Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo
2017-12-01
Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Does a p53 "Wild-type" Immunophenotype Exclude a Diagnosis of Endometrial Serous Carcinoma?
Fadare, Oluwole; Roma, Andres A; Parkash, Vinita; Zheng, Wenxin; Walavalkar, Vighnesh
2018-01-01
An aberrant p53 immunophenotype may be identified in several histotypes of endometrial carcinoma, and is accordingly recognized to lack diagnostic specificity in and of itself. However, based on the high frequency with which p53 aberrations have historically been identified in endometrial serous carcinoma, a mutation-type immunophenotype is considered to be highly sensitive for the histotype. Using an illustrative case study and a review of the literature, we explore a relatively routine diagnostic question: whether the negative predictive value of a wild-type p53 immunophenotype for serous carcinoma is absolute, that is, whether a p53-wild type immunophenotype is absolutely incompatible with a diagnosis of serous carcinoma. The case is an advanced stage endometrial carcinoma that was reproducibly classified by pathologists from 3 institutions as serous carcinoma based on its morphologic features. By immunohistochemistry, the tumor was p53-wild type (DO-7 clone), diffusely positive for p16 (block positivity), and showed retained expression of PTEN, MSH2, MSH6, MLH1, and PMS2. Next generation sequencing showed that there indeed was an underlying mutation in TP53 (D393fs*78, R213*). The tumor was microsatellite stable, had a low mutational burden (4 mutations per MB), and displayed no mutations in the exonuclease domain of DNA polymerase epsilon (POLE) gene. Other genomic alterations included RB1 mutation (R46fs*19), amplifications in MYST3 and CRKL, and ARID1A deletion (splice site 5125-94_5138del108). A review of the recent literature identified 5 studies in which a total of 259 cases of serous carcinoma were whole-exome sequenced. The average TP53 mutational rate in endometrial serous carcinoma was only 75% (range, 60 to 88). A total of 12 (33%) of 36 immunohistochemical studies reported a p53-aberrant rate of <80% in endometrial serous carcinoma. We discuss in detail several potential explanations that may underlie the scenario of serous carcinoma-like morphology
Insights into wild-type and mutant p53 functions provided by genetically engineered mice.
Donehower, Lawrence A
2014-06-01
Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.
Negative feedback regulation of wild-type p53 biosynthesis.
Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W
1995-01-01
When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087
1996-08-01
J-4030 TITLE: The In Vivo DNA Binding Properties of Wild-Type and Mutant p53 Proteins in Mammary Cell Lines During the Course of Cell Cycle PRINCIPAL...The In Vivo DNA Binding Properties of 5. FUNDING NUMBERS Wild-Type and Mutant p53 Proteins in Mammary Cell Lines DAMD17-94-J-4030 During the Course of...ABSTRACT (Maximum 200 Using a pair of murine cell lines, one lacking p53 and a derivative cell line containing temperature sensitive p53 val 135
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great
Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.
Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel
2016-04-12
p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.
Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T
1999-06-01
The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.
Inhibition of autophagy as a treatment strategy for p53 wild-type acute myeloid leukemia
Folkerts, Hendrik; Hilgendorf, Susan; Wierenga, Albertus T J; Jaques, Jennifer; Mulder, André B; Coffer, Paul J; Schuringa, Jan Jacob; Vellenga, Edo
2017-01-01
Here we have explored whether inhibition of autophagy can be used as a treatment strategy for acute myeloid leukemia (AML). Steady-state autophagy was measured in leukemic cell lines and primary human CD34+ AML cells with a large variability in basal autophagy between AMLs observed. The autophagy flux was higher in AMLs classified as poor risk, which are frequently associated with TP53 mutations (TP53mut), compared with favorable- and intermediate-risk AMLs. In addition, the higher flux was associated with a higher expression level of several autophagy genes, but was not affected by alterations in p53 expression by knocking down p53 or overexpression of wild-type p53 or p53R273H. AML CD34+ cells were more sensitive to the autophagy inhibitor hydroxychloroquine (HCQ) than normal bone marrow CD34+ cells. Similar, inhibition of autophagy by knockdown of ATG5 or ATG7 triggered apoptosis, which coincided with increased expression of p53. In contrast to wild-type p53 AML (TP53wt), HCQ treatment did not trigger a BAX and PUMA-dependent apoptotic response in AMLs harboring TP53mut. To further characterize autophagy in the leukemic stem cell-enriched cell fraction AML CD34+ cells were separated into ROSlow and ROShigh subfractions. The immature AML CD34+-enriched ROSlow cells maintained higher basal autophagy and showed reduced survival upon HCQ treatment compared with ROShigh cells. Finally, knockdown of ATG5 inhibits in vivo maintenance of AML CD34+ cells in NSG mice. These results indicate that targeting autophagy might provide new therapeutic options for treatment of AML since it affects the immature AML subfraction. PMID:28703806
Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília
2016-01-01
Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173
BclxL changes conformation upon binding to wild-type but not mutant p53 DNA binding domain.
Hagn, Franz; Klein, Christian; Demmer, Oliver; Marchenko, Natasha; Vaseva, Angelina; Moll, Ute M; Kessler, Horst
2010-01-29
p53 can induce apoptosis through mitochondrial membrane permeabilization by interaction of its DNA binding region with the anti-apoptotic proteins BclxL and Bcl2. However, little is known about the action of p53 at the mitochondria in molecular detail. By using NMR spectroscopy and fluorescence polarization we characterized the binding of wild-type and mutant p53 DNA binding domains to BclxL and show that the wild-type p53 DNA binding domain leads to structural changes in the BH3 binding region of BclxL, whereas mutants fail to induce such effects due to reduced affinity. This was probed by induced chemical shift and residual dipolar coupling data. These data imply that p53 partly achieves its pro-apoptotic function at the mitochondria by facilitating interaction between BclxL and BH3-only proteins in an allosteric mode of action. Furthermore, we characterize for the first time the binding behavior of Pifithrin-mu, a specific small molecule inhibitor of the p53-BclxL interaction, and present a structural model of the protein-ligand complex. A rather unusual behavior is revealed whereby Pifithrin-mu binds to both sides of the protein-protein complex. These data should facilitate the rational design of more potent specific BclxL-p53 inhibitors.
Bajaj, Swati; Alam, Sk Kayum; Roy, Kumar Singha; Datta, Arindam; Nath, Somsubhra; Roychoudhury, Susanta
2016-07-01
Spindle assembly checkpoint governs proper chromosomal segregation during mitosis to ensure genomic stability. At the cellular level, this event is tightly regulated by UBE2C, an E2 ubiquitin-conjugating enzyme that donates ubiquitin to the anaphase-promoting complex/cyclosome. This, in turn, facilitates anaphase-onset by ubiquitin-mediated degradation of mitotic substrates. UBE2C is an important marker of chromosomal instability and has been associated with malignant growth. However, the mechanism of its regulation is largely unexplored. In this study, we report that UBE2C is transcriptionally activated by the gain-of-function (GOF) mutant p53, although it is transcriptionally repressed by wild-type p53. We showed that wild-type p53-mediated inhibition of UBE2C is p21-E2F4-dependent and GOF mutant p53-mediated transactivation of UBE2C is NF-Y-dependent. We further explored that DNA damage-induced wild-type p53 leads to spindle assembly checkpoint arrest by repressing UBE2C, whereas mutant p53 causes premature anaphase exit by increasing UBE2C expression in the presence of 5-fluorouracil. Identification of UBE2C as a target of wild-type and GOF mutant p53 further highlights the contribution of p53 in regulation of spindle assembly checkpoint. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Ralhan, Ranju; Sandhya, Agarwal; Meera, Mathur; Bohdan, Wasylyk; Nootan, Shukla K.
2000-01-01
MDM2, a critical element of cellular homeostasis mechanisms, is involved in complex interactions with important cell-cycle and stress-response regulators including p53. The mdm2-P2 promoter is a transcriptional target of p53. The aim of this study was to determine the association between mdm2-P2 transcripts and the status of the p53 gene in betel- and tobacco-related oral squamous cell carcinomas (SCCs) to understand the mechanism of deregulation of MDM2 and p53 expression and their prognostic implications in oral tumorigenesis. Elevated levels of MDM2 proteins were observed in 11 of 25 (44%) oral hyperplastic lesions, nine of 15 (60%) dysplastic lesions, and 71 of 100 (71%) SCCs. The intriguing feature of the study was the identification and different subcellular localization of three isoforms of MDM2 (ie, 90 kd, 76 kd, and 57 kd) in oral SCCs and their correlation with p53 overexpression in each tumor. The hallmark of the study was the detection of mdm2-P2 transcripts in 12 of 20 oral SCCs overexpressing both MDM2 and p53 proteins while harboring wild-type p53 alleles. Furthermore, mdm2 amplification was an infrequent event in betel- and tobacco-associated oral tumorigenesis. The differential compartmentalization of the three isoforms of MDM2 suggests that each has a distinct function, potentially in the regulation of p53 and other gene products implicated in oral tumorigenesis. In conclusion, we report herein the first evidence suggesting that enhanced translation of mdm2-P2 transcripts (S-mdm2) may represent an important mechanism of overexpression and consequent stabilization and functional inactivation of wild-type p53 serving as an adverse prognosticator in betel- and tobacco-related oral cancer. The clinical significance of the functional inactivation of wild-type p53 by MDM2 is underscored by the significantly shorter median disease-free survival time (16 months) observed in p53/MDM2-positive cases as compared to those which did not show co-expression of
Waggoner, S E; Baunoch, D A; Anderson, S A; Leigh, F; Zagaja, V G
1998-09-01
Clear cell adenocarcinomas (CCAs) of the vagina and cervix are rare tumors that often overexpress wild-type p53. In vitro, expression of protooncogene bcl-2 can block p53-mediated apoptosis. The objective of this study was to determine if bcl-2 is expressed in CCAs and whether this expression is associated with inhibition of apoptosis. Twenty-one paraffin-embedded clear cell adenocarcinomas were immunohistochemically stained for bcl-2 (antibody M 887, Dako, Carpinteria, CA) and DNA fragmentation (ApopTag, Oncor, Gaithersburg, MD), a marker for apoptosis. Fifteen tumors were associated with in utero exposure to diethylstilbestrol (DES). Prior p53 gene analysis had indicated the presence of wild-type p53 in each tumor. Human lymphoid tissue containing bcl-2-expressing lymphocytes and DNase I-exposed CCA tissue sections were used as positive controls for the bcl-2 and apoptosis assays, respectively. Expression of bcl-2 and DNA fragmentation was classified (0 to 3+) according to percentage of positive cells and intensity of staining. Expression of bcl-2 was identified in each CCA examined, and was strongly positive (2+ to 3+) in 18 of 21 samples. Despite the presence of wild-type p53, only 4 of 21 tumors showed evidence of apoptosis as assessed through DNA fragmentation. DNA damage leads to increased intracellular p53 levels. Overexpression of p53 induces apoptosis as a means of protecting organisms from the development of malignancy. CCAs of the vagina and cervix, which contain wild-type p53 genes and often overexpress p53 protein, presumably have evolved mechanisms to avoid p53-induced apoptosis. Our observations are consistent with the hypothesis that overexpression of bcl-2 can inhibit p53-mediated apoptosis and suggest a mechanism by which these rare tumors can arise without mutation of the p53 gene.
Nieva, Jorge; Song, Byeong-Doo; Rogel, Joseph K.; Kujawara, David; Altobel, Lawrence; Izharrudin, Alicia; Boldt, Grant E.; Grover, Rajesh K.; Wentworth, Anita D.; Wentworth, Paul
2011-01-01
SUMMARY Epidemiologic and clinical evidence points to an increased risk of cancer when coupled with chronic inflammation. However, the molecular mechanisms that underpin this interrelationship remain largely unresolved. Herein we show that the inflammation-derived cholesterol 5,6-secosterol aldehydes, atheronal-A (KA) and –B (ALD), but not the PUFA-derived aldehydes 4-hydroxynonenal (HNE) and 4-hydroxyhexenal (HHE), induce misfolding of wild-type p53 into an amyloidogenic form that binds thioflavin T and Congo Red dyes but cannot bind to a consensus DNA sequence. Treatment of lung carcinoma cells with KA and ALD leads to a loss of function of extracted p53, as determined by analysis of extracted nuclear protein and in activation of p21. Our results uncover a plausible chemical link between inflammation and cancer and expands the already pivotal role of p53 dysfunction and cancer risk. PMID:21802012
Caicedo-Granados, Emiro; Lin, Rui; Fujisawa, Caitlin; Yueh, Bevan; Sangwan, Veena; Saluja, Ashok
2014-12-01
The incidence of high-risk human papillomavirus (HR-HPV) head and neck squamous cell carcinoma (HNSCC) continues to increase, particularly oropharyngeal squamous cell carcinoma (OPSCC) cases. The inactivation of the p53 tumor suppressor gene promotes a chain of molecular events, including cell cycle progression and apoptosis resistance. Reactivation of wild-type p53 function is an intriguing therapeutic strategy. The aim of this study was to investigate whether a novel compound derived from diterpene triepoxide (Minnelide™) can reactivate wild-type p53 function in HPV-positive HNSCC. For all of our in vitro experiments, we used 2 HPV-positive HNSCC cell lines, University of Michigan squamous cell carcinoma (UM-SCC) 47 and 93-VU-147, and 2 HPV-positive human cervical cancer cell lines, SiHa and CaSki. Cells were treated with different concentrations of triptolide and analyzed for p53 activation. Mice bearing UM-SCC 47 subcutaneous xenografts and HPV-positive patient-derived tumor xenografts were treated with Minnelide and evaluated for tumor growth and p53 activation. In HPV-positive HNSCC, Minnelide reactivated p53 by suppressing E6 oncoprotein. Activation of apoptosis followed, both in vitro and in vivo. In 2 preclinical HNSCC animal models (a subcutaneous xenograft model and a patient-derived tumor xenograft model), Minnelide reactivated p53 function and significantly decreased tumor progression and tumor volume. Triptolide and Minnelide caused cell death in vitro and in vivo in HPV-positive HNSCC by reactivating wild-type p53 and thus inducing apoptosis. In addition, in 2 HPV-positive HNSCC animal models, Minnelide decreased tumor progression and induced apoptosis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Immunohistochemical detection of p53 protein in ameloblastoma types.
el-Sissy, N A
1999-05-01
Overexpression of p53 protein in unicystic ameloblastoma (uAB) is denser than in the conventional ameloblastoma (cAB) type, indicating increased wild type p53--suppressing the growth potential of uAB and denoting the early event of neoplastic transformation, probably of a previous odontogenic cyst. Overexpression of p53 in borderline cAB and malignant ameloblastoma (mAB) types might reflect a mutational p53 protein playing an oncogenic role, promoting tumour growth. Overexpression of p53 protein could be a valid screening method for predicting underlying malignant genetic changes in AB types, through increased frequency of immunoreactive cells or increased staining density.
Tang, Yaxiong; Simoneau, Anne R.; Xie, Jun; Shahandeh, Babbak; Zi, Xiaolin
2010-01-01
Flavokawain A is the predominant chalcone from kava extract. We have assessed the mechanisms of flavokawain A's action on cell cycle regulation. In a p53 wild-type, low-grade, and papillary bladder cancer cell line (RT4), flavokawain A increased p21/WAF1 and p27/KIP1, which resulted in a decrease in cyclin-dependent kinase-2 (CDK2) kinase activity and subsequent G1 arrest. The increase of p21/WAF1 protein corresponded to an increased mRNA level, whereas p27/KIP1 accumulation was associated with the down-regulation of SKP2 and then increased the stability of the p27/KIP1 protein. The accumulation of p21/WAF1 and p27/KIP1 was independent of cell cycle position and thus not a result of the cell cycle arrest. In contrast, flavokawain A induced a G2-M arrest in six p53 mutant-type, high-grade bladder cancer cell lines (T24, UMUC3, TCCSUP, 5637, HT1376, and HT1197). Flavokawain A significantly reduced the expression of CDK1-inhibitory kinases, Myt1 and Wee1, and caused cyclin B1 protein accumulation leading to CDK1 activation in T24 cells. Suppression of p53 expression by small interfering RNA in RT4 cells restored Cdc25C expression and down-regulated p21/WAF1 expression, which allowed Cdc25C and CDK1 activation and then led to a G2-M arrest and an enhanced growth-inhibitory effect by flavokawain A. Consistently, flavokawain A also caused a pronounced CDK1 activation and G2-M arrest in p53 knockout but not in p53 wild-type HCT116 cells. This selectivity of flavokawain A for inducing a G2-M arrest in p53-defective cells deserves further investigation as a new mechanism for the prevention and treatment of bladder cancer. PMID:19138991
Swaminathan, Santhanam; Torino, Jennifer L; Burger, Melissa S
2002-01-29
The effect of the tumor suppressor gene TP53 on repair of genomic DNA damage was examined in human urinary bladder transitional cell carcinoma (TCC) cell lines. Utilizing TCC10 containing wild-type p53 (wt-p53) as the parental line, an isogenic set of cell lines was derived by retroviral infection that expressed a transdominant mutant p53 (Arg --> His at codon 273, TDM273-TCC10), or the human papilloma virus 16-E6 oncoprotein (E6-TCC10). 32P-postlabeling analyses were performed on DNA from TCC cultures obtained after treatment with N-hydroxy-4-aminobiphenyl (N-OH-ABP), N-hydroxy-4-acetylaminobiphenyl (N-OH-AABP) and N-acetoxy-4-acetylaminobiphenyl (N-OAc-AABP). The major adduct was identified as N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP) with all three chemicals. The amount of adducts in urothelial DNA ranged between 0.1 and 20 per 10(6) nucleotides, N-OAc-AABP yielding the highest levels, followed by N-OH-ABP and N-OH-AABP. To determine, if the functional status of p53 affects the rate of repair of dG-C8-ABP in genomic DNA, TCC10 and the TDM273-TCC10 and E6-TCC10 isotypes were exposed to N-OH-AABP for 12h and the DNA damage was allowed to repair up to 24h. The adduct levels were quantified and compared between the TCC10 isotypes. The amounts of dG-C8-ABP that remained in genomic DNA from E6-TCC10 and TDM273-TCC10 were approximately two-fold higher, as compared to the parental TCC10. At the dose used for DNA repair studies, N-OH-AABP or N-OAc-AABP did not induce apoptosis in TCC10. However, N-OAc-AABP at high doses (>5 microM) induced apoptosis, as evidenced by DNA fragmentation analyses. Furthermore, N-OAc-AABP-mediated apoptosis was independent of the functional status of wt-p53, since both E6-TCC10 and the parental TCC10 exhibited DNA fragmentation following treatment. These results suggest that p53 might modulate the repair of DNA adducts generated from the human bladder carcinogen ABP in its target human uroepithelial cells. This implies that in p53
Choi, Tae Gyu; Nguyen, Minh Nam; Kim, Jieun; Jo, Yong Hwa; Jang, Miran; Nguyen, Ngoc Ngo Yen; Yun, Hyeong Rok; Choe, Wonchae; Kang, Insug; Ha, Joohun; Tang, Dean G; Kim, Sung Soo
2018-06-06
Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Chemoresistance is a major problem for effective therapy in CRC. Here, we investigated the mechanism by which peptidylprolyl isomerase B (PPIB; cyclophilin B, CypB) regulates chemoresistance in CRC. We found that CypB is a novel wild type p53 (p53WT)-inducible gene but a negative regulator of p53WT in response to oxaliplatin treatment. Overexpression of CypB shortens the half-life of p53WT and inhibits oxaliplatin-induced apoptosis in CRC cells, whereas knockdown of CypB lengthens the half-life of p53WT and stimulates p53WT dependent apoptosis. CypB interacts directly with MDM2, and enhances MDM2-dependent p53WT ubiquitination and degradation. Furthermore, we firmly validated using bioinformatics analyses that overexpression of CypB is associated with poor prognosis in CRC progression and chemoresistance. Hence, we suggest a novel mechanism of chemoresistance caused by overexpressed CypB, which may help to develop new anti-cancer drugs. We also propose that CypB may be utilized as a predictive biomarker in CRC patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Ireno, Ivanildce Cristiane; Wiehe, Rahel Stephanie; Stahl, Andreea Iulia; Hampp, Stephanie; Aydin, Sevtap; Troester, Melissa A; Selivanova, Galina; Wiesmüller, Lisa
2014-10-01
Synthetic lethal interactions between poly (ADP-ribose) polymerase (PARP) and homologous recombination (HR) repair pathways have been exploited for the development of novel mono- and combination cancer therapies. The tumor suppressor p53 was demonstrated to exhibit indirect and direct regulatory activities in DNA repair, particularly in DNA double-strand break (DSB)-induced and replication-associated HR. In this study, we tested a potential influence of the p53 status on the response to PARP inhibition, which is known to cause replication stress. Silencing endogenous or inducibly expressing p53 we found a protective effect of p53 on PARP inhibitor (PARPi)-mediated cytotoxicities. This effect was specific for wild-type versus mutant p53 and observed in cancer but not in non-transformed cell lines. Enhanced cytotoxicities after treatment with the p53-inhibitory drug Pifithrinα further supported p53-mediated resistance to PARP inhibition. Surprisingly, we equally observed increased PARPi sensitivity in the presence of the p53-activating compound Nutlin-3. As a common denominator, both drug responses correlated with decreased HR activities: Pifithrinα downregulated spontaneous HR resulting in damage accumulation. Nutlin-3 induced a decrease of DSB-induced HR, which was accompanied by a severe drop in RAD51 protein levels. Thus, we revealed a novel link between PARPi responsiveness and p53-controlled HR activities. These data expand the concept of cell and stress type-dependent healer and killer functions of wild-type p53 in response to cancer therapeutic treatment. Our findings have implications for the individualized design of cancer therapies using PARPi and the potentially combined use of p53-modulatory drugs. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio
2013-01-01
Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E
1996-09-01
Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.
Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A
1998-01-01
Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.
Poirier, Miriam C.
2012-01-01
We have evaluated DNA damage (DNA adduct formation) after feeding benzo[a]pyrene (BP) to wild-type (WT) and cancer-susceptible Xpa(−/−)p53(+/−) mice deficient in nucleotide excision repair and haploinsufficient for the tumor suppressor p53. DNA damage was evaluated by high-performance liquid chromatography/electrospray ionization tandem mass spectrometry (HPLC/ES-MS/MS), which measures r7,t8,t9-trihydroxy-c-10-(N 2-deoxyguanosyl)-7,8,9,10-tetrahydrobenzo[a]pyrene (BPdG), and a chemiluminescence immunoassay (CIA), using anti-r7,t8-dihydroxy-t-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE)–DNA antiserum, which measures both BPdG and the other stable BP-DNA adducts. When mice were fed 100 ppm BP for 28 days, BP-induced DNA damage measured in esophagus, liver and lung was typically higher in Xpa(−/−)p53(+/−) mice, compared with WT mice. This result is consistent with the previously observed tumor susceptibility of Xpa(−/−)p53(+/−) mice. BPdG, the major DNA adduct associated with tumorigenicity, was the primary DNA adduct formed in esophagus (a target tissue in the mouse), whereas total BP-DNA adducts predominated in higher levels in the liver (a non-target tissue in the mouse). In an attempt to lower BP-induced DNA damage, we fed the WT and Xpa(−/−)p53(+/−) mice 0.3% chlorophyllin (CHL) in the BP-containing diet for 28 days. The addition of CHL resulted in an increase of BP–DNA adducts in esophagus, liver and lung of WT mice, a lowering of BPdG in esophagi of WT mice and livers of Xpa(−/−)p53(+/−) mice and an increase of BPdG in livers of WT mice. Therefore, the addition of CHL to a BP-containing diet showed a lack of consistent chemoprotective effect, indicating that oral CHL administration may not reduce PAH–DNA adduct levels consistently in human organs. PMID:22828138
Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.
2000-01-01
p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327
Zn(II)-curc targets p53 in thyroid cancer cells.
Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella
2015-10-01
TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.
Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.
Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L
1999-12-01
The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Mechanisms of Breast Carcinogenesis Involving Wild-Type p53
2001-09-01
Nelson, C. E., Gryka , M . A., Litwak, G., Gebhardt, M ., level of p53 that was expressed in the cells in both these studies Bressac, B., Ozturk, M ., Baker...14 Publication resulting from this research: 1. Resnick-Silverman, L., S. St Clair, M . Maurer, K...activation by the tumor suppressor protein p53. Genes Dev 12:2102-7. 2. Tang, H. Y., K. Zhao, J. F. Pizzolato, M . Fonarev, J. C. Langer, and J. J
NASA Technical Reports Server (NTRS)
Kohli, M.; Jorgensen, T. J.
1999-01-01
The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.
Nitric oxide prodrug JS-K inhibits ubiquitin E1 and kills tumor cells retaining wild-type p53.
Kitagaki, J; Yang, Y; Saavedra, J E; Colburn, N H; Keefer, L K; Perantoni, A O
2009-01-29
Nitric oxide (NO) is a major effector molecule in cancer prevention. A number of studies have shown that NO prodrug JS-K (O(2)-(2,4-dinitrophenyl) 1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate) induces apoptotic cell death in vitro and in vivo, indicating that it is a promising new therapeutic for cancer. However, the mechanism of its tumor-killing activity remains unclear. Ubiquitin plays an important role in the regulation of tumorigenesis and cell apoptosis. Our earlier report has shown that inactivation of the ubiquitin system through blocking E1 (ubiquitin-activating enzyme) activity preferentially induces apoptosis in p53-expressing transformed cells. As E1 has an active cysteine residue that could potentially interact with NO, we hypothesized that JS-K could inactivate E1 activity. E1 activity was evaluated by detecting ubiquitin-E1 conjugates through immunoblotting. JS-K strikingly inhibits the ubiquitin-E1 thioester formation in cells in a dose-dependent manner with an IC(50) of approximately 2 microM, whereas a JS-K analog that cannot release NO did not affect these levels in cells. Moreover, JS-K decreases total ubiquitylated proteins and increases p53 levels, which is mainly regulated by ubiquitin and proteasomal degradation. Furthermore, JS-K preferentially induces cell apoptosis in p53-expressing transformed cells. These findings indicate that JS-K inhibits E1 activity and kills transformed cells harboring wild-type p53.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Finlay, C.A.; Hinds, P.W.; Tan, T.H.
1988-02-01
The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less
Modeling the Etiology of p53-mutated Cancer Cells*
Perez, Ricardo E.; Shen, Hong; Duan, Lei; Kim, Reuben H.; Kim, Terresa; Park, No-Hee; Maki, Carl G.
2016-01-01
p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. PMID:27022024
Preclinical efficacy of the MDM2 inhibitor RG7112 in MDM2 amplified and TP53 wild-type glioblastomas
Verreault, Maite; Schmitt, Charlotte; Goldwirt, Lauriane; Pelton, Kristine; Haidar, Samer; Levasseur, Camille; Guehennec, Jeremy; Knoff, David; Labussiere, Marianne; Marie, Yannick; Ligon, Azra H.; Mokhtari, Karima; Hoang-Xuan, Khe; Sanson, Marc; Alexander, Brian M; Wen, Patrick Y.; Delattre, Jean-Yves; Ligon, Keith L.; Idbaih, Ahmed
2016-01-01
Rationale p53 pathway alterations are key molecular events in glioblastoma (GBM). MDM2 inhibitors increase expression and stability of p53 and are presumed to be most efficacious in patients with TP53 wild-type and MDM2-amplified cancers. However, this biomarker hypothesis has not been tested in patients or patient-derived models for GBM. Methods We performed a preclinical evaluation of RG7112 MDM2 inhibitor, across a panel of 36 patient-derived GBM cell lines (PDCLs), each genetically characterized according to their P53 pathway status. We then performed a pharmacokinetic (PK) profiling of RG7112 distribution in mice and evaluated the therapeutic activity of RG7112 in orthotopic and subcutaneous GBM models. Results MDM2-amplified PDCLs were 44 times more sensitive than TP53 mutated lines that showed complete resistance at therapeutically attainable concentrations (avg. IC50 of 0.52 μM vs 21.9 μM). MDM4 amplified PDCLs were highly sensitive but showed intermediate response (avg. IC50 of 1.2 μM), whereas response was heterogeneous in TP53 wild-type PDCLs with normal MDM2/4 levels (avg. IC50 of 7.7 μM). In MDM2-amplified lines, RG7112 restored p53 activity inducing robust p21 expression and apoptosis. PK profiling of RG7112-treated PDCL intracranial xenografts demonstrated that the compound significantly crosses the blood-brain and the blood-tumor barriers. Most importantly, treatment of MDM2-amplified/TP53 wild-type PDCL-derived model (subcutaneous and orthotopic) reduced tumor growth, was cytotoxic, and significantly increased survival. Conclusion These data strongly support development of MDM2 inhibitors for clinical testing in MDM2-amplified GBM patients. Moreover, significant efficacy in a subset of non-MDM2 amplified models suggests that additional markers of response to MDM2 inhibitors must be identified. PMID:26482041
Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid
2017-01-01
The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
p53 mutations promote proteasomal activity.
Oren, Moshe; Kotler, Eran
2016-07-27
p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.
