of the phylum Proteobacteria were more abundant in patients with active CD than in the other child groups, while those of the phylum Firmicutes were less abundant. Members of the families Enterobacteriaceae and Staphylococcaceae, particularly the species Klebsiella oxytoca, Staphylococcus epidermidis, and Staphylococcus pasteuri, were more abundant in patients with active disease than in controls. In contrast, members of the family Streptococcaceae were less abundant in patients with active CD than in controls. Furthermore, isolates of the Streptococcus anginosus and Streptococcus mutans groups were more abundant in controls than in both CD patient groups, regardless of inflammatory status. The findings indicated that the disease is associated with the overgrowth of possible pathobionts that exclude symbionts or commensals that are characteristic of the healthy small intestinal microbiota. PMID:23835180

Sánchez, Ester; Donat, Ester; Ribes-Koninckx, Carmen; Fernández-Murga, Maria Leonor

2013-01-01

68

Effects of inoculation of Poa pratensis and Triticum aestivum with root-associated, N 2 -fixing Klebsiella, Enterobacter and Azospirillum  

Microsoft Academic Search

Strains ofKlebsiella pneumoniae, Klebsiella terrigena, Enterobacter agglomerans andAzospirillum lipoferum were compared as diazotrophic inoculants in association withPoa pratensis andTriticum aestivum. Each strain colonized both plants in numbers ranging from 104 to 107 bacteria per root, and electron microscopy and immunofluorescence staining of inoculated roots revealed bacteria mainly on\\u000a root hairs. Indirect immunofluorescence with specific antifimbriae antibodies showed that the enteric

Kielo Haahtela; Tuula Laakso; Eeva-Liisa Nurmiaho-Lassila; Timo K. Korhonen

1988-01-01

69

Genotoxic Klebsiella pneumoniae in Taiwan  

PubMed Central

Background Colibactin is a nonribosomal peptide-polyketide synthesized by multi-enzyme complexes encoded by the pks gene cluster. Colibactin-producing Escherichia coli have been demonstrated to induce host DNA damage and promote colorectal cancer (CRC) development. In Taiwan, the occurrence of pyogenic liver abscess (PLA) has been suggested to correlate with an increasing risk of CRC, and Klebsiella pneumoniae is the predominant PLA pathogen in Taiwan Methodology/Principal Findings At the asn tRNA loci of the newly sequenced K. pneumoniae 1084 genome, we identified a 208-kb genomic island, KPHPI208, of which a module identical to the E. coli pks colibactin gene cluster was recognized. KPHPI208 consists of eight modules, including the colibactin module and the modules predicted to be involved in integration, conjugation, yersiniabactin production, microcin production, and unknown functions. Transient infection of BALB/c normal liver cells with K. pneumoniae 1084 increased the phosphorylation of histone H2AX, indicating the induction of host DNA damage. Colibactin was required for the genotoxicity of K. pneumoniae 1084, as it was diminished by deletion of clbA gene and restored to the wild type level by trans-complementation with a clbA coding plasmid. Besides, BALB/c mice infected with K. pneumoniae 1084 exhibited enhanced DNA damage in the liver parenchymal cells when compared to the isogenic clbA deletion mutant. By PCR detection, the prevalence of pks-positive K. pneumoniae in Taiwan is 25.6%, which is higher than that reported in Europe (3.5%), and is significantly correlated with K1 type, which predominantly accounted for PLA in Taiwan. Conclusions Our knowledge regarding how bacteria contribute to carcinogenesis has just begun. The identification of genotoxic K. pneumoniae and its genetic components will facilitate future studies to elucidate the molecular basis underlying the link between K. pneumoniae, PLA, and CRC. PMID:24852749

Lai, Yi-Chyi; Lin, Ann-Chi; Chiang, Ming-Ko; Dai, Yu-Han; Hsu, Chih-Chieh; Lu, Min-Chi; Liau, Chun-Yi; Chen, Ying-Tsong

2014-01-01

70

www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-print Network

, mastitis- causing species are Klebsiella pneumoniae and K. oxytoca, but treatment and control is similar Administrator, 1890 Extension Program, Virginia State, Petersburg. PUBLICATION 404-223 Klebsiella spp. Klebsiella spp. are Gram-negative bacteria, similar in structure to Escherichia coli. The most common

Liskiewicz, Maciej

71

Rapid Identification of Carbapenemase Genes in Gram-Negative Bacteria with an Oligonucleotide Microarray-Based Assay  

PubMed Central

Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well as selected extended (ESBL) and narrow spectrum (NSBL) beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13), blaGIM (2/2), blaKPC (27/27), blaNDM (5/5), blaIMP-2/4/7/8/13/14/15/16/31 (10/10), blaOXA-23 (12/13), blaOXA-40-group (7/7), blaOXA-48-group (32/33), blaOXA-51 (1/1) and blaOXA-58 (1/1). Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16), blaOXA-2 (4/4), blaOXA-9 (33/33), OXA-10 (3/3), blaOXA-51 (25/25), blaOXA-58 (2/2), CTX-M1/M15 (17/17) and blaVIM (1/1)]. In direct comparison to phenotypical identification obtained by VITEK or MALDI-TOF systems, 114 of 117 (97.4%) isolates, including Acinetobacter baumannii (28/28), Enterobacter spec. (5/5), Escherichia coli (4/4), Klebsiella pneumoniae (62/63), Klebsiella oxytoca (0/2), Pseudomonas aeruginosa (12/12), Citrobacter freundii (1/1) and Citrobacter braakii (2/2), were correctly identified by a panel of species specific probes. This assay might be easily extended, adapted and transferred to point of care platforms enabling fast surveillance, rapid detection and appropriate early treatment of infections caused by multiresistant Gram-negative bacteria. PMID:25068267

Braun, Sascha D.; Monecke, Stefan; Thürmer, Alexander; Ruppelt, Antje; Makarewicz, Oliwia; Pletz, Mathias; Reißig, Annett; Slickers, Peter; Ehricht, Ralf

2014-01-01

72

Rapid identification of carbapenemase genes in gram-negative bacteria with an oligonucleotide microarray-based assay.  

PubMed

Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well as selected extended (ESBL) and narrow spectrum (NSBL) beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13), blaGIM (2/2), blaKPC (27/27), blaNDM (5/5), blaIMP-2/4/7/8/13/14/15/16/31 (10/10), blaOXA-23 (12/13), blaOXA-40-group (7/7), blaOXA-48-group (32/33), blaOXA-51 (1/1) and blaOXA-58 (1/1). Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16), blaOXA-2 (4/4), blaOXA-9 (33/33), OXA-10 (3/3), blaOXA-51 (25/25), blaOXA-58 (2/2), CTX-M1/M15 (17/17) and blaVIM (1/1)]. In direct comparison to phenotypical identification obtained by VITEK or MALDI-TOF systems, 114 of 117 (97.4%) isolates, including Acinetobacter baumannii (28/28), Enterobacter spec. (5/5), Escherichia coli (4/4), Klebsiella pneumoniae (62/63), Klebsiella oxytoca (0/2), Pseudomonas aeruginosa (12/12), Citrobacter freundii (1/1) and Citrobacter braakii (2/2), were correctly identified by a panel of species specific probes. This assay might be easily extended, adapted and transferred to point of care platforms enabling fast surveillance, rapid detection and appropriate early treatment of infections caused by multiresistant Gram-negative bacteria. PMID:25068267

Braun, Sascha D; Monecke, Stefan; Thürmer, Alexander; Ruppelt, Antje; Makarewicz, Oliwia; Pletz, Mathias; Rei?ig, Annett; Slickers, Peter; Ehricht, Ralf

2014-01-01

73

Studies on water quality and pathogenic bacteria in coastal water Langkawi, Malaysia.  

PubMed

A study on physico-chemical parameters and pathogenic bacterial community was carried out at the coastal waters of Pulau Tuba island, Langkawi. The physico-chemical parameters such as temperature (27.43-28.88 degrees C), dissolved oxygen (3.79-6.49 mg l(-1)), pH (7.72-8.20), salinity (33.10-33.96 ppt), total dissolved solids (32.27-32.77 g l(-1)) and specific conductivity (49.83-51.63 mS cm(-1)) were observed. Station 3 and station 4 showed highest amount of nitrates (26.93 and 14.61 microg at N l(-1)) than station 1 (2.04 microg at N l(-1)) and station 2 (4.18 microg at N l(-1)). The highest concentration (12.4 +/- microg l(-1)) of chlorophyll a was observed in station 4 in October 2005. High phosphorus content (561 microg P l(-1)) was found in the station 2. Thirteen bacterial isolates were successfully identified using API 20E system. The highest amount of bacteria was observed at Station 4 (3400 CFU ml(-1)) and the lowest numberwas at Station 2 (890 CFU ml(-1)). Out of identified 13 Gram-negative bacterial isolates dominant species were Aeromonas hydrophila, Klebsiella oxytoca, Pseudomonas baumannii, Vibrio vulnificus, Proteus mirabilis, Providencia alcalifaciens and Serratia liquefaciens. Apart from this, oil biodegrading Pseudomonas putida were also identified. The study reveals the existing status of water quality is still conducive and the reasonably diverse with Gram-negative bacteria along the Pulau Tuba Langkawi. PMID:23360015

Jalal, K C A; Faizul, H N Noor; Naim, M Azrul; John, B Akbar; Kamaruzzaman, B Y

2012-07-01

74

Occurrence of yeasts, enterococci and other enteric bacteria in subgingival biofilm of HIV-positive patients with chronic gingivitis and necrotizing periodontitis  

PubMed Central

The purpose of this study was to determine the prevalence of enteric bacteria and yeasts in biofilm of 80 HIV-positive patients with plaque-associated gingivitis or necrotizing periodontitis. Patients were subjected to extra, intra oral and radiographic examinations. The oral hygiene, bleeding on probing, gingival conditions, and attachment loss were evaluated. Clinical specimens were collected from gingival crevices or periodontal pockets, transferred to VMGA III, diluted and transferred to Sabouraud Dextrose agar with 100 ?g/ml of chloramphenicol, peptone water, EVA broth, EMB agar, SS agar, Bile esculin agar and Brilliant green agar. Isolation of yeasts was carried out at room temperature, for 3-7 days; and for the isolation of enteric microorganisms plates were incubated at 37°C, for 24-48 h. The yeasts identification was performed according to the carbon and nitrogen assimilation, fermentation of carbohydrates and germ tube formation. Bacteria were identified according to their colonial and cellular morphologies and biochemical tests. Yeasts were identified as Candida albicans and its occurrence was more common in patients with CD4+ below 200/mm3 and was affected by the extension of periodontal involvement (P = 0.0345). Enteric bacteria recovered from clinical specimens were identified as Enterobacter sakazakii, Enterobacter cloacae, Serratia liquefaciens, Klebsiella oxytoca and Enterococcus sp. Enterobacteriaceae and enterococci were detected in 32.5% of clinical samples from patients with necrotizing periodontitis. In conclusion, non-oral pathogenic bacteria and C. albicans were more prevalent in periodontal sites of HIV-positive patients with necrotizing periodontitis and chronic gingivitis. PMID:24031212

Gaetti-Jardim Júnior, Elerson; Nakano, Viviane; Wahasugui, Thais C.; Cabral, Fátima C.; Gamba, Rosa; Avila-Campos, Mario Julio

2008-01-01

75

Hypervirulent (hypermucoviscous) Klebsiella pneumoniae  

PubMed Central

A new hypervirulent (hypermucoviscous) variant of Klebsiella pneumoniae has emerged. First described in the Asian Pacific Rim, it now increasingly recognized in Western countries. Defining clinical features are the ability to cause serious, life-threatening community-acquired infection in younger healthy hosts, including liver abscess, pneumonia, meningitis and endophthalmitis and the ability to metastatically spread, an unusual feature for enteric Gram-negative bacilli in the non-immunocompromised. Despite infecting a healthier population, significant morbidity and mortality occurs. Although epidemiologic features are still being defined, colonization, particularly intestinal colonization, appears to be a critical step leading to infection. However the route of entry remains unclear. The majority of cases described to date are in Asians, raising the issue of a genetic predisposition vs. geospecific strain acquisition. The traits that enhance its virulence when compared with “classical” K. pneumoniae are the ability to more efficiently acquire iron and perhaps an increase in capsule production, which confers the hypermucoviscous phenotype. An objective diagnostic test suitable for routine use in the clinical microbiology laboratory is needed. If/when these strains become increasingly resistant to antimicrobials, we will be faced with a frightening clinical scenario. PMID:23302790

Shon, Alyssa S.; Bajwa, Rajinder P.S.; Russo, Thomas A.

2013-01-01

76

Enrichment and Identification of Cellulolytic Bacteria from the Gastrointestinal Tract of Giant African Snail, Achatina fulica.  

PubMed

The cellulolytic bacterial community structure in gastrointestinal (GI) tract of Achatina fulica was studied using culture-independent and -dependent methods by enrichment in carboxymethyl cellulose (CMC). Culture-dependent method indicated that GI tract of snail was dominated by Enterobacteriaceae members. When tested for cellulase activities, all isolates obtained by culture-dependent method showed both or either of CMCase or avicelase activity. Isolate identified as Citrobacter freundii showed highest CMCase and medium avicelase activity. Sequencing of clones from the 16S rRNA gene clone library identified ten operational taxonomic units (OTUs), which were affiliated to Enterobacteriaceae of phylum Gammaproteobacteria. Of these ten OTUs, eight OTUs closely matched with Enterobacter and Klebsiella genera. The most abundant OTU allied to Klebsiella oxytoca accounted for 70 % of the total sequences. The members of Klebsiella and Enterobacter were observed by both methods indicating their dominance among the cellulolytic bacterial community in the GI tract of the snail. PMID:25432338

Pawar, Kiran D; Dar, Mudasir A; Rajput, Bharati P; Kulkarni, Girish J

2015-02-01

77

Population dynamics of bacteria associated with different strains of the pine wood nematode Bursaphelenchus xylophilus after inoculation in maritime pine (Pinus pinaster).  

PubMed

For a long time it was thought that Bursaphelenchus xylophilus was the only agent of the pine wilt disease. Recently, it was discovered that there are bacteria associated with the nematodes that contribute to the pathogenesis of this disease, mainly through the release of toxins that promote the death of the pines. Among the species most commonly found, are bacteria belonging to the Bacillus, Pantoea, Pseudomonas and Xanthomonas genera. The main objective of this work was to study the effect of inoculation of maritime pine (Pinus pinaster) with four different nematode isolates, in the bacterial population of nematodes and trees, at different stages of disease progression. The monitoring of progression of disease symptoms was also recorded. Also, the identification of bacteria isolated from the xylem of trees and the surface of nematodes was performed by classical identification methods, by the API20E identification system and by sequencing of bacterial DNA. The results showed that for the symptoms progression, the most striking difference was observed for the pines inoculated with the avirulent isolate, C14-5, which led to a slower and less severe aggravation of symptoms than in pines inoculated with the virulent isolates. In general, it was found that bacterial population, inside the tree, increased with disease progression. A superior bacterial quantity was isolated from pines inoculated with the nematode isolates HF and 20, and, comparatively, few bacteria were isolated from pines inoculated with the avirulent isolate. The identification system API20E was insufficient in the identification of bacterial species; Enterobacter cloacae species was identified in 79% of the isolated bacterial colonies and seven of these colonies could not be identified by this method. Molecular identification methods, through bacterial DNA sequencing, allowed a more reliable identification: eleven different bacterial species within the Bacillus, Citrobacter, Enterobacter, Escherichia, Klebsiella, Paenibacillus, Pantoea and Terribacillus genera were identified. General bacterial diversity increased with the progression of the disease. Bacillus spp. were predominant at the earlier stage of disease progression and Klebsiella oxytoca at the later stages. Furthermore, bacterial species isolated from the surface of nematodes were similar to those isolated from the xylem of pines. In the present work new bacterial species were identified which have never been reported before in this type of study and may be associated with their geographical origin (Portugal). P. pinaster, the pine species used in this study, was different from those commonly grown in Japan and China. Furthermore, it was the first time that bacteria were isolated and identified from an avirulent pine wood nematode isolate. PMID:21570967

Roriz, Mariana; Santos, Carla; Vasconcelos, Marta W

2011-08-01

78

Molecular characterization of antimicrobial resistance in Gram-negative bacteria isolated from bovine mastitis in Egypt.  

PubMed

The aim of this study was to characterize the genetic basis of multidrug resistance in Gram-negative bacteria isolated from bovine mastitis cases in Egypt. Multidrug resistance phenotypes were found in 34 of 112 (30.4%) Gram-negative bacterial isolates, which harbored at least one antimicrobial resistance gene. The most prevalent multidrug-resistant (MDR) species were Enterobacter cloacae (8 isolates, 7.1%), Klebsiella pneumoniae (7 isolates, 6.3%), Klebsiella oxytoca (7 isolates, 6.3%), Escherichia coli (5 isolates, 4.5%), and Citrobacter freundii (3 isolates, 2.7%). The most commonly observed resistance phenotypes were against ampicillin (97.0%), streptomycin (94.1%), tetracycline (91.2%), trimethoprim-sulfamethoxazole (88.2%), nalidixic acid (85.3%), and chloramphenicol (76.5%). Class 1 integrons were detected in 28 (25.0%) isolates. The gene cassettes within class 1 integrons included those encoding resistance to trimethoprim (dfrA1, dfrA5, dfrA7, dfrA12, dfrA15, dfrA17, and dfrA25), aminoglycosides (aadA1, aadA2, aadA5, aadA7, aadA12, aadA22, and aac(3)-Id), chloramphenicol (cmlA), erythromycin (ereA2), and rifampicin (arr-3). Class 2 integrons were identified in 6 isolates (5.4%) with three different profiles. Furthermore, the ?-lactamase encoding genes, bla(TEM), bla(SHV), bla(CTX-M), and bla(OXA), the plasmid-mediated quinolone resistance genes, qnr and aac(6)-Ib-cr, and the florfenicol resistance gene, floR, were also identified. To the best of our knowledge, the results identified class 2 integrons, qnr and aac(6)-Ib-cr from cases of mastitis for the first time. This is the first report of molecular characterization for antimicrobial resistance in Gram-negative bacteria isolated from bovine mastitis in Africa. PMID:21338385

Ahmed, Ashraf M; Shimamoto, Tadashi

2011-05-01

79

Prevalence and Antimicrobial Susceptibility Patterns of Bacteria from Milkmen and Cows with Clinical Mastitis in and around Kampala, Uganda  

PubMed Central

Background Identification of pathogens associated with bovine mastitis is helpful in treatment and management decisions. However, such data from sub-Saharan Africa is scarce. Here we describe the distribution and antimicrobial susceptibility patterns of bacteria from cows with clinical mastitis in Kampala, Uganda. Due to high concern of zoonotic infections, isolates from milkmen are also described. Methodology/Principal Findings Ninety seven milk samples from cows with clinical mastitis and 31 nasal swabs from milkmen were collected (one sample per cow/human). Fifty eight (60%) Gram-positive isolates namely Staphylococci (21), Enterococci (16), Streptococci (13), Lactococci (5), Micrococci (2) and Arcanobacteria (1) were detected in cows; only one grew Staphylococcus aureus. Furthermore, 24 (25%) coliforms namely Escherichia coli (12), Klebsiella oxytoca (5), Proteus vulgaris (2), Serratia (2), Citrobacter (1), Cedecea (1) and Leclercia (1) were identified. From humans, 24 Gram-positive bacteria grew, of which 11 were Staphylococci (35%) including four Staphylococcus aureus. Upon susceptibility testing, methicillin-resistant coagulase-negative staphylococci (CoNS) were prevalent; 57%, 12/21 in cows and 64%, 7/11 in humans. However, methicillin-resistant Staphylococcus aureus was not detected. Furthermore, methicillin and vancomycin resistant CoNS were detected in cows (Staphylococcus hominis, Staphylococcus lugdunensis) and humans (Staphylococcus scuiri). Also, vancomycin and daptomycin resistant Enterococci (Enterococcus faecalis and Enterococcus faecium, respectively) were detected in cows. Coliforms were less resistant with three pan-susceptible isolates. However, multidrug resistant Klebsiella, Proteus, Serratia, Cedecea, and Citrobacter were detected. Lastly, similar species grew from human and bovine samples but on genotyping, the isolates were found to be different. Interestingly, human and bovine Staphylococcus aureus were genetically similar (spa-CC435, spa-type t645 corresponding to ST121) but with different susceptibility patterns. Conclusions/Significance CoNS, Enterococci, Streptococci, and Escherichia coli are the predominant pathogens associated with clinical bovine-mastitis in Kampala, Uganda. Multidrug resistant bacteria are also prevalent. While similar species occurred in humans and cows, transmission was not detected. PMID:23667611

Kateete, David Patrick; Kabugo, Usuf; Baluku, Hannington; Nyakarahuka, Luke; Kyobe, Samuel; Okee, Moses; Najjuka, Christine Florence; Joloba, Moses Lutaakome

2013-01-01

80

KLEBSIELLA TO SALMONELLA GENE TRANSFER WITHIN RUMEN PROTOZOA: IMPLICATIONS FOR ANTIBIOTIC RESISTANCE AND RUMEN DEFAUNATION  

Technology Transfer Automated Retrieval System (TEKTRAN)

The rumen has long been known to be a site of gene transfer for microorganisms. Rumen protozoa (RPz) are active predators of bacteria that can harbor antibiotic resistance genes. In this study, RPz were assessed as sites of gene transfer between two bacterial species, Salmonella and Klebsiella. O...

81

Role of Antibiotic Penetration Limitation in Klebsiella pneumoniae Biofilm Resistance to Ampicillin and Ciprofloxacin  

Microsoft Academic Search

The penetration of two antibiotics, ampicillin and ciprofloxacin, through biofilms developed in an in vitro model system was investigated. The susceptibilities of biofilms and corresponding freely suspended bacteria to killing by the antibiotics were also measured. Biofilms of Klebsiella pneumoniae were developed on microporous membranes resting on agar nutrient medium. The susceptibilities of planktonic cultures and biofilms to 10 times

JEFF N. ANDERL; MICHAEL J. FRANKLIN; PHILIP S. STEWART

2000-01-01

82

RESEARCH ARTICLE Open Access Klebsiella pneumoniae related community-  

E-print Network

RESEARCH ARTICLE Open Access Klebsiella pneumoniae related community- acquired acute lower, Klebsiella pneumoniae (KP) is the second pathogen responsible for community-acquired pneumonia. Yet, very-sector hospitals. Keywords: Klebsiella pneumoniae, Community-acquired, Pneumonia, Extended-spectrum betalactamases

Paris-Sud XI, Université de

83

Molecular analysis of type 3 fimbrial genes from Escherichia coli, Klebsiella and Citrobacter species  

PubMed Central

Background Catheter-associated urinary tract infection (CAUTI) is the most common nosocomial infection in the United States and is caused by a range of uropathogens. Biofilm formation by uropathogens that cause CAUTI is often mediated by cell surface structures such as fimbriae. In this study, we characterised the genes encoding type 3 fimbriae from CAUTI strains of Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Citrobacter koseri and Citrobacter freundii. Results Phylogenetic analysis of the type 3 fimbrial genes (mrkABCD) from 39 strains revealed they clustered into five distinct clades (A-E) ranging from one to twenty-three members. The majority of sequences grouped in clade A, which was represented by the mrk gene cluster from the genome sequenced K. pneumoniae MGH78578. The E. coli and K. pneumoniae mrkABCD gene sequences clustered together in two distinct clades, supporting previous evidence for the occurrence of inter-genera lateral gene transfer. All of the strains examined caused type 3 fimbriae mediated agglutination of tannic acid treated human erythrocytes despite sequence variation in the mrkD-encoding adhesin gene. Type 3 fimbriae deletion mutants were constructed in 13 representative strains and were used to demonstrate a direct role for type 3 fimbriae in biofilm formation. Conclusions The expression of functional type 3 fimbriae is common to many Gram-negative pathogens that cause CAUTI and is strongly associated with biofilm growth. Our data provides additional evidence for the spread of type 3 fimbrial genes by lateral gene transfer. Further work is now required to substantiate the clade structure reported here by examining more strains as well as other bacterial genera that make type 3 fimbriae and cause CAUTI. PMID:20576143

2010-01-01

84

Ethanol from lignocellulosic wastes with utilization of recombinant bacteria.  

PubMed

This article presents the advanced technology that has been developed by BioEnergy International of Gainesville, Florida, utilizing novel recombinant strains of bacteria developed by Lonnie Ingram of the University of Florida. The first commercial applications of these unique fermenting organisms convert 5-carbon sugars, as well as 6-carbon sugars, and oligomers of cellulose (e.g., cellobiose and cellotriose) directly to ethanol. The proposed systems that will be utilized for conversion of agricultural wastes, mixed waste papers, and pulp and paper mill waste in forthcoming commercial installations are now under design. This involves the extensive experience of Raphael Katzen Associates International, Inc. in acid hydrolysis, enzyme production, enzymatic hydrolysis, large-scale fermentation engineering, and distillation/dehydration. Specific examples of this advanced technology will be presented in different applications, namely: 1. Conversion of the hemicellulose content of sugar cane bagasse to 5-carbon sugars by mild-acid prehydrolysis, followed by fermentation of the 5-carbon sugar extract with recombinant Escherichia coli in a commercial installation soon to be under construction in Brazil. This unique process utilizes the surplus hemicellulose fraction of bagasse not required for steam and power generation to produce ethanol, additional to that from the original can juice, which has been converted by conventional sucrose fermentation to ethanol. The process also recovers and converts to ethanol the majority of sucrose normally lost with the bagasse fibers. Resultant beer is enriched in an innovative process to eliminate the need for incremental rectification capacity. 2. Application of this technology to mixed waste paper in Florida, with a moderate loading of newsprint (85% mechanical wood fiber), will involve a mild-acid prehydrolysis, the partial extraction of the 5-carbon sugars produced from hemicellulose as a feedstock for propagation of the recombinant Klebsiella oxytoca bacterium. Included is a facility providing for in-house production of cellulase enzyme, as an active whole broth for direct use in simultaneous saccharification and fermentation (SSF) of the remaining cellulose and residual 5-carbon sugars to ethanol. This is followed by distillation and dehydration in the advanced commercially available low-energy recovery system. 3. Another potential application of this unique technology involves utilization of a variety of wastes from several pulp and paper mills in close proximity, permitting collection of these wastes at low cost and reducing the considerable cost encountered in disposing of such low-energy wet waste.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:8010771

Katzen, R; Fowler, D E

1994-01-01

85

Methionine-to-Cysteine Recycling in Klebsiella aerogenes  

PubMed Central

In the enteric bacteria Escherichia coli and Salmonella enterica, sulfate is reduced to sulfide and assimilated into the amino acid cysteine; in turn, cysteine provides the sulfur atom for other sulfur-bearing molecules in the cell, including methionine. These organisms cannot use methionine as a sole source of sulfur. Here we report that this constraint is not shared by many other enteric bacteria, which can use either cysteine or methionine as the sole source of sulfur. The enteric bacterium Klebsiella aerogenes appears to use at least two pathways to allow the reduced sulfur of methionine to be recycled into cysteine. In addition, the ability to recycle methionine on solid media, where cys mutants cannot use methionine as a sulfur source, appears to be different from that in liquid media, where they can. One pathway likely uses a cystathionine intermediate to convert homocysteine to cysteine and is induced under conditions of sulfur starvation, which is likely sensed by low levels of the sulfate reduction intermediate adenosine-5?-phosphosulfate. The CysB regulatory proteins appear to control activation of this pathway. A second pathway may use a methanesulfonate intermediate to convert methionine-derived methanethiol to sulfite. While the transsulfurylation pathway may be directed to recovery of methionine, the methanethiol pathway likely represents a general salvage mechanism for recovery of alkane sulfide and alkane sulfonates. Therefore, the relatively distinct biosyntheses of cysteine and methionine in E. coli and Salmonella appear to be more intertwined in Klebsiella. PMID:11114934

Seiflein, Thomas A.; Lawrence, Jeffrey G.

2001-01-01

86

Enterobacter and Klebsiella species isolated from fresh vegetables marketed in Valencia (Spain) and their clinically relevant resistances to chemotherapeutic agents.  

PubMed

Occurrence of antibiotic-resistant pathogenic or commensal enterobacteria in marketed agricultural foodstuffs may contribute to their incorporation into the food chain and constitutes an additional food safety concern. In this work, we have determined the clinically relevant resistances to 11 common chemotherapeutic agents in Enterobacter and Klebsiella isolates from fresh vegetables from various sources (supermarkets and greengrocers' shops in Valencia, Spain). A total of 96 isolates were obtained from 160 vegetables analyzed (50% positive samples): 68 Enterobacter isolates (59 E. cloacae, two E. aerogenes, two E. cancerogenus, one E. gergoviae, and four E. sakazakii, currently Cronobacter spp.), and 28 Klebsiella isolates (19 K. oxytoca and 9 K. pneumoniae). Only seven isolates were susceptible to all agents tested, and no resistances to ceftazidime, ciprofloxacin, gentamicin, and chloramphenicol were detected. Most isolates were resistant to amoxicillin/clavulanic acid (74 [58 Enterobacter and 16 Klebsiella]) or to ampicillin (80 [55/25]). Other resistances were less frequent: nitrofurantoin (13 isolates [12/1]), tetracycline (6 [5/1]), co-trimoxazole (3 [3/0]), cefotaxime (1 [1/0]), and streptomycin (2 [1/1]). Multiresistant isolates to two (56 [41/15]), three (10 E. cloacae isolates), four (one E. cloacae and one K. pneumoniae isolate), and five (two E. cloacae isolates) chemotherapeutic agents were also detected. The presence of potential pathogens points to marketed fresh produce, which often is eaten raw, as a risk factor for consumer health. In addition, these results support the usefulness of these bacterial species as indicators of the spreading of antibiotic resistances into the environment, particularly in the food chain, and suggest their role as carriers of resistance determinants from farms to consumers, which may constitute an additional "silent" food safety concern. Therefore, there is a need to improve the hygienic quality of marketed fresh vegetables, from better methods to prevent contamination in the farms to the use of sanitizing practices at home. PMID:23980710

Falomir, María Pilar; Rico, Hortensia; Gozalbo, Daniel

2013-12-01

87

[Pyogenic liver abscess caused by Klebsiella pneumoniae].  

PubMed

Pyogenic liver abscess caused by Klebsiella pneumoniae is usually found in Southeast Asia, while in Europe Escherichia coli, Streptococcus or Staphylococcus are most common. In case of a failed ultrasound controlled abscess, aspiration surgical treatment is indicated. This paper reports the clinical case of pyogenic liver abscess caused by Klebsiella pneumoniae, which was treated by operative drainage. A 60-year-old patient was transferred to our institution from the University Hospital for Infectious Diseases with septic temperature, abdominal pain and finding of Klebsiella pneumoniae liver abscess (resistant to antibiotic therapy). Additional laboratory tests and abdominal MSCT scan confirmed the initial diagnosis. The localization of abscesses technically prevented ultrasound-controlled abscess aspiration and drainage; after appropriate preparation, operative liver abscess incision and drainage were performed. Microbiological examination of the abscess sample revealed Klebsiella pneumoniae as the cause of liver abscess. PMID:23814976

Zorici?, Ivan; Vukusi?, Darko; Sever, Marko; Lojo, Nermin; Bari?, Marko

2012-10-01

88

Klebsiella pneumoniae: a progression to multidrug resistance   

E-print Network

Klebsiella pneumoniae is a common cause of nosocomial and community-acquired infections, and the increasing incidence and prevalence of antibiotic resistant strains is proving to be particularly problematic to clinicians. ...

Findlay, Jacqueline

2012-06-22

89

Nasopharyngeal Carriage of Klebsiella pneumoniae and Other Gram-Negative Bacilli in Pneumonia-Prone Age Groups in Semarang, Indonesia  

PubMed Central

Gram-negative bacilli (GNB) cause many cases of pneumonia in Indonesia. We investigated nasopharyngeal carriage of GNB in Semarang, Indonesia. Klebsiella pneumoniae carriage in adults (15%) was higher than in children (7%) (P = 0.004), while that of other GNB was comparable. Poor food and water hygiene are determinants of carriage of these bacteria. PMID:23486716

Severin, Juliëtte A.; Gasem, M. Hussein; Keuter, Monique; van den Broek, Peterhans; Hermans, Peter W. M.; Wahyono, Hendro; Verbrugh, Henri A.

2013-01-01

90

Interaction of cationic dye\\/surfactants with Klebsiella K18 capsular polysaccharides: Physicochemical studies  

Microsoft Academic Search

Physico-chemical studies on the interaction of capsular polysaccharide (SPS) isolated from Klebsiella K18, with cationic dyes and surfactants have been reported. SPS is an integral component of gram-negative bacteria and having glucuronic acid as the potential anionic site, induced strong metachromasy (blue shift ?110nm) in the cationic dye pinacyanol chloride (PCYN). Reversal of metachromasy was observed upon addition of co-solvents

Ranendu Kumar Nath; Th. Charanjit Singh; Satwati Dasgupta; Asish Mitra; Amiya Kumar Panda

2010-01-01

91

Klebsiella species associated with bovine mastitis in Newfoundland.  

PubMed

Klebsiella spp. is a common cause of bovine mastitis, but information regarding its molecular epidemiology is lacking from many parts of the world. On using mass spectrometry and partial sequencing of the rpoB gene, it was found that over a one year study, K. variicola and Enterobacter cloacae were misidentified as K. pneumoniae in a small number of clinical mastitis (CM) cases from Newfoundland. Results suggest that the currently used standard biochemical/phenotypic tests lack the sensitivity required to accurately discriminate among the three mentioned Gram negative bacteria. In addition, a single strain of K. variicola was associated with CM from one farm in the study as demonstrated by Random Amplified Polymorphic DNA (RAPD) PCR. To the best of our knowledge, K. variicola, which is normally found in the environment, has not been isolated previously from milk obtained from cows with CM. Therefore, it is possible that K. variicola was not detected in milk samples in the past due to the inability of standard tests to discriminate it from other Klebsiella species. PMID:25180510

Podder, Milka P; Rogers, Laura; Daley, Peter K; Keefe, Greg P; Whitney, Hugh G; Tahlan, Kapil

2014-01-01

92

Klebsiella Species Associated with Bovine Mastitis in Newfoundland  

PubMed Central

Klebsiella spp. is a common cause of bovine mastitis, but information regarding its molecular epidemiology is lacking from many parts of the world. On using mass spectrometry and partial sequencing of the rpoB gene, it was found that over a one year study, K. variicola and Enterobacter cloacae were misidentified as K. pneumoniae in a small number of clinical mastitis (CM) cases from Newfoundland. Results suggest that the currently used standard biochemical/phenotypic tests lack the sensitivity required to accurately discriminate among the three mentioned Gram negative bacteria. In addition, a single strain of K. variicola was associated with CM from one farm in the study as demonstrated by Random Amplified Polymorphic DNA (RAPD) PCR. To the best of our knowledge, K. variicola, which is normally found in the environment, has not been isolated previously from milk obtained from cows with CM. Therefore, it is possible that K. variicola was not detected in milk samples in the past due to the inability of standard tests to discriminate it from other Klebsiella species. PMID:25180510

Podder, Milka P.; Rogers, Laura; Daley, Peter K.; Keefe, Greg P.; Whitney, Hugh G.; Tahlan, Kapil

2014-01-01

93

Prevalence of hypermucoid Klebsiella pneumoniae among wild-caught and captive vervet monkeys (Chlorocebus aethiops sabaeus) on the island of St. Kitts.  

PubMed

Invasive, hypermucoid Klebsiella pneumoniae causes severe abscess formation in humans and in certain species of nonhuman primates. We conducted a survey of captive and wild-caught African green monkeys, or vervets (Chlorocebus aethiops sabaeus), on the Caribbean island of St. Kitts to assess their carriage rate of Klebsiella spp. Forty percent of rectal swabs from captive monkeys were positive for K. pneumoniae, and 20% of wild-caught animals were positive. Two wild-caught monkeys (4%) were positive for K. oxytoca, and one monkey (2%) was found to be infected with a hypermucoid rmpA-positive K. pneumoniae strain. Genotyping of this strain showed that it had an indistinguishable random amplified polymorphic DNA fingerprint to a strain that caused fatal abscessation in several African green monkeys in a research colony in the USA in 2005. This is the first report of hypermucoid K. pneumoniae isolation from a wild population of nonhuman primates and represents a potential health risk to these animals, as well as to the humans who come in contact with them. PMID:20688708

Whitehouse, Chris A; Keirstead, Natalie; Taylor, Justin; Reinhardt, Jessica L; Beierschmitt, Amy

2010-07-01

94

Evaluation of an Automated Rapid Diagnostic Assay for Detection of Gram-Negative Bacteria and Their Drug-Resistance Genes in Positive Blood Cultures  

PubMed Central

We evaluated the performance of the Verigene Gram-Negative Blood Culture Nucleic Acid Test (BC-GN; Nanosphere, Northbrook, IL, USA), an automated multiplex assay for rapid identification of positive blood cultures caused by 9 Gram-negative bacteria (GNB) and for detection of 9 genes associated with ?-lactam resistance. The BC-GN assay can be performed directly from positive blood cultures with 5 minutes of hands-on and 2 hours of run time per sample. A total of 397 GNB positive blood cultures were analyzed using the BC-GN assay. Of the 397 samples, 295 were simulated samples prepared by inoculating GNB into blood culture bottles, and the remaining were clinical samples from 102 patients with positive blood cultures. Aliquots of the positive blood cultures were tested by the BC-GN assay. The results of bacterial identification between the BC-GN assay and standard laboratory methods were as follows: Acinetobacter spp. (39 isolates for the BC-GN assay/39 for the standard methods), Citrobacter spp. (7/7), Escherichia coli (87/87), Klebsiella oxytoca (13/13), and Proteus spp. (11/11); Enterobacter spp. (29/30); Klebsiella pneumoniae (62/72); Pseudomonas aeruginosa (124/125); and Serratia marcescens (18/21); respectively. From the 102 clinical samples, 104 bacterial species were identified with the BC-GN assay, whereas 110 were identified with the standard methods. The BC-GN assay also detected all ?-lactam resistance genes tested (233 genes), including 54 blaCTX-M, 119 blaIMP, 8 blaKPC, 16 blaNDM, 24 blaOXA-23, 1 blaOXA-24/40, 1 blaOXA-48, 4 blaOXA-58, and 6 blaVIM. The data shows that the BC-GN assay provides rapid detection of GNB and ?-lactam resistance genes in positive blood cultures and has the potential to contributing to optimal patient management by earlier detection of major antimicrobial resistance genes. PMID:24705449

Tojo, Masayoshi; Fujita, Takahiro; Ainoda, Yusuke; Nagamatsu, Maki; Hayakawa, Kayoko; Mezaki, Kazuhisa; Sakurai, Aki; Masui, Yoshinori; Yazaki, Hirohisa; Takahashi, Hiroshi; Miyoshi-Akiyama, Tohru; Totsuka, Kyoichi; Kirikae, Teruo; Ohmagari, Norio

2014-01-01

95

Haematogenous infection of a total knee arthroplasty with Klebsiella pneumoniae  

PubMed Central

This case report describes a prosthetic joint infection due to the haematogenous spread of Klebsiella pneumoniae from a genitourinary focus. Prior to the infection, the patient was diagnosed with early stage prostatic carcinoma, which had been successfully treated with surgery. However, in the time period following surgical treatment, the patient suffered recurring urinary tract infections. During the course of these recurring infections, he developed a concurrent bacterial infection of his total knee arthroplasty. Two sequential joint aspirates revealed K pneumoniae to be the cause. Therefore, two-stage revision total knee arthroplasty was performed. This case reiterates the fact that invasive therapeutic procedures can cause bacteraemia resulting in infection of a joint replacement. We would therefore like to emphasise the importance of prophylactic antibiotic treatment prior to invasive therapies, particularly in organs with potentially large counts of bacteria. PMID:23592813

Pepke, Wojciech; Lehner, Burkhard; Bekeredjian-Ding, Isabelle; Egermann, Marcus

2013-01-01

96

Pathogenicity of Propionibacterium acnes in mixed infections with facultative bacteria  

Microsoft Academic Search

Summary. Single and mixed infections with 11 clinical isolates of Propionibacterium acnes and three facultative bacteria (Staphylococcus aureus, Escherichia coli and Klebsiella pneumoniae) were studied in a subcutaneous abscess model in mice. Abscesses were induced by pure cultures of six of 11 strains of P. acnes and by the three facultative bacteria. The abscesses produced by each of the six

I. Brook

1991-01-01

97

RESEARCH ARTICLE Open Access Comparative analysis of Klebsiella pneumoniae  

E-print Network

RESEARCH ARTICLE Open Access Comparative analysis of Klebsiella pneumoniae genomes identifies Background: Klebsiella pneumoniae strains are pathogenic to animals and humans, in which they are both, Lipid metabolism Background Klebsiella pneumoniae is responsible for a variety of dis- eases in humans

Paris-Sud XI, Université de

98

No carbapenem resistance in pneumonia caused by Klebsiella species.  

PubMed

Klebsiella species are a common cause of community- and nosocomial-acquired pneumonia. Antibiotic resistance to the class of carbapenem in patients with pneumonia caused by Klebsiella species is unusual. New studies report carbapenem resistance in patients with pneumonia caused by Klebsiella species.This article examines, retrospectively, antibiotic resistance in patients with community- and nosocomial-acquired pneumonia caused by Klebsiella species.The data of all patients with community- and nosocomial-acquired pneumonia caused by Klebsiella species were collected from the hospital charts at the HELIOS Clinic, Witten/Herdecke University, Wuppertal, Germany, within the study period 2004 to 2014. An antibiogram was created from all of the study patients with pneumonia caused by Klebsiella species. Sensitivity and resistance profiles were performed for the different antibiotics that have been consistently used in the treatment of patients with pneumonia caused by Klebsiella species. All demographic, clinical, and laboratory data of all of the patients with pneumonia caused by Klebsiella species were collected from the patients' records.During the study period of January 1, 2004, to August 12, 2014, 149 patients were identified with community- and nosocomial-acquired pneumonia affected by Klebsiella species. These patients had a mean age of 70.6?±?13 (107 [71.8%, 95% CI 64.6%-79%] men and 42 [28.2%, 95% CI 21%-35.4%] women). In all of the patients with pneumonia caused by Klebsiella species, there was resistance to ampicillin (P?Klebsiella species (75.3%) also showed resistance to piperacillin (P?Klebsiella species showed resistance to imipenem or meropenem (P?Klebsiella species. PMID:25674753

Yayan, Josef; Ghebremedhin, Beniam; Rasche, Kurt

2015-02-01

99

Plasmid-Mediated Antibiotic Resistance and Virulence in Gram-negatives: the Klebsiella pneumoniae Paradigm  

PubMed Central

Summary Plasmids harbor genes coding for specific functions including virulence factors and antibiotic resistance that permit bacteria to survive the hostile environment found in the host and resist treatment. Together with other genetic elements such as integrons and transposons, and using a variety of mechanisms, plasmids participate in the dissemination of these traits resulting in the virtual elimination of barriers among different kinds of bacteria. In this article we review the current information about physiology and role in virulence and antibiotic resistance of plasmids from the gram-negative opportunistic pathogen Klebsiella pneumoniae. This bacterium has acquired multidrug resistance and is the causative agent of serious communityand hospital-acquired infections. It is also included in the recently defined ESKAPE group of bacteria that cause most of US hospital infections. PMID:25705573

Ramirez, Maria S.; Traglia, German M.; Lin, David L.; Tran, Tung; Tolmasky, Marcelo E.

2015-01-01

100

Emphysematous prostatic abscess due to Klebsiella pneumoniae  

Microsoft Academic Search

Prostatic abscess is an unusual occurrence in the era of modern antibiotics. We report a rare case of emphysematous prostatic abscess owing to Klebsiella pneumoniae in a 45-year-old man with a 10-year history of alcoholism and a 6-year history of diabetes mellitus. Prostatic abscess is a difficult clinical diagnosis without specific symptoms and signs. Computerized tomography can assist in making

Daniel C.-T. Lu; Meng-Huan Lei; Shan-Chwen Chang

1998-01-01

101

Klebsiella pneumoniae in orange juice concentrate.  

PubMed

Fecal coliform-positive, capsule-forming Klebsiella pneumoniae cells were observed in high densities (10(4) to 10(8) CFU/100 ml) in two commercial batches of frozen orange juice concentrate at a cannery in Puerto Rico. Contamination of both lots was gross and included off colors and odors. Isolates of K. pneumoniae from these concentrates revealed growth at 4, 25, and 34 degrees C with generation times from 0.39 to 1.84 h. PMID:3893321

Fuentes, F A; Hazen, T C; López-Torres, A J; Rechani, P

1985-06-01

102

Complete genome sequence of the lignin-degrading bacterium Klebsiella sp. strain BRL6-2.  

PubMed

In an effort to discover anaerobic bacteria capable of lignin degradation, we isolated Klebsiella sp. strain BRL6-2 on minimal media with alkali lignin as the sole carbon source. This organism was isolated anaerobically from tropical forest soils collected from the Bisley watershed at the Ridge site in the El Yunque National Forest in Puerto Rico, USA, part of the Luquillo Long-Term Ecological Research Station. At this site, the soils experience strong fluctuations in redox potential and are characterized by cycles of iron oxidation and reduction. Genome sequencing was targeted because of its ability to grow on lignin anaerobically and lignocellulolytic activity via in vitro enzyme assays. The genome of Klebsiella sp. strain BRL6-2 is 5.80 Mbp with no detected plasmids, and includes a relatively small arsenal of genes encoding lignocellulolytic carbohydrate active enzymes. The genome revealed four putative peroxidases including glutathione and DyP-type peroxidases, and a complete protocatechuate pathway encoded in a single gene cluster. Physiological studies revealed Klebsiella sp. strain BRL6-2 to be relatively stress tolerant to high ionic strength conditions. It grows in increasing concentrations of ionic liquid (1-ethyl-3-methyl-imidazolium acetate) up to 73.44 mM and NaCl up to 1.5 M. PMID:25566348

Woo, Hannah L; Ballor, Nicholas R; Hazen, Terry C; Fortney, Julian L; Simmons, Blake; Davenport, Karen Walston; Goodwin, Lynne; Ivanova, Natalia; Kyrpides, Nikos C; Mavromatis, Konstantinos; Woyke, Tanja; Jansson, Janet; Kimbrel, Jeff; DeAngelis, Kristen M

2014-01-01

103

Complete genome sequence of the lignin-degrading bacterium Klebsiella sp. strain BRL6-2  

PubMed Central

In an effort to discover anaerobic bacteria capable of lignin degradation, we isolated Klebsiella sp. strain BRL6-2 on minimal media with alkali lignin as the sole carbon source. This organism was isolated anaerobically from tropical forest soils collected from the Bisley watershed at the Ridge site in the El Yunque National Forest in Puerto Rico, USA, part of the Luquillo Long-Term Ecological Research Station. At this site, the soils experience strong fluctuations in redox potential and are characterized by cycles of iron oxidation and reduction. Genome sequencing was targeted because of its ability to grow on lignin anaerobically and lignocellulolytic activity via in vitro enzyme assays. The genome of Klebsiella sp. strain BRL6-2 is 5.80 Mbp with no detected plasmids, and includes a relatively small arsenal of genes encoding lignocellulolytic carbohydrate active enzymes. The genome revealed four putative peroxidases including glutathione and DyP-type peroxidases, and a complete protocatechuate pathway encoded in a single gene cluster. Physiological studies revealed Klebsiella sp. strain BRL6-2 to be relatively stress tolerant to high ionic strength conditions. It grows in increasing concentrations of ionic liquid (1-ethyl-3-methyl-imidazolium acetate) up to 73.44 mM and NaCl up to 1.5 M. PMID:25566348

2014-01-01

104

21 CFR 866.3340 - Klebsiella spp. serological reagents.  

Code of Federal Regulations, 2014 CFR

...Klebsiella and provides epidemiological information on these diseases. These organisms can cause serious urinary tract and pulmonary infections, particularly in hospitalized patients. (b) Classification. Class I (general controls)....

2014-04-01

105

21 CFR 866.3340 - Klebsiella spp. serological reagents.  

Code of Federal Regulations, 2013 CFR

...Klebsiella and provides epidemiological information on these diseases. These organisms can cause serious urinary tract and pulmonary infections, particularly in hospitalized patients. (b) Classification. Class I (general controls)....

2013-04-01

106

21 CFR 866.3340 - Klebsiella spp. serological reagents.  

Code of Federal Regulations, 2012 CFR

... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3340 Klebsiella spp. serological reagents. (a) Identification....

2012-04-01

107

Physiologie, mtabolisme Dtection de bactries lactiques produisant  

E-print Network

region of one of the glycerol dehydratase subunit of Citrobacter freundii, Klebsiella pneumoniae, Klebsiella oxytoca, Salmonella typhimurium and Clostridium pasteurianum. The primers led to a 279 bp amplicon

Paris-Sud XI, Université de

108

Normal anti-Klebsiella lymphocytotoxicity in ankylosing spondylitis  

SciTech Connect

We compared in vitro lymphocytotoxicity (LCT) of peripheral blood lymphocytes (PBL), obtained from patients with ankylosing spondylitis (AS) and normal controls (NC). Assays were performed with antibacterial antisera prepared from AS- and NC-derived Klebsiella and coliforms Escherichia coli. LCT assessed by eosin staining was not significantly different in PBL of 12 AS patients and 28 controls when reacted with 3 Klebsiella and 1 E coli antisera. LCT assessed by /sup 51/Cr release was not significantly different for PBL of 20 age- and sex-matched pairs of AS patients and NC when reacted with 3 Klebsiella and 1 E coli antisera. Similarly, LCT-/sup 51/Cr of PBL of 15 matched AS and NC pairs was not significantly different for anti-K21, a serotype putatively implicated in Klebsiella-HLA-B27 antigenic cross-reactivity. Our results do not support the notion of molecular mimicry between Klebsiella and B27 in the pathogenesis of primary AS.

Kinsella, T.D.; Fritzler, M.J.; Lewkonia, R.M.

1986-03-01

109

Translocatable resistance to mercuric and phenylmercuric ions in soil bacteria  

SciTech Connect

Of a sample of 42 grams-negative Hg-resistant bacteria, three (a Pseudomonas fluorescens, a Klebsiella sp. and a Citrobacter sp.) contained translocatable elements conferring resistance to Hgbj (all three) and to Hgbj and phenylmercuric acetate (P. fluorescens). The discovery of transposable phenylmercuric acetate resistance extends the range of known resistance ''transposons'' from heavy metals and antibiotics to organometallic compounds.

Radford, A.J. (LaTrobe Univ., Victoria, Australia); Oliver, J.; Kelly, W.J.; Reaney, D.C.

1981-08-01

110

Anti-Biofilm Activity: A Function of Klebsiella pneumoniae Capsular Polysaccharide  

PubMed Central

Competition and cooperation phenomena occur within highly interactive biofilm communities and several non-biocides molecules produced by microorganisms have been described as impairing biofilm formation. In this study, we investigated the anti-biofilm capacities of an ubiquitous and biofilm producing bacterium, Klebsiella pneumoniae. Cell-free supernatant from K. pneumoniae planktonic cultures showed anti-biofilm effects on most Gram positive bacteria tested but also encompassed some Gram negative bacilli. The anti-biofilm non-bactericidal activity was further investigated on Staphylococcus epidermidis, by determining the biofilm biomass, microscopic observations and agglutination measurement through a magnetic bead-mediated agglutination test. Cell-free extracts from K. pneumoniae biofilm (supernatant and acellular matrix) also showed an influence, although to a lesser extend. Chemical analyses indicated that the active molecule was a high molecular weight polysaccharide composed of five monosaccharides: galactose, glucose, rhamnose, glucuronic acid and glucosamine and the main following sugar linkage residues [?2)-?-l-Rhap-(1?]; [?4)-?-l-Rhap-(1?]; [?-d-Galp-(1?]; [?2,3)-?-d-Galp-(1?]; [?3)-?-d-Galp-(1?] and, [?4)-?-d-GlcAp-(1?]. Characterization of this molecule indicated that this component was more likely capsular polysaccharide (CPS) and precoating of abiotic surfaces with CPS extracts from different serotypes impaired the bacteria-surface interactions. Thus the CPS of Klebsiella would exhibit a pleiotropic activity during biofilm formation, both stimulating the initial adhesion and maturation steps as previously described, but also repelling potential competitors. PMID:24932475

Dos Santos Goncalves, Marina; Delattre, Cédric; Balestrino, Damien; Charbonnel, Nicolas; Elboutachfaiti, Redouan; Wadouachi, Anne; Badel, Stéphanie; Bernardi, Thierry; Michaud, Philippe; Forestier, Christiane

2014-01-01

111

PCR-Based Identification of Klebsiella pneumoniae subsp. rhinoscleromatis, the Agent of Rhinoscleroma  

E-print Network

PCR-Based Identification of Klebsiella pneumoniae subsp. rhinoscleromatis, the Agent of this study was to develop two simple PCR assays. We took advantage of the fact that all Klebsiella pneumoniae assayed on the 76 other Klebsiella capsular types. Further, to discriminate Klebsiella pneumoniae subsp

Paris-Sud XI, Université de

112

Two distinct sensing pathways allow recognition of Klebsiella pneumoniae by Dictyostelium amoebae  

PubMed Central

Summary Recognition of bacteria by metazoans is mediated by receptors that recognize different types of microorganisms and elicit specific cellular responses. The soil amoebae Dictyostelium discoideum feeds upon a variable mixture of environmental bacteria, and it is expected to recognize and adapt to various food sources. To date, however, no bacteria-sensing mechanisms have been described. In this study, we isolated a Dictyostelium mutant (fspA KO) unable to grow in the presence of non-capsulated Klebsiella pneumoniae bacteria, but growing as efficiently as wild-type cells in the presence of other bacteria, such as Bacillus subtilis. fspA KO cells were also unable to respond to K. pneumoniae and more specifically to bacterially secreted folate in a chemokinetic assay, while they responded readily to B. subtilis. Remarkably, both WT and fspA KO cells were able to grow in the presence of capsulated LM21 K. pneumoniae, and responded to purified capsule, indicating that capsule recognition may represent an alternative, FspA-independent mechanism for K. pneumoniae sensing. When LM21 capsule synthesis genes were deleted, growth and chemokinetic response were lost for fspA KO cells, but not for WT cells. Altogether, these results indicate that Dictyostelium amoebae use specific recognition mechanisms to respond to different K. pneumoniae elements. PMID:24128258

Lima, Wanessa C; Balestrino, Damien; Forestier, Christiane; Cosson, Pierre

2013-01-01

113

BOGUS BACTERIA...  

NSDL National Science Digital Library

Here are some websites to get you started... Just click on the links and start searching! microbe world- bacteria Bacteria Rule Quiz! Bacteria.... Harmful Bacteria Bacteria Museum Bacteria! Microbes- all sorts of info... When you are finished looking at the sites or when you have enough information concerning bacteria, ask Mrs. Deaton for some books that can give you even more DETAIL!!! *Don\\'t forget to keep track of your information on your I-CHARTS... ...

Mrs. Deaton

2007-01-24

114

Klebsiella pneumoniae liver abscess and endophthalmitis  

PubMed Central

A 36-year-old man was referred to the general medical team with endophthalmitis. He was noted to have raised inflammatory markers and deranged liver function tests on admission. Subsequent abdominal ultrasound scan revealed a liver abscess requiring percutaneous drainage. A common human pathogen, Klebsiella pneumoniae, was cultured from multiple sites. K pneumoniae has virulent serotypes (K1 and K2) that can cause primary liver abscess with metastatic infections. Cases have previously been predominantly reported in Southeast Asia but are increasing in prevalence in Europe and North America. The main known risk factor for the disease is diabetes mellitus. Swift antibiotic therapy, ophthalmology review and percutaneous drainage of any liver abscess are essential. Early recognition of the syndrome, despite potentially few initial symptoms, can significantly reduce morbidity and mortality. The authors report the first recorded case of K pneumoniae liver abscess with endophthalmitis in the UK. PMID:23559652

Abdul-Hamid, Ayeshah; Bailey, Sarah-Jane

2013-01-01

115

Extended-spectrum-beta-lactamases, AmpC beta-lactamases and plasmid mediated quinolone resistance in klebsiella spp. from companion animals in Italy.  

PubMed

We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6')-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6')-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6')-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission between pets and humans, especially at household level. PMID:24595207

Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

2014-01-01

116

Extended-Spectrum-Beta-Lactamases, AmpC Beta-Lactamases and Plasmid Mediated Quinolone Resistance in Klebsiella spp. from Companion Animals in Italy  

PubMed Central

We report the genetic characterization of 15 Klebsiella pneumoniae (KP) and 4 isolates of K. oxytoca (KO) from clinical cases in dogs and cats and showing extended-spectrum cephalosporin (ESC) resistance. Extended spectrum beta-lactamase (ESBL) and AmpC genes, plasmid-mediated quinolone resistance (PMQR) and co-resistances were investigated. Among KP isolates, ST101 clone was predominant (8/15, 53%), followed by ST15 (4/15, 27%). ST11 and ST340, belonging to Clonal Complex (CC)11, were detected in 2012 (3/15, 20%). MLST on KP isolates corresponded well with PFGE results, with 11 different PFGE patterns observed, including two clusters of two (ST340) and four (ST101) indistinguishable isolates, respectively. All isolates harbored at least one ESBL or AmpC gene, all carried on transferable plasmids (IncR, IncFII, IncI1, IncN), and 16/19 were positive for PMQR genes (qnr family or aac(6?)-Ib-cr). The most frequent ESBL was CTX-M-15 (11/19, 58%), detected in all KP ST101, in one KP ST15 and in both KP ST340. blaCTX-M-15 was carried on IncR plasmids in all but one KP isolate. All KP ST15 isolates harbored different ESC resistance genes and different plasmids, and presented the non-transferable blaSHV-28 gene, in association with blaCTX-M-15, blaCTX-M-1 (on IncR, or on IncN), blaSHV-2a (on IncR) or blaCMY-2 genes (on IncI1). KO isolates were positive for blaCTX-M-9 gene (on IncHI2), or for the blaSHV-12 and blaDHA-1 genes (on IncL/M). They were all positive for qnr genes, and one also for the aac(6?)-Ib-cr gene. All Klebsiella isolates showed multiresistance towards aminoglycosides, sulfonamides, tetracyclines, trimethoprim and amphenicols, mediated by strA/B, aadA2, aadB, ant (2")-Ia, aac(6?)-Ib, sul, tet, dfr and cat genes in various combinations. The emergence in pets of multidrug-resistant Klebsiella with ESBL, AmpC and PMQR determinants, poses further and serious challenges in companion animal therapy and raise concerns for possible bi-directional transmission between pets and humans, especially at household level. PMID:24595207

Donati, Valentina; Feltrin, Fabiola; Hendriksen, Rene S.; Svendsen, Christina Aaby; Cordaro, Gessica; García-Fernández, Aurora; Lorenzetti, Serena; Lorenzetti, Raniero; Battisti, Antonio; Franco, Alessia

2014-01-01

117

CHARACTERISTICS OF KLEBSIELLA FROM TEXTILE FINISHING PLANT EFFLUENTS  

EPA Science Inventory

Klebsiella strains are found in abnormally high numbers in a stream receiving wastewater from a textile finishing plant. Representative strains are randomly selected to determine biochemical, serotype, and virulence patterns. All strains conform to the commonly accepted biochemic...

118

'KLEBSIELLA' DENSITIES IN WATERS RECEIVING WOOD PULP EFFLUENTS  

EPA Science Inventory

Surface waters receiving pulp mill effluents were examined for the presence of total coliforms, fecal coliforms, and Salmonella species. Fecal coliforms were biochemically identified as belonging to the Escherichia, Klebsiella or Enterobacter genera. Sixty percent of the isolates...

119

Klebsiella pneumoniae Infection: A Virulent Cause of Visual Loss  

PubMed Central

Bacterial endophthalmitis is endogenous in 2–6% of cases and is frequently misdiagnosed initially. Klebsiella pneumoniae is being increasingly recognised as an aggressive causative organism, and it is particularly prevalent in Asian populations. We describe the case of a 71-year-old female of Southeast Asian origin with type 2 diabetes mellitus who presented with visual loss secondary to bacterial endophthalmitis and concomitant cerebral abscesses. Imaging revealed the probable primary source of infection to be a liver abscess. She developed retinal detachment and subsequently underwent an evisceration of her right eye. A Klebsiella spp. was identified from the eye tissue by 16S rRNA amplification. Klebsiella pneumoniae endophthalmitis has a characteristic disease phenotype and a particularly aggressive course with poor visual outcomes observed in most cases. This case highlights the risks of metastatic infection including bacterial endophthalmitis in association with Klebsiella infection. PMID:25606041

Soon, Wai Cheong; Pouncey, Anna; Ashley, Elizabeth; Bowen, Elizabeth Frances

2014-01-01

120

Overlapping sequences of Klebsiella pneumoniae nif DNA cloned and characterised  

Microsoft Academic Search

A HindIII (17.0 kb) and an EcoRl restriction fragment (6.9 kb) of Klebsiella pneumoniae nif DNA were cloned on two small amplifiable plasmids, pCM1 and pSA30 respectively. These plasmids between them carry 14 of the 15 known Klebsiella nif genes. The operon for the three structural genes for nitrogenase, nifpHDK, is carried on pSA30: four and five of the remaining

Frank C. Cannon; Gerard E. Riedel; Fredrick M. Ausubel

1979-01-01

121

Cefotaxime resistance and outcome of Klebsiella spp bloodstream infection.  

PubMed

We attempt to describe the epidemiology and outcome associated with cefotaxime-resistant (CTX-R) Klebsiella spp bacteraemia. Klebsiella spp bloodstream infection episodes prospectively collected through a blood culture surveillance programme from January 1991 to December 2008 in a single institution were analysed. A total of 910 monomicrobial episodes of Klebsiella spp bacteraemia were identified during the study period. The most important sources were from urinary tract infection, unknown sources, billiary focus and catheter related infection. There were 112 (12%) CTX-R isolates. Out of 112 isolates, 98 were CTX-R by Extended-Spectrum ?-Lactamase production. Shock on presentation and mortality were significantly more frequent in CTX-R than in CTX susceptible isolates. Inappropriate empirical therapy was received in 50 (45%) cases in the CTX-R Klebsiella spp group (13 cases of death, 26%). Predictive factors associated with CTX-R Klebsiella spp isolate were: previous ?-lactam therapy (OR?=?4.16), nosocomial acquired bacteraemia (OR?=?1.93), solid organ trasplantation (OR?=?2.09) and shock (OR?=?1.90). Independent risk factors associated with mortality in Klebsiella spp bacteraemia were: age (OR?=?1.03), liver cirrhosis (OR?=?2.63), ultimately or rapidly fatal prognosis of underlying disease (OR?=?2.44), shock (OR?=?8.60), pneumonia (OR?=?4.96) or intraabdominal (OR?=?3.85) source of bacteraemia and CTX-R isolate (OR?=?4.63). Klebsiella spp is an important cause of bloodstream infection. CTX-R isolates have been increasing since 2000. CTX-R is an independent factor associated with mortality in Klebsiella spp bacteraemia. PMID:21509474

Ortega, M; Marco, F; Soriano, A; Almela, M; Martínez, J A; López, J; Pitart, C; Mensa, J

2011-12-01

122

Risk Factors for Fecal Carriage of Extended-Spectrum Beta-Lactamase Producing Escherichia coli and Klebsiella spp. in the Community  

Microsoft Academic Search

Aim: Community-acquired infections caused by extended-spectrum beta-lactamase (ESBL)-producing bacteria are an emerging problem. Digestive tract colonization is a prerequisite for infections by ESBL-producing microorganisms. The aim of this study was to determine the prevalence of and risk factors for fecal carriage of ESBL-producing Escherichia coli (E. coli) or Klebsiella spp. in the community. Materials and Methods: A total of 928

Özlem KURT AZAP; Hande ARSLAN; Turhan TOGAN

123

[Update on outbreaks reported from neonatal intensive care units: Serratia marcescens, Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa].  

PubMed

In terms of the unique risk profile, the clinical course of nosocomial infections, and the most prevalent bacterial pathogens, literature on outbreaks of potentially pathogenic bacteria on neonatal intensive care units (NICUs) needs to be analyzed separately from reports derived from other intensive care units. With the purpose of updating important information for those involved in outbreak management and fostering preventive efforts, this article summarizes the results of a systematic literature analysis, referring to an earlier publication by Gastmeier et al. This review focuses on NICU outbreaks caused by Serratia marcescens, Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa. PMID:25665889

Kraus-Haas, Martina; Mielke, Martin; Simon, Arne

2015-03-01

124

Perianal Abscess and Proctitis by Klebsiella pneumoniae.  

PubMed

Klebsiella pneumoniae (K. pneumoniae) can at times cause invasive infections, especially in patients with diabetes mellitus and a history of alcohol abuse. A 61-year-old man with diabetes mellitus and a history of alcohol abuse presented with abdominal and anal pain for two weeks. After admission, he underwent sigmoidoscopy, which revealed multiple ulcerations with yellowish exudate in the rectum and sigmoid colon. The patient was treated with ciprofloxacin and metronidazole. After one week, follow up sigmoidoscopy was performed owing to sustained fever and diarrhea. The lesions were aggravated and seemed webbed in appearance because of damage to the rectal mucosa. Abdominal computed tomography and rectal magnetic resonance imaging were performed, and showed a perianal and perirectal abscess. The patient underwent laparoscopic sigmoid colostomy and perirectal abscess incision and drainage. Extended-spectrum beta-lactamase-producing K. pneumoniae was identified in pus culture. The antibiotics were switched to ertapenem. He improved after surgery and was discharged. K. pneumoniae can cause rapid invasive infection in patients with diabetes and a history of alcohol abuse. We report the first rare case of proctitis and perianal abscess caused by invasive K. pneumoniae infection. PMID:25691848

Jeong, Woo Shin; Choi, Sung Youn; Jeong, Eun Haeng; Bang, Ki Bae; Park, Seung Sik; Lee, Dae Sung; Park, Dong Il; Jung, Yoon Suk

2015-01-01

125

Perianal Abscess and Proctitis by Klebsiella pneumoniae  

PubMed Central

Klebsiella pneumoniae (K. pneumoniae) can at times cause invasive infections, especially in patients with diabetes mellitus and a history of alcohol abuse. A 61-year-old man with diabetes mellitus and a history of alcohol abuse presented with abdominal and anal pain for two weeks. After admission, he underwent sigmoidoscopy, which revealed multiple ulcerations with yellowish exudate in the rectum and sigmoid colon. The patient was treated with ciprofloxacin and metronidazole. After one week, follow up sigmoidoscopy was performed owing to sustained fever and diarrhea. The lesions were aggravated and seemed webbed in appearance because of damage to the rectal mucosa. Abdominal computed tomography and rectal magnetic resonance imaging were performed, and showed a perianal and perirectal abscess. The patient underwent laparoscopic sigmoid colostomy and perirectal abscess incision and drainage. Extended-spectrum beta-lactamase-producing K. pneumoniae was identified in pus culture. The antibiotics were switched to ertapenem. He improved after surgery and was discharged. K. pneumoniae can cause rapid invasive infection in patients with diabetes and a history of alcohol abuse. We report the first rare case of proctitis and perianal abscess caused by invasive K. pneumoniae infection. PMID:25691848

Jeong, Woo Shin; Choi, Sung Youn; Jeong, Eun Haeng; Bang, Ki Bae; Park, Seung Sik; Lee, Dae Sung; Park, Dong Il

2015-01-01

126

Tracking a hospital outbreak of carbapenem-resistant Klebsiella pneumoniae with whole-genome sequencing.  

PubMed

The Gram-negative bacteria Klebsiella pneumoniae is a major cause of nosocomial infections, primarily among immunocompromised patients. The emergence of strains resistant to carbapenems has left few treatment options, making infection containment critical. In 2011, the U.S. National Institutes of Health Clinical Center experienced an outbreak of carbapenem-resistant K. pneumoniae that affected 18 patients, 11 of whom died. Whole-genome sequencing was performed on K. pneumoniae isolates to gain insight into why the outbreak progressed despite early implementation of infection control procedures. Integrated genomic and epidemiological analysis traced the outbreak to three independent transmissions from a single patient who was discharged 3 weeks before the next case became clinically apparent. Additional genomic comparisons provided evidence for unexpected transmission routes, with subsequent mining of epidemiological data pointing to possible explanations for these transmissions. Our analysis demonstrates that integration of genomic and epidemiological data can yield actionable insights and facilitate the control of nosocomial transmission. PMID:22914622

Snitkin, Evan S; Zelazny, Adrian M; Thomas, Pamela J; Stock, Frida; Henderson, David K; Palmore, Tara N; Segre, Julia A

2012-08-22

127

Neonatal Brain Abscess due to Extended-Spectrum Beta-Lactamase Producing Klebsiella pneumoniae  

PubMed Central

Klebsiella pneumoniae (K. pneumoniae) causing brain abscess in newborn infants is rare. Presented herein, is a 27-day-old male neonate who developed two frontal lobe abscesses in association with K. pneumoniae sepsis and meningitis. Antibiotic susceptibility testing utilizing the double-disk synergy method (Cefotaxime and Amoxycillin-Clavulanate) confirmed the extended spectrum beta-lactamase (ESBL) production by the isolate. He was treated simultaneously with antibiotics (Meropenem and Amikacin) and abscess aspiration through the anterior fontanelle, with less than satisfactory outcome. ESBL producing K. pneumoniae brain abscess in neonates is extremely rare in the English literature. Emperical carbapenems and aminoglycoside coverage in neonates with K. pneumoniae sepsis and brain abscess, especially in areas with high rate of ESBL producing bacteria may be warranted. PMID:25584278

Mondal, Monojit; Thapa, Rajoo; Mallick, Debkrishna; Datta, Asok Kumar

2014-01-01

128

Tracking a Hospital Outbreak of Carbapenem-Resistant Klebsiella pneumoniae with Whole-Genome Sequencing  

PubMed Central

The Gram-negative bacteria Klebsiella pneumoniae is a major cause of nosocomial infections, primarily among immunocompromised patients. The emergence of strains resistant to carbapenems has left few treatment options, making infection containment critical. In 2011, the U.S. National Institutes of Health Clinical Center experienced an outbreak of carbapenem-resistant K. pneumoniae that affected 18 patients, 11 of whom died. Whole-genome sequencing was performed on K. pneumoniae isolates to gain insight into why the outbreak progressed despite early implementation of infection control procedures. Integrated genomic and epidemiological analysis traced the outbreak to three independent transmissions from a single patient who was discharged 3 weeks before the next case became clinically apparent. Additional genomic comparisons provided evidence for unexpected transmission routes, with subsequent mining of epidemiological data pointing to possible explanations for these transmissions. Our analysis demonstrates that integration of genomic and epidemiological data can yield actionable insights and facilitate the control of nosocomial transmission. PMID:22914622

Snitkin, Evan S.; Zelazny, Adrian M.; Thomas, Pamela J.; Stock, Frida; Henderson, David K.; Palmore, Tara N.; Segre, Julia A.

2012-01-01

129

'KLEBSIELLA' OCCURRENCE, SIGNIFICANCE AND DETECTION IN WATER SYSTEMS: A PROGRESS REPORT  

EPA Science Inventory

Frequent occurrence of Klebsiella in coliform colonization problems found in water supply distribution has prompted the development of a new medium (m-Kleb agar) for specific detection. The medium has excellent differential characteristics, and an average 94% Klebsiella recovery ...

130

Bacteria Museum  

NSDL National Science Digital Library

Who knew that bacteria had their own virtual museum? Here, visitors will "learn that not all bacteria are harmful, how they are used in industry, that they belong to the oldest living creatures on Earth", and many more interesting facts to discover about the diverse world of bacteria. The "Bacterial Species Files" tab at the top of the page, allows visitors to look up information on 40 different specific bacteria, from Anthrax to Yersinia enterocolitica. The information provided for each bacterium includes photographs, consumer guides, fact sheets, and scientific links. Visitors will find that the "Main Exhibits" tab addresses the basics about bacteria, as well as "Pathogenic Bacteria", "Evolution", "How We Fight Bacteria", and "Food and Water Safety". Visitors will surely enjoy the "Good Bacteria in Food" link found in the Food and Water Safety section, as it explains how some foods benefit from good bacteria, such as Swiss cheese, sausage, sauerkraut, chocolate, and coffee.

131

Lipocalin 2 Is Required for Pulmonary Host Defense against Klebsiella Infection1  

E-print Network

that lipocalin 2 is rapidly and robustly induced by Klebsiella pneumoniae infection and is TLR4 dependent. IL-1 and multidrug resistance (4). Klebsiella pneumoniae (KP)3 is an insidious organism, causing both pulmonaryLipocalin 2 Is Required for Pulmonary Host Defense against Klebsiella Infection1 Yvonne R. Chan

Strong, Roland K.

132

Functions of Some Capsular Polysaccharide Biosynthetic Genes in Klebsiella pneumoniae NTUH K-2044  

E-print Network

Functions of Some Capsular Polysaccharide Biosynthetic Genes in Klebsiella pneumoniae NTUH K-2044, Taiwan Abstract The growing number of Klebsiella pneumoniae infections, commonly acquired in hospitals of Some Capsular Polysaccharide Biosynthetic Genes in Klebsiella pneumoniae NTUH K- 2044. PLoS ONE 6(7): e

Tsai, Ming-Daw

133

Efflux Pump, the Masked Side of -Lactam Resistance in Klebsiella pneumoniae Clinical Isolates  

E-print Network

Efflux Pump, the Masked Side of Ã?-Lactam Resistance in Klebsiella pneumoniae Clinical Isolates Jean are the well-recognized mechanisms of acquired Ã?-lactam resistance in Klebsiella pneumoniae isolates. However-Marie.PAGES@univmed.fr Introduction Klebsiella pneumoniae, a member of Enterobacteriaceae family, is an important pathogen in both

Paris-Sud XI, Université de

134

The Ecology of “fecal indicator” bacteria commonly found in Pulp and paper mill water systems  

Microsoft Academic Search

Coliform bacteria have long been used to indicate fecal contamination of water and thus a health hazard. In this study, the in-mill water and external effluent treatment systems of seven typical Canadian pulp and paper mills were all shown to support the growth of numerous coliforms, especially Klebsiella spp., Escherichia coli, Enterobacter spp., and Citrobacter spp. In all mills and

Francis Gauthier; Frederick Archibald

2001-01-01

135

In vitro Activity of Moxalactam against Pathogenic Bacteria and Its Comparison with Other Antibiotics  

Microsoft Academic Search

843 isolates from clinical specimens were tested against moxalactam by disc agar diffusion. The bacteria used in this study consisted of Escherichia coli, Enterobacter aerogenes, Enterobacter agglomerans, Enterobacter cloacae, Klebsiella pneumoniae, Proteus mirabilis, Providencia rettgeri, Pseudomonas aeruginosa, Serratia marcescens, Staphylococcus aureus, Staphylococcus epidermidis and group B and group D Streptococci. In vitro activity of moxalactam was compared with the following

Fred Perrymann; D. J. Flournoy; Hussain Qadri

1983-01-01

136

Parasitic infection improves survival from septic peritonitis by enhancing mast cell responses to bacteria in mice.  

PubMed

Mammals are serially infected with a variety of microorganisms, including bacteria and parasites. Each infection reprograms the immune system's responses to re-exposure and potentially alters responses to first-time infection by different microorganisms. To examine whether infection with a metazoan parasite modulates host responses to subsequent bacterial infection, mice were infected with the hookworm-like intestinal nematode Nippostrongylus brasiliensis, followed in 2-4 weeks by peritoneal injection of the pathogenic bacterium Klebsiella pneumoniae. Survival from Klebsiella peritonitis two weeks after parasite infection was better in Nippostrongylus-infected animals than in unparasitized mice, with Nippostrongylus-infected mice having fewer peritoneal bacteria, more neutrophils, and higher levels of protective interleukin 6. The improved survival of Nippostrongylus-infected mice depends on IL-4 because the survival benefit is lost in mice lacking IL-4. Because mast cells protect mice from Klebsiella peritonitis, we examined responses in mast cell-deficient Kit(W-sh)/Kit(W-sh) mice, in which parasitosis failed to improve survival from Klebsiella peritonitis. However, adoptive transfer of cultured mast cells to Kit(W-sh)/Kit(W-sh) mice restored survival benefits of parasitosis. These results show that recent infection with Nippostrongylus brasiliensis protects mice from Klebsiella peritonitis by modulating mast cell contributions to host defense, and suggest more generally that parasitosis can yield survival advantages to a bacterially infected host. PMID:22110673

Sutherland, Rachel E; Xu, Xiang; Kim, Sophia S; Seeley, Eric J; Caughey, George H; Wolters, Paul J

2011-01-01

137

Investigation on American cockroaches medically important bacteria in Khorramshahr hospital, Iran  

PubMed Central

Objective To investigate American cockroaches' infection to various bacteria in Khorramshahr Vali-e-Asr hospital, which was done in 2008. Methods In this descriptive cross-sectional study, 20 American cockroaches were caught via direct collection. Medically important bacteria were extracted from their outer surface of bodies by standard procedures. Results Culturing outer surface wash of cockroaches resulted in the separation of Klebsiella, Pseudomonas, Escherichia coli, Staphylococcus, Proteus and Streptococcus. The main common bacteria were Klebsiella (35%) and Pseudomonas (30%). Also, results of culture media showed that about 90% of cockroaches infected to at least one bacterium. Conclusions American cockroaches can transmit pathogenic and potential pathogenic bacteria, therefore their presence in hospitals may be a sanitation challenge. It is recommended to assess plans in purpose to combat these pests in the hospitals.

Kassiri, Hamid; Kassiri, Ali; Kazemi, Shahnaz

2014-01-01

138

Klebsiella pneumoniae isolates causing liver abscess in Taiwan  

Microsoft Academic Search

Klebsiella pneumoniae has been the leading cause of pyogenic liver abscess in Taiwan during the period from 1985 to 1999, which is different from other countries. The present study investigated the in vitro antimicrobial susceptibilities of 51 K. pneumoniae isolates collected from blood cultures of patients with liver abscess in Taiwan during the period from 1993–1997, and typed by pulsed-field

Shan-Chwen Chang; Chi-Tai Fang; Po-Ren Hsueh; Yee-Chun Chen; Kwen-Tay Luh

2000-01-01

139

Differentiation of Enterobacter aerogenes from Klebsiellae by Deoxyribonucleic Acid Reassociation  

Microsoft Academic Search

Polynucleotide sequence relatedness tests were carried out to determine the extent of deoxyribonucleic acid (DNA) divergence among species of Klebsiella and Enterobacter aerogenes strains. Labeled, denatured DNA fragments from K. pneumoniae type 2 and E. aerogenes 1627-66 were each incubated with an excess of unlabeled DNA fragments from Klebsielia species and strains of E. aerogenes. Reassociated DNA duplexes were separated

DON J. BRENNER; A. G. STEIGERWALT; G. R. FANNING

1972-01-01

140

Pyrrolidonyl Peptidase in Bacteria: A New Colrimetric Test for Differentiation of Enterobacteriaceae  

Microsoft Academic Search

SUMMARY A simple and rapid colorimetric test has been developed for the detection of pyrrolidonpl peptidase (PLP) activity in bacteria. Of 2354 strains be- longing to various groups of enteric bacteria tested, 451 were PLP-positive. These included Citrobacter, 223 out of 226 strains, Klebsiella (178\\/188), Enterobacter (49\\/52), and one strain of Serratia. Pyrrolidonyl peptidase was not detected in I 146

M. Mulczyk; A. Szewczuk

1970-01-01

141

Two cases of monomicrobial intraabdominal abscesses due to KPC - 3 Klebsiella pneumoniae ST258 clone  

PubMed Central

Background Knowledge of the etiology of pyogenic liver and pancreatic abscesses is an important factor in determining the success of combined surgical and antibiotic treatment. Literature shows geographical variations in the prevalence and distribution of causative organisms, and the spread of Klebsiella pneumoniae carbapenemase-producing bacteria is an emerging cause of abdominal infections. Case presentation We herein describe two cases of intra-abdominal abscesses due to monomicrobial infection by Klebsiella pneumoniae Sequence Type 258 producing K. pneumoniae carbapenemase 3 (KPC-Kp). In case 1, a 50-year-old HIV-negative Italian woman with chronic pancreatitis showed infection of a pancreatic pseudocystic lesion caused by KPC-Kp. In case 2, a 64-year-old HIV- negative Italian woman with pancreatic neoplasm and liver metastases developed a liver abscess due to KPC after surgery. Both women were admitted to our hospital but to different surgical units. The clonal relationship between the two isolates was investigated by pulsed-field gel electrophoresis (PFGE). In case 2, the patient was already colonized at admission and inter-hospital transmission of the pathogen was presumed. A long-term combination regimen of colistin with tigecycline and percutaneous drainage resulted in full recovery and clearance of the multidrug-resistant (MDR) pathogen. Conclusions Timely microbiological diagnosis, the combined use of new and old antibiotics and radiological intervention appeared to be valuable in managing these serious conditions. The emergence and dissemination of MDR organisms is posing an increasing challenge for physicians to develop new therapeutic strategies and control and prevention frameworks. PMID:21961811

2011-01-01

142

Role of bacterial surface structures on the interaction of Klebsiella pneumoniae with phagocytes.  

PubMed

Phagocytosis is a key process of the immune system. The human pathogen Klebsiella pneumoniae is a well known example of a pathogen highly resistant to phagocytosis. A wealth of evidence demonstrates that the capsule polysaccharide (CPS) plays a crucial role in resistance to phagocytosis. The amoeba Dictyostelium discoideum shares with mammalian macrophages the ability to phagocytose and kill bacteria. The fact that K. pneumoniae is ubiquitous in nature and, therefore, should avoid predation by amoebae, poses the question whether K. pneumoniae employs similar means to counteract amoebae and mammalian phagocytes. Here we developed an assay to evaluate K. pneumoniae-D. discoideum interaction. The richness of the growth medium affected the threshold at which the cps mutant was permissive for Dictyostelium and only at lower nutrient concentrations the cps mutant was susceptible to predation by amoebae. Given the critical role of bacterial surface elements on host-pathogen interactions, we explored the possible contribution of the lipopolysaccharide (LPS) and outer membrane proteins (OMPs) to combat phagoyctosis by D. discoideum. We uncover that, in addition to the CPS, the LPS O-polysaccharide and the first core sugar participate in Klebsiella resistance to predation by D. discoideum. K. pneumoniae LPS lipid A decorations are also necessary to avoid predation by amoebae although PagP-dependent palmitoylation plays a more important role than the lipid A modification with aminoarabinose. Mutants lacking OMPs OmpA or OmpK36 were also permissive for D. discoideium growth. Except the LPS O-polysaccharide mutants, all mutants were more susceptible to phagocytosis by mouse alveolar macrophages. Finally, we found a correlation between virulence, using the pneumonia mouse model, and resistance to phagocytosis. Altogether, this work reveals novel K. pneumoniae determinants involved in resistance to phagocytosis and supports the notion that Dictyostelium amoebae might be useful as host model to measure K. pneumoniae virulence and not only phagocytosis. PMID:23457627

March, Catalina; Cano, Victoria; Moranta, David; Llobet, Enrique; Pérez-Gutiérrez, Camino; Tomás, Juan M; Suárez, Teresa; Garmendia, Junkal; Bengoechea, José A

2013-01-01

143

Myeloperoxidase plays critical roles in killing Klebsiella pneumoniae and inactivating neutrophil elastase: effects on host defense.  

PubMed

Activated neutrophils use myeloperoxidase (MPO) to generate an array of potent toxic oxidants. In the current studies we used genetically altered mice deficient in MPO to investigate the role of the enzyme in host defense against the Gram-negative bacterium Klebsiella pneumoniae, an important human pathogen. For comparison, we used mice deficient in the antimicrobial molecule, neutrophil elastase (NE). When challenged i.p., mice deficient in either MPO or NE were markedly more susceptible to bacterial infection and death. In vitro studies suggested that MPO impairs the morphology of bacteria in a distinctive way. Of importance, our in vitro studies found that MPO mediated oxidative inactivation of NE, an enzyme that has been widely implicated in the pathogenesis of various tissue-destructive diseases. This pathway of oxidative inactivation may be physiologically relevant, because activated neutrophils isolated from MPO-deficient mice exhibited increased elastase activity. Our observations provide strong evidence that MPO, like NE, is a key player in the killing of K. pneumoniae bacteria. They also suggest that MPO may modulate NE to protect the host from the tissue-degrading activity of this proteinase. PMID:15661916

Hirche, Tim O; Gaut, Joseph P; Heinecke, Jay W; Belaaouaj, Azzaq

2005-02-01

144

Hessian Fly-Associated Bacteria: Transmission, Essentiality, and Composition  

PubMed Central

Plant-feeding insects have been recently found to use microbes to manipulate host plant physiology and morphology. Gall midges are one of the largest groups of insects that manipulate host plants extensively. Hessian fly (HF, Mayetiola destructor) is an important pest of wheat and a model system for studying gall midges. To examine the role of bacteria in parasitism, a systematic analysis of bacteria associated with HF was performed for the first time. Diverse bacteria were found in different developmental HF stages. Fluorescent in situ hybridization detected a bacteriocyte-like structure in developing eggs. Bacterial DNA was also detected in eggs by PCR using primers targeted to different bacterial groups. These results indicated that HF hosted different types of bacteria that were maternally transmitted to the next generation. Eliminating bacteria from the insect with antibiotics resulted in high mortality of HF larvae, indicating that symbiotic bacteria are essential for the insect to survive on wheat seedlings. A preliminary survey identified various types of bacteria associated with different HF stages, including the genera Enterobacter, Pantoea, Stenotrophomonas, Pseudomonas, Bacillus, Ochrobactrum, Acinetobacter, Alcaligenes, Nitrosomonas, Arcanobacterium, Microbacterium, Paenibacillus, and Klebsiella. Similar bacteria were also found specifically in HF-infested susceptible wheat, suggesting that HF larvae had either transmitted bacteria into plant tissue or brought secondary infection of bacteria to the wheat host. The bacteria associated with wheat seedlings may play an essential role in the wheat-HF interaction. PMID:21858016

Bansal, Raman; Hulbert, Scot; Schemerhorn, Brandi; Reese, John C.; Whitworth, R. Jeff; Stuart, Jeffrey J.; Chen, Ming-Shun

2011-01-01

145

Hessian fly-associated bacteria: transmission, essentiality, and composition.  

PubMed

Plant-feeding insects have been recently found to use microbes to manipulate host plant physiology and morphology. Gall midges are one of the largest groups of insects that manipulate host plants extensively. Hessian fly (HF, Mayetiola destructor) is an important pest of wheat and a model system for studying gall midges. To examine the role of bacteria in parasitism, a systematic analysis of bacteria associated with HF was performed for the first time. Diverse bacteria were found in different developmental HF stages. Fluorescent in situ hybridization detected a bacteriocyte-like structure in developing eggs. Bacterial DNA was also detected in eggs by PCR using primers targeted to different bacterial groups. These results indicated that HF hosted different types of bacteria that were maternally transmitted to the next generation. Eliminating bacteria from the insect with antibiotics resulted in high mortality of HF larvae, indicating that symbiotic bacteria are essential for the insect to survive on wheat seedlings. A preliminary survey identified various types of bacteria associated with different HF stages, including the genera Enterobacter, Pantoea, Stenotrophomonas, Pseudomonas, Bacillus, Ochrobactrum, Acinetobacter, Alcaligenes, Nitrosomonas, Arcanobacterium, Microbacterium, Paenibacillus, and Klebsiella. Similar bacteria were also found specifically in HF-infested susceptible wheat, suggesting that HF larvae had either transmitted bacteria into plant tissue or brought secondary infection of bacteria to the wheat host. The bacteria associated with wheat seedlings may play an essential role in the wheat-HF interaction. PMID:21858016

Bansal, Raman; Hulbert, Scot; Schemerhorn, Brandi; Reese, John C; Whitworth, R Jeff; Stuart, Jeffrey J; Chen, Ming-Shun

2011-01-01

146

Bacteria Transformation  

NSDL National Science Digital Library

Students construct paper recombinant plasmids to simulate the methods genetic engineers use to create modified bacteria. They learn what role enzymes, DNA and genes play in the modification of organisms. For the particular model they work on, they isolate a mammal insulin gene and combine it with a bacteria's gene sequence (plasmid DNA) for production of the protein insulin.

2014-09-18

147

Isolation and characterization of an alginate lyase from Klebsiella aerogenes  

Microsoft Academic Search

The bacterium Klebsiella aerogenes (type 25) produced an inducible alginate lyase, whose major activity was located intracellularly during all growth phases. The enzyme was purified from the soluble fraction of sonicated cells by ammonium sulfate precipitation, anion- and cation-exchange chromatography and gel filtration. The apparent molecular weight of purified alginate lyase of 28,000 determined by gel filtration and of 31,600

B. Lange; J. Wingender; U. K. Winkler

1989-01-01

148

Complementation analysis of Klebsiella pneumoniae mutants defective in nitrogen fixation  

Microsoft Academic Search

A series of mutants defective in nitrogen fixation (nif) were isolated in Klebsiella pneunoniae strain M5a1. The nif mutations were either located on plasmid pRD1 or on the K. pneumoniae chromosome. A total of 37 plasmid mutants and 28 chromosomal mutants were employed in complementation tests using the acetylene reduction technique. Most mutants could be assigned to one of seven

Ray Dixon; Christina Kennedy; Adám Kondorosi; Viji Krishnapillai; Mike Merrick

1977-01-01

149

Emergence of KPC-producing Klebsiella pneumoniae in Italy  

Microsoft Academic Search

BACKGROUND: The emergence of KPC-producing K. pneumoniae has now become a global concern. KPC beta-lactamases are plasmid-borne and, like extended spectrum beta lactamases (ESBLs), can accumulate and transfer resistance determinants to other classes of antibiotics. Therefore, infection control guidelines on early identification and control of the spread of organisms carrying these resistant determinants are needed. FINDINGS: Klebsiella pneumoniae carbapenemase (KPC)

Carla Fontana; Marco Favaro; Loredana Sarmati; Silvia Natoli; Anna Altieri; Maria C Bossa; Silvia Minelli; Francesca Leonardis; Cartesio Favalli

2010-01-01

150

Necrotizing external otitis in a patient caused by Klebsiella pneumoniae.  

PubMed

Necrotizing external otitis is a potentially life-threatening infection involving the temporal and adjacent bones. The most frequent pathogen is attributed to Pseudomonas aeruginosa, but is rarely caused by Klebsiella pneumoniae. Recently, we encountered a 47-year-old diabetic man with a swollen obliterated external ear canal with granulation tissue on the right ear. Image study demonstrated skull base osteomyelitis, epidural abscess and cerebral venous sinus thrombi. It was later proved to be necrotizing external otitis caused by Klebsiella pneumoniae. He then underwent craniotomy for drainage of the epidural abscess, followed by intravenous ciprofloxacin and metronidazole for 2 consecutive weeks until both pus and blood cultures depicted no growth of pathogens. Based on this case, synergistic antibiotic therapy using a third-generation cephalosporin or quinolone (ciprofloxacin), accompanied by metronidazole, and even a short-term aminoglycoside is recommended for the treatment of severe Klebsiella-induced necrotizing external otitis. Surgical intervention should be limited without shedding of the pathogens. PMID:16378221

Yang, Ting-Hua; Kuo, Shuo-Tzung; Young, Yi-Ho

2006-04-01

151

Infection with Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae in cancer patients.  

PubMed

Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae (KPC-Kp) is an emergent pathogen in healthcare-associated infections (HAIs). The aim of this study was to describe HAIs due to KPC-Kp, as well as identify mortality risk factors in cancer patients. In patients diagnosed with HAIs due to KPC-Kp between January 2009 and July 2013, we evaluated only the first infection episode of each patient, analyzing mortality separately for patients treated for??48 h with at least one antimicrobial agent proven to display in vitro activity against KPC-Kp. We evaluated variables related to the malignancy, the severity and characteristics of the HAI, and the antimicrobial therapy. We identified 83 HAIs due to KPC-Kp. The 30-day mortality was 57.8 % for all infections and 72.7 % for bacteremic infections. Of the 83 patients, 60 patients received??48 h of appropriate treatment and 44 (53 %) developed bacteremia. Ten patients (12 %) were neutropenic at HAI diagnosis and 33 (39.8 %) had infection at the tumor site. The most common HAI was urinary tract infection, seen in 26 patients (31.3 %), followed by primary bloodstream infection, seen in 24 patients (28.9 %). Forty-four patients (73.3 %) received combination antimicrobial therapy, most often including polymyxin (68.3 %). Risk factors for 30-day mortality are high sequential organ failure assessment (SOFA) score, need for intensive care stay at diagnosis of infection, and acute kidney injury; the removal of invasive devices related to infection and treatment with effective antibiotics for KPC-Kp are protective factors. In cancer patients, high mortality is associated with HAI due to KPC-Kp and mortality risk factors are more often related to acute infection than to the underlying disease. PMID:25169967

Freire, M P; Pierrotti, L C; Filho, H H C; Ibrahim, K Y; Magri, A S G K; Bonazzi, P R; Hajar, L; Diz, M P E; Pereira, J; Hoff, P M; Abdala, E

2015-02-01

152

Molecular diversity and genetic organization of antibiotic resistance in Klebsiella species   

E-print Network

Klebsiella spp. are opportunistic pathogens that cause hospital and community acquired infections such as pneumonia, urinary tract infection, septicaemia, soft tissue infections, liver abscess, and meningitis. ...

Younes, Abd El-Gayed Metwaly

2011-06-27

153

Overproduction of the secretin OutD suppresses the secretion defect of an Erwinia chrysanthemi outB mutant  

Microsoft Academic Search

OutB is a component of the Erwinia chrysanthemi Out secretion machinery. Homologues of OutB have been described in two other bacteria, Klebsiella oxytoca and Aeromonas hydrophila, but their requirement in the secretion process seems to be different. Study of OutB topology with the BlaM topology probe suggests that it is an inner-membrane protein with a large periplasmic domain. However, fractionation

Guy Condemine; Vladimir E. Shevchik

2000-01-01

154

Antibiofilm efficacy of silver nanoparticles against biofilm of extended spectrum ?-lactamase isolates of Escherichia coli and Klebsiella pneumoniae  

NASA Astrophysics Data System (ADS)

The ability of bacteria to develop antibiotic resistance and colonize abiotic surfaces by forming biofilms is a major cause of medical implant-associated infections and results in prolonged hospitalization periods and patient mortality. Different approaches have been used for preventing biofilm-related infections in health care settings. Many of these methods have their own demerits that include chemical-based complications; emergent antibiotic-resistant strains, and so on. Silver nanoparticles (AgNPs) are renowned for their influential antimicrobial activity. We demonstrate the biofilm formation by extended spectrum ?-lactamases-producing Escherichia coli and Klebsiella spp. by direct visualization applying tissue culture plate, tube, and Congo red agar methods. Double fluorescent staining for confocal laser scanning microscopy (CLSM) consisted of propidium iodide staining to detect bacterial cells and concanavalin A-fluorescein isothiocyanate staining to detect the exopolysaccharides matrix were used. Scanning electron microscopy observations clearly indicate that AgNPs reduced the surface coverage by E. coli and Klebsiella spp. thus prevent the biofilm formations. Double-staining technique using CLSM provides the visual evidence that AgNPs arrested the bacterial growth and prevent the exopolysaccharides formation. The AgNPs-coated surfaces effectively restricted biofilm formation of the tested bacteria. In our study, we could demonstrate the complete antibiofilm activity AgNPs at a concentration as low as 50 ?g/ml. Our findings suggested that AgNPs can be exploited towards the development of potential antibacterial coatings for various biomedical and environmental applications. These formulations can be used for the treatment of drug-resistant bacterial infections caused by biofilms, at much lower nanosilver loading with higher efficiency.

Ansari, Mohammad Azam; Khan, Haris M.; Khan, Aijaz A.; Cameotra, Swaranjit Singh; Pal, Ruchita

2014-10-01

155

Resistance of Klebsiella pneumoniae to the innate immune system of African green monkeys.  

PubMed

In recent years, an emergent Klebsiella pneumoniae hypermucoviscosity (HMV) phenotype has been associated with increased invasiveness and pathogenicity in primates. In this project, bacteria recovered from infected African green monkeys (AGM) (Chlorocebus aethiops sabaeus) were screened for HMV phenotype, and were compared to non-HMV isolates in in vitro, serum, and oxidative-mediated killing assays. Complement-mediated killing was assessed utilizing freshly collected serum from healthy AGM. Oxidative-mediated killing was investigated utilizing sodium hypochlorite and hydrogen peroxide. Compared to non-HMV isolates, HMV isolates were more resistant to serum-mediated and oxidative killing (p<0.05). Phagocytosis resistance was evaluated using AGM peripheral blood monocytes (PBMC), and results indicated that non-HMV isolates associated with the AGM PBMC to a greater extent than HMV isolates (p<0.001). Measurement of lactate dehydrogenase release showed that HMV isolates were more cytotoxic to AGM PBMC than non-HMV isolates (p<0.001). Thus, the hypermucoid phenotype appears to be an important virulence factor that promotes evasion of innate immune defenses. PMID:25614101

Cox, Brandi L; Schiffer, Holly; Dagget, Gregory; Beierschmitt, Amy; Sithole, Fortune; Lee, Elise; Revan, Floyd; Halliday-Simmonds, Iona; Beeler-Marfisi, Janet; Palmour, Roberta; Soto, Esteban

2015-03-23

156

Crystal structures of Klebsiella pneumoniae pantothenate kinase in complex with N-substituted pantothenamides.  