2013-01-01
results utilizing our new theoretical strategy show that the residual secondary structure conversion stabilities resulting in α-helix formation are not significantly affected by the mutation. Interestingly, the residual secondary structure conversion stabilities show that secondary structure conversions resulting in β-sheet formation are influenced by the A53T mutation and the most stable residual transition yielding β-sheet occurs directly from the coil structure. Long-range interactions detected between the NAC region and the N- or C-terminal regions of the wild-type αS disappear upon A53T mutation. The A53T mutant-type αS structures are thermodynamically more stable than those of the wild-type αS protein structures in aqueous solution. Overall, the higher propensity of the A53T mutant-type αS protein to aggregate in comparison to the wild-type αS protein is related to the increased β-sheet formation and lack of strong intramolecular long-range interactions in the N-terminal region in comparison to its wild-type form. The specific residual secondary structure component stabilities reported herein provide information helpful for designing and synthesizing small organic molecules that can block the β-sheet forming residues, which are reactive toward aggregation. PMID:23607785
Coskuner, Orkid; Wise-Scira, Olivia
2013-07-17
utilizing our new theoretical strategy show that the residual secondary structure conversion stabilities resulting in α-helix formation are not significantly affected by the mutation. Interestingly, the residual secondary structure conversion stabilities show that secondary structure conversions resulting in β-sheet formation are influenced by the A53T mutation and the most stable residual transition yielding β-sheet occurs directly from the coil structure. Long-range interactions detected between the NAC region and the N- or C-terminal regions of the wild-type αS disappear upon A53T mutation. The A53T mutant-type αS structures are thermodynamically more stable than those of the wild-type αS protein structures in aqueous solution. Overall, the higher propensity of the A53T mutant-type αS protein to aggregate in comparison to the wild-type αS protein is related to the increased β-sheet formation and lack of strong intramolecular long-range interactions in the N-terminal region in comparison to its wild-type form. The specific residual secondary structure component stabilities reported herein provide information helpful for designing and synthesizing small organic molecules that can block the β-sheet forming residues, which are reactive toward aggregation.
MicroRNAs as Key Effectors in the p53 Network.
Goeman, Frauke; Strano, Sabrina; Blandino, Giovanni
2017-01-01
The guardian of the genome p53 is embedded in a fine-spun network of MicroRNAs. p53 is able to activate or repress directly the transcription of MicroRNAs that are participating in the tumor-suppressive mission of p53. On the other hand, the expression of p53 is under tight control of MicroRNAs that are either targeting directly p53 or factors that are modifying its protein level or activity. Although the most important function of p53 is suggested to be transcriptional regulation, there are several nontranscriptional functions described. One of those regards the modulation of MicroRNA biogenesis. Wild-type p53 is increasing the maturation of selected MicroRNAs from the primary transcript to the precursor MiRNA by interacting with the Microprocessor complex. Furthermore, p53 is modulating the mRNA accessibility for certain MicroRNAs by association with the RISC complex and transcriptional regulation of RNA-binding proteins. In this way p53 is able to remodel the MiRNA-mRNA interaction network. As wild-type p53 is employing MicroRNAs to suppress cancer development, gain-of-function mutant p53 proteins use MicroRNAs to confer oncogenic properties like chemoresistance and the ability to drive metastasis. Like its wild-type counterpart mutant p53 is able to regulate MicroRNAs transcriptionally and posttranscriptionally. Mutant p53 affects the MiRNA processing at two cleavage steps through interfering with the Microprocessor complex and by downregulating Dicer and KSRP, a modulator of MiRNA biogenesis. Thus, MicroRNAs are essential components in the p53 pathway, contributing substantially to combat or enhance tumor development depending on the wild-type or mutant p53 context. © 2017 Elsevier Inc. All rights reserved.
Therapeutic targeting of the p53 pathway in cancer stem cells
Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.
2013-01-01
Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602
2010-01-01
Background α-Santalol, an active component of sandalwood oil, has shown chemopreventive effects on skin cancer in different murine models. However, effects of α-santalol on cell cycle have not been studied. Thus, the objective of this study was to investigate effects of α-santalol on cell cycle progression in both p53 mutated human epidermoid carcinoma A431 cells and p53 wild-type human melanoma UACC-62 cells to elucidate the mechanism(s) of action. Methods MTT assay was used to determine cell viability in A431 cells and UACC-62; fluorescence-activated cell sorting (FACS) analysis of propidium iodide staining was used for determining cell cycle distribution in A431 cells and UACC-62 cells; immunoblotting was used for determining the expression of various proteins and protein complexes involved in the cell cycle progression; siRNA were used to knockdown of p21 or p53 in A431 and UACC-62 cells and immunofluorescence microscopy was used to investigate microtubules in UACC-62 cells. Results α-Santalol at 50-100 μM decreased cell viability from 24 h treatment and α-santalol at 50 μM-75 μM induced G2/M phase cell cycle arrest from 6 h treatment in both A431 and UACC-62 cells. α-Santalol altered expressions of cell cycle proteins such as cyclin A, cyclin B1, Cdc2, Cdc25c, p-Cdc25c and Cdk2. All of these proteins are critical for G2/M transition. α-Santalol treatment up-regulated the expression of p21 and suppressed expressions of mutated p53 in A431 cells; whereas, α-santalol treatment increased expressions of wild-type p53 in UACC-62 cells. Knockdown of p21 in A431 cells, knockdown of p21 and p53 in UACC-62 cells did not affect cell cycle arrest caused by α-santalol. Furthermore, α-santalol caused depolymerization of microtubules similar to vinblastine in UACC-62 cells. Conclusions This study for the first time identifies effects of α-santalol in G2/M phase arrest and describes detailed mechanisms of G2/M phase arrest by this agent, which might be
Recognition of Local DNA Structures by p53 Protein
Brázda, Václav; Coufal, Jan
2017-01-01
p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J
2012-01-01
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J
2012-04-05
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.
Burmakin, Mikhail; Shi, Yao; Hedström, Elisabeth; Kogner, Per; Selivanova, Galina
2013-09-15
Restoration of the p53 function in tumors is a promising therapeutic strategy due to the high potential of p53 as tumor suppressor and the fact that established tumors depend on p53 inactivation for their survival. Here, we addressed the question whether small molecule RITA can reactivate p53 in neuroblastoma and suppress the growth of neuroblastoma cells in vitro and in vivo. The ability of RITA to inhibit growth and to induce apoptosis was shown in seven neuroblastoma cell lines. Mechanistic studies were carried out to determine the p53 dependence and the molecular mechanism of RITA-induced apoptosis in neuroblastoma, using cell viability assays, RNAi silencing, co-immunoprecipitation, qPCR, and Western blotting analysis. In vivo experiments were conducted to study the effect of RITA on human neuroblastoma xenografts in mice. RITA induced p53-dependent apoptosis in a set of seven neuroblastoma cell lines, carrying wild-type or mutant p53; it activated p53 and triggered the expression of proapoptotic p53 target genes. Importantly, p53 activated by RITA inhibited several key oncogenes that are high-priority targets for pharmacologic anticancer strategies in neuroblastoma, including N-Myc, Aurora kinase, Mcl-1, Bcl-2, Wip-1, MDM2, and MDMX. Moreover, RITA had a strong antitumor effect in vivo. Reactivation of wild-type and mutant p53 resulting in the induction of proapoptotic factors along with ablation of key oncogenes by compounds such as RITA may be a highly effective strategy to treat neuroblastoma. ©2013 AACR.
Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko
2015-01-01
A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.
Impact of p53 status on heavy-ion radiation-induced micronuclei in circulating erythrocytes
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Torous, D.; Lutze-Mann, L.; Winegar, R.
2000-01-01
Transgenic mice that differed in their p53 genetic status were exposed to an acute dose of highly charged and energetic (HZE) iron particle radiation. Micronuclei (MN) in two distinct populations of circulating peripheral blood erythrocytes, the immature reticulocytes (RETs) and the mature normochromatic erythrocytes (NCEs), were measured using a simple and efficient flow cytometric procedure. Our results show significant elevation in the frequency of micronucleated RETs (%MN-RETs) at 2 and 3 days post-radiation. At 3 days post-irradiation, the magnitude of the radiation-induced MN-RET was 2.3-fold higher in the irradiated p53 wild-type animals compared to the unirradiated controls, 2.5-fold higher in the p53 hemizygotes and 4.3-fold higher in the p53 nullizygotes. The persistence of this radiation-induced elevation of MN-RETs is dependent on the p53 genetic background of the animal. In the p53 wild-type and p53 hemizygotes, %MN-RETs returned to control levels by 9 days post-radiation. However, elevated levels of %MN-RETs in p53 nullizygous mice persisted beyond 56 days post-radiation. We also observed elevated MN-NCEs in the peripheral circulation after radiation, but the changes in radiation-induced levels of MN-NCEs appear dampened compared to those of the MN-RETs for all three strains of animals. These results suggest that the lack of p53 gene function may play a role in the iron particle radiation-induced genomic instability in stem cell populations in the hematopoietic system.
Decreased Virus Population Diversity in p53-Null Mice Infected with Weakly Oncogenic Abelson Virus
Marchlik, Erica; Kalman, Richard; Rosenberg, Naomi
2005-01-01
The Abelson murine leukemia virus (Ab-MLV), like other retroviruses that contain v-onc genes, arose following a recombination event between a replicating retrovirus and a cellular oncogene. Although experimentally validated models have been presented to address the mechanism by which oncogene capture occurs, very little is known about the events that influence emerging viruses following the recombination event that incorporates the cellular sequences. One feature that may play a role is the genetic makeup of the host in which the virus arises; a number of host genes, including oncogenes and tumor suppressor genes, have been shown to affect the pathogenesis of many murine leukemia viruses. To examine how a host gene might affect an emerging v-onc gene-containing retrovirus, we studied the weakly oncogenic Ab-MLV-P90A strain, a mutant that generates highly oncogenic variants in vivo, and compared the viral populations in normal mice and mice lacking the p53 tumor suppressor gene. While variants arose in both p53+/+ and p53−/− tumors, the samples from the wild-type animals contained a more diverse virus population. Differences in virus population diversity were not observed when wild-type and null animals were infected with a highly oncogenic wild-type strain of Ab-MLV. These results indicate that p53, and presumably other host genes, affects the selective forces that operate on virus populations in vivo and likely influences the evolution of oncogenic retroviruses such as Ab-MLV. PMID:16140739
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-07-15
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.
Constant p53 Pathway Inactivation in a Large Series of Soft Tissue Sarcomas with Complex Genetics
Pérot, Gaëlle; Chibon, Frédéric; Montero, Audrey; Lagarde, Pauline; de Thé, Hugues; Terrier, Philippe; Guillou, Louis; Ranchère, Dominique; Coindre, Jean-Michel; Aurias, Alain
2010-01-01
Alterations of the p53 pathway are among the most frequent aberrations observed in human cancers. We have performed an exhaustive analysis of TP53, p14, p15, and p16 status in a large series of 143 soft tissue sarcomas, rare tumors accounting for around 1% of all adult cancers, with complex genetics. For this purpose, we performed genomic studies, combining sequencing, copy number assessment, and expression analyses. TP53 mutations and deletions are more frequent in leiomyosarcomas than in undifferentiated pleomorphic sarcomas. Moreover, 50% of leiomyosarcomas present TP53 biallelic inactivation, whereas most undifferentiated pleomorphic sarcomas retain one wild-type TP53 allele (87.2%). The spectrum of mutations between these two groups of sarcomas is different, particularly with a higher rate of complex mutations in undifferentiated pleomorphic sarcomas. Most tumors without TP53 alteration exhibit a deletion of p14 and/or lack of mRNA expression, suggesting that p14 loss could be an alternative genotype for direct TP53 inactivation. Nevertheless, the fact that even in tumors altered for TP53, we could not detect p14 protein suggests that other p14 functions, independent of p53, could be implicated in sarcoma oncogenesis. In addition, both p15 and p16 are frequently codeleted or transcriptionally co-inhibited with p14, essentially in tumors with two wild-type TP53 alleles. Conversely, in TP53-altered tumors, p15 and p16 are well expressed, a feature not incompatible with an oncogenic process. PMID:20884963
Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy
Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.
2006-01-01
The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686
Liang, Yayun; Mafuvadze, Benford; Besch-Williford, Cynthia; Hyder, Salman M
2018-01-01
Background Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53) lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood vessels, which serve as the major route for tumor metastasis, in tumor xenografts compared with either agent alone. Conclusion Based on our findings, we contend that breast tumor growth might effectively be controlled by simultaneous
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-11-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717
Mechanisms of Breast Carcinogenesis Involving Wild-Type p53
1999-09-01
Gryka , M . A., Litwak, G., Gebhardt, M ., level of p53 that was expressed in the cells in both these studies Bressac, B., Ozturk, M ., Baker, S. J...research: Tang, H., Zhao, K., Pizzolato, J.F., Fonarev, M ., Langer, J.C., and Manfredi, J.J. (1998) Constitutive expression of the cyclin-dependent...Biol. Chem. 274: 33747-33755. Meeting abstracts resulting from this, research: Resnick-Silverman, L., St. Clair, S., Thornborrow, E., Maurer, M
S100A4 interacts with p53 in the nucleus and promotes p53 degradation.
Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J
2013-12-05
S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.
Self-aggregation and coaggregation of the p53 core fragment with its aggregation gatekeeper variant.
Lei, Jiangtao; Qi, Ruxi; Wei, Guanghong; Nussinov, Ruth; Ma, Buyong
2016-03-21
Recent studies suggested that p53 aggregation can lead to loss-of-function (LoF), dominant-negative (DN) and gain-of-function (GoF) effects, with adverse cancer consequences. The p53 aggregation-nucleating (251)ILTIITL(257) fragment is a key segment in wild-type p53 aggregation; however, an I254R mutation can prevent it. It was suggested that self-assembly of wild-type p53 and its cross-interaction with mutants differ from the classical amyloid nucleation-growth mechanism. Here, using replica exchange molecular dynamics (REMD) simulations, we studied the cross-interactions of this p53 core fragment and its aggregation rescue I254R mutant. We found that the core fragment displays strong aggregation propensity, whereas the gatekeeper I254R mutant tends to be disordered, consistent with experiments. Our cross-interaction results reveal that the wild-type p53 fragment promotes β-sheet formation of the I254R mutant by shifting the disordered mutant peptides into aggregating states. As a result, the system has similar oligomeric structures, inter-peptide interactions and free energy landscape as the wild type fragment does, revealing a prion-like process. We also found that in the cross-interaction system, the wild-type species has higher tendency to interact with the mutant than with itself. This phenomenon illustrates synergistic effects between the p53 (251)ILTIITL(257) fragment and the mutant resembling prion cross-species propagation, cautioning against exploiting it in drug discovery.
p53 prevents progression of nevi to melanoma predominantly through cell cycle regulation
Terzian, Tamara; Torchia, Enrique C.; Dai, Daisy; Robinson, Steven E.; Murao, Kazutoshi; Stiegmann, Regan A.; Gonzalez, Victoria; Boyle, Glen M.; Powell, Marianne B.; Pollock, Pamela M.; Lozano, Guillermina; Robinson, William A.; Roop, Dennis R.; Box, Neil F.
2011-01-01
p53 is the central member of a critical tumor suppressor pathway in virtually all tumor types, where it is silenced mainly by missense mutations. In melanoma, p53 predominantly remains wild type, thus its role has been neglected. To study the effect of p53 on melanocyte function and melanomagenesis, we crossed the ‘high-p53’ Mdm4+/− mouse to the well-established TP-ras0/+ murine melanoma progression model. After treatment with the carcinogen dimethylbenzanthracene (DMBA), TP-ras0/+ mice on the Mdm4+/− background developed fewer tumors with a delay in the age of onset of melanomas compared to TP-ras0/+ mice. Furthermore, we observed a dramatic decrease in tumor growth, lack of metastasis with increased survival of TP-ras0/+: Mdm4+/− mice. Thus, p53 effectively prevented the conversion of small benign tumors to malignant and metastatic melanoma. p53 activation in cultured primary melanocyte and melanoma cell lines using Nutlin-3, a specific Mdm2 antagonist, supported these findings. Moreover, global gene expression and network analysis of Nutlin-3-treated primary human melanocytes indicated that cell cycle regulation through the p21WAF1/CIP1 signaling network may be the key anti-melanomagenic activity of p53. PMID:20849464
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less
Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut
2013-01-01
To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol−1 (15.1 kJ mol−1). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared
Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L
2010-01-01
The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544
Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina
2013-01-01
The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961
Expression of C-terminal deleted p53 isoforms in neuroblastoma
Goldschneider, David; Horvilleur, Emilie; Plassa, Louis-François; Guillaud-Bataille, Marine; Million, Karine; Wittmer-Dupret, Evelyne; Danglot, Gisèle; de Thé, Hughes; Bénard, Jean; May, Evelyne; Douc-Rasy, Sétha
2006-01-01
The tumor suppressor gene, p53, is rarely mutated in neuroblastomas (NB) at the time of diagnosis, but its dysfunction could result from a nonfunctional conformation or cytoplasmic sequestration of the wild-type p53 protein. However, p53 mutation, when it occurs, is found in NB tumors with drug resistance acquired over the course of chemotherapy. As yet, no study has been devoted to the function of the specific p53 mutants identified in NB cells. This study includes characterization and functional analysis of p53 expressed in eight cell lines: three wild-type cell lines and five cell lines harboring mutations. We identified two transcription-inactive p53 variants truncated in the C-terminus, one of which corresponded to the p53β isoform recently identified in normal tissue by Bourdon et al. [J. C. Bourdon, K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, D. P. Xirodimas, M. K. Saville and D. P. Lane (2005) Genes Dev., 19, 2122–2137]. Our results show, for the first time, that the p53β isoform is the only p53 species to be endogenously expressed in the human NB cell line SK-N-AS, suggesting that the C-terminus truncated p53 isoforms may play an important role in NB tumor development. PMID:17028100
Male and Female Mice Lacking Neuroligin-3 Modify the Behavior of Their Wild-Type Littermates.
Kalbassi, Shireene; Bachmann, Sven O; Cross, Ellen; Roberton, Victoria H; Baudouin, Stéphane J
2017-01-01
In most mammals, including humans, the postnatal acquisition of normal social and nonsocial behavior critically depends on interactions with peers. Here we explore the possibility that mixed-group housing of mice carrying a deletion of Nlgn3 , a gene associated with autism spectrum disorders, and their wild-type littermates induces changes in each other's behavior. We have found that, when raised together, male Nlgn3 knockout mice and their wild-type littermates displayed deficits in sociability. Moreover, social submission in adult male Nlgn3 knockout mice correlated with an increase in their anxiety. Re-expression of Nlgn3 in parvalbumin-expressing cells in transgenic animals rescued their social behavior and alleviated the phenotype of their wild-type littermates, further indicating that the social behavior of Nlgn3 knockout mice has a direct and measurable impact on wild-type animals' behavior. Finally, we showed that, unlike male mice, female mice lacking Nlgn3 were insensitive to their peers' behavior but modified the social behavior of their littermates. Altogether, our findings show that the environment is a critical factor in the development of behavioral phenotypes in transgenic and wild-type mice. In addition, these results reveal that the social environment has a sexually dimorphic effect on the behavior of mice lacking Nlgn3 , being more influential in males than females.
Male and Female Mice Lacking Neuroligin-3 Modify the Behavior of Their Wild-Type Littermates
Kalbassi, Shireene; Cross, Ellen
2017-01-01
Abstract In most mammals, including humans, the postnatal acquisition of normal social and nonsocial behavior critically depends on interactions with peers. Here we explore the possibility that mixed-group housing of mice carrying a deletion of Nlgn3, a gene associated with autism spectrum disorders, and their wild-type littermates induces changes in each other’s behavior. We have found that, when raised together, male Nlgn3 knockout mice and their wild-type littermates displayed deficits in sociability. Moreover, social submission in adult male Nlgn3 knockout mice correlated with an increase in their anxiety. Re-expression of Nlgn3 in parvalbumin-expressing cells in transgenic animals rescued their social behavior and alleviated the phenotype of their wild-type littermates, further indicating that the social behavior of Nlgn3 knockout mice has a direct and measurable impact on wild-type animals’ behavior. Finally, we showed that, unlike male mice, female mice lacking Nlgn3 were insensitive to their peers’ behavior but modified the social behavior of their littermates. Altogether, our findings show that the environment is a critical factor in the development of behavioral phenotypes in transgenic and wild-type mice. In addition, these results reveal that the social environment has a sexually dimorphic effect on the behavior of mice lacking Nlgn3, being more influential in males than females. PMID:28795135
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira
2013-10-01
X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutationmore » substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the
P53 Suppression of Homologous Recombination and Tumorigenesis
2011-01-01
huge strides have been made in the numbers of mice breed and relevant cells collected for the purposes of experiments outlined in the aims below. The PI... breeding colony of R172P, R172H, Wild type and p53 null mice in order to have sufficient numbers of animals to perform the in vivo pun assay. Mouse...Strains and Breeding Cohorts Mice heterozygous for the point mutations p53R172P and p53R172H both on a C57BL/6 genetic background were kindly
Tonnessen-Murray, Crystal; Ungerleider, Nathan A; Rao, Sonia G; Wasylishen, Amanda R; Frey, Wesley D; Jackson, James G
2018-05-28
p53 is a transcription factor that regulates expression of genes involved in cell cycle arrest, senescence, and apoptosis. TP53 harbors mutations that inactivate its transcriptional activity in roughly 30% of breast cancers, and these tumors are much more likely to undergo a pathological complete response to chemotherapy. Thus, the gene expression program activated by wild-type p53 contributes to a poor response. We used an in vivo genetic model system to comprehensively define the p53- and p21-dependent genes and pathways modulated in tumors following doxorubicin treatment. We identified genes differentially expressed in spontaneous mammary tumors harvested from treated MMTV-Wnt1 mice that respond poorly (Trp53+/+) or favorably (Trp53-null) and those that lack the critical senescence/arrest p53 target gene Cdkn1a. Trp53 wild-type tumors differentially expressed nearly 10-fold more genes than Trp53-null tumors after treatment. Pathway analyses showed that genes involved in cell cycle, senescence, and inflammation were enriched in treated Trp53 wild-type tumors; however, no genes/pathways were identified that adequately explain the superior cell death/tumor regression observed in Trp53-null tumors. Cdkn1a-null tumors that retained arrest capacity (responded poorly) and those that proliferated (responded well) after treatment had remarkably different gene regulation. For instance, Cdkn1a-null tumors that arrested upregulated Cdkn2a (p16), suggesting an alternative, p21-independent route to arrest. Live animal imaging of longitudinal gene expression of a senescence/inflammation gene reporter in Trp53+/+ tumors showed induction during and after chemotherapy treatment, while tumors were arrested, but expression rapidly diminished immediately upon relapse. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.
Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B
2018-05-23
TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.
Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.
Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I
2013-04-16
Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.
Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy
Shchors, Ksenya; Persson, Anders I.; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S.; Hanahan, Douglas; Weiss, William A.; Evan, Gerard I.
2013-01-01
Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRasV12 mouse model crossed into the p53ERTAM background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ERTAM allele. The p53ERTAM protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRasV12;p53+/KI mice abrogate the p53 pathway by mutating p19ARF/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ERTAM allele. By contrast, gliomas arising in GFAP-HRasV12;p53KI/KI mice develop in the absence of functional p53. Such tumors retain a functional p19ARF/MDM2-signaling pathway, and restoration of p53ERTAM allele triggers p53-tumor–suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14ARF/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRasV12;p53KI/KI animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ERTAM activity mitigated the selective pressure to inactivate the p19ARF/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance. PMID:23542378
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu, Zhendong, E-mail: zdyu@hotmail.com; Wang, Hao; Zhang, Libin
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrugmore » system.« less
Both germ line and somatic genetics of the p53 pathway affect ovarian cancer incidence and survival.
Bartel, Frank; Jung, Juliane; Böhnke, Anja; Gradhand, Elise; Zeng, Katharina; Thomssen, Christoph; Hauptmann, Steffen
2008-01-01
Although p53 is one of the most studied genes/proteins in ovarian carcinomas, the predictive value of p53 alterations is still ambiguous. We performed analyses of the TP53 mutational status and its protein expression using immunohistochemistry. Moreover, the single nucleotide polymorphism SNP309 in the P2 promoter of the MDM2 gene was investigated. We correlated the results with age of onset and outcome from 107 patients with ovarian carcinoma. In our study, we identified a large group of patients with p53 overexpression despite having a wild-type gene (49% of all patients with wild-type TP53). This was associated with a significantly shortened overall survival time (P = 0.019). Patients with p53 alterations (especially those with overexpression of wild-type TP53) were also more refractory to chemotherapy compared with patients with normal p53 (P = 0.027). The G-allele of SNP309 is associated with an earlier age of onset in patients with estrogen receptor-overexpressing FIGO stage III disease (P = 0.048). In contrast, in patients with FIGO stage III disease, a weakened p53 pathway (either the G-allele of SNP309 or a TP53 mutation) was correlated with increased overall survival compared with patients whose tumors were wild-type for both TP53 and SNP309 (P = 0.0035). Our study provides evidence that both germ line and somatic alterations of the p53 pathway influence the incidence and survival of ovarian carcinoma, and it underscores the importance of assessing the functionality of p53 in order to predict the sensitivity of platinum-based chemotherapies and patient outcome.
Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.
Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina
2010-05-01
Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.
P53 Gene Mutagenesis in Breast Cancer
2005-03-01
the wild type T peak. 12 Table 1. Sonic ntations dected by SINtA Individual Cell Sequence Amino Acid Species Conservation 3 ID’ ID Change2 Change... differences in the content of toxic substances in the diet (Biggs et al., 1993; Blaszyk et al., 1996). The development of this p53 mutation load...Changes in the P53 Gene in Single Cells Individual Sequence Amino acid Species conservation ’ ID’ Cell ID change’ change Monkey Mouse Rat Chicken
Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A
1998-01-01
A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.
Anti-cancer peptides from ras-p21 and p53 proteins.
Pincus, Matthew R; Fenelus, Maly; Sarafraz-Yazdi, Ehsan; Adler, Victor; Bowne, Wilbur; Michl, Josef
2011-01-01
We have employed computer-based molecular modeling approaches to design peptides from the ras-p21 and p53 proteins that either induce tumor cell reversion to the untransformed phenotype or induce tumor cell necrosis without affecting normal cells. For rasp21, we have computed and superimposed the average low energy structures for the wild-type protein and oncogenic forms of this protein and found that specific domains change conformation in the oncogenic proteins. We have synthesized peptides corresponding to these and found that ras peptides, 35-47 (PNC-7) and 96-110 (PNC-2), block oncogenic ras-p21-induced oocyte maturation but have no effect on insulin-induced oocyte maturation that requires activation of endogenous wild-type ras-p21. These results show signal transduction pathway differences between oncogenic and activated wild-type ras-p21. Both peptides, attached to a membrane-penetrating peptide (membrane residency peptide or MRP), either induce phenotypic reversion to the untransformed phenotype or tumor cell necrosis of several ras-transformed cell lines, but have no effect on the growth of normal cells. Using other computational methods, we have designed two peptides, PNC-27 and 28, containing HDM-2-protein-binding domain sequences from p53 linked on their C-termini to the MRP that induce pore formation in the membranes of a wide range of cancer cells but not any normal cells tested. This is due to the expression of HDM-2 in the cancer cell membrane that does not occur in normal cells. These peptides eradicate a highly malignant tumor in nude mice with no apparent side effects. Both ras and p53 peptides show promise as anti-tumor agents in humans.
Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.
2017-01-01
Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158
Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika
2016-01-01
Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325
System-based strategies for p53 recovery.
Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I
2018-06-01
The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.
Battle against cancer: an everlasting saga of p53.
Hao, Qian; Cho, William C
2014-12-01
Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.
el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.
1997-01-01
We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405
Activation Of Wild-Type Hras Suppresses The Earliest Stages Of Pancreatic Cancer.
Weyandt, Jamie
2015-08-01
The RAS family of small GTPases is comprised of HRAS, NRAS, and KRAS. KRAS is invariably oncogenically mutated in pancreatic cancers, which is known to induce this disease. Beyond oncogenic KRAS, redox-dependent reactions have been implicated in the activation of the remaining wild-type RAS proteins in pancreatic cancer cell lines. These results suggest a possible involvement of wild-type RAS proteins in pancreatic cancer. To evaluate the impact of genetically suppressing wild-type RAS expression on pancreatic cancer. Hras homozygous null mice (Hras -/- ) were crossed into a Pdx-Cre; LSL-Kras G12D/+ (KC) murine background in which oncogenic Kras is activated in the pancreas to promote preinvasive pancreatic cancer. Tumor burden was then measured at different stages of disease. HRas -/- ;KC mice exhibited more precancerous lesions in the pancreas and more off-target skin papillomas compared to their wild-type counterparts, suggesting that Hras suppresses early oncogenic Kras-driven tumorigenesis, possibly at the time of initiation. Loss of Hras also reduced the survival of mice engineered to develop aggressive pancreatic cancer by the additional disruption of one allele of the tumor suppressor p53 (Trp53 R172H/+ ). However, this survival advantage was lost when both alleles of Trp53 were mutated, suggesting that wild-type Hras inhibits tumorigenesis in a p53-dependent fashion. Loss of wild-type Hras promotes the earliest stages of pancreatic tumorigenesis, and moreover results in more rapid progression of the disease. As such, mechanisms leading to activation of wild-type Ras proteins, including but not limited to redox-dependent reactions, may influence the development of pancreatic cancer. Copyright © 2015. Published by Elsevier B.V.
Enhanced radiosensitization of p53 mutant cells by oleamide.
Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil
2006-04-01
Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.
Defective Autophagosome Formation in p53-Null Colorectal Cancer Reinforces Crocin-Induced Apoptosis
Amin, Amr; Bajbouj, Khuloud; Koch, Adrian; Gandesiri, Muktheshwar; Schneider-Stock, Regine
2015-01-01
Crocin, a bioactive molecule of saffron, inhibited proliferation of both HCT116 wild-type and HCT116 p53−/− cell lines at a concentration of 10 mM. Flow cytometric analysis of cell cycle distribution revealed that there was an accumulation of HCT116 wild-type cells in G1 (55.9%, 56.1%) compared to the control (30.4%) after 24 and 48 h of crocin treatment, respectively. However, crocin induced only mild G2 arrest in HCT116 p53−/− after 24 h. Crocin induced inefficient autophagy in HCT116 p53−/− cells, where crocin induced the formation of LC3-II, which was combined with a decrease in the protein levels of Beclin 1 and Atg7 and no clear p62 degradation. Autophagosome formation was not detected in HCT116 p53−/− after crocin treatment predicting a nonfunctional autophagosome formation. There was a significant increase of p62 after treating the cells with Bafilomycin A1 (Baf) and crocin compared to crocin exposure alone. Annexin V staining showed that Baf-pretreatment enhanced the induction of apoptosis in HCT116 wild-type cells. Baf-exposed HCT116 p53−/− cells did not, however, show any enhancement of apoptosis induction despite an increase in the DNA damage-sensor accumulation, γH2AX indicating that crocin induced an autophagy-independent classical programmed cell death. PMID:25584615
Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.
Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald
2013-04-17
The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.
2013-01-01
The genetic missense A30P mutation of the wild-type α-synuclein protein results in the replacement of the 30th amino acid residue from alanine (Ala) to proline (Pro) and was initially found in the members of a German family who developed Parkinson’s disease. Even though the structures of these proteins have been measured before, detailed understanding about the structures and their relationships with free energy landscapes is lacking, which is of interest to provide insights into the pathogenic mechanism of Parkinson’s disease. We report the secondary and tertiary structures and conformational free energy landscapes of the wild-type and A30P mutant-type α-synuclein proteins in an aqueous solution environment via extensive parallel tempering molecular dynamics simulations along with thermodynamic calculations. In addition, we present the residual secondary structure component transition stabilities at the atomic level with dynamics in terms of free energy change calculations using a new strategy that we reported most recently. Our studies yield new interesting results; for instance, we find that the A30P mutation has local as well as long-range effects on the structural properties of the wild-type α-synuclein protein. The helical content at Ala18-Gly31 is less prominent in comparison to the wild-type α-synuclein protein. The β-sheet structure abundance decreases in the N-terminal region upon A30P mutation of the wild-type α-synuclein, whereas the NAC and C-terminal regions possess larger tendencies for β-sheet structure formation. Long-range intramolecular protein interactions are less abundant upon A30P mutation, especially between the NAC and C-terminal regions, which is linked to the less compact and less stable structures of the A30P mutant-type rather than the wild-type α-synuclein protein. Results including the usage of our new strategy for secondary structure transition stabilities show that the A30P mutant-type α-synuclein tendency toward
Wise-Scira, Olivia; Aloglu, Ahmet Kemal; Dunn, Aquila; Sakallioglu, Isin Tuna; Coskuner, Orkid
2013-03-20
The genetic missense A30P mutation of the wild-type α-synuclein protein results in the replacement of the 30th amino acid residue from alanine (Ala) to proline (Pro) and was initially found in the members of a German family who developed Parkinson's disease. Even though the structures of these proteins have been measured before, detailed understanding about the structures and their relationships with free energy landscapes is lacking, which is of interest to provide insights into the pathogenic mechanism of Parkinson's disease. We report the secondary and tertiary structures and conformational free energy landscapes of the wild-type and A30P mutant-type α-synuclein proteins in an aqueous solution environment via extensive parallel tempering molecular dynamics simulations along with thermodynamic calculations. In addition, we present the residual secondary structure component transition stabilities at the atomic level with dynamics in terms of free energy change calculations using a new strategy that we reported most recently. Our studies yield new interesting results; for instance, we find that the A30P mutation has local as well as long-range effects on the structural properties of the wild-type α-synuclein protein. The helical content at Ala18-Gly31 is less prominent in comparison to the wild-type α-synuclein protein. The β-sheet structure abundance decreases in the N-terminal region upon A30P mutation of the wild-type α-synuclein, whereas the NAC and C-terminal regions possess larger tendencies for β-sheet structure formation. Long-range intramolecular protein interactions are less abundant upon A30P mutation, especially between the NAC and C-terminal regions, which is linked to the less compact and less stable structures of the A30P mutant-type rather than the wild-type α-synuclein protein. Results including the usage of our new strategy for secondary structure transition stabilities show that the A30P mutant-type α-synuclein tendency toward
Lehmann, Christian; Friess, Thomas; Birzele, Fabian; Kiialainen, Anna; Dangl, Markus
2016-06-28
Venetoclax, a small molecule BH3 mimetic which inhibits the anti-apoptotic protein Bcl-2, and idasanutlin, a selective MDM2 antagonist, have both shown activity as single-agent treatments in pre-clinical and clinical studies in acute myeloid leukemia (AML). In this study, we deliver the rationale and molecular basis for the combination of idasanutlin and venetoclax for treatment of p53 wild-type AML. The effect of idasanutlin and venetoclax combination on cell viability, apoptosis, and cell cycle progression was investigated in vitro using established AML cell lines. In vivo efficacy was demonstrated in subcutaneous and orthotopic xenograft models generated in female nude or non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mice. Mode-of-action analyses were performed by means of cell cycle kinetic studies, RNA sequencing as well as western blotting experiments. Combination treatment with venetoclax and idasanutlin results in synergistic anti-tumor activity compared with the respective single-agent treatments in vitro, in p53 wild-type AML cell lines, and leads to strongly superior efficacy in vivo, in subcutaneous and orthotopic AML models. The inhibitory effects of idasanutlin were cell-cycle dependent, with cells arresting in G1 in consecutive cycles and the induction of apoptosis only evident after cells had gone through at least two cell cycles. Combination treatment with venetoclax removed this dependency, resulting in an acceleration of cell death kinetics. As expected, gene expression studies using RNA sequencing showed significant alterations to pathways associated with p53 signaling and cell cycle arrest (CCND1 pathway) in response to idasanutlin treatment. Only few gene expression changes were observed for venetoclax treatment and combination treatment, indicating that their effects are mediated mainly at the post-transcriptional level. Protein expression studies demonstrated that inhibition of the anti-apoptotic protein Mcl-1 contributed to
Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K
2011-09-27
Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.
Identification of a small molecule that overcomes HdmX-mediated suppression of p53
Chakrabarti, Amit; Karan, Sukanya; Liu, Zhigang; Xia, Zhiqiang; Gundluru, Mahesh; Moreton, Stephen; Saunthararajah, Yogen; Jackson, Mark W; Agarwal, Mukesh K; Wald, David N
2016-01-01
Inactivation of the p53 tumor suppressor by mutation or overexpression of negative regulators occurs frequently in cancer. Since p53 plays a key role in regulating proliferation or apoptosis in response to DNA damaging chemotherapies, strategies aimed at reactivating p53 are increasingly being sought. Strategies to reactivate wild-type p53 include the use of small molecules capable of releasing wild-type p53 from key, cellular negative regulators, such as Hdm2 and HdmX. Derivatives of the Hdm2 antagonist Nutlin-3 are in clinical trials. However, Nutlin-3 specifically disrupts Hdm2-p53, leaving tumors harboring high levels of HdmX resistant to Nutlin-3 treatment. Here we identify CTX1, a novel small molecule that overcomes HdmX-mediated p53 repression. CTX1 binds directly to HdmX to prevent p53-HdmX complex formation, resulting in the rapidly induction of p53 in a DNA damage-independent manner. Treatment of a panel of cancer cells with CTX1 induced apoptosis or suppressed proliferation and importantly, CTX1 demonstrates promising activity as a single agent in a mouse model of circulating primary human leukemia. CTX1 is a small molecule HdmX inhibitor that demonstrates promise as a cancer therapeutic candidate. PMID:26883273
Tiwari, Sameeksha; Awasthi, Manika; Singh, Swati; Pandey, Veda P; Dwivedi, Upendra N
2017-10-23
Protein-protein interactions (PPI) are a new emerging class of novel therapeutic targets. In order to probe these interactions, computational tools provide a convenient and quick method towards the development of therapeutics. Keeping this in view the present study was initiated to analyse interaction of tumour suppressor protein p53 (TP53) and breast cancer associated protein (BRCA1) as promising target against breast cancer. Using computational approaches such as protein-protein docking, hot spot analyses, molecular docking and molecular dynamics simulation (MDS), stepwise analyses of the interactions of the wild type and mutant TP53 with that of wild type BRCA1 and their modulation by alkaloids were done. Protein-protein docking method was used to generate both wild type and mutant complexes of TP53-BRCA1. Subsequently, the complexes were docked using sixteen different alkaloids, fulfilling ADMET and Lipinski's rule of five criteria, and were compared with that of a well-known inhibitor of PPI, namely nutlin. The alkaloid dicentrine was found to be the best docked alkaloid among all the docked alklaloids as well as that of nutlin. Furthermore, MDS analyses of both wild type and mutant complexes with the best docked alkaloid i.e. dicentrine, revealed higher stability of mutant complex than that of the wild one, in terms of average RMSD, RMSF and binding free energy, corroborating the results of docking. Results suggested more pronounced interaction of BRCA1 with mutant TP53 leading to increased expression of mutated TP53 thus showing a dominant negative gain of function and hampering wild type TP53 function leading to tumour progression.
p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.
Cox, Darren P
2012-01-01
Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.
Phosphorylation of p53 modifies sensitivity to ionizing radiation.
Okaichi, Kumio; Nose, Kanako; Kotake, Takako; Izumi, Nanaka; Kudo, Takashi
2011-06-01
Phosphorylation is an important modification involved in the control of p53 activity. We examined the relationship between p53 phosphorylation and cell radiosensitivity. We prepared H1299 cells (p53-null) with various mutations of p53 at three sites (serine 15, 20 and 46) and examined the radiosensitivity of the cells. In three mutant forms of p53--S15A, S20A and S46A--serine was converted to alanine at these sites to prevent phosphorylation, and in two other mutant forms, S15D and S20D, serine was converted to aspartic acid to mimic phosphorylation. H1299 cells were more radioresistant than cells with wild-type p53. Cells with the S15A and S46A mutant forms of p53 were radiosensitive, whereas those with the S15D, S20A and S20D forms showed medium radiosensitivity. Thus the sensitivity of cells to ionizing radiation varies according to the site of phosphorylation of p53.
Novel MDM2 inhibitor SAR405838 (MI-773) induces p53-mediated apoptosis in neuroblastoma
Lu, Jiaxiong; Guan, Shan; Zhao, Yanling; Yu, Yang; Wang, Yongfeng; Shi, Yonghua; Mao, Xinfang; Yang, Kristine L.; Sun, Wenjing; Xu, Xin; Yi, Joanna S.; Yang, Tianshu; Yang, Jianhua; Nuchtern, Jed G.
2016-01-01
Neuroblastoma (NB), which accounts for about 15% of cancer-related mortality in children, is the most common childhood extracranial malignant tumor. In NB, somatic mutations of the tumor suppressor, p53, are exceedingly rare. Unlike in adult tumors, the majority of p53 downstream functions are still intact in NB cells with wild-type p53. Thus, restoring p53 function by blocking its interaction with p53 suppressors such as MDM2 is a viable therapeutic strategy for NB treatment. Herein, we show that MDM2 inhibitor SAR405838 is a potent therapeutic drug for NB. SAR405838 caused significantly decreased cell viability of p53 wild-type NB cells and induced p53-mediated apoptosis, as well as augmenting the cytotoxic effects of doxorubicin (Dox). In an in vivo orthotopic NB mouse model, SAR405838 induced apoptosis in NB tumor cells. In summary, our data strongly suggest that MDM2-specific inhibitors like SAR405838 may serve not only as a stand-alone therapy, but also as an effective adjunct to current chemotherapeutic regimens for treating NB with an intact MDM2-p53 axis. PMID:27764791
Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells.
Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun
2014-07-23
The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Wanka, C; Brucker, D P; Bähr, O; Ronellenfitsch, M; Weller, M; Steinbach, J P; Rieger, J
2012-08-16
P53 has an important role in the processing of starvation signals. P53-dependent molecular mediators of the Warburg effect reduce glucose consumption and promote mitochondrial function. We therefore hypothesized that the retention of wild-type p53 characteristic of primary glioblastomas limits metabolic demands induced by deregulated signal transduction in the presence of hypoxia and nutrient depletion. Here we report that short hairpin RNA-mediated gene suppression of wild-type p53 or ectopic expression of mutant temperature-sensitive dominant-negative p53(V135A) increased glucose consumption and lactate production, decreased oxygen consumption and enhanced hypoxia-induced cell death in p53 wild-type human glioblastoma cells. Similarly, genetic knockout of p53 in HCT116 colon carcinoma cells resulted in reduced respiration and hypersensitivity towards hypoxia-induced cell death. Further, wild-type p53 gene silencing reduced the expression of synthesis of cytochrome c oxidase 2 (SCO2), an effector necessary for respiratory chain function. An SCO2 transgene reverted the metabolic phenotype and restored resistance towards hypoxia in p53-depleted and p53 mutant glioma cells in a rotenone-sensitive manner, demonstrating that this effect was dependent on intact oxidative phosphorylation. Supplementation with methyl-pyruvate, a mitochondrial substrate, rescued p53 wild-type but not p53 mutant cells from hypoxic cell death, demonstrating a p53-mediated selective aptitude to metabolize mitochondrial substrates. Further, SCO2 gene silencing in p53 wild-type glioma cells sensitized these cells towards hypoxia. Finally, lentiviral gene suppression of SCO2 significantly enhanced tumor necrosis in a subcutaneous HCT116 xenograft tumor model, compatible with impaired energy metabolism in these cells. These findings demonstrate that glioma and colon cancer cells with p53 wild-type status can skew the Warburg effect and thereby reduce their vulnerability towards tumor hypoxia in
Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang
2012-08-01
Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.
Mutant p53 protein localized in the cytoplasm inhibits autophagy.
Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido
2008-10-01
The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.
Biological and genetic properties of the p53 null preneoplastic mammary epithelium
NASA Technical Reports Server (NTRS)
Medina, Daniel; Kittrell, Frances S.; Shepard, Anne; Stephens, L. Clifton; Jiang, Cheng; Lu, Junxuan; Allred, D. Craig; McCarthy, Maureen; Ullrich, Robert L.
2002-01-01
The absence of the tumor suppressor gene p53 confers an increased tumorigenic risk for mammary epithelial cells. In this report, we describe the biological and genetic properties of the p53 null preneoplastic mouse mammary epithelium in a p53 wild-type environment. Mammary epithelium from p53 null mice was transplanted serially into the cleared mammary fat pads of p53 wild-type BALB/c female to develop stable outgrowth lines. The outgrowth lines were transplanted for 10 generations. The outgrowths were ductal in morphology and progressed through ductal hyperplasia and ductal carcinoma in situ before invasive cancer. The preneoplastic outgrowth lines were immortal and exhibited activated telomerase activity. They are estrogen and progesterone receptor-positive, and aneuploid, and had various levels of tumorigenic potential. The biological and genetic properties of these lines are distinct from those found in most hyperplastic alveolar outgrowth lines, the form of mammary preneoplasia occurring in most traditional models of murine mammary tumorigenesis. These results indicate that the preneoplastic cell populations found in this genetically engineered model are similar in biological properties to a subset of precurser lesions found in human breast cancer and provide a unique model to identify secondary events critical for tumorigenicity and invasiveness.
Restoration of Wild-Type Activity to Mutant p53 in Prostate Cancer: A Novel Therapeutic Approach
2006-01-01
B) Cells were transfected with 1 mg of the indicated luciferase reporter constructs and 50 ng of pRL- Renilla . 24 hrs post transfections p53 was...induced by removal of tetracyline. Cells were lysed and assayed for luciferase and Renilla activities 24 hrs after induction of p53. The indicated
Robertson, Keith D.; Jones, Peter A.
1998-01-01
The INK4a/ARF locus encodes two proteins involved in tumor suppression in a manner virtually unique in mammalian cells. Distinct first exons, driven from separate promoters, splice onto a common exon 2 and 3 but utilize different reading frames to produce two completely distinct proteins, both of which play roles in cell cycle control. INK4a, a critical element of the retinoblastoma gene pathway, binds to and inhibits the activities of CDK4 and CDK6, while ARF, a critical element of the p53 pathway, increases the level of functional p53 via interaction with MDM2. Here we clone and characterize the promoter of the human ARF gene and show that it is a CpG island characteristic of a housekeeping gene which contains numerous Sp1 sites. Both ARF and INK4a are coordinately expressed in cells except when their promoter regions become de novo methylated. In one of these situations, ARF transcription could be reactivated by treatment with the DNA methylation inhibitor 5-aza-2′-deoxycytidine, and the reactivation kinetics of ARF and INK4a were found to differ slightly in a cell line in which both genes were silenced by methylation. The ARF promoter was also found to be highly responsive to E2F1 expression, in keeping with previous results at the RNA level. Lastly, transcription from the ARF promoter was down-regulated by wild-type p53 expression, and the magnitude of the effect correlated with the status of the endogenous p53 gene. This finding points to the existence of an autoregulatory feedback loop between p53, MDM2, and ARF, aimed at keeping p53 levels in check. PMID:9774662
Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo
2012-04-01
Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.
Park, Yon Jung; Wen, Jing; Bang, Seungmin; Park, Seung Woo
2006-01-01
[6]-Gingerol, a major phenolic compound derived from ginger, has anti-bacterial, anti-inflammatory and anti-tumor activities. While several molecular mechanisms have been described to underlie its effects on cells in vitro and in vivo, the underlying mechanisms by which [6]-gingerol exerts anti-tumorigenic effects are largely unknown. The purpose of this study was to investigate the action of [6]-gingerol on two human pancreatic cancer cell lines, HPAC expressing wild-type (wt) p53 and BxPC-3 expressing mutated p53. We found that [6]-gingerol inhibited the cell growth through cell cycle arrest at G1 phase in both cell lines. Western blot analyses indicated that [6]-gingerol decreased both Cyclin A and Cyclin-dependent kinase (Cdk) expression. These events led to reduction in Rb phosphorylation followed by blocking of S phase entry. p53 expression was decreased by [6]-gingerol treatment in both cell lines suggesting that the induction of Cyclin-dependent kinase inhibitor, p21cip1, was p53-independent. [6]-Gingerol induced mostly apoptotic death in the mutant p53-expressing cells, while no signs of early apoptosis were detected in wild type p53-expressing cells and this was related to the increased phosphorylation of AKT. These results suggest that [6]-gingerol can circumvent the resistance of mutant p53-expressing cells towards chemotherapy by inducing apoptotic cell death while it exerts cytostatic effect on wild type p53-expressing cells by inducing temporal growth arrest. PMID:17066513
Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W
2010-11-01
Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.
Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang
2012-01-01
Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
Demir, Özlem; Baronio, Roberta; Salehi, Faezeh; Wassman, Christopher D.; Hall, Linda; Hatfield, G. Wesley; Chamberlin, Richard; Kaiser, Peter; Lathrop, Richard H.; Amaro, Rommie E.
2011-01-01
The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain (“cancer mutants”). Activity can be restored by second-site suppressor mutations (“rescue mutants”). This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD), without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC) metric was strongly correlated (r2 = 0.77) with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i) p53 cancer mutants were more flexible than wild-type protein, (ii) second-site rescue mutations decreased the flexibility of cancer mutants, and (iii) negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants. PMID:22028641
Soares, Paulo C; Abdelhay, Eliana S; Thuler, Luiz Claudio S; Soares, Bruno Moreira; Demachki, Samia; Ferro, Gessica Valéria Rocha; Assumpção, Paulo P; Lamarão, Leticia Martins; Ribeiro Pinto, Luis Felipe; Burbano, Rommel Mario Rodríguez
2018-02-21
Anal residual tumors are consensually identified within six months of chemoradiotherapy and represent a persistent lesion that may have prognostic value for overall survival. The aim of this study was to evaluate the association of HPV and HIV status, p16 expression level and TP53 mutations with the absence of residual tumors (local response) in Squamous Cell Carcinoma (SCC) of the anal canal after chemoradiotherapy. We performed a study on 78 patients with SCC of the anal canal who submitted to chemoradiotherapy and were followed for a six-month period to identify the absence or presence of residual tumors. HPV DNA was identified by polymerase chain reaction and direct sequencing, HIV RNA was detected by TaqMan amplification, p16 expression was detected by western blotting, and the mutational analysis of TP53 was performed by direct sequencing; additionally, samples carrying mutations underwent fluorescent in sit hybridization. The evaluation of the tumor response to treatment was conducted six months after the conclusion of chemoradiotherapy. The following classifications were used to evaluate the outcomes: a) no response (presence of residual tumor) and b) complete response (absence of residual tumor). The significant variables associated with the absence of residual tumors were HPV positive, p16 overexpressed, wild-type TP53, female gender, and stages I and II. Only the presence of HPV was independently correlated with the clinical response; this variable increased the chances of a response within six months by 31-fold. The presence of HPV in tumor cells was correlated with the absence of a residual tumor. This correlation is valuable and can direct future therapeutic approaches in the anal canal.
Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.
Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick
2003-08-01
Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its
2000-08-01
Spodoptera frugiperda (Sf21) cells were infected with a recombinant baculovirus expressing the wild-type human p53. 3-4 and 10-1 cells were grown at 37 ’C in...for further use. Spodoptera fugiperda (Sf21) cells were grown at 27 0C in TC-100 medium (GIBCO), supplemented with 10% of heat inactivated Fetal
Basal p53 expression is indispensable for mesenchymal stem cell integrity.
Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G
2018-03-01
Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional
Gulati, Anthony P; Yang, Yang-Ming; Harter, David; Mukhopadhyay, Asok; Aggarwal, Bharat B; Aggarwal, Bharat A; Benzil, Deborah L; Whysner, John; Albino, Anthony P; Murali, Raj; Jhanwar-Uniyal, Meena
2006-01-01
The roles of the mitogen-activated kinase protein (MAPK) pathway, nuclear factor-kappa B (NF-kappaB), and activator protein-1 (AP-1) in cellular responses to growth factors and mitogen are well established. However, the manner by which these proliferative pathways are affected by the tumor suppressor protein p53 is not fully understood. We report here the results of an investigation of the status of p53 on two human melanoma cell lines with wild-type p53 (SK-Mel-186) or mutant p53 (SK-Mel-110). The basal levels of the activated extracellular-signal regulated kinases 1 and 2 (ERK1/2) were high in cells with wild-type p53, but low in cells with mutant p53. The 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced activation of ERK1/2 through the phosphorylation of threonine and tyrosine at 202 and 204, respectively, was demonstrated in both cell lines, however, in a discrete manner. TPA-induced activation of ERK1/2 was sustained in wild-type p53 cells, while only a transient activation was seen in mutant p53 cells. Inhibition of MAPK kinase (MEK), an upstream kinase, by U0126, blocked TPA-induced activation of ERK1/2 in wild-type p53 cells and in mutant p53 cells. Treatment of wild-type p53 (SK-Mel 186) cells with small interfering RNA (siRNA) of p53 displayed a transient induction of activation of ERK1/2 following TPA treatment, indicating that p53 has a role in the regulation of the activation of ERK1/2. NF-kappaB activity decreased significantly in cells with wild-type p53, while enhanced NF-kappaB activity was evident in cells with mutant p53. The expression of either wild-type or mutant p53 had a similar effect on TPA-induced Jun N-terminal kinase (JNK) activation, indicating specificity for the ERK pathway. Similarly, AP-1 binding activity showed a transient variation in both cell lines after TPA treatment but with different kinetics. These observations suggest that both wild-type and mutant p53 can modulate the activation pathways for ERK1/2, and NF
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wakatsuki, Masaru; Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba; Ohno, Tatsuya
2008-03-15
Purpose: p73 belongs to the p53 tumor suppressor family of genes and can inhibit cell growth in a p53-like manner by inducing apoptosis or cell cycle arrest. Here, we investigated whether p73 could compensate for impaired p53 function in apoptosis induced by radiation therapy (RT) for cervical cancer. Methods and Materials: Sixty-eight patients with squamous cell carcinoma of the cervix who received definitive RT combined with (n = 37) or without (n = 31) cisplatin were investigated. Biopsy specimens were excised from the cervical tumor before RT and after 9 Gy. Results: Mean apoptosis index (AI) was 0.93% before RTmore » and 1.97% after 9 Gy with a significant increase (p < 0.001). For all patients, there was a significant correlation between p73 expression positivity after 9 Gy and AI ratio (AI after 9 Gy/AI before RT) (p = 0.021). Forty-one patients were regarded as the p53-responding group according to the expression of p53 after 9 Gy, whereas the remaining 27 patients were regarded as the p53-nonresponding group. A significant correlation between p73 expression after 9 Gy and AI ratio was observed in the p53-non-responding group (p < 0.001) but not in the p53-responding group (p = 0.940). Conclusion: Our results suggest that p73 plays an important role in compensating for the lack of p53 function in radiation-induced apoptosis of cervical cancer.« less
Polato, Federica; Rusconi, Paolo
2014-01-01
Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652
Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun
2015-03-01
The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.
Huang, Y; Yu, P; Li, W; Ren, G; Roberts, A I; Cao, W; Zhang, X; Su, J; Chen, X; Chen, Q; Shou, P; Xu, C; Du, L; Lin, L; Xie, N; Zhang, L; Wang, Y; Shi, Y
2014-07-17
p53 is one of the most studied genes in cancer biology, and mutations in this gene may be predictive for the development of many types of cancer in humans and in animals. However, whether p53 mutations in non-tumor stromal cells can affect tumor development has received very little attention. In this study, we show that B16F0 melanoma cells form much larger tumors in p53-deficient mice than in wild-type mice, indicating a potential role of p53 deficiency in non-tumor cells of the microenvironment. As mesenchymal stem cells (MSCs) are attracted to tumors and form a major component of the tumor microenvironment, we examined the potential role of p53 status in MSCs in tumor development. We found that larger tumors resulted when B16F0 melanoma cells were co-injected with bone marrow MSCs derived from p53-deficient mice rather than MSCs from wild-type mice. Interestingly, this tumor-promoting effect by p53-deficient MSCs was not observed in non-obese diabetic/severe combined immunodeficiency mice, indicating the immune response has a critical role. Indeed, in the presence of inflammatory cytokines, p53-deficient MSCs expressed more inducible nitric oxide synthase (iNOS) and exhibited greater immunosuppressive capacity. Importantly, tumor promotion by p53-deficient MSCs was abolished by administration of S-methylisothiourea, an iNOS inhibitor. Therefore, our data demonstrate that p53 status in tumor stromal cells has a key role in tumor development by modulating immune responses.
Borchert, Sophie; Czech-Sioli, Manja; Neumann, Friederike; Schmidt, Claudia; Wimmer, Peter; Dobner, Thomas
2014-01-01
ABSTRACT Interference with tumor suppressor pathways by polyomavirus-encoded tumor antigens (T-Ags) can result in transformation. Consequently, it is thought that T-Ags encoded by Merkel cell polyomavirus (MCPyV), a virus integrated in ∼90% of all Merkel cell carcinoma (MCC) cases, are major contributors to tumorigenesis. The MCPyV large T-Ag (LT-Ag) has preserved the key functional domains present in all family members but has also acquired unique regions that flank the LxCxE motif. As these regions may mediate unique functions, or may modulate those shared with T-Ags of other polyomaviruses, functional studies of MCPyV T-Ags are required. Here, we have performed a comparative study of full-length or MCC-derived truncated LT-Ags with regard to their biochemical characteristics, their ability to bind to retinoblastoma (Rb) and p53 proteins, and their transforming potential. We provide evidence that full-length MCPyV LT-Ag may not directly bind to p53 but nevertheless can significantly reduce p53-dependent transcription in reporter assays. Although early region expression constructs harboring either full-length or MCC-derived truncated LT-Ag genes can transform primary baby rat kidney cells, truncated LT-Ags do not bind to p53 or reduce p53-dependent transcription. Interestingly, shortened LT-Ags exhibit a very high binding affinity for Rb, as shown by coimmunoprecipitation and in vitro binding studies. Additionally, we show that truncated MCPyV LT-Ag proteins are expressed at higher levels than those for the wild-type protein and are able to partially relocalize Rb to the cytoplasm, indicating that truncated LT proteins may have gained additional features that distinguish them from the full-length protein. IMPORTANCE MCPyV is one of the 12 known polyomaviruses that naturally infect humans. Among these, it is of particular interest since it is the only human polyomavirus known to be involved in tumorigenesis. MCPyV is thought to be causally linked to MCC, a rare
Jones, Richard J.; Bjorklund, Chad C.; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J.; Orlowski, Robert Z.
2012-01-01
The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover, and has been validated pre-clinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, while Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA. HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor non-genotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G2/M arrest, up-regulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared to RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation. PMID:22933706
Apoptotic cell death in erythrocytes of p53-deficient medaka (Oryzias latipes) after γ-irradiation.
Sayed, Alaa El-Din Hamid; Watanabe-Asaka, Tomomi; Oda, Shoji; Mitani, Hiroshi
2016-10-01
Previous studies have examined the effects of γ-irradiation (γ-IR) on wild-type and p53 mutant Medaka (Oryzias latipes) 24 hours after irradiation and in the present work, apoptosis and alterations in erythrocytes of 4, 8 and 24 h and 14 days after gamma-ray irradiation were reported as genotoxic biomarkers of γ-irradiation. Sexually mature wild-type, WT (Hd-rR) and p53(-/-) adult female medaka (O. latipes) were exposed to 4 Gy dose of γ-IR and sampling were collected after 4, 8 and 24 h and 14 days. Apoptosis and morphological alterations were observed from 4 h after irradiation and remarkably increased 8 h after irradiation in the wild-type. Apoptotic cell death has been observed 8 h after irradiation most prominently but subtle in p53 mutant medaka. All these phenotypes were recovered 14 days after irradiation in both strains. Although no micronuclei were seen in any group, nuclear abnormalities were observed in red blood cells. Both apoptosis and morphological alterations in erythrocytes were decreased after 24 and 14 days after γ-irradiation. We conclude that apoptosis and malformations caused by 4 Gy γ-irradiation in the erythrocytes of medaka fish occurs from 4-24 h and the initial response until 8 h was p53-dependent.
Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z
2012-10-01
The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation.