PubMed

N-Substituted pantothenamides are derivatives of pantothenate, the precursor in the biosynthesis of the essential metabolic cofactor coenzyme A (CoA). These compounds are substrates of pantothenate kinase (PanK) in the first step of CoA biosynthesis and possess antimicrobial activity against various pathogenic bacteria. Here we solved the crystal structure of the Klebsiella pneumoniae PanK (KpPanK) in complex with N-pentylpantothenamide (N5-Pan) to understand the molecular basis of its antimicrobial activity. The structure reveals a polar pocket interacting with the pantothenate moiety of N5-Pan and an aromatic pocket loosely protecting the pentyl tail, suggesting that the introduction of an aromatic ring to a new pantothenamide may enhance the compound's affinity to KpPanK. To test this idea, we synthesized N-pyridin-3-ylmethylpantothenamide (Np-Pan) and solved its co-crystal structure with KpPanK. The structure reveals two alternat conformations of the aromatic ring of Np-Pan bound at the aromatic pocket, providing the basis for further improvement of pantothenamide binding to KpPanK. PMID:23553820

Li, Buren; Tempel, Wolfram; Smil, David; Bolshan, Yuri; Schapira, Matthieu; Park, Hee-Won

2013-08-01

157

Molecular dissection of the evolution of carbapenem-resistant multilocus sequence type 258 Klebsiella pneumoniae  

PubMed Central

Infections caused by drug-resistant bacteria are a major problem worldwide. Carbapenem-resistant Klebsiella pneumoniae, most notably isolates classified as multilocus sequence type (ST) 258, have emerged as an important cause of hospital deaths. ST258 isolates are predominantly multidrug resistant, and therefore infections caused by them are difficult to treat. It is not known why the ST258 lineage is the most prevalent cause of multidrug-resistant K. pneumoniae infections in the United States and other countries. Here we tested the hypothesis that carbapenem-resistant ST258 K. pneumoniae is a single genetic clone that has disseminated worldwide. We sequenced to closure the genomes of two ST258 clinical isolates and used these genomes as references for comparative genome sequencing of 83 additional clinical isolates recovered from patients at diverse geographic locations worldwide. Phylogenetic analysis of the SNPs in the core genome of these isolates revealed that ST258 K. pneumoniae organisms are two distinct genetic clades. This unexpected finding disproves the single-clone hypothesis. Notably, genetic differentiation between the two clades results from an ?215-kb region of divergence that includes genes involved in capsule polysaccharide biosynthesis. The region of divergence appears to be a hotspot for DNA recombination events, and we suggest that this region has contributed to the success of ST258 K. pneumoniae. Our findings will accelerate research on novel diagnostic, therapeutic, and vaccine strategies designed to prevent and/or treat infections caused by multidrug resistant K. pneumoniae. PMID:24639510

DeLeo, Frank R.; Chen, Liang; Porcella, Stephen F.; Martens, Craig A.; Kobayashi, Scott D.; Porter, Adeline R.; Chavda, Kalyan D.; Jacobs, Michael R.; Mathema, Barun; Olsen, Randall J.; Bonomo, Robert A.; Musser, James M.; Kreiswirth, Barry N.

2014-01-01

158

Therapeutic activities of cefazolin, cefotaxime, and ceftazidime against experimentally induced Klebsiella pneumoniae pneumonia in rats.  

PubMed Central

The efficacies of several dosage schedules of cefazolin, cefotaxime, and ceftazidime, started 12 or 36 h after infection, were examined in experimental pneumonia caused by Klebsiella pneumoniae in rats. The therapeutic activities of the cephalosporins were compared with the antibacterial activities in vitro and the serum concentration curves. The course of experimental pneumonia was rapid and characterized by tissue necrosis. Response to antimicrobial treatment was evaluated with respect to mortality and numbers of bacteria in lung (left lobe), blood, and pleural fluid. When antibiotic treatment was started early, i.e., 12 h after bacterial inoculation, cefotaxime and ceftazidime were equally effective and superior to cefazolin. Eleven doses of 10 mg of cefotaxime or ceftazidime per kg or 11 doses of 60 mg of cefazolin per kg were required to improve the survival rate. With a delay in administration to 36 h after inoculation, the efficacy of the cephalosporins decreased markedly. In the three dosages tested, cefazolin was ineffective. Survival improved with the administration of nine doses of 60 mg of cefotaxime per kg or nine doses of 10 mg of ceftazidime per kg. These results are not in accordance with the ratio of in vitro activities of cefotaxime and ceftazidime or the serum concentration curves. Images PMID:6297384

Bakker-Woudenberg, I A; van den Berg, J C; Michel, M F

1982-01-01

159

NMR solution structure of KP-TerB, a tellurite-resistance protein from Klebsiella pneumoniae.  

PubMed

Klebsiella pneumoniae (KP), a Gram-negative bacterium, is a common cause of hospital-acquired bacterial infections worldwide. Tellurium (Te) compounds, although relatively rare in the environment, have a long history as antimicrobial and therapeutic agents. In bacteria, tellurite (TeO(3) (-2)) resistance is conferred by the ter (Te(r)) operon (terZABCDEF). Here, on the basis of 2593 restraints derived from NMR analysis, we report the NMR structure of TerB protein (151 amino acids) of KP (KP-TerB), which is mainly composed of seven alpha-helices and a 3(10) helix, with helices II to V apparently forming a four-helix bundle. The ensemble of 20 NMR structures was well-defined, with a RMSD of 0.32 +/- 0.06 A for backbone atoms and 1.11 +/- 0.07 A for heavy atoms, respectively. A unique property of the KP-TerB structure is that the positively and negatively charged clusters are formed by the N-terminal positively and C-terminal negatively charged residues, respectively. To the best of our knowledge, the protein sequence and structures of KP-TerB are unique. PMID:18305192

Chiang, Sheng-Kuo; Lou, Yuan-Chao; Chen, Chinpan

2008-04-01

160

Emergence of Klebsiella pneumoniae clinical isolates producing KPC-2 carbapenemase in Cuba.  

PubMed

The emergence of Klebsiella pneumoniae producing carbapenemase (KPC) has now become a global concern. As a part of a nationwide multicentre surveillance study in Cuba, three K. pneumoniae clinical isolates resistant to carbapenems were detected for a 1-month period (September to October 2011). PCR and sequence analysis revealed that the three strains harboured bla KPC-2. They showed resistance or intermediate susceptibility to expanded-spectrum cephalosporins, other ?-lactams, a ?-lactam/?-lactamase inhibitor combination, and gentamicin. Two strains were susceptible only to colistin, whereas the other strain showing colistin resistance was susceptible to fluoroquinolones. These bla KPC -2-positive K. pneumoniae strains were classified into ST1271 (CC29), a novel clone harbouring bla KPC -2, and were revealed to be genetically identical by PCR-based DNA fingerprinting. The three patients infected with the KPC-producing K. pneumoniae had common risk factors, and had no overseas travel experience outside Cuba, suggesting local acquisition of the resistant pathogen. This is the first report of a KPC-producing K. pneumoniae in Cuba. Although detection of KPC in Enterobacteriaceae is still rare in Cuba, our finding indicated that KPC-producing bacteria are a global concern and highlighted the need to identify these microorganisms in clinical laboratories. PMID:25356357

Quiñones, D; Hart, M; Espinosa, F; Garcia, S; Carmona, Y; Ghosh, S; Urushibara, N; Kawaguchiya, M; Kobayashi, N

2014-07-01

161

Multicellularity and Antibiotic Resistance in Klebsiella pneumoniae Grown Under Bloodstream-Mimicking Fluid Dynamic Conditions  

PubMed Central

Background.?While the importance of fluid dynamical conditions is well recognized in the growth of biofilms, their role during bacteremia is unknown. We examined the impact of physiological fluid shear forces on the development of multicellular aggregates of Klebsiella pneumoniae. Methods.?Wild-type and O-antigen or capsular mutants of K. pneumoniae were grown as broth culture in a Taylor-Couette flow cell configured to provide continuous shear forces comparable to those encountered in the human arterial circulation (ie, on the order of 1.0 Pa). The size distribution and antibiotic resistance of aggregates formed in this apparatus were determined, as was their ability to persist in the bloodstream of mice following intravenous injection. Results.?Unlike growth in shaking flasks, bacteria grown in the test apparatus readily formed aggregates, a phenotype largely absent in capsular mutants and to a lesser degree in O-antigen mutants. Aggregates were found to persist in the bloodstream of mice. Importantly, organisms grown under physiological shear were found to have an antibiotic resistance phenotype intermediate between that of fully planktonic and biofilm states. Conclusions.?When grown under intravascular-magnitude fluid dynamic conditions, K. pneumoniae spontaneously develops into multicellular aggregates that are capable of persisting in the circulation and exhibit increased antibiotic resistance. PMID:22711903

Thornton, Margaret M.; Chung-Esaki, Hangyul M.; Irvin, Charlene B.; Bortz, David M.; Solomon, Michael J.; Younger, John G.

2012-01-01

162

Emergence of Klebsiella pneumoniae clinical isolates producing KPC-2 carbapenemase in Cuba  

PubMed Central

The emergence of Klebsiella pneumoniae producing carbapenemase (KPC) has now become a global concern. As a part of a nationwide multicentre surveillance study in Cuba, three K. pneumoniae clinical isolates resistant to carbapenems were detected for a 1-month period (September to October 2011). PCR and sequence analysis revealed that the three strains harboured blaKPC-2. They showed resistance or intermediate susceptibility to expanded-spectrum cephalosporins, other ?-lactams, a ?-lactam/?-lactamase inhibitor combination, and gentamicin. Two strains were susceptible only to colistin, whereas the other strain showing colistin resistance was susceptible to fluoroquinolones. These blaKPC-2-positive K. pneumoniae strains were classified into ST1271 (CC29), a novel clone harbouring blaKPC-2, and were revealed to be genetically identical by PCR-based DNA fingerprinting. The three patients infected with the KPC-producing K. pneumoniae had common risk factors, and had no overseas travel experience outside Cuba, suggesting local acquisition of the resistant pathogen. This is the first report of a KPC-producing K. pneumoniae in Cuba. Although detection of KPC in Enterobacteriaceae is still rare in Cuba, our finding indicated that KPC-producing bacteria are a global concern and highlighted the need to identify these microorganisms in clinical laboratories. PMID:25356357

Quiñones, D; Hart, M; Espinosa, F; Garcia, S; Carmona, Y; Ghosh, S; Urushibara, N; Kawaguchiya, M; Kobayashi, N

2014-01-01

163

Sequential studies in ankylosing spondylitis. Association of Klebsiella pneumoniae with active disease  

Microsoft Academic Search

A study of 163 patients with ankylosing spondylitis seen on 433 occasions showed that active inflammatory disease was strongly associated with the presence of Klebsiella pneumoniae in the faeces (P less than 0.001). Sequential studies showed that in patients with inactive disease the presence of a positive culture for Klebsiella was associated with the subsequent development of active inflammatory disease

R W Ebringer; D R Cawdell; P Cowling; A Ebringer

1978-01-01

164

Detection of NDM-1-producing Klebsiella pneumoniae in Kenya.  

PubMed

Seven carbapenem-resistant NDM-1-positive Klebsiella pneumoniae isolates were recovered from patients hospitalized between 2007 and 2009 in different wards at a referral and tertiary care center in Nairobi. Most of the isolates were obtained from urine. All isolates carried the bla(NDM-1) carbapenemase gene previously reported from India, Pakistan, and the United Kingdom. These isolates were clonally related and expressed many other resistance determinants, including ?-lactamases CTX-M-15, OXA-1, OXA-9, CMY-6, and aminoglycoside resistance methylase RmtC. This work corresponds to the first report of NDM-1 producers in Africa. PMID:21115785

Poirel, Laurent; Revathi, Gunturu; Bernabeu, Sandrine; Nordmann, Patrice

2011-02-01

165

Detection of NDM-1-Producing Klebsiella pneumoniae in Kenya?  

PubMed Central

Seven carbapenem-resistant NDM-1-positive Klebsiella pneumoniae isolates were recovered from patients hospitalized between 2007 and 2009 in different wards at a referral and tertiary care center in Nairobi. Most of the isolates were obtained from urine. All isolates carried the blaNDM-1 carbapenemase gene previously reported from India, Pakistan, and the United Kingdom. These isolates were clonally related and expressed many other resistance determinants, including ?-lactamases CTX-M-15, OXA-1, OXA-9, CMY-6, and aminoglycoside resistance methylase RmtC. This work corresponds to the first report of NDM-1 producers in Africa. PMID:21115785

Poirel, Laurent; Revathi, Gunturu; Bernabeu, Sandrine; Nordmann, Patrice

2011-01-01

166

Tolerance of Anaerobic Bacteria to Chlorinated Solvents  

PubMed Central

The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515

Koenig, Joanna C.; Groissmeier, Kathrin D.; Manefield, Mike J.

2014-01-01

167

Isolation of gram-negative bacteria from cockroaches trapped from urban environment.  

PubMed

Three different areas--hospital, food-handling establishments and human dwellings, were surveyed for pathogenic gram-negative bacteria carried on the cuticles of cockroaches. Fifty species of bacteria were identified from all cockroaches. Escherichia coli, Klebsiella pneumoniae, Citrobacter freundii and Enterobacter cloacae were the most frequently found. Pathogenic and potentially pathogenic bacteria represented 58% of all bacteria identified. The numbers of pathogenic and potentially pathogenic bacteria were similar in hospital areas and food-handling establishments, while, human dwellings possessed a poorer bacterial flora. E. coli, K. pneumoniae and E. cloacae were dominant species in hospital areas, while in food-handling establishments and human dwellings, E. coli, K. pneumoniae and C. freundii predominated. Therefore, cockroaches can play a role in bacterial transmission, due to the bacteria carried on their cuticles. PMID:15689087

Chaichanawongsaroj, Nuntaree; Vanichayatanarak, Kaunjeera; Pipatkullachat, Thapanee; Polrojpanya, Mongkol; Somkiatcharoen, Srivitta

2004-09-01

168

Parasitic Bacteria  

E-print Network

species and 2 varieties of bacteria parasitic on plants in Ohio. Bacterial plant diseases in Ohio, such as alfalfa wilt, cucurbit wilt, corn leaf blight and wilt (Stewart's disease), fire blight of apple and pear, FIGURE 1. Bacterial wilt of carnation. crown gall, soft rot of many vegetables, and

Ellett C. Wayne; C. W. Ellett; C. W. Ellett; Plate I

169

Magnetotactic Bacteria  

Microsoft Academic Search

Bacteria with motility directed by the local geomagnetic field have been observed in marine sediments. These magnetotactic microorganisms possess flagella and contain novel structured particles, rich in iron, within intracytoplasmic membrane vesicles. Conceivably these particles impart to cells a magnetic moment. This could explain the observed migration of these organisms in fields as weak as 0.5 gauss.

Richard Blakemore

1975-01-01

170

Chemical composition and antibacterial activity of Lavandula coronopifolia essential oil against antibiotic-resistant bacteria.  

PubMed

The aim of this study was to analyse the composition of the essential oil (EO) of Lavandula coronopifolia from Morocco and to evaluate its in vitro antibacterial activity against antibiotic-resistant bacteria isolated from clinical infections. The antimicrobial activity was assessed by a broth micro-well dilution method using multiresistant clinical isolates of 11 pathogenic bacteria: Klebsiella pneumoniae subsp. pneumoniae, Klebsiella ornithinolytica, Escherichia coli, Enterobacter cloacae, Enterobacter aerogenes, Providencia rettgeri, Citrobacter freundii, Hafnia alvei, Salmonella spp., Acinetobacter baumannii and methicillin-resistant Staphylococcus aureus. The main compounds of the oil were carvacrol (48.9%), E-caryophyllene (10.8%) and caryophyllene oxide (7.7%). The oil showed activity against all tested strains with minimal inhibitory concentration (MIC) values ranging between 1% and 4%. For most of the strains, the MIC value was equivalent to the minimal bactericidal concentration value, indicating a clear bactericidal effect of L. coronopifolia EO. PMID:25174508

Ait Said, L; Zahlane, K; Ghalbane, I; El Messoussi, S; Romane, A; Cavaleiro, C; Salgueiro, L

2015-03-01

171

Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences  

PubMed Central

Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism’s transcriptome is related to its cellular proteome. PMID:24551820

Motalleb, Gholamreza

2014-01-01

172

Transduction of chromosomal genes between enteric bacteria by bacteriophage P1.  

PubMed Central

We have used P1 transduction to create intergeneric hybrid strains of enteric bacteria by moving the genA and hut genes between Klebsiella aerogenes, Escherichia coli and Salmonella typhimurium. The use of E. coli as the recipient in such transductions permits the construction of episomes and specialized transducing phage containing non-E. coli material. The effect of host restriction modification and deoxyribonucleic acid homology on the frequency of intergeneric transduction of these loci has been examined. PMID:3494

Tyler, B M; Goldberg, R B

1976-01-01

173

Effects of waste water treatment on the species composition and Antibiotic resistance of coliform bacteria  

Microsoft Academic Search

Coliform bacteria from raw and treated sewage in a mechanical-biological treatment plant were examined for resistance to four to six antibiotics, and randomly selected isolates were identified. The results indicate that certain coliform species are eliminated at lower rates than others by the treatment.Klebsiella sp. became more frequent, whereas the proportion ofEscherichia coli diminished. A comparison of raw and treated

Sigrid Rita Andersen

1993-01-01

174

Group of Peptides That Act Synergistically with Hydrophobic Antibiotics against Gram-Negative Enteric Bacteria  

Microsoft Academic Search

A synthetic peptide, KFFKFFKFF, consisting of cationic lysine residues and hydrophobic phenylalanine residues was found to sensitize gram-negative bacteria to hydrophobic and amphipathic antibiotics. At a concentrationof3 mg\\/ml,itdecreasedtheMICofrifampinforsmooth,encapsulatedEscherichiacolibyafactor of 300. Other susceptible bacterial species includedEnterobacter cloacae,Klebsiella pneumoniae, andSalmonella typhimurium, butPseudomonas aeruginosawas resistant. Similar results were obtained with another synthetic peptide, IKFLKFLKFL. The fractional inhibitory concentration indices for the synergism of

MARTTI VAARA; ANDMASSIMO PORRO

1996-01-01

175

Characterization of RarA, a Novel AraC Family Multidrug Resistance Regulator in Klebsiella pneumoniae  

PubMed Central

Transcriptional regulators, such as SoxS, RamA, MarA, and Rob, which upregulate the AcrAB efflux pump, have been shown to be associated with multidrug resistance in clinically relevant Gram-negative bacteria. In addition to the multidrug resistance phenotype, these regulators have also been shown to play a role in the cellular metabolism and possibly the virulence potential of microbial cells. As such, the increased expression of these proteins is likely to cause pleiotropic phenotypes. Klebsiella pneumoniae is a major nosocomial pathogen which can express the SoxS, MarA, Rob, and RamA proteins, and the accompanying paper shows that the increased transcription of ramA is associated with tigecycline resistance (M. Veleba and T. Schneiders, Antimicrob. Agents Chemother. 56:4466–4467, 2012). Bioinformatic analyses of the available Klebsiella genome sequences show that an additional AraC-type regulator is encoded chromosomally. In this work, we characterize this novel AraC-type regulator, hereby called RarA (Regulator of antibiotic resistance A), which is encoded in K. pneumoniae, Enterobacter sp. 638, Serratia proteamaculans 568, and Enterobacter cloacae. We show that the overexpression of rarA results in a multidrug resistance phenotype which requires a functional AcrAB efflux pump but is independent of the other AraC regulators. Quantitative real-time PCR experiments show that rarA (MGH 78578 KPN_02968) and its neighboring efflux pump operon oqxAB (KPN_02969_02970) are consistently upregulated in clinical isolates collected from various geographical locations (Chile, Turkey, and Germany). Our results suggest that rarA overexpression upregulates the oqxAB efflux pump. Additionally, it appears that oqxR, encoding a GntR-type regulator adjacent to the oqxAB operon, is able to downregulate the expression of the oqxAB efflux pump, where OqxR complementation resulted in reductions to olaquindox MICs. PMID:22644028

Veleba, Mark; Higgins, Paul G.; Gonzalez, Gerardo; Seifert, Harald

2012-01-01

176

High isolation rates of multidrug-resistant bacteria from water and carpets of mosques  

PubMed Central

Objective There is little information regarding the isolation of antimicrobial-resistant potentially pathogenic bacteria from water and carpets of mosques worldwide. The objective of the present investigation is to determine the bacteriological quality of water and carpets of mosques in Elkhomes city in Libya. Methods Potentially pathogenic bacteria were isolated from water samples (n=44) and dust samples from carpets (n=50) of 50 mosques in Elkhomes city, Libya, using standard bacteriological procedures. Susceptibility of isolated bacteria to antimicrobial agents was determined by the disc-diffusion method. Results Of the water samples examined, 12 (27.3%) were positive for Escherichia coli, 10 (22.7%) for Klebsiella spp., and 15 (34.1%) for other enteric bacteria. Of the dust samples of carpets examined, 6 (12%) were positive for E. coli, 33 (66%) for Klebsiella spp., and 30 (60%) for Staphylococcus spp. Multidrug resistance (MDR, resistance to three or more antimicrobial groups) was found among 48.7% (19/37) and 46.9% (30/64) of the examined enterobacteria from water and carpets, respectively, and among 66.7% (20/30) of Staphylococcus spp. from carpets. In addition, methicillin-resistant Staphylococcus aureus (MRSA) was isolated from a carpet of one mosque. Conclusion Presence of multidrug-resistant potentially pathogenic bacteria in examined water and carpets indicate that mosques as communal environments may play a role in the spread of multidrug-resistant bacteria in the community and pose a serious health risk to worshipers. PMID:25128691

Mohamed Ali, Mostafa Mohamed; Alemary, Fuoad; Alrtail, Amna; Rzeg, Moftah M.; Albakush, Abdulla M.; Ghenghesh, Khalifa Sifaw

2014-01-01

177

Legionella pneumophila Persists within Biofilms Formed by Klebsiella pneumoniae, Flavobacterium sp., and Pseudomonas fluorescens under Dynamic Flow Conditions  

PubMed Central

Legionella pneumophila, the agent of Legionnaires' disease pneumonia, is transmitted to humans following the inhalation of contaminated water droplets. In aquatic systems, L. pneumophila survives much of time within multi-organismal biofilms. Therefore, we examined the ability of L. pneumophila (clinical isolate 130b) to persist within biofilms formed by various types of aquatic bacteria, using a bioreactor with flow, steel surfaces, and low-nutrient conditions. L. pneumophila was able to intercalate into and persist within a biofilm formed by Klebsiella pneumoniae, Flavobacterium sp. or Pseudomonas fluorescens. The levels of L. pneumophila within these biofilms were as much as 4×104 CFU per cm2 of steel coupon and lasted for at least 12 days. These data document that K. pneumoniae, Flavobacterium sp., and P. fluorescens can promote the presence of L. pneumophila in dynamic biofilms. In contrast to these results, L. pneumophila 130b did not persist within a biofilm formed by Pseudomonas aeruginosa, confirming that some bacteria are permissive for Legionella colonization whereas others are antagonistic. In addition to colonizing certain mono-species biofilms, L. pneumophila 130b persisted within a two-species biofilm formed by K. pneumoniae and Flavobacterium sp. Interestingly, the legionellae were also able to colonize a two-species biofilm formed by K. pneumoniae and P. aeruginosa, demonstrating that a species that is permissive for L. pneumophila can override the inhibitory effect(s) of a non-permissive species. PMID:23185637

Stewart, Catherine R.; Muthye, Viraj; Cianciotto, Nicholas P.

2012-01-01

178

Ethanol production from glycerol-containing biodiesel waste by Klebsiella variicola shows maximum productivity under alkaline conditions.  

PubMed

Biodiesel fuel (BDF) waste contains large amounts of crude glycerol as a by-product, and has a high alkaline pH. With regard to microbial conversion of ethanol from BDF-derived glycerol, bacteria that can produce ethanol at alkaline pH have not been reported to date. Isolation of bacteria that shows maximum productivity under alkaline conditions is essential to effective production of ethanol from BDF-derived glycerol. In this study, we isolated the Klebsiella variicola TB-83 strain, which demonstrated maximum ethanol productivity at alkaline pH. Strain TB-83 showed effective usage of crude glycerol with maximum ethanol production at pH 8.0-9.0, and the culture pH was finally neutralized by formate, a by-product. In addition, the ethanol productivity of strain TB-83 under various culture conditions was investigated. Ethanol production was more efficient with the addition of yeast extract. Strain TB-83 produced 9.8 g/L ethanol (0.86 mol/mol glycerol) from cooking oil-derived BDF waste. Ethanol production from cooking oil-derived BDF waste was higher than that of new frying oil-derived BDF and pure-glycerol. This is the first report to demonstrate that the K. variicola strain TB-83 has the ability to produce ethanol from glycerol at alkaline pH. PMID:24681408

Suzuki, Toshihiro; Nishikawa, Chiaki; Seta, Kohei; Shigeno, Toshiya; Nakajima-Kambe, Toshiaki

2014-05-25

179

Klebsiella pneumoniae liver abscess associated with septic spinal epidural abscess.  

PubMed

A 56-year-old Japanese man with hypertension presented with a 10 days history of high fever, right and left upper quadrant tenderness. An abdominal ultrasonography and computerized tomographic scan revealed a large collection in the right lobe of the liver that was consistent with an abscess. A drainage catheter was placed and purulent fluid was drained. Cultures of the fluid and blood were positive for a strain of ampicillin-resistant Klebsiella pneumoniae. Six days after admission, paraplegia and urinary retention were found. On the neurological examination, deep tendon reflexes of the lower extremities were absent bilaterally. Magnetic resonance imaging scan detected thoracic spinal epidural abscess and paraspinal abscess. He received the emergent decompressive laminectomy. Culture of surgical specimen grew ampicillin-resistant K. pneumoniae. The patient was treated with biapenem intravenously. Thereafter, clinical symptoms improved gradually and he was removed to the professional hospital to continue rehabilitation for gait disturbance on hospital day 147. PMID:15652471

Kuramochi, Gen; Takei, Shin-Ichi; Sato, Munehiro; Isokawa, Osamu; Takemae, Takashi; Takahashi, Akira

2005-01-01

180

Contemplating 3-Hydroxypropionic Acid Biosynthesis in Klebsiella pneumoniae.  

PubMed

3-Hydroxypropionic acid (3-HP) is a commercially valuable platform chemical from which an array of C3 compounds can be generated. Klebsiella pneumoniae has been considered a promising species for biological production of 3-HP. Despite a wealth of reports related to 3-HP biosynthesis in K. pneumoniae, its commercialization is still in infancy. The major hurdle hindering 3-HP overproduction lies in the poor understanding of glycerol dissimilation in K. pneumoniae. To surmount this problem, this review aims to portray a picture of 3-HP biosynthesis, involving 3-HP-synthesizing strains, biochemical attributes, metabolic pathways and key enzymes. Inspired by the state-of-the-art advances in metabolic engineering and synthetic biology, here we advocate protocols for overproducing 3-HP in K. pneumoniae. These protocols range from cofactor regeneration, alleviation of metabolite toxicity, genome editing, remodeling of transport system, to carbon flux partition via logic gate. The feasibility for these protocols was also discussed. PMID:25805899

Li, Ying; Tian, Pingfang

2015-06-01

181

Carbapenemase-producing Klebsiella pneumoniae: molecular and genetic decoding.  

PubMed

Klebsiella pneumoniae carbapenemases (KPCs) were first identified in 1996 in the USA. Since then, regional outbreaks of KPC-producing K. pneumoniae (KPC-Kp) have occurred in the USA, and have spread internationally. Dissemination of blaKPC involves both horizontal transfer of blaKPC genes and plasmids, and clonal spread. Of epidemiological significance, the international spread of KPC-producing K. pneumoniae is primarily associated with a single multilocus sequence type (ST), ST258, and its related variants. However, the molecular factors contributing to the success of ST258 largely remain unclear. In this review, we discuss the recent progresses in understanding KPC-producing K. pneumoniae that are contributing to our knowledge of plasmid and genome composition and structure among the KPC epidemic clone, and we identify possible factors that influence its epidemiological success. PMID:25304194

Chen, Liang; Mathema, Barun; Chavda, Kalyan D; DeLeo, Frank R; Bonomo, Robert A; Kreiswirth, Barry N

2014-12-01

182

Antibiotic Resistance Related to Biofilm Formation in Klebsiella pneumoniae  

PubMed Central

The Gram-negative opportunistic pathogen, Klebsiella pneumoniae, is responsible for causing a spectrum of community-acquired and nosocomial infections and typically infects patients with indwelling medical devices, especially urinary catheters, on which this microorganism is able to grow as a biofilm. The increasingly frequent acquisition of antibiotic resistance by K. pneumoniae strains has given rise to a global spread of this multidrug-resistant pathogen, mostly at the hospital level. This scenario is exacerbated when it is noted that intrinsic resistance to antimicrobial agents dramatically increases when K. pneumoniae strains grow as a biofilm. This review will summarize the findings about the antibiotic resistance related to biofilm formation in K. pneumoniae. PMID:25438022

Vuotto, Claudia; Longo, Francesca; Balice, Maria Pia; Donelli, Gianfranco; Varaldo, Pietro E.

2014-01-01

183

Production of an extracellular polysaccharide bioflocculant by Klebsiella pneumoniae.  

PubMed

Klebsiella pneumoniae H12 produced a newly identified extracellular polysaccharide in an ethanol medium with a yield of 3.0 g/l. The molar composition of the polysaccharide was 56.04% galactose, 25.92% glucose, 10.92% galacturonic acid, 3.71% mannose, and 3.37% glucuronic acid. The addition of 0.5%-1.5% NaCl increased production. The polysaccharide flocculated with kaolin clay in suspension at the concentration of 1 ppm in a 300-ppm solution of CaCl2. Almost all bacterial species cells aggregated in the polysaccharide solution. The ability to flocculate with kaolin clay changed with the pH and with the concentrations of coexisting cation and anion species. The polysaccharide flocculant may participate in in vivo bacterial aggregation or adherence to host organisms. PMID:10664839

Nakata, K; Kurane, R

1999-12-01

184

Complete Genome Sequence of Klebsiella pneumoniae Phage JD001  

PubMed Central

Klebsiella pneumoniae is a member of the family Enterobacteriaceae, opportunistic pathogens that are among the eight most prevalent infectious agents in hospitals. The emergence of multidrug-resistant strains of K. pneumoniae has became a public health problem globally. To develop an effective antimicrobial agent, we isolated a bacteriophage, named JD001, from seawater and sequenced its genome. Comparative genome analysis of phage JD001 with other K. pneumoniae bacteriophages revealed that phage JD001 has little similarity to previously published K. pneumoniae phages KP15, KP32, KP34, and phiKO2. Here we announce the complete genome sequence of JD001 and report major findings from the genomic analysis. PMID:23166250

Cui, Zelin; Shen, Wenbin; Wang, Zheng; Zhang, Haotian; Me, Rao; Wang, Yanchun; Zeng, Lingbin; Zhu, Yongzhang; Qin, Jinhong

2012-01-01

185

[Coliform bacteria in raw and pasteurized milk].  

PubMed

Studied were 360 samples of raw and 1404 samples of pasteurized milk, collected from three milk centers, for the presence of coliform bacteria. It was found that the coli titer of the raw milk varied from 10(-5) up to 10(-7), depending on the season. The regimes of pasteurization applied kill 100 per cent of the present coli organisms. After the thermic treatment the milk was additionally contaminated with coli forms from the containers and the equipment in dependence on the conditions of washing and disinfection. The coli titer of the pasteurized milk varied from 1 to 10(-3). A total of 602 strains of coliform bacteria were isolated from the pasteurized and the raw milk; the bacteria were differentiated by the scheme of Kauffmann. Most commonly encountered were the coli forms of the following genera:Citrobacter (35 per cent), Enterobacter (29.8 per cent), Klebsiella (23.9 per cent), and Escherichia (11.3 per cent). The following species were prevailing in raw milk: Kl. aerogenes, Ent. aerogenes, Ent. cloacae, C. freundi, and C. intermedium. In pasteurized milk dominating were Kl. aerogenes, C. freundi. Ent. aerogenes, and Ent. cloacae. PMID:345606

Kaloianov, I; Gogov, I

1977-01-01

186

Molecular characterization of clinical multidrug-resistant Klebsiella pneumoniae isolates  

PubMed Central

Background Klebsiella pneumoniae is a frequent nosocomial pathogen, with the multidrug-resistant (MDR) K. pneumoniae being a major public health concern, frequently causing difficult-to-treat infections worldwide. The aim of this study was to investigate the molecular characterization of clinical MDR Klebsiella pneumoniae isolates. Methods A total of 27 non-duplicate MDR K. pneumoniae isolates with a CTX-CIP-AK resistance pattern were investigated for the prevalence of antimicrobial resistance genes including extended spectrum ?-lactamase genes (ESBLs), plasmid-mediated quinolone resistance (PMQR) genes, 16S rRNA methylase (16S-RMTase) genes, and integrons by polymerase chain reaction (PCR) amplification and DNA sequencing. Plasmid replicons were typed by PCR-based replicon typing (PBRT). Multi-locus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE) were carried out to characterize the strain relatedness. Results All the isolates co-harbored 3 or more resistance determinants. OqxAB, CTX-M-type ESBLs and RmtB were the most frequent determinants, distributed among19 (70.4%),18 (66.7%) and 8 (29.6%) strains. Fourteen isolates harbored class 1 integrons, with orfD-aacA4 being the most frequent gene cassette array. Class 3 integrons were less frequently identified and contained the gene cassette array of blaGES-1-blaOXA-10-aac(6?)-Ib. IncFII replicon was most commonly found in this collection. One cluster was observed with ?80% similarity among profiles obtained by PFGE, and one sequence type (ST) by MLST, namely ST11, was observed in the cluster. Conclusion K. pneumoniae carbapenemase (KPC)–producing ST11 was the main clone detected. Of particular concern was the high prevalence of multiple resistance determinants, classs I integrons and IncFII plasmid replicon among these MDR strains, which provide advantages for the rapid development of MDR strains. PMID:24884610

2014-01-01

187

Correlation of Klebsiella pneumoniae Comparative Genetic Analyses with Virulence Profiles in a Murine Respiratory Disease Model  

E-print Network

Klebsiella pneumoniae is a bacterial pathogen of worldwide importance and a significant contributor to multiple disease presentations associated with both nosocomial and community acquired disease. ATCC 43816 is a well-studied ...

Fodah, Ramy A.

188

Presence of Nitrogen Fixing Klebsiella pneumoniae in the gut of the Formosan Subterranean Termite (Coptotermes formosanus)  

Technology Transfer Automated Retrieval System (TEKTRAN)

A gram-negative facultative anaerobic enteric bacterium, Klebsiella pneumoniae was isolated from the hindgut of the Formosan subterranean termite (FST). It was characterized using, Fatty acid methyl ester (FAME) analysis, BIOLOG assay, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-...

189

Treatment of Klebsiella pneumoniae carbapenemase (KPC) infections: a review of published case series and case reports.  

PubMed

The emergence of Klebsiella pneumoniae carbapenemases (KPCs) producing bacteria has become a significant global public health challenge while the optimal treatment remains undefined. We performed a systematic review of published studies and reports of treatment outcomes of KPC infections using MEDLINE (2001-2011). Articles or cases were excluded if one of the following was fulfilled: no individual patient data provided, no treatment regimen specified, no treatment outcome specified, report of colonization, or greater than three antibiotics were used to treat the KPC infection. Data extracted included patient demographics, site of infection, organism, KPC subtype, antimicrobial therapy directed at KPC-infection, and treatment outcome. Statistical analysis was performed in an exploratory manner. A total of 38 articles comprising 105 cases were included in the analysis. The majority of infections were due to K. pneumoniae (89%). The most common site of infection was blood (52%), followed by respiratory (30%), and urine (10%). Forty-nine (47%) cases received monotherapy and 56 (53%) cases received combination therapy directed at the KPC-infection. Significantly more treatment failures were seen in cases that received monotherapy compared to cases who received combination therapy (49% vs 25%; p= 0.01). Respiratory infections were associated with higher rates of treatment failure with monotherapy compared to combination therapy (67% vs 29% p= 0.03). Polymyxin monotherapy was associated with higher treatment failure rates compared to polymyxin-based combination therapy (73% vs 29%; p= 0.02); similarly, higher treatment failure rates were seen with carbapenem monotherapy compared to carbapenem-based combination therapy (60% vs 26%; p= 0.03). Overall treatment failure rates were not significantly different in the three most common antibiotic-class combinations: polymyxin plus carbapenem, polymyxin plus tigecycline, polymyxin plus aminoglycoside (30%, 29%, and 25% respectively; p=0.6). In conclusion, combination therapy is recommended for the treatment of KPC infections; however, which combination of antimicrobial agents needs to be established in future prospective clinical trials. PMID:23234297

Lee, Grace C; Burgess, David S

2012-01-01

190

Acute-onset postoperative endophthalmitis caused by multidrug-resistant Klebsiella pneumoniae  

PubMed Central

The purpose of this paper is to report outcomes of intravitreal imipenem in the treatment of multidrug-resistant Klebsiella-related postoperative endophthalmitis. This observational case series consists of three eyes from three patients seen between 2013 and 2014. Multidrug-resistant Klebsiella pneumoniae is characterized by a rapid, fulminant course and severe intraocular inflammation. Intravitreal imipenem may be used to treat such infection. PMID:25258505

Sanghi, Shekhar; Pathengay, Avinash; Jindal, Animesh; Raval, Vishal; Nayak, Sameera; Sharma, Savitri; Bawdekar, Abhishek; Flynn, Harry W

2014-01-01

191

Acute placental infection due to Klebsiella pneumoniae: report of a unique case.  

PubMed Central

A 40-year-old woman, gravida 9, with seven healthy children and a history of one abortion (p 7 + 1), presented at 18 weeks of gestation with fever and malodorous vaginal discharge. Ultrasound revealed a macerated fetus. The placenta showed acute chorioamnionitis and acute villitis with microabscess formation. Blood and vaginal cultures both grew Klebsiella pneumoniae. This is the first reported case in English literature of Klebsiella pneumoniae causing suppurative placentitis leading to fetal demise. PMID:16040328

Sheikh, Salwa S; Amr, Samir S; Lage, Janice M

2005-01-01

192

Adverse influence of diazepam upon resistance to Klebsiella pneumoniae infection in mice.  

PubMed

Male and female mice, IOPS OF1 strain, received an i.p. injection of diazepam 1,2,4 or 8 mg/kg daily for 3 days prior to i.p. challenge with Klebsiella pneumoniae. Diazepam pretreatment increased mortality due to Klebsiella pneumoniae indicating that diazepam alters natural resistance to infection. The mechanism has not been elucidated but would appear to involve T cells and/or macrophages. PMID:6344337

Laschi, A; Descotes, J; Tachon, P; Evreux, J C

1983-05-01

193

Klebsiella pneumoniae infections in Greek hospitals. Dissemination of plasmids encoding an SHV-5 type ?-lactamase  

Microsoft Academic Search

A total of 160 Klebsiella pneumoniae clinical strains consecutively isolated in 14 Greek hospitals in a three-month period was examined. Application of capsular typing using 72 monovalent antisera combined with phage-typing using a set of 15 Klebsiella-specific phages showed the absence of epidemic strains. However, 41% of the isolates examined displayed high level resistance to ceftazidime and aztreonam and, in

N. J. Legakis; L. S. Tzouvelekis; G. Hatzoudis; E. Tzelepi; A. Gourkou; T. L. Pitt; A. C. Vatopoulos

1995-01-01

194

Degradation of immobilized azo dyes by Klebsiella sp. UAP-b5 isolated from maize bioadsorbent  

Microsoft Academic Search

The degradation of two immobilized dyes by Klebsiella sp. UAP-b5 was studied. In batch experiments, the azo dyestuffs Basic Blue 41 and Reactive Black 5 were immobilized onto corn cobs by adsorption, and the adsorption process was characterized by a pseudo-second-order kinetic equation. Klebsiella sp. UAP-b5 was previously isolated from the corn waste and shown to decolorize these dyes in

M. P. Elizalde-González; L. E. Fuentes-Ramírez; M. R. G. Guevara-Villa

2009-01-01

195

Pyogenic liver abscess and the emergence of Klebsiella as an etiology: a retrospective study  

PubMed Central

Objectives Pyogenic liver abscess (PLA) is a significant, though uncommon, cause of morbidity in the United States. Recently, Klebsiella has emerged as an important cause of PLA. We analyzed the clinical course, microbiology, and treatment outcomes of patients discharged with PLA. In addition, we sought to examine the incidence of and risk factors for Klebsiella liver abscess (KLA). Methods We reviewed the charts of patients who discharged with PLA from two teaching hospitals in West Texas between January 1, 2007 and December 31, 2011. Results We identified 49 cases of PLA. Abscess cultures were positive in 23 (48%) patients. The mean age of the cohort was 56 years (range: 20–83 years). Sixty percent were male. The most frequent conditions associated with PLA were intra-abdominal infections (ten cases; 20%), diabetes mellitus (nine cases; 18%) and malignancy (nine cases; 18%). Klebsiella was the most commonly isolated species from the abscess cultures (seven cases; 30% of all positive abscess cultures). We used univariate and logistic regression analyses to identify the risk factors for KLA. Controlling for age, only malignancy was identified in our cohort as a risk factor for a Klebsiella liver abscess. The overall mortality was 2%. Conclusion Klebsiella is emerging as an important cause of liver abscesses. Malignancy may be an important risk factor for Klebsiella liver abscess. PMID:24379693

Ali, Ahmad H; Smalligan, Roger D; Ahmed, Mashrafi; Khasawneh, Faisal A

2014-01-01

196

Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria  

PubMed Central

Polymyxins are polycationic antimicrobial peptides that are currently the last-resort antibiotics for the treatment of multidrug-resistant, Gram-negative bacterial infections. The reintroduction of polymyxins for antimicrobial therapy has been followed by an increase in reports of resistance among Gram-negative bacteria. Some bacteria, such as Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii, develop resistance to polymyxins in a process referred to as acquired resistance, whereas other bacteria, such as Proteus spp., Serratia spp., and Burkholderia spp., are naturally resistant to these drugs. Reports of polymyxin resistance in clinical isolates have recently increased, including acquired and intrinsically resistant pathogens. This increase is considered a serious issue, prompting concern due to the low number of currently available effective antibiotics. This review summarizes current knowledge concerning the different strategies bacteria employ to resist the activities of polymyxins. Gram-negative bacteria employ several strategies to protect themselves from polymyxin antibiotics (polymyxin B and colistin), including a variety of lipopolysaccharide (LPS) modifications, such as modifications of lipid A with phosphoethanolamine and 4-amino-4-deoxy-L-arabinose, in addition to the use of efflux pumps, the formation of capsules and overexpression of the outer membrane protein OprH, which are all effectively regulated at the molecular level. The increased understanding of these mechanisms is extremely vital and timely to facilitate studies of antimicrobial peptides and find new potential drugs targeting clinically relevant Gram-negative bacteria. PMID:25505462

Olaitan, Abiola O.; Morand, Serge; Rolain, Jean-Marc

2014-01-01

197

Bacteria, biofilm and honey: a study of the effects of honey on 'planktonic' and biofilm-embedded chronic wound bacteria.  

PubMed

Chronically infected wounds are a costly source of suffering. An important factor in the failure of a sore to heal is the presence of multiple species of bacteria, living cooperatively in highly organized biofilms. The biofilm protects the bacteria from antibiotic therapy and the patient's immune response. Honey has been used as a wound treatment for millennia. The components responsible for its antibacterial properties are now being elucidated. The study aimed to determine the effects of different concentrations of 'Medihoney' therapeutic honey and Norwegian Forest Honey 1) on the real-time growth of typical chronic wound bacteria; 2) on biofilm formation; and 3) on the same bacteria already embedded in biofilm. Reference strains of MRSE, MRSA, ESBL Klebsiella pneumoniae and Pseudomonas aeruginosa were incubated with dilution series of the honeys in microtitre plates for 20 h. Growth of the bacteria was assessed by measuring optical density every 10 min. Growth curves, biofilm formation and minimum bactericidal concentrations are presented. Both honeys were bactericidal against all the strains of bacteria. Biofilm was penetrated by biocidal substances in honey. Reintroduction of honey as a conventional wound treatment may help improve individual wound care, prevent invasive infections, eliminate colonization, interrupt outbreaks and thereby preserve current antibiotic stocks. PMID:19308800

Merckoll, Patricia; Jonassen, Tom Øystein; Vad, Marie Elisabeth; Jeansson, Stig L; Melby, Kjetil K

2009-01-01

198

Klebsiella pneumoniae related community-acquired acute lower respiratory infections in Cambodia: Clinical characteristics and treatment  

PubMed Central

Background In many Asian countries, Klebsiella pneumoniae (KP) is the second pathogen responsible for community-acquired pneumonia. Yet, very little is known about KP etiology in ALRI in Cambodia, a country that has one of the weakest medical infrastructures in the region. We present here the first clinico-radiological description of KP community-acquired ALRI in hospitalized Cambodian patients. Methods Through ALRI surveillance in two provincial hospitals, KP was isolated from sputum and blood cultures, and identified by API20E gallery from patients ? 5 years-old with fever and respiratory symptoms onset ?14 days. Antibiotics susceptibility testing was provided systematically to clinicians when bacteria were isolated. We collected patients' clinical, radiological and microbiological data and their outcome 3 months after discharge. We also compared KP-related with other bacteria-related ALRI to determine risk factors for KP infection. Results From April 2007 to December 2009, 2315 ALRI patients ? 5 years-old were enrolled including 587 whose bacterial etiology could be assigned. Of these, 47 (8.0%) had KP infection; their median age was 55 years and 68.1% were females. Reported prior medication was high (42.5%). Patients' chest radiographs showed pneumonia (61.3% including 39% that were necrotizing), preexisting parenchyma lesions (29.5%) and pleural effusions alone (4.5%) and normal parenchyma (4.5%). Five patients had severe conditions on admission and one patient died during hospitalization. Of the 39 patients that were hospital discharged, 14 died including 12 within 1 month after discharge. Only 13 patients (28%) received an appropriate antibiotherapy. Extended-spectrum beta-lactamases (ESBL) - producing strains were found in 8 (17.0%) patients. Female gender (Odds ratio (OR) 2.1; p = 0.04) and diabetes mellitus (OR 3.1; p = 0.03) were independent risk factors for KP-related ALRI. Conclusions KP ALRI in Cambodia has high fatality rate, are more frequently found in women, and should be considered in diabetic patients. The extremely high frequency of ESBL-producing strains in the study is alarming in the context of uncontrolled antibiotic consumption and in absence of microbiology capacity in most public-sector hospitals. PMID:22233322

2012-01-01

199

Prevalence of Extended Spectrum ?-lactamase-Producing Klebsiella pneumoniae in Clinical Isolates  

PubMed Central

Background: Extended spectrum ?-lactamase (ESBL) are gram-negative bacteria that produce the enzyme, ?-lactamase, which can break down commonly used antibiotics, such as penicillin and cephalosporins, making infections with ESBL producing bacteria more difficult to treat. Extended spectrum ?-lactamase-producing Klebsiella pneumoniae were first reported in 1983 from Germany, and since then a steady increase in resistance against cephalosporins has been seen causing health problems. Objectives: The aim of this study was to determine the prevalence of ESBL in strains of K. pneumoniae isolated from different clinical samples. Patients and Methods: One hundred and thirty isolates of K. pneumoniae were isolated from different clinical specimens from King Khalid hospital, Hafr Elbatin, Kingdom Saudi Arabia. These isolates were then characterized, tested for antimicrobial susceptibility and screened for ESBL production by the MicroScan WalkAway-96 SI System. Extended spectrum ?-lactamase production was confirmed by the phenotypic confirmatory disc diffusion test (PCDDT) and the double disc synergy test (DDST). Results: Overall, 76.9% (100) of the isolates were resistant to cefuroxime, cefepime and cefazolin, 69.23% (90) were resistant to cefotaxime, and 46.15% (60) were resistant to cefoxitin. Extended spectrum ?-lactamase was detected in 53.8% (70) of K. pneumoniae as detected by the MicroScan “WalkAway-96” SI System and 50.07% (66) by PCDDT and 46.15% (60) by DDST. All K. pneumoniae isolates were resistant to ampicillin followed by both piperacillin and mezlocillin 92.30% (120). K. pneumoniae isolates showed high sensitivity to imipenem (15.38%) (20), followed by ertapenem, tetracycline, tigecycline pipracilline/tazobactam and amikacin (23.07%) (30). Conclusions: Our study showed that the prevalence of ESBL-producing K. pneumoniae at King Khalid Hospital was significantly high. Routine detection of ESBL-producing microorganisms is required by each of the laboratory standard detection methods to control the spread of these infections and allow a proper therapeutic strategy. For detection, the phenotypic confirmatory disc diffusion test is simple, sensitive and cost effective. However, there is a need for larger scale drug susceptibility surveillance.

Ali Abdel Rahim, Khalid Abdalla; Ali Mohamed, Ahmed Mohamed

2014-01-01

200

Phagocytic and chemiluminescent responses of mouse peritoneal macrophages to living and killed Salmonella typhimurium and other bacteria  

SciTech Connect

In the presence of luminol, resident as well as thioglycolate-induced and immunized macrophages emitted chemiluminescence more efficiently when the cells were exposed to living Salmonella typhimurium than when they were exposed to the same bacterium killed by ultraviolet light or heat. This phenomenon was observed whether or not the bacterium was opsonized. The different response to living and killed bacteria was also found with Escherichia coli, Pseudomonas aeruginosa, Proteus morganii, and Enterobacter aerogenes, but not with Shigella sonnei, Klebsiella pneumoniae, and Propionibacterium acnes. The results suggest that macrophages respond better to living, motile bacteria than to nonmotile or killed bacteria. The experimental results obtained with motility mutants of S. typhimurium, E. coli, and P. aeruginosa confirm that macrophages exposed to the motile bacteria emit chemiluminescence more efficiently and ingest the motile bacteria at a much faster rate than the nonmotile bacteria.

Tomita, T.; Blumenstock, E.; Kanegasaki, S.

1981-06-01

201

Exploration génotypique d’une bouffée épidémique nosocomiale néonatale à Klebsiella pneumoniae productrice de bêtalactamase à spectre étendu  

Microsoft Academic Search

Background. – The aim of the study was to explore nosocomial neonatal outbreak of Klebsiella pneumoniae producing extended-spectrum-betalactamase by macrorestriction genotyping.Patients and methods. – Over a 25 days period, a hospital neonatal outbreak due to Klebsiella pneumoniae producing extended-spectrum-betalactamase affected 14 newborn infants admitted to a university hospital in Sousse (Tunisia). We collected 21 strains of Klebsiella pneumoniae producing extended-spectrum-betalactamase. Susceptibility testing

J Boukadida; N Salem; N Hannachi; K Monastiri; N Snoussi

2002-01-01

202

The interleukin-1 receptor antagonist can either reduce or enhance the lethality of Klebsiella pneumoniae sepsis in newborn rats.  

PubMed Central

Klebsiella pneumoniae, a worldwide cause of nosocomial infections, is one of the most common causes of death in newborns in nurseries. In this study, we investigated the role of interleukin-1 (IL-1) in an experimental animal model of neonatal sepsis, using a natural antagonist of IL-1 receptors, the IL-1 receptor antagonist (IL-1Ra), to block IL-1's effects in neonatal Klebsiella sepsis in the absence of antibiotic treatment. Newborn Wistar-Kyoto rats were injected intraperitoneally with a single dose (10 mg/kg) of either IL-1Ra (n = 43) or human serum albumin as a control (n = 40). At the same time, a 50% lethal dose of K. pneumoniae was injected subcutaneously. No antibiotics were given at any time. After 10 days, survival was 60% for the albumin group and 80% for the IL-1Ra group (P < 0.01). IL-1Ra treatment also afforded protection when the dose of bacteria was increased sixfold (P < 0.01). There were two episodes of leukopenia in the control group, which were suppressed by IL-1Ra (P < 0.01 and P < 0.001). IL-1 and IL-6 levels were lower in the IL-1Ra-treated group (P < 0.05 and P < 0.001, respectively). No differences between the two groups were observed in the number of bacteria in cultures of the blood, lungs, liver, or spleen. When IL-1Ra (10 mg/kg) was given both at time zero and 24 h after bacterial challenge, lethality was significantly increased (P < 0.01). Single doses of IL-1Ra of from 20 to 40 mg/kg progressively increased lethality compared with controls (P < 0.01) in both Wistar-Kyoto and Sprague-Dawley strain rats. In the same model, low doses of IL-1 itself (0.4 ng per rat), given 24 h prior to bacterial challenge, afforded protection (P < 0.001). These studies suggest that, in the absence of antibiotics, partial blockade of IL-1 receptors improves survival, whereas a longer or greater blockade increases lethality in newborn rats infected with K. pneumoniae. PMID:8432613

Mancilla, J; García, P; Dinarello, C A

1993-01-01

203

Numerical taxonomy and ecology of petroleum-degrading bacteria.  

PubMed

A total of 99 strains of petroleum-degrading bacteria isolated from Chesapeake Bay water and sediment were identified by using numerical taxonomy procedures. The isolates, together with 33 reference cultures, were examined for 48 biochemical, cultural, morphological, and physiological characters. The data were analyzed by computer, using both the simple matching and the Jaccard coefficients. Clustering was achieved by the unweighted average linkage method. From the sorted similarity matrix and dendrogram, 14 phenetic groups, comprising 85 of the petroleum-degrading bacteria, were defined at the 80 to 85% similarity level. These groups were identified as actinomycetes (mycelial forms, four clusters), coryneforms, Enterobacteriaceae, Klebsiella aerogenes, Micrococcus spp. (two clusters), Nocardia species (two clusters), Pseudomonas spp. (two clusters), and Sphaerotilus natans. It is concluded that the degradation of petroleum is accomplished by a diverse range of bacterial taxa, some of which were isolated only at given sampling stations and, more specifically, from sediment collected at a given station. PMID:889329

Austin, B; Calomiris, J J; Walker, J D; Colwell, R R

1977-07-01

204

Dust-borne bacteria in animal sheds, schools and children's day care centres.  

PubMed

A total of 316 bacterial strains, including psychrophiles, mesophiles and thermophiles, were isolated and identified from indoor dusts in schools, children's day care centres and animal sheds. Several species which had not previously been reported from indoor environments were found: Sphingomonas, Brevibacterium, Nocardiopsis, Deinococcus and Rhodococcus/Gordona. A new psychrophilic actinomycete genus was also found in animal sheds, representing a new undescribed peptidoglycan type and an unusual whole-cell fatty acid composition. The indoor dusts of animal sheds contained mainly the Gram-negative genera Pseudomonas, Pantoea, Flavobacterium and Xanthomonas early in the indoor feeding season, but changed to a composition dominated by Bacillus, Micrococcus and mesophilic and thermophilic actinomycetes towards the end of the season. The dust contained, and air-borne bacterial flora in schools and day care centres were dominated by, Gram-positive bacilli and actinomycetes, notably Bacillus cereus, Brevibacillus brevis, B. licheniformis, B. subtilis and species of Arthrobacter, Corynebacterium, Rhodococcus/Gordona, Nocardiopsis sp., Deinococcus, Staphylococcus and Micrococcus. Indoor air and dust contained Klebsiella oxytoca, Acinetobacter calcoaceticus, Ac. lwoffi, Bacillus cereus and Nocardiopsis dassonvillei with the status of hazard group II. Indoor dusts of animal sheds contained eight different 3-hydroxy fatty acids, the 2-hydroxy fatty acid 14:0 and two 10-methyl fatty acids, whereas in dusts from schools and day care centres, these were below the detection level (< 3.5 ng mg-1). The 3-and 2-hydroxy fatty acids could be assigned to one or more of the dust-contained cultivable strains, but 10-methyl C16:0 was not present in any of the strains isolated. The dusts from schools and children's day care centres contained 0.2-0.3 ng of endotoxin mg-1 and 0.5-1.4 ng of beta-D-glucan mg-1, whereas the dusts from animal sheds contained more 0.3-41 ng mg-1 and 8-35 ng mg-1, respectively. PMID:10212408

Andersson, A M; Weiss, N; Rainey, F; Salkinoja-Salonen, M S

1999-04-01

205

Phosphatase synthesis in Klebsiella (aerobacter) aerogenes growing in continuous culture.  

PubMed

1. Phosphatase synthesis was studied in Klebsiella aerogenes grown in a wide range of continuous-culture systems. 2. Maximum acid phosphatase synthesis was associated with nutrient-limited, particularly carbohydrate-limited, growth at a relatively low rate, glucose-limited cells exhibiting the highest activity. Compared with glucose as the carbon-limiting growth material, other sugars not only altered the activity but also changed the pH-activity profile of the enzyme(s). 3. The affinity of the acid phosphatase in glucose-limited cells towards p-nitrophenyl phosphate (K(m) 0.25-0.43mm) was similar to that of staphylococcal acid phosphatase but was ten times greater than that of the Escherichia coli enzyme. 4. PO(4) (3-)-limitation derepressed alkaline phosphatase synthesis but the amounts of activity were largely independent of the carbon source used for growth. 5. The enzymes were further differentiated by the effect of adding inhibitors (F(-), PO(4) (3-)) and sugars to the reaction mixture during the assays. In particular, it was shown that adding glucose, but not other sugars, stimulated the rate of hydrolysis of p-nitrophenyl phosphate by the acid phosphatase in carbohydrate-limited cells at low pH values (<4.6) but inhibited it at high pH values (>4.6). Alkaline phosphatase activity was unaffected. 6. The function of phosphatases in general is discussed and possible mechanisms for the glucose effect are outlined. PMID:4342213

Bolton, P G; Dean, A C

1972-03-01

206

Properties of Klebsiella phage P13 and associated exopolysaccharide depolymerase  

NASA Astrophysics Data System (ADS)

The bacteriophage P13 that infects Klebsiella serotype K13 contains a heat-stable depolymerase capable of effective degradation of exopolysaccharide (EPS) produced by this microorganism. In this study, the titer of phage P13, initially 2.0 × 107 pfu mL-1, was found increasing 20 min after infection and reached 5.0 × 109 pfu mL-1 in 60 min. Accordingly, the enzyme activity of depolymerase approached the maximum 60 min after infection. Treatment at 70°C for 30 min inactivated all the phage, but retained over 90% of the depolymerase activity. Addition of acetone into the crude phage lysate led to precipitation of the protein, with a marked increase in bacterial EPS degradation activity and a rapid drop in the titer of phage. After partial purification by acetone precipitation and ultrafiltration centrifugation, the enzyme was separated from the phage particles, showing two components with enzyme activity on Q-Sepharose Fast Flow. The soluble enzyme had an optimum degradation activity at 60°C and pH 6.5. Transmission electron microscopy demonstrated that the phage P13 particles were spherical with a diameter of 50 nm and a short stumpy tail. It was a doublestrand DNA virus consisting of a nucleic acid molecule of 45976 bp. This work provides an efficient purification operation including thermal treatment and ultrafiltration centrifugation, to dissociate depolymerase from phage particles. The characterization of phage P13 and associated EPS depolymerase is beneficial for further application of this enzyme.

Liu, Yang; Li, Guiyang; Mo, Zhaolan; Chai, Zihan; Shang, Anqi; Mou, Haijin

2013-11-01

207

CRYSTAL STRUCTURE ANALYSIS OF A PUTATIVE OXIDOREDUCTASE FROM KLEBSIELLA PNEUMONIAE  

SciTech Connect

Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) at Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.

Baig, M.; Brown, A.; Eswaramoorthy, S.; Swaminathan, S.

2009-01-01

208

Magnetic bacteria against MIC  

SciTech Connect

In this article, it is suggested to use the sensitivity of magnetotactic bacteria to changes of magnetic field direction and the natural ability of this bacteria in rapid growth during relatively short time intervals against corrosion-enhancing bacteria and especially sulfate-reducing bacteria. If colonies of sulfate-reducing bacteria could be packed among magnetotactic bacteria, then, by applying sufficiently powerful magnetic field (about 0.5 gauss), all of these bacteria (magnetic and non-magnetic) will be oriented towards an Anti-bacteria agent (oxygen or biocide). So, Microbiologically-Influenced Corrosion in the system would be controlled to a large extent.

Javaherdashti, R. [I.D.R.O.-IR, Tehran (Iran, Islamic Republic of)

1997-12-01

209

Back To Bacteria.  

ERIC Educational Resources Information Center

Explores new research about bacteria. Discusses bacterial genomes, archaea, unusual environments, evolution, pathogens, bacterial movement, biofilms, bacteria in the body, and a bacterial obsession. Contains 29 references. (JRH)

Flannery, Maura C.

1997-01-01

210

Studies on N 2 -fixing bacteria associated with the salt-tolerant grass, Leptochloa fusca (L.) Kunth  

Microsoft Academic Search

Summary N2-fixing bacteria were isolated from the rhizosphere of naturally grown salt tolerant grass (Leptochloa fusca). A broad spectrum of diazotrophs was found to be associated with the roots ofL. fusca. the systematic position of the three isolates, NIAB-1, C-2 and Iso-2 was determined by morphological, biochemical and mol % (G+C) DNA contents. Two isolates were identified asKlebsiella pneumoniae (NIAB-1)

Y. Zafar; K. A. Malik; E. G. Niemann

1987-01-01

211

Infected Hydatid Cysts Bacteria in Slaughtered Livestock and Their Effects on Protoscoleces Degeneration  

PubMed Central

Background: The protoscoleces of fertile hydatid cysts are considered as major risks in surgery and producing secondary cysts if rupture the cyst during operation and, cause infecting the dogs with adult worm if eaten by this animal. Bacterial infection of the hydatid fluid can lead to sterilization of the cyst. Objectives: The aim of this study was to determine the bacterial infection rate of livestock hydatid cysts in Hamedan, Iran, and test the isolated bacteria effects on viable protoscoleces, in vitro. Materials and Methods: A total of 5709 slaughtered livestock were inspected to detect the presence of hydatid cysts. The hydatid fluid of all cysts was cultured separately to isolate and identify the bacteria. The effect of isolated bacteria was tested on viable protoscoleces in culture tubes, in vitro. The culture tubes were observed and examined under a light microscope every two hours for 24 hours, and then, after 36 and 48 hours. Results: Infected cysts were found in 74% of animals in Hamedan (46% were calcified and the bacteria was isolated from 52%) and 62% in Borujerd. The isolated bacteria in the infected cysts were as follows: Escherichia coli, E. blattae, Klebsiella pnoumoniae, Proteus mirabilis, Enterobacter aerogenes, coagulase-positive and coagulase-negative Staphylococci, Pseudomonas aeruginosa and Edwardsiella tarda. The protoscoleces incubated with the isolated bacteria totally degenerated, but 55% of the protoscoleces in the control groups were intact and viable even after one week. Conclusions: This study indicated a high percentage of cysts bacterial infections in two provinces of Iran. The common isolated bacteria were E. coli and Klebsiella. The isolated bacteria degenerated the protoscoleces during short-time incubation, in vitro. PMID:25371792

Fallah, Mohammad; Kavand, Abdollah; Yousefi Mashouf, Rasoul

2014-01-01

212

Multisystemic abscesses in African green monkeys (Chlorocebus aethiops) with invasive Klebsiella pneumoniae--identification of the hypermucoviscosity phenotype.  

PubMed

Invasive Klebsiella pneumoniae is an emerging disease of humans characterized by abscesses in the liver or other sites involving bacteria with the unique hypermucoviscosity phenotype. Over several months, 7 African green monkeys in our research colony developed abscess formation in multiple locations and succumbed to disease. K. pneumoniae was identified by bacterial culture in 6 monkeys and immunohistochemistry in 1 additional monkey. All monkeys had been housed in, or had contact with monkeys housed in, 1 animal room in our facility. All affected monkeys had 1 or more abscesses, most notably in the abdomen, but also affecting the lungs, cerebellum, and skin. Abdominal abscesses and associated adhesions entrapped loops of bowel, forming palpable masses. Abdominal masses were located at the root of the mesentery, the ileocecocolic junction, or the pelvic inlet. In 1 case, culture, serotyping, and polymerase chain reaction (PCR) analysis of the bacterial isolate identified K. pneumoniae expressing the hypermucoviscosity phenotype and capsular serotype K2 and determined that the K. pneumonia was genetically rmpA(+)/magA(-). PMID:18424839

Twenhafel, N A; Whitehouse, C A; Stevens, E L; Hottel, H E; Foster, C D; Gamble, S; Abbott, S; Janda, J M; Kreiselmeier, N; Steele, K E

2008-03-01

213

Direct Detection and Genotyping of Klebsiella pneumoniae Carbapenemases from Urine by Use of a New DNA Microarray Test  

PubMed Central

Klebsiella pneumoniae carbapenemases (KPCs) are considered a serious threat to antibiotic therapy, as they confer resistance to carbapenems, which are used to treat extended-spectrum beta-lactamase (ESBL)-producing bacteria. Here, we describe the development and evaluation of a DNA microarray for the detection and genotyping of KPC genes (blaKPC) within a 5-h period. To test the whole assay procedure (DNA extraction plus a DNA microarray assay) directly from clinical specimens, we compared two commercial DNA extraction kits (the QIAprep Spin miniprep kit [Qiagen] and the urine bacterial DNA isolation kit [Norgen]) for the direct DNA extraction from urine samples (dilution series spiked in human urine). Reliable single nucleotide polymorphism (SNP) typing was demonstrated using 1 × 105 CFU/ml urine for Escherichia coli (Qiagen and Norgen) and 80 CFU/ml urine, on average, for K. pneumoniae (Norgen). This study presents, for the first time, the combination of a new KPC microarray with commercial sample preparation for detecting and genotyping microbial pathogens directly from clinical specimens; this paves the way toward tests providing epidemiological and diagnostic data, enabling better antimicrobial stewardship. PMID:23035190

Peter, Harald; Berggrav, Kathrine; Thomas, Peter; Pfeifer, Yvonne; Witte, Wolfgang; Templeton, Kate

2012-01-01

214

Effects of the hindlimb-unloading model of spaceflight conditions on resistance of mice to infection with Klebsiella pneumoniae  

NASA Technical Reports Server (NTRS)

BACKGROUND: It has been well documented in several studies that many immunologic parameters are altered in experimental animals and human subjects who have flown in space. However, it is not fully known whether these immunologic changes could result in increased susceptibility to infection. Hindlimb (antiorthostatic) unloading of rodents has been used successfully to simulate some of the effects of spaceflight on physiologic systems. OBJECTIVE: The objective of this study was to determine the effect of hindlimb unloading on the outcome of Klebsiella pneumoniae infection in mice. METHODS: Hindlimb-unloaded, hindlimb-restrained, and control mice were intraperitoneally infected with one 50% lethal dose of K pneumoniae 2 days after suspension. Mortality and bacterial load in several organs were compared among the groups. RESULTS: Unloaded mice showed significantly increased mortality and reduced mean time to death compared with that seen in the control groups. Kinetics of bacterial growth with smaller infective doses revealed that control mice were able to clear bacteria from the organs after 30 hours. In contrast, unloaded mice had continued bacterial growth at the same time point. CONCLUSION: The results of this study suggest that hindlimb unloading might enhance the dissemination of K pneumoniae, leading to increased mortality. The complex physiologic changes observed during hindlimb unloading, including stress, have a key role in the pathophysiology of this infection.

Belay, Tesfaye; Aviles, Hernan; Vance, Monique; Fountain, Kimberly; Sonnenfeld, Gerald

2002-01-01

215

Pleuritis and suppurative pneumonia associated with a hypermucoviscosity phenotype of Klebsiella pneumoniae in California sea lions (Zalophus californianus).  

PubMed

The aim of this study is to document the isolation of a hypermucoviscosity (HMV) phenotype of Klebsiella pneumoniae from 25 cases of suppurative pneumonia and pleuritis and two cases of abscesses in California sea lions (Zalophus californianus) from the central California coast, representing the first report of this zoonotic pathogen from the marine environment and only the second report in non-humans. Animals died 2h to 4 days after first being observed sick on beaches. Clinical signs varied from dyspnoea to coma. Gross post-mortem examination of 25 cases revealed fibrinous pleuritis, copious pus in the pleural cavity and suppurative bronchopneumonia. K. pneumoniae isolates obtained from lung and pleural swabs and the hepatic and subcuticular abscesses were highly mucoid on blood agar culture media and were positive to the "string test". Twenty-one of the 27 isolates were examined by PCR and all were positive for rmpA and K2wyz and negative for K1magA genes. Although pneumonia and pleuritis have previously commonly been observed in marine mammals, their association with pure cultures of a zoonotic bacteria, K. pneumoniae HMV phenotype, has not. This report provides further evidence of the role marine mammals play as sentinels of health risks to humans from coastal waters. PMID:19709820

Jang, Spencer; Wheeler, Liz; Carey, Roberta B; Jensen, Bette; Crandall, Claudia M; Schrader, Kimmi N; Jessup, David; Colegrove, Kathleen; Gulland, Frances M D

2010-02-24

216

Nosocomial Outbreak of Klebsiella pneumoniae Producing SHV-5 Extended-Spectrum ?-Lactamase, Originating from a Contaminated Ultrasonography Coupling Gel  

PubMed Central

Klebsiella pneumoniae resistant to ceftazidime was isolated from six adult women and two neonates hospitalized between July and November 1993 in the Department of Obstetrics and Gynecology of Boucicaut Hospital (Paris, France). The epidemiological investigation revealed a notably short delay (less than 48 h) between admission and contamination of the six adults and peripartum transmission to the neonates. The only environmental source of ceftazidime-resistant K. pneumoniae was the ultrasonography coupling gel used in the emergency room. Phenotypic (biotyping and antibiotyping) and genotypic (plasmid profile and pulsed-field gel electrophoresis) analysis of all the clinical isolates indicated the spread of a single strain. It produced SHV-5 and TEM-1 ?-lactamases, as demonstrated by isoelectric focusing and gene sequencing. The risk of cross-contamination in ultrasonography procedures is usually low and had not been associated so far with bacteria producing an extended-spectrum ?-lactamase (ESBL). Furthermore, this is the first time an epidemic of an SHV-5 ESBL-producing member of the family Enterobacteriaceae has been reported from a French hospital. PMID:9574705

Gaillot, Olivier; Maruéjouls, Christophe; Abachin, Éric; Lecuru, Fabrice; Arlet, Guillaume; Simonet, Michel; Berche, Patrick

1998-01-01

217

Comparison of Biofilm and Attachment Mechanisms of a Phytopathological and Clinical Isolate of Klebsiella pneumoniae Subsp. pneumoniae  

PubMed Central

Some bacterial species can colonize humans and plants. It is almost impossible to prevent the contact of clinically pathogenic bacteria with food crops, and if they can persist there, they can reenter the human food chain and cause disease. On the leaf surface, microorganisms are exposed to a number of stress factors. It is unclear how they survive in such different environments. By increasing adhesion to diverse substrates, minimizing environmental differences, and providing protection against defence mechanisms, biofilms could provide part of the answer. Klebsiella pneumoniae subsp. pneumoniae is clinically important and also associated with fruit diseases, such as “pineapple fruit collapse.” We aimed to characterize biofilm formation and adhesion mechanisms of this species isolated from pineapple in comparison with a clinical isolate. No differences were found between the two isolates quantitatively or qualitatively. Both tested positive for capsule formation and were hydrophobic, but neither produced adherence fibres, which might account for their relatively weak adhesion compared to the positive control Staphylococcus epidermidis ATCC 35984. Both produced biofilms on glass and polystyrene, more consistently at 40°C than 35°C, confirmed by atomic force and high-vacuum scanning electron microscopy. Biofilm formation was maintained in an acidic environment, which may be relevant phytopathologically. PMID:24222755

Nicolau Korres, Adriana Marcia; Aquije, Gloria Maria de Farias V.; Buss, David S.; Ventura, Jose Aires; Fernandes, Patricia Machado Bueno; Fernandes, Antonio Alberto Ribeiro

2013-01-01

218

Direct detection and genotyping of Klebsiella pneumoniae carbapenemases from urine by use of a new DNA microarray test.  

PubMed

Klebsiella pneumoniae carbapenemases (KPCs) are considered a serious threat to antibiotic therapy, as they confer resistance to carbapenems, which are used to treat extended-spectrum beta-lactamase (ESBL)-producing bacteria. Here, we describe the development and evaluation of a DNA microarray for the detection and genotyping of KPC genes (bla(KPC)) within a 5-h period. To test the whole assay procedure (DNA extraction plus a DNA microarray assay) directly from clinical specimens, we compared two commercial DNA extraction kits (the QIAprep Spin miniprep kit [Qiagen] and the urine bacterial DNA isolation kit [Norgen]) for the direct DNA extraction from urine samples (dilution series spiked in human urine). Reliable single nucleotide polymorphism (SNP) typing was demonstrated using 1 × 10(5) CFU/ml urine for Escherichia coli (Qiagen and Norgen) and 80 CFU/ml urine, on average, for K. pneumoniae (Norgen). This study presents, for the first time, the combination of a new KPC microarray with commercial sample preparation for detecting and genotyping microbial pathogens directly from clinical specimens; this paves the way toward tests providing epidemiological and diagnostic data, enabling better antimicrobial stewardship. PMID:23035190

Peter, Harald; Berggrav, Kathrine; Thomas, Peter; Pfeifer, Yvonne; Witte, Wolfgang; Templeton, Kate; Bachmann, Till T

2012-12-01

219

Understanding the host inflammatory response to wound infection: an in vivo study of Klebsiella pneumoniae in a rabbit ear wound model.  

PubMed

Wound infection development is critically dependent on the complex interactions between bacteria and host. Klebsiella pneumoniae has become an increasingly common wound pathogen, but its natural history within wounds has never been studied. Using a validated, in vivo rabbit ear model, wounds were inoculated with K.?pneumoniae at different concentrations (10²-10? colony-forming units) with measurement of viable and nonviable bacterial counts, histological wound-healing parameters, and host inflammatory gene expression at multiple time points postinoculation (48, 96, and 240 hours). Bacteria and wound morphologies were evaluated with scanning electron microscopy. Comparable experiments were performed in ischemic ears to model immune response impairment. All wounds, despite different inoculants, equilibrated to similar bacterial concentrations by 96 hours. With a 10? colony-forming units inoculant, wounds at 240 hours showed decreased bacterial counts (p?bacteria to establish a chronic presence. Our novel study quantitatively validates the host immune response as integral to wound infection dynamics. PMID:22332606

Seth, Akhil K; Geringer, Matthew R; Gurjala, Anandev N; Abercrombie, Johnathan A; Chen, Ping; You, Tao; Hong, Seok J; Galiano, Robert D; Mustoe, Thomas A; Leung, Kai P

2012-01-01

220

Antibiotic resistance and plasmid transfer capacity in biofilm formed with a CTX-M-15-producing Klebsiella pneumoniae isolate  

E-print Network

Klebsiella pneumoniae isolate Claire Hennequin1,2*, Claire Aumeran1,3, Fre´de´ric Robin2,4­7, Ousmane Traore1-producing Klebsiella pneumoniae isolate that was identified during an outbreak involving 16 patients who had. pneumoniae strain was notable for its ability to transfer its plasmid, especially in biofilm conditions

Paris-Sud XI, Université de

221

Inhibition of spoilage and food-borne pathogens by lactic acid bacteria isolated from fermenting tef (Eragrostis tef) dough.  

PubMed

A study was carried out at the Department of Biology, Addis Abeba University, in 1991 to determine the inhibitory potential of fermenting tef and the lactic acid bacteria isolated from fermenting tef dough on Salmonella spp., Pseudomonas aeruginosa, Klebsiella spp., Bacillus cereus and Staphylococcus aureus. The test bacteria grew in the fermenting tef uptill 30 hr or till the pH dropped to 4.7. Thereafter, growth was inhibited and decreases in population were apparent. The results showed that the spent media from all of the four lactic acid bacterial isolates, namely, Lactobacillus spp., Pediococcus spp., Leuconostoc spp. and Streptococcus spp. inhibited the test bacteria. Acidity on its own was not responsible for the inhibition of the test bacteria. The spent medium from Streptococcus spp. showed the best inhibitory activity amongst the lactic acid bacteria. PMID:7835350

Nigatu, A; Gashe, B A

1994-10-01

222

The Museum of Bacteria  

NSDL National Science Digital Library

The Museum of Bacteria serves as a clearinghouse of Web links on bacteria and bacteriology and also provides "crystal-clear information about many aspects of bacteria." The Museum of Bacteria is provided by the Foundation of Bacteria, a non-profit organization dedicated to promoting the field of bacteriology. Links are selected for a general audience, although one section is geared toward professionals in the field. Some of the latest features of the Museum are an "exhibit" on the good bacteria found in food and a Student Hall where students can present their own bacteria-related projects.

223

Identification of antigenic proteins of the nosocomial pathogen Klebsiella pneumoniae.  

PubMed

The continuous expansion of nosocomial infections around the globe has become a precarious situation. Key challenges include mounting dissemination of multiple resistances to antibiotics, the easy transmission and the growing mortality rates of hospital-acquired bacterial diseases. Thus, new ways to rapidly detect these infections are vital. Consequently, researchers around the globe pursue innovative approaches for point-of-care devices. In many cases the specific interaction of an antigen and a corresponding antibody is pivotal. However, the knowledge about suitable antigens is lacking. The aim of this study was to identify novel antigens as specific diagnostic markers. Additionally, these proteins might be aptly used for the generation of vaccines to improve current treatment options. Hence, a cDNA-based expression library was constructed and screened via microarrays to detect novel antigens of Klebsiella pneumoniae, a prominent agent of nosocomial infections well-known for its extensive antibiotics resistance, especially by extended-spectrum beta-lactamases (ESBL). After screening 1536 clones, 14 previously unknown immunogenic proteins were identified. Subsequently, each protein was expressed in full-length and its immunodominant character examined by ELISA and microarray analyses. Consequently, six proteins were selected for epitope mapping and three thereof possessed linear epitopes. After specificity analysis, homology survey and 3d structural modelling, one epitope sequence GAVVALSTTFA of KPN_00363, an ion channel protein, was identified harboring specificity for K. pneumoniae. The remaining epitopes showed ambiguous results regarding the specificity for K. pneumoniae. The approach adopted herein has been successfully utilized to discover novel antigens of Campylobacter jejuni and Salmonella enterica antigens before. Now, we have transferred this knowledge to the key nosocomial agent, K. pneumoniae. By identifying several novel antigens and their linear epitope sites, we have paved the way for crucial future research and applications including the design of point-of-care devices, vaccine development and serological screenings for a highly relevant nosocomial pathogen. PMID:25333280

Hoppe, Sebastian; Bier, Frank F; von Nickisch-Rosenegk, Markus

2014-01-01

224

Identification of Antigenic Proteins of the Nosocomial Pathogen Klebsiella pneumoniae  

PubMed Central

The continuous expansion of nosocomial infections around the globe has become a precarious situation. Key challenges include mounting dissemination of multiple resistances to antibiotics, the easy transmission and the growing mortality rates of hospital-acquired bacterial diseases. Thus, new ways to rapidly detect these infections are vital. Consequently, researchers around the globe pursue innovative approaches for point-of-care devices. In many cases the specific interaction of an antigen and a corresponding antibody is pivotal. However, the knowledge about suitable antigens is lacking. The aim of this study was to identify novel antigens as specific diagnostic markers. Additionally, these proteins might be aptly used for the generation of vaccines to improve current treatment options. Hence, a cDNA-based expression library was constructed and screened via microarrays to detect novel antigens of Klebsiella pneumoniae, a prominent agent of nosocomial infections well-known for its extensive antibiotics resistance, especially by extended-spectrum beta-lactamases (ESBL). After screening 1536 clones, 14 previously unknown immunogenic proteins were identified. Subsequently, each protein was expressed in full-length and its immunodominant character examined by ELISA and microarray analyses. Consequently, six proteins were selected for epitope mapping and three thereof possessed linear epitopes. After specificity analysis, homology survey and 3d structural modelling, one epitope sequence GAVVALSTTFA of KPN_00363, an ion channel protein, was identified harboring specificity for K. pneumoniae. The remaining epitopes showed ambiguous results regarding the specificity for K. pneumoniae. The approach adopted herein has been successfully utilized to discover novel antigens of Campylobacter jejuni and Salmonella enterica antigens before. Now, we have transferred this knowledge to the key nosocomial agent, K. pneumoniae. By identifying several novel antigens and their linear epitope sites, we have paved the way for crucial future research and applications including the design of point-of-care devices, vaccine development and serological screenings for a highly relevant nosocomial pathogen. PMID:25333280

Hoppe, Sebastian; Bier, Frank F.; von Nickisch-Rosenegk, Markus

2014-01-01

225

Epidemic Klebsiella pneumoniae ST258 Is a Hybrid Strain  

PubMed Central

ABSTRACT Carbapenem-resistant Enterobacteriaceae (CRE), especially Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae, pose an urgent threat in health facilities in the United States and worldwide. K. pneumoniae isolates classified as sequence type 258 (ST258) by multilocus sequence typing are largely responsible for the global spread of KPC. A recent comparative genome study revealed that ST258 K. pneumoniae strains are two distinct genetic clades; however, the molecular origin of ST258 largely remains unknown, and our understanding of the evolution of the two genetic clades is incomplete. Here we compared the genetic structures and single-nucleotide polymorphism (SNP) distributions in the core genomes of strains from two ST258 clades and other STs (ST11, ST442, and ST42). We identified an ~1.1-Mbp region on ST258 genomes that is homogeneous to that of ST442, while the rest of the ST258 genome resembles that of ST11. Our results suggest ST258 is a hybrid clone—80% of the genome originated from ST11-like strains and 20% from ST442-like strains. Meanwhile, we sequenced an ST42 strain that carries the same K-antigen-encoding capsule polysaccharide biosynthesis gene (cps) region as ST258 clade I strains. Comparison of the cps-harboring regions between the ST42 and ST258 strains (clades I and II) suggests the ST258 clade I strains evolved from a clade II strain as a result of cps region replacement. Our findings unravel the molecular evolution history of ST258 strains, an important first step toward the development of diagnostic, therapeutic, and vaccine strategies to combat infections caused by multidrug-resistant K. pneumoniae. PMID:24961694

Chen, Liang; Mathema, Barun; Pitout, Johann D. D.; DeLeo, Frank R.

2014-01-01

226

The Role of Klebsiella in Crohn's Disease with a Potential for the Use of Antimicrobial Measures  

PubMed Central

There is a general consensus that Crohn's disease (CD) develops as the result of immune-mediated tissue damage triggered by infections with intestinal microbial agents. Based on the results of existing microbiological, molecular, and immunological studies, Klebsiella microbe seems to have a key role in the initiation and perpetuation of the pathological damage involving the gut and joint tissues in patients with CD. Six different gastroenterology centres in the UK have reported elevated levels of antibodies to Klebsiella in CD patients. There is a relationship between high intake of starch-containing diet, enhanced growth of gut microbes, and the production of pullulanases by Klebsiella. It is proposed that eradication of these microbes by the use of antibiotics and low starch diet, in addition to the currently used treatment, could help in alleviating or halting the disease process in CD. PMID:24223596

Rashid, Taha; Ebringer, Alan; Wilson, Clyde

2013-01-01

227

Whole genome sequencing of extended-spectrum ?-lactamase producing Klebsiella pneumoniae isolated from a patient in Lebanon  

PubMed Central

Objective: The emergence of extended-spectrum ?-lactamase (ESBL)-producing bacteria is now a critical concern. The ESBL-producing Klebsiella pneumoniae constitutes one of the most common multidrug-resistant (MDR) groups of gram-negative bacteria involved in nosocomial infections worldwide. In this study we report on the molecular characterization through whole genome sequencing of an ESBL-producing K. pneumoniae strain, LAU-KP1, isolated from a stool sample from a patient admitted for a gastrointestinal procedure/surgery at the Lebanese Amrican University Medical Center-Rizk Hospital (LAUMCRH) in Lebanon. Methods: Illumina paired-end libraries were prepared and sequenced, which resulted in 4,220,969 high-quality reads. All sequence processing and assembly were performed using the A5 assembly pipeline. Results: The initial assembly produced 86 contigs, for which no scaffolding was obtained. The final collection of contigs was submitted to GenBank. The final draft genome sequence consists of a combined 5,632,663 bases with 57% G+C content. Automated annotation was performed using the RAST annotation server. Sequencing analysis revealed that the isolate harbored different ?-lactamase genes, including blaoxa?1, blaCTX?M?15, blaSHV?11, and blaTEM?1b. The isolate was also characterized by the concomitant presence of other resistance determinants most notably acc(6?)-lb-cr and qnrb1. The entire plasmid content was also investigated and revealed homology with four major plasmids pKPN-IT, pBS512_2, pRSF1010_SL1344, and pKPN3. Conclusions: The potential role of K. pneumonia as a reservoir for ESBL genes and other resistance determinants is along with the presence of key factors that favor the spread of antimicrobial resistance a clear cause of concern and the problem that Carbapenem-non-susceptible ESBL isolates are posing in hospitals should be reconsidered through systematic exploration and molecular characterization.

Tokajian, Sima; Eisen, Jonathan A.; Jospin, Guillaume; Farra, Anna; Coil, David A.

2015-01-01

228

In Silico Analysis of Usher Encoding Genes in Klebsiella pneumoniae and Characterization of Their Role in Adhesion and Colonization  

PubMed Central

Chaperone/usher (CU) assembly pathway is used by a wide range of Enterobacteriaceae to assemble adhesive surface structures called pili or fimbriae that play a role in bacteria-host cell interactions. In silico analysis revealed that the genome of Klebsiella pneumoniae LM21 harbors eight chromosomal CU loci belonging to ??? and ? clusters. Of these, only two correspond to previously described operons, namely type 1 and type 3-encoding operons. Isogenic usher deletion mutants of K. pneumoniae LM21 were constructed for each locus and their role in adhesion to animal (Intestine 407) and plant (Arabidopsis thaliana) cells, biofilm formation and murine intestinal colonization was investigated. Type 3 pili usher deleted mutant was impaired in all assays, whereas type 1 pili usher deleted mutant only showed attenuation in adhesion to plant cells and in intestinal colonization. The LM21?kpjC mutant was impaired in its capacity to adhere to Arabidopsis cells and to colonize the murine intestine, either alone or in co-inoculation experiments. Deletion of LM21kpgC induced a significant decrease in biofilm formation, in adhesion to animal cells and in colonization of the mice intestine. The LM21?kpaC and LM21?kpeC mutants were only attenuated in biofilm formation and the adhesion abilities to Arabidopsis cells, respectively. No clear in vitro or in vivo effect was observed for LM21?kpbC and LM21?kpdC mutants. The multiplicity of CU loci in K. pneumoniae genome and their specific adhesion pattern probably reflect the ability of the bacteria to adhere to different substrates in its diverse ecological niches. PMID:25751658

Khater, Fida; Balestrino, Damien; Charbonnel, Nicolas; Dufayard, Jean François; Brisse, Sylvain; Forestier, Christiane

2015-01-01

229

Surveillance of Carbapenem-Resistant Klebsiella pneumoniae: Tracking Molecular Epidemiology and Outcomes through a Regional Network  

PubMed Central

Carbapenem resistance in Gram-negative bacteria is on the rise in the United States. A regional network was established to study microbiological and genetic determinants of clinical outcomes in hospitalized patients with carbapenem-resistant (CR) Klebsiella pneumoniae in a prospective, multicenter, observational study. To this end, predefined clinical characteristics and outcomes were recorded and K. pneumoniae isolates were analyzed for strain typing and resistance mechanism determination. In a 14-month period, 251 patients were included. While most of the patients were admitted from long-term care settings, 28% of them were admitted from home. Hospitalizations were prolonged and complicated. Nonsusceptibility to colistin and tigecycline occurred in isolates from 7 and 45% of the patients, respectively. Most of the CR K. pneumoniae isolates belonged to repetitive extragenic palindromic PCR (rep-PCR) types A and B (both sequence type 258) and carried either blaKPC-2 (48%) or blaKPC-3 (51%). One isolate tested positive for blaNDM-1, a sentinel discovery in this region. Important differences between strain types were noted; rep-PCR type B strains were associated with blaKPC-3 (odds ratio [OR], 294; 95% confidence interval [CI], 58 to 2,552; P < 0.001), gentamicin nonsusceptibility (OR, 24; 95% CI, 8.39 to 79.38; P < 0.001), amikacin susceptibility (OR, 11.0; 95% CI, 3.21 to 42.42; P < 0.001), tigecycline nonsusceptibility (OR, 5.34; 95% CI, 1.30 to 36.41; P = 0.018), a shorter length of stay (OR, 0.98; 95% CI, 0.95 to 1.00; P = 0.043), and admission from a skilled-nursing facility (OR, 3.09; 95% CI, 1.26 to 8.08; P = 0.013). Our analysis shows that (i) CR K. pneumoniae is seen primarily in the elderly long-term care population and that (ii) regional monitoring of CR K. pneumoniae reveals insights into molecular characteristics. This work highlights the crucial role of ongoing surveillance of carbapenem resistance determinants. PMID:24798270

Perez, Federico; Rudin, Susan D.; Cober, Eric; Hanrahan, Jennifer; Ziegler, Julie; Webber, Raymond; Fox, Jacqueline; Mason, Pamela; Richter, Sandra S.; Cline, Marianne; Hall, Geraldine S.; Kaye, Keith S.; Jacobs, Michael R.; Kalayjian, Robert C.; Salata, Robert A.; Segre, Julia A.; Conlan, Sean; Evans, Scott; Fowler, Vance G.

2014-01-01

230

Epidemiology and resistance mechanisms to imipenem in Klebsiella pneumoniae: a multicenter study.  

PubMed

Four clinical isolates of imipenem-resistant Klebsiella pneumoniae were isolated from clinical patient specimens and from samples obtained from hygienic surveillance in our hospital. We examined their minimum inhibitory concentration (MIC) to various types of antibiotics, detected the carbapenemases by a modified Hodge test and analyzed the genotype and homogeneity. The enzyme, Klebsiella pneumoniae carbapenemase (KPC)-2, was detected in all four isolates and this was the main cause of their imipenem resistance. In addition, these four isolates also contained the extended-spectrum ?-lactamase (ESBL) gene blaCTX-M-9 and the cephalosporinase (AmpC) gene blaDHA-1, which resulted in multidrug resistance. PMID:23128404

Chen, Huihong; Yuehua, Xue; Shen, Weiwei; Zhou, Hua; Zhou, Lizhong; Li, Zhaoyun

2013-01-01

231

In vitro fermentation of lactulose by human gut bacteria.  

PubMed

Lactulose has been known as a prebiotic that can selectively stimulate the growth of beneficial bifidobacteria and lactobacilli. Recent studies have indicated that Streptococcus mutans, Clostridium perfringens, and Faecalibacterium prausnitzii are also able to utilize lactulose. However, the previous studies mainly focused on the utilization of lactulose by individual strains, and few studies were designed to identify the species that could utilize lactulose among gut microbiota. This study aimed to identify lactulose-metabolizing bacteria in the human gut, using in silico and traditional culture methods. The prediction results suggested that genes for the transporters and glycosidases of lactulose are well distributed in the genomes of 222 of 453 strains of gastrointestinal-tract bacteria. The screening assays identified 35 species with the ability to utilize lactulose, of which Cronobacter sakazakii, Enterococcus faecium, Klebsiella pneumoniae, and Pseudomonas putida were reported for the first time to be capable of utilizing lactulose. In addition, significant correlations between lactulose and galactooligosaccharide metabolism were found. Thus, more attention should be paid to bacteria besides bifidobacteria and lactobacilli to further investigate the relationship between functional oligosaccharides and gut bacteria. PMID:25340538

Mao, Bingyong; Li, Dongyao; Zhao, Jianxin; Liu, Xiaoming; Gu, Zhennan; Chen, Yong Q; Zhang, Hao; Chen, Wei

2014-11-12

232

Bacteria isolated from amoebae/bacteria consortium  

DOEpatents

New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

Tyndall, R.L.

1995-05-30

233

Bacteria isolated from amoebae/bacteria consortium  

DOEpatents

New protozoan derived microbial consortia and method for their isolation are provided. Consortia and bacteria isolated therefrom are useful for treating wastes such as trichloroethylene and trinitrotoluene. Consortia, bacteria isolated therefrom, and dispersants isolated therefrom are useful for dispersing hydrocarbons such as oil, creosote, wax, and grease.

Tyndall, Richard L. (Clinton, TN)

1995-01-01

234

Association of Tellurite Resistance with Hypervirulent Clonal Groups of Klebsiella pneumoniae.  

PubMed

Tellurite-based selective growth media are used for several bacterial pathogens. We found that, in Klebsiella pneumoniae, tellurite resistance is strongly associated with hypervirulent clonal group 23 (CG23), CG65, and CG86, providing a novel approach for screening environmental or carriage samples. The terW gene was also associated with these groups. PMID:25631812

Passet, Virginie; Brisse, Sylvain

2015-04-01

235

Necrotizing Fasciitis Caused by Hypermucoviscous Klebsiella pneumoniae in a Filipino Female in North America.  

PubMed

Necrotizing fasciitis caused by Klebsiella pneumoniae has been described in Southeast Asia, but has only recently begun to emerge in North America. The hypermucoviscous strain of K. pneumoniae is a particularly virulent strain known to cause devastatingly invasive infections, including necrotizing fasciitis. Here we present the first known case of necrotizing fasciitis caused by hypermucoviscous K. pneumoniae in North America. PMID:25671032

Ng, Daniel; Frazee, Brad

2015-01-01

236

Microbiology (1997), 143, 26732683 Printed in Great Britain The Klebsiella pneumoniae cytochrome bd'  

E-print Network

(see Hill, 1992). The ability to fix N # is widely distributed amongst obligate anaerobic, facultative anaerobic and obligate aerobic prokaryotes (Young, 1992), where the most commonly occurring nitrogenases microaerophile when fixing N #(Kelly et al., 1990). By contrast, the facultative anaerobe Klebsiella pneumoniae

Merrick, Mike

237

Klebsiella pneumoniae strains producing extended-spectrum beta-lactamases in Spain: microbiological and clinical features.  

PubMed

Extended-spectrum ?-lactamases (ESBL) of the CTX-M, SHV, and TEM families were recognized in 76 (67%), 31 (27%), and 6 (5%) isolates, respectively, among 162 ESBL-producing Klebsiella pneumoniae (ESBL-Kp) strains obtained in a multicenter study in Spain. Predisposing factors for ESBL-Kp acquisition included invasive procedures, mechanical ventilation, and previous antimicrobial use. PMID:21191059

Ruiz de Alegría, C; Rodríguez-Baño, J; Cano, M E; Hernández-Bello, J R; Calvo, J; Román, E; Díaz, M A; Pascual, A; Martínez-Martínez, L

2011-03-01

238

Klebsiella pneumoniae Strains Producing Extended-Spectrum ?-Lactamases in Spain: Microbiological and Clinical Features?  

PubMed Central

Extended-spectrum ?-lactamases (ESBL) of the CTX-M, SHV, and TEM families were recognized in 76 (67%), 31 (27%), and 6 (5%) isolates, respectively, among 162 ESBL-producing Klebsiella pneumoniae (ESBL-Kp) strains obtained in a multicenter study in Spain. Predisposing factors for ESBL-Kp acquisition included invasive procedures, mechanical ventilation, and previous antimicrobial use. PMID:21191059

de Alegría, C. Ruiz; Rodríguez-Baño, J.; Cano, M. E.; Hernández-Bello, J. R.; Calvo, J.; Román, E.; Díaz, M. A.; Pascual, A.; Martínez-Martínez, L.

2011-01-01

239

Existence of Sinorhizobium meliloti genomic fragment hybridizing with the nifM gene of Klebsiella pneumoniae.  

PubMed

A novel finding that genomic restriction fragments of symbiotic nitrogen fixer S. meliloti hybridized with nifM gene probe of the free-living diazotroph Klebsiella pneumoniae is reported. When SmaI endonuclease was used to digest S. meliloti DNA, a unique hybridizing band was obtained. PMID:18062196

Gigova, L; Petrova, N; Dimova, S; Staneva, D

2007-01-01

240

Immunoproteomic to Analysis the Pathogenicity Factors in Leukopenia Caused by Klebsiella Pneumonia Bacteremia  

PubMed Central

Incidences of leukopenia caused by bacteremia have increased significantly and it is associated with prolonged hospital stay and increased cost. Immunoproteomic is a promising method to identify pathogenicity factors of different diseases. In the present study, we used immunoproteomic to analysis the pathogenicity factors in leukopenia caused by Klebsiella Pneumonia bacteremia. Approximately 40 protein spots localized in the 4 to 7 pI range were detected on two-dimensional electrophoresis gels, and 6 differentially expressed protein spots between 10 and 170 kDa were identified. Pathogenicity factors including S-adenosylmethionine synthetase, pyruvate dehydrogenase, glutathione synthetase, UDP-galactose-4-epimerase, acetate kinase A and elongation factor tu (EF-Tu). In validation of the pathogenicity factor, we used western blotting to show that Klebsiella pneumonia had higher (EF-Tu) expression when they accompanied by leukopenia rather than leukocytosis. Thus, we report 6 pathogenicity factors of leukopenia caused by Klebsiella pneumonia bacteremia, including 5 housekeeping enzymes and EF-Tu. We suggest EF-Tu could be a potential pathogenicity factor for leukopenia caused by Klebsiella pneumonia. PMID:25330314

Liu, Haiyan; Cheng, Zhongle; Song, Wen; Wu, Wenyong; Zhou, Zheng

2014-01-01

241

Carbapenem Resistance in Klebsiella pneumoniae Due to the New Delhi Metallo-?-lactamase  

PubMed Central

(See editorial commentary by Bronomo, on pages 485–487.) Carbapenem resistance in Klebsiella pneumoniae is most notably due to the K. pneumoniae carbapenemase (KPC) ?-lactamase. In this report, we describe the occurrence of a newly described mechanism of carbapenem resistance, the NDM-1 ?-lactamase, in a patient who received medical attention (but was not hospitalized) in India. PMID:21258100

Sidjabat, Hanna; Nimmo, Graeme R.; Walsh, Timothy R.; Binotto, Enzo; Htin, Anthony; Hayashi, Yoshiro; Li, Jian; Nation, Roger L.; George, Narelle

2011-01-01

242

Complete genome sequence of a Klebsiella pneumoniae strain isolated from a known cotton insect boll vector  

Technology Transfer Automated Retrieval System (TEKTRAN)

Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the...

243

Phenotypic and genotypic characterization of Klebsiella pneumonia recovered from nonhuman primates  

Technology Transfer Automated Retrieval System (TEKTRAN)

Klebsiella pneumoniae is a zoonotic, Gram-negative member of the family Enterobacteriaceae and is the causative agent of nosocomial septicemic, pneumonic, and urinary tract infections. Recently, pathogenic strains of K. pneumoniae sharing a hypermucoviscosity (HMV) phenotype have been attributed to ...