Badie, B; Kramar, M H; Lau, R; Boothman, D A; Economou, J S; Black, K L
1998-05-01
Patients with malignant gliomas continue to have very poor prognosis even after surgical resection, radiation and chemotherapy. Because these tumors often have alterations in the p53 tumor suppressor gene, which plays a key role in the cellular response to DNA damaging agents, we investigated the role of p53 gene therapy in conjunction with ionizing radiation in a rat brain tumor model. Exposure of cultured rat 9L gliosarcoma cells, which contain a mutant p53 gene, to a recombinant adenovirus-vector bearing the wild-type p53 gene (Adp53), induced apoptosis within 24 hours. Although ionizing radiation had no additional effect on apoptosis within this time frame, it caused G1 arrest in non-apoptotic cells after Adp53 therapy. In contrast, wild-type 9L cells demonstrated little G1 arrest after X-irradiation. When animals bearing brain tumors were irradiated after intratumoral Adp53 injections, more than 85% reduction in tumor size was noted. Moreover, the group of rats receiving both radiation and Adp53 therapy had a significant increase in survival as compared to animals receiving either therapy alone. These results support the use of p53 gene therapy as an adjunct to radiation in treatment of malignant brain tumors.
Ensemble-based virtual screening reveals dual-inhibitors for the p53-MDM2/MDMX interactions.
Barakat, Khaled; Mane, Jonathan; Friesen, Douglas; Tuszynski, Jack
2010-02-26
The p53 protein, a guardian of the genome, is inactivated by mutations or deletions in approximately half of human tumors. While in the rest of human tumors, p53 is expressed in wild-type form, yet it is inhibited by over-expression of its cellular regulators MDM2 and MDMX proteins. Although the p53-binding sites within the MDMX and MDM2 proteins are closely related, known MDM2 small-molecule inhibitors have been shown experimentally not to bind to its homolog, MDMX. As a result, the activity of these inhibitors including Nutlin3 is compromised in tumor cells over-expressing MDMX, preventing these compounds from fully activating the p53 protein. Here, we applied the relaxed complex scheme (RCS) to allow for the full receptor flexibility in screening for dual-inhibitors that can mutually antagonize the two p53-regulator proteins. First, we filtered the NCI diversity set, DrugBank compounds and a derivative library for MDM2-inhibitors against 28 dominant MDM2-conformations. Then, we screened the MDM2 top hits against the binding site of p53 within the MDMX target. Results described herein identify a set of compounds that have been computationally predicted to ultimately activate the p53 pathway in tumor cells retaining the wild-type protein. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.
Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra
2008-07-01
To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.
York, D.; Withers, S. S.; Watson, K. D.; Seo, K. W.; Rebhun, R. B.
2016-01-01
Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. PMID:27333821
York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B
2017-09-01
Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.
Mutation at p53 serine 389 does not rescue the embryonic lethality in mdm2 or mdm4 null mice.
Iwakuma, Tomoo; Parant, John M; Fasulo, Mark; Zwart, Edwin; Jacks, Tyler; de Vries, Annemieke; Lozano, Guillermina
2004-10-07
Mdm2 and its homolog Mdm4 inhibit the function of the tumor suppressor p53. Targeted disruption of either mdm2 or mdm4 genes in mice results in embryonic lethality that is completely rescued by concomitant deletion of p53, suggesting that deletion of negative regulators of p53 results in a constitutively active p53. Thus, these mouse models offer a unique in vivo system to assay the functional significance of different p53 modifications. Phosphorylation of serine 389 in murine p53 occurs specifically after ultraviolet-light-induced DNA damage, and phosphorylation of this site enhances p53 activity both in vitro and in vivo. Recently, mice with a serine to alanine substitution at serine 389 (p53S389A) in the endogenous p53 locus were generated. To examine the in vivo significance of serine 389 phosphorylation during embryogenesis, we crossed these mutant mice to mice lacking mdm2 or mdm4. The p53S389A allele did not alter the embryonic lethality of mdm2 or mdm4. Additional crosses to assay the effect of one p53S389A allele with a p53 null allele also did not rescue the lethal phenotypes. In conclusion, the phenotypes due to loss of mdm2 or mdm4 were not even partially rescued by p53S389A, suggesting that p53S389A is functionally wild type during embryogenesis.
p53 Involvement in the Control of Murine Hair Follicle Regression
Botchkarev, Vladimir A.; Komarova, Elena A.; Siebenhaar, Frank; Botchkareva, Natalia V.; Sharov, Andrei A.; Komarov, Pavel G.; Maurer, Marcus; Gudkov, Andrei V.; Gilchrest, Barbara A.
2001-01-01
p53 is a transcription factor mediating a variety of biological responses including apoptotic cell death. p53 was recently shown to control apoptosis in the hair follicle induced by ionizing radiation and chemotherapy, but its role in the apoptosis-driven physiological hair follicle regression (catagen) remains to be elucidated. Here, we show that p53 protein is strongly expressed and co-localized with apoptotic markers in the regressing hair follicle compartments during catagen. In contrast to wild-type mice, p53 knockout mice show significant retardation of catagen accompanied by significant decrease in the number of apoptotic cells in the hair matrix. Furthermore, p53 null hair follicles are characterized by alterations in the expression of markers that are encoded by p53 target genes and are implicated in the control of catagen (Bax, Bcl-2, insulin-like growth factor binding protein-3). These data suggest that p53 is involved in the control of apoptosis in the hair follicle during physiological regression and imply that p53 antagonists may be useful for the management of hair growth disorders characterized by premature entry into catagen, such as androgenetic alopecia, alopecia areata, and telogen effluvium. PMID:11395365
Loss of p53 protein during radiation transformation of primary human mammary epithelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wazer, D.E.; Chu, Qiuming; Liu, Xiao Long
1994-04-01
The causative factors leading to breast cancer are largely unknown. Increased incidence of breast cancer following diagnostic or therapeutic radiation suggests that radiation may contribute to mammary oncogenesis. This report describes the in vitro neoplastic transformation of a normal human mammary epithelial cell strain, 76N, by fractionated [gamma]-irradiation at a clinically used dose (30 Gy). The transformed cells (76R-30) were immortal, had reduced growth factor requirements, and produced tumors in nude mice. Remarkably, the 76R-30 cells completely lacked the p53 tumor suppressor protein. Loss of p53 was due to deletion of the gene on one allele and a 26-bp deletionmore » within the third intron on the second allele which resulted in abnormal splicing out of either the third or fourth exon from the mRNA. PCR with a mutation-specific primer showed that intron 3 mutation was present in irradiated cells before selection for immortal phenotype. 76R-30 cells did not exhibit G[sub 1] arrest in response to radiation, indicating a loss of p53-mediated function. Expression of the wild-type p53 gene in 76R-30 cells led to their growth inhibition. Thus, loss of p53 protein appears to have contributed to neoplastic transformation of these cells. This unique model should facilitate analyses of molecular mechanisms of radiation-induced breast cancer and allow identification of p53-regulated cellular genes in breast cells. 44 refs., 8 figs., 1 tab.« less
Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.
Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K
2005-01-20
Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.
Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine
2009-04-01
Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.
Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells
Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav
2013-01-01
Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710
p53-Mediated Cellular Response to DNA Damage in Cells with Replicative Hepatitis B Virus
NASA Astrophysics Data System (ADS)
Puisieux, Alain; Ji, Jingwei; Guillot, Celine; Legros, Yann; Soussi, Thierry; Isselbacher, Kurt; Ozturk, Mehmet
1995-02-01
Wild-type p53 acts as a tumor suppressor gene by protecting cells from deleterious effects of genotoxic agents through the induction of a G_1/S arrest or apoptosis as a response to DNA damage. Transforming proteins of several oncogenic DNA viruses inactivate tumor suppressor activity of p53 by blocking this cellular response. To test whether hepatitis B virus displays a similar effect, we studied the p53-mediated cellular response to DNA damage in 2215 hepatoma cells with replicative hepatitis B virus. We demonstrate that hepatitis B virus replication does not interfere with known cellular functions of p53 protein.
Targeting p53-MDM2-MDMX Loop for Cancer Therapy
Zhang, Qi; Zeng, Shelya X.
2015-01-01
The tumor suppressor p53 plays a central role in anti-tumorigenesis and cancer therapy. It has been described as “the guardian of the genome”, because it is essential for conserving genomic stability by preventing mutation, and its mutation and inactivation are highly related to all human cancers. Two important p53 regulators, MDM2 and MDMX, inactivate p53 by directly inhibiting its transcriptional activity and mediating its ubiquitination in a feedback fashion, as their genes are also the transcriptional targets of p53. On account of the importance of the p53-MDM2- MDMX loop in the initiation and development of wild type p53-containing tumors, intensive studies over the past decade have been aiming to identify small molecules or peptides that could specifically target individual protein molecules of this pathway for developing better anti-cancer therapeutics. In this chapter, we review the approaches for screening and discovering efficient and selective MDM2 inhibitors with emphasis on the most advanced synthetic small molecules that interfere with the p53-MDM2 interaction and are currently on Phase I clinical trials. Other therapeutically useful strategies targeting this loop, which potentially improve the prospects of cancer therapy and prevention, will also be discussed briefly. PMID:25201201
Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A
2002-08-22
A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.
Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma.
Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne-Marie; Brenton, James D
2016-10-01
TP53 mutations are ubiquitous in high-grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low-grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged-amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain-of-function (GOF or nonsynonymous), loss-of-function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low-grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%.
Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma
Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne‐Marie
2016-01-01
Abstract TP53 mutations are ubiquitous in high‐grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low‐grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged‐amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain‐of‐function (GOF or nonsynonymous), loss‐of‐function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low‐grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
Lai, Chin-Yu; Tsai, An-Chi; Chen, Mei-Chuan; Chang, Li-Hsun; Sun, Hui-Lung; Chang, Ya-Ling; Chen, Chien-Chih
2012-01-01
Aciculatin, a natural compound extracted from the medicinal herb Chrysopogon aciculatus, shows potent anti-cancer potency. This study is the first to prove that aciculatin induces cell death in human cancer cells and HCT116 mouse xenografts due to G1 arrest and subsequent apoptosis. The primary reason for cell cycle arrest and cell death was p53 accumulation followed by increased p21 level, dephosphorylation of Rb protein, PUMA expression, and induction of apoptotic signals such as cleavage of caspase-9, caspase-3, and PARP. We demonstrated that p53 allele-null (−/−) (p53-KO) HCT116 cells were more resistant to aciculatin than cells with wild-type p53 (+/+). The same result was achieved by knocking down p53 with siRNA in p53 wild-type cells, indicating that p53 plays a crucial role in aciculatin-induced apoptosis. Although DNA damage is the most common event leading to p53 activation, we found only weak evidence of DNA damage after aciculatin treatment. Interestingly, the aciculatin-induced downregulation of MDM2, an important negative regulator of p53, contributed to p53 accumulation. The anti-cancer activity and importance of p53 after aciculatin treatment were also confirmed in the HCT116 xenograft models. Collectively, these results indicate that aciculatin treatment induces cell cycle arrest and apoptosis via inhibition of MDM2 expression, thereby inducing p53 accumulation without significant DNA damage and genome toxicity. PMID:22912688
Thamkachy, Reshma; Kumar, Rohith; Rajasekharan, K N; Sengupta, Suparna
2016-03-08
p53 is a tumour suppressor protein that plays a key role in many steps of apoptosis, and malfunctioning of this transcription factor leads to tumorigenesis. Prognosis of many tumours also depends upon the p53 status. Most of the clinically used anticancer compounds activate p53 dependent pathway of apoptosis and hence require p53 for their mechanism of action. Further, Ras/Raf/MEK/ERK axis is an important signaling pathway activated in many cancers. Dependence of diaminothiazoles, compounds that have gained importance recently due to their anticancer and anti angiogenic activities, were tested in cancer models with varying p53 or Ras/Raf mutational status. In this study we have used p53 mutated and knock out colon cancer cells and xenograft tumours to study the role of p53 in apoptosis mediated by diaminothiazoles. Colon cancer cell lines with varying mutational status for Ras or Raf were also used. We have also examined the toxicity and in vivo efficacy of a lead diaminothiazole 4-Amino-5-benzoyl-2-(4-methoxy phenylamino)thiazole (DAT1) in colon cancer xenografts. We have found that DAT1 is active in both in vitro and in vivo models with nonfunctional p53. Earlier studies have shown that extrinsic pathway plays major role in DAT1 mediated apoptosis. In this study, we have found that DAT1 is causing p53 independent upregulation of the death receptor 5 by activating the Ras/Raf/MEK/ERK signaling pathway both in wild type and p53 suppressed colon cancer cells. These findings are also confirmed by the in vivo results. Further, DAT1 is more efficient to induce apoptosis in colon cancer cells with mutated Ras or Raf. Minimal toxicity in both acute and subacute studies along with the in vitro and in vivo efficacy of DAT1 in cancers with both wild type and nonfunctional p53 place it as a highly beneficial candidate for cancer chemotherapy. Besides, efficiency in cancer cells with mutations in the Ras oncoprotein or its downstream kinase Raf raise interest in
Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats
Botcheva, Krassimira; McCorkle, Sean R.
2014-11-21
The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less
Tompa, Peter; Han, Kyou-Hoon; Bokor, Mónika; Kamasa, Pawel; Tantos, Ágnes; Fritz, Beáta; Kim, Do-Hyoung; Lee, Chewook; Verebélyi, Tamás; Tompa, Kálmán
2016-01-01
Wide-line 1H NMR intensity and differential scanning calorimetry measurements were carried out on the intrinsically disordered 73-residue full transactivation domain (TAD) of the p53 tumor suppressor protein and two peptides: one a wild type p53 TAD peptide with a helix pre-structuring property, and a mutant peptide with a disabled helix-forming propensity. Measurements were carried out in order to characterize their water and ion binding characteristics. By quantifying the number of hydrate water molecules, we provide a microscopic description for the interactions of water with a wild-type p53 TAD and two p53 TAD peptides. The results provide direct evidence that intrinsically disordered proteins (IDPs) and a less structured peptide not only have a higher hydration capacity than globular proteins, but are also able to bind a larger amount of charged solute ions. [BMB Reports 2016; 49(9): 497-501] PMID:27418282
Roles of p53 and p27 Kip1 in the regulation of neurogenesis in the murine adult subventricular zone
Gil-Perotin, Sara; Haines, Jeffery D.; Kaur, Jasbir; Marin-Husstege, Mireya; Spinetta, Michael J.; Kim, Kwi-Hye; Duran-Moreno, Maria; Schallert, Timothy; Zindy, Frederique; Roussel, Martine F.; Garcia-Verdugo, Jose M.; Casaccia, Patrizia
2011-01-01
The tumor suppressor protein p53 (Trp53) and the cell cycle inhibitor p27 Kip1 (Cdknb1) have both been implicated in regulating proliferation of adult subventricular zone (aSVZ) cells. We previously reported that genetic ablation of Trp53 (Trp53 −/−) or Cdknb1 (p27 Kip1−/−) increased proliferation of cells in the aSVZ, but differentially affected the number of adult born neuroblasts. We therefore hypothesized that these molecules might play non-redundant roles. To test this hypothesis we generated mice lacking both genes (Trp53 −/−;p27 Kip1−/−) and analysed the consequences on aSVZ cells and adult neuroblasts. Proliferation and self-renewal of cultured aSVZ cells were increased in the double mutants compared with control, but the mice did not develop spontaneous brain tumors. In contrast, the number of adult-born neuroblasts in the double mutants was similar to wild-type animals and suggested a complementation of the p27 Kip1−/− phenotype due to loss of Trp53. Cellular differences detected in the aSVZ correlated with cellular changes in the olfactory bulb and behavioral data on novel odor recognition. The exploration time for new odors was reduced in p27 Kip1−/− mice, increased in Trp53 −/− mice and normalized in the double Trp53−/−;p27 Kip1−/− mutants. At the molecular level, Trp53 −/− aSVZ cells were characterized by higher levels of NeuroD and Math3 and by the ability to generate neurons more readily. In contrast, p27 Kip1−/− cells generated fewer neurons, due to enhanced proteasomal degradation of pro-neural transcription factors. Together, these results suggest that p27 Kip1 and p53 function non-redundantly to modulate proliferation and self-renewal of aSVZ cells and antagonistically in regulating adult neurogenesis. PMID:21899604
p53 and metabolism: from mechanism to therapeutics
Simabuco, Fernando M.; Morale, Mirian G.; Pavan, Isadora C.B.; Morelli, Ana P.; Silva, Fernando R.; Tamura, Rodrigo E.
2018-01-01
The tumor cell changes itself and its microenvironment to adapt to different situations, including action of drugs and other agents targeting tumor control. Therefore, metabolism plays an important role in the activation of survival mechanisms to keep the cell proliferative potential. The Warburg effect directs the cellular metabolism towards an aerobic glycolytic pathway, despite the fact that it generates less adenosine triphosphate than oxidative phosphorylation; because it creates the building blocks necessary for cell proliferation. The transcription factor p53 is the master tumor suppressor; it binds to more than 4,000 sites in the genome and regulates the expression of more than 500 genes. Among these genes are important regulators of metabolism, affecting glucose, lipids and amino acids metabolism, oxidative phosphorylation, reactive oxygen species (ROS) generation and growth factors signaling. Wild-type and mutant p53 may have opposing effects in the expression of these metabolic genes. Therefore, depending on the p53 status of the cell, drugs that target metabolism may have different outcomes and metabolism may modulate drug resistance. Conversely, induction of p53 expression may regulate differently the tumor cell metabolism, inducing senescence, autophagy and apoptosis, which are dependent on the regulation of the PI3K/AKT/mTOR pathway and/or ROS induction. The interplay between p53 and metabolism is essential in the decision of cell fate and for cancer therapeutics. PMID:29805774
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
2015-01-01
Temozolomide (TMZ)-resistance in glioblastoma multiforme (GBM) has been linked to upregulation of O6-methylguanine-DNA methyltransferase (MGMT). Wild-type (wt) p53 was previously shown to down-modulate MGMT. However, p53 therapy for GBM is limited by lack of efficient delivery across the blood brain barrier (BBB). We have developed a systemic nanodelivery platform (scL) for tumor-specific targeting (primary and metastatic), which is currently in multiple clinical trials. This self-assembling nanocomplex is formed by simple mixing of the components in a defined order and a specific ratio. Here, we demonstrate that scL crosses the BBB and efficiently targets GBM, as well as cancer stem cells (CSCs), which have been implicated in recurrence and treatment resistance in many human cancers. Moreover, systemic delivery of scL-p53 down-modulates MGMT and induces apoptosis in intracranial GBM xenografts. The combination of scL-p53 and TMZ increased the antitumor efficacy of TMZ with enhanced survival benefit in a mouse model of highly TMZ-resistant GBM. scL-p53 also sensitized both CSCs and bulk tumor cells to TMZ, increasing apoptosis. These results suggest that combining scL-p53 with standard TMZ treatment could be a more effective therapy for GBM. PMID:24811110
The role of p53 in cancer drug resistance and targeted chemotherapy.
Hientz, Karin; Mohr, André; Bhakta-Guha, Dipita; Efferth, Thomas
2017-01-31
Cancer has long been a grievous disease complicated by innumerable players aggravating its cure. Many clinical studies demonstrated the prognostic relevance of the tumor suppressor protein p53 for many human tumor types. Overexpression of mutated p53 with reduced or abolished function is often connected to resistance to standard medications, including cisplatin, alkylating agents (temozolomide), anthracyclines, (doxorubicin), antimetabolites (gemcitabine), antiestrogenes (tamoxifen) and EGFR-inhibitors (cetuximab). Such mutations in the TP53 gene are often accompanied by changes in the conformation of the p53 protein. Small molecules that restore the wild-type conformation of p53 and, consequently, rebuild its proper function have been identified. These promising agents include PRIMA-1, MIRA-1, and several derivatives of the thiosemicarbazone family. In addition to mutations in p53 itself, p53 activity may be also be impaired due to alterations in p53's regulating proteins such as MDM2. MDM2 functions as primary cellular p53 inhibitor and deregulation of the MDM2/p53-balance has serious consequences. MDM2 alterations often result in its overexpression and therefore promote inhibition of p53 activity. To deal with this problem, a judicious approach is to employ MDM2 inhibitors. Several promising MDM2 inhibitors have been described such as nutlins, benzodiazepinediones or spiro-oxindoles as well as novel compound classes such as xanthone derivatives and trisubstituted aminothiophenes. Furthermore, even naturally derived inhibitor compounds such as α-mangostin, gambogic acid and siladenoserinols have been discovered. In this review, we discuss in detail such small molecules that play a pertinent role in affecting the p53-MDM2 signaling axis and analyze their potential as cancer chemotherapeutics.
Xiong, Kan; Zwier, Matthew C.; Myshakina, Nataliya S.; Burger, Virginia M.; Asher, Sanford A.; Chong, Lillian T.
2011-01-01
We report the first experimental measurements of Ramachandran Ψ-angle distributions for intrinsically disordered peptides: the N-terminal peptide fragment of tumor suppressor p53 and its P27 mutant form. To provide atomically detailed views of the conformational distributions, we performed classical, explicit-solvent molecular dynamics simulations on the microsecond timescale. Upon binding its partner protein, MDM2, wild-type p53 peptide adopts an α-helical conformation. Mutation of Pro27 to serine results in the highest affinity yet observed for MDM2-binding of the p53 peptide. Both UV resonance Raman spectroscopy (UVRR) and simulations reveal that the P27S mutation decreases the extent of PPII helical content and increases the probability for conformations that are similar to the α-helical MDM2-bound conformation. In addition, UVRR measurements were performed on peptides that were isotopically labeled at the Leu26 residue preceding the Pro27 in order to determine the conformational distributions of Leu26 in the wild-type and mutant peptides. The UVRR and simulation results are in quantitative agreement in terms of the change in the population of non-PPII conformations involving Leu26 upon mutation of Pro27 to serine. Finally, our simulations reveal that the MDM2-bound conformation of the peptide is significantly populated in both the wild-type and mutant isolated peptide ensembles in their unbound states, suggesting that MDM2 binding of the p53 peptides may involve conformational selection. PMID:21528875
The Central Sirtuin 1/p53 Pathway Is Essential for the Orexigenic Action of Ghrelin
Velásquez, Douglas A.; Martínez, Gloria; Romero, Amparo; Vázquez, María J.; Boit, Katia D.; Dopeso-Reyes, Iria G.; López, Miguel; Vidal, Anxo; Nogueiras, Ruben; Diéguez, Carlos
2011-01-01
OBJECTIVE Ghrelin is a stomach-derived peptide that increases food intake through the activation of hypothalamic AMP-activated protein kinase (AMPK). However, the molecular mechanisms initiated by the activation of the ghrelin receptor, which in turn lead to AMPK activation, remain unclear. Sirtuin 1 (SIRT1) is a deacetylase activated in response to calorie restriction that acts through the tumor suppressor gene p53. We tested the hypothesis that the central SIRT1/p53 pathway might be mediating the orexigenic action of ghrelin. RESEARCH DESIGN AND METHODS SIRT1 inhibitors, such as Ex527 and sirtinol, and AMPK activators, such as AICAR, were administered alongside ghrelin in the brain of rats and mice (wild-type versus p53 knockout [KO]). Their hypothalamic effects on lipid metabolism and changes in transcription factors and neuropeptides were assessed by Western blot and in situ hybridization. RESULTS The central pretreatment with Ex527, a potent SIRT1 inhibitor, blunted the ghrelin-induced food intake in rats. Mice lacking p53, a target of SIRT1 action, failed to respond to ghrelin in feeding behavior. Ghrelin failed to phosphorylate hypothalamic AMPK when rats were pretreated with Ex527, as it did in p53 KO mice. It is noteworthy that the hypothalamic SIRT1/p53 pathway seems to be specific for mediating the orexigenic action of ghrelin, because central administration of AICAR, a potent AMPK activator, increased food intake in p53 KO mice. Finally, blockade of the central SIRT1 pathway did not modify ghrelin-induced growth hormone secretion. CONCLUSIONS Ghrelin specifically triggers a central SIRT1/p53 pathway that is essential for its orexigenic action, but not for the release of growth hormone. PMID:21386086
Di Marzo, Domenico; Forte, Iris Maria; Indovina, Paola; Di Gennaro, Elena; Rizzo, Valeria; Giorgi, Francesca; Mattioli, Eliseo; Iannuzzi, Carmelina Antonella; Budillon, Alfredo; Giordano, Antonio; Pentimalli, Francesca
2014-01-01
Malignant mesothelioma, a very aggressive tumor associated to asbestos exposure, is expected to increase in incidence, and unfortunately, no curative modality exists. Reactivation of p53 is a new attractive antitumoral strategy. p53 is rarely mutated in mesothelioma, but it is inactivated in most tumors by the lack of p14(ARF). Here, we evaluated the feasibility of this approach in pleural mesothelioma by testing RITA and nutlin-3, two molecules able to restore p53 function through a different mechanism, on a panel of mesothelioma cell lines representing the epithelioid (NCI-H28, NCI-H2452, IST-MES 2), biphasic (MSTO-211H), and sarcomatoid (NCI-H2052) histotypes compared with the normal mesothelial HMC-hTERT. RITA triggered robust caspase-dependent apoptosis specifically in epithelioid and biphasic mesothelioma cell lines, both through wild-type and mutant p53, concomitant to p21 downregulation. Conversely, nutlin-3 induced a p21-dependent growth arrest, rather than apoptosis, and was slightly toxic on HMC-hTERT. Interestingly, we identified a previously undetected point mutation of p53 (p.Arg249Ser) in IST-MES 2, and showed that RITA is also able to reactivate this p53 mutant protein and its apoptotic function. RITA reduced tumor growth in a MSTO-211H-derived xenograft model of mesothelioma and synergized with cisplatin, which is the mainstay of treatment for this tumor. Our data indicate that reactivation of p53 and concomitant p21 downregulation effectively induce cell death in mesothelioma, a tumor characterized by a high intrinsic resistance to apoptosis. Altogether, our findings provide the preclinical framework supporting the use of p53-reactivating agents alone, or in combination regimens, to improve the outcome of patients with mesothelioma.
p53 in breast cancer subtypes and new insights into response to chemotherapy.
Bertheau, Philippe; Lehmann-Che, Jacqueline; Varna, Mariana; Dumay, Anne; Poirot, Brigitte; Porcher, Raphaël; Turpin, Elisabeth; Plassa, Louis-François; de Roquancourt, Anne; Bourstyn, Edwige; de Cremoux, Patricia; Janin, Anne; Giacchetti, Sylvie; Espié, Marc; de Thé, Hugues
2013-08-01
Despite an obvious central role of p53 in the hallmarks of cancer, TP53 status is not yet used for the management of breast cancer. Recent findings may lead to reconsider the role of p53 in breast cancer. TP53 mutations are the most frequent genetic alterations in breast cancer, observed in 30% of breast carcinomas. Their distribution is highly linked to molecular tumor subtypes found in 26% of luminal tumors (17% of luminal A, 41% of luminal B), in 50% of HER2 amplified tumors, in 69% of molecular apocrine breast carcinomas and in 88% of basal-like carcinomas. The type of mutation is linked to the tumor subtype with higher frequency of base-pair substitutions in luminal tumors, whereas molecular apocrine and basal-like tumors present much higher frequency of complex mutations (deletions/insertions). The timing of TP53 mutation also depends on the tumor subtype, being the first important event in luminal tumors but occurring after PTEN loss in basal-like tumors. Regarding response to cytotoxic chemotherapy, the situation is far from the p53-dependent apoptosis paradigm with subsequent clinical response. We reported that TP53 mutated non inflammatory locally advanced breast carcinomas had a high rate of complete pathological response to dose-dense doxorubicin-cyclophosphamide chemotherapy, while TP53 wild-type (WT) tumors never achieved complete response. Using human breast cancer xenograft models, we suggested that this could be due to the induction of senescence in TP53 WT tumor cells. A recent work confirmed these findings in MMTV-Wnt1 mammary tumors, showing that growth arrest and senescent phenotype, not apoptosis, were induced in TP53 WT tumors following doxorubicin treatment, while lack of arrest in mutant tumors resulted in aberrant mitoses, cell death and a superior clinical response. Furthermore, in ER positive (ER(+)) breast tumors, it has been recently reported that ER represses the p53-mediated apoptotic response induced by DNA damage. Taken together
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
2010-01-01
Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557
Grating acuity at different luminances in wild-type mice and in mice lacking rod or cone function.