244

Analysis of regulation of Klebsiella pneumoniae nitrogen fixation (nif) gene cluster with gene fusions  

Microsoft Academic Search

Gene fusions in which the lac genes are under the control of each promoter in the Klebsiella pneumoniae nitrogen fixation (nif) gene cluster have been constructed. These fusions have been used to examine positive control of the cluster and the response of individual genes to repression by ammonia and oxygen. De-repression of nif transcriptional units is coordinate and molybdate is

Ray Dixon; Robert R. Eady; Guadalupe Espin; Susan Hill; Maurizio Iaccarino; Daniel Kahn; Mike Merrick

1980-01-01

245

Repressor properties of the nifL gene product in Klebsiella pneumoniae  

Microsoft Academic Search

Certain mutations in the nifL gene of the Klebsiella pneumoniae nitrogen fixation (nif) gene cluster resulted in altered nif regulaiton such that nitrogenase synthesis was no longer repressed by low levels of exogenous fixed nitrogen, by oxygen or by high temperature. Introduction of a plasmid with a nifL+ allele restored fixed nitrogen and oxygen repression. We therefore conclude that the

Mike Merrick; Susan Hill; Hauke Hennecke; Matthias Hahn; Ray Dixon; Christina Kennedy

1982-01-01

246

Evaluation of Methods To Identify the Klebsiella pneumoniae Carbapenemase in Enterobacteriaceae  

Microsoft Academic Search

The Klebsiella pneumoniae carbapenem (KPC) -lactamase occurs in Enterobacteriaceae and can confer resistance to all -lactam agents including carbapenems. The enzyme may confer low-level carbapenem resistance, and the failure of susceptibility methods to identify this resistance has been reported. Automated and nonautomated methods for carbapenem susceptibility were evaluated for identification of KPC-mediated resistance. Ertapenem was a more sensitive indicator of

K. F. Anderson; D. R. Lonsway; J. K. Rasheed; J. Biddle; B. Jensen; L. K. McDougal; R. B. Carey; A. Thompson; S. Stocker; B. Limbago; J. B. Patel

2007-01-01

247

Intrinsic Klebsiella pneumoniae contamination of liquid germicidal hand soap containing chlorhexidine.  

PubMed

We describe intrinsic contamination with Klebsiella pneumoniae occurring during the manufacture of germicidal hand soap, labeled as containing 2% chlorhexidine, used throughout a 350-bed community medical center. A 3-year retrospective study failed to find evidence of increased incidence of clinical isolates of this strain. PMID:15518034

Brooks, Steven E; Walczak, Mary A; Malcolm, Sharon; Hameed, Rizwanullah

2004-10-01

248

Necrotizing Fasciitis Caused by Hypermucoviscous Klebsiella pneumoniae in a Filipino Female in North America  

PubMed Central

Necrotizing fasciitis caused by Klebsiella pneumoniae has been described in Southeast Asia, but has only recently begun to emerge in North America. The hypermucoviscous strain of K. pneumoniae is a particularly virulent strain known to cause devastatingly invasive infections, including necrotizing fasciitis. Here we present the first known case of necrotizing fasciitis caused by hypermucoviscous K. pneumoniae in North America. PMID:25671032

Ng, Daniel; Frazee, Brad

2015-01-01

249

Emergence of Klebsiella pneumoniae co-producing NDM-type and OXA-181 carbapenemases.  

PubMed

The emergence of carbapenemase-producing Enterobacteriaceae is a rapidly evolving threat worldwide. Here, we report the molecular characterization of two Klebsiella pneumoniae isolates carrying both bla(OXA -181) and bla(NDM -1) or bla(NDM -5) isolated from epidemiologically unrelated patients in Singapore. The bla(OXA -181) genes were found existing in different genetic environments. PMID:23668475

Balm, M N D; La, M-V; Krishnan, P; Jureen, R; Lin, R T P; Teo, J W P

2013-09-01

250

Phenotypic and Molecular Characterization of Multidrug Resistant Klebsiella pneumoniae Isolated from a University Teaching Hospital, China  

PubMed Central

The multidrug-resistant rate of Klebsiella pneumoniae has risen rapidly worldwide. To better understand the multidrug resistance situation and molecular characterization of Klebsiella pneumoniae, a total of 153 Klebsiella pneumoniae isolates were collected, and drug susceptibility test was performed to detect its susceptibility patterns to 13 kinds of antibiotics. Phenotypic tests for carbapenemases ESBLs and AmpC enzyme-producing strains were performed to detect the resistance phenotype of the isolates. Then PCR amplification and sequencing analysis were performed for the drug resistance determinants. The results showed that 63 strains harbored blaCTX-M gene, and 14 strains harbored blaDHA gene. Moreover, there were 5 strains carrying blaKPC gene, among which 4 strains carried blaCTX-M, blaDHA and blaKPC genes, and these 4 strains were also resistant to imipenem. Our data indicated that drug-resistant Klebsiella pneumoniae were highly prevalent in the hospital. Thus it is warranted that surveillance of epidemiology of those resistant isolates should be a cause for concern, and appropriate drugs should be chosen. PMID:24740167

Liu, Helu; Lü, Dongyue; Liang, Hong; Dou, Yuhong

2014-01-01

251

Phenotypic and molecular characterization of multidrug resistant Klebsiella pneumoniae isolated from a university teaching hospital, China.  

PubMed

The multidrug-resistant rate of Klebsiella pneumoniae has risen rapidly worldwide. To better understand the multidrug resistance situation and molecular characterization of Klebsiella pneumoniae, a total of 153 Klebsiella pneumoniae isolates were collected, and drug susceptibility test was performed to detect its susceptibility patterns to 13 kinds of antibiotics. Phenotypic tests for carbapenemases ESBLs and AmpC enzyme-producing strains were performed to detect the resistance phenotype of the isolates. Then PCR amplification and sequencing analysis were performed for the drug resistance determinants. The results showed that 63 strains harbored bla CTX-M gene, and 14 strains harbored bla DHA gene. Moreover, there were 5 strains carrying bla KPC gene, among which 4 strains carried bla CTX-M, bla DHA and bla KPC genes, and these 4 strains were also resistant to imipenem. Our data indicated that drug-resistant Klebsiella pneumoniae were highly prevalent in the hospital. Thus it is warranted that surveillance of epidemiology of those resistant isolates should be a cause for concern, and appropriate drugs should be chosen. PMID:24740167

Du, Jikun; Li, Peipei; Liu, Helu; Lü, Dongyue; Liang, Hong; Dou, Yuhong

2014-01-01

252

Production and purification of rhamnose from microbial polysaccharide produced by Klebsiella sp. I-714  

Microsoft Academic Search

A rhamnose-containing microbial polysaccharide has been produced by Klebsiella sp. I-714. strain. The polysaccharide has been used as a source for the obtention of L-rhamnose. A biotechnological process has been developed to purify the hydrolyzed polysaccharide (EPSH), which contains rhamnose, galactose and glucuronic acid.

J. M. Serrat; G. Caminal; F. Gòdia; C. Solà; J. López-Santin

1995-01-01

253

Microbiological and Genetic Characterization of Carbapenem-Resistant Klebsiella pneumoniae Isolated From Pediatric Patients  

PubMed Central

This manuscript reports the clinical, microbiological, and genetic characteristics of carbapenem-resistant K. pnuemoniae isolates from pediatric patients at a tertiary-care children's hospital. Although there is an extensive body of literature describing carbapenem-resistant Klebsiella infections in adults, pediatric data are comparatively limited. PMID:24567846

Dara, Jasmeen S.; Chen, Liang; Levi, Michael H.; Kreiswirth, Barry N.; Pellett Madan, Rebecca

2014-01-01

254

Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.  

PubMed

The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. PMID:24820641

Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching

2014-06-15

255

Bioelectricity Aware of bacteria  

E-print Network

that are responsible. To verify this hypothesis, they genetically modified bacteria to replace in the pili, these amino acids with alanine, aliphatic*. Result: the genetically changed bacteria does drive more electricity

Lovley, Derek

256

Bleach vs. Bacteria  

MedlinePLUS

... Articles | Inside Life Science Home Page Bleach vs. Bacteria By Sharon Reynolds Posted April 2, 2014 Your ... hypochlorous acid to help kill invading microbes, including bacteria. Researchers funded by the National Institutes of Health ...

257

Lactic Acid Bacteria  

NSDL National Science Digital Library

This on-line exercise is focused on lactic acid bacteria, a group of related bacteria that produce lactic acid as a result of carbohydrate fermentation. It includes a protocol for the enrichment of lactic acid bacteria from enriched samples (like yogurt, sauerkraut, decaying plant matter, and tooth plaque). Three parameters are measured: growth, culture diversity, and pH. The exercise also includes instructions for the isolation of some of these bacteria by using the streak-plate method.

258

CHAPTER IV-2 BACTERIA  

Technology Transfer Automated Retrieval System (TEKTRAN)

Entomopathogenic bacteria provide an alternative to chemical pesticides used in insect control programs. Today, the principal microbial insecticides utilize spore forming bacteria or toxins produced by these bacteria as their active ingredients, either in formulations or by incorporation of toxin g...

259

Bacteria: More Than Pathogens  

NSDL National Science Digital Library

The issue-focused, peer-reviewed article reveals that there are more bacteria on Earth than there are humans. Bacteria: inhabit every environment on the planet, playing a key ecological role, can be good for our health -- for example, by helping us digest food, and can cause disease even though the human body is not the natural host for many bacteria.

Trudy Wassenaar (; )

2002-07-01

260

Bacteria: Friend or Foe?  

NSDL National Science Digital Library

This lesson explores "good" and "bad" bacteria. Students can draw "Wanted!" bacteria mug shots, create composting trials and designs, produce a skit involving a boastful virus and bacterium, experiment with soil and ordinary objects in the lab, write a news story about an outbreak, complete a multiple-choice bacteria quiz and more!

David Brock (Roland Park Public School; )

2003-01-10

261

Modeling Klebsiella pneumoniae pathogenesis by infection of the wax moth Galleria mellonella.  

PubMed

The implementation of infection models that approximate human disease is essential for understanding pathogenesis at the molecular level and for testing new therapies before they are entered into clinical stages. Insects are increasingly being used as surrogate hosts because they share, with mammals, essential aspects of the innate immune response to infections. We examined whether the larva of the wax moth Galleria mellonella could be used as a host model to conceptually approximate Klebsiella pneumoniae-triggered pneumonia. We report that the G. mellonella model is capable of distinguishing between pathogenic and nonpathogenic Klebsiella strains. Moreover, K. pneumoniae infection of G. mellonella models some of the known features of Klebsiella-induced pneumonia, i.e., cell death associated with bacterial replication, avoidance of phagocytosis by phagocytes, and the attenuation of host defense responses, chiefly the production of antimicrobial factors. Similar to the case for the mouse pneumonia model, activation of innate responses improved G. mellonella survival against subsequent Klebsiella challenge. Virulence factors necessary in the mouse pneumonia model were also implicated in the Galleria model. We found that mutants lacking capsule polysaccharide, lipid A decorations, or the outer membrane proteins OmpA and OmpK36 were attenuated in Galleria. All mutants activated G. mellonella defensive responses. The Galleria model also allowed us to monitor Klebsiella gene expression. The expression levels of cps and the loci implicated in lipid A remodeling peaked during the first hours postinfection, in a PhoPQ- and PmrAB-governed process. Taken together, these results support the utility of G. mellonella as a surrogate host for assessing infections with K. pneumoniae. PMID:23836821

Insua, José Luis; Llobet, Enrique; Moranta, David; Pérez-Gutiérrez, Camino; Tomás, Anna; Garmendia, Junkal; Bengoechea, José A

2013-10-01

262

Modeling Klebsiella pneumoniae Pathogenesis by Infection of the Wax Moth Galleria mellonella  

PubMed Central

The implementation of infection models that approximate human disease is essential for understanding pathogenesis at the molecular level and for testing new therapies before they are entered into clinical stages. Insects are increasingly being used as surrogate hosts because they share, with mammals, essential aspects of the innate immune response to infections. We examined whether the larva of the wax moth Galleria mellonella could be used as a host model to conceptually approximate Klebsiella pneumoniae-triggered pneumonia. We report that the G. mellonella model is capable of distinguishing between pathogenic and nonpathogenic Klebsiella strains. Moreover, K. pneumoniae infection of G. mellonella models some of the known features of Klebsiella-induced pneumonia, i.e., cell death associated with bacterial replication, avoidance of phagocytosis by phagocytes, and the attenuation of host defense responses, chiefly the production of antimicrobial factors. Similar to the case for the mouse pneumonia model, activation of innate responses improved G. mellonella survival against subsequent Klebsiella challenge. Virulence factors necessary in the mouse pneumonia model were also implicated in the Galleria model. We found that mutants lacking capsule polysaccharide, lipid A decorations, or the outer membrane proteins OmpA and OmpK36 were attenuated in Galleria. All mutants activated G. mellonella defensive responses. The Galleria model also allowed us to monitor Klebsiella gene expression. The expression levels of cps and the loci implicated in lipid A remodeling peaked during the first hours postinfection, in a PhoPQ- and PmrAB-governed process. Taken together, these results support the utility of G. mellonella as a surrogate host for assessing infections with K. pneumoniae. PMID:23836821

Insua, José Luis; Llobet, Enrique; Moranta, David; Pérez-Gutiérrez, Camino; Tomás, Anna; Garmendia, Junkal

2013-01-01

263

Antibacterial efficacy of lytic bacteriophages against antibiotic-resistant Klebsiella species.  

PubMed

Bacterial resistance to antibiotics is a leading and highly prevalent problem in the treatment of infectious diseases. Bacteriophages (phages) appear to be effective and safe alternatives for the treatment of resistant infections because of their specificity for bacterial species and lack of infectivity in eukaryotic cells. The present study aimed to isolate bacteriophages against Klebsiella spp. and evaluate their efficacy against antibiotic-resistant species. Seventy-two antibiotic-resistant Klebsiella spp. were isolated from samples of patients who referred to the Ghaem Hospital (Mashhad, Iran). Lytic bacteriophages against Klebsiella spp. were isolated from wastewater of the septic tank of the same hospital. Bactericidal activity of phages against resistant Klebsiella spp. was tested in both liquid (tube method; after 1 and 24 h of incubation) and solid (double-layer agar plate method; after 24 h of incubation) phases. In each method, three different concentrations of bacteriophages (low: <10(4) PFU/mL, medium: 10(4)-10(7) PFU/mL, and high: >10(7) PFU/mL) were used. Bacteriophages showed promising bactericidal activity at all assessed concentrations, regardless of the test method and duration of incubation. Overall, bactericidal effects were augmented at higher concentrations. In the tube method, higher activity was observed after 24 h of incubation compared to the 1-h incubation. The bactericidal effects were also higher in the tube method compared to the double-layer agar plate method after 24 h of incubation. The findings of the present study suggest that bacteriophages possess effective bactericidal activity against resistant Klebsiella spp. These bactericidal activities are influenced by phage concentration, duration of incubation, and test method. PMID:21789469

Karamoddini, M Khajeh; Fazli-Bazzaz, B S; Emamipour, F; Ghannad, M Sabouri; Jahanshahi, A R; Saed, N; Sahebkar, A

2011-01-01

264

Identification and Characterization of the fis Operon in Enteric Bacteria  

PubMed Central

The small DNA binding protein Fis is involved in several different biological processes in Escherichia coli. It has been shown to stimulate DNA inversion reactions mediated by the Hin family of recombinases, stimulate integration and excision of phage ? genome, regulate the transcription of several different genes including those of stable RNA operons, and regulate the initiation of DNA replication at oriC. fis has also been isolated from Salmonella typhimurium, and the genomic sequence of Haemophilus influenzae reveals its presence in this bacteria. This work extends the characterization of fis to other organisms. Very similar fis operon structures were identified in the enteric bacteria Klebsiella pneumoniae, Serratia marcescens, Erwinia carotovora, and Proteus vulgaris but not in several nonenteric bacteria. We found that the deduced amino acid sequences for Fis are 100% identical in K. pneumoniae, S. marcescens, E. coli, and S. typhimurium and 96 to 98% identical when E. carotovora and P. vulgaris Fis are considered. The deduced amino acid sequence for H. influenzae Fis is about 80% identical and 90% similar to Fis in enteric bacteria. However, in spite of these similarities, the E. carotovora, P. vulgaris, and H. influenzae Fis proteins are not functionally identical. An open reading frame (ORF1) preceding fis in E. coli is also found in all these bacteria, and their deduced amino acid sequences are also very similar. The sequence preceding ORF1 in the enteric bacteria showed a very strong similarity to the E. coli fis P region from ?53 to +27 and the region around ?116 containing an ihf binding site. Both ?-galactosidase assays and primer extension assays showed that these regions function as promoters in vivo and are subject to growth phase-dependent regulation. However, their promoter strengths vary, as do their responses to Fis autoregulation and integration host factor stimulation. PMID:9811652

Beach, Michael B.; Osuna, Robert

1998-01-01

265

Sensitization of Gram-negative bacteria to rifampin and OAK combinations.  

PubMed

While individually inefficient against Gram-negative bacteria, in-vitro combinations of rifampin and OAK were mutually synergistic since sub-minimal inhibitory concentrations of one compound have potentiated the other by 2-4 orders of magnitude. Synergy persisted in-vivo as single-dose systemic treatment of Klebsiella infected mice resulted in 10-20% versus 60% survival, respectively accomplished by individual and combined compounds. This outcome was achieved without drug formulation, rather, pharmacokinetic considerations have inspired the therapeutic regimen. PMID:25782773

Jammal, Joanna; Zaknoon, Fadia; Kaneti, Galoz; Goldberg, Keren; Mor, Amram

2015-01-01

266

Sensitization of Gram-negative bacteria to rifampin and OAK combinations  

PubMed Central

While individually inefficient against Gram-negative bacteria, in-vitro combinations of rifampin and OAK were mutually synergistic since sub-minimal inhibitory concentrations of one compound have potentiated the other by 2–4 orders of magnitude. Synergy persisted in-vivo as single-dose systemic treatment of Klebsiella infected mice resulted in 10–20% versus 60% survival, respectively accomplished by individual and combined compounds. This outcome was achieved without drug formulation, rather, pharmacokinetic considerations have inspired the therapeutic regimen. PMID:25782773

Jammal, Joanna; Zaknoon, Fadia; Kaneti, Galoz; Goldberg, Keren; Mor, Amram

2015-01-01

267

Factors promoting survival of bacteria in chlorinated water supplies.  

PubMed Central

Results of our experiments showed that the attachment of bacteria to surfaces provided the greatest increase in disinfection resistance. Attachment of unencapsulated Klebsiella pneumoniae grown in medium with high levels of nutrients to glass microscope slides afforded the microorganisms as much as a 150-fold increase in disinfection resistance. Other mechanisms which increased disinfection resistance included the age of the biofilm, bacterial encapsulation, and previous growth conditions (e.g., growth medium and growth temperature). These factors increased resistance to chlorine from 2- to 10-fold. The choice of disinfectant residual was shown to influence the type of resistance mechanism observed. Disinfection by free chlorine was affected by surfaces, age of the biofilm, encapsulation, and nutrient effects. Disinfection by monochloramine, however, was only affected by surfaces. Importantly, results showed that these resistance mechanisms were multiplicative (i.e., the resistance provided by one mechanism could be multiplied by the resistance provided by a second mechanism). PMID:3288119

LeChevallier, M W; Cawthon, C D; Lee, R G

1988-01-01

268

Histamine-producing bacteria in decomposing skipjack tuna (Katsuwonus pelamis).  

PubMed

Spoilage in skipjack tuna (Katsuwonus pelamis) was studied under controlled conditions by incubating whole, fresh fish in seawater at 38 degrees C, the optimum temperature for histamine formation. Bacterial isolates were obtained from the loin tissue of a decomposing tuna containing 134 mg of histamine per 100 g and a total anaerobic count of 3.5 x 10(5)/g after incubation for 24 h. Over 92% of the 134 isolates obtained were facultatively or obligately anaerobic bacteria. Eighteen isolates produced histamine in culture media containing histidine, and these were identified as Clostridium perfringens, Enterobacter aerogenes, Klebsiella pneumoniae, Proteus mirabilis, and Vibrio alginolyticus. Histidine decarboxylase activity of several isolates was measured in a tuna broth medium and with resting cells suspended in a buffered histidine solution. PMID:6289747

Yoshinaga, D H; Frank, H A

1982-08-01

269

Bacteria Are Everywhere!  

NSDL National Science Digital Library

Students are introduced to the concept of engineering biological organisms and studying their growth to be able to identify periods of fast and slow growth. They learn that bacteria are found everywhere, including on the surfaces of our hands. Student groups study three different conditions under which bacteria are found and compare the growth of the individual bacteria from each source. In addition to monitoring the quantity of bacteria from differ conditions, they record the growth of bacteria over time, which is an excellent tool to study binary fission and the reproduction of unicellular organisms.

AMPS GK-12 Program,

270

Susceptibility and bactericidal activity of five biocides on Klebsiella pneumoniae and its association with efflux pump genes and antibiotic resistance   

E-print Network

Klebsiella pneumoniae is one of the top eight pathogens in hospitals, causing around 10% of hospital-acquired infections (nosocomial infections). It often produces extended-spectrum ?-lactamase enzymes (ESBLs). This has led to numerous outbreaks...

Abuzaid, Abdulmonem Ali

2013-11-29

271

Molecular epidemiology of KPC2- producing Klebsiella pneumoniae isolates in Brazil: the predominance of sequence type 437  

Microsoft Academic Search

The aim of this study was to investigate the genetic relatedness of 57 KPC-2–producing Klebsiella pneumoniae isolates from 5 states in Brazil, during 2006–2009. Pulse-field gel electrophoresis analysis identified 10 pulsotypes. The pulsotype designated as Kp-RJ (Klebsiella pneumoniae–Rio de Janeiro) was the dominant clone found in the states of Rio de Janeiro and Espírito Santo. Multilocus sequence typing of Kp-RJ

Liliane M. Seki; Polyana S. Pereira; Maria da Penha A. H. de Souza; Magda de S. Conceição; Elizabeth A. Marques; Carlos Oliveira Porto; Elvira Maria L. Colnago; Carlene de F. M. Alves; Deize Gomes; Ana Paula D. A. Carvalho Assef; Ørjan Samuelsen; Marise D. Asensi

2011-01-01

272

Transferable resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of Klebsiella pneumoniae and Serratia marcescens  

Microsoft Academic Search

Summary In conjugational crosses, threeKlebsiella pneumoniae strains and oneSerratia marcescens strain have been demonstrated to transfer resistance determinants to newer types of cephalosporins. WhileKlebsiella strains donated cefotaxime, cefamandole and cefuroxime resistance toEscherichia coli K-12 recipients, the genetic analysis of exconjugants after the transfer of plasmids fromSerratia strains toProteus orSalmonella recipients showed that the cefoxitin resistance determinant was also co-transferred. In

H. Knothe; P. Shah; V. Krcmery; M. Antal; S. Mitsuhashi

1983-01-01

273

Bacteria: Fossil Record  

NSDL National Science Digital Library

This description of the fossil record of bacteria focuses on one particular group of bacteria, the cyanobacteria or blue-green algae, which have left a fossil record that extends far back into the Precambrian. The oldest cyanobacteria-like fossils known are nearly 3.5 billion years old and are among the oldest fossils currently known. Cyanobacteria are larger than most bacteria and may secrete a thick cell wall. More importantly, cyanobacteria may form large layered structures, called stromatolites (if more or less dome-shaped) or oncolites (if round). The site also refers to pseudomorphs of pyrite and siderite, and a group of bacteria known as endolithic. Two links are available for more information. One provides information on the discovery of possible remains of bacteria-like organisms on a meteorite from Mars and the other has a research report on fossilized filamentous bacteria and other microbes, found in Cretaceous amber.

274

Nitrogenase of Klebsiella pneumoniae. Purification and properties of the component proteins  

PubMed Central

1. Nitrogenase from the facultative anaerobe Klebsiella pneumoniae was resolved into two protein components resembling those obtained from other nitrogen-fixing bacteria. 2. Both proteins were purified to homogeneity as shown by the criteria of disc electrophoresis and ultracentrifugal analysis. 3. The larger component had a mol.wt. of 218000 and contained one Mo atom, 17Fe atoms and 17 acid-labile sulphide groups/mol; it contained two types of subunit, present in equal amounts, of mol.wts. 50000 and 60000. All the common amino acids were present, with a predominance of acidic residues. The apparent partial specific volume was 0.73; ultracentrifugal analysis gave s020,w=11.0S and D020,w=4.94×10?7cm2/s. The specific activities (nmol of product formed/min per mg of protein) when assayed with the second nitrogenase component were 1500 for H2 evolution, 380 for N2 reduction, 1200 for acetylene reduction and 5400 for ATP hydrolysis. The reduced protein showed electron-paramagnetic-resonance signals at g=4.3, 3.7 and 2.015; the Mössbauer spectrum of the reduced protein consisted of at least three doublets. The u.v. spectra of the oxidized and reduced proteins were identical. On oxidation the absorbance increased generally throughout the visible region and a shoulder at 430nm appeared. The circular-dichroism spectra of both the oxidized and reduced proteins were the same, consisting mainly of a negative trough at 220nm. 4. The smaller component had mol.wt. 66800 and contained four Fe atoms and four acid-labile sulphide groups in a molecule comprising two subunits each of mol.wt. 34600. All common amino acids except tryptophan were present, with a predominance of acidic residues. The apparent partial specific volume calculated from the amino acid analysis was 0.732, which was significantly higher than that obtained from density measurements (0.69); ultracentrifugal analysis gave s020,w=4.8S and D020,w=5.55×10?7cm2/s. The specific activities (nmol of product formed/min per mg of protein) were 1050 for H2 evolution, 275 for N2 reduction, 980 for acetylene reduction and 4350 for ATP hydrolysis. The protein was not cold-labile. The reduced protein showed electron-paramagnetic-resonance signals in the g=1.94 region. The Mössbauer spectrum of the reduced protein consisted of a doublet at 77°K. The u.v. spectra of reduced and O2-inactivated proteins were identical, and inactivation by O2 generally increased the absorbance in the visible region and resulted in a shoulder at 460nm. The circular-dichroism spectra exhibited a negative trough at 220nm and inactivation by O2 decreased the depth of the trough. 5. The reduction of N2 and acetylene, and H2 evolution, were maximal at a 1:1 molar ratio of the Fe-containing protein to the Mo–Fe-containing protein; excess of the Mo–Fe-containing protein was inhibitory. All reductions were accompanied by H2 evolution. The combined proteins had no ATP-independent hydrogenase activity. ImagesPLATE 1Fig. 2. PMID:4344006

Eady, R. R.; Smith, B. E.; Cook, K. A.; Postgate, J. R.

1972-01-01

275

Genomics of Probiotic Bacteria  

NASA Astrophysics Data System (ADS)

Probiotic bacteria from the Lactobacillus and Bifidobacterium species belong to the Firmicutes and the Actinobacteria phylum, respectively. Lactobacilli are members of the lactic acid bacteria (LAB) group, a broadly defined family of microorganisms that ferment various hexoses into primarily lactic acid. Lactobacilli are typically low G + C gram-positive species which are phylogenetically diverse, with over 100 species documented to date. Bifidobacteria are heterofermentative, high G + C content bacteria with about 30 species of bifidobacteria described to date.

O'Flaherty, Sarah; Goh, Yong Jun; Klaenhammer, Todd R.

276

Bacteria TMDL Projects  

E-print Network

of the projects are listed below. ? Peach CreekWater Quality Improvement Project ? Monitoring and Educational Programs Focused on Bacteria and Nutrient Runoff on Dairy Operations in the LeonWatershed ? Development of the Plum CreekWPP ? Impact of Proper... Star Healthy Streams * ? Environmental Management of Grazing Lands * *TWRI-managed projects More information on the initiative is available at www.tsswcb.state.tx.us/managementprogram/ initiatives/bacteria. Bacteria Projects Across the State...

Wythe, Kathy

2007-01-01

277

Biosynthesis of selenium nanoparticles using Klebsiella pneumoniae and their recovery by a simple sterilization process  

PubMed Central

The use of biologically derived metal nanoparticles for various proposes is going to be an issue of considerable importance; thus, appropriate methods should be developed and tested for the biological synthesis and recovery of these nanoparticles from bacterial cells. In this research study, a strain of Klebsiella pneumoniae was tested for its ability to synthesize elemental selenium nanoparticles from selenium chloride. A broth of Klebsiella pneumoniae culture containing selenium nanoparticles was subjected to sterilization at 121oC and 17 psi for 20 minutes. Released selenium nanoparticles ranged in size from 100 to 550 nm, with an average size of 245 nm. Our study also showed that no chemical changes occurred in selenium nanoparticles during the wet heat sterilization process. Therefore, the wet heat sterilization process can be used successfully to recover elemental selenium from bacterial cells. PMID:24031517

Fesharaki, Parisa Jafari; Nazari, Pardis; Shakibaie, Mojtaba; Rezaie, Sassan; Banoee, Maryam; Abdollahi, Mohammad; Shahverdi, Ahmad Reza

2010-01-01

278

Introduction to Bacteria  

NSDL National Science Digital Library

This science site has students research how bacteria move, where they live, and how they reproduce; learn how bacteria can be helpful or harmful; and create a design illustrating what they have learned about bacteria. Included in the lesson plan are the objectives, needed materials and Web sites, procedures, discussion questions, evaluation, extensions, suggested reading, and vocabulary. Teachers can link to Teaching Tools to create custom worksheets, puzzles, and quizzes. A printable version of the lesson plan can be downloaded. The video Bacteria, Viruses and Allergies can be purchased and comprehension questions and answers can be downloaded.

DiscoverySchool.com

2007-12-12

279

Draft Genome Sequence of the First Hypermucoviscous Klebsiella variicola Clinical Isolate.  

PubMed

An antibiotic-susceptible and hypermucoviscous clinical isolate of Klebsiella variicola (K. variicola 8917) was obtained from the sputum of an adult patient. This work reports the complete draft genome sequence of K. variicola 8917 with 103 contigs and an annotation that revealed a 5,686,491-bp circular chromosome containing a total of 5,621 coding DNA sequences, 65 tRNA genes, and an average G+C content of 56.98%. PMID:25858850

Garza-Ramos, Ulises; Silva-Sanchez, Jesus; Barrios, Humberto; Rodriguez-Medina, Nadia; Martínez-Barnetche, Jesus; Andrade, Veronica

2015-01-01

280

Liver abscess associated with severe myopathy caused by Klebsiella pneumoniae serotype K1 in Romania.  

PubMed

Liver abscess was diagnosed in a man presenting with fever, chills and severe myopathy. The K. pneumoniae isolated from blood cultures belonged to the K1 serotype. The patient responded favourably to percutaneous drainage of the abscess and antibiotics. This is the first documented report of Klebsiella pneumoniae liver abscess syndrome (KLAS) described in Romania and may indicate the emergence of this syndrome in Eastern Europe. PMID:25390064

Popescu, Gabriel-Adrian; Tanase, Diana; Petrescu, Ana-Maria; Florea, Dragos

2014-11-01

281

Draft Genome Sequence of the First Hypermucoviscous Klebsiella variicola Clinical Isolate  

PubMed Central

An antibiotic-susceptible and hypermucoviscous clinical isolate of Klebsiella variicola (K. variicola 8917) was obtained from the sputum of an adult patient. This work reports the complete draft genome sequence of K. variicola 8917 with 103 contigs and an annotation that revealed a 5,686,491-bp circular chromosome containing a total of 5,621 coding DNA sequences, 65 tRNA genes, and an average G+C content of 56.98%. PMID:25858850

Silva-Sanchez, Jesus; Barrios, Humberto; Rodriguez-Medina, Nadia; Martínez-Barnetche, Jesus; Andrade, Veronica

2015-01-01

282

Activity of imipenem against Klebsiella pneumoniae biofilms in vitro and in vivo.  

PubMed

Encapsulated Klebsiella pneumoniae has emerged as one of the most clinically relevant and more frequently encountered opportunistic pathogens in combat wounds as the result of nosocomial infection. In this report, we show that imipenem displayed potent activity against established K. pneumoniae biofilms under both static and flow conditions in vitro. Using a rabbit ear model, we also demonstrated that imipenem was highly effective against preformed K. pneumoniae biofilms in wounds. PMID:24247132

Chen, Ping; Seth, Akhil K; Abercrombie, Johnathan J; Mustoe, Thomas A; Leung, Kai P

2014-01-01

283

Is combination therapy for carbapenem-resistant Klebsiella pneumoniae the new standard of care?  

PubMed

Carbapenem-resistant Klebsiella pneumoniae causes serious nosocomial infections and therapeutic options are limited. There is increasing evidence suggesting that combination antibiotic therapy is more effective than monotherapy and leads to better outcomes. However, questions remain about which regimen is optimal and how to balance the potential benefits of combination therapy versus the risks and possible complications (e.g., toxicity, increased costs, Clostridium difficile infection). Well-designed randomized clinical trials are needed to clarify these issues. PMID:25711690

Watkins, Richard R; Deresinski, Stan

2015-04-01

284

First Isolate of KPC-2-Producing Klebsiella pneumonaie Sequence Type 23 from the Americas  

PubMed Central

KPC-2-producing Klebsiella pneumoniae isolates mainly correspond to clonal complex 258 (CC258); however, we describe KPC-2-producing K. pneumoniae isolates belonging to invasive sequence type 23 (ST23). KPC-2 has scarcely been reported to occur in ST23, and this report describes the first isolation of this pathogen in the Americas. Acquisition of resistant markers in virulent clones could mark an evolutionary step toward the establishment of these clones as major nosocomial pathogens. PMID:25031447

Cejas, Daniela; Fernández Canigia, Liliana; Rincón Cruz, Giovanna; Elena, Alan X.; Maldonado, Ivana; Gutkind, Gabriel O.

2014-01-01

285

First outbreak of Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae in Germany  

Microsoft Academic Search

We report the first outbreak of Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae in Germany. The presence of KPC was confirmed by polymerase chain reaction (PCR). The KPC-encoding plasmid was analysed by\\u000a transconjugation experiments, DNA sequencing, Southern blotting and isoelectric focussing. Typing was performed by pulsed-field\\u000a gel electrophoresis (PFGE). An ertapenem-resistant K. pneumoniae with low minimum inhibitory concentrations (MIC) to other

C. Wendt; S. Schütt; A. H. Dalpke; M. Konrad; M. Mieth; B. Trierweiler-Hauke; M. A. Weigand; S. Zimmermann; K. Biehler; D. Jonas

2010-01-01

286

Arrival of Klebsiella pneumoniae producing KPC carbapenemase in the United Kingdom  

Microsoft Academic Search

Background: KPC-type carbapenemases are increasingly prevalent in parts of the USA and Israel and are an emerging concern in South America, Europe and China. We investigated the UK's first two KPC-producing Klebsiella pneumoniae isolates. Methods: The isolates were referred to the UK's national reference laboratory for confirmation of carba- penem resistance. Susceptibilities were determined by agar dilution, and blaKPC and

Neil Woodford; Jiancheng Zhang; Marina Warner; Mary E. Kaufmann; Jorge Matos; Alan MacDonald; Daniel Brudney; David Sompolinsky; Shiri Navon-Venezia; David M. Livermore

2008-01-01

287

The influence of lignin degradation products on xylose fermentation by Klebsiella pneumoniae  

Microsoft Academic Search

The inhibitory effects of seven closely related lignin degradation products on xylose fermentation by Klebsiella pneumoniae were studied. Compounds were added in varying concentrations. Less heavily substituted phenolics (at concentrations of, 0.1–0.4 g\\/l) were more inhibitory to growth and solvent production than vanillyl or syringyl derivatives. All of the cultures recovered from this inhibition after a prolonged incubation period. When

Nora K. Nishikawa; Roger Sutcliffe; John N. Saddler

1988-01-01

288

Correlation between Klebsiella pneumoniae carrying pLVPK-derived loci and abscess formation  

Microsoft Academic Search

Klebsiella pneumoniae-caused liver abscess (KLA) is an emerging infectious disease. However, factors other than K1-specific loci that contribute\\u000a to the pathogenesis of this disease have not been identified. pLVPK is a 219,385-bp plasmid of K. pneumoniae CG43, an invasive K2 strain associated with KLA. We aimed in this study to evaluate the involvement of pLVPK in K. pneumoniae virulence and

H.-L. Tang; M.-K. Chiang; W.-J. Liou; Y.-T. Chen; H.-L. Peng; C.-S. Chiou; K.-S. Liu; M.-C. Lu; K.-C. Tung; Y.-C. Lai

2010-01-01

289

Spread of klebsiella pneumoniae producing SHV-5 beta-lactamase among hospitalized patients  

Microsoft Academic Search

Summary The first outbreak of infections caused by an SHV-5 producing strain ofKlebsiella pneumoniae is reported. Within a period of 1 year and 9 months, multiresistantK. pneumoniae strains caused severe infections, mostly of the lower respiratory tract, in 22 patients. The strains were resistant to penicillins, third-generation cephalosporins, aztreonam, chloramphenicol, tetracycline and co-trimoxazole. The resistance determinants were transferable toEscherichia coli.

A. Bauernfeind; E. Eberlein; M. Holley; S. Schweighart; E. Rosenthal

1993-01-01

290

Concurrent Endophthalmitis and Orbital Cellulitis From Metastatic Klebsiella pneumonia Liver Abscess.  

PubMed

A 70-year-old Korean female with a history of Klebsiella pneumonia liver abscess was presented to the authors' service with signs of endophthalmitis and orbital cellulitis. Vitreous biopsy confirmed K. pneumonia as the causative organism. With prolonged intravenous antibiotics and steroids, orbital symptoms resolved, but visual acuity remained at light perception. This is the first case in the literature to report on endophthalmitis and orbital cellulitis from K. pneumonia liver abscess. PMID:25186218

Davies, Brett W; Fante, Robert G

2014-09-01

291

Fermentation of glycerol to 1,3-propanediol and 2,3-butanediol by Klebsiella pneumoniae  

Microsoft Academic Search

Klebsiella pneumoniae was shown to convert glycerol to 1,3-propanediol, 2,3-butanediol and ethanol under conditions of uncontrolled pH. Formation\\u000a of 2,3-butanediol starts with some hours' delay and is accompanied by a reuse of the acetate that was formed in the first\\u000a period. The fermentation was demonstrated in the type strain of K. pneumoniae, but growth was better with the more acid-tolerant

H. Biebl; A.-P. Zeng; K. Menzel; W.-D. Deckwer

1998-01-01

292

Multiple product inhibition and growth modeling of Clostridium butyricum and Klebsiella pneumoniae in glycerol fermentation  

Microsoft Academic Search

The inhibition potentials of products and substrate on the growth of Clostridium butyricum and Klebsiella pneumoniae in the glycerol fermentation are examined from experimental data and with a mathematical model. Whereas the inhibition potential of externally added and self-produced 1,3-propanediol is essentially the same, butyric acid produced by the culture is more toxic than that externally added. The same seems

A.-P. Zeng; A. Ross; H. Biebl; C. Tag; B. Guenzel; W.-D. Deckwer

1994-01-01

293

Outbreak of nosocomial infections due to Klebsiella pneumoniae producing SHV-4 beta-lactamase  

Microsoft Academic Search

One hundred and fifty-four clinical isolates ofKlebsiella pneumoniae resistant to broad-spectrum cephalosporins, aztreonam and amikacin were responsible for an outbreak of nosocomial infections lasting eight months in a university hospital in Paris. This outbreak occurred in the intensive care unit (39 patients), haematology units (8 patients) and surgical and medical units (11 patients). Antibiotic resistant strains were isolated from the

G. Arletl; M. J. Sanson-le Pors; M. Rouveau; G. Fournier; O. Marie; B. Schlemmer; A. Philippon

1990-01-01

294

Positive control and autogenous regulation of the nifLA promoter in Klebsiella pneumoniae  

Microsoft Academic Search

The nitrogen fixation (nif) genes of Klebsiella pneumoniae are specifically regulated by the products of the nifLA operon. We have located the promoter of this operon, and identified sequences required for nifLA transcription. Transcription from this promoter is shown to be positively regulated by the ntrC gene product (which coordinates the expression of many operons required for nitrogen assimilation) and

Martin Drummond; John Clements; Mike Merrick; Ray Dixon

1983-01-01

295

Extended broad spectrum ?-lactamase in Klebsiella pneumoniae including resistance to cephamycins  

Microsoft Academic Search

Summary A plasmid-encoded ß-lactamase conferring extended broad spectrum resistance including cephamycins was identified in aKlebsiella pneumoniae strain isolated from a patient's wound. Strains harbouring the plasmid pMVP-1 were resistant to penicillins, cephalosporins of all generations (parenteral and new oral compounds) cephamycins, aztreonam, tetracycline, chloramphenicol, sulfonamides and to all aminoglycosides modified by AAC-(6)-I-transferase. ß-lactams still active against these strains were temocillin,

A. Bauernfeind; S. Schweighart; Y. Chong

1989-01-01

296

Plasmid-mediated, carbapenem-hydrolysing ?-lactamase, KPC2, in Klebsiella pneumoniae isolates  

Microsoft Academic Search

Four isolates of Klebsiella pneumoniae obtained from patients at a Maryland medical centre exhibited reduced susceptibility to carbapenems and were found to produce the novel, class A, plasmid-mediated, carbapenem-hydrolysing enzyme, KPC-2. This enzyme has 99% identity with the plasmid-mediated, carbapenem-hydrolysing enzyme KPC-1, reported previously in a North Carolina K. pneumoniae isolate. The KPC-2-producing isolates were either susceptible or inter- mediate

Ellen Smith Moland; Nancy D. Hanson; Vicki L. Herrera; Jennifer A. Black; Thomas J. Lockhart; Ashfaque Hossain; Judith A. Johnson; Richard V. Goering; Kenneth S. Thomson

2003-01-01

297

An outbreak of multiply-resistant Klebsiella pneumoniae in the Grampian region of Scotland  

Microsoft Academic Search

A predominantly hospital-based outbreak of multiply-resistant Klebsiella pneumoniae capsular type K2 (MRK) expressing expanded spectrum ?-lactamase (ESBL) activity and fully sensitive only to the carbapenems and amikacin is described. The organism was isolated from 283 patients between March 1992 and September 1995. The outbreak started in the intensive care unit (ICU) of a major acute hospital and spread through surgical

R. P. Hobson; F. M. MacKenzie; I. M. Gould

1996-01-01

298

Emergence of KPC-Possessing Klebsiella pneumoniae in Brooklyn, New York: Epidemiology and Recommendations for Detection  

Microsoft Academic Search

Among 257 isolates of Klebsiella pneumoniae collected in Brooklyn, NY, 24% were found to possess blaKPC. Clinical microbiology laboratories that used automated broth microdilution systems reported 15% of the KPC-possessing isolates as susceptible to imipenem. The imipenem MIC was found to be markedly affected by the inoculum. For accurate detection of KPC-possessing K. pneumoniae, particular attention should be paid to

Simona Bratu; Mohamad Mooty; Satyen Nichani; David Landman; Carl Gullans; Barbara Pettinato; Usha Karumudi; Pooja Tolaney; John Quale

2005-01-01

299

Decolorization and biodegradation of methyl red by Klebsiella pneumoniae RS13  

Microsoft Academic Search

Bacterial strains isolated from dye-contaminated sludge decolorized a toxic azo dye, namely, methyl red (MR). Klebsiella pneumoniae RS-13 was selected because of its better abilities to completely decolorize and degrade MR under aerobic conditions. Effects of physico-chemical parameters, such as: temperature and aeration, concentrations of glucose, ethanol, ammonium sulfate and pH of the culture medium on the MR degradation by

P. K. Wong; P. Y. Yuen

1996-01-01

300

Two Cases of Pyomyositis Caused by Klebsiella pneumoniae and Review of the Literature  

Microsoft Academic Search

.    Two patients with diabetes mellitus developed Klebsiella pneumoniae pyomyositis involving multiple muscles and other metastatic foci associated with bacteraemia. The cases are presented here,\\u000a and the 22 cases of gram-negative pyomyositis reported previously in the literature are reviewed. As gram-positive cocci cause\\u000a 99% of pyomyositis, it is postulated that the pathogenesis of pyomyositis may be associated with the

T. K. F. Wang; S. S. Y. Wong; P. C. Y. Woo

2001-01-01

301

New Method for Laboratory Detection of AmpC  -Lactamases in Escherichia coli and Klebsiella pneumoniae  

Microsoft Academic Search

A new cefoxitin-agar medium (CAM)-based assay was compared to the previously published modified three-dimensional (M3D) assay for the detection of AmpC production in Escherichia coli and Klebsiella pneumoniae. Clinical isolates of cefoxitin-resistant E. coli (n 5) and K. pneumoniae (n 7) and multiple control strains with and without AmpC enzymes were tested by both methods. The CAM method with 4

K. Nasim; S. Elsayed; J. D. D. Pitout; J. Conly; D. L. Church; D. B. Gregson

2004-01-01

302

Isolation of fluoroquinolone-resistant Escherichia coli and Klebsiella pneumoniae from an infected hickman catheter  

Microsoft Academic Search

Escherichia coli andKlebsiella pneumoniae resistant to fluoroquinolones were isolated from an infected Hickman catheter in a 43-year-old diabetic patient who had previously been treated with a 24-day course of ciprofloxacin (200 mg\\/12 h i.v.). MICs and MBCs of nalidixic acid, norfloxacin, ciprofloxacin, ofloxacin, pefloxacin and fleroxacin were determined for the strains using the methodology recommended by the NCCLS. Both strains

M. López-Brea; T. Alarcón

1990-01-01

303

Activity of Imipenem against Klebsiella pneumoniae Biofilms In Vitro and In Vivo  

PubMed Central

Encapsulated Klebsiella pneumoniae has emerged as one of the most clinically relevant and more frequently encountered opportunistic pathogens in combat wounds as the result of nosocomial infection. In this report, we show that imipenem displayed potent activity against established K. pneumoniae biofilms under both static and flow conditions in vitro. Using a rabbit ear model, we also demonstrated that imipenem was highly effective against preformed K. pneumoniae biofilms in wounds. PMID:24247132

Chen, Ping; Seth, Akhil K.; Abercrombie, Johnathan J.; Mustoe, Thomas A.

2014-01-01

304

Inhibitors of Antibiotic Efflux in Resistant Enterobacter aerogenes and Klebsiella pneumoniae Strains  

PubMed Central

In Enterobacter aerogenes and Klebsiella pneumoniae, efflux provides efficient extrusion of antibiotics and contributes to the multidrug resistance phenotype. One of the alkoxyquinoline derivatives studied here, 2,8-dimethyl-4-(2?-pyrrolidinoethyl)-oxyquinoline, restores noticeable drug susceptibility to resistant clinical strains. Analyses of energy-dependent chloramphenicol efflux indicate that this compound inhibits the efflux pump mechanism and improves the activity of structurally unrelated antibiotics on multidrug-resistant E. aerogenes and K. pneumoniae isolates. PMID:14982806

Chevalier, Jacqueline; Bredin, Jérôme; Mahamoud, Abdallah; Malléa, Monique; Barbe, Jacques; Pagès, Jean-Marie

2004-01-01

305

Extended-spectrum ?-lactamase types in Klebsiella pneumoniae and Escherichia coli in two Greek hospitals  

Microsoft Academic Search

Seventy-nine Klebsiella pneumoniae and 124 Escherichia coli clinical strains, isolated consecutively during August–October 2001 in two Greek hospitals, were examined for production of extended-spectrum ?-lactamases (ESBLs). Seventy-one (35%) isolates (46 K. pneumoniae and 25 E. coli) were ESBL-positive by phenotypic methods. Isoelectric focusing of ?-lactamases and PCR assays for bla genes showed that SHV-5-type ESBLs were the most frequent (45

E Tzelepi; Ch Magana; E Platsouka; D Sofianou; O Paniara; N. J Legakis; A. C Vatopoulos; L. S Tzouvelekis

2003-01-01

306

Sporadic Emergence of Klebsiella pneumoniae Strains Resistant to Cefepime and Cefpirome in Greek Hospitals  

Microsoft Academic Search

Cephalosporin-resistant Klebsiella pneumoniae strains pro- ducing extended-spectrum b-lactamases (ESBLs) of the TEM and SHV types have been implicated in nosocomial infections (1, 3, 5, 8, 17). ESBLs are active against most expanded-spec- trum cephalosporins, such as ceftazidime (CAZ) and cefo- taxime (CTX), but they are unable to hydrolyze cefoxitin (FOX) (7). The SHV-5 b-lactamase is one of the most preva-

L. S. TZOUVELEKIS; E. TZELEPI; E. PRINARAKIS; M. GAZOULI; A. KATRAHOURA

307

Increasing resistance rate to carbapenem among blood culture isolates of Klebsiella pneumoniae, Acinetobacter baumannii and Pseudomonas aeruginosa in a university-affiliated hospital in China, 2004-2011.  

PubMed

The objective of this study is to investigate the profile of antimicrobial resistance of Gram-negative bacteria in blood cultures from 2004-2011. Pathogens from positive blood cultures were subcultured, and identified in the First Affiliated Hospital of Nanjing Medical University from January 2004 to December 2011. The antibiotic resistance pattern was analyzed by WHONET 5.4. A total of 1224 cases of Gram-negative bacterial isolates were documented, accounting for 38.6% of the total pathogens isolated from positive blood cultures in the 8-year period. The isolation rates of Klebsiella pneumoniae and Acinetobacter baumannii increased nearly three times over the same time span. Most Gram-negative bacteria isolates, except the isolates of Pseudomonas aeruginosa, showed a significantly increased resistance rate to cephalosporins (in particular third/fourth generation cephalosporins). Noteworthy, the antimicrobial resistance of K. pneumoniae, A. baumannii and P. aeruginosa isolates to carbapenem (imipenem and meropenem) was significantly increased and the resistant rate to carbapenem was >80.0% in A. baumannii in 2011. The results from PCR detection for carbapenemases were as follows: 82.8% (24/29) isolates of K. pneumoniae carried the kpc-2 gene; only three metallo-beta-lactamase-positive P. aeruginosa isolates were detected; and 93.1% (67/72) A. baumannii isolates were blaOXA-23 positive. The antimicrobial resistance rate of Gram-negative bacteria isolated from blood cultures significantly increased from 2004 to 2011, with significant resistance to the third/fourth generation cephalosporins and carbapenem. PMID:25182483

Zhang, Xiaoli; Gu, Bing; Mei, Yaning; Wen, Yi; Xia, Wenying

2015-02-01

308

Complete Genome Sequence of the N2-Fixing Broad Host Range Endophyte Klebsiella pneumoniae 342 and Virulence Predictions Verified in Mice  

PubMed Central

We report here the sequencing and analysis of the genome of the nitrogen-fixing endophyte, Klebsiella pneumoniae 342. Although K. pneumoniae 342 is a member of the enteric bacteria, it serves as a model for studies of endophytic, plant-bacterial associations due to its efficient colonization of plant tissues (including maize and wheat, two of the most important crops in the world), while maintaining a mutualistic relationship that encompasses supplying organic nitrogen to the host plant. Genomic analysis examined K. pneumoniae 342 for the presence of previously identified genes from other bacteria involved in colonization of, or growth in, plants. From this set, approximately one-third were identified in K. pneumoniae 342, suggesting additional factors most likely contribute to its endophytic lifestyle. Comparative genome analyses were used to provide new insights into this question. Results included the identification of metabolic pathways and other features devoted to processing plant-derived cellulosic and aromatic compounds, and a robust complement of transport genes (15.4%), one of the highest percentages in bacterial genomes sequenced. Although virulence and antibiotic resistance genes were predicted, experiments conducted using mouse models showed pathogenicity to be attenuated in this strain. Comparative genomic analyses with the presumed human pathogen K. pneumoniae MGH78578 revealed that MGH78578 apparently cannot fix nitrogen, and the distribution of genes essential to surface attachment, secretion, transport, and regulation and signaling varied between each genome, which may indicate critical divergences between the strains that influence their preferred host ranges and lifestyles (endophytic plant associations for K. pneumoniae 342 and presumably human pathogenesis for MGH78578). Little genome information is available concerning endophytic bacteria. The K. pneumoniae 342 genome will drive new research into this less-understood, but important category of bacterial-plant host relationships, which could ultimately enhance growth and nutrition of important agricultural crops and development of plant-derived products and biofuels. PMID:18654632

Fouts, Derrick E.; Tyler, Heather L.; DeBoy, Robert T.; Daugherty, Sean; Ren, Qinghu; Badger, Jonathan H.; Durkin, Anthony S.; Huot, Heather; Shrivastava, Susmita; Kothari, Sagar; Dodson, Robert J.; Mohamoud, Yasmin; Khouri, Hoda; Roesch, Luiz F. W.; Krogfelt, Karen A.; Struve, Carsten; Triplett, Eric W.; Methé, Barbara A.

2008-01-01

309

Identification and Differentiation of Carbapenemases in Klebsiella Pneumoniae: A Phenotypic Test Evaluation Study from Jaipur, India  

PubMed Central

Background: Carbapenem resistance is one of the major threats faced in antimicrobial treatment of infections caused by gram negative organisms. In recent years, carbapenem resistance has emerged in Klebsiella pneumoniae isolates due to acquisition of carbapenemases which belong to Ambler class A KPC type enzymes or to Ambler class B metallo-?-lactamases (MBL). Routine lab detection of carbapenemase producing K. pneumoniae isolates is crucial, both for a therapeutic management and an efficient infection control. Materials and Methods: A study was conducted on 60 carbapenem resistant Klebsiella pneumoniae strains which were isolated from various clinical samples over a period of one year (September 2010-August 2011), at a tertiary care hospital in Jaipur. Phenotypic confirmatory test was done by using discs of Meropenem alone and those with phenyl boronic acid (PBA) or Ethylenediaminetetraacetic acid (EDTA) or both, for detection of carbapenemase production and differentiation of KPC and MBL enzymes. Results: Of the 60 carbapenem resistant Klebsiella pneumoniae isolates, 53 (88.33%) were found to be MBL producers, 4(6.66%) were found to be MBL and KPC co-producers and the rest of the 3(5%) isolates were negative for both MBL and KPC production, as was seen by combined disc testing. Conclusion: The combined disc test is a simple test which can be used for differentiation of carbapenemases and it can be easily incorporated in routine microbiology lab testing. PMID:25177562

2014-01-01

310

Antibacterial effects of Apis mellifera and stingless bees honeys on susceptible and resistant strains of Escherichia coli, Staphylococcus aureus and Klebsiella pneumoniae in Gondar, Northwest Ethiopia  

PubMed Central

Background Honey is a natural substance produced by honeybees and has nutritional and therapeutic uses. In Ethiopia, honeys are used traditionally to treat wounds, respiratory infections and diarrhoea. Recent increase of drug resistant bacteria against the existing antibiotics forced investigators to search for alternative natural remedies and evaluate their potential use on scientific bases. Thus, the aim of this study was to evaluate the antibacterial effects of different types of honeys in Ethiopia which are used traditionally to treat different types of respiratory and gastrointestinal infections. Methods Mueller Hinton agar (70191) diffusion and nutrient broth culture medium assays were performed to determine susceptibility of Staphylococcus aureus (ATCC 25923), Escherichia coli (ATCC 25922) and resistant clinical isolates (Methicillin resistant Staphylococcus aureus(MRSA), Escherichia coli(R) and Klebsiella pneumoniae (R), using honeys of Apis mellifera and stingless bees in northern and north western Ethiopia. Results Honey of the stingless bees produced the highest mean inhibition (22.27?±?3.79 mm) compared to white honey (21.0?±?2.7 mm) and yellow honey (18.0?±?2.3 mm) at 50% (v/v) concentration on all the standard and resistant strains. Stingless bees honey was found to have Minimum Inhibitory Concentration (MIC) of 6.25% (6.25 mg/ml) for 80% of the test organisms compared to 40% for white and yellow Apis mellifera honeys. All the honeys were found to have minimum bactericidal concentration (MBC) of 12.5% (12.5 mg/ml) against all the test organisms. Staphylococcus aureus (ATCC 25923) was susceptible to amoxicillin, methicillin, kanamycine, tetracycline, and vancomycine standard antibiotic discs used for susceptibility tests. Similarly, Escherichia coli (ATCC 25922) was found susceptible for kanamycine, tetracycline and vancomycine. Escherichia coli (ATCC 25922) has not been tested for amoxicillin ampicillin and methicillin. The susceptibility tests performed against Staphylococcus aureus (MRSA), Escherichia coli (R) and Klebsiella pneumoniae (R) using three of methicillin, erythromycin, ampicillin, Penicillin and amoxicillin discs were resistant. But, these drug resistant strains were susceptible to antibacterial agents found in the honeys and inhibited from 16 mm to 20.33 mm. Conclusions Honeys in Ethiopia can be used as therapeutic agents for drug resistant bacteria after pharmaceutical standardization and clinical trials. PMID:24138782

2013-01-01

311

Quantifying the clinical virulence of Klebsiella pneumoniae producing carbapenemase Klebsiella pneumoniae with a Galleria mellonella model and a pilot study to translate to patient outcomes  

PubMed Central

Background Previous studies may have overestimated morbidity and mortality due to Klebsiella pneumoniae producing carbapenemase (KPC) Klebsiella pneumoniae infections because of difficulties in modeling patient comorbidities. This pilot study sought to evaluate KPC virulence by combining clinical and Galleria mellonella models in patients with K. pneumoniae blood stream infections (BSIs). Methods G. mellonella were inoculated using KPC(+) and KPC(?) isolates from these patients. Extent and rapidity of insect mortality was analyzed. Patients were stratified by KPC BSI status. Clinical outcomes of mortality and length of stay post-infection for survivors (LOS) were analyzed. Median virulence scores calculated from the insect studies were imputed in the clinical model. Results The in-vivo model revealed greater mortality in KPC(?) isolates (p?

2014-01-01

312

Some Bacteria Are Beneficial!  

USGS Publications Warehouse

Most people would agree that bacteria usually spell trouble where the quality of drinking water is con cerned. However, recent studies conducted by the U.S. Geological Survey (USGS) under the National Water-Quality Assessment (NAWQA) program have shown that some bacteria can improve the quality of water.

McMahon, Peter B.

1995-01-01

313

Bacteria turn tiny gears  

SciTech Connect

Swarms of bacteria turn two 380-micron long gears, opening the possibility of building hybrid biological machines at the microscopic scale. Read more at Wired: http://www.wired.com/wiredscience/2009/12/bacterial-micro-machine/#more-15684 or Scientific American: http://www.scientificamerican.com/article.cfm?id=brownian-motion-bacteria

None

2009-01-01

314

Penetration of bacteria into meat.  

PubMed Central

Bacteria are confined to the surface of meat during the logarithmic phase of growth. When proteolytic bacteria approach their maximum cell density, extracellular proteases secreted by the bacteria apparently break down the connective tissue between muscle fibers, allowing the bacteria to penetrate the meat. Non-proteolytic bacteria do not penetrate meat, even when grown in association with proteolytic species. Images PMID:406846

Gill, C O; Penney, N

1977-01-01

315

Carbapenemase-producing Gram-negative bacteria: current epidemics, antimicrobial susceptibility and treatment options.  

PubMed

ABSTRACT? Carbapenemases, with versatile hydrolytic capacity against ?-lactams, are now an important cause of resistance of Gram-negative bacteria. The genes encoding for the acquired carbapenemases are associated with a high potential for dissemination. In addition, infections due to Gram-negative bacteria with acquired carbapenemase production would lead to high clinical mortality rates. Of the acquired carbapenemases, Klebsiella pneumoniae carbapenemase (Ambler class A), Verona integron-encoded metallo-?-lactamase (Ambler class B), New Delhi metallo-?-lactamase (Ambler class B) and many OXA enzymes (OXA-23-like, OXA-24-like, OXA-48-like, OXA-58-like, class D) are considered to be responsible for the worldwide resistance epidemics. As compared with monotherapy with colistin or tigecycline, combination therapy has been shown to effectively lower case-fatality rates. However, development of new antibiotics is crucial in the present pandrug-resistant era. PMID:25812463

Jean, Shio-Shin; Lee, Wen-Sen; Lam, Carlos; Hsu, Chin-Wang; Chen, Ray-Jade; Hsueh, Po-Ren

2015-03-01

316

Multidrug-resistant Gram-negative bacteria: a product of globalization.  

PubMed

Global trade and mobility of people has increased rapidly over the last 20 years. This has had profound consequences for the evolution and the movement of antibiotic resistance genes. There is increasing exposure of populations all around the world to resistant bacteria arising in the emerging economies. Arguably the most important development of the last two decades in the field of antibiotic resistance is the emergence and spread of extended-spectrum ?-lactamases (ESBLs) of the CTX-M group. A consequence of the very high rates of ESBL production among Enterobacteriaceae in Asian countries is that there is a substantial use of carbapenem antibiotics, resulting in the emergence of plasmid-mediated resistance to carbapenems. This article reviews the emergence and spread of multidrug-resistant Gram-negative bacteria, focuses on three particular carbapenemases ? imipenem carbapenemases, Klebsiella pneumoniae carbapenemase, and New Delhi metallo-?-lactamase ? and highlights the importance of control of antibiotic use. PMID:25737092

Hawkey, P M

2015-04-01

317

Recombinational DNA Repair in Bacteria  

E-print Network

Recombinational DNA Repair in Bacteria: Postreplication Kevin P Rice,University of Wisconsin Recombinational DNA repair represents the primary function for homologous DNA recombination in bacteria. Most of genetic diversity, primarily during conjugation, homologous DNA recombination in bacteria is now

Cox, Michael M.

318

Inactivation of biofilm bacteria.  

PubMed Central

The current project was developed to examine inactivation of biofilm bacteria and to characterize the interaction of biocides with pipe surfaces. Unattached bacteria were quite susceptible to the variety of disinfectants tested. Viable bacterial counts were reduced 99% by exposure to 0.08 mg of hypochlorous acid (pH 7.0) per liter (1 to 2 degrees C) for 1 min. For monochloramine, 94 mg/liter was required to kill 99% of the bacteria within 1 min. These results were consistent with those found by other investigators. Biofilm bacteria grown on the surfaces of granular activated carbon particles, metal coupons, or glass microscope slides were 150 to more than 3,000 times more resistant to hypochlorous acid (free chlorine, pH 7.0) than were unattached cells. In contrast, resistance of biofilm bacteria to monochloramine disinfection ranged from 2- to 100-fold more than that of unattached cells. The results suggested that, relative to inactivation of unattached bacteria, monochloramine was better able to penetrate and kill biofilm bacteria than free chlorine. For free chlorine, the data indicated that transport of the disinfectant into the biofilm was a major rate-limiting factor. Because of this phenomenon, increasing the level of free chlorine did not increase disinfection efficiency. Experiments where equal weights of disinfectants were used suggested that the greater penetrating power of monochloramine compensated for its limited disinfection activity. These studies showed that monochloramine was as effective as free chlorine for inactivation of biofilm bacteria. The research provides important insights into strategies for control of biofilm bacteria. Images PMID:2849380

LeChevallier, M W; Cawthon, C D; Lee, R G

1988-01-01

319

Plasmid Mediated Antibiotic Resistance in Isolated Bacteria From Burned Patients  

PubMed Central

Background: Nowadays, the treatment of burned patients is difficult because of the high frequency of infection with antibiotic resistance bacteria. Objectives: This study was conducted to evaluate the level of antibiotic resistance in Gram-negative bacteria and its relation with the existence of plasmid. Materials and Methods: The samples were collected from two hundred twenty hospitalized burned patients in Isfahan burn hospital during a three-month period (March 2012 to June 2012). The samples were isolated and the Gram-negative bacteria were identified using phenotypic method and API 20E System. Antibiotic susceptibility and plasmid profile were determined by standard Agar disc diffusion and plasmid spin column extraction methods. Results: Totally 117 Gram-negative bacteria were isolated, the most common were Pseudomonas aerugionsa (37.6%), P. fluorescens (25.6%), Acinetobacter baumanii (20/5%) and Klebsiella pneumoniae (7.6%), respectively. The isolates showed high frequency of antibiotic resistance against ceftazidime and co-amoxiclave (100%) and low frequency of antibiotic resistance against amikacin with (70%).The results indicated that 60% of the isolates harboured plasmid. On the other hand, the patients infected with A. baumanii and P. aeruginosa were cured (with 60% frequency) whereas, those infected with P. fluorescens were not cured. Hence, probably antibiotic resistance markers of A. baumanii and P. aeruginosa are plasmid mediated; however, P. fluorescens is chromosomally mediated. Conclusions: Based on our findings, P. aerugionsa is a major causative agent of wound infections and amikacin could be considered as a more effective antibiotic for treatment of the burned patients. PMID:25789121

Beige, Fahimeh; Baseri Salehi, Majid; Bahador, Nima; Mobasherzadeh, Sina

2014-01-01

320

Enterotoxigenic Bacteria in Food and Water from an Ethiopian Community  

PubMed Central

Food and water samples from an Ethiopian community were screened for the presence of enterotoxin-producing bacteria. Using the Chinese hamster ovary cell assay, 40 of 213 isolates (18.8%) produced heat-labile (LT) enterotoxin. These LT-producing isolates comprised 33 of 177 (18.6%) strains from 24 of 68 food samples (35.3%) and 7 of 36 (19.4%) isolates of 4 of 17 water samples (23.5%). One LT-producing strain each of Salmonella emek and of Shigella dysenteriae was found. Three pseudomonads, all LT producers, produced heat-stable enterotoxin as gauged by the suckling mouse test. Two strains of LT-enterotoxigenic Escherichia coli O68 were found in water samples. No enterotoxigenic E. coli were isolated from food samples, but 13 of the LT-producing strains were Enterobacter, Klebsiella, Serratia, and Proteus species, and 7 food samples yielded more than one species of enterotoxigenic bacterium. Of the enterotoxigenic isolates from food, 15 were oxidase-positive strains of the genera Aeromonas, Pseudomonas, Achromobacter, Flavobacterium, and Vibrio. LT-enterotoxigenic Enterobacter, Acinetobacter, Klebsiella, Proteus, Providencia, and Serratia species represented 20 of the food and water isolates. Culture supernatant fluids of representative strains of oxidase-positive and oxidase-negative species giving positive reactions in Chinese hamster ovary cell tests induced fluid accumulation in rabbit ileal loops. Eight of the food samples and two of the water samples contained more than one isolate or species of enterotoxigenic bacterium. The stability of the LT production by oxidase-positive bacteria and non-E. coli strains was assessed by the rabbit skin and adrenal cell tests after 9 months and 1 year of storage, respectively, in Trypticase soy broth with glycerol at ?70°C. Only 33% of the oxidase-positive strains were still LT enterotoxigenic. Of the oxidase-negative strains, 50 and 33% were LT producing at 9 months and 1 year, respectively. None of the E. coli isolates, both enterotoxigenic and nonenterotoxigenic, possessed K88, K99, or colonization factor antigen. The survey demonstrates the presence in food and water of enterotoxigenic bacteria of the same species as those isolated from cases of infantile diarrhea in the same community, although a correlation between these sources and infantile diarrhea remains to be established. Images PMID:7016032

Jiwa, Sadruddin F. H.; Krovacek, Karel; Wadström, Torkel

1981-01-01

321

Specificity of the protein secretory apparatus: secretion of the heat-labile enterotoxin B subunit pentamers by different species of gram- bacteria.  

PubMed

The B-subunit pentamer(s) (EtxBp) of Escherichia coli heat-labile enterotoxin (LT) are secreted from Vibrio cholerae via the general secretion pathway (GSP), but remain periplasmic in E. coli. In order to determine if other Gram- bacteria were also able to secrete the ExtBp, the etxB gene, which encodes EtxB was introduced into different bacteria. Of the bacteria examined, most species of Vibrio and Aeromonas were able to secrete this protein through the outer membrane; other Gram- genera, including Erwinia, Klebsiella and Xanthomonas were not, even though they encode GSP genes homologous to those of V. cholerae. Thus, the ability to recognize the EtxBp as a secretable protein is confined to bacteria that were identified as being closely related to V. cholerae by examination of their 5S rRNA [MacDonell and Colwell, Syst. Appl. Microbiol. 6 (1985) 171-182]. PMID:7828926

Michel, L O; Sandkvist, M; Bagdasarian, M

1995-01-11

322

Surveillance programme for multidrug-resistant bacteria in healthcare-associated infections: an urban perspective in South Brazil.  

PubMed

Multidrug-resistant bacteria (MDRB) have emerged as a public health problem and the World Health Organization recommends actions to control MDRB in healthcare-associated infections (HCAIs). This study describes a surveillance programme for MDRB in HCAIs at Curitiba, Brazil. MDRB in pneumonia, bloodstream, urinary tract and surgical site infections has been surveyed since January 2010. Carbapenem-resistant Acinetobacter baumannii and third generation resistant Klebsiella pneumoniae were the most frequent MDRB in HCAIs. Infection control strategies enrolling hospitals and public health have been developed. The data presented describe MDRB prevalence and the feasibility of this municipal MDRB surveillance programme in Brazil. PMID:22382275

Toledo, P V M; Arend, L N; Pilonetto, M; Costa Oliveira, J C; Luhm, K R

2012-04-01

323

Prevention of Biofilm Colonization by Gram-Negative Bacteria on Minocycline-Rifampin-Impregnated Catheters Sequentially Coated with Chlorhexidine  

PubMed Central

Resistant Gram-negative bacteria are increasing central-line-associated bloodstream infection threats. To better combat this, chlorhexidine (CHX) was added to minocycline-rifampin (M/R) catheters. The in vitro antimicrobial activity of CHX-M/R catheters against multidrug resistant, Gram-negative Acinetobacter baumannii, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia was tested. M/R and CHX-silver sulfadiazine (CHX/SS) catheters were used as comparators. The novel CHX-M/R catheters were significantly more effective (P < 0.0001) than CHX/SS or M/R catheters in preventing biofilm colonization and showed better antimicrobial durability. PMID:24165191

Jamal, Mohamed A.; Rosenblatt, Joel S.; Hachem, Ray Y.; Ying, Jiang; Pravinkumar, Egbert; Nates, Joseph L.; Chaftari, Anne-Marie P.

2014-01-01

324

Prevention of biofilm colonization by Gram-negative bacteria on minocycline-rifampin-impregnated catheters sequentially coated with chlorhexidine.  

PubMed

Resistant Gram-negative bacteria are increasing central-line-associated bloodstream infection threats. To better combat this, chlorhexidine (CHX) was added to minocycline-rifampin (M/R) catheters. The in vitro antimicrobial activity of CHX-M/R catheters against multidrug resistant, Gram-negative Acinetobacter baumannii, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia was tested. M/R and CHX-silver sulfadiazine (CHX/SS) catheters were used as comparators. The novel CHX-M/R catheters were significantly more effective (P < 0.0001) than CHX/SS or M/R catheters in preventing biofilm colonization and showed better antimicrobial durability. PMID:24165191

Jamal, Mohamed A; Rosenblatt, Joel S; Hachem, Ray Y; Ying, Jiang; Pravinkumar, Egbert; Nates, Joseph L; Chaftari, Anne-Marie P; Raad, Issam I

2014-01-01

325

Occurrence of carbapenemase-producing bacteria in coastal recreational waters.  

PubMed

The spread of carbapenemase-producing Gram-negative rods is an emerging global problem. Although most infections due to carbapenemase producers are limited to healthcare institutions, reports of the occurrence of clinically relevant carbapenemase producers in sewage and polluted rivers are increasingly frequent. Polluted rivers flowing to oceans may contaminate coastal waters with multidrug-resistant bacteria, potentially threatening the safety of recreational activities in these locations. Here we assessed the occurrence of carbapenemase producers in water from touristic beaches located in Rio de Janeiro, Brazil, showing distinct pollution patterns. The presence of enterobacteria was noted, including the predominantly environmental genus Kluyvera spp., producing either Klebsiella pneumoniae carbapenemase (KPC) or Guyana extended-spectrum (GES)-type carbapenemases and often associated with quinolone resistance determinants. An Aeromonas sp. harbouring blaKPC and qnrS was also observed. These findings strengthen the role of aquatic matrices as reservoirs and vectors of clinically relevant antimicrobial-resistant bacteria, with potential to favour the spread of these resistance threats throughout the community. PMID:25499185

Montezzi, Lara Feital; Campana, Eloiza Helena; Corrêa, Laís Lisboa; Justo, Livia Helena; Paschoal, Raphael Paiva; da Silva, Isabel Lemos Vieira Dias; Souza, Maria do Carmo Maciel; Drolshagen, Marcia; Picão, Renata Cristina

2015-02-01

326

Cellulolytic activity and structure of symbiotic bacteria in locust guts.  

PubMed

Locusts are able to digest the cellulose of Gramineae plants, resulting in their being considered as major crop pests. To illustrate the mechanism involved in cellulose digestion, the cellulolytic activity and zymography in the gut contents of 16 locust species were determined using carboxymethyl cellulose (CMC) as substrate. The diversity of gut symbiotic bacteria was studied using denaturing gradient gel electrophoresis (DGGE). The results showed that high CMC activity was present in Acrididae gut fluid (mean 356.4 U/g proteins). Of the 5 locust species, Oxya chinensis had the highest diversity of intestinal symbiotic bacteria, characterized by the DGGE profile containing more than 20 bands of 16S rRNA. Klebsiella pneumoniae, in the gut of Locusta migratoria manilensis, was identified as the most abundant symbiotic bacterium by DNA sequencing, with a relative abundance of 19.74%. In comparison, Methylobacterium sp was the most dominant species in the Atractomorpha sinensis gut, with a relative abundance of 29.04%. The results indicated that the cellulolytic enzymes and gut microbial communities probably reflected their phylogenetic relationship with different locust species and associated feeding strategies. PMID:25299108

Su, L-J; Liu, H; Li, Y; Zhang, H-F; Chen, M; Gao, X-H; Wang, F-Q; Song, A-D

2014-01-01

327

Phytochemistry and Preliminary Assessment of the Antibacterial Activity of Chloroform Extract of Amburana cearensis (Allemão) A.C. Sm. against Klebsiella pneumoniae Carbapenemase-Producing Strains  

PubMed Central

The chloroform extract of the stem bark of Amburana cearensis was chemically characterized and tested for antibacterial activity.The extract was analyzed by gas chromatography and mass spectrometry. The main compounds identified were 4-methoxy-3-methylphenol (76.7%), triciclene (3.9%), ?-pinene (1.0%), ?-pinene (2.2%), and 4-hydroxybenzoic acid (3.1%). Preliminary antibacterial tests were carried out against species of distinct morphophysiological characteristics: Escherichia coli, Salmonella enterica Serotype Typhimurium, Pseudomonas aeruginosa, Staphylococcus aureus, Listeria monocytogenes, and Bacillus cereus. The minimum inhibitory concentration (MIC) was determinate in 96-well microplates for the chloroform extract and an analogue of themain compound identified, which was purchased commercially.We have shown that plant's extract was only inhibitory (but not bactericidal) at the maximum concentration of 6900??g/mL against Pseudomonas aeruginosa and Bacillus cereus. Conversely, the analogue 2-methoxy-4-methylphenol produced MICs ranging from215 to 431??g/mL against all bacterial species.New antibacterial assays conducted with such chemical compound against Klebsiella pneumoniae carbapenemase-producing strains have shown similarMICresults and minimumbactericidal concentration (MBC) of 431??g/mL.We conclude that A. cearensis is a good source of methoxy-methylphenol compounds,which could be screened for antibacterial activity againstmultiresistant bacteria fromdifferent species PMID:24772183

Sá, Mirivaldo Barros; Ralph, Maria Taciana; Nascimento, Danielle Cristina Oliveira; Ramos, Clécio Souza; Barbosa, Isvânia Maria Serafin; Sá, Fabrício Bezerra; Lima-Filho, J. V.

2014-01-01

328

Oral DAV131, a Charcoal-Based Adsorbent, Inhibits Intestinal Colonization by ?-Lactam-Resistant Klebsiella pneumoniae in Cefotaxime-Treated Mice  

PubMed Central

Antibiotics excreted into the intestinal tract, such as broad-spectrum cephalosporins, disrupt the indigenous microflora, affect colonization resistance (CR), and promote intestinal colonization by resistant bacteria. We tested whether oral DAV131, a charcoal-based adsorbent, would prevent colonization by a cefotaxime (CTX)-resistant Klebsiella pneumoniae strain (PUG-2) in CTX-treated mice. Mice received CTX, saline, CTX and DAV131, or saline and DAV131 for 3 days before oral challenge with 106 CFU of PUG-2. The fecal CTX concentrations and counts of PUG-2 were assayed. Fecal CTX disappeared when DAV131 was given concomitantly with CTX (P < 0.05), and the area under the curve of PUG-2 fecal density was significantly reduced (P < 0.01). In conclusion, reducing intestinal antibiotic exposure with DAV131 may reduce colonization by resistant strains during treatment compared to treatment with CTX only. This might open new possibilities for decreasing the impact of antibiotics on the intestinal microbiota during treatments. PMID:23959311

Massias, Laurent; Nguyen, Thu Thuy; Sayah-Jeanne, Sakina; Ducrot, Nicolas; Chachaty, Elisabeth; de Gunzburg, Jean; Andremont, Antoine

2013-01-01

329

Piscidin is Highly Active against Carbapenem-Resistant Acinetobacter baumannii and NDM-1-Producing Klebsiella pneumonia in a Systemic Septicaemia Infection Mouse Model.  

PubMed

This study was designed to investigate the antimicrobial activity of two synthetic antimicrobial peptides from an aquatic organism, tilapia piscidin 3 (TP3) and tilapia piscidin 4 (TP4), in vitro and in a murine sepsis model, as compared with ampicillin, tigecycline, and imipenem. Mice were infected with (NDM-1)-producing K. pneumonia and multi-drug resistant Acinetobacter baumannii, and subsequently treated with TP3, TP4, or antibiotics for different periods of time (up to 168 h). Mouse survival and bacterial colony forming units (CFU) in various organs were measured after each treatment. Toxicity was determined based on observation of behavior and measurement of biochemical parameters. TP3 and TP4 exhibited strong activity against K. pneumonia and A. baumannii in vitro. Administration of TP3 (150 ?g/mouse) or TP4 (50 ?g/mouse) 30 min after infection with K. pneumonia or A. baumannii significantly increased survival in mice. TP4 was more effective than tigecycline at reducing CFU counts in several organs. TP3 and TP4 were shown to be non-toxic, and did not affect mouse behavior. TP3 and TP4 are able at potentiate anti-Acinetobacter baumannii or anti-Klebsiella pneumonia drug activity, reduce bacterial load, and prevent drug resistance, indicating their potential for use in combating multidrug-resistant bacteria. PMID:25874924

Pan, Chieh-Yu; Chen, Jian-Chyi; Chen, Te-Li; Wu, Jen-Leih; Hui, Cho-Fat; Chen, Jyh-Yih

2015-01-01

330

Production of a novel bioflocculant MNXY1 by Klebsiella pneumoniae strain NY1 and application in precipitation of cyanobacteria and municipal wastewater treatment  

PubMed Central

Aims To isolate and characterize the novel bioflocculant-producing bacteria, to optimize the bioflocculant production and evaluate its potential applications. Methods and Results Klebsiella pneumoniae strain NY1, a bacterium that produces a novel bioflocculant (MNXY1), was selected on the chemically defined media. It was classified according to the 16S rRNA gene sequence, morphological and microscopic characteristics. MNXY1 was characterized to contain 26% protein and 66% total sugar. The constituent sugar monomers of MNXY1, revealed by NMR analysis, are glucose, galactose and quinovose. Favorable culture conditions for MNXY1 production were determined. Strain NY1 produces a high level (14.9 g l?1) of MNXY1. MNXY1 is thermostable and tolerant to the extreme pH. It precipitated 54% of cyanobacteria from laboratory culture and 72% of the total suspended solids from raw wastewater. Conclusions Strain NY1 was identified to produce a novel bioflocculant MNXY1. The outstanding performance of MNXY1 in practical applications and its availability in copious amounts make it attractive for further investigation and development for industrial scale applications. PMID:21679283

Nie, M.; Yin, X.; Jia, J.; Wang, Y.; Liu, S.; Shen, Q.; Li, P.; Wang, Z.

2015-01-01

331

Rapid discrimination of Klebsiella pneumoniae carbapenemase 2-producing and non-producing Klebsiella pneumoniae strains using near-infrared spectroscopy (NIRS) and multivariate analysis.  

PubMed

Klebsiella pneumoniae Carbapenemase (KPC-2)-producing and non-producing Klebsiella pneumoniae (KP) have rapidly disseminated worldwide, challenging the diagnostics of Gram-negative infections. We evaluate the potential of a novel non-destructive and rapid method based on Near-Infrared Spectroscopic (NIRS) and multivariate analysis for distinguishing KPC-2-producing and non-producing KP. Thirty-nine NIRS spectra (24 KPC-2-producing KP, 15 KPC-2 non-producing KP) were acquired; different pre-processing methods such as baseline correction, derivative and Savitzky-Golay smoothing were performed. A spectral region fingerprint was achieved after using genetic algorithm-linear discriminant analysis (GA-LDA) and successive projection algorithm (SPA-LDA) algorithms for variable selection. The variables selected were then used for discriminating the microorganisms.Accuracy test results including sensitivity and specificity were determined. Sensitivity in KPC-2 producing and non-producing KP categories was 66.7% and 75%, respectively, using a SPA-LDA model with 66 wavenumbers. The resulting GA-LDA model successfully classified both microorganisms with respect to their "fingerprints" using only 39 wavelengths. Sensitivity in KPC-2 producing category was moderate(?66.7%) using a GA-LDA model. However, sensitivity in KPC-2 non-producing category using GA-LDA accurately predicted the correct class (with 100% accuracy). As100% accuracy was achieved, this novel approach identifies potential biochemical markers that may have a relation with microbial functional roles and means of rapid identification of KPC-2 producing and non-producing KP strains. PMID:25618648

Marques, Aline S; Moraes, Edgar P; Júnior, Miguel A A; Moura, Andrew D; Neto, Valter F A; Neto, Renato M; Lima, Kássio M G

2015-03-01

332

Indicator For Pseudomonas Bacteria  

NASA Technical Reports Server (NTRS)

Characteristic protein extracted and detected. Natural protein marker found in Pseudomonas bacteria. Azurin, protein containing copper readily extracted, purified, and used to prepare antibodies. Possible to develop simple, fast, and accurate test for marker carried out in doctor's office.

Margalit, Ruth

1990-01-01

333

Cultivation Media for Bacteria  

NSDL National Science Digital Library

Common bacteriological culture media (tryptic soy agar, chocolate agar, Thayer-Martin agar, MacConkey agar, eosin-methylene blue agar, hektoen agar, mannitol salt agar, and sheep blood agar) are shown uninoculated and inoculated with bacteria.

American Society For Microbiology

2009-12-08

334

Bacteria in shear flow  

E-print Network

Bacteria are ubiquitous and play a critical role in many contexts. Their environment is nearly always dynamic due to the prevalence of fluid flow: creeping flow in soil, highly sheared flow in bodily conduits, and turbulent ...

Marcos, Ph.D. Massachusetts Institute of Technology

2011-01-01

335

Studies on the roles of GlnK and GlnB in regulating Klebsiella pneumoniae NifL-dependent nitrogen control  

E-print Network

Studies on the roles of GlnK and GlnB in regulating Klebsiella pneumoniae NifL-dependent nitrogen June 1999; accepted 9 September 1999 Abstract In Klebsiella pneumoniae, nitrogen fixation (nif) genes are regulated in response to fixed nitrogen and oxygen. The activity of the nif-specific transcriptional

Merrick, Mike

336

Influence of Inoculum Size and Marbofloxacin Plasma Exposure on the Amplification of1 Resistant Subpopulations of Klebsiella pneumoniae in a Rat Lung Infection Model.2  

E-print Network

Resistant Subpopulations of Klebsiella pneumoniae in a Rat Lung Infection Model.2 3 Anne-Sylvie Kesteman1 of Klebsiella pneumoniae. For daily fractionated doses of marbofloxacin, the23 prevention of resistance occurred In infections such as pneumonia, the burden of microorganisms can become quite high40 and may frequently exceed

Paris-Sud XI, Université de

337

Aerobic Anoxygenic Phototrophic Bacteria  

PubMed Central

The aerobic anoxygenic phototrophic bacteria are a relatively recently discovered bacterial group. Although taxonomically and phylogenetically heterogeneous, these bacteria share the following distinguishing features: the presence of bacteriochlorophyll a incorporated into reaction center and light-harvesting complexes, low levels of the photosynthetic unit in cells, an abundance of carotenoids, a strong inhibition by light of bacteriochlorophyll synthesis, and the inability to grow photosynthetically under anaerobic conditions. Aerobic anoxygenic phototrophic bacteria are classified in two marine (Erythrobacter and Roseobacter) and six freshwater (Acidiphilium, Erythromicrobium, Erythromonas, Porphyrobacter, Roseococcus, and Sandaracinobacter) genera, which phylogenetically belong to the ?-1, ?-3, and ?-4 subclasses of the class Proteobacteria. Despite this phylogenetic information, the evolution and ancestry of their photosynthetic properties are unclear. We discuss several current proposals for the evolutionary origin of aerobic phototrophic bacteria. The closest phylogenetic relatives of aerobic phototrophic bacteria include facultatively anaerobic purple nonsulfur phototrophic bacteria. Since these two bacterial groups share many properties, yet have significant differences, we compare and contrast their physiology, with an emphasis on morphology and photosynthetic and other metabolic processes. PMID:9729607

Yurkov, Vladimir V.; Beatty, J. Thomas

1998-01-01

338

Investigation of the antibacterial activity of a short cationic peptide against multidrug-resistant Klebsiella pneumoniae and Salmonella typhimurium strains and its cytotoxicity on eukaryotic cells.  

PubMed

With the growing microbial resistance to conventional antimicrobial agents, the development of novel and alternative therapeutic strategies are vital. During recent years novel peptide antibiotics with broad spectrum activity against many Gram-positive and Gram-negative bacteria have been developed. In this study, antibacterial activity of CM11 peptide (WKLFKKILKVL-NH2), a short cecropin-melittin hybrid peptide, is evaluated against antibiotic-resistant strains of Klebsiella pneumoniae and Salmonella typhimurium as two important pathogenic bacteria. To appraise the antibacterial activity, minimal inhibitory concentration (MIC), minimal bactericidal concentration (MBC) and bactericidal killing assay were utilized with different concentrations (2-128 mg/L) of peptide. To evaluate cytotoxic effect of peptide, viability of RAJI, Hela, SP2/0, CHO, LNCAP cell lines and primary murine macrophage cells were also investigated with MTT assay in different concentrations (3-24 and 0.5-16 mg/L, respectively). MICs of K. pneumoniae and S. typhimurium isolates were in range of 8-16 and 4-16 mg/L, respectively. In bactericidal killing assay no colonies were observed at 2X MIC for K. pneumoniae and S. typhimurium isolates after 80-90 min, respectively. Despite the fact that CM11 reveals no significant cytotoxicity on RAJI, Hela, SP2/0, and CHO cell lines beneath 6 mg/L at first 24 and 48 h, the viability of LNCAP cells are about 50 % at 3 mg/L, which indicates strong cytotoxicity of the peptide. In addition, macrophage toxicity by MTT assay showed that LD50 of CM11 peptide is 12 ?M (16 mg/L) after 48 h while in this concentration after 24 h macrophage viability was about 70 %. PMID:24323118

Moghaddam, Mehrdad Moosazadeh; Barjini, Kamal Azizi; Ramandi, Mahdi Fasihi; Amani, Jafar

2014-05-01

339

Accuracy of different methods for susceptibility testing of gentamicin with KPC carbapenemase-producing Klebsiella pneumoniae.  

PubMed

Performance of Vitek2, Etest, and TREK broth microdilution (BMD) panels was evaluated versus reference CLSI BMD for gentamicin susceptibility testing with 57 bloodstream isolates of KPC-producing Klebsiella pneumoniae. Compared with reference BMD, the Essential Agreement and Categorical Agreement for TREK panels, Vitek2, and Etest were 91.2%, 31.6%, and 61.4%, respectively, and 86%, 21%, and 52.6%, respectively. Four very major discrepancies occurred with Vitek2. In these 4 strains, gentamicin resistance was associated with the presence of an armA aminoglycoside resistance determinant. PMID:25533616

Arena, Fabio; Giani, Tommaso; Vaggelli, Guendalina; Terenzi, Giovanni; Pecile, Patrizia; Rossolini, Gian Maria

2015-02-01

340

Outbreak of NDM-1-Producing Klebsiella pneumoniae in a Neonatal Unit in Colombia  

PubMed Central

Six multiresistant, NDM-1-producing Klebsiella pneumoniae strains were recovered from an outbreak that affected six neonatal patients in a Colombian hospital. Molecular analysis showed that all of the isolates harbored the blaNDM-1, qnrA, and intI1 genes and were clonally related. Multilocus sequence typing showed that the isolates belonged to a new sequence type (ST1043) that was different from the sequence types that had previously been reported. This is the first report of NDM-1-producing isolates in South America. PMID:23357776

Olarte Escobar, Narda María; Castro-Cardozo, Betsy; Valderrama Márquez, Ismael Alberto; Garzón Aguilar, Martha Isabel; Martinez de la Barrera, Leslie; Barrero Barreto, Esther Rocio; Marquez-Ortiz, Ricaurte Alejandro; Moncada Guayazán, Maria Victoria; Vanegas Gómez, Natasha

2013-01-01

341

First Report of KPC-2 Carbapenemase-Producing Klebsiella pneumoniae in Japan  

PubMed Central

We investigated a novel Japanese isolate of sequence type 11 (ST11), the Klebsiella pneumoniae carbapenemase-2 (KPC-2)-producing K. pneumoniae strain Kp3018, which was previously obtained from a patient treated at a Brazilian hospital. This strain was resistant to various antibiotic classes, including carbapenems, and harbored the gene blaKPC-2, which was present on the transferable plasmid of ca. 190 kb, in addition to the blaCTX-M-15 gene. Furthermore, the ca. 2.3-kb sequences (ISKpn8-blaKPC-2–ISKpn6-like), encompassing blaKPC-2, were found to be similar to those of K. pneumoniae strains from China. PMID:24566171

Takahashi, Rieko; Sawabe, Etsuko; Koyano, Saho; Takahashi, Yutaka; Shima, Mari; Ushizawa, Hiroto; Fujie, Toshihide; Tosaka, Naoki; Kato, Yuko; Moriya, Kyoji; Tohda, Shuji; Tojo, Naoko; Koike, Ryuji; Kubota, Tetsuo

2014-01-01

342

KPC-producing Klebsiella pneumoniae strains that harbor AAC(6')-Ib exhibit intermediate resistance to amikacin.  

PubMed

The aminoglycoside-modifying enzyme AAC(6')-Ib is common among carbapenem-resistant Klebsiella pneumoniae (CR-Kp) strains. We investigated amikacin (AMK) activity against 20 AAC(6')-Ib-producing CR-Kp strains. MICs clustered at 16 to 32 ?g/ml. By the time-kill study, AMK (1× and 4× the MIC) was bactericidal against 30% and 85% of the strains, respectively. At achievable human serum concentrations, however, the majority of strains showed regrowth, suggesting that AAC(6')-Ib confers intermediate AMK resistance. AMK and trimethoprim-sulfamethoxazole (TMP-SMX) were synergistic against 90% of the strains, indicating that the combination may overcome resistance. PMID:25288089

Bremmer, Derek N; Clancy, Cornelius J; Press, Ellen G; Almaghrabi, Reem; Chen, Liang; Doi, Yohei; Nguyen, M Hong; Shields, Ryan K

2014-12-01

343

Molecular Characterization of Newly Emerged blaKPC-2-Producing Klebsiella pneumoniae in Singapore  

PubMed Central

In Asia, blaKPC detection has been limited to East Asia and not yet seen in Southeast Asia. We report four blaKPC-2-containing Klebsiella pneumoniae isolates from two different hospitals in Singapore. All isolates belonged to strain type 11 (ST11) and were indistinguishable by pulsed-field gel electrophoresis (PFGE). blaKPC-2 was located on nonconjugative plasmids and flanked by mobile genetic structures composed of a partial Tn4401 transposon and a Tn3-based transposon which previously have been described only in Chinese isolates. PMID:22116160

Ngan, Grace; Jureen, Roland; Lin, Raymond T. P.; Teo, Jeanette

2012-01-01

344

Isolation of NDM-1-producing Klebsiella pnemoniae in Ireland, July 2011.  

PubMed

We report the identification of New Delhi metallo-betalactamase 1 (NDM-1)-producing Klebsiella pnemoniae in Ireland. The organism was resistant to multiple antibiotic classes, including carbapenems, and PCR and sequencing confirmed the presence of the blaNDM-1 gene, carried on a 98 kb plasmid. The organism was isolated from an infant, who was born in India and moved to Ireland at the age of four months. This is the first reported isolation of an NDM-1-producing Enterobacteriaceae strain in Ireland. PMID:22370013

McDermott, H; Morris, D; McArdle, E; O'Mahony, G; Kelly, S; Cormican, M; Cunney, R

2012-01-01

345

Infection of mice by aerosols of Klebsiella pneumoniae under hyperbaric conditions.  

PubMed Central

Both the physical behavior of aerosols and survival of airborne Serratia marcescens in hyperbaric chambers with a helium-air mixture at 20 atm of pressure was approximately the same as in the system at ambient pressures. Exposure of mice to aerosols of Klebsiella pneumoniae at 1-, 2-, and 17-atm (ca. 101-, 203-, and 1,722-kPa) pressures of helium-oxygen mixture showed that the number of viable organisms constituting a 50% lethal dose was not significantly affected by the hyperbaric conditions. Images PMID:6996616

Heckly, R J; Chatigny, M A; Dimmick, R L

1980-01-01

346

Toward repurposing ciclopirox as an antibiotic against drug-resistant Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae.  

PubMed

Antibiotic-resistant infections caused by gram-negative bacteria are a major healthcare concern. Repurposing drugs circumvents the time and money limitations associated with developing new antimicrobial agents needed to combat these antibiotic-resistant infections. Here we identified the off-patent antifungal agent, ciclopirox, as a candidate to repurpose for antibiotic use. To test the efficacy of ciclopirox against antibiotic-resistant pathogens, we used a curated collection of Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae clinical isolates that are representative of known antibiotic resistance phenotypes. We found that ciclopirox, at 5-15 µg/ml concentrations, inhibited bacterial growth regardless of the antibiotic resistance status. At these same concentrations, ciclopirox reduced growth of Pseudomonas aeruginosa clinical isolates, but some of these pathogens required higher ciclopirox concentrations to completely block growth. To determine how ciclopirox inhibits bacterial growth, we performed an overexpression screen in E. coli. This screen revealed that galE, which encodes UDP-glucose 4-epimerase, rescued bacterial growth at otherwise restrictive ciclopirox concentrations. We found that ciclopirox does not inhibit epimerization of UDP-galactose by purified E. coli GalE; however, ?galU, ?galE, ?rfaI, or ?rfaB mutant strains all have lower ciclopirox minimum inhibitory concentrations than the parent strain. The galU, galE, rfaI, and rfaB genes all encode enzymes that use UDP-galactose or UDP-glucose for galactose metabolism and lipopolysaccharide (LPS) biosynthesis. Indeed, we found that ciclopirox altered LPS composition of an E. coli clinical isolate. Taken together, our data demonstrate that ciclopirox affects galactose metabolism and LPS biosynthesis, two pathways important for bacterial growth and virulence. The lack of any reported fungal resistance to ciclopirox in over twenty years of use in the clinic, its excellent safety profiles, novel target(s), and efficacy, make ciclopirox a promising potential antimicrobial agent to use against multidrug-resistant problematic gram-negative pathogens. PMID:23936064

Carlson-Banning, Kimberly M; Chou, Andrew; Liu, Zhen; Hamill, Richard J; Song, Yongcheng; Zechiedrich, Lynn

2013-01-01

347

Toward Repurposing Ciclopirox as an Antibiotic against Drug-Resistant Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae  

PubMed Central

Antibiotic-resistant infections caused by gram-negative bacteria are a major healthcare concern. Repurposing drugs circumvents the time and money limitations associated with developing new antimicrobial agents needed to combat these antibiotic-resistant infections. Here we identified the off-patent antifungal agent, ciclopirox, as a candidate to repurpose for antibiotic use. To test the efficacy of ciclopirox against antibiotic-resistant pathogens, we used a curated collection of Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae clinical isolates that are representative of known antibiotic resistance phenotypes. We found that ciclopirox, at 5–15 µg/ml concentrations, inhibited bacterial growth regardless of the antibiotic resistance status. At these same concentrations, ciclopirox reduced growth of Pseudomonas aeruginosa clinical isolates, but some of these pathogens required higher ciclopirox concentrations to completely block growth. To determine how ciclopirox inhibits bacterial growth, we performed an overexpression screen in E. coli. This screen revealed that galE, which encodes UDP-glucose 4-epimerase, rescued bacterial growth at otherwise restrictive ciclopirox concentrations. We found that ciclopirox does not inhibit epimerization of UDP-galactose by purified E. coli GalE; however, ?galU, ?galE, ?rfaI, or ?rfaB mutant strains all have lower ciclopirox minimum inhibitory concentrations than the parent strain. The galU, galE, rfaI, and rfaB genes all encode enzymes that use UDP-galactose or UDP-glucose for galactose metabolism and lipopolysaccharide (LPS) biosynthesis. Indeed, we found that ciclopirox altered LPS composition of an E. coli clinical isolate. Taken together, our data demonstrate that ciclopirox affects galactose metabolism and LPS biosynthesis, two pathways important for bacterial growth and virulence. The lack of any reported fungal resistance to ciclopirox in over twenty years of use in the clinic, its excellent safety profiles, novel target(s), and efficacy, make ciclopirox a promising potential antimicrobial agent to use against multidrug-resistant problematic gram-negative pathogens. PMID:23936064

Carlson-Banning, Kimberly M.; Chou, Andrew; Liu, Zhen; Hamill, Richard J.; Song, Yongcheng; Zechiedrich, Lynn

2013-01-01

348

Alterations in peptidoglycan chemical composition associated with rod-to-sphere transition in a conditional mutant of Klebsiella pneumoniae.  