Schmucker, Christine; Seeliger, Mathias; Humphries, Pete; Biel, Martin; Schaeffel, Frank
2005-01-01
The mouse eye has become an important model in vision research. However, it is not known how visual acuity changes with luminance. Therefore, grating acuity of mice was measured at different luminances in an automated optomotor paradigm. Furthermore, mutant mice lacking either rods (RHO-/- and CNGB1-/-) or cones (CNGA3-/-), or both, were studied to determine the rod and cone contribution to visual acuity. Freely ranging individual mice were automatically tracked at a 25-Hz sampling rate with a self-programmed video system in a large rotating optomotor drum. The drum had a square-wave grating inside with adjustable spatial frequency. The angular speed of the mice with respect to the center of the drum and the angular orientation of the snout-tail body axis were analyzed. In addition, the motor activity of the wild-type mice was recorded at different luminances. The optomotor drum provided reliable data on visual input to the mouse's behavior and was convenient to use, since the experimenter's had only to place the mice individually in a Perspex cylinder. Optomotor grating acuity of the wild-type mice was limited to 0.3 to 0.4 cyc/deg. Maximum optomotor responses were obtained at 0.1 to 0.2 cyc/deg. The importance of visual input declined monotonically with decreasing luminance (30 cd/m2, 100%; 0.1 cd/m2, 76.4%; 0.005 cd/m2, 45.9%; and darkness, -9%). Mice lacking functional rods were able to resolve gratings up to 0.1 cyc/deg at 30 cd/m2. Surprisingly, mice lacking functional cones had an optomotor acuity that was similar to the wild-type. Double-knockout mice without rods and cones had no detectable grating acuity. Because the visual system of the mouse is more responsive at bright luminances, experiments in which visual input is important should be performed in photopic conditions (30 cd/m2 or even more). Apparently, spatial vision is governed by the rod system, which is not saturated in the mesopic or low photopic range. Mice lacking both rods and cones have no
Yang, Min-Chi; Lin, Ru-Wei; Huang, Shih-Bo; Huang, Shin-Yuan; Chen, Wen-Jie; Wang, Shiaw; Hong, Yi-Ren; Wang, Chihuei
2016-01-01
Doxorubicin and other anthracycline compounds exert their anti-cancer effects by causing DNA damage and initiating cell cycle arrest in cancer cells, followed by apoptosis. DNA damage generally activates a p53-mediated pathway to initiate apoptosis by increasing the level of the BH3-only protein, Puma. However, p53-mediated apoptosis in response to DNA damage has not yet been validated in prostate cancers. In the current study, we used LNCaP and PC3 prostate cancer cells, representing wild type p53 and a p53-null model, to determine if DNA damage activates p53-mediated apoptosis in prostate cancers. Our results revealed that PC3 cells were 4 to 8-fold less sensitive than LNCaP cells to doxorubicin-inuced apoptosis. We proved that the differential response of LNCaP and PC3 to doxorubicin was p53-independent by introducing wild-type or dominant negative p53 into PC3 or LNCaP cells, respectively. By comparing several apoptosis-related proteins in both cell lines, we found that Bcl-xl proteins were much more abundant in PC3 cells than in LNCaP cells. We further demonstrated that Bcl-xl protects LNCaP and PC3 cells from doxorubicin-induced apoptosis by using ABT-263, an inhibitor of Bcl-xl, as a single agent or in combination with doxorubicin to treat LNCaP or PC3 cells. Bcl-xl rather than p53, likely contributes to the differential response of LNCaP and PC3 to doxorubicin in apoptosis. Finally, co-immunoprecipitation and siRNA analysis revealed that a BH3-only protein, Bim, is involved in doxorubicin-induced apoptosis by directly counteracting Bcl-xl.
de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad
2016-01-01
O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma. PMID:27402830
The oncoprotein gankyrin binds to MDM2/HDM2, enhancing ubiquitylation and degradation of p53.
Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Nagao, Toshikazu; Sumitomo, Yasuhiko; Sumitomo, Haruhiko; Masuda, Tomoko; Dawson, Simon; Shimada, Yutaka; Mayer, R John; Fujita, Jun
2005-07-01
Gankyrin is an ankyrin repeat oncoprotein commonly overexpressed in hepatocellular carcinomas. Gankyrin interacts with the S6 proteasomal ATPase and accelerates the degradation of the tumor suppressor Rb. We show here that gankyrin has an antiapoptotic activity in cells exposed to DNA damaging agents. Downregulation of gankyrin induces apoptosis in cells with wild-type p53. In vitro and in vivo experiments revealed that gankyrin binds to Mdm2, facilitating p53-Mdm2 binding, and increases ubiquitylation and degradation of p53. Gankyrin also enhances Mdm2 autoubiquitylation in the absence of p53. Downregulation of gankyrin reduced amounts of Mdm2 and p53 associated with the 26S proteasome. Thus, gankyrin is a cofactor that increases the activities of Mdm2 on p53 and probably targets polyubiquitylated p53 into the 26S proteasome.
Detection of genotoxic and non-genotoxic carcinogens in Xpc{sup −/−}p53{sup +/−} mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Melis, Joost P.M.; Leiden University Medical Center, Department of Toxicogenetics, Leiden; Speksnijder, Ewoud N.
2013-01-15
An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed themore » Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Highlights: ► The Xpc*p53 mouse model is able to identify genotoxic and non-genotoxic carcinogens. ► Time, animals and cost can be significantly reduced compared to the 2-year bioassay. ► Xpc*p53 mice are more advantageous for carcinogen identification than Xpa*p53 mice. ► Xpc*p53 mice exhibit a wild type response upon exposure to genotoxicants.« less
Basu, Mahashweta; Bhattacharyya, Nitai P.; Mohanty, Pradeep K.
2013-01-01
Disease-causing mutations usually change the interacting partners of mutant proteins. In this article, we propose that the biological consequences of mutation are directly related to the alteration of corresponding protein protein interaction networks (PPIN). Mutation of Huntingtin (HTT) which causes Huntington's disease (HD) and mutations to TP53 which is associated with different cancers are studied as two example cases. We construct the PPIN of wild type and mutant proteins separately and identify the structural modules of each of the networks. The functional role of these modules are then assessed by Gene Ontology (GO) enrichment analysis for biological processes (BPs). We find that a large number of significantly enriched () GO terms in mutant PPIN were absent in the wild type PPIN indicating the gain of BPs due to mutation. Similarly some of the GO terms enriched in wild type PPIN cease to exist in the modules of mutant PPIN, representing the loss. GO terms common in modules of mutant and wild type networks indicate both loss and gain of BPs. We further assign relevant biological function(s) to each module by classifying the enriched GO terms associated with it. It turns out that most of these biological functions in HTT networks are already known to be altered in HD and those of TP53 networks are altered in cancers. We argue that gain of BPs, and the corresponding biological functions, are due to new interacting partners acquired by mutant proteins. The methodology we adopt here could be applied to genetic diseases where mutations alter the ability of the protein to interact with other proteins. PMID:23741403
p53-Mdm2 interaction inhibitors as novel nongenotoxic anticancer agents.
Nayak, Surendra Kumar; Khatik, Gopal L; Narang, Rakesh; Monga, Vikramdeep; Chopra, Harish Kumar
2017-06-23
Cancer is a major global health problem with high mortality rate. Most of clinically used anticancer agents induce apoptosis through genotoxic stress at various stages of cell cycle and activation of p53. Acting as a tumor suppressor p53 plays a vital role in preventing tumor development. Tumor suppressor function of p53 is effectively antagonized by its direct interaction with murine double minute 2 (Mdm2) proteins via multiple mechanisms. Thus, p53-Mdm2 interaction has been found to be an important target for the development of novel anticancer agents. Currently, nutlin, spirooxindole, isoquilinone and piperidinone analogues inhibiting p53-Mdm2 interaction are found to be promising in the treatment of cancer. The current review focused to scrutinize the structural aspects of p53-Mdm2 interaction inhibitors. The present study provides a detailed collection of published information on different classes of inhibitors of p53-Mdm2 interaction as potential anticancer agents. The review highlighted the structural aspects of various reported p53-Mdm2 inhibitor for optimization. In the last few years, different classes of inhibitors of p53-Mdm2 have been designed and developed, and seven such compounds are being evaluated in clinical trials as new anticancer drugs. Further, to explore the role of p53 protein as a potential target for anticancer drug development, in this review, the mechanism of Mdm2 mediated inactivation of p53 and recent developments on p53-Mdm2 interactions inhibitors are discussed. Agents designed to block the p53-Mdm2 interaction may have a therapeutic potential for treatment of a subset of human cancers retaining wild-type p53. We review herein the recent advances in the design and development of potent small molecules as p53-Mdm2 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Chloroquine activates the p53 pathway and induces apoptosis in human glioma cells
Kim, Ella L.; Wüstenberg, Robin; Rübsam, Anne; Schmitz-Salue, Christoph; Warnecke, Gabriele; Bücker, Eva-Maria; Pettkus, Nadine; Speidel, Daniel; Rohde, Veit; Schulz-Schaeffer, Walter; Deppert, Wolfgang; Giese, Alf
2010-01-01
Glioblastoma is the most common malignant brain tumor in adults. The currently available treatments offer only a palliative survival advantage and the need for effective treatments remains an urgent priority. Activation of the p53 growth suppression/apoptotic pathway is one of the promising strategies in targeting glioma cells. We show that the quinoline derivative chloroquine activates the p53 pathway and suppresses growth of glioma cells in vitro and in vivo in an orthotopic (U87MG) human glioblastoma mouse model. Induction of apoptosis is one of the mechanisms underlying the effects of chloroquine on suppressing glioma cell growth and viability. siRNA-mediated downregulation of p53 in wild-type but not mutant p53 glioblastoma cells substantially impaired chloroquine-induced apoptosis. In addition to its p53-activating effects, chloroquine may also inhibit glioma cell growth via p53-independent mechanisms. Our results clarify the mechanistic basis underlying the antineoplastic effect of chloroquine and reveal its therapeutic potential as an adjunct to glioma chemotherapy. PMID:20308316
EBNA3C regulates p53 through induction of Aurora kinase B
Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.
2015-01-01
In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063
Degradation of phosphorylated p53 by viral protein-ECS E3 ligase complex.
Sato, Yoshitaka; Kamura, Takumi; Shirata, Noriko; Murata, Takayuki; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Isomura, Hiroki; Nishiyama, Yukihiro; Tsurumi, Tatsuya
2009-07-01
p53-signaling is modulated by viruses to establish a host cellular environment advantageous for their propagation. The Epstein-Barr virus (EBV) lytic program induces phosphorylation of p53, which prevents interaction with MDM2. Here, we show that induction of EBV lytic program leads to degradation of p53 via an ubiquitin-proteasome pathway independent of MDM2. The BZLF1 protein directly functions as an adaptor component of the ECS (Elongin B/C-Cul2/5-SOCS-box protein) ubiquitin ligase complex targeting p53 for degradation. Intringuingly, C-terminal phosphorylation of p53 resulting from activated DNA damage response by viral lytic replication enhances its binding to BZLF1 protein. Purified BZLF1 protein-associated ECS could be shown to catalyze ubiquitination of phospho-mimetic p53 more efficiently than the wild-type in vitro. The compensation of p53 at middle and late stages of the lytic infection inhibits viral DNA replication and production during lytic infection, suggesting that the degradation of p53 is required for efficient viral propagation. Taken together, these findings demonstrate a role for the BZLF1 protein-associated ECS ligase complex in regulation of p53 phosphorylated by activated DNA damage signaling during viral lytic infection.
p53 Regulates Bone Differentiation and Osteosarcoma Formation | Center for Cancer Research
Osteosarcoma is an uncommon cancer that usually begins in the large bones of the arm or leg, but is the second leading cause of cancer-related death in children and young adults. The tumor suppressor protein, p53, appears to be an important player in osteosarcomagenesis in part because these cancers are one of the most common to develop in patients with Li-Fraumeni syndrome, which is caused by an inherited mutation in p53. However, the precise role of p53 in osteosarcoma development has not been established. To begin investigating its importance to the formation of normal bone and osteosarcomas, Jing Huang, Ph.D., of CCR’s Laboratory of Cancer Biology and Genetics, and his colleagues, isolated bone marrow-derived mesenchymal stem cells (BMSCs) from p53 wild type (WT) and knock out (KO) mice using a recently validated approach. Because BMSCs are one of the cells-of-origin of osteosarcoma, they serve as a useful model system. BMSCs contain a subset of multipotent stem cells that can differentiate into several cell types, including osteoblasts, and are important mediators of bone homeostasis.
Caspase-2-mediated cleavage of Mdm2 creates p53-induced positive feedback loop
Oliver, Trudy G.; Meylan, Etienne; Chang, Gregory P.; Xue, Wen; Burke, James R.; Humpton, Timothy J.; Hubbard, Diana; Bhutkar, Arjun; Jacks, Tyler
2011-01-01
SUMMARY Caspase-2 is an evolutionarily conserved caspase, yet its biological function and cleavage targets are poorly understood. Caspase-2 is activated by the p53 target gene product PIDD (also known as LRDD) in a complex called the Caspase-2-PIDDosome. We show that PIDD expression promotes growth arrest and chemotherapy resistance by a mechanism that depends on Caspase-2 and wild-type p53. PIDD-induced Caspase-2 directly cleaves the E3 ubiquitin ligase Mdm2 at Asp 367, leading to loss of the C-terminal RING domain responsible for p53 ubiquitination. As a consequence, N-terminally truncated Mdm2 binds p53 and promotes its stability. Upon DNA damage, p53 induction of the Caspase-2-PIDDosome creates a positive feedback loop that inhibits Mdm2 and reinforces p53 stability and activity, contributing to cell survival and drug resistance. These data establish Mdm2 as a cleavage target of Caspase-2 and provide insight into a mechanism of Mdm2 inhibition that impacts p53 dynamics upon genotoxic stress. PMID:21726810
Guo, Yunjun; Parry, Jesse J.; Laforest, Richard; Rogers, Buck E.; Anderson, Carolyn J.
2014-01-01
Radioimmunotherapy has been successfully used in the treatment of lymphoma but thus far has not demonstrated significant efficacy in humans beyond disease stabilization in solid tumors. Radioimmunotherapy with 64Cu was highly effective in a hamster model of colorectal cancer, but targeted radiotherapies with this radionuclide have since not shown as much success. It is widely known that mutations in key proteins play a role in the success or failure of cancer therapies. For example, the KRAS mutation is predictive of poor response to anti–epidermal growth factor receptor therapies in colorectal cancer, whereas p53 is frequently mutated in tumors, causing resistance to multiple therapeutic regimens. Methods We previously showed that nuclear localization of 64Cu-labeled DOTA-cetuximab was enhanced in p53 wild-type tumor cells. Here, we examine the role of p53 in the response to radioimmunotherapy with 64Cu-DOTA-cetuximab in KRAS-mutated HCT116 tumor–bearing mice, with and without cisplatin, which upregulates wild-type p53. Results Experiments with HCT116 cells that are p53 +/+ (p53 wild-type) and −/− (p53 null) grown in cell culture demonstrated that preincubation with cisplatin increased expression of p53 and subsequently enhanced localization of 64Cu from 64Cuacetate and 64Cu-DOTA-cetuximab to the tumor cell nuclei. Radioimmunotherapy studies in p53-positive HCT116 tumor–bearing mice, receiving either radioimmunotherapy alone or in combination with cisplatin, showed significantly longer survival in mice receiving unlabeled cetuximab or cisplatin alone or in combination (all, P < 0.01). In contrast, the p53-negative tumor-bearing mice treated with radioimmunotherapy alone or combined with cisplatin showed no survival advantage, compared with control groups (all, P > 0.05). Conclusion Together, these data suggest that 64Cu specifically delivered to epidermal growth factor receptor–positive tumors by cetuximab can suppress tumor growth despite the KRAS
Guo, Yunjun; Parry, Jesse J; Laforest, Richard; Rogers, Buck E; Anderson, Carolyn J
2013-09-01
Radioimmunotherapy has been successfully used in the treatment of lymphoma but thus far has not demonstrated significant efficacy in humans beyond disease stabilization in solid tumors. Radioimmunotherapy with (64)Cu was highly effective in a hamster model of colorectal cancer, but targeted radiotherapies with this radionuclide have since not shown as much success. It is widely known that mutations in key proteins play a role in the success or failure of cancer therapies. For example, the KRAS mutation is predictive of poor response to anti-epidermal growth factor receptor therapies in colorectal cancer, whereas p53 is frequently mutated in tumors, causing resistance to multiple therapeutic regimens. We previously showed that nuclear localization of (64)Cu-labeled DOTA-cetuximab was enhanced in p53 wild-type tumor cells. Here, we examine the role of p53 in the response to radioimmunotherapy with (64)Cu-DOTA-cetuximab in KRAS-mutated HCT116 tumor-bearing mice, with and without cisplatin, which upregulates wild-type p53. Experiments with HCT116 cells that are p53 +/+ (p53 wild-type) and -/- (p53 null) grown in cell culture demonstrated that preincubation with cisplatin increased expression of p53 and subsequently enhanced localization of (64)Cu from (64)Cu-acetate and (64)Cu-DOTA-cetuximab to the tumor cell nuclei. Radioimmunotherapy studies in p53-positive HCT116 tumor-bearing mice, receiving either radioimmunotherapy alone or in combination with cisplatin, showed significantly longer survival in mice receiving unlabeled cetuximab or cisplatin alone or in combination (all, P < 0.01). In contrast, the p53-negative tumor-bearing mice treated with radioimmunotherapy alone or combined with cisplatin showed no survival advantage, compared with control groups (all, P > 0.05). Together, these data suggest that (64)Cu specifically delivered to epidermal growth factor receptor-positive tumors by cetuximab can suppress tumor growth despite the KRAS status and present
p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin
2008-01-25
S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53{sup wt}) or being p(HCT-116 p53{sup -/-}), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53{sup -/-} xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53{sup wt}more » cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53{sup wt} cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75{sup NTR}, p53 and Bax.« less
Mitoguazone induces apoptosis via a p53-independent mechanism.
Davidson, K; Petit, T; Izbicka, E; Koester, S; Von Hoff, D D
1998-08-01
Mitoguazone (methylglyoxal bisguanylhydrazone, methyl-GAG or MGBG) is a synthetic polycarbonyl derivative with activity in patients with Hodgkin's and non-Hodgkin's lymphoma, head and neck cancer, prostate cancer, and esophageal cancer. Mitoguazone has also recently been documented to have activity in patients with AIDS-related lymphoma. Among anticancer drugs, mitoguazone has a unique mechanism of action via interference with the polyamine biosynthetic pathway. Polyamines stabilize DNA structure by non-covalent cross-bridging between phosphate groups on opposite strands. In addition, mitoguazone causes uncoupling of oxidative phosphorylation. In this study, the ability of mitoguazone to induce apoptosis by inhibiting the polyamine pathway was assessed in three Burkitt's lymphoma cell lines (Raji, Ramos and Daudi) and one prostate carcinoma cell line (MPC 3). Additional evaluations were performed in two human breast cancer cell lines (MCF7 with wild-type p53 and VM4K with mutated p53) to determine whether the p53 tumor suppressor gene was required for efficient apoptosis induction. The present study demonstrated that mitoguazone induces apoptosis in all the different human cancer cell lines tested in a concentration- and time-dependent way, and triggers a p53-independent programmed cell death in the human breast cancer MCF7 cell line.
Namba, Takushi; Chu, Kiki; Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W
2015-08-21
Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53.
Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W.
2015-01-01
Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53. PMID:26254280
Poor prognosis in non-villous splenic marginal zone cell lymphoma is associated with p53 mutations.
Baldini, L; Guffanti, A; Cro, L; Fracchiolla, N S; Colombi, M; Motta, M; Maiolo, A T; Neri, A
1997-11-01
We have recently reported a series of 15 non-villous splenic marginal zone lymphoma patients, six of whom showed p53 mutations (40%). This molecular alteration did not correlate with any particular clinico-pathologic feature at diagnosis. After a median follow-up of 56 months, four cases evolved into aggressive fatal non-Hodgkin's lymphoma (NHL) and two had refractory progressive disease; interestingly, p53 mutations were demonstrated in five of these patients at diagnosis. As the patients with wild-type p53 presented responsive or indolent disease, this genetic alteration may be an early marker of aggressive transformation or refractoriness. p53 evaluation at diagnosis could be advisable in this particular subset of NHL.
Pu-erh Tea Inhibits Tumor Cell Growth by Down-Regulating Mutant p53
Zhao, Lanjun; Jia, Shuting; Tang, Wenru; Sheng, Jun; Luo, Ying
2011-01-01
Pu-erh tea is a kind of fermented tea with the incorporation of microorganisms’ metabolites. Unlike green tea, the chemical characteristics and bioactivities of Pu-erh tea are still not well understood. Using water extracts of Pu-erh tea, we analyzed the tumor cell growth inhibition activities on several genetically engineered mouse tumor cell lines. We found that at the concentration that did not affect wild type mouse embryo fibroblasts (MEFs) growth, Pu-erh tea extracts could inhibit tumor cell growth by down-regulated S phase and cause G1 or G2 arrest. Further study showed that Pu-erh tea extracts down-regulated the expression of mutant p53 in tumor cells at the protein level as well as mRNA level. The same concentration of Pu-erh tea solution did not cause p53 stabilization or activation of its downstream pathways in wild type cells. We also found that Pu-erh tea treatment could slightly down-regulate both HSP70 and HSP90 protein levels in tumor cells. These data revealed the action of Pu-erh tea on tumor cells and provided the possible mechanism for Pu-erh tea action, which explained its selectivity in inhibiting tumor cells without affecting wild type cells. Our data sheds light on the application of Pu-erh tea as an anti-tumor agent with low side effects. PMID:22174618
Lo, Pang-Kuo; Lee, Ji Shin; Sukumar, Saraswati
2011-01-01
We previously identified FOXF1 as a potential tumor suppressor gene with an essential role in preventing DNA rereplication to maintain genomic stability, which is frequently inactivated in breast cancer through the epigenetic mechanism. Here we further addressed the role of the p53-p21WAF1 checkpoint pathway in DNA rereplication induced by silencing of FOXF1. Knockdown of FOXF1 by small interference RNA (siRNA) rendered colorectal p53-null and p21WAF1-null HCT116 cancer cells more susceptible to rereplication and apoptosis than the wild-type parental cells. In parental HCT116 cells with a functional p53 checkpoint, the p53-p21WAF1 checkpoint pathway was activated upon FOXF1 knockdown, which was concurrent with suppression of the CDK2-Rb cascade and induction of G1 arrest. In contrast, these events were not observed in FOXF1-depleted HCT116-p53−/− and HCT116-p21−/− cells, indicating the p53-dependent checkpoint function is vital for inhibiting CDK2 to induce G1 arrest and protect cells from rereplication. The pharmacologic inhibitor (caffeine) of Ataxia telangiectasia mutated (ATM) and ataxia telangiectasia and Rad3 related (ATR) protein kinases abolished activation of the p53-p21WAF1 pathway upon FOXF1 knockdown, suggesting that suppression of FOXF1 function triggered the ATM/ATR-mediated DNA damage response. Cosilencing of p53 by siRNA synergistically enhanced the effect of FOXF1 depletion on stimulation of DNA rereplication and apoptosis in wild-type HCT116. Finally, we show that FOXF1 expression is predominantly silenced in breast and colorectal cancer cell lines with inactive p53. Our study demonstrated that the p53-p21WAF1 checkpoint pathway is an intrinsically protective mechanism to prevent DNA rereplication induced by silencing of FOXF1. PMID:21964066
Geredeli, Caglayan; Yasar, Nurgul
2018-03-27
The aim of this study was to investigate the efficacy and safety of first-line panitumumab plus folinic acid, 5-fluorouracil and irinotecan (FOLFIRI) in patients with wild-type KRAS and wild-type NRAS metastatic colorectal cancer (mCRC). Patients with wild-type KRAS and wild-type NRAS mCRC presenting to the medical oncology department of the Okmeydani Training and Research Hospital in Istanbul, Turkey, between April 2014 and January 2018 were enrolled in this study. A total of 64 patients (35 males and 29 females) with a median age of 59 (35-81) years old were enrolled. The median follow-up was 18.9 months, and the median progression-free survival was 13 months. The median overall survival (OS) was 26 months in the patients with wild-type KRAS and wild-type NRAS mCRC. It was 90.4% for the 6-month OS, 79.5% for the 1-year OS, 53.7% for the 2-year OS and 31.1% for the 3-year OS. The median OS of the patients who underwent metastasectomies was 40 [95% confidence interval (CI) = 19.9-60.1] months, and the median OS of the patients without metastasectomies was 22 (95% CI = 17.7-26.4) months. There was a statistically significant difference between these (P = 0.007). The first-line FOLFIRI plus panitumumab was associated with favourable efficacy in the patients with wild-type KRAS and wild-type NRAS mCRC, and it was well tolerated. The removal of the metastases that became resectable after chemotherapy further prolonged the patients' survival. Retrospectively registered: 33886.
Michaelis, M; Rothweiler, F; Barth, S; Cinatl, J; van Rikxoort, M; Löschmann, N; Voges, Y; Breitling, R; von Deimling, A; Rödel, F; Weber, K; Fehse, B; Mack, E; Stiewe, T; Doerr, H W; Speidel, D; Cinatl, J
2011-01-01
Six p53 wild-type cancer cell lines from infrequently p53-mutated entities (neuroblastoma, rhabdomyosarcoma, and melanoma) were continuously exposed to increasing concentrations of the murine double minute 2 inhibitor nutlin-3, resulting in the emergence of nutlin-3-resistant, p53-mutated sublines displaying a multi-drug resistance phenotype. Only 2 out of 28 sublines adapted to various cytotoxic drugs harboured p53 mutations. Nutlin-3-adapted UKF-NB-3 cells (UKF-NB-3rNutlin10 μM, harbouring a G245C mutation) were also radiation resistant. Analysis of UKF-NB-3 and UKF-NB-3rNutlin10 μM cells by RNA interference experiments and lentiviral transduction of wild-type p53 into p53-mutated UKF-NB-3rNutlin10 μM cells revealed that the loss of p53 function contributes to the multi-drug resistance of UKF-NB-3rNutlin10 μM cells. Bioinformatics PANTHER pathway analysis based on microarray measurements of mRNA abundance indicated a substantial overlap in the signalling pathways differentially regulated between UKF-NB-3rNutlin10 μM and UKF-NB-3 and between UKF-NB-3 and its cisplatin-, doxorubicin-, or vincristine-resistant sublines. Repeated nutlin-3 adaptation of neuroblastoma cells resulted in sublines harbouring various p53 mutations with high frequency. A p53 wild-type single cell-derived UKF-NB-3 clone was adapted to nutlin-3 in independent experiments. Eight out of ten resulting sublines were p53-mutated harbouring six different p53 mutations. This indicates that nutlin-3 induces de novo p53 mutations not initially present in the original cell population. Therefore, nutlin-3-treated cancer patients should be carefully monitored for the emergence of p53-mutated, multi-drug-resistant cells. PMID:22170099
Soares, Joana; Raimundo, Liliana; Pereira, Nuno A L; dos Santos, Daniel J V A; Pérez, Maria; Queiroz, Glória; Leão, Mariana; Santos, Maria M M; Saraiva, Lucília
2015-01-01
Inactivation of the p53 tumor suppressor protein by interaction with murine double minute (MDM) proteins, MDM2 and MDMX, is a common event in human tumors expressing wild-type p53. In these tumors, the simultaneous inhibition of these interactions with MDMs, for a full p53 reactivation, represents a promising anticancer strategy. Herein, we report the identification of a dual inhibitor of the p53 interaction with MDM2 and MDMX, the (S)-tryptophanol derivative OXAZ-1, from the screening of a small library of enantiopure tryptophanol-derived oxazolopiperidone lactams, using a yeast-based assay. With human colon adenocarcinoma HCT116 cell lines expressing wild-type p53 (HCT116 p53(+/+)) and its p53-null isogenic derivative (HCT116 p53(-/-)), it was shown that OXAZ-1 induced a p53-dependent tumor growth-inhibitory effect. In fact, OXAZ-1 induced p53 stabilization, up-regulated p53 transcription targets, such as MDM2, MDMX, p21, Puma and Bax, and led to PARP cleavage, in p53(+/+), but not in p53(-/-), HCT116 cells. In addition, similar tumor cytotoxic effects were observed for OXAZ-1 against MDMX-overexpressing breast adenocarcinoma MCF-7 tumor cells, commonly described as highly resistant to MDM2-only inhibitors. In HCT116 p53(+/+) cells, the disruption of the p53 interaction with MDMs by OXAZ-1 was further confirmed by co-immunoprecipitation. It was also shown that OXAZ-1 potently triggered a p53-dependent mitochondria-mediated apoptosis, characterized by reactive oxygen species generation, mitochondrial membrane potential dissipation, Bax translocation to mitochondria, and cytochrome c release, and exhibited a p53-dependent synergistic effect with conventional chemotherapeutic drugs. Collectively, in this work, a novel selective activator of the p53 pathway is reported with promising antitumor properties to be explored either alone or combined with conventional chemotherapeutic drugs. Moreover, OXAZ-1 may represent a promising starting scaffold to search for new dual
MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.
Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M
2018-04-17
The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.