PubMed Central

Klebsiella pneumoniae Mir M7 is a spontaneous parentless morphology mutant which grows as cocci at pH 7 and as rods at pH 5.8. This strain has been characterized as defective in lateral wall formation (at pH7). Data suggest that the cell wall is mainly made up of poles of the rods (G. Satta, R. Fontana, P. Canepari, and G. Botta, J. Bacteriol. 137:727--734, 1979). In this work the isolation and the biochemical properties of the peptidoglycan of both Mir M7 rods and cocci and a nonconditional rod-shaped Mir M7 revertant (strain Mir A12) are described. The peptidoglycan of Mir M7 (both rods and cocci) and Mir A12 strains carried covalently bound proteins which could be easily removed by pronase treatment in Mir M7 rods and Mir A12 cells, but not in Mir M7 round cells. However, when the sodium dodecyl sulfate-insoluble residues of Mir M7 cocci were pretreated with ethylenediaminetetraacetic acid (EDTA), pronase digestion removed the covalently bound proteins, and pure peptidoglycan was obtained. EDTA treatment of the rigid layer of Mir M7 cocci removed amounts of Mg2+ and Ca2+, which were 10- and 50-fold higher, respectively, than the amount liberated from the rigid layer of Mir M7 rods and Mir A12 cells. Amino acid composition was qualitatively similar in both strains, but Mir M7 cocci contained a higher amount of alanine and glucosamine. Mir M7 cocci contained approximately 50% less peptidoglycan than rods. Under electron microscopy, the rigid layer of the Mir M7 rods and Mir A12 cells appeared to be rod-shaped and their shape remained unchanged after EDTA and pronase treatment. On the contrary, the Mir M7 cocci rigid layer appeared to be round, and after EDTA treatment it collapsed and lost any definite morphology. In spite of these alterations, the peptidoglycan of Mir M7 cocci still appeared able to determine the shape of the cell and protect it from osmotic shock and mechanical damages. The accumluation of divalent cations appeared necessary for the peptidoglycan to acquire sufficient rigidity for shape determination and cell protection. We concluded that the coccal shape in Mir M7 cells is not due to loss of cell wall rigidity but is a consequence of the formation of a round peptidoglycan molecule. The possibility that the alterations found in the Mir M7 cocci rigid layer may reflect natural differences in the biochemical composition of the septa and lateral wall of normally shaped bacteria is discussed. Images PMID:113382

Fontana, R; Canepari, P; Satta, G

1979-01-01

349

Effects of cadmium, copper, magnesium, and zinc on the decomposition of citrate by a Klebsiella sp.  

PubMed Central

The effects of Cd2+, Cu2+, Mg2+, and Zn2+ on the decomposition of citric acid by a Klebsiella sp. were studied by monitoring the degradation of [14C]citrate. The carbon concentration used was 10 micrograms of C liter-1, and the media were designed to provide at least 95% of the citrate complexed to the metal studied. After 72 h of incubation, 80% of the uncomplexed citric acid and 76% of the magnesium citrate had been decomposed. A marked inhibition was observed when Cd2+, Cu2+, or Zn2+ was bound to the organic anion; only 23% of the cadmium citrate, 14% of the zinc citrate, and 5% of the cuprous citrate had been decomposed. The effects were not the result of toxicity, since experiments run with [14C]glucose (nonchelating compound) instead of citrate resulted in similar decomposition rates regardless of the presence of the metal. To examine whether the binding of a metal to citrate enhanced its uptake by the Klebsiella sp., we studied the relative uptake of 65Zn in citrate- and in glucose-containing media. No such effect could be observed, with the uptake of Zn2+ being higher in the glucose-containing media. The study shows that metals may render low-molecular-weight organic acids, such as citric acid, resistant to bacterial degradation. This stresses the importance of metals in influencing microbial decomposition of organic compounds, not only as a result of toxicity. PMID:2764560

Brynhildsen, L; Rosswall, T

1989-01-01

350

KPC-2-producing Klebsiella pneumoniae infections in Greek hospitals are mainly due to a hyperepidemic clone.  

PubMed

To verify the presence of Klebsiella pneumoniae carbapenemase-producing (KPC-producing) Klebsiella pneumoniae in Greece, we asked 40 Greek hospitals participating in the Greek System for the Surveillance of Antimicrobial Resistance (GSSAR) to apply a combination of the modified Hodge test plus EDTA synergy test on all K. pneumoniae clinical isolates obtained from February 2008 which displayed reduced susceptibility to carbapenems (MIC of imipenem > or = 1 mg/L). The presence of the blaKPC gene was confirmed by PCR and sequencing. This procedure revealed the presence of KPC-2 in isolates from 173 patients in 18 hospitals during a period of 11 months. Of these, 166 isolates belonged to a single pulsotype a fact consistent with possible epidemic spread, whereas the remaining seven isolates were further classified into four different pulsotypes. BlaKPC-2 gene was found to be transferable by conjugation in the four pulsotypes other than the prevailing one. The emergence of a new carbapenemase gene in Greece, where high resistance rates to carbapenems in K. pneumoniae due to the spread of the VIM type metalloenzyme have been observed, emphasises the urgent need for the implementation of public health measures in the field of infection control and antibiotic consumption. It also underlines the need to supplement surveillance systems based on susceptibility data with the surveillance of resistance mechanisms. PMID:19480809

Giakoupi, P; Maltezou, H; Polemis, M; Pappa, O; Saroglou, G; Vatopoulos, A

2009-05-28

351

Novel screening assay for in vivo selection of Klebsiella pneumoniae genes promoting gastrointestinal colonisation  

PubMed Central

Background Klebsiella pneumoniae is an important opportunistic pathogen causing pneumonia, sepsis and urinary tract infections. Colonisation of the gastrointestinal (GI) tract is a key step in the development of infections; yet the specific factors important for K. pneumoniae to colonize and reside in the GI tract of the host are largely unknown. To identify K. pneumoniae genes promoting GI colonisation, a novel genomic-library-based approach was employed. Results Screening of a K. pneumoniae C3091 genomic library, expressed in E. coli strain EPI100, in a mouse model of GI colonisation led to the positive selection of five clones containing genes promoting persistent colonisation of the mouse GI tract. These included genes encoding the global response regulator ArcA; GalET of the galactose operon; and a cluster of two putative membrane-associated proteins of unknown function. Both ArcA and GalET are known to be involved in metabolic pathways in Klebsiella but may have additional biological actions beneficial to the pathogen. In support of this, GalET was found to confer decreased bile salt sensitivity to EPI100. Conclusions The present work establishes the use of genomic-library-based in vivo screening assays as a valuable tool for identification and characterization of virulence factors in K. pneumoniae and other bacterial pathogens. PMID:22967317

2012-01-01

352

[Growth-promoting effect of inoculating klebsiella variicola DX120E on different sugarcane cultivars].  

PubMed

In order to investigate the growth promoting effect of inoculating Klebsiella variicola DX120E, a bacterial strain with high activity of associative nitrogen fixation, on sugarcane, the strain was inoculated through roots into the pathogen free micropropagated seedlings of two sugarcane cultivars B8 and GT21. The bacterial numbers colonized in sugarcane plants, the activities of the key enzymes for nitrogen metabolism, the nitrate concentration and nutrient uptake were analyzed. The results indicated that the DX120E strain could live, propagate and colonize in the roots and aerial parts of sugarcane seedlings. The DX120E inoculation could effectively promote the plant growth and nutrient uptake, significantly improve the nitrate reductase (NR) activities, and increase the glutamine synthetase (GS) activities and nitrate concentration in certain degree in the leaves, compared with the uninoculated seedlings. It was suggested that Klebsiella variicola DX120E possesses a significant growth promoting effect on sugarcane plants which has a great application potential in developing biological nitrogen fixation fertilizer for sugarcane. PMID:25345062

Wei, Chun-Yan; Xing, Yong-Xiu; Lin, Li; Yang, Li-Tao; Li, Yang-Rui; Hu, Chun-Jin

2014-07-01

353

Activation of human endothelial cells by viable or heat-killed gram-negative bacteria requires soluble CD14.  

PubMed Central

In response to bacterial lipopolysaccharides (LPS; endotoxin), endothelial cells are converted to an activation phenotype expressing both proinflammatory and procoagulant properties that include the induction of leukocyte adhesion molecules and tissue factor expression. LPS-induced endothelial cell activation requires a soluble form of the monocyte LPS receptor, sCD14. We evaluated the capacity of multiple strains of gram-negative and gram-positive bacteria to induce endothelial E-selectin and tissue factor expression through sCD14-dependent pathways with cultured human umbilical vein endothelial cells (HUVE). Both viable and heat-killed gram-negative bacteria (Bacteroides fragilis, Enterobacter cloacae, Haemophilus influenzae, and Klebsiella pneumoniae) but not viable or heat-killed gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis, and Streptococcus pneumoniae) induced prominent E-selectin surface expression detected by enzyme-linked immunosorbent assay. Tissue factor activity on HUVE, indicated by factor X activation, was induced in response to gram-negative bacteria but not in response to gram-positive bacteria. Gram-negative bacteria induced transcriptional activation in HUVE, indicated by the appearance of E-selectin-specific mRNA and by the demonstration of activation of NF-kappa B, a trans-activating factor necessary for E-selectin and tissue factor gene transcription. In contrast, neither E-selectin mRNA nor activation of NF-kappa B was detected in HUVE treated with gram-positive bacteria. Endothelial cell activation by gram-negative bacteria in each of these assays was inhibited with a monoclonal antibody (60bd) against CD14. Furthermore, CHO-K1 cells, transfected with human recombinant CD14, responded to all strains of gram-negative bacteria (viable or heat killed), indicated by CHO-K1 NF-kappa B activation. We conclude that gram-negative bacteria induce endothelial cell activation through a common sCD14-dependent pathway. PMID:7558318

Noel, R F; Sato, T T; Mendez, C; Johnson, M C; Pohlman, T H

1995-01-01

354

Ice-Nucleating Bacteria  

NASA Astrophysics Data System (ADS)

Since the discovery of ice-nucleating bacteria in 1974 by Maki et al., a large number of studies on the biological characteristics, ice-nucleating substance, ice nucleation gene and frost damage etc. of the bacteria have been carried out. Ice-nucleating bacteria can cause the freezing of water at relatively warm temperature (-2.3°C). Tween 20 was good substrates for ice-nucleating activity of Pseudomonas fluorescens KUIN-1. Major fatty acids of Isolate (Pseudomonas fluorescens) W-11 grown at 30°C were palmitic, cis-9-hexadecenoic and cis-11-octadecenoic which amounted to 90% of the total fatty acids. Sequence analysis shows that an ice nucleation gene from Pseudomonas fluorescens is related to the gene of Pseudomonas syringae.

Obata, Hitoshi

355

Quinolones Sensitize Gram-Negative Bacteria to Antimicrobial Peptides  

PubMed Central

The treatment of infections caused by bacteria resistant to the vast majority of antibiotics is a challenge worldwide. Antimicrobial peptides (APs) make up the front line of defense in those areas exposed to microorganisms, and there is intensive research to explore their use as new antibacterial agents. On the other hand, it is known that subinhibitory concentrations of antibiotics affect the expression of numerous bacterial traits. In this work we evaluated whether treatment of bacteria with subinhibitory concentrations of quinolones may alter the sensitivity to APs. A 1-h treatment of Klebsiella pneumoniae with 0.25× the MIC of ciprofloxacin rendered bacteria more sensitive to polymyxins B and E, human neutrophil defensin 1, and ?-defensin 1. Levofloxacin and nalidixic acid at 0.25× the MICs also increased the sensitivity of K. pneumoniae to polymyxin B, whereas gentamicin and ceftazidime at 0.25× the MICs did not have such an effect. Ciprofloxacin also increased the sensitivities of K. pneumoniae ciprofloxacin-resistant strains to polymyxin B. Two other pathogens, Pseudomonas aeruginosa and Haemophilus influenzae, also became more sensitive to polymyxins B and E after treatment with 0.25× the MIC of ciprofloxacin. Incubation with ciprofloxacin did not alter the expression of the K. pneumoniae loci involved in resistance to APs. A 1-N-phenyl-naphthylamine assay showed that ciprofloxacin and levofloxacin increased the permeabilities of the K. pneumoniae and P. aeruginosa outer membranes, while divalent cations antagonized this action. Finally, we demonstrated that ciprofloxacin and levofloxacin increased the binding of APs to the outer membrane by using dansylated polymyxin B. PMID:16801413

Campos, Miguel A.; Morey, Pau; Bengoechea, José A.

2006-01-01

356

Evolution of the ferric enterobactin receptor in gram-negative bacteria.  

PubMed

Using sodium dodecyl sulfate-polyacrylamide gel electrophoresis of iron-deficient and replete cell envelopes, 59Fe-siderophore uptake studies, and Western immunoblots and cytofluorimetric analyses with monoclonal antibodies (MAbs), we surveyed a panel of gram-negative bacteria to identify outer membrane proteins that are structurally related to the Escherichia coli K-12 ferric enterobactin receptor, FepA. Antibodies within the panel identified FepA epitopes that are conserved among the majority of the bacteria tested, as well as epitopes present in only a few of the strains. In general, epitopes of FepA that are buried in the outer membrane bilayer were more conserved among gram-negative bacteria than epitopes that are exposed on the bacterial cell surface. The surface topology and tertiary structure of FepA are quite similar in E. coli and Shigella flexneri but differ in Salmonella typhimurium. Of the 18 different genera tested, 94% of the bacteria transported ferric enterobactin, including members of the previously unrecognized genera Citrobacter, Edwardsiella, Enterobacter, Haemophilus, Hafnia, Morganella, Neisseria, Proteus, Providencia, Serratia, and Yersinia. The ferric enterobactin receptor contains at least one buried epitope, recognized by MAb 2 (C. K. Murphy, V. I. Kalve, and P. E. Klebba, J. Bacteriol. 172:2736-2746, 1990), that is conserved within the structure of an iron-regulated cell envelope protein in all the bacteria that we have surveyed. With MAb 2, we identified and determined the Mr of cell envelope antigens that are immunologically related to E. coli FepA in all the gram-negative bacteria tested. Collectively, the library of anti-FepA MAbs showed unique patterns of reactivity with the different bacteria, allowing identification and discrimination of species within the following gram-negative genera: Aeromonas, Citrobacter, Edwardsiella, Enterobacter, Escherichia, Haemophilus, Hafnia, Klebsiella, Morganella, Neisseria, Proteus, Providencia, Pseudomonas, Salmonella, Serratia, Shigella, Vibrio, and Yersinia. PMID:1717434

Rutz, J M; Abdullah, T; Singh, S P; Kalve, V I; Klebba, P E

1991-10-01

357

Transfer of antibiotic multiresistant plasmid RP4 from escherichia coli to activated sludge bacteria.  

PubMed

In situ transfer of a self-transmissible, antibiotic-multiresistant plasmid RP4 from a laboratory Escherichia coli strain C600 to indigenous activated sludge bacteria was investigated using filter mating. The transfer frequency of RP4 from the donor E. coli to the bacteria that was sampled from two wastewater treatment plants was 5.1x10(-2) to 7.5x10(-1) and 4.6x10(-3) to 1.3x10(-2)/potential recipient. The isolated transconjugants showed resistance to Ap, Km, and Tc and the presence of a plasmid with a similar size to RP4. The traG gene on RP4 was also detected from all transconjugants. Reverse-transfer experiments from the transconjugants to E. coli HB101 indicated that RP4 maintained self-transmissibility in the transconjugants. The transconjugant strains were dominant bacteria in activated sludge including Pseudomonas fluorescens, P. putida, and Ochrobactrum anthropi and minor populations of enteric bacterial strains including Citrobacter freundii, E. coli, Enterobacter cloacae, E. asburiae, and Klebsiella pneumoniae ssp. pneumoniae. The transconjugant strains K. pneumoniae ssp. pneumonia, E. cloacae, and E. asburiae had several naturally occurring plasmids. These results suggest that in situ transfer of plasmids and the exchange of antibiotic-resistant genes can occur between released and indigenous bacteria in activated sludge. PMID:18930008

Soda, Satoshi; Otsuki, Hidetaka; Inoue, Daisuke; Tsutsui, Hirofumi; Sei, Kazunari; Ike, Michihiko

2008-09-01

358

Anaerobic bacteria grow within Candida albicans biofilms and induce biofilm formation in suspension cultures.  

PubMed

The human microbiome contains diverse microorganisms, which share and compete for the same environmental niches. A major microbial growth form in the human body is the biofilm state, where tightly packed bacterial, archaeal, and fungal cells must cooperate and/or compete for resources in order to survive. We examined mixed biofilms composed of the major fungal species of the gut microbiome, Candida albicans, and each of five prevalent bacterial gastrointestinal inhabitants: Bacteroides fragilis, Clostridium perfringens, Escherichia coli, Klebsiella pneumoniae, and Enterococcus faecalis. We observed that biofilms formed by C. albicans provide a hypoxic microenvironment that supports the growth of two anaerobic bacteria, even when cultured in ambient oxic conditions that are normally toxic to the bacteria. We also found that coculture with bacteria in biofilms induces massive gene expression changes in C. albicans, including upregulation of WOR1, which encodes a transcription regulator that controls a phenotypic switch in C. albicans, from the "white" cell type to the "opaque" cell type. Finally, we observed that in suspension cultures, C. perfringens induces aggregation of C. albicans into "mini-biofilms," which allow C. perfringens cells to survive in a normally toxic environment. This work indicates that bacteria and C. albicans interactions modulate the local chemistry of their environment in multiple ways to create niches favorable to their growth and survival. PMID:25308076

Fox, Emily P; Cowley, Elise S; Nobile, Clarissa J; Hartooni, Nairi; Newman, Dianne K; Johnson, Alexander D

2014-10-20

359

Homology of the gene coding for outer membrane lipoprotein within various Gram-negative bacteria.  

PubMed

The mRNA for a major outer membrane lipoprotein from Escherichia coli was found to hybridize specifically with one of the EcoRI and one of the HindIII restriction endonuclease-generated fragments of total DNA from nine bacteria in the family Enterobacteriaceae: E. coli, Shigella dysenteriae, Salmonella typhimurium, Citrobacter freundii, Klebsiella aerogenes, Enterobacter aerogenes, Edwardsiella tarda, Serratia marcescens, and Erwinia amylovora. However, among the Enterobacteriaceae, DNA from two species of Proteus (P. mirabilis and P. morganii) did not contain any restriction endonuclease fragments that hybridized with the E. coli lipoprotein mRNA. Furthermore, no hybrid bands were detected in four other gram-negative bacteria outside the family Enterobacteriaceae: Pseudomonas aeruginosa, Acinetobacter sp. HO1-N, Caulobacter crescentus, and Myxococcus xanthus. Envelope fractions from all bacteria in the family Enterobacteriaceae tested above cross-reacted with antiserum against the purified E. coli free-form lipoprotein in the Ouchterlony immunodiffusion test. Both species of Proteus, however, gave considerably weaker precipitation lines, in comparison with the intense lines produced by the other members of the family. All of the above four bacteria outside the family Enterobacteriaceae did not cross-react with anti-E. coli lipoprotein serum. From these results, the rate of evolutionary changes in the lipoprotein gene seems to be closely related to that observed for various soluble enzymes of the Enterobacteriaceae. PMID:104972

Nakamura, K; Pirtle, R M; Inouye, M

1979-01-01

360

Differential effects of catecholamines on in vitro growth of pathogenic bacteria  

NASA Technical Reports Server (NTRS)

Supplementation of minimal medium inoculated with bacterial cultures with norepinephrine, epinephrine, dopamine, or isoproterenol resulted in marked increases in growth compared to controls. Norepinephrine and dopamine had the greatest enhancing effects on growth of cultures of Pseudomonas aeruginosa and Klebsiella pneumoniae, while epinephrine and isoproterenol also enhanced growth to a lesser extent. The growth of Escherichia coli in the presence of norepinephrine was greater than growth in the presence of the three other neurochemicals used in the study. Growth of Staphylococcus aureus was also enhanced in the presence of norepinephrine, but not to the same degree as was the growth of gram negative bacteria. Addition of culture supernatants from E. coli cultures that had been grown in the presence of norepinephrine was able to enhance the growth of K. pneumoniae. Addition of the culture supernatant fluid culture from E. coli cultures that had been grown in the presence of norepinephrine did not enhance growth of P. aeruginosa or S. aureus. Culture supernatant fluids from bacteria other than E. coli grown in the presence of norepinephrine were not able to enhance the growth of any bacteria tested. The results suggest that catecholamines can enhance growth of pathogenic bacteria, which may contribute to development of pathogenesis; however, there is no uniform effect of catecholamines on bacterial growth.

Belay, Tesfaye; Sonnenfeld, Gerald

2002-01-01

361

Draft Whole-Genome Sequence of OXA-48-Producing Multidrug-Resistant Klebsiella pneumoniae KP_ST11_OXA-48  

PubMed Central

We present the draft genome sequence of a blood culture isolate of OXA-48-producing Klebsiella pneumoniae (sequence type 11 [ST11]) obtained in the course of a hospital outbreak in Spain. Sequence analysis showed 121 genes related to antibiotic and antiseptic resistance, including blaOXA-48, which was located in an IncL/M plasmid. PMID:25081259

Villa, Jennifer; Viedma, Esther; Brañas, Patricia; Mingorance, Jesús

2014-01-01

362

Complete Genome Sequence of a Klebsiella pneumoniae Isolate with Chromosomally Encoded Carbapenem Resistance and Colibactin Synthesis Loci  

PubMed Central

Klebsiella pneumoniae is an important nosocomial pathogen, and multidrug-resistant strains have become a worldwide concern. Here, we report the complete genome of a K. pneumoniae isolate with chromosomally integrated blaKPC genes and a colibactin synthesis locus. PMID:25540345

Deming, Clayton; Tsai, Yu-Chih; Lau, Anna F.; Dekker, John P.; Korlach, Jonas; Segre, Julia A.

2014-01-01

363

Sex differences in the impact of ozone on survival and alveolar macrophage function of mice after Klebsiella pneumoniae infection  

Microsoft Academic Search

BACKGROUND: Sex differences have been described in a number of pulmonary diseases. However, the impact of ozone exposure followed by pneumonia infection on sex-related survival and macrophage function have not been reported. The purpose of this study was to determine whether ozone exposure differentially affects: 1) survival of male and female mice infected with Klebsiella pneumoniae, and 2) the phagocytic

Anatoly N Mikerov; Xiaozhuang Gan; Todd M Umstead; Laura Miller; Vernon M Chinchilli; David S Phelps; Joanna Floros

2008-01-01

364

Genetic diversity of genes encoding OKP and LEN beta-lactamases produced by clinical Klebsiella pneumoniae strains in Portugal.  

PubMed

Of the 308 clinical Klebsiella pneumoniae strains collected in 21 Portuguese health institutions, 11 encoded for LEN and 9 for OKP enzymes; of these, 15 were new enzymes. Ninety-one percent of LEN and all OKP producer strains were resistant to amoxicillin. We demonstrate that these beta-lactamase were highly diverse. PMID:19128913

Mendonça, Nuno; Ferreira, Eugénia; Caniça, Manuela

2009-03-01

365

Destruction of single-species biofilms of Escherichia coli or Klebsiella pneumoniae subsp. pneumoniae by dextranase, lactoferrin, and lysozyme  

Technology Transfer Automated Retrieval System (TEKTRAN)

The activity of dextranase, lactoferrin, lysozyme, and nisin against biofilms composed of either Klebsiella pneumonia or Escherichia coli was examined using the MBEC Assay™. Mature biofilms were treated and then sonicated to remove the adherent biofilm. This material was quantified using a lumines...

366

Pyogenic Liver Abscess with a Focus on Klebsiella pneumoniae as a Primary Pathogen: An Emerging Disease with Unique Clinical Characteristics  

Microsoft Academic Search

OBJECTIVES:Pyogenic liver abscess is a common intraabdominal infection. Historically, Escherichia coli (E. coli) has been the predominant causative agent. Klebsiella liver abscess (KLA) was first reported in Taiwan and has surpassed E. coli as the number one isolate from patients with hepatic abscesses in that country and reports from other countries, including the United States, have increased. We examined the

Edith R. Lederman; Nancy F. Crum

2005-01-01

367

Identification of putative plant pathogenic determinants from a draft genome sequence of an opportunistic klebsiella pneumoniae strain  

Technology Transfer Automated Retrieval System (TEKTRAN)

Klebsiella pneumoniae has been known historically as a causal agent of bacterial pneumonia. More recently, K. pneumoniaerepresentatives have been shown to have a broad ecological distribution and are recognized nitrogen-fixers. Previously, we demonstrated the capacity of K. pneumoniae strain Kp 5-1R...

368

Emerging Plasmid-Mediated Quinolone Resistance Associated with the qnr Gene in Klebsiella pneumoniae Clinical Isolates in the United States  

Microsoft Academic Search

Although quinolone resistance commonly results from chromosomal mutation, recent studies indicate that such resistance can also be transferred on plasmids carrying the gene responsible, qnr. One hundred ten ciprofloxacin-resistant clinical isolates of Klebsiella pneumoniae and Escherichia coli from the United States were screened for the qnr gene by PCR and Southern hybridization of plasmid DNA. Conjugation experiments were done with

Minggui Wang; Daniel F. Sahm; George A. Jacoby; David C. Hooper

2004-01-01

369

Septic Shock Caused by Klebsiella pneumoniae Carbapenemase-Producing Enterobacter gergoviae in a Neutropenic Patient with Leukemia  

PubMed Central

We present the first reported infection caused by Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacter gergoviae. The patient had leukemia and neutropenia and died of septic shock from KPC-producing E. gergoviae bacteremia. The emergence of KPCs in additional species of Enterobacteriaceae is alarming and may disproportionately affect patients with hematologic malignancies. PMID:23761145

Jenkins, Stephen G.; Chen, Liang; Helfgott, David; Feldman, Eric J.; Kreiswirth, Barry N.; Schuetz, Audrey N.

2013-01-01

370

Pleuritis and suppurative pneumonia associated with a hypermucoviscosity phenotype of Klebsiella pneumoniae in California sea lions ( Zalophus californianus)  

Microsoft Academic Search

The aim of this study is to document the isolation of a hypermucoviscosity (HMV) phenotype of Klebsiella pneumoniae from 25 cases of suppurative pneumonia and pleuritis and two cases of abscesses in California sea lions (Zalophus californianus) from the central California coast, representing the first report of this zoonotic pathogen from the marine environment and only the second report in

Spencer Jang; Liz Wheeler; Roberta B. Carey; Bette Jensen; Claudia M. Crandall; Kimmi N. Schrader; David Jessup; Kathleen Colegrove; Frances M. D. Gulland

2010-01-01

371

Glowing Bacteria: Transformation Efficiency  

E-print Network

1 Glowing Bacteria: Transformation Efficiency Purpose: To determine how well your E. coli cells took up and expressed GFP after transformation. Background: Transformation efficiency is a quantitative)______ (Fraction of DNA spread on plate) = ______ µg plasmid DNA spread on plate #12;2 5. Transformation efficiency

Rose, Michael R.

372

Beneficial plant bacteria  

Microsoft Academic Search

The recognition of plant growth?promoting rhizobacteria (PGPR), a group of beneficial plant bacteria, as potentially useful for stimulating plant growth and increasing crop yields has evolved over the past several years to where today researchers are able to repeatedly use them successfully in field experiments. Increased growth and yields of potato, sugar beet, and radish have been reported. The most

Thomas J. Burr; Anthony Caesar; M. N. Schrolh

1984-01-01

373

Sexual isolation in bacteria  

Microsoft Academic Search

Bacteria exchange genes rarely but are promiscuous in the choice of their genetic partners. Inter-specific recombination has the advantage of increasing genetic diversity and promoting dissemination of novel adaptations, but suffers from the negative effect of importing potentially harmful alleles from incompatible genomes. Bacterial species experience a degree of 'sexual isolation' from genetically divergent organisms ^ recombination occurs more frequently

Jacek Majewski

2001-01-01

374

Bacteria-surface interactions  

PubMed Central

The interaction of bacteria with surfaces has important implications in a range of areas, including bioenergy, biofouling, biofilm formation, and the infection of plants and animals. Many of the interactions of bacteria with surfaces produce changes in the expression of genes that influence cell morphology and behavior, including genes essential for motility and surface attachment. Despite the attention that these phenotypes have garnered, the bacterial systems used for sensing and responding to surfaces are still not well understood. An understanding of these mechanisms will guide the development of new classes of materials that inhibit and promote cell growth, and complement studies of the physiology of bacteria in contact with surfaces. Recent studies from a range of fields in science and engineering are poised to guide future investigations in this area. This review summarizes recent studies on bacteria-surface interactions, discusses mechanisms of surface sensing and consequences of cell attachment, provides an overview of surfaces that have been used in bacterial studies, and highlights unanswered questions in this field. PMID:23930134

Tuson, Hannah H.; Weibel, Douglas B.

2013-01-01

375

Thermophilic bacteria from wool  

Microsoft Academic Search

Twenty-one samples of wool removed from pelts either by the “pie” or “slipemaster” process were obtained from meat works throughout New Zealand. The number of mesophilic and thermophilic bacteria on the samples was determined by the plate count method. The numbers of thermophiles varied from less than 102 to 1.9 × 10\\/g. Six isolates were obtained for final study; these

A. P. Mulcock; Philippa E. Horn

1965-01-01

376

Photobiology of Bacteria  

Microsoft Academic Search

The field of photobiology is concerned with the interactions between light and living matter. For Bacteria this interaction serves three recognisable physiological functions: provision of energy, protection against excess radiation and signalling (for motility and gene expression). The chemical structure of the primary light-absorbing components in biology (the chromophores of photoactive proteins) is surprisingly simple: tetrapyrroles, polyenes and derivatised aromats

K. J. Hellingwerf; W. Crielaard; W. D. Hoff; H. C. P. Matthijs; L. R. Mur; B. J. Rotterdam

1994-01-01

377

Aquatic Bacteria Samples  

USGS Multimedia Gallery

On April 20, 2010, the BP Deepwater Horizon drilling platform collapsed and sank in the Gulf of Mexico, causing one of the largest oil spills in history. One of the big dilemmas in responding to the oil spil is how to clean up the oil itself. One way currently under research is to use bacteria that ...

378

Performance evaluation and bacteria analysis of AFB-MFC enriched with high-strength synthetic wastewater.  

PubMed

In order to study the performance and bacterial communities of an anaerobic fluidized bed microbial fuel cell (AFB-MFC) system, the 16S rDNA gene sequencing was applied, and high-strength synthetic wastewater was treated by the AFB-MFC system. The high-strength synthetic wastewater, in which the concentrations of chemical oxygen demand (COD), nitrite nitrogen, and nitrate nitrogen were above 19,000, 2,516-3,871 and 927-1,427 mg/L, was treated by the AFB-MFC system. The removal efficiency of COD, nitrite nitrogen, and nitrate nitrogen reached 70-89, 98 and 98%, while the maximum voltage was 394 mV. The bacteria analysis revealed the presence of Alistipes putredinis, Carnobacterium sp., Victivallis vadensis, Klebsiella pneumoniae, Thauera sp., Parabacteroides merdae, Parvimonas micra, Parabacteroides sp., and Desulfomicrobium baculatum in the anode chamber. In addition, the Klebsiella pneumoniae was observed to have the capability of organic degradation and electricity generation, while the Thauera sp. has the capability of denitrification. PMID:24434962

Huang, Jian-sheng; Guo, Yong; Yang, Ping; Li, Chong-ming; Gao, Hui; Feng, Li; Zhang, Yun

2014-01-01

379

Toxicological effects of selective herbicides on plant growth promoting activities of phosphate solubilizing Klebsiella sp. strain PS19.  

PubMed

This study examines the effect of four herbicides, quizalafop-p-ethyl, clodinafop, metribuzin and glyphosate, on plant growth promoting activities like phosphate solubilization, siderophores, indole acetic acid, exo-polysaccharides, hydrogen cyanide and ammonia production by herbicide tolerant Klebsiella sp. strain PS19. The strain was isolated from mustard rhizosphere. The selected herbicides were applied two to three times at the recommended rates. Klebsiella sp. strain PS19 tolerated a concentration of 1600 ?g/ml each of quizalafop-p-ethyl and clodinafop, and 3200 and 2800 ?g/ml of metribuzin and glyphosate, respectively. The activities of Klebsiella sp. strain PS19 observed under in vitro environment were persistent in the presence of all herbicides at lower rates. The plant growth promoting activities even-though decreased regularly, but was not lost completely, as the concentration of each herbicide was increased from the recommended to three times of higher doses. Among all herbicides, quizalafop-p-ethyl, generally, showed maximum toxicity to plant growth promoting activities of Klebsiella sp. strain PS19. As an example, 40, 80 and 120 ?g/l of quizalafop-p-ethyl added to liquid culture Pikovskaya medium, decreased phosphate solubilizing activity of strain PS19 by 93, 95 and 97%, respectively over untreated control. The study revealed that the higher rates of herbicides though decreased the plant growth promoting activity but it did not completely inhibit the metabolic activities of strain PS19. The herbicide tolerance together with growth promoting activities observed under herbicide stress suggests that Klebsiella sp. strain PS19 could be used as bacterial preparation for facilitating the growth and yields of crops even in soils polluted with herbicides. PMID:20721665

Ahemad, Munees; Saghir Khan, Md

2011-02-01

380

Relationship between Antimicrobial Consumption and the Incidence of Antimicrobial Resistance in Escherichia coli and Klebsiella pneumoniae Isolates  

PubMed Central

Introduction: Gram negative organisms are one of the major causes of nosocomial diseases. Development of resistance to antibiotics by these organisms increases their risk in clinical treatment of patients. It also affects morbidity and mortality hence needs to be monitored and controlled. Aim: The aim of the present study was to analyse the correlation between consumption of parenteral antibiotics and the rates of antimicrobial resistance among the Escherichia coli and Klebsiella pneumoniae isolates collected during Dec 2010 - Jun 2013 from JIPMER hospital. Materials and Methods: Consumption data of parenteral antibiotics in J01 category of Anatomical Therapeutic Chemical (ATC) in JIPMER was obtained and expressed in Defined Daily Doses (DDD) per 1000 inhabitants. Valid consumption and resistance data during the period Dec 2010 to Jun 2013 were obtained at 6 month intervals and were correlated to draw a relationship between antimicrobial consumption and its impact on drug resistance for Escherichia coli and Klebsiella pneumoniae. Results: Escherichia coli isolates showed high resistance for increased use of gentamycin and ciprofloxacin. Increase in antibiotic consumption increases the resistance for Escherichia coli except for amikacin. Among the Klebsiella isolates, meropenem and gentamycin showed high correlations followed by ceftazidime, amikacin, ceftriaxone and ciprofloxacin. Conclusion: In summary, a statistically significant association was noticed between consumption of the studied antimicrobials and resistance of Escherichia coli isolates, except for amikacin and ceftazidime. In the case of Klebsiella pneumoniae, there was a statistically significant association between the resistance rates and consumption of gentamycin, ceftazidime and meropenem. Further, a linear relationship was noted between antimicrobial consumption and resistant isolates of Escherichia coli and Klebsiella pneumoniae, except for Escherichia coli resistance to amikacin.

Joseph, Noyal Mariya; Shewade, Deepak Gopal; Harish, Belgode Narasimha

2015-01-01

381

Predominance of Klebsiella pneumoniae ST14 carrying CTX-M-15 causing neonatal sepsis in Tanzania  

PubMed Central

Background Klebsiella pneumoniae strains expressing ESBLs are a predominant cause of hospital acquired infections. Here we describe the molecular epidemiology of these isolates in a tertiary hospital in Tanzania, as potential pathogens for neonatal infections. Methods Between April 2009 and March 2010 all Klebsiella pneumoniae isolates with phenotypic expression Extended Spectrum Beta Lactamase (ESBL) were collected and characterized. Identification was done using in house biochemical tests in case of ambiguous results confirmation was done using API 20E. Susceptibility testing was determined using the disc diffusion method followed by specific PCR and sequencing to determine ESBL genes. Phylogenetic analysis, Pulse field gel electrophoresis (PFGE) and Multi-Locus sequence typing (MLST) to PFGE clusters representative isolates were performed to determine clones of the isolates. Conjugation and hybridization were performed to determine the location of blaCTX-M-15 gene. Results A total of 92 non- repetitive ESBL producing K. pneumoniae representing 50.3% of Klebsiella pneumoniae isolates were characterized. These isolates were from blood 61 (66%), wound swab 13 (14%), urine 12 (13%) and pus 6 (7%) were analyzed. Most blood culture strains originated from neonatal unit 39/61(64%) and 22 (36%) of the blood culture isolates were from neonatal ICU. All isolates were resistant to gentamicin and 54% were resistant to ciprofloxacin. Using a similarity index of 80%, the isolates were assigned to thirteen clusters based on PFGE patterns and contained sub-clusters with identical strains indicating clonal outbreaks. Cluster X5, X7 and X8, and X9 were grouped into ST48, ST14 and ST348 respectively. Based on gyrA PCR- RFLP phylogenetic analysis all isolates were grouped as KpI. The predominant ESBL allele detected was blaCTX-M-15 which was found in 76% of isolates, followed by blaTEM-104 (19%), blaSHV-11 (3.2%) and blaTEM-176 (2%). The blaCTX-M-15 gene was located in multiple conjugative IncF plasmids ranging from 25 kb-485 kb in size. Conclusion The high prevalence of blaCTX-M-15 observed among ESBL producing K. pneumoniae in Tanzania, is possibly due to the spread of a common IncFII 145 kb plasmid and of certain clones such as ST14 and ST48. Furthermore the 485 kb plasmid detected is the largest plasmid reported to carry blaCTX-M-15 todate. PMID:24099282

2013-01-01

382

Three Activities: Bacteria Study, Micro Study, and Bacteria Killers  

NSDL National Science Digital Library

This resource provides a problem-based activity on risk assessment of environmental health issues. The lesson consists of three related activities: Bacteria Study, Micro Study and Bacteria Killers. "Bacteria Study" gives students hands-on experience with the concepts of epidemiology. "Micro Study" has students sketch, observe, and compare different types of bacteria that can grow in moist conditions. "Bacteria Killers" has students determine what kills bateria, especially in common household products. Detailed instructions are provided for each activity. This resource is free to download. Users must first create a login with ATEEC's website to access the file.

383

Structural and kinetic insights into the mechanism of 5-hydroxyisourate hydrolase from Klebsiella pneumoniae  

SciTech Connect

The stereospecific oxidative degradation of uric acid to (S)-allantoin has recently been demonstrated to proceed via two unstable intermediates and requires three separate enzymatic reactions. The second step of this reaction, the conversion of 5-hydroxyisourate (HIU) to 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline, is catalyzed by HIU hydrolase (HIUH). The high-resolution crystal structure of HIUH from the opportunistic pathogen Klebsiella pneumoniae (KpHIUH) has been determined. KpHIUH is a homotetrameric protein that, based on sequence and structural similarity, belongs to the transthyretin-related protein family. In addition, the steady-state kinetic parameters for this enzyme and four active-site mutants have been measured. These data provide valuable insight into the functional roles of the active-site residues. Based upon the structural and kinetic data, a mechanism is proposed for the KpHIUH-catalyzed reaction.

French, Jarrod B.; Ealick, Steven E. (Cornell)

2011-07-19

384

Multiclonal epidemic of Klebsiella pneumoniae isolates producing DHA-1 in a Spanish hospital.  

PubMed

Between June 2007 and January 2008, 26 Klebsiella pneumoniae isolates carrying bla(DHA-1) on an IncL/M plasmid were obtained from clinical samples at Granollers Hospital, Barcelona, Spain. Three of the isolates also carried a bla(CTX-M-15) gene. The 26 isolates showed 11 pulsed-field gel electrophoresis (PFGE) patterns. Multilocus sequence typing showed that PFGE patterns A, B and C belonged to sequence type (ST)17, D to ST13, E to ST427, F and G to ST416, H to ST37, I to ST440, J to ST326, and K to ST428. Results demonstrated the effectiveness of the infection control programme in place at the centre. This study reports the first characterization of STs for bla(DHA-1) -producing K. pneumoniae isolates. PMID:20673270

Diestra, K; Miró, E; Martí, C; Navarro, D; Cuquet, J; Coll, P; Navarro, F

2011-07-01

385

New strategy to improve efficiency for gene replacement in Klebsiella pneumoniae.  

PubMed

We previously reported the method for introducing gene replacement into Klebsiella pneumoniae through Red-assisted homologous recombination; and it demonstrated that a higher transformation efficiency required long flanking arms at both ends of the linear DNA. The assembly job of the linear DNA is usually time-consuming and laborious. We report here an innovative method for DNA exchange in K. pneumoniae based on PCR-mediated Red recombination. The novel procedure enables rapid gene replacement in K. pneumoniae without prior cloning of the gene of interest; the key modification is to perform PCR reaction to generate linear DNA with extra non-homologous fragments on both ends as mercenary sequences which come from a TA-cloning plasmid. We give a demonstration by deleting the gene dhak1 in K. pneumoniae with high efficiency of about 20 CFU/?g DNA using the new technique. PMID:23478882

Wei, Dong; Sun, Junsong; Shi, Jiping; Liu, Pengfu; Hao, Jian

2013-05-01

386

News and Research Good Bacteria  

E-print Network

News and Research Good Bacteria Part 2 Article 13 Click here for Probiotics Basics Cooperation Is A No-brainer For Symbiotic Bacteria 9-4-2003 Humans may learn cooperation in kindergarten, but what about bacteria, whose behavior is preprogrammed by their DNA? Some legume plants, which rely

West, Stuart

387

Resistance Determinants and Mobile Genetic Elements of an NDM-1-Encoding Klebsiella pneumoniae Strain  

PubMed Central

Multidrug-resistant Enterobacteriaceae are emerging as a serious infectious disease challenge. These strains can accumulate many antibiotic resistance genes though horizontal transfer of genetic elements, those for ?-lactamases being of particular concern. Some ?-lactamases are active on a broad spectrum of ?-lactams including the last-resort carbapenems. The gene for the broad-spectrum and carbapenem-active metallo-?-lactamase NDM-1 is rapidly spreading. We present the complete genome of Klebsiella pneumoniae ATCC BAA-2146, the first U.S. isolate found to encode NDM-1, and describe its repertoire of antibiotic-resistance genes and mutations, including genes for eight ?-lactamases and 15 additional antibiotic-resistance enzymes. To elucidate the evolution of this rich repertoire, the mobile elements of the genome were characterized, including four plasmids with varying degrees of conservation and mosaicism and eleven chromosomal genomic islands. One island was identified by a novel phylogenomic approach, that further indicated the cps-lps polysaccharide synthesis locus, where operon translocation and fusion was noted. Unique plasmid segments and mosaic junctions were identified. Plasmid-borne blaCTX-M-15 was transposed recently to the chromosome by ISEcp1. None of the eleven full copies of IS26, the most frequent IS element in the genome, had the expected 8-bp direct repeat of the integration target sequence, suggesting that each copy underwent homologous recombination subsequent to its last transposition event. Comparative analysis likewise indicates IS26 as a frequent recombinational junction between plasmid ancestors, and also indicates a resolvase site. In one novel use of high-throughput sequencing, homologously recombinant subpopulations of the bacterial culture were detected. In a second novel use, circular transposition intermediates were detected for the novel insertion sequence ISKpn21 of the ISNCY family, suggesting that it uses the two-step transposition mechanism of IS3. Robust genome-based phylogeny showed that a unified Klebsiella cluster contains Enterobacter aerogenes and Raoultella, suggesting the latter genus should be abandoned. PMID:24905728

Hudson, Corey M.; Bent, Zachary W.; Meagher, Robert J.; Williams, Kelly P.

2014-01-01

388

Resistance determinants and mobile genetic elements of an NDM-1-encoding Klebsiella pneumoniae strain.  

PubMed

Multidrug-resistant Enterobacteriaceae are emerging as a serious infectious disease challenge. These strains can accumulate many antibiotic resistance genes though horizontal transfer of genetic elements, those for ?-lactamases being of particular concern. Some ?-lactamases are active on a broad spectrum of ?-lactams including the last-resort carbapenems. The gene for the broad-spectrum and carbapenem-active metallo-?-lactamase NDM-1 is rapidly spreading. We present the complete genome of Klebsiella pneumoniae ATCC BAA-2146, the first U.S. isolate found to encode NDM-1, and describe its repertoire of antibiotic-resistance genes and mutations, including genes for eight ?-lactamases and 15 additional antibiotic-resistance enzymes. To elucidate the evolution of this rich repertoire, the mobile elements of the genome were characterized, including four plasmids with varying degrees of conservation and mosaicism and eleven chromosomal genomic islands. One island was identified by a novel phylogenomic approach, that further indicated the cps-lps polysaccharide synthesis locus, where operon translocation and fusion was noted. Unique plasmid segments and mosaic junctions were identified. Plasmid-borne blaCTX-M-15 was transposed recently to the chromosome by ISEcp1. None of the eleven full copies of IS26, the most frequent IS element in the genome, had the expected 8-bp direct repeat of the integration target sequence, suggesting that each copy underwent homologous recombination subsequent to its last transposition event. Comparative analysis likewise indicates IS26 as a frequent recombinational junction between plasmid ancestors, and also indicates a resolvase site. In one novel use of high-throughput sequencing, homologously recombinant subpopulations of the bacterial culture were detected. In a second novel use, circular transposition intermediates were detected for the novel insertion sequence ISKpn21 of the ISNCY family, suggesting that it uses the two-step transposition mechanism of IS3. Robust genome-based phylogeny showed that a unified Klebsiella cluster contains Enterobacter aerogenes and Raoultella, suggesting the latter genus should be abandoned. PMID:24905728

Hudson, Corey M; Bent, Zachary W; Meagher, Robert J; Williams, Kelly P

2014-01-01

389

Molecular Characterization of Klebsiella pneumoniae Carbapenemase (KPC)-Producing Enterobacteriaceae in Ontario, Canada, 2008-2011  

PubMed Central

Due to the lack of detailed reports of Klebsiella pneumoniae carbapenemase (KPC)-producing enterobacteria in Ontario, Canada, we perform a molecular characterization of KPC-producing Enterobacteriaceae submitted to the provincial reference laboratory from 2008 to 2011. Susceptibility profiles were accessed by E-test. Molecular types of isolates were determined by pulse-field gel electrophoresis (PFGE) and multilocus sequence typing. Screening of ß-lactamase genes was performed by multiplex PCR and alleles were identified by DNA sequencing. The genetic platform of blaKPC gene was analyzed by PCR. Plasmid replicons were typed using PCR-based typing approach. KPC-plasmids were also evaluated by S1 nuclease-PFGE and Southern blot. Thirty unique clinical isolates (26 Klebsiella pneumoniae, 2 Enterobacter cloacae, 1 Citrobacter freundii and 1 Raoultella ornithinolytica) were identified as blaKPC positive: 4 in 2008, 3 in 2009, 10 in 2010 and 13 in 2011. The majority exhibited resistance to carbapenems, cephalosporins and fluoroquinolones and two isolates were also resistant to colistin. The isolates harbored blaKPC-2 (n?=?23) or blaKPC-3 (n?=?7). blaTEM-1 (n?=?27) was commonly detected and occasionally blaOXA-1 (n?=?3) and blaCTX-M-15 (n?=?1). As expected, all K. pneumoniae isolates carried blaSHV-11. blaKPC genes were identified on Tn4401a (n?=?20) or b (n?=?10) isoforms, on plasmids of different sizes belonging to the incompatibility groups IncFIIA (n?=?19), IncN (n?=?3), IncI2 (n?=?3), IncFrep (n?=?2) and IncA/C (n?=?1). The occurrence of KPC ß-lactamase in Ontario was mainly associated with the spread of the K. pneumoniae clone ST258. PMID:25549365

Tijet, Nathalie; Sheth, Prameet M.; Lastovetska, Olga; Chung, Catherine; Patel, Samir N.; Melano, Roberto G.

2014-01-01

390

Exopolysaccharides from marine bacteria  

NASA Astrophysics Data System (ADS)

Microbial polysaccharides represent a class of important products of growing interest for many sectors of industry. In recent years, there has been a growing interest in isolating new exopolysaccharides (EPSs)-producing bacteria from marine environments, particularly from various extreme marine environments. Many new marine microbial EPSs with novel chemical compositions, properties and structures have been found to have potential applications in fields such as adhesives, textiles, Pharmaceuticals and medicine for anti-cancer, food additives, oil recovery and metal removal in mining and industrial waste treatments, etc This paper gives a brief summary of the information about the EPSs produced by marine bacteria, including their chemical compositions, properties and structures, together with their potential applications in industry.

Chi, Zhenming; Fang, Yan

2005-01-01

391

Lipoprotein sorting in bacteria.  

PubMed

Bacterial lipoproteins are synthesized as precursors in the cytoplasm and processed into mature forms on the cytoplasmic membrane. A lipid moiety attached to the N terminus anchors these proteins to the membrane surface. Many bacteria are predicted to express more than 100 lipoproteins, which play diverse functions on the cell surface. The Lol system, composed of five proteins, catalyzes the localization of Escherichia coli lipoproteins to the outer membrane. Some lipoproteins play vital roles in the sorting of other lipoproteins, lipopolysaccharides, and ?-barrel proteins to the outer membrane. On the basis of results from biochemical, genetic, and structural studies, we discuss the biogenesis of lipoproteins in bacteria, their importance in cellular functions, and the molecular mechanisms underlying efficient sorting of hydrophobic lipoproteins to the outer membrane through the hydrophilic periplasm. PMID:21663440

Okuda, Suguru; Tokuda, Hajime

2011-01-01

392

Bacteria, food, and cancer  

PubMed Central

Gut microbes are essential components of the human organism—helping us metabolize food into energy, produce micronutrients, and shape our immune systems. Having a particular pattern of gut microbes is also increasingly being linked to medical conditions including obesity, inflammatory bowel disease, and diabetes. Recent studies now indicate that our resident intestinal bacteria may also play a critical role in determining one's risk of developing cancer, ranging from protection against cancer to promoting its initiation and progression. Gut bacteria are greatly influenced by diet and in this review we explore evidence that they may be the missing piece that explains how dietary intake influences cancer risk, and discuss possible prevention and treatment strategies. PMID:21876723

Rooks, Michelle G.