Signorelli, Sara; Santini, Simona; Yamada, Tohru; Bizzarri, Anna Rita; Beattie, Craig W; Cannistraro, Salvatore
2017-04-01
Mutations within the DNA binding domain (DBD) of the tumor suppressor p53 are found in >50% of human cancers and may significantly modify p53 secondary structure impairing its function. p28, an amphipathic cell-penetrating peptide, binds to the DBD through hydrophobic interaction and induces a posttranslational increase in wildtype and mutant p53 restoring functionality. We use mutation analyses to explore which elements of secondary structure may be critical to p28 binding. Molecular modeling, Raman spectroscopy, Atomic Force Spectroscopy (AFS) and Surface Plasmon Resonance (SPR) were used to identify which secondary structure of site-directed and naturally occurring mutant DBDs are potentially altered by discrete changes in hydrophobicity and the molecular interaction with p28. We show that specific point mutations that alter hydrophobicity within non-mutable and mutable regions of the p53 DBD alter specific secondary structures. The affinity of p28 was positively correlated with the β-sheet content of a mutant DBD, and reduced by an increase in unstructured or random coil that resulted from a loss in hydrophobicity and redistribution of surface charge. These results help refine our knowledge of how mutations within p53-DBD alter secondary structure and provide insight on how potential structural alterations in p28 or similar molecules improve their ability to restore p53 function. Raman spectroscopy, AFS, SPR and computational modeling are useful approaches to characterize how mutations within the p53DBD potentially affect secondary structure and identify those structural elements prone to influence the binding affinity of agents designed to increase the functionality of p53. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Lei; Pre-Doctoral Chinese Fellowship Student, Second West China Hospital, Sichuan University, Sichuan; Ling, Xiang
2012-05-04
Highlights: Black-Right-Pointing-Pointer Survivin inhibits the expression of p21 protein, mRNA and promoter activity. Black-Right-Pointing-Pointer Survivin neutralizes p53-induced p21 expression and promoter activity. Black-Right-Pointing-Pointer Survivin physically interacts with p53 in cancer cells. Black-Right-Pointing-Pointer Genetic silencing of endogenous survivin upregulates p21 in p53 wild type cancer cells. Black-Right-Pointing-Pointer Both p53 and survivin interacts on the two p53-binding sites in the p21 promoter. -- Abstract: Growing evidence suggests a role for the antiapoptotic protein survivin in promotion of cancer cell G1/S transition and proliferation. However, the underlying mechanism is unclear. Further, although upregulation of p21{sup WAF1/CIP1} by p53 plays an important role inmore » p53-mediated cell G1 arrests in response to various distresses, it is unknown whether survivin plays a role in the regulation of p21{sup WAF1/CIP1} expression. Here, we report that exogenous expression of survivin in p53-wild type MCF-7 breast cancer cells inhibits the expression of p21{sup WAF1/CIP1} protein, mRNA and promoter activity, while the survivin C84A mutant and antisense failed to do so. Cotransfection experiments in the p53 mutant H1650 lung cancer cell line showed that survivin neutralizes p53-induced p21{sup WAF1/CIP1} expression and promoter activity. Importantly, genetically silencing of endogenous survivin using lentiviral survivin shRNA also enhances endogenous p21 in p53 wild type cancer cells, suggesting the physiological relevance of the fining. We further demonstrated that both p53 and survivin interacts on the two p53-binding sites in the p21{sup WAF1/CIP1} promoter (-2313 to -2212; -1452 to -1310), and survivin physically interacts with p53 in cancer cells. Together, we propose that survivin may act as a transcription factor or cofactor to interact with p53 on the p21{sup WAF1/CIP1} promoter leading to the inhibition of p21{sup WAF1/CIP1
Wild, Peter J; Ikenberg, Kristian; Fuchs, Thomas J; Rechsteiner, Markus; Georgiev, Strahil; Fankhauser, Niklaus; Noske, Aurelia; Roessle, Matthias; Caduff, Rosmarie; Dellas, Athanassios; Fink, Daniel; Moch, Holger; Krek, Wilhelm; Frew, Ian J
2012-01-01
Type II endometrial carcinomas are a highly aggressive group of tumour subtypes that are frequently associated with inactivation of the TP53 tumour suppressor gene. We show that mice with endometrium-specific deletion of Trp53 initially exhibited histological changes that are identical to known precursor lesions of type II endometrial carcinomas in humans and later developed carcinomas representing all type II subtypes. The mTORC1 signalling pathway was frequently activated in these precursor lesions and tumours, suggesting a genetic cooperation between this pathway and Trp53 deficiency in tumour initiation. Consistent with this idea, analyses of 521 human endometrial carcinomas identified frequent mTORC1 pathway activation in type I as well as type II endometrial carcinoma subtypes. mTORC1 pathway activation and p53 expression or mutation status each independently predicted poor patient survival. We suggest that molecular alterations in p53 and the mTORC1 pathway play different roles in the initiation of the different endometrial cancer subtypes, but that combined p53 inactivation and mTORC1 pathway activation are unifying pathogenic features among histologically diverse subtypes of late stage aggressive endometrial tumours. PMID:22678923
Cohran, Valeria; Managlia, Elizabeth; Bradford, Emily M; Goretsky, Tatiana; Li, Ting; Katzman, Rebecca B; Cheresh, Paul; Brown, Jeffrey B; Hawkins, Jennifer; Liu, Shirley X L; De Plaen, Isabelle G; Weitkamp, Jörn-Hendrik; Helmrath, Michael; Zhang, Zheng; Barrett, Terrence A
2016-07-01
Intestinal adaptation to small-bowel resection (SBR) after necrotizing enterocolitis expands absorptive surface areas and promotes enteral autonomy. Survivin increases proliferation and blunts apoptosis. The current study examines survivin in intestinal epithelial cells after ileocecal resection. Wild-type and epithelial Pik3r1 (p85α)-deficient mice underwent sham surgery or 30% resection. RNA and protein were isolated from small bowel to determine levels of β-catenin target gene expression, activated caspase-3, survivin, p85α, and Trp53. Healthy and post-resection human infant small-bowel sections were analyzed for survivin, Ki-67, and TP53 by immunohistochemistry. Five days after ileocecal resection, epithelial levels of survivin increased relative to sham-operated on mice, which correlated with reduced cleaved caspase-3, p85α, and Trp53. At baseline, p85α-deficient intestinal epithelial cells had less Trp53 and more survivin, and relative responses to resection were blunted compared with wild-type. In infant small bowel, survivin in transit amplifying cells increased 71% after SBR. Resection increased proliferation and decreased numbers of TP53-positive epithelial cells. Data suggest that ileocecal resection reduces p85α, which lowers TP53 activation and releases survivin promoter repression. The subsequent increase in survivin among transit amplifying cells promotes epithelial cell proliferation and lengthens crypts. These findings suggest that SBR reduces p85α and TP53, which increases survivin and intestinal epithelial cell expansion during therapeutic adaptation in patients with short bowel syndrome. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells.
Ihry, Robert J; Worringer, Kathleen A; Salick, Max R; Frias, Elizabeth; Ho, Daniel; Theriault, Kraig; Kommineni, Sravya; Chen, Julie; Sondey, Marie; Ye, Chaoyang; Randhawa, Ranjit; Kulkarni, Tripti; Yang, Zinger; McAllister, Gregory; Russ, Carsten; Reece-Hoyes, John; Forrester, William; Hoffman, Gregory R; Dolmetsch, Ricardo; Kaykas, Ajamete
2018-06-11
CRISPR/Cas9 has revolutionized our ability to engineer genomes and conduct genome-wide screens in human cells 1-3 . Whereas some cell types are amenable to genome engineering, genomes of human pluripotent stem cells (hPSCs) have been difficult to engineer, with reduced efficiencies relative to tumour cell lines or mouse embryonic stem cells 3-13 . Here, using hPSC lines with stable integration of Cas9 or transient delivery of Cas9-ribonucleoproteins (RNPs), we achieved an average insertion or deletion (indel) efficiency greater than 80%. This high efficiency of indel generation revealed that double-strand breaks (DSBs) induced by Cas9 are toxic and kill most hPSCs. In previous studies, the toxicity of Cas9 in hPSCs was less apparent because of low transfection efficiency and subsequently low DSB induction 3 . The toxic response to DSBs was P53/TP53-dependent, such that the efficiency of precise genome engineering in hPSCs with a wild-type P53 gene was severely reduced. Our results indicate that Cas9 toxicity creates an obstacle to the high-throughput use of CRISPR/Cas9 for genome engineering and screening in hPSCs. Moreover, as hPSCs can acquire P53 mutations 14 , cell replacement therapies using CRISPR/Cas9-enginereed hPSCs should proceed with caution, and such engineered hPSCs should be monitored for P53 function.
Influence of p53 status on the effects of boron neutron capture therapy in glioblastoma.
Seki, Keiko; Kinashi, Yuko; Takahashi, Sentaro
2015-01-01
The tumor suppressor gene p53 is mutated in glioblastoma. We studied the relationship between the p53 gene and the biological effects of boron neutron capture therapy (BNCT). The human glioblastoma cells; A172, expressing wild-type p53, and T98G, with mutant p53, were irradiated by the Kyoto University Research Reactor (KUR). The biological effects after neutron irradiation were evaluated by the cell killing effect, 53BP1 foci assay and apoptosis induction. The survival-fraction data revealed that A172 was more radiosensitive than T98G, but the difference was reduced when boronophenylalanine (BPA) was present. Both cell lines exhibited similar numbers of foci, suggesting that the initial levels of DNA damage did not depend on p53 function. Detection of apoptosis revealed a lower rate of apoptosis in the T98G. BNCT causes cell death in glioblastoma cells, regardless of p53 mutation status. In T98G cells, cell killing and apoptosis occurred effectively following BNCT. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
A Designed Peptide Targets Two Types of Modifications of p53 with Anti-cancer Activity.
Liang, Lunxi; Wang, Huanbin; Shi, Hubing; Li, Zhaoli; Yao, Han; Bu, Zhigao; Song, Ningning; Li, Chushu; Xiang, Dabin; Zhang, Yao; Wang, Jilin; Hu, Ye; Xu, Qi; Ma, Yanlei; Cheng, Zhongyi; Wang, Yingchao; Zhao, Shuliang; Qian, Jin; Chen, Yingxuan; Fang, Jing-Yuan; Xu, Jie
2018-06-21
Many cancer-related proteins are controlled by composite post-translational modifications (PTMs), but prevalent strategies only target one type of modification. Here we describe a designed peptide that controls two types of modifications of the p53 tumor suppressor, based on the discovery of a protein complex that suppresses p53 (suppresome). We found that Morn3, a cancer-testis antigen, recruits different PTM enzymes, such as sirtuin deacetylase and ubiquitin ligase, to confer composite modifications on p53. The molecular functions of Morn3 were validated through in vivo assays and chemico-biological intervention. A rationally designed Morn3-targeting peptide (Morncide) successfully activated p53 and suppressed tumor growth. These findings shed light on the regulation of protein PTMs and present a strategy for targeting two modifications with one molecule. Copyright © 2018 Elsevier Ltd. All rights reserved.
Mechanical cell competition kills cells via induction of lethal p53 levels
Wagstaff, Laura; Goschorska, Maja; Kozyrska, Kasia; Duclos, Guillaume; Kucinski, Iwo; Chessel, Anatole; Hampton-O'Neil, Lea; Bradshaw, Charles R.; Allen, George E.; Rawlins, Emma L.; Silberzan, Pascal; Carazo Salas, Rafael E.; Piddini, Eugenia
2016-01-01
Cell competition is a quality control mechanism that eliminates unfit cells. How cells compete is poorly understood, but it is generally accepted that molecular exchange between cells signals elimination of unfit cells. Here we report an orthogonal mechanism of cell competition, whereby cells compete through mechanical insults. We show that MDCK cells silenced for the polarity gene scribble (scribKD) are hypersensitive to compaction, that interaction with wild-type cells causes their compaction and that crowding is sufficient for scribKD cell elimination. Importantly, we show that elevation of the tumour suppressor p53 is necessary and sufficient for crowding hypersensitivity. Compaction, via activation of Rho-associated kinase (ROCK) and the stress kinase p38, leads to further p53 elevation, causing cell death. Thus, in addition to molecules, cells use mechanical means to compete. Given the involvement of p53, compaction hypersensitivity may be widespread among damaged cells and offers an additional route to eliminate unfit cells. PMID:27109213
Combined radiation and p53 gene therapy of malignant glioma cells.
Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A
1999-01-01
More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We
Wang, Shaomeng; Sun, Wei; Zhao, Yujun; ...
2014-08-21
Blocking the MDM2-p53 protein-protein interaction has long been considered to offer a broad cancer therapeutic strategy, despite the potential risks of selecting tumors harboring p53 mutations that escape MDM2 control. In this study, we report a novel small molecule inhibitor of the MDM2-p53 interaction, SAR405838 (MI-77301) that has been advanced into Phase I clinical trials. SAR405838 binds to MDM2 with K i = 0.88 nM and has high specificity over other proteins. A co-crystal structure of the SAR405838:MDM2 complex shows that in addition to mimicking three key p53 amino acid residues, the inhibitor captures additional interactions not observed in themore » p53-MDM2 complex and induces refolding of the short, unstructured MDM2 N-terminal region to achieve its high affinity. SAR405838 effectively activates wild-type p53 in vitro and in xenograft tumor tissue of leukemia and solid tumors, leading to p53-dependent cell cycle arrest and/or apoptosis. At well-tolerated dose schedules, SAR405838 achieves either durable tumor regression or complete tumor growth inhibition in mouse xenograft models of SJSA-1 osteosarcoma, RS4;11 acute leukemia, LNCaP prostate cancer and HCT-116 colon cancer. Remarkably, a single oral dose of SAR405838 is sufficient to achieve complete tumor regression in the SJSA-1 model. Mechanistically, robust transcriptional up-regulation of PUMA induced by SAR405838 results in strong apoptosis in tumor tissue, leading to complete tumor regression. Lastly, our findings provide a preclinical basis upon which to evaluate SAR405838 as a therapeutic agent in patients whose tumors retain wild-type p53.« less
Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.
2015-03-01
Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acutemore » and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new
Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.
Rani, Reena; Li, Jie; Pang, Qishen
2008-12-01
Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.
Free Radicals Generated by Ionizing Radiation Signal Nuclear Translocation of p53
NASA Technical Reports Server (NTRS)
Martinez, J. D.; Pennington, M. E.; Craven, M. T.; Warters, R. L.
1997-01-01
The p53 tumor suppressor is a transcription factor that regulates several pathways, which function collectively to maintain the integrity of the genome. Nuclear localization is critical for wild-type function. However, the signals that regulate subcellular localization of p53 have not been identified. Here, we examine the effect of ionizing radiation on the subcellular localization of p53 in two cell lines in which p63 is normally sequestered in the cytoplasm and found that ionizing radiation caused a biphasic translocation response. p53 entered the nucleus 1-2 hours postirradiation (early response), subsequently emerged from the nucleus, and then again entered the nucleus 12-24 hours after the cells had been irradiated (delayed response). These changes in subcellular localization could be completely blocked by the free radical scavenger, WR1065. By comparison, two DNA-damaging agents that do not generate free radicals, mitomycin C and doxorubicin, caused translocation only after 12-24 h of exposure to the drugs, and this effect could not be inhibited by WR1065. Hence, although all three DNA-damaging agents induced relocalization of p53 to the nucleus, only the translocation caused by radiation was sensitive to free radical scavenging. We suggest that the free radicals generated by ionizing radiation can signal p53 translocation to the nucleus.
p53 sequence analysis predicts treatment response and outcome of patients with esophageal carcinoma.
Ribeiro, U; Finkelstein, S D; Safatle-Ribeiro, A V; Landreneau, R J; Clarke, M R; Bakker, A; Swalsky, P A; Gooding, W E; Posner, M C
1998-07-01
The ability to predict biologic behavior and treatment responsiveness would be a valuable asset in the multimodality approach to esophageal carcinoma. The authors examined whether alterations of the p53 gene correlate with clinicopathologic parameters, response to preoperative chemotherapy/radiotherapy, and outcome in patients with esophageal carcinoma. METHODS. Histopathologic/genetic analysis of p53 was performed on formalin fixed, paraffin embedded tissues. Tissue sections were stained immunohistochemically for p53 protein followed by topographic genotyping comprised of polymerase chain reaction amplification and direct sequencing of p53 exons 5-8. All patients received induction chemotherapy (5-fluorouracil, cisplatin, and alpha-interferon) and concurrent external beam radiotherapy (4500 centigrays) followed by resection. p53 analysis performed on 42 tumors from patients with potentially resectable esophageal carcinoma revealed 25 of the 42 tumors (59.5%) to be p53 immunopositive; however, only 17 of the 42 tumors (40.5%) were proven to contain p53 point mutational damage in exons 8 (n=5), 5 (n=5), 7 (n=4), and 6 (n=3). Eight cases were weakly immunopositive and had no genotype mutation suggesting hyperexpression of normal wild-type p53. Genotyping also identified two immunonegative cases with deletion-type mutations (exons 5 and 6). Tissue samples collected before and after chemotherapy/radiotherapy exhibited fidelity in p53 mutational genotype in all cases. The presence of a p53 point mutation positively correlated with pTNM stage (P=0.003) and residual disease in the resected specimen (P=0.01). Moreover, survival of patients with p53 mutations was significantly lower than that of patients without mutations (overall survival of 21.6 months vs. 40 months; P=0.0038; and disease free survival of 14.1 months vs. 38 months; P=0.0004). Histopathologic/genetic analysis is a better determinant of p53 mutational damage than immunohistochemistry alone and can be used
Mathew, R; Arora, S; Mathur, M; Chattopadhyay, T K; Ralhan, R
2001-10-01
Microsatellite instability (MSI) as a determinant of propensity to esophageal squamous cell carcinoma (ESCC) at seven microsatellite markers at 2p (2p15-16), 3p (3p13, 3p14.1-3, 3p25, and 3p26) and 16q (16q12.1-3) was investigated to analyze their putative role as indicators of predisposition to esophageal malignancies. Seven microsatellite loci were amplified by polymerase chain reaction, from surgically resected tumor tissues from 30 ESCC patients from Indian population, to assess the loss of heterozygosity (LOH) and replication error repeats (RER) and to correlate these alterations with aberrations in major cell cycle regulatory proteins and histopathological parameters. LOH and RER analyses at these loci demonstrated moderate microsatellite alterations, suggesting the involvement of MSI in esophageal tumorigenesis in a subset of the Indian population. MSI, defined as RER in at least two or more of the loci studied, was observed in ten of 30 (33%) patients. Twenty-two of 30 patients (73%) showed LOH at one or more loci, while 17 of the 30 patients (60%) showed RER in at least one of the loci studied. RER-positive patients showed a trend towards better prognosis when compared to RER-negative patients. MSI demonstrated a significant association with concomitant loss of p16 and pRb (p16-/pRb- phenotype) (P=0.046). Interestingly, we observed an inverse correlation between MSI and p53 mutations (P=0.03) suggesting that MSI may provide a p53-independent pathway for esophageal tumorigenesis in RER+ patients. MSI showed a trend towards longer survival and absence of distant organ metastasis (P=0.06). The present study demonstrates the probable role of MSI in esophageal squamous cell carcinoma in the Indian population. Instability associated with the repetitive sequences--the revealing marks of loss of DNA replication fidelity may serve as an indicator of predisposition to esophageal cancer.
Detection of genotoxic and non-genotoxic carcinogens in Xpc(-/-)p53(+/-) mice.
Melis, Joost P M; Speksnijder, Ewoud N; Kuiper, Raoul V; Salvatori, Daniela C F; Schaap, Mirjam M; Maas, Saskia; Robinson, Joke; Verhoef, Aart; van Benthem, Jan; Luijten, Mirjam; van Steeg, Harry
2013-01-15
An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed the Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Copyright © 2012 Elsevier Inc. All rights reserved.
Lack of correlation between p53 codon 72 polymorphism and anal cancer risk
Contu, Simone S; Agnes, Grasiela; Damin, Andrea P; Contu, Paulo C; Rosito, Mário A; Alexandre, Claudio O; Damin, Daniel C
2009-01-01
AIM: To investigate the potential role of p53 codon 72 polymorphism as a risk factor for development of anal cancer. METHODS: Thirty-two patients with invasive anal carcinoma and 103 healthy blood donors were included in the study. p53 codon 72 polymorphism was analyzed in blood samples through polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing. RESULTS: The relative frequency of each allele was 0.60 for Arg and 0.40 for Pro in patients with anal cancer, and 0.61 for Arg and 0.39 for Pro in normal controls. No significant differences in distribution of the codon 72 genotypes between patients and controls were found. CONCLUSION: These results do not support a role for the p53 codon 72 polymorphism in anal carcinogenesis. PMID:19777616
Insight into a novel p53 single point mutation (G389E) by Molecular Dynamics Simulations.
Pirolli, Davide; Carelli Alinovi, Cristiana; Capoluongo, Ettore; Satta, Maria Antonia; Concolino, Paola; Giardina, Bruno; De Rosa, Maria Cristina
2010-12-30
The majority of inactivating mutations of p53 reside in the central core DNA binding domain of the protein. In this computational study, we investigated the structural effects of a novel p53 mutation (G389E), identified in a patient with congenital adrenal hyperplasia, which is located within the extreme C-terminal domain (CTD) of p53, an unstructured, flexible region (residues 367-393) of major importance for the regulation of the protein. Based on the three-dimensional structure of a carboxyl-terminal peptide of p53 in complex with the S100B protein, which is involved in regulation of the tumor suppressor activity, a model of wild type (WT) and mutant extreme CTD was developed by molecular modeling and molecular dynamics simulation. It was found that the G389E amino acid replacement has negligible effects on free p53 in solution whereas it significantly affects the interactions of p53 with the S100B protein. The results suggest that the observed mutation may interfere with p53 transcription activation and provide useful information for site-directed mutagenesis experiments.
Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils
Stegh, Alexander H.
2012-01-01
Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435
p53 Mutation suppresses adult neurogenesis in medaka fish (Oryzias latipes)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Isoe, Yasuko; Okuyama, Teruhiro; Taniguchi, Yoshihito
2012-07-13
Highlights: Black-Right-Pointing-Pointer Progenitor migration is accompanied by an increase in their numbers in the adult brain. Black-Right-Pointing-Pointer p53 Mutation suppressed an increase in the number of the migrated progenitors. Black-Right-Pointing-Pointer The decreased progenitor number is not due to enhanced cell death. Black-Right-Pointing-Pointer p53 Mutation did not affect proliferation of stem cells. -- Abstract: Tumor suppressor p53 negatively regulates self-renewal of neural stem cells in the adult murine brain. Here, we report that the p53 null mutation in medaka fish (Oryzias latipes) suppressed neurogenesis in the telencephalon, independent of cell death. By using 5-bromo-29-deoxyuridine (BrdU) immunohistochemistry, we identified 18 proliferation zonesmore » in the brains of young medaka fish; in situ hybridization showed that p53 was expressed selectively in at least 12 proliferation zones. We also compared the number of BrdU-positive cells present in the whole telencephalon of wild-type (WT) and p53 mutant fish. Immediately after BrdU exposure, the number of BrdU-positive cells did not differ significantly between them. One week after BrdU-exposure, the BrdU-positive cells migrated from the proliferation zone, which was accompanied by an increased number in the WT brain. In contrast, no significant increase was observed in the p53 mutant brain. Terminal deoxynucleotidyl transferase (dUTP) nick end-labeling revealed that there was no significant difference in the number of apoptotic cells in the telencephalon of p53 mutant and WT medaka, suggesting that the decreased number of BrdU-positive cells in the mutant may be due to the suppression of proliferation rather than the enhancement of neural cell death. These results suggest that p53 positively regulates neurogenesis via cell proliferation.« less
Prospective virtual screening for novel p53-MDM2 inhibitors using ultrafast shape recognition
NASA Astrophysics Data System (ADS)
Patil, Sachin P.; Ballester, Pedro J.; Kerezsi, Cassidy R.
2014-02-01
The p53 protein, known as the guardian of genome, is mutated or deleted in approximately 50 % of human tumors. In the rest of the cancers, p53 is expressed in its wild-type form, but its function is inhibited by direct binding with the murine double minute 2 (MDM2) protein. Therefore, inhibition of the p53-MDM2 interaction, leading to the activation of tumor suppressor p53 protein presents a fundamentally novel therapeutic strategy against several types of cancers. The present study utilized ultrafast shape recognition (USR), a virtual screening technique based on ligand-receptor 3D shape complementarity, to screen DrugBank database for novel p53-MDM2 inhibitors. Specifically, using 3D shape of one of the most potent crystal ligands of MDM2, MI-63, as the query molecule, six compounds were identified as potential p53-MDM2 inhibitors. These six USR hits were then subjected to molecular modeling investigations through flexible receptor docking followed by comparative binding energy analysis. These studies suggested a potential role of the USR-selected molecules as p53-MDM2 inhibitors. This was further supported by experimental tests showing that the treatment of human colon tumor cells with the top USR hit, telmisartan, led to a dose-dependent cell growth inhibition in a p53-dependent manner. It is noteworthy that telmisartan has a long history of safe human use as an approved anti-hypertension drug and thus may present an immediate clinical potential as a cancer therapeutic. Furthermore, it could also serve as a structurally-novel lead molecule for the development of more potent, small-molecule p53-MDM2 inhibitors against variety of cancers. Importantly, the present study demonstrates that the adopted USR-based virtual screening protocol is a useful tool for hit identification in the domain of small molecule p53-MDM2 inhibitors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mulder, Jeanne E.; Bondy, Genevieve S.; Mehta, Rekha
Aflatoxin B{sub 1} (AFB{sub 1}) is biotransformed in vivo into an epoxide metabolite that forms DNA adducts that may induce cancer if not repaired. p53 is a tumor suppressor gene implicated in the regulation of global nucleotide excision repair (NER). Male heterozygous p53 knockout (B6.129-Trp53{sup tm1Brd}N5, Taconic) and wild-type mice were exposed to 0, 0.2 or 1.0 ppm AFB{sub 1} for 26 weeks. NER activity was assessed with an in vitro assay, using AFB{sub 1}-epoxide adducted plasmid DNA as a substrate. For wild-type mice, repair of AFB{sub 1}–N7-Gua adducts was 124% and 96% greater in lung extracts from mice exposedmore » to 0.2 ppm and 1.0 ppm AFB{sub 1} respectively, and 224% greater in liver extracts from mice exposed to 0.2 ppm AFB{sub 1} (p < 0.05). In heterozygous p53 knockout mice, repair of AFB{sub 1}–N7-Gua was only 45% greater in lung extracts from mice exposed to 0.2 ppm AFB{sub 1} (p < 0.05), and no effect was observed in lung extracts from mice treated with 1.0 ppm AFB{sub 1} or in liver extracts from mice treated with either AFB{sub 1} concentration. p53 genotype did not affect basal levels of repair. AFB{sub 1} exposure did not alter repair of AFB{sub 1}-derived formamidopyrimidine adducts in lung or liver extracts of either mouse genotype nor did it affect XPA or XPB protein levels. In summary, chronic exposure to AFB{sub 1} increased NER activity in wild-type mice, and this response was diminished in heterozygous p53 knockout mice, indicating that loss of one allele of p53 limits the ability of NER to be up-regulated in response to DNA damage. - Highlights: • Mice are chronically exposed to low doses of the mycotoxin aflatoxin B{sub 1} (AFB{sub 1}). • The effects of AFB{sub 1} and p53 status on nucleotide excision repair are investigated. • AFB{sub 1} increases nucleotide excision repair in wild type mouse lung and liver. • This increase is attenuated in p53 heterozygous mouse lung and liver. • Results portray the role of p53 in
Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction.
Pettersson, Mariell; Quant, Maria; Min, Jaeki; Iconaru, Luigi; Kriwacki, Richard W; Waddell, M Brett; Guy, R Kiplin; Luthman, Kristina; Grøtli, Morten
2015-01-01
The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2) via a direct protein-protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay.
Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction
Pettersson, Mariell; Quant, Maria; Min, Jaeki; Iconaru, Luigi; Kriwacki, Richard W.; Waddell, M. Brett; Guy, R. Kiplin; Luthman, Kristina; Grøtli, Morten
2015-01-01
The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2) via a direct protein—protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay. PMID:26427060
DOE Office of Scientific and Technical Information (OSTI.GOV)
Armesilla-Diaz, Alejandro, E-mail: aarmesilla@cib.csic.es; Elvira, Gema; Silva, Augusto
2009-12-10
Mesenchymal stem cells (MSC) have been extensively studied and gained wide popularity due to their therapeutic potential. Spontaneous transformation of MSC, from both human and murine origin, has been reported in many studies. MSC transformation depends on the culture conditions, the origin of the cells and the time on culture; however, the precise biological characteristics involved in this process have not been fully defined yet. In this study, we investigated the role of p53 in the biology and transformation of murine bone marrow (BM)-derived MSC. We demonstrate that the MSC derived from p53KO mice showed an augmented proliferation rate, amore » shorter doubling time and also morphologic and phenotypic changes, as compared to MSC derived from wild-type animals. Furthermore, the MSC devoid of p53 had an increased number of cells able to generate colonies. In addition, not only proliferation but also MSC differentiation is controlled by p53 since its absence modifies the speed of the process. Moreover, genomic instability, changes in the expression of c-myc and anchorage independent growth were also observed in p53KO MSC. In addition, the absence of p53 implicates the spontaneous transformation of MSC in long-term cultures. Our results reveal that p53 plays a central role in the biology of MSC.« less
p53 and its mutants on the slippery road from stemness to carcinogenesis.
Molchadsky, Alina; Rotter, Varda
2017-04-01
Normal development, tissue homeostasis and regeneration following injury rely on the proper functions of wide repertoire of stem cells (SCs) persisting during embryonic period and throughout the adult life. Therefore, SCs employ robust mechanisms to preserve their genomic integrity and avoid heritage of mutations to their daughter cells. Importantly, propagation of SCs with faulty DNA as well as dedifferentiation of genomically altered somatic cells may result in derivation of cancer SCs, which are considered to be the driving force of the tumorigenic process. Multiple experimental evidence suggest that p53, the central tumor suppressor gene, plays a critical regulatory role in determination of SCs destiny, thereby eliminating damaged SCs from the general SC population. Notably, mutant p53 proteins do not only lose the tumor suppressive function, but rather gain new oncogenic function that markedly promotes various aspects of carcinogenesis. In this review, we elaborate on the role of wild type and mutant p53 proteins in the various SCs types that appear under homeostatic conditions as well as in cancer. It is plausible that the growing understanding of the mechanisms underlying cancer SC phenotype and p53 malfunction will allow future optimization of cancer therapeutics in the context of precision medicine. © Crown copyright 2017.
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
p53-dependent cell death/apoptosis is required for a productive adenovirus infection.
Hall, A R; Dix, B R; O'Carroll, S J; Braithwaite, A W
1998-09-01
The p53 tumor suppressor protein binds to both cellular and viral proteins, which influence its biological activity. One such protein is the large E1b tumor antigen (E1b58kDa) from adenoviruses (Ads), which abrogates the ability of p53 to transactivate various promoters. This inactivation of p53 function is believed to be the mechanism by which E1b58kDa contributes to the cell transformation process. Although the p53-E1b58kDa complex occurs during infection and is conserved among different serotypes, there are limited data demonstrating that it has a role in virus replication. However, loss of p53 expression occurs after adenovirus infection of human cells and an E1b58kDa deletion mutant (Onyx-015, also called dl 1520) selectively replicates in p53-defective cells. These (and other) data indicate a plausible hypothesis is that loss of p53 function may be conducive to efficient adenovirus replication. However, wild-type (wt) Ad5 grows more efficiently in cells expressing a wt p53 protein. These studies indicate that the hypothesis may be an oversimplification. Here, we show that cells expressing wt p53, as well as p53-defective cells, allow adenovirus replication, but only cells expressing wt p53 show evidence of virus-induced cytopathic effect. This correlates with the ability of adenovirus to induce cell death. Our data indicate that p53 plays a necessary part in mediating cellular destruction to allow a productive adenovirus infection. In contrast, p53-deficient cells are less sensitive to the cytolytic effects of adenovirus and as such raise questions about the use of E1b58kDa-deficient adenoviruses in tumor therapy.
Gadhikar, Mayur A.; Sciuto, Maria Rita; Alves, Marcus Vinicius Ortega; Pickering, Curtis R.; Osman, Abdullah A.; Neskey, David M.; Zhao, Mei; Fitzgerald, Alison L.; Myers, Jeffrey N.; Frederick, Mitchell J
2014-01-01
Despite the use of multimodality therapy employing cisplatin to treat patients with advanced stage head and neck squamous cell carcinoma (HNSCC), there is an unacceptably high rate of treatment failure. TP53 is the most commonly mutated gene in HNSCC, and the impact of p53 mutation on response to cisplatin treatment is poorly understood. Here we show unambiguously that wild type TP53 (wtp53) is associated with sensitivity of HNSCC cells to cisplatin treatment while mutation or loss of TP53 is associated with cisplatin resistance. We also demonstrate that senescence is the major cellular response to cisplatin in wtp53 HNSCC cells and that cisplatin resistance in p53 null or mutant TP53 cells is due to their lack of senescence. Given the dependence on Chk1/2 kinases to mediate the DNA damage response in p53 deficient cells, there is potential to exploit this to therapeutic advantage through targeted inhibition of the Chk1/2 kinases. Treatment of p53 deficient HNSCC cells with the Chk inhibitor AZD7762 sensitizes them to cisplatin through induction of mitotic cell death. This is the first report demonstrating the ability of a Chk kinase inhibitor to sensitize TP53-deficient HNSCC to cisplatin in a synthetic lethal manner, which has significance given the frequency of TP53 mutations in this disease and because cisplatin has become part of standard therapy for aggressive HNSCC tumors. These pre-clinical data provide evidence that a personalized approach to the treatment of HNSCC based on Chk inhibition in p53 mutant tumors may be feasible. PMID:23839309
R248Q mutation--Beyond p53-DNA binding.
Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L
2015-12-01
R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.
Heublein, Sabine; Page, Sabina K; Mayr, Doris; Ditsch, Nina; Jeschke, Udo
2016-06-01
The oncofoetal Thomsen-Friedenreich (TF1, CD176) epitope is a carbohydrate cancer stem cell (CSC) antigen, and TF1-mediated cancer progression can be widely reversed by anti-TF1 antibodies. Particularly, CSC-like cells are regarded to be tumorigenic and chemoresistant. Aberrant p53 is probably the factor most closely associated with chemoresistance and tumour aggressiveness in ovarian tumours. We thus questioned whether TF1 in combination with p53 or as a single marker may be related to clinico-pathological features and survival of ovarian cancer patients. Both markers were quantified in ovarian cancer tissue (n = 151) by immunohistochemistry. p53 staining was subdivided into three subgroups [n (completely negative) = 57, n (moderately stained) = 28, n (overexpressing) = 66]. TF1 was scored as positive (n = 30) versus negative (n = 121). Only in those cancers classified with moderate p53 staining-and thus most likely displaying with wild-type TP53-TF1 positivity turned out to be a predictor for shortened overall survival (univariate: p < 0.001, multivariate: p = 0.001). By screening 17 different protein markers for correlation with TF1, only mucin-1 emerged as a potential TF1 carrier protein. It is hypothesized that TF1 may confer tumour-promoting features, especially in a TP53 wild-type genetic background. In addition, TF1 is an attractive immunotherapeutic target. Whether those cases classified as TF1 positive and at the same time as moderately stained for p53 might particularly benefit from a future anti-TF1 antibody treatment or from TF1 vaccination therapy remains to be determined.
Han, Jia; Li, Jie; Tang, Kaijie; Zhang, Huahua; Guo, Bo; Hou, Ni; Huang, Chen
2017-11-15
Evidence demonstrate that p53 mutations and microRNAs (miRs) are important components of 5-FU resistance in colorectal cancer (CRC). miR-338-3p has been reported associated with cancer prognosis. However whether or not it influences chemotherapy sensitivity and the underlying mechanisms have not been elucidated. Here, three types of human colon cancer cell lines, HT29 (mutant p53), HCT116 (wild-type p53), and HCT116 p53 -/- (deficient p53), were treated with 5-FU. We showed that expression of miR-338-3p was correlated with apoptosis and 5-FU resistance in colon cancer cells. Ectopic expression of miR-338-3p conferred resistance to 5-FU in HCT116 cells. Further experiments indicated that miR-338-3p mediated 5-FU resistance through down-regulation of mTOR expression. Moreover, inhibition of miR-338-3p in HT29 and HCT116 p53 -/- cells increased their sensitivity to 5-FU treatment. Furthermore, we detected autophagy changes in our experiment because mTOR was known prominently regulating autophagy and the competition between autophagy and apoptosis in response to 5-FU was a mechanism influencing 5-FU sensitivity. Our results reveal a critical and novel role of miR-338-3p in the correlation of 5-FU resistance with p53 status. Moreover, the miR-338-3p inhibitor has the potential to overcome 5-FU resistance in p53 mutant colon cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Synthesis and evaluation of modified chalcone based p53 stabilizing agents.
Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdel-Hamid; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib
2017-09-01
Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (CAL-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI 50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI 50 of 0.473±0.043µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-h post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities. Copyright © 2017 Elsevier Ltd. All rights reserved.
Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen
2018-06-01
The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.
Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status
Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L
2000-01-01
p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365
Phase I dendritic cell p53 peptide vaccine for head and neck cancer.
Schuler, Patrick J; Harasymczuk, Malgorzata; Visus, Carmen; Deleo, Albert; Trivedi, Sumita; Lei, Yu; Argiris, Athanassios; Gooding, William; Butterfield, Lisa H; Whiteside, Theresa L; Ferris, Robert L
2014-05-01
p53 accumulation in head and neck squamous cell carcinoma (HNSCC) cells creates a targetable tumor antigen. Adjuvant dendritic cell (DC)-based vaccination against p53 was tested in a phase I clinical trial. Monocyte-derived DC from 16 patients were loaded with two modified HLA-class I p53 peptides (Arm 1), additional Th tetanus toxoid peptide (Arm 2), or additional Th wild-type (wt) p53-specific peptide (Arm 3). Vaccine DCs (vDC) were delivered to inguinal lymph nodes at three time points. vDC phenotype, circulating p53-specific T cells, and regulatory T cells (Treg) were serially monitored by flow cytometry and cytokine production by Luminex. vDC properties were compared with those of DC1 generated with an alternative maturation regimen. No grade II-IV adverse events were observed. Two-year disease-free survival of 88% was favorable. p53-specific T-cell frequencies were increased postvaccination in 11 of 16 patients (69%), with IFN-γ secretion detected in four of 16 patients. Treg frequencies were consistently decreased (P = 0.006) relative to prevaccination values. The phenotype and function of DC1 were improved relative to vDC. Adjuvant p53-specific vaccination of patients with HNSCC was safe and associated with promising clinical outcome, decreased Treg levels, and modest vaccine-specific immunity. HNSCC patients' DC required stronger maturation stimuli to reverse immune suppression and improve vaccine efficacy. ©2014 AACR.
Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M
2012-12-01
We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
p53 as the focus of gene therapy: past, present and future.
Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani
2018-01-15
Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph
2017-04-01
Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 <3.0 μmol/l) were identified within established (4/9) and primary patient-derived (2/5) CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC
Pradhan, Shrikant; Mahajan, Divyank; Kaur, Prabhjot; Pandey, Namita; Sharma, Chandresh; Srivastava, Tapasya
2016-01-01
Non-small cell lung cancer (NSCLC), comprising 85% of lung cancer cases, has been associated with resistance to chemo/radiotherapy. The hypoxic tumor micro-environment, where insufficient vasculature results in poor drug penetrance and sub-optimal chemotherapy in the tumor interiors contributes heavily to this resistance. Additionally, epigenetic changes in tumorigenic cells also change their response to different forms of therapy. In our study, we have investigated the effectiveness of a combination of cisplatin with scriptaid [a pan-Histone Deacetylase inhibitor (HDACi)] in a model that mimics the tumor microenvironment of hypoxia and sub-lethal chemotherapy. Scriptaid synergistically increases the efficacy of cisplatin in normoxia as well as hypoxia, accompanied with reduced metastasis and enhanced DNA damage. Addition of scriptaid also overcomes the cisplatin resistance exhibited in lung cancer cells with stabilized hypoxia inducible factor 1 (HIF1)-α (mutant) and mutant p53. Molecular studies showed that the combination treatment increased apoptotic cell death in both normoxia and hypoxia with a dual role of p38MAPK. Together, our results suggest that the combination of low dose cisplatin and scriptaid is cytotoxic to NSCLC lines, can overcome hypoxia induced resistance and mutant p53- induced instability often associated with this cancer, and has the potential to be an effective therapeutic modality. PMID:27708247
Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage
Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.
2018-01-01
Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532
Wang, Lin; Yu, Peiwu
2016-12-01
p53 mutations in tumors can induce the loss of wild-type tumor-suppressing p53 function, which results in the increase in proliferation, migration and invasion ability in cancer cells. Studies have shown that the expression of p53 is regulated by several microRNAs (miRNAs). In the present study, we found that miR-300 and p53 were significantly increased in colorectal cancer (CRC) tissues when compared with levels noted in adjacent colorectal tissues. Both miR-300 and p53 were significantly correlated with lymphatic metastasis and TNM stage. Both miR-300 and p53 promoted CRC cell (SW480 and HT29) proliferation, migration, and invasion, respectively, in vitro. In addition, we found that miR-300 is a direct positive regulator of p53 through binding to the binding site in the 3'UTR of the p53 gene in human CRC cells. Moreover, both miR-300 and p53 induced CRC cell epithelial‑mesenchymal transition (EMT) respectively. Taken together, we demonstrated that miR-300 promoted proliferation and EMT-mediated CRC migration and invasion by targeting p53. These findings provide a new theoretical basis and potential therapeutic targets, and thus lays the foundation for exploring the pathogenesis of CRC.
Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong
2015-08-18
p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected
Kuball, Jürgen; Wen, Shu Fen; Leissner, Joachim; Atkins, Derek; Meinhardt, Patricia; Quijano, Erlinda; Engler, Heidrun; Hutchins, Beth; Maneval, Daniel C; Grace, Michael J; Fritz, Mary Ann; Störkel, Stefan; Thüroff, Joachim W; Huber, Christoph; Schuler, Martin
2002-02-15
To study safety, feasibility, and biologic activity of adenovirus-mediated p53 gene transfer in patients with bladder cancer. Twelve patients with histologically confirmed bladder cancer scheduled for cystectomy were treated on day 1 with a single intratumoral injection of SCH 58500 (rAd/p53) at cystoscopy at one dose level (7.5 x 10(11) particles) or a single intravesical instillation of SCH 58500 with a transduction-enhancing agent (Big CHAP) at three dose levels (7.5 x 10(11) to 7.5 x 10(13) particles). Cystectomies were performed in 11 patients on day 3, and transgene expression, vector distribution, and biologic markers of transgene activity were assessed by molecular and immunohistochemical methods in tumors and normal bladder samples. Specific transgene expression was detected in tissues from seven of eight assessable patients treated with intravesical instillation of SCH 58500 but in none of three assessable patients treated with intratumoral injection of SCH 58500. Induction of RNA and protein expression of the p53 target gene p21/WAF1 was demonstrated in samples from patients treated with SCH 58500 instillation at higher dose levels. Distribution studies after intravesical instillation of SCH 58500 revealed both high transduction efficacy and vector penetration throughout the whole urothelium and into submucosal tumor cells. No dose-limiting toxicity was observed, and side effects were local and of transient nature. Intravesical instillation of SCH 58500 combined with a transduction-enhancing agent is safe, feasible, and biologically active in patients with bladder cancer. Studies to evaluate the clinical efficacy of this treatment in patients with localized high-risk bladder cancer are warranted.
Loss of p53-inducible long non-coding RNA LINC01021 increases chemosensitivity
Kaller, Markus; Götz, Ursula; Hermeking, Heiko
2017-01-01
We have previously identified the long non-coding RNA LINC01021 as a direct p53 target (Hünten et al. Mol Cell Proteomics. 2015; 14:2609-2629). Here, we show that LINC01021 is up-regulated in colorectal cancer (CRC) cell lines upon various p53-activating treatments. The LINC01021 promoter and the p53 binding site lie within a MER61C LTR, which originated from insertion of endogenous retrovirus 1 (ERV1) sequences. Deletion of this MER61C element by a CRISPR/Cas9 approach, as well as siRNA-mediated knockdown of LINC01021 RNA significantly enhanced the sensitivity of the CRC cell line HCT116 towards the chemotherapeutic drugs doxorubicin and 5-FU, suggesting that LINC01021 is an integral part of the p53-mediated response to DNA damage. Inactivation of LINC01021 and also its ectopic expression did not affect p53 protein expression and transcriptional activity, implying that LINC01021 does not feedback to p53. Furthermore, in CRC patient samples LINC01021 expression positively correlated with a wild-type p53-associated gene expression signature. LINC01021 expression was increased in primary colorectal tumors and displayed a bimodal distribution that was particularly pronounced in the mesenchymal CMS4 consensus molecular subtype of CRCs. CMS4 tumors with low LINC01021 expression were associated with poor patient survival. Our results suggest that the genomic redistribution of ERV1-derived p53 response elements and generation of novel p53-inducible lncRNA-encoding genes was selected for during primate evolution as integral part of the cellular response to various forms of genotoxic stress. PMID:29262524
RAG-induced DNA lesions activate proapoptotic BIM to suppress lymphomagenesis in p53-deficient mice
Herold, Marco J.
2016-01-01
Neoplastic transformation is driven by oncogenic lesions that facilitate unrestrained cell expansion and resistance to antiproliferative signals. These oncogenic DNA lesions, acquired through errors in DNA replication, gene recombination, or extrinsically imposed damage, are thought to activate multiple tumor suppressive pathways, particularly apoptotic cell death. DNA damage induces apoptosis through well-described p53-mediated induction of PUMA and NOXA. However, loss of both these mediators (even together with defects in p53-mediated induction of cell cycle arrest and cell senescence) does not recapitulate the tumor susceptibility observed in p53−/− mice. Thus, potentially oncogenic DNA lesions are likely to also trigger apoptosis through additional, p53-independent processes. We found that loss of the BH3-only protein BIM accelerated lymphoma development in p53-deficient mice. This process was negated by concomitant loss of RAG1/2-mediated antigen receptor gene rearrangement. This demonstrates that BIM is critical for the induction of apoptosis caused by potentially oncogenic DNA lesions elicited by RAG1/2-induced gene rearrangement. Furthermore, this highlights the role of a BIM-mediated tumor suppressor pathway that acts in parallel to the p53 pathway and remains active even in the absence of wild-type p53 function, suggesting this may be exploited in the treatment of p53-deficient cancers. PMID:27621418
p53 Enables metabolic fitness and self-renewal of nephron progenitor cells.
Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida
2015-04-01
Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre(+);p53(fl/fl)) induces progressive depletion of Cited1(+)/Six2(+) self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre(+);p53(fl/fl) cap has 30% fewer Six2(GFP(+)) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre(+);p53(fl/fl) cells in the S and G2/M phases compared with Six2Cre(+);p53(+/+) cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP(+)) CM cells revealed that the top downregulated genes in Six2Cre(+);p53(fl/fl) CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼ 50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. © 2015. Published by The Company of Biologists Ltd.
p53 downregulates the Fanconi anaemia DNA repair pathway.
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-04-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santhanam, U.; Ray, A.; Sehgal, P.B.
1991-09-01
The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less
Mooney, Sandra M.; Middleton, Frank A.
2017-01-01
Prenatal ethanol exposure can produce structural and functional deficits in the brain and result in Fetal Alcohol Spectrum Disorder (FASD). In rodent models acute exposure to a high concentration of alcohol causes increased apoptosis in the developing brain. A single causal molecular switch that signals for this increase in apoptosis has yet to be identified. The protein p53 has been suggested to play a pivotal role in enabling cells to engage in pro-apoptotic processes, and thus figures prominently as a hub molecule in the intracellular cascade of responses elicited by alcohol exposure. In the present study we examined the effect of ethanol-induced cellular and molecular responses in primary somatosensory cortex (SI) and hippocampus of 7-day-old wild-type (WT) and p53-knockout (KO) mice. We quantified apoptosis by active caspase-3 immunohistochemistry and ApopTag™ labeling, then determined total RNA expression levels in laminae of SI and hippocampal subregions. Immunohistochemical results confirmed increased incidence of apoptotic cells in both regions in WT and KO mice following ethanol exposure. The lack of p53 was not protective in these brain regions. Molecular analyses revealed a heterogeneous response to ethanol exposure that varied depending on the subregion, and which may go undetected using a global approach. Gene network analyses suggest that the presence or absence of p53 alters neuronal function and synaptic modifications following ethanol exposure, in addition to playing a classic role in cell cycle signaling. Thus, p53 may function in a way that underlies the intellectual and behavioral deficits observed in FASD. PMID:28723918
Camargo Moreno, Maria; Mooney, Sandra M; Middleton, Frank A
2017-01-01
Prenatal ethanol exposure can produce structural and functional deficits in the brain and result in Fetal Alcohol Spectrum Disorder (FASD). In rodent models acute exposure to a high concentration of alcohol causes increased apoptosis in the developing brain. A single causal molecular switch that signals for this increase in apoptosis has yet to be identified. The protein p53 has been suggested to play a pivotal role in enabling cells to engage in pro-apoptotic processes, and thus figures prominently as a hub molecule in the intracellular cascade of responses elicited by alcohol exposure. In the present study we examined the effect of ethanol-induced cellular and molecular responses in primary somatosensory cortex (SI) and hippocampus of 7-day-old wild-type (WT) and p53-knockout (KO) mice. We quantified apoptosis by active caspase-3 immunohistochemistry and ApopTag™ labeling, then determined total RNA expression levels in laminae of SI and hippocampal subregions. Immunohistochemical results confirmed increased incidence of apoptotic cells in both regions in WT and KO mice following ethanol exposure. The lack of p53 was not protective in these brain regions. Molecular analyses revealed a heterogeneous response to ethanol exposure that varied depending on the subregion, and which may go undetected using a global approach. Gene network analyses suggest that the presence or absence of p53 alters neuronal function and synaptic modifications following ethanol exposure, in addition to playing a classic role in cell cycle signaling. Thus, p53 may function in a way that underlies the intellectual and behavioral deficits observed in FASD.
Loss of Atrx Sensitizes Cells to DNA Damaging Agents through p53-Mediated Death Pathways
Conte, Damiano; Huh, Michael; Goodall, Emma; Delorme, Marilyne; Parks, Robin J.; Picketts, David J.
2012-01-01
Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx f/f mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS) activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU). Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres) were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors. PMID:23284920
Loss of Atrx sensitizes cells to DNA damaging agents through p53-mediated death pathways.
Conte, Damiano; Huh, Michael; Goodall, Emma; Delorme, Marilyne; Parks, Robin J; Picketts, David J
2012-01-01
Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx(f/f) mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS) activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU). Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres) were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors.
Yi, Hanjie; Yan, Xianglei; Luo, Qiuyun; Yuan, Luping; Li, Baoxia; Pan, Wentao; Zhang, Lin; Chen, Haibo; Wang, Jing; Zhang, Yubin; Zhai, Yifan; Qiu, Miao-Zhen; Yang, Da-Jun
2018-05-02
Gastric cancer is the leading cause of cancer related death worldwide. Radiation alone or combined with chemotherapy plays important role in locally advanced and metastatic gastric adenocarcinoma. MDM2-p53 interaction and downstream signaling affect cellular response to DNA damage which leads to cell cycle arrest and apoptosis. Therefore, restoring p53 function by inhibiting its interaction with MDM2 is a promising therapeutic strategy for cancer. APG-115 is a novel small molecule inhibitor which blocks the interaction of MDM2 and p53. In this study, we investigated that the radiosensitivity of APG-115 in gastric adenocarcinoma in vitro and in vivo. The role of APG-115 in six gastric cancer cells viability in vitro was determined by CCK-8 assay. The expression level of MDM2, p21, PUMA and BAX in AGS and MKN45 cell lines was measured via real-time PCR (RT-PCR). The function of treatment groups on cell cycle and cell apoptosis were detected through Flow Cytometry assay. Clonogenic assays were used to measure the radiosensitivity of APG-115 in p53 wild type gastric cancer cell lines. Western blot was conducted to detect the protein expressions of mdm2-p53 signal pathway. Xenograft models in nude mice were established to explore the radiosensitivity role of APG-115 in gastric cancer cells in vivo. We found that radiosensitization by APG-115 occurred in p53 wild-type gastric cancer cells. Increasing apoptosis and cell cycle arrest was observed after administration of APG-115 and radiation. Radiosensitivity of APG-115 was mainly dependent on MDM2-p53 signal pathway. In vivo, APG-115 combined with radiation decreased xenograft tumor growth much more significantly than either single treatment. Moreover, the number of proliferating cells (Ki-67) significantly decreased in combination group compared with single treatment group. In summary, we found that combination of MDM2-p53 inhibitor (APG-115) and radiotherapy can enhance antitumor effect both in vitro and in vivo. This
2002-10-01
This document contains three papers focusing on the analysis of anti-p53 cellular immune responses of breast, head, neck, and oral cancer patients...variants were generated by amino acid exchanges at positions 6 (6T) and 7 (7W) of the peptide. The 7W variant peptide has potential for immunotherapy of nonresponsive oral cancer patients.
MicroRNA-145 is regulated by DNA methylation and p53 gene mutation in prostate cancer
Suh, Seong O.; Chen, Yi; Zaman, Mohd Saif; Hirata, Hiroshi; Yamamura, Soichiro; Shahryari, Varahram; Liu, Jan; Tabatabai, Z.Laura; Kakar, Sanjay; Deng, Guoren; Tanaka, Yuichiro; Dahiya, Rajvir
2011-01-01
MiR-145 is downregulated in various cancers including prostate cancer. However, the underlying mechanisms of miR-145 downregulation are not fully understood. Here, we reported that miR-145 was silenced through DNA hypermethylation and p53 mutation status in laser capture microdissected (LCM) prostate cancer and matched adjacent normal tissues. In 22 of 27 (81%) prostate tissues, miR-145 was significantly downregulated in the cancer compared with the normal tissues. Further studies on miR-145 downregulation mechanism showed that miR-145 is methylated at the promoter region in both prostate cancer tissues and 50 different types of cancer cell lines. In seven cancer cell lines with miR-145 hypermethylation, 5-aza-2′-deoxycytidine treatment dramatically induced miR-145 expression. Interestingly, we also found a significant correlation between miR-145 expression and the status of p53 gene in both LCM prostate tissues and 47 cancer cell lines. In 29 cell lines with mutant p53, miR-145 levels were downregulated in 28 lines (97%), whereas in 18 cell lines with wild-type p53 (WT p53), miR-145 levels were downregulated in only 6 lines (33%, P < 0.001). Electrophoretic mobility shift assay showed that p53 binds to the p53 response element upstream of miR-145, but the binding was inhibited by hypermethylation. To further confirm that p53 binding to miR-145 could regulate miR-145 expression, we transfected WT p53 and MUT p53 into PC-3 cells and found that miR-145 is upregulated by WT p53 but not with MUTp53. The apoptotic cells are increased after WT p53 transfection. In summary, this is the first report documenting that downregulation of miR-145 is through DNA methylation and p53 mutation pathways in prostate cancer. PMID:21349819
Koulgi, Shruti; Achalere, Archana; Sonavane, Uddhavesh; Joshi, Rajendra
2015-01-01
The tp53 gene is found to be mutated in 50% of all the cancers. The p53 protein, a product of tp53 gene, is a multi-domain protein. It consists of a core DNA binding domain (DBD) which is responsible for its binding and transcription of downstream target genes. The mutations in p53 protein are responsible for creating cancerous conditions and are found to be occurring at a high frequency in the DBD region of p53. Some of these mutations are also known to be temperature sensitive (ts) in nature. They are known to exhibit partial or strong binding with DNA in the temperature range (298–306 K). Whereas, at 310 K and above they show complete loss in binding. We have analyzed the changes in binding and conformational behavior at 300 K and 310 K for three of the ts-mutants viz., V143A, R249S and R175H. QM-MM simulations have been performed on the wild type and the above mentioned ts-mutants for 30 ns each. The optimal estimate of free energy of binding for a particular number of interface hydrogen bonds was calculated using the maximum likelihood method as described by Chodera et. al (2007). This parameter has been observed to be able to mimic the binding affinity of the p53 ts-mutants at 300 K and 310 K. Thus the correlation between MM-GBSA free energy of binding and hydrogen bonds formed by the interface residues between p53 and DNA has revealed the temperature dependent nature of these mutants. The role of main chain dihedrals was obtained by performing dihedral principal component analysis (PCA). This analysis, suggests that the conformational variations in the main chain dihedrals (ϕ and ψ) of the p53 ts-mutants may have caused reduction in the overall stability of the protein. The solvent exposure of the side chains of the interface residues were found to hamper the binding of the p53 to the DNA. Solvent Accessible Surface Area (SASA) also proved to be a crucial property in distinguishing the conformers obtained at 300 K and 310 K for the three ts-mutants from
Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.
Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A
1990-11-30
Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.
Tsuji, Takemasa; Matsuzaki, Junko; Ritter, Erika; Miliotto, Anthony; Ritter, Gerd; Odunsi, Kunle; Old, Lloyd J.; Gnjatic, Sacha
2011-01-01
Analyses of NY-ESO-1-specific spontaneous immune responses in cancer patients revealed that antibody and both CD4+ and CD8+ T cell responses were induced together in cancer patients. To explore whether such integrated immune responses are also spontaneously induced for other tumor antigens, we have evaluated antibody and T cell responses against self/tumor antigen p53 in ovarian cancer patients and healthy individuals. We found that 21% (64/298) of ovarian cancer patients but no healthy donors showed specific IgG responses against wild-type p53 protein. While none of 12 patients with high titer p53 antibody showed spontaneous p53-specific CD8+ T cell responses following a single in vitro sensitization, significant p53-specific IFN-γ producing CD4+ T cells were detected in 6 patients. Surprisingly, similar levels of p53-specific CD4+ T cells but not CD8+ T cells were also detected in 5/10 seronegative cancer patients and 9/12 healthy donors. Importantly, p53-specific CD4+ T cells in healthy donors originated from a CD45RA− antigen-experienced T cell population and recognized naturally processed wild-type p53 protein. These results raise the possibility that p53-specific CD4+ T cells reflect abnormalities in p53 occurring in normal individuals and that they may play a role in processes of immunosurveillance or immunoregulation of p53-related neoplastic events. PMID:21858191
Kim, Sang-Soo; Rait, Antonina; Kim, Eric; Pirollo, Kathleen F; Chang, Esther H
2015-02-01
Development of temozolomide (TMZ) resistance contributes to the poor prognosis for glioblastoma multiforme (GBM) patients. It was previously demonstrated that delivery of exogenous wild-type tumor suppressor gene p53 via a tumor-targeted nanocomplex (SGT-53) which crosses the blood-brain barrier could sensitize highly TMZ-resistant GBM tumors to TMZ. Here we assessed whether SGT-53 could inhibit development of TMZ resistance. SGT-53 significantly chemosensitized TMZ-sensitive human GBM cell lines (U87 and U251), in vitro and in vivo. Furthermore, in an intracranial GBM tumor model, two cycles of concurrent treatment with systemically administered SGT-53 and TMZ inhibited tumor growth, increased apoptosis and most importantly, significantly prolonged median survival. In contrast TMZ alone had no significant effect on median survival compared to a single cycle of TMZ. These results suggest that combining SGT-53 with TMZ appears to limit development of TMZ resistance, prolonging its anti-tumor effect and could be a more effective therapy for GBM. Using human glioblastoma multiforma cell lines, this research team demonstrated that the delivery of exogenous wild-type tumor suppressor gene p53 via a tumor-targeted nanocomplex limited the development of temozolomide resistance and prolonged its anti-tumor effect, which may enable future human application of this or similar techniques. Copyright © 2015 Elsevier Inc. All rights reserved.
Functional Analysis of Interactions Between 53BP1, BRCA1 and p53
2004-07-01
deficiency synergize in tumorigenesis. Furthermore, the loss of a single 53BP1 allele enhances the susceptibility to cancer in the absence of p53. 14...specific antibodies against these sites and showed that at least two of them (S25 and S29) are phosphorylated in vivo by ATM, the kinase mutated in cancer ...characterized by chromosomal aberrations, genetic instability and cancer predisposition. +HU 153BP1 Fig. 5: Lack of 53BP1 prevents the efficient accumulation
Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.
Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J
2006-04-01
p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.
p53 downregulates the Fanconi anaemia DNA repair pathway
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-01-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104
Expressions of p53 and p21 in primary gastric lymphomas.
Go, J. H.; Yang, W. I.