2011-01-01

393

Reanimation of Ancient Bacteria  

SciTech Connect

Recent highly publicized experiments conducted on salt crystals taken from the Permian Salado Formation in Southeastern New Mexico have shown that some ancient crystals contain viable microorganisms trapped within fluid inclusions. Stringent geological and microbiological selection criteria were used to select crystals and conduct all sampling. This talk will focus on how each of these lines of data support the conclusion that such isolated bacteria are as old as the rock in which they are trapped. In this case, the isolated microbes are salt tolerant bacilli that grow best in media containing 8% NaCl, and respond to concentrated brines by forming spores. One of the organisms is phylogenetically related to several bacilli, but does have several unique characteristics. This talk will trace the interdisciplinary data and procedures supporting these discoveries, and describe the various isolated bacteria.

Russell Vreeland

2009-01-09

394

In vitro antibacterial potency of Butea monosperma Lam. against 12 clinically isolated multidrug resistant bacteria  

PubMed Central

Objective To investigate the antibacterial activity, using cold and hot extraction procedures with five solvents, petroleum ether, acetone, ethanol, methanol and water to validate medicinal uses of Butea monosperma Lam (B. monosperma) in controlling infections; and to qualitatively estimate phytochemical constituents of leaf-extracts of the plant. Methods The antibacterial activity of leaf-extracts was evaluated by the agar-well diffusion method against clinically isolated 12 Gram-positive and -negative multidrug resistant (MDR) pathogenic bacteria in vitro. Values of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of leaf-extracts against each bacterium were obtained in a 96-well micro-titre plate, by broth dilution micro-titre plate technique. Results The presence of tannins, flavonoids, starch, glycosides and carbohydrates in different leaf extracts was established. Pathogenic bacteria used were, Acinetobacter sp., Chromobacterium violaceum, Citrobacter freundii, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhi, Shigella sp., Enterococcus sp., Staphylococcus aureus (S. aureus), methicillin resistant S. aureus and vancomycin resistant S. aureus, along with standard bacterial strains. These MDR bacteria had been recorded to have significant inhibitions by leaf extracts, obtained by cold and hot extraction procedures with five solvents. In addition, the hot aqueous extract against Enterococcus sp. had the highest inhibition zone-size (21 mm). Ciprofloxacin 30 µg/disc was the positive/reference control and the diluting solvent, 10% dimethyl sulphoxide was the negative control. Recorded MIC values of different extracts ranged between 0.23 and 13.30 mg/mL, and MBC values were 0.52 to 30.00 mg/mL, for these bacteria. Conclusions Leaf-extracts with hot water and ethanol had shown significant antibacterial activity against all bacteria. B. monosperma leaf-extract could be used in treating infectious diseases, caused by the range of tested bacteria, as complementary and alternate medicine.

Sahu, Mahesh Chandra; Padhy, Rabindra Nath

2013-01-01

395

Quantitative and Qualitative Analysis of Bacteria in Er(III) Solution by Thin-Film Magnetopheresis  

PubMed Central

Magnetic deposition, quantitation, and identification of bacteria reacting with the paramagnetic trivalent lanthanide ion, Er3+, was evaluated. The magnetic deposition method was dubbed thin-film magnetopheresis. The optimization of the magnetic deposition protocol was accomplished with Escherichia coli as a model organism in 150 mM NaCl and 5 mM ErCl3 solution. Three gram-positive bacteria, Staphylococcus epidermidis, Staphylococcus saprophyticus, and Enterococcus faecalis, and four gram-negative bacteria, E. coli, Pseudomonas aeruginosa, Proteus mirabilis, and Klebsiella pneumoniae, were subsequently investigated. Quantitative analysis consisted of the microscopic cell count and a scattered-light scanning of the magnetically deposited material aided by the computer data acquisition system. Qualitative analysis consisted of Gram stain differentiation and fluorescein isothiocyanate staining in combination with selected antisera against specific types of bacteria on the solid substrate. The magnetic deposition protocol allowed quantitative detection of E. coli down to the concentration of 105 CFU ml-1, significant in clinical diagnosis applications such as urinary tract infections. Er3+ did not interfere with the typical appearance of the Gram-stained bacteria nor with the antigen recognition by the antibody in the immunohistological evaluations. Indirect antiserum-fluorescein isothiocyanate labelling correctly revealed the presence of E. faecalis and P. aeruginosa in the magnetically deposited material obtained from the mixture of these two bacterial species. On average, the reaction of gram-positive organisms was significantly stronger to the magnetic field in the presence of Er3+ than the reaction of gram-negative organisms. The thin-film magnetophoresis offers promise as a rapid method for quantitative and qualitative analysis of bacteria in solutions such as urine or environmental water. Images PMID:16348916

Zborowski, Maciej; Tada, Yoko; Malchesky, Paul S.; Hall, Geraldine S.

1993-01-01

396

Bacteria: More Than Pathogens  

NSDL National Science Digital Library

This ActionBioscience lesson plan has students explore the many roles of bacteria, harmful and beneficial. A detailed article written for ActionBioscience by a microbiologist provides background information, which is followed by discussion questions and educational activities designed for middle school to undergraduate biology courses. The Web site also provides carefully selected links for further exploring the topic, including useful sites for student research projects.

Wassenaar, Trudy M.

397

Glacial Lake Hides Bacteria  

NSDL National Science Digital Library

This article highlights the published work of a geomicrobiology research team led by Eric Gaidos from the University of Hawaii and Brian Lanoil, from the University of California, Riverside. This group reports the identification of bacteria from an Icelandic sub-glacial lake, and how the collection and description of these microorganisms immured within glacial ice and sub-surface water serve as a model in the search for extra-terrestrial life.

2010-03-01

398

Bacteria in Confined Spaces  

NASA Astrophysics Data System (ADS)

Bacterial cells can display differentiation between several developmental pathways, from planktonic to matrix-producing, depending upon the colony conditions. We study the confinement of bacteria in hydrogels as well as in liquid-liquid double emulsion droplets and observe the growth and morphology of these colonies as a function of time and environment. Our results can give insight into the behavior of bacterial colonies in confined spaces that can have applications in the areas of food science, cosmetics, and medicine.

Wilking, Connie; Weitz, David

2010-03-01

399

Glacial lake hides bacteria  

NSDL National Science Digital Library

This article highlights the published work of a geomicrobiology research team led by Eric Gaidos from the University of Hawaii and Brian Lanoil, from the University of California, Riverside. This group reports the identification of bacteria from an Icelandic sub-glacial lake, and how the collection and description of these microorganisms immured within glacial ice and sub-surface water serve as a model in the search for extra-terrestrial life.

Mark Peplow

400

QUORUM SENSING IN BACTERIA  

Microsoft Academic Search

? Abstract Quorum sensing is the regulation of gene expression in response to fluctuations in cell-population density. Quorum sensing bacteria produce and release chemical signal molecules called autoinducers that increase in concentration as a function of cell density. The detection of a minimal threshold stimulatory con- centration of an autoinducer leads to an alteration in gene expression. Gram-positive and Gram-negative

Melissa B. Miller; Bonnie L. Bassler

2001-01-01

401

Antibiotic Resistant Bacteria  

NSDL National Science Digital Library

This week's Topic In Depth is about antibiotic resistant bacteria.The first site is a recent news report from BBC news (1) that describes some recent research on resistant strains of two "of the world's most dangerous bacteria. Next is a Centers for Disease Control (CDC) page (2) with a brief background on antibiotic resistance and how to prevent it. A much more in-depth report is provided by the Select Committee on Science and Technology of the British House of Lords (3). There has been some public concern over the use of antibiotic resistant bacteria strains as markers in genetically modified food crops. The next two resources present information specific to this topic. The first is from the European Federation of Biotechnology (4), and the second is a shorter report from the Council for Biotechnology Information (5). The Alliance for the Prudent Use of Antibiotics (6) has a consumer and patient information section that explains what individuals can do to help prevent the problem from increasing. Readers who need a brief primer on antibiotics may appreciate this Web site from the University of Edinburgh (7). The last site is a "bugs in the news" feature from the University of Kansas (8), which is an easy-to-read explanation of "what the heck" antibiotic resistance is.

Lee, Amy.

2002-01-01

402

Effect of storage of the du Pont lysis-centrifugation system on recovery of bacteria and fungi in a prospective clinical trial.  

PubMed Central

A commercially available lysis-centrifugation system was compared with a conventional biphasic brain heart infusion medium in a prospective clinical study of 5,125 fungal blood cultures. Recovery rates were compared between two time periods to assess the effect of 25 degrees C storage before processing by the lysis-centrifugation system. The lysis-centrifugation tubes processed within 9 h showed a significantly higher yield (3.4 versus 1.49%) for yeasts (Candida glabrata), filamentous fungi (Histoplasma capsulatum), and bacteria (8.84 versus 7.34%) (Klebsiella pneumoniae and Serratia marcescens) than did those processed after 9 h. PMID:6365965

Stockman, L; Roberts, G D; Ilstrup, D M

1984-01-01

403

The effect of complement depletion on lung clearance of bacteria.  

PubMed Central

We have investigated the effect of hypocomplementemia on early pulmonary clearance of four species of bacteria. The experiments were performed in an inbred animal model to minimize immunologic variability. Complement was depleted by cobra venom factor, and activity in serum was monitored with a phagocytic assay. Bacterial specific antibodies were examined by an indirect radioimmunoassay, and animals with high levels of activity were excluded from anaysis. 4 h after aerosolization with Streptococcus pneumoniae, complement-depleted animals had cleared only 75% of the initial number of organisms, whereas saline-treated controls cleared 91% (P less than 0.01). Aerosolization with Pseudomonas aeruginosa was followed at 4 h by a twofold greater growth of organisms in the complement-depleted animals (446% of original deposition) as compared to the saline-treated controls (211% of original deposition) (P less than 0.02). Clearance of Klebsiella pneumoniae and Staphylococcus aureus were similar in complement-depleted animals and saline-treated controls. These experiments suggest that hypocomplementemia predisposes to bacterial pneumonia and may explain the high incidence of pulmonary infections in patients having impaired complement activity. Our results further indicate that varying defense mechanisms may be involved with clearing the lung of differing bacterial species. PMID:27534

Gross, G N; Rehm, S R; Pierce, A K

1978-01-01

404

Evolution of chemotactic-signal transducers in enteric bacteria.  

PubMed Central

The methyl-accepting chemotactic-signal transducers of the enteric bacteria are transmembrane proteins that consist of a periplasmic receptor domain and a cytoplasmic signaling domain. To study their evolution, transducer genes from Enterobacter aerogenes and Klebsiella pneumoniae were compared with transducer genes from Escherichia coli and Salmonella typhimurium. There are at least two functional transducer genes in the nonmotile species K. pneumoniae, one of which complements the defect in serine taxis of an E. coli tsr mutant. The tse (taxis to serine) gene of E. aerogenes also complements an E. coli tsr mutant; the tas (taxis to aspartate) gene of E. aerogenes complements the defect in aspartate taxis, but not the defect in maltose taxis, of an E. coli tar mutant. The sequence was determined for 5 kilobases of E. aerogenes DNA containing a 3' fragment of the cheA gene, cheW, tse, tas, and a 5' fragment of the cheR gene. The tse and tas genes are in one operon, unlike tsr and tar. The cytoplasmic domains of Tse and Tas are very similar to those of E. coli and S. typhimurium transducers. The periplasmic domain of Tse is homologous to that of Tsr, but Tas and Tar are much less similar in this region. However, several short sequences are conserved in the periplasmic domains of Tsr, Tar, Tse, and Tas but not of Tap and Trg, transducers that do not bind amino acids. These conserved regions include residues implicated in amino-acid binding. Images PMID:2496104

Dahl, M K; Boos, W; Manson, M D

1989-01-01

405

Isolation and characterization of arsenic resistant bacteria from wastewater  

PubMed Central

The present study proposed the isolation of arsenic resistant bacteria from wastewater. Only three bacterial isolates (MNZ1, MNZ4 and MNZ6) were able to grow in high concentrations of arsenic. The minimum inhibitory concentrations of arsenic against MNZ1, MNZ4 and MNZ6 were 300 mg/L, 300 mg/L and 370 mg/L respectively. The isolated strains showed maximum growth at 37 °C and at 7.0 pH in control but in arsenite stress Luria Bertani broth the bacterial growth is lower than control. All strains were arsenite oxidizing. All strains were biochemically characterized and ribotyping (16S rRNA) was done for the purpose of identification which confirmed that MNZ1 was homologous to Enterobacter sp. while MNZ4 and MNZ6 showed their maximum homology with Klebsiella pneumoniae. The protein profiling of these strains showed in arsenic stressed and non stressed conditions, so no bands of induced proteins appeared in stressed conditions. The bacterial isolates can be exploited for bioremediation of arsenic containing wastes, since they seem to have the potential to oxidize the arsenite (more toxic) into arsenate (less toxic) form. PMID:25763035

Abbas, Syed Zaghum; Riaz, Mehwish; Ramzan, Naseem; Zahid, M. Tariq; Shakoori, Farah R.; Rafatullah, Mohd.

2014-01-01

406

Detection and Molecular Characterization of Escherichia coli CTX-M-15 and Klebsiella pneumoniae SHV-12 ?-Lactamases from Bovine Mastitis Isolates in the United Kingdom  

PubMed Central

Recent reports raised concerns about the role that farm stock may play in the dissemination of extended-spectrum ?-lactamase (ESBL)-producing bacteria. This study characterized the ESBLs in two Escherichia coli and three Klebsiella pneumoniae subsp. pneumoniae isolates from cases of clinical bovine mastitis in the United Kingdom. Bacterial culture and sensitivity testing of bovine mastitic milk samples identified Gram-negative cefpodoxime-resistant isolates, which were assessed for their ESBL phenotypes. Conjugation experiments and PCR-based replicon typing (PBRT) were used for characterization of transferable plasmids. E. coli isolates belonged to sequence type 88 (ST88; determined by multilocus sequence typing) and carried blaCTX-M-15 and blaTEM-1, while K. pneumoniae subsp. pneumoniae isolates carried blaSHV-12 and blaTEM-1. Conjugation experiments demonstrated that blaCTX-M-15 and blaTEM-1 were carried on a conjugative plasmid in E. coli, and PBRT identified this to be an IncI1 plasmid. The resistance genes were nontransferable in K. pneumoniae subsp. pneumoniae isolates. Moreover, in the E. coli isolates, an association of ISEcp1 and IS26 with blaCTX-M-15 was found where the IS26 element was inserted upstream of both ISEcp1 and the blaCTX-M promoter, a genetic arrangement highly similar to that described in some United Kingdom human isolates. We report the first cases in Europe of bovine mastitis due to E. coli CTX-M-15 and also of bovine mastitis due to K. pneumoniae subsp. pneumoniae SHV-12 ?-lactamases in the United Kingdom. We also describe the genetic environment of blaCTX-M-15 and highlight the role that IncI1 plasmids may play in the spread and dissemination of ESBL genes, which have been described in both human and cattle isolates. PMID:24247146

Maciuca, Iuliana E.; Evans, Nicholas J.; Williams, Helen; Wattret, Andrew; Fick, Jenny C.; Williams, Nicola J.

2014-01-01

407

Effect of the inactivation of lactate dehydrogenase, ethanol dehydrogenase, and phosphotransacetylase on 2,3-butanediol production in Klebsiella pneumoniae strain  

PubMed Central

Background 2,3-Butanediol (2,3-BD) is a high-value chemical usually produced petrochemically but which can also be synthesized by some bacteria. To date, Klebsiella pneumoniae is the most powerful 2,3-BD producer which can utilize a wide range of substrates. However, many by-products are also produced by K. pneumoniae, such as ethanol, lactate, and acetate, which negatively regulate the 2,3-BD yield and increase the costs of downstream separation and purification. Results In this study, we constructed K. pneumoniae mutants with lactate dehydrogenase (LDH), acetaldehyde dehydrogenase (ADH), and phosphotransacetylase (PTA) deletion individually by suicide vector conjugation. These mutants showed different behavior of production formation. Knock out of ldhA had little influence on the yield of 2,3-BD, whereas knock out of adhE or pta significantly improved the formation of 2,3-BD. The accumulation of the intermediate of 2,3-BD biosynthesis, acetoin, was decreased in all the mutants. The mutants were then tested in five different carbon sources and increased 2,3-BD was observed. Also a double mutant strain with deletion of adhE and ldhA was constructed which resulted in accelerated fermentation and higher 2,3-BD production. In fed-batch culture this strain achieved more than 100 g/L 2,3-BD from glucose with a relatively high yield of 0.49 g/g. Conclusion 2,3-BD production was dramatically improved with the inactivation of adhE and pta. The inactivation of ldhA could advance faster cell growth and shorter fermentation time. The double mutant strain with deletion of adhE and ldhA resulted in accelerated fermentation and higher 2,3-BD production. These results provide new insights for industrial production of 2,3-BD by K. pneumoniae. PMID:24669952

2014-01-01

408

YjcC, a c-di-GMP Phosphodiesterase Protein, Regulates the Oxidative Stress Response and Virulence of Klebsiella pneumoniae CG43  

PubMed Central

This study shows that the expression of yjcC, an in vivo expression (IVE) gene, and the stress response regulatory genes soxR, soxS, and rpoS are paraquat inducible in Klebsiella pneumoniae CG43. The deletion of rpoS or soxRS decreased yjcC expression, implying an RpoS- or SoxRS-dependent control. After paraquat or H2O2 treatment, the deletion of yjcC reduced bacterial survival. These effects could be complemented by introducing the ?yjcC mutant with the YjcC-expression plasmid pJR1. The recombinant protein containing only the YjcC-EAL domain exhibited phosphodiesterase (PDE) activity; overexpression of yjcC has lower levels of cyclic di-GMP. The yjcC deletion mutant also exhibited increased reactive oxygen species (ROS) formation, oxidation damage, and oxidative stress scavenging activity. In addition, the yjcC deletion reduced capsular polysaccharide production in the bacteria, but increased the LD50 in mice, biofilm formation, and type 3 fimbriae major pilin MrkA production. Finally, a comparative transcriptome analysis showed 34 upregulated and 29 downregulated genes with the increased production of YjcC. The activated gene products include glutaredoxin I, thioredoxin, heat shock proteins, chaperone, and MrkHI, and proteins for energy metabolism (transporters, cell surface structure, and transcriptional regulation). In conclusion, the results of this study suggest that YjcC positively regulates the oxidative stress response and mouse virulence but negatively affects the biofilm formation and type 3 fimbriae expression by altering the c-di-GMP levels after receiving oxidative stress signaling inputs. PMID:23935824

Huang, Ching-Jou; Wang, Zhe-Chong; Huang, Hsi-Yuan; Huang, Hsien-Da; Peng, Hwei-Ling

2013-01-01

409

“Silent” Dissemination of Klebsiella pneumoniae Isolates Bearing K. pneumoniae Carbapenemase in a Long-term Care Facility for Children and Young Adults in Northeast Ohio  

PubMed Central

Background.?Klebsiella pneumoniae isolates harboring the K. pneumoniae carbapenemase gene (blaKPC) are creating a significant healthcare threat in both acute and long-term care facilities (LTCFs). As part of a study conducted in 2004 to determine the risk of stool colonization with extended-spectrum cephalosporin-resistant gram-negative bacteria, 12 isolates of K. pneumoniae that exhibited nonsusceptibility to extended-spectrum cephalosporins were detected. All were gastrointestinal carriage isolates that were not associated with infection. Methods.?Reassessment of the carbapenem minimum inhibitory concentrations using revised 2011 Clinical Laboratory Standards Institute breakpoints uncovered carbapenem resistance. To further investigate, a DNA microarray assay, PCR-sequencing of bla genes, immunoblotting, repetitive-sequence-based PCR (rep-PCR) and multilocus sequence typing (MLST) were performed. Results.?The DNA microarray detected blaKPC in all 12 isolates, and blaKPC-3 was identified by PCR amplification and sequencing of the amplicon. In addition, a blaSHV-11 gene was detected in all isolates. Immunoblotting revealed “low-level” production of the K. pneumoniae carbapenemase, and rep-PCR indicated that all blaKPC-3-positive K. pneumoniae strains were genetically related (?98% similar). According to MLST, all isolates belonged to sequence type 36. This sequence type has not been previously linked with blaKPC carriage. Plasmids from 3 representative isolates readily transferred the blaKPC-3 to Escherichia coli J-53 recipients. Conclusions.?Our findings reveal the “silent” dissemination of blaKPC-3 as part of Tn4401b on a mobile plasmid in Northeast Ohio nearly a decade ago and establish the first report, to our knowledge, of K. pneumoniae containing blaKPC-3 in an LTCF caring for neurologically impaired children and young adults. PMID:22492318

Viau, Roberto A.; Hujer, Andrea M.; Marshall, Steven H.; Perez, Federico; Hujer, Kristine M.; Briceño, David F.; Dul, Michael; Jacobs, Michael R.; Grossberg, Richard; Toltzis, Philip

2012-01-01

410

Clinical and bacteriological efficacy of amikacin in the treatment of lower urinary tract infection caused by extended-spectrum beta-lactamase-producing Escherichia coli or Klebsiella pneumoniae.  

PubMed

Urinary tract infections (UTIs) caused by extended-spectrum beta-lactamase (ESBL)-producing bacteria have become a growing problem limiting therapeutic options. The aim of this study was to investigate the clinical and microbiological efficacy of amikacin treatment in adult patients with lower UTIs due to ESBL-producing Escherichia coli (Ec) or Klebsiella pneumonia (Kp). We conducted a retrospective study of 36 outpatients aged >18 years with dysuria or problems with frequency or urgency in passing urine; pyuria and a positive urine culture (10(5) cfu/ml) for ESBL producing Ec or Kp which is also resistant to nitrofurantoin, fosfomycin, quinolones and trimethoprim/sulfamethoxazole, between January 2013 and February 2014. Patients received intramuscular amikacin 15 mg/kg/day for 10 days. Clinical success was defined as disappearance of symptoms. Bacteriological success was defined as sterile control urine cultures. 58.3% of patients were female. Age range was 18-89 years. All of the patients had at least one complicating factor. 77.8% of the isolates were E. coli. Clinical success rate was 97.2%. Overall bacteriological success rates were 91.7% on the 3 day of treatment, 97.1% at the end of the treatment and 94.1% on the 7-10 days after treatment. After 28-32 days following the treatment, reinfection was found in 12% whereas relapse was not determined. Nephrotoxicity was developed in one patient. The clinicians should keep in mind that amikacin treatment is an efficient and safe alternative treatment option before the carbapenem treatment especially in patients with lower UTIs caused by ESBL-producing Ec or Kp that are resistant to all oral antibiotics. PMID:25179392

Ipekci, Tumay; Seyman, Derya; Berk, Hande; Celik, Orcun

2014-12-01

411

Detection and molecular characterization of Escherichia coli CTX-M-15 and Klebsiella pneumoniae SHV-12 ?-lactamases from bovine mastitis isolates in the United Kingdom.  

PubMed

Recent reports raised concerns about the role that farm stock may play in the dissemination of extended-spectrum ?-lactamase (ESBL)-producing bacteria. This study characterized the ESBLs in two Escherichia coli and three Klebsiella pneumoniae subsp. pneumoniae isolates from cases of clinical bovine mastitis in the United Kingdom. Bacterial culture and sensitivity testing of bovine mastitic milk samples identified Gram-negative cefpodoxime-resistant isolates, which were assessed for their ESBL phenotypes. Conjugation experiments and PCR-based replicon typing (PBRT) were used for characterization of transferable plasmids. E. coli isolates belonged to sequence type 88 (ST88; determined by multilocus sequence typing) and carried blaCTX-M-15 and blaTEM-1, while K. pneumoniae subsp. pneumoniae isolates carried blaSHV-12 and blaTEM-1. Conjugation experiments demonstrated that blaCTX-M-15 and blaTEM-1 were carried on a conjugative plasmid in E. coli, and PBRT identified this to be an IncI1 plasmid. The resistance genes were nontransferable in K. pneumoniae subsp. pneumoniae isolates. Moreover, in the E. coli isolates, an association of ISEcp1 and IS26 with blaCTX-M-15 was found where the IS26 element was inserted upstream of both ISEcp1 and the blaCTX-M promoter, a genetic arrangement highly similar to that described in some United Kingdom human isolates. We report the first cases in Europe of bovine mastitis due to E. coli CTX-M-15 and also of bovine mastitis due to K. pneumoniae subsp. pneumoniae SHV-12 ?-lactamases in the United Kingdom. We also describe the genetic environment of blaCTX-M-15 and highlight the role that IncI1 plasmids may play in the spread and dissemination of ESBL genes, which have been described in both human and cattle isolates. PMID:24247146

Timofte, Dorina; Maciuca, Iuliana E; Evans, Nicholas J; Williams, Helen; Wattret, Andrew; Fick, Jenny C; Williams, Nicola J

2014-01-01

412

Prevalence of plasmid-mediated quinolone resistance genes among ciprofloxacin-nonsusceptible Escherichia coli and Klebsiella pneumoniae isolated from blood cultures in Korea  

PubMed Central

OBJECTIVES: To analyze the prevalence of plasmid-mediated quinolone resistance (PMQR) determinants in ciprofloxacin-nonsusceptible Escherichia coli and Klebsiella pneumoniae isolated from patients at a tertiary care hospital in Korea. METHODS: A total of 102 nonduplicate isolates of ciprofloxacin-intermediate or ciprofloxacin-resistant E coli (n=80) and K pneumoniae (n=22) from blood cultures were obtained. The qnr (qnrA, qnrB, qnrS), aac(6?)-Ib-cr, qepA and oqxAB genes were detected using polymerase chain reaction (PCR) and confirmed using direct sequencing. To determine whether the PMQR-positive plasmid was horizontally transferable, conjugation experiments were performed. RESULTS: Of the 102 isolates, 81 (79.4%) had one or more PMQR genes; these consisted of 59 (73.8%) E coli and 22 (100%) K pneumoniae isolates. The qnr genes were present in 15 isolates (14.7%): qnrB4 was detected in 10.8% and qnrS1 was detected in 3.9%. The aac(6?)-Ib-cr, qepA and oqxAB genes were detected in 77.5%, 3.9% and 10.8%, respectively. In conjugation experiments, PMQR genes were successfully transferred from seven (8.6%) isolates. The range of minimum inhibitory concentrations of ciprofloxacin for these seven transconjugants increased to 0.5 mg/L to 1 mg/L, which was 16- to 33-fold that of the recipient E coli J53 bacteria. CONCLUSIONS: PMQR genes were highly prevalent among ciprofloxacin-nonsusceptible E coli and K pneumoniae from blood cultures in the authors’ hospital. Therefore, it is necessary to monitor for the spread of PMQR genes of clinical isolates and to ensure careful antibiotic use in a hospital setting. PMID:25285114

Yang, Hee Young; Nam, You Sun; Lee, Hee Joo

2014-01-01

413

Examination of the morphology of bacteria adhering to peritoneal dialysis catheters by scanning and transmission electron microscopy.  

PubMed Central

We examined Tenckhoff peritoneal catheters by scanning and transmission electron microscopy to study the morphology of bacterial adherence. Two catheters were removed from uninfected patients, three from patients with exit site infections, four from patients with peritonitis, and one from a patient with both exit site infection and peritonitis. Infecting organisms included three of Staphylococcus aureus and one each of Enterobacter sp., Staphylococcus epidermidis, Achromobacter xylosoxidans, Serratia sp., Klebsiella sp., and Candida albicans. Considerable morphological variation in adherence to the peritoneal dialysis apparatus occurred. No inflammatory cells were ever seen in association with infected cuffs, only two of the five patients with peritonitis had inflammatory cells associated with their catheters. In both instances, these cells tended to occur in clumps and demonstrated no flattening when in contact with the surface. Colonization of the catheter was uneven--bacteria tended to occur in clusters. Extensive matrix formation was evident in several instances, and condensation of this matrix onto the bacteria during the dehydration process rendered clumps of bacterial cells amorphous at times. Bacteria were adherent to the subcutaneous cuff in those patients with exit site infections. Gram-negative bacteria attached to individual dacron fibers of the cuff, often several layers deep. Gram-positive bacteria tended to adhere in clusters. Images PMID:6228562

Marrie, T J; Noble, M A; Costerton, J W

1983-01-01

414

The inhibitory effect of Zingiber corallinum Hance essential oil on drug-resistant bacteria and evaluation of its acute toxicity  

PubMed Central

Summary Background The excessive and irregular use of antibiotics could result in the generation and diffusion of drug-resistant bacteria. The aim of this study was to investigate the inhibitory effect of Zingiber corallinum Hance essential oil (ZCHO) on drug-resistant bacteria, especially on drug-resistant Acinetobacter baumannii. Material/Methods Susceptibility testing was used to evaluate the effect of ZCHO on growth inhibition of drug-resistant bacteria by paper disk method. Mice orally administered with ZCHO were used to observe acute toxicity and to determine median lethal dose (LD50) of ZCHO. Broth dilution method was used to determine minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of ZCHO on drug-resistant Acinetobacter baumannii. Results ZCHO exhibited an obvious inhibitory effect not only on gram-negative drug-resistant bacteria including Escherichia coli, Klebsiella pneumoniae, Enterobacter cloacae and Acinetobacter baumannii, but also on gram-positive drug-resistant bacteria including Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus haemolyticus. The ZCHO containing 79% terpinen-4-ol revealed better bacteriostatic effect than ZCHO with 34% terpinen-4-ol. The LD50 of ZCHO was 1790.427 mg/kg. The MIC and MBC of ZCHO on drug-resistant Acinetobacter baumannii were 1457.81 mg/L. Conclusions ZCHO has obvious bacteriostasis and bactericidal effects, especially against drug-resistant Acinetobacter baumannii. Therefore, ZCHO is a promising natural bioactive component with antibacterial effect and satisfactory safety due to its low toxicity. PMID:21525802

Yang, Ce; Zhou, Lin-Lin; Wang, Hai-Yan; Huang, Su-Na; Liu, Qing; Hu, Shi-Lin; Li, Ting-Rong; Chen, Yan-Bing; Jiang, Jian-Xin

2011-01-01

415

Pepsin homologues in bacteria  

PubMed Central

Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication and fusion event might be very ancient indeed, preceding the divergence of bacteria and eukaryotes. It is unclear whether all the bacterial homologues are derived from horizontal gene transfer, but those from the plant symbionts probably are. The homologues from oceanic bacteria are most closely related to memapsins (or BACE-1 and BACE-2), but are so divergent that they are close to the root of the phylogenetic tree and to the division of the A1 family into two subfamilies. PMID:19758436

Rawlings, Neil D; Bateman, Alex

2009-01-01

416

Plugging of a Model Rock System by Using Starved Bacteria  

PubMed Central

The effects of starvation on bacterial penetration through artificial rock cores were examined. Klebsiella pneumoniae was starved in a simple salts solution for a duration of up to 4 weeks. These cell suspensions were injected into sintered glass bead cores, and the resulting reductions in core permeabilities were recorded. Vegetative cell cultures of K. pneumoniae grown in a sodium citrate medium were injected into other, similar cores, and the reductions in core permeabilities were recorded. The starved cell suspensions did not completely block the core pores, whereas the vegetative cultures reduced core permeability to less than 1%. Scanning electron microscopy of core sections infiltrated with either vegetative or starved cells showed that the former produced shallow “skin” plugs and copious amounts of glycocalyx at the inlet face, whereas the latter produced very little glycocalyx and the cells were distributed evenly throughout the length of the core. The use of a DNA assay to produce a cell distribution profile showed that, compared with the vegetative cells, starved bacteria were able to penetrate deeper into the cores. This was due to the smaller size of the cells and the reduction in biofilm production. This ability of starved bacteria to penetrate further into cores than the normal-size vegetative cells can be usefully applied to selective plugging for enhanced oil recovery. To further test the suitability of starved cells for use in selective plugging, the activities of starved cells present within cores were monitored before and after nutrient stimulation. Our data indicate that with nutrient stimulation, the starved cells lose their metabolic dormancy and produce reductions in core permeability due to cell growth and polymer production. Images PMID:16347647

MacLeod, F. A.; Lappin-Scott, H. M.; Costerton, J. W.

1988-01-01

417

Phylogenetic diversity and antimicrobial activity of marine bacteria associated with the soft coral Sarcophyton glaucum.  

PubMed

Coral reefs are the most biodiverse and biologically productive of all marine ecosystems. Corals harbor diverse and abundant prokaryotic groups. However, little is known about the diversity of coral-associated microorganisms. We used molecular techniques to identify and compare the culturable bacterial assemblages associated with the soft coral Sarcophyton glaucum from the Red sea. Different media were utilized for microbial isolation, and the phylogeny of the culturable bacteria associated with the coral was analyzed based on 16S rDNA sequencing. The coral associated bacteria were found to be representatives within the Gammaproteobacteria, Actinobacteria, and Firmicutes. Antimicrobial activities of twenty bacterial isolates were tested against four pathogenic bacteria (Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Vibrio fluvialis) and three fungi (Penicillium sp., Aspergillus niger, Candida albicans). A relatively high proportion of bacterial strains displayed distinct antibacterial and antifungal activities, suggesting that soft coral-associated microorganisms may aid their host in protection against marine pathogens. Members of genera Bacillus and Pseudomonas had the highest proportion of antimicrobial activity which supported the hypothesis that they might play a protective role in the coral hosts. PMID:23996153

ElAhwany, Amani M D; Ghozlan, Hanan A; ElSharif, Hafed A; Sabry, Soraya A

2015-01-01

418

Distribution and drug resistance of pathogenic bacteria isolated from cancer hospital in 2013  

PubMed Central

Objective To understand distribution and drug resistance of pathogenic bacteria from a specialized cancer hospital in 2013 in order to provide a basis for rational clinical antimicrobial agents. Methods Pathogenic bacteria identification and drug sensitivity tests were performed with a VITEK 2 compact automatic identification system and data were analyzed using WHONET5.6 software. Results Of the 1,378 strains tested, 980 were Gram-negative bacilli, accounting for 71.1%, in which Klebsiella pneumonia, Escherichia coli and Pseudomonas aeruginosa were the dominant strains. We found 328 Gram-positive coccus, accounting for 23.8%, in which the amount of Staphylococcus aureus was the highest. We identified 46 fungi, accounting for 4.1%. According to the departmental distribution within the hospital, the surgical departments isolated the major strains, accounting for 49.7%. According to disease types, lung cancer, intestinal cancer and esophagus cancer were the top three, accounting for 20.9%, 17.3% and 14.2%, respectively. No strains were resistant to imipenem, ertapenem or vancomycin. Conclusions Pathogenic bacteria isolated from the specialized cancer hospital have different resistance rates compared to commonly used antimicrobial agents; therefore antimicrobial agents to reduce the morbidity and mortality of infections should be used. PMID:25561768

Liu, Linjuan; Li, Qi; Zhang, Qingyun; Wang, Guohong; Xu, Guobin

2014-01-01

419

Vapor-induced transfer of bacteria in the absence of mechanical disturbances.  

PubMed

Transfer of bacteria through water vapor generated at moderate temperatures (30-50°C) in passive solar stills, has scarcely been reported. The objective of this research was to investigate whether bacteria in highly humid atmospheres can get transferred through water vapor in the absence of other transfer media to find their way to the distillate. To achieve this objective, passive solar reactors were chosen as the medium for experimentation, and distillation experiments were conducted by spiking a pure bacterial culture (Escherichia coli, Klebsiella pneumonia or Enterococcus faecalis) in low mineralized water vs. highly mineralized water in the dark under moderate temperatures ranges (30-35°C, 40-45°C and 50-55°C). Results showed that bacteria indeed get transferred with the vapor in stills when not exposed to solar U.V. radiation. The trends observed were adequately explained by a zero-modified Hurdle-Poisson model. The numbers of cultivable bacterial colonies transferred were bacterial size, water type and temperature dependent with highest transfers occurring in E. faecalis>E. coli>K. pneumonia at the 40°C range in low mineralized water. Proper management strategies are recommended to achieve complete disinfection in solar stills. PMID:25169809

Ayoub, G M; Dahdah, L; Alameddine, I; Malaeb, L

2014-09-15

420

Molecular phylogenetic profiling of gut-associated bacteria in larvae and adults of flesh flies.  

PubMed

Flesh flies of the genus Sarcophaga (Diptera: Sarcophagidae) are carrion-breeding, necrophagous insects important in medical and veterinary entomology as potential transmitters of pathogens to humans and animals. Our aim was to analyse the diversity of gut-associated bacteria in wild-caught larvae and adult flesh flies using culture-dependent and culture-independent methods. Analysis of 16S rRNA gene sequences from cultured isolates and clone libraries revealed bacteria affiliated to Proteobacteria, Actinobacteria, Firmicutes and Bacteroidetes in the guts of larval and adult flesh flies. Bacteria cultured from larval and adult flesh fly guts belonged to the genera Acinetobacter, Bacillus, Budvicia, Citrobacter, Dermacoccus, Enterococcus, Ignatzschineria, Lysinibacillus, Myroides, Pasteurella, Proteus, Providencia and Staphylococcus. Phylogenetic analysis showed clone sequences of the genera Aeromonas, Bacillus, Bradyrhizobium, Citrobacter, Clostridium, Corynebacterium, Ignatzschineria, Klebsiella, Pantoea, Propionibacterium, Proteus, Providencia, Serratia, Sporosarcina, Weissella and Wohlfahrtiimonas. Species of clinically significant genera such as Ignatzschineria and Wohlfahrtiimonas spp. were detected in both larvae and adult flesh flies. Sequence analysis of 16S rRNA gene libraries supported culture-based results and revealed the presence of additional bacterial taxa. This study determined the diversity of gut microbiota in flesh flies, which will bolster the ability to assess microbiological risk associated with the presence of these flies. The present data thereby establish a platform for a much larger study. PMID:24805263

Gupta, A K; Rastogi, G; Nayduch, D; Sawant, S S; Bhonde, R R; Shouche, Y S

2014-12-01

421

Gram-negative bacteria that produce carbapenemases causing death attributed to recent foreign hospitalization.  

PubMed

Overseas travel, as a risk factor for the acquisition of infections due to antimicrobial-resistant organisms, has recently been linked to carbapenemase-producing Gram-negative bacteria. Multiresistant Klebsiella pneumoniae, Escherichia coli, and Acinetobacter baumannii strains were isolated from a wound of a Canadian patient with a recent history of hospitalization in India. This resulted in the initiation of outbreak management that included surveillance cultures. Epidemiological and molecular investigations showed that NDM-1-producing K. pneumoniae ST16 and OXA-23-producing A. baumannii ST10 strains were transmitted to 5 other patients, resulting in the colonization of 4 patients and the death of 1 patient due to septic shock caused by the OXA-23-producing A. baumannii strain. The high rate of false positivity of the screening cultures resulted in additional workloads and increased costs for infection control and clinical laboratory work. We believe that this is the first report of an infection with carbapenemase-producing Gram-negative bacteria resulting in death attributed to a patient with recent foreign hospitalization. We recommend routine rectal and wound screening for colonization with multiresistant bacteria for patients who have recently been admitted to hospitals outside Canada. PMID:23612195

Ahmed-Bentley, Jasmine; Chandran, A Uma; Joffe, A Mark; French, Desiree; Peirano, Gisele; Pitout, Johann D D

2013-07-01

422

Acetylene reduction (nitrogen fixation) by pulp and paper mill effluents and by Klebsiella isolated from effluents and environmental situations.  

PubMed

High rates of acetylene (C(2)H(2)) reduction (nitrogenase activity) were observed in woodroom effluent from a neutral sulfite semi-chemical mill under aerobic (up to 644 nmol of C(2)H(4) produced per ml per h) and under anaerobic (up to 135 nmol of C(2)H(4) produced per ml per h) conditions. Pasteurized effluent developed C(2)H(2) reduction activity when incubated under anaerobic but not under aerobic conditions. Activities were increased by addition of 0.5 to 3.0% glucose or xylose. Enrichment and enumeration studies showed that N(2)-fixing Azotobacter and Klebsiella were abundant, and N(2)-fixing Bacillus was present. Of 129 isolates of Klebsiella from pulp mills, lakes, rivers, and drainage and sewage systems, 32% possessed nitrogen-fixing ability. PMID:4425455

Knowles, R; Neufeld, R; Simpson, S

1974-10-01

423

Bacteria in the Cafeteria  

NSDL National Science Digital Library

This activity from the American Museum of Natural History's family magazine series challenges kids to go on a microbe quest to solve a riddle. The online activity begins with a page of directions for how to find the missing letters of the riddle. As kids click their way around a virtual lunchroom, they are given 11 Yes/No questions asking whether the featured bacteria helps people. Along with the answer to the riddle, kids get a round of applause when they correctly answer all 11 questions.

424

Bacteria in Solitary Confinement  

PubMed Central

Even in clonal bacterial cultures, individual bacteria can show substantial stochastic variation, leading to pitfalls in the interpretation of data derived from millions of cells in a culture. In this issue of the Journal of Bacteriology, as part of their study on osmoadaptation in a cyanobacterium, Nanatani et al. describe employing an ingenious microfluidic device that gently cages individual cells (J Bacteriol 197:676–687, 2015, http://dx.doi.org/10.1128/JB.02276-14). The device is a welcome addition to the toolkit available to probe the responses of individual cells to environmental cues. PMID:25488297

2014-01-01

425

The KQ Element, a Complex Genetic Region Conferring Transferable Resistance to Carbapenems, Aminoglycosides, and Fluoroquinolones in Klebsiella pneumoniae  

Microsoft Academic Search

The blaKPC-3 and qnrB19 determinants of transferable Klebsiella pneumoniae plasmid pLRM24 reside within a complex region consisting of a Tn1331 backbone into which a Tn4401-like element and qnrB19 mobilized by an adjacent ISEcp1 insertion sequence have been inserted. This novel element represents a coalescence of genes conferring multidrug resistance in K. pneumoniae. The activities of carbapenems and fluoroquinolones are in-

Louis B. Rice; Lenore L. Carias; Rebecca A. Hutton; Susan D. Rudin; Andrea Endimiani; Robert A. Bonomo

2008-01-01

426

Polymyxin Resistance Caused by mgrB Inactivation Is Not Associated with Significant Biological Cost in Klebsiella pneumoniae.  

PubMed

The inactivation of the mgrB gene, which encodes a negative-feedback regulator of the PhoPQ signaling system, was recently shown to be a common mutational mechanism responsible for acquired polymyxin resistance among carbapenemase-producing Klebsiella pneumoniae strains from clinical sources. In this work, we show that mgrB mutants can easily be selected in vitro from different K. pneumoniae lineages, and mgrB inactivation is not associated with a significant biological cost. PMID:25691629

Cannatelli, Antonio; Santos-Lopez, Alfonso; Giani, Tommaso; Gonzalez-Zorn, Bruno; Rossolini, Gian Maria

2015-05-01

427

Emergence of KPC-producing Klebsiella pneumoniae ST512 isolated from cerebrospinal fluid of a child in Algeria.  

PubMed

We report class A carbapenemase (KPC)-3-producing Klebsiella pneumoniae meningitis in a 6-month-old child in Algeria. Multilocus sequence typing showed that the sequence type obtained corresponded to ST512, an allelic single-locus variant of the pandemic ST258 widely distributed in KPC producers from Europe. To our knowledge, this is the first report of KPC-3-producing K. pneumoniae ST512 in a North African country. PMID:25755890

Bakour, S; Sahli, F; Touati, A; Rolain, J-M

2015-01-01

428

Evaluation of Boronic Acid Disk Tests for Differentiating KPC-Possessing Klebsiella pneumoniae Isolates in the Clinical Laboratory  

Microsoft Academic Search

The worldwide increase in the occurrence and dissemination of KPC -lactamases among gram-negative pathogens makes critical the early detection of these enzymes. Boronic acid disk tests using different antibiotic substrates were evaluated for detection of KPC-possessing Klebsiella pneumoniae isolates. A total of 57 genotypically confirmed KPC-possessing K. pneumoniae isolates with varying carbapenem MICs were examined. To measure the specificity of

Athanassios Tsakris; Ioulia Kristo; Aggeliki Poulou; Katerina Themeli-Digalaki; Alexandros Ikonomidis; Dimitra Petropoulou; Spyros Pournaras; Danai Sofianou

429

Molecular Epidemiology of KPC-Producing Klebsiella pneumoniae Isolates in the United States: Clonal Expansion of Multilocus Sequence Type 258  

Microsoft Academic Search

Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacteriaceae have become more common in the United States and throughout the world. We used pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) to examine the molecular epidemiology of KPC-producing K. pneumoniae isolates sent to the Centers for Disease Control and Prevention (CDC) for reference testing from 1996 to 2008. A dominant strain, sequence type

Brandon Kitchel; J. Kamile Rasheed; Jean B. Patel; Arjun Srinivasan; Shiri Navon-Venezia; Yehuda Carmeli; Alma Brolund; Christian G. Giske

2009-01-01

430

The influence of the culture pH value on the direct glucose oxidative pathway in Klebsiella pneumoniae NCTC 418  

Microsoft Academic Search

Klebsiella pneumoniae NCTC 418 was cultured aerobically in chemostat cultures (D=0.3 h-1; 35°C) under respectively carbon-, phosphate-, potassium-, sulphate-, and ammonia-limited conditions with glucose as the sole carbon and energy source. The effect of the external pH value on glucose metabolism and on the enzymes of the direct glucose oxidative pathway was examined. The pH value of the medium had

R. W. J. Hommes; P. W. Postma; D. W. Tempest; O. M. Neijssel

1989-01-01

431

Inhibition of Gene Expression and Growth by Antisense Peptide Nucleic Acids in a Multiresistant  -Lactamase-Producing Klebsiella pneumoniae Strain  

Microsoft Academic Search

Klebsiella pneumoniae causes common and severe hospital- and community-acquired infections with a high incidence of multidrug resistance. The emergence and spread of -lactamase-producing K. pneumoniae strains highlight the need to develop new therapeutic strategies. In this study, we developed antisense peptide nucleic acids (PNAs) conjugated to the (KFF)3K peptide and investigated whether they could mediate gene-specific antisense effects in K.

Prathiba Kurupati; K. S. W. Tan; G. Kumarasinghe; C. L. Poh

2007-01-01

432

Bloodstream Infections by Extended-Spectrum  -Lactamase-Producing Escherichia coli and Klebsiella pneumoniae in Children: Epidemiology and Clinical Outcome  

Microsoft Academic Search

To determine the epidemiologic features and clinical outcomes of bloodstream infections caused by extend- ed-spectrum -lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae isolates, cases of bac- teremia caused by these organisms in children were analyzed retrospectively. Among the 157 blood isolates recovered from 1993 to 1998 at the Seoul National University Children's Hospital, the prevalence of ESBL production was 17.9%

Yun-Kyung Kim; Hyunjoo Pai; Hoan-Jong Lee; Su-Eun Park; Eun-Hwa Choi; Jungmin Kim; Je-Hak Kim; Eui-Chong Kim

2002-01-01

433

Epidemiology and Successful Control of a Large Outbreak Due to Klebsiella pneumoniae Producing Extended Spectrum b-Lactamases  

Microsoft Academic Search

An outbreak due to extended-spectrum b-lactamase-producing Klebsiella pneumoniae (ESBL-KP) was detect- ed from May 1993 to June 1995. A total of 145 patients, particularly patients in intensive care units (ICUs) (107 patients (72%)), were colonized or infected. Infection developed in 92 (63%) patients, and primary bacteremia caused by ESBL-KP was the most frequent infection (40 of 92 patients (43%)). A

CARMEN PENA; MIQUEL PUJOL; CARMEN ARDANUY; ASUMPTA RICART; ROMAN PALLARES; JOSEFINA LINARES; JAVIER ARIZA; FRANCISCO GUDIOL

434

High concentration and productivity of 1,3-propanediol from continuous fermentation of glycerol by Klebsiella pneumoniae  

Microsoft Academic Search

In a continuous fermentation of glycerol by Klebsiella pneumoniae, a final propanediol concentration of 35.2–48.5 g l?1 and a volumetric productivity of 4.9–8.8 g l?1 h?1 can be obtained at dilution rates between 0.1 and 0.25 h?1. These results correspond to about 80–96% of the theoretical maxima under ideal conditions (no ethanol and hydrogen formation). The highest propanediol concentration achieved

K. Menzel; A.-P. Zeng; W.-D. Deckwer

1997-01-01

435

Risk factors for faecal carriage of Klebsiella pneumoniae producing extended spectrum ?-lactamase (ESBL-KP) in the intensive care unit  

Microsoft Academic Search

In the course of an outbreak of extended-spectrum ?-lactamase producing Klebsiella pneumoniae (ESBL-KP) in an intensive care unit (ICU), we conducted active surveillance to determine the risk factors for ESBL-KP faecal colonization of patients. We used weekly rectal samples during a four-month period. ESBL-KP was found in the faeces of 72 of 188 (38%) patients, and 42 (58%) of them

C. Peña; M. Pujol; A. Ricart; C. Ardanuy; J. Ayats; J. Liñares; F. Garrigosa; J. Ariza; F. Gudiol

1997-01-01

436

Extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae bloodstream infection: risk factors and clinical outcome  

Microsoft Academic Search

Objectives. To study the risk factor for nosocomial bacteremia caused by Escherichia coli or Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) and the influence on patient outcome. Design. Retrospective, single-center study of consecutive bacteremic patients. Settings. A university-affiliated teaching hospital. Patients. A total of 85 patients with nosocomial bacteremia due to E. coli or K. pneumoniae were enrolled. Intervention. None. Measurements

Bin Du; Yun Long; Hongzhong Liu; Dechang Chen; Dawei Liu; Yingchun Xu; Xiuli Xie

2002-01-01