2001-01-01
The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong
2012-01-01
The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK
Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma
Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong
2012-01-01
The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK
Survivin safeguards chromosome numbers and protects from aneuploidy independently from p53
2014-01-01
Background Survivin, a member of the inhibitor of apoptosis (IAP) gene family, has a dual role in mitosis and in apoptosis. It is abundantly expressed in every human tumor, compared with normal tissues. During mitosis Survivin assembles with the chromosomal passenger complex and regulates chromosomal segregation. Here, we aim to explore whether interference with the mitotic function of Survivin is linked to p53-mediated G1 cell cycle arrest and affects chromosomal stability. Methods In this study, we used HCT116, SBC-2, and U87-MG and generated corresponding isogenic p53-deficient cells. Retroviral vectors were used to stably knockdown Survivin. The resulting phenotype, in particular the mechanisms of cell cycle arrest and of initiation of aneuploidy, were investigated by Western Blot analysis, confocal laser scan microscopy, proliferation assays, spectral karyotyping and RNAi. Results In all cell lines Survivin-RNAi did not induce instant apoptosis but caused polyplodization irrespective of p53 status. Strikingly, polyploidization after knockdown of Survivin resulted in merotelic kinetochore spindle assemblies, γH2AX-foci, and DNA damage response (DDR), which was accompanied by a transient p53-mediated G1-arrest. That p53 wild type cells specifically arrest due to DNA damage was shown by simultaneous inhibition of ATM and DNA-PK, which abolished induction of p21waf/cip. Cytogenetic analysis revealed chromosomal aberrations indicative for DNA double strand break repair by the mechanism of non-homologous end joining (NHEJ), only in Survivin-depleted cells. Conclusion Our findings suggest that Survivin plays an essential role in proper amphitelic kinetochore-spindle assembly and that constraining Survivin’s mitotic function results in polyploidy and aneuploidy which cannot be controlled by p53. Therefore, Survivin critically safeguards chromosomal stability independently from p53. PMID:24886358
Contreras, Esteban G.; Sierralta, Jimena
2018-01-01
Background Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called ‘brain sparing’. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Results Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Conclusions Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals. PMID:29621246
Contreras, Esteban G; Sierralta, Jimena; Glavic, Alvaro
2018-01-01
Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called 'brain sparing'. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals.
CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.
He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu
2016-01-01
The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.
Papillomavirus, p53 alteration, and primary carcinoma of the vulva.
Pilotti, S; D'Amato, L; Della Torre, G; Donghi, R; Longoni, A; Giarola, M; Sampietro, G; De Palo, G; Pierotti, M A; Rilke, F
1995-12-01
Twenty-nine samples from 28 cases of vulvar squamous cell carcinoma, of which 13 fulfilled the criteria of the bowenoid subtype (mean age 45 years, range 31-68) and 16 of the usual subtype of invasive squamous cell carcinoma (ISCC) (mean age 67.5 years, range 34-83) were investigated for human papillomavirus (HPV) DNA, TP53 alterations, and mdm2 and bcl-2 gene product deregulation. Microscopically all the bowenoid subtype cases (group I) showed a high-grade intraepithelial (VIN 3, carcinoma in situ) lesion associated with early invasive carcinoma in six cases and overt invasive carcinoma in one. By contrast, no evidence of early carcinoma was present in the ISCCs (group II). By in situ hybridization and/or Southern blot hybridization or polymerase chain reaction (PCR), HPV DNA was detected in all cases of group I and in four of 16 cases (25%) of group II, two only by Southern blot after PCR. By single-strand conformation polymorphism and immunocytochemistry only wild-type TP53 and absence of detectable p53 product, respectively, were found in all cases of group I, i.e., in high-risk HPV-positive carcinomas, whereas mutations and/or p53 overexpression accounted for 75% in group II, i.e., in mainly HPV-negative carcinomas. The TP53 gene mutations observed in invasive carcinomas were significantly related to node-positive cases (p = 0.04). Taken together and in agreement with in vitro data, these results support the view that an alteration of TP53, gained either by interaction with viral oncoproteins or by somatic mutations, is a crucial event in the pathogenesis of vulvar carcinomas, but that TP53 mutations are mainly associated with disease progression. Finally, a preliminary immunocytochemical analysis seems to speak against the possible involvement of both MDM2 and BCL-2 gene products in the development of vulvar carcinoma.
Accumulation of p53 in infectious mononucleosis tissues.
Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L
2000-11-01
Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company
Mohapatra, Susovan; Kawahara, Misako; Khan, Imran S; Yannone, Steven M; Povirk, Lawrence F
2011-08-01
Deficiency in Artemis is associated with lack of V(D)J recombination, sensitivity to radiation and radiomimetic drugs, and failure to repair a subset of DNA double-strand breaks (DSBs). Artemis harbors an endonuclease activity that trims both 5'- and 3'-ends of DSBs. To examine whether endonucleolytic trimming of terminally blocked DSBs by Artemis is a biologically relevant function, Artemis-deficient fibroblasts were stably complemented with either wild-type Artemis or an endonuclease-deficient D165N mutant. Wild-type Artemis completely restored resistance to γ-rays, bleomycin and neocarzinostatin, and also restored DSB-repair proficiency in G0/G1 phase as measured by pulsed-field gel electrophoresis and repair focus resolution. In contrast, cells expressing the D165N mutant, even at very high levels, remained as chemo/radiosensitive and repair deficient as the parental cells, as evidenced by persistent γ-H2AX, 53BP1 and Mre11 foci that slowly increased in size and ultimately became juxtaposed with promyelocytic leukemia protein nuclear bodies. In normal fibroblasts, overexpression of wild-type Artemis increased radioresistance, while D165N overexpression conferred partial repair deficiency following high-dose radiation. Restoration of chemo/radioresistance by wild-type, but not D165N Artemis suggests that the lack of endonucleolytic trimming of DNA ends is the principal cause of sensitivity to double-strand cleaving agents in Artemis-deficient cells.
The Isoforms of the p53 Protein
Khoury, Marie P.; Bourdon, Jean-Christophe
2010-01-01
p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chhipa, Rishi Raj; Kumari, Ratna; Upadhyay, Ankur Kumar
2007-11-15
The p53 protein has been a subject of intense research interest since its discovery as about 50% of human cancers carry p53 mutations. Mutations in the p53 gene are the most frequent genetic lesions in breast cancers suggesting a critical role of p53 in breast cancer development, growth and chemosensitivity. This report describes the derivation and characterization of MCF-7As53, an isogenic cell line derived from MCF-7 breast carcinoma cells in which p53 was abrogated by antisense p53 cDNA. Similar to MCF-7 and simultaneously selected hygromycin resistant MCF-7H cells, MCF-7As53 cells have consistent basal epithelial phenotype, morphology, and estrogen receptor expressionmore » levels at normal growth conditions. Present work documents investigation of molecular variations, growth kinetics, and cell cycle related studies in relation to absence of wild-type p53 protein and its transactivation potential as well. Even though wild-type tumor suppressor p53 is an activator of cell growth arrest and apoptosis-mediator genes such as p21, Bax, and GADD45 in MCF-7As53 cells, no alterations in expression levels of these genes were detected. The doubling time of these cells decreased due to depletion of G0/G1 cell phase because of constitutive activation of Akt and increase in cyclin D1 protein levels. This proliferative property was abrogated by wortmannin, an inhibitor of PI3-K/Akt signaling pathway. Therefore this p53 null cell line indicates that p53 is an indispensable component of cellular signaling system which is regulated by caveolin-1 expression, involving Akt activation and increase in cyclin D1, thereby promoting proliferation of breast cancer cells.« less
Estrada-Ortiz, Natalia; Neochoritis, Constantinos G; Dömling, Alexander
2016-04-19
A recent therapeutic strategy in oncology is based on blocking the protein-protein interaction between the murine double minute (MDM) homologues MDM2/X and the tumor-suppressor protein p53. Inhibiting the binding between wild-type (WT) p53 and its negative regulators MDM2 and/or MDMX has become an important target in oncology to restore the antitumor activity of p53, the so-called guardian of our genome. Interestingly, based on the multiple disclosed compound classes and structural analysis of small-molecule-MDM2 adducts, the p53-MDM2 complex is perhaps the best studied and most targeted protein-protein interaction. Several classes of small molecules have been identified as potent, selective, and efficient inhibitors of the p53-MDM2/X interaction, and many co-crystal structures with the protein are available. Herein we review the properties as well as preclinical and clinical studies of these small molecules and peptides, categorized by scaffold type. A particular emphasis is made on crystallographic structures and the observed binding modes of these compounds, including conserved water molecules present. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yasuda, T; Oda, S; Li, Z; Kimori, Y; Kamei, Y; Ishikawa, T; Todo, T; Mitani, H
2012-01-01
In this study, the roles of p53 in impaired spermatogenic male germ cells of p53-deficient medaka were investigated by analyzing histological changes, and gene expressions of 42Sp50, Oct 4 and vitellogenin (VTG2) by RT-PCR or in situ hybridization in the testes. We found that a small number of oocyte-like cells (testis–ova) differentiated spontaneously in the cysts of type A and early type B spermatogonia in the p53-deficient testes, in contrast to the wild-type (wt) testes in which testis–ova were never found. Furthermore, ionizing radiation (IR) irradiation increased the number of testis–ova in p53-deficient testes, increased testis–ova size and proceeded up to the zygotene or pachytene stages of premature meiosis within 14 days after irradiation. However, 28 days after irradiation, almost all the testis–ova were eliminated presumably by p53-independent apoptosis, and spermatogenesis was restored completely. In the wt testis, IR never induced testis–ova differentiation. This is the first study to demonstrate the pivotal role of the p53 gene in the elimination of spontaneous testis–ova in testes, and that p53 is not indispensable for the restoration of spermatogenesis in the impaired testes in which cell cycle regulation is disturbed by IR irradiation. PMID:23034330
Hargraves, Kris G.; He, Lin; Firestone, Gary L.
2016-01-01
The tumor suppressive microRNA miR-34a is transcriptionally regulated by p53 and shown to inhibit breast cancer cell proliferation as well as being a marker of increased disease free survival. Indole-3-carbinol (I3C) derived from cruciferous vegetables, artemisinin, extracted from the sweet wormwood plant, and artesunate, a semi-synthetic derivative of artemisinin, are phytochemicals with anti-tumorigenic properties however, little is known about the role of microRNAs in their mechanism of action. Human breast cancer cells expressing wild-type (MCF-7) or mutant p53 (T47D) were treated with a concentration range and time course of each phytochemical under conditions of cell cycle arrest as detected by flow cytometry to examine the potential connection between miR-34a expression and their anti-proliferative responses. Real-time PCR and western blot analysis of extracted RNA and total protein revealed artemsinin and artesunate increased miR-34a expression in a dose-dependent manner correlating with down-regulation of the miR-34a target gene, CDK4. I3C stimulation of miR-34a expression required functional p53, whereas, both artemisinin and artesunate up-regulated miR-34a expression regardless of p53 mutational status or in the presence of dominant negative p53. Phytochemical treatments inhibited the luciferase activity of a construct containing the wild-type 3′UTR of CDK4, but not those with a mutated miR-34a binding site, whereas, transfection of miR-34a inhibitors ablated the phytochemical mediated down-regulation of CDK4 and induction of cell cycle arrest. Our results suggest that miR-34a is an essential component of the anti-proliferative activities of I3C, artemisinin and artesunate and demonstrate that both wild-type p53 dependent and independent pathways are responsible for miR-34a induction. PMID:25789847
Gagnon, David; Archambault, Jacques
2015-01-01
A subset of human papillomaviruses (HPVs), known as the high-risk types, are the causative agents of cervical cancer and other malignancies of the anogenital region and oral mucosa. The capacity of these viruses to induce cancer and to immortalize cells in culture relies in part on a critical function of their E6 oncoprotein, that of promoting the poly-ubiquitination of the cellular tumor suppressor protein p53 and its subsequent degradation by the proteasome. Here, we describe a cellular assay to measure the p53-degradation activity of E6 from different HPV types. This assay is based on a translational fusion of p53 to Renilla luciferase (Rluc-p53) that remains sensitive to degradation by high-risk E6 and whose steady-state levels can be accurately measured in standard luciferase assays. The p53-degradation activity of any E6 protein can be tested and quantified in transiently transfected cells by determining the amount of E6-expression vector required to reduce by half the levels of RLuc-p53 luciferase activity (50 % effective concentration [EC50]). The high-throughput and quantitative nature of this assay makes it particularly useful to compare the p53-degradation activities of E6 from several HPV types in parallel.
Increased sensitivity of p53-deficient cells to anticancer agents due to loss of Pms2
Fedier, A; Ruefenacht, U B; Schwarz, V A; Haller, U; Fink, D
2002-01-01
A large fraction of human tumours carries mutations in the p53 gene. p53 plays a central role in controlling cell cycle checkpoint regulation, DNA repair, transcription, and apoptosis upon genotoxic stress. Lack of p53 function impairs these cellular processes, and this may be the basis of resistance to chemotherapeutic regimens. By virtue of the involvement of DNA mismatch repair in modulating cytotoxic pathways in response to DNA damaging agents, we investigated the effects of loss of Pms2 on the sensitivity to a panel of widely used anticancer agents in E1A/Ha-Ras-transformed p53-null mouse fibroblasts either proficient or deficient in Pms2. We report that lack of the Pms2 gene is associated with an increased sensitivity, ranging from 2–6-fold, to some types of anticancer agents including the topoisomerase II poisons doxorubicin, etoposide and mitoxantrone, the platinum compounds cisplatin and oxaliplatin, the taxanes docetaxel and paclitaxel, and the antimetabolite gemcitabine. In contrast, no change in sensitivity was found after treatment with 5-fluorouracil. Cell cycle analysis revealed that both, Pms2-deficient and -proficient cells, retain the ability to arrest at the G2/M upon cisplatin treatment. The data indicate that the concomitant loss of Pms2 function chemosensitises p53-deficient cells to some types of anticancer agents, that Pms2 positively modulates cell survival by mechanisms independent of p53, and that increased cytotoxicity is paralleled by increased apoptosis. Tumour-targeted functional inhibition of Pms2 may be a valuable strategy for increasing the efficacy of anticancer agents in the treatment of p53-mutant cancers. British Journal of Cancer (2002) 87, 1027–1033. doi:10.1038/sj.bjc.6600599 www.bjcancer.com © 2002 Cancer Research UK PMID:12434296
Carrasco, V; Canfrán, S; Rodríguez-Franco, F; Benito, A; Sáinz, A; Rodríguez-Bertos, A
2011-01-01
Immunohistochemical staining for cell cycle proteins and heat shock proteins was performed on 17 canine gastric carcinomas. The immunoexpression of p53, p21, p16, Hsp27, and Hsp70 was investigated. A study was conducted to determine the histological type and parameters related to tumor malignancy. Possible associations and trends were assessed between the immunoexpression of each protein and tumor type as well as specific parameters of malignancy. High intratumor frequency of cellular p53 immunostaining was observed (61.96% average), but lower frequencies of p21 and p16 expression were present (34.65% and 10.41%, respectively). The p53 overexpression was associated with tumor infiltration (P = .0258). Expression of p21 was lower in undifferentiated carcinomas, and the loss of expression was associated with histopathological parameters characteristic of a poor prognosis such as lymphatic vessel invasion (P = .0258). The lack of p16 immunoreactivity was related to histopathological characteristics of malignancy such as the presence of evident and multiple nucleoli (P = .0475). In contrast, deep tumor infiltration was observed in those carcinomas with a high p16 index (P = .0475). Hsp70 appeared to be overexpressed in all gastric neoplasms included in this study. This is in contrast to Hsp27, because a group of tumors showed complete lack of Hsp27 immunoexpression, whereas the others displayed extensive Hsp27 immunostaining. The differences in Hsp27 did not correlate with any of the histopathological parameters, but Hsp27 immunoexpression was higher in the undifferentiated carcinoma. No significant differences in the expression of the proteins were found in canine gastric carcinomas according to their histological type. These findings may be useful for establishing a prognosis for canine gastric carcinoma.
Rose, Tatiana L; Miagostovich, Marize P; Leite, José Paulo G
2010-12-01
Rotaviruses are important enteric pathogens for humans and animals. Group A rotaviruses (RV-A) are the most common agents of severe gastroenteritis in infants and young children and vaccination is the most effective method to reduce RV-A-associated diseases. G1P[8], the most prevalent RV-A genotype worldwide, is included in the RV-A vaccine Rotarix®. The discrimination between wild-type G1P[8] and vaccine G1P[8] strains is an important topic in the study of RV-A epidemiology to manage outbreaks and to define control measures for vaccinated children. In this study, we developed a novel method to segregate the wild-type and vaccine strains using restriction endonucleases. The dsRNA from the Rotarix® vaccine was sequenced and the NSP3 gene was selected as the target gene. The vaccine strain has a restriction pattern that is different than that of wild-type RV-A G1P[8] isolates after digestion with the restriction endonuclease BspHI. This pattern could be used as a marker for the differentiation of wild-type G1P[8] strains from the vaccine strain.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yun, Hong Shik; Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791; Baek, Jeong-Hwa
2014-07-11
Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates themore » radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells.« less
1997-10-01
and Biomedical Laboratories. PI - Signature Date TABLE OF CONTENTS Report Documentation Page ii Foreword m Introduction 1-2 Experimental Methods...life studies of P53 or p53as in G1, S, and G2/ M was unsuccessful as reported last year. Long cell cycle times may be responsible for lack of separation...of S-phase 5 cells from G2/ M -phase cells by centrifugal elutriation. Attempts to synchronize cells by density arrest and/or serum starvation resulted
A stapled p53 helix overcomes HDMX-mediated suppression of p53.
Bernal, Federico; Wade, Mark; Godes, Marina; Davis, Tina N; Whitehead, David G; Kung, Andrew L; Wahl, Geoffrey M; Walensky, Loren D
2010-11-16
Cancer cells neutralize p53 by deletion, mutation, proteasomal degradation, or sequestration to achieve a pathologic survival advantage. Targeting the E3 ubiquitin ligase HDM2 can lead to a therapeutic surge in p53 levels. However, the efficacy of HDM2 inhibition can be compromised by overexpression of HDMX, an HDM2 homolog that binds and sequesters p53. Here, we report that a stapled p53 helix preferentially targets HDMX, blocks the formation of inhibitory p53-HDMX complexes, induces p53-dependent transcriptional upregulation, and thereby overcomes HDMX-mediated cancer resistance in vitro and in vivo. Importantly, our analysis of p53 interaction dynamics provides a blueprint for reactivating the p53 pathway in cancer by matching HDM2, HDMX, or dual inhibitors to the appropriate cellular context. Copyright © 2010 Elsevier Inc. All rights reserved.
Ptak, K; Hunt, S P; Monteau, R
2000-07-01
Neurokinin-1 receptors (NK1) are present within the respiratory medullary network and in the phrenic nucleus, which controls the diaphragm. We compared the efficacy of substance P (SP) at inducing changes in respiratory frequency or the amplitude of the respiratory motor output between NK1 knockout (NK1-/-) and wild-type mice, using the in vitro brainstem-spinal cord preparation. The in vitro respiratory frequency, as well as the variability of the rhythm and the amplitude of the motor output were similar in both lines. In wild-type mice, application of exogenous SP induced either an increase in respiratory frequency (superfusion of the medulla) or an increase of the inspiratory motor output, as defined by the integral of C4 cervical ventral root activity (superfusion of the spinal cord). These two effects were not apparent in NK1-/- mice. In conclusion, NK1 receptors mediate the respiratory responses to SP but the lack of NK1 receptors in newborn NK1-/- mice does not change the respiratory activity.
NASA Astrophysics Data System (ADS)
Armitage, Mark
Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or
Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq
2017-10-01
In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.
INGN 201: Ad-p53, Ad5CMV-p53, adenoviral p53, p53 gene therapy--introgen, RPR/INGN 201.
2007-01-01
patients including virtually all of those routes currently being used for adenoviral delivery was awarded. In addition, US Patent No. 6,740,320, which broadly covers adenoviral vectors with the tumour suppressor p53 in pharmaceutical compositions, was awarded. This patent extends Introgen's patent coverage for its adenoviral p53 gene therapy product to the year 2021, not taking into account possible patent extensions. In February 2003, the US Patent and Trademark Office issued patent No. 6,511,847, entitled Recombinant p53 Adenovirus Methods and Compositions, covering any adenoviral DNA molecule that encodes the p53 gene positioned under the control of a promoter.US patents issued in 2002 include Patent No. 6,410,010, broadly covering all adenoviral p53 compositions (including ADVEXIN((R))) that express adequate p53 in amounts sufficient to suppress the growth of or kill cancer cells in patients. The patent also covers adenoviral p53, which incorporates a specific type of promoter that helps cells to express the p53 tumour suppressor gene. Introgen has a number of US patents that relate to the clinical use of adenoviral p53 gene therapy in cancer as monotherapy or in combination with one or more chemotherapeutic drugs, radiation therapies or other agents that have a damaging effect on the DNA or survival of (i.e. 2-methoxyestradiol, Patent No. 6,410,029) cancer cells.A patent with broad claims directed to combination therapy with the p53 gene and conventional chemotherapy or radiation was issued in China in August 2005. Patent No. ZL95192776.0, entitled Compositions Comprising DNA Damaging Agents and p53, was issued to the Board of Regents of The University of Texas System and was exclusively licenced to Introgen. (ABSTRACT TRUNCATED)
Molecular Mechanism of Mutant p53 Stabilization: The Role of HSP70 and MDM2
Wiech, Milena; Olszewski, Maciej B.; Tracz-Gaszewska, Zuzanna; Wawrzynow, Bartosz; Zylicz, Maciej; Zylicz, Alicja
2012-01-01
Numerous p53 missense mutations possess gain-of-function activities. Studies in mouse models have demonstrated that the stabilization of p53 R172H (R175H in human) mutant protein, by currently unknown factors, is a prerequisite for its oncogenic gain-of-function phenotype such as tumour progression and metastasis. Here we show that MDM2-dependent ubiquitination and degradation of p53 R175H mutant protein in mouse embryonic fibroblasts is partially inhibited by increasing concentration of heat shock protein 70 (HSP70/HSPA1-A). These phenomena correlate well with the appearance of HSP70-dependent folding intermediates in the form of dynamic cytoplasmic spots containing aggregate-prone p53 R175H and several molecular chaperones. We propose that a transient but recurrent interaction with HSP70 may lead to an increase in mutant p53 protein half-life. In the presence of MDM2 these pseudoaggregates can form stable amyloid-like structures, which occasionally merge into an aggresome. Interestingly, formation of folding intermediates is not observed in the presence of HSC70/HSPA8, the dominant-negative K71S variant of HSP70 or HSP70 inhibitor. In cancer cells, where endogenous HSP70 levels are already elevated, mutant p53 protein forms nuclear aggregates without the addition of exogenous HSP70. Aggregates containing p53 are also visible under conditions where p53 is partially unfolded: 37°C for temperature-sensitive variant p53 V143A and 42°C for wild-type p53. Refolding kinetics of p53 indicate that HSP70 causes transient exposure of p53 aggregate-prone domain(s). We propose that formation of HSP70- and MDM2-dependent protein coaggregates in tumours with high levels of these two proteins could be one of the mechanisms by which mutant p53 is stabilized. Moreover, sequestration of p73 tumour suppressor protein by these nuclear aggregates may lead to gain-of-function phenotypes. PMID:23251530
Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang
1998-01-01
Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860
Yatagai, Fumio; Morimoto, Shigeko; Kato, Takesi; Honma, Masamitsu
2004-06-13
Loss of heterozygosity (LOH) is the predominant mechanism of spontaneous mutagenesis at the heterozygous thymindine kinase locus (tk) in TK6 cells. LOH events detected in spontaneous TK(-) mutants (110 clones from p53 wild-type cells TK6-20C and 117 clones from p53-abrogated cells TK6-E6) were analyzed using 13 microsatellite markers spanning the whole of chromosome 17. Our analysis indicated an approximately 60-fold higher frequency of terminal deletions in p53-abrogated cells TK6-E6 compared to p53 wild-type cells TK6-20C whereas frequencies of point mutations (non-LOH events), interstitial deletions, and crossing over events were found to increase only less than twofold by such p53 abrogation. We then made use of an additional 17 microsatellite markers which provided an average map-interval of 1.6Mb to map various LOH endpoints on the 45Mb portion of chromosome 17q corresponding to the maximum length of LOH tracts (i.e. from the distal marker D17S932 to the terminal end). There appeared to be four prominent peaks (I-IV) in the distribution of LOH endpoints/Mb of Tk6-20C cells that were not evident in p53-abrogated cells TK6-E6, where they appeared to be rather broadly distributed along the 15-20Mb length (D17S1807 to D17S1607) surrounding two of the peaks that we detected in TK6-20C cells (peaks II and III). We suggest that the chromosomal instability that is so evident in TK6-E6 cells may be due to DNA double-strand break repair occurring through non homologous end-joining rather than allelic recombination.
Takeda, Yohei; Yashima, Kazuo; Hayashi, Akihiro; Sasaki, Shuji; Kawaguchi, Koichiro; Harada, Kenichi; Murawaki, Yoshikazu; Ito, Hisao
2012-01-01
AIM: To analyze the expression of the tumor-related proteins in differentiated-type early gastric carcinoma (DEGC) samples. METHODS: Tumor specimens were obtained from 102 patients (75 males and 27 females) who had received an endoscopic tumor resection at Tottori University Hospital between 2007 and 2009. Ninety-one cancer samples corresponded to noninvasive or intramucosal carcinoma according to the Vienna classification system, and 11 samples were submucosal invasive carcinomas. All of the EGCs were histologically differentiated carcinomas. All patients were classified as having Helicobacter pylori (H. pylori) infections by endoscopic atrophic changes or by testing seropositive for H. pylori IgG. All of the samples were histopathologically classified as either tubular or papillary adenocarcinoma according to their structure. The immunohistochemical staining was performed in a blinded manner with respect to the clinical information. Two independent observers evaluated protein expression. All data were statistically analyzed then. RESULTS: The rates of aberrant activation-induced cytidine deaminase (AID) expression and P53 overexpression were both 34.3% in DEGCs. The expression of Mlh1 was lost in 18.6% of DEGCs. Aberrant AID expression was not significantly associated with P53 overexpression in DEGCs. However, AID expression was associated with the severity of mononuclear cell activity in the non-cancerous mucosa adjacent to the tumor (P = 0.064). The rate of P53 expression was significantly greater in flat or depressed tumors than in elevated tumors. The frequency of Mlh1 loss was significantly increased in distal tumors, elevated gross-type tumors, papillary histological-type tumors, and tumors with a severe degree of endoscopic atrophic gastritis (P < 0.05). CONCLUSION: Aberrant AID expression, P53 overexpression, and the loss of Mlh1 were all associated with clinicopathological features and gastric mucosal alterations in DEGCs. The aberrant expression of AID
Mechanisms that enhance sustainability of p53 pulses.
Kim, Jae Kyoung; Jackson, Trachette L
2013-01-01
The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.
p53 inhibits autophagy by interacting with the human ortholog of yeast Atg17, RB1CC1/FIP200.
Morselli, Eugenia; Shen, Shensi; Ruckenstuhl, Christoph; Bauer, Maria Anna; Mariño, Guillermo; Galluzzi, Lorenzo; Criollo, Alfredo; Michaud, Mickael; Maiuri, Maria Chiara; Chano, Tokuhiro; Madeo, Frank; Kroemer, Guido
2011-08-15
The tumor suppressor protein p53 tonically suppresses autophagy when it is present in the cytoplasm. This effect is phylogenetically conserved from mammals to nematodes, and human p53 can inhibit autophagy in yeast, as we show here. Bioinformatic investigations of the p53 interactome in relationship to the autophagy-relevant protein network underscored the possible relevance of a direct molecular interaction between p53 and the mammalian ortholog of the essential yeast autophagy protein Atg17, namely RB1-inducible coiled-coil protein 1 (RB1CC1), also called FAK family kinase-interacting protein of 200 KDa (FIP200). Mutational analyses revealed that a single point mutation in p53 (K382R) abolished its capacity to inhibit autophagy upon transfection into p53-deficient human colon cancer or yeast cells. In conditions in which wild-type p53 co-immunoprecipitated with RB1CC1/FIP200, p53 (K382R) failed to do so, underscoring the importance of the physical interaction between these proteins for the control of autophagy. In conclusion, p53 regulates autophagy through a direct molecular interaction with RB1CC1/FIP200, a protein that is essential for the very apical step of autophagy initiation.
Carter, Bing Z.; Mak, Duncan H.; Schober, Wendy D.; Koller, Erich; Pinilla, Clemencia; Vassilev, Lyubomir T.; Reed, John C.
2010-01-01
Activation of p53 by murine double minute (MDM2) antagonist nutlin-3a or inhibition of X-linked inhibitor of apoptosis (XIAP) induces apoptosis in acute myeloid leukemia (AML) cells. We demonstrate that concomitant inhibition of MDM2 by nutlin-3a and of XIAP by small molecule antagonists synergistically induced apoptosis in p53 wild-type OCI-AML3 and Molm13 cells. Knockdown of p53 by shRNA blunted the synergy, and down-regulation of XIAP by antisense oligonucleotide (ASO) enhanced nutlin-3a–induced apoptosis, suggesting that the synergy was mediated by p53 activation and XIAP inhibition. This is supported by data showing that inhibition of both MDM2 and XIAP by their respective ASOs induced significantly more cell death than either ASO alone. Importantly, p53 activation and XIAP inhibition enhanced apoptosis in blasts from patients with primary AML, even when the cells were protected by stromal cells. Mechanistic studies demonstrated that XIAP inhibition potentiates p53-induced apoptosis by decreasing p53-induced p21 and that p53 activation enhances XIAP inhibition-induced cell death by promoting mitochondrial release of second mitochondria-derived activator of caspases (SMAC) and by inducing the expression of caspase-6. Because both XIAP and p53 are presently being targeted in ongoing clinical trials in leukemia, the combination strategy holds promise for expedited translation into the clinic. PMID:19897582
Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa
2016-07-26
DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.
Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong
2016-01-01
Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53−/− cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin. PMID:27626169
Zhang, Qing-Yu; Jin, Rui; Zhang, Xian; Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong
2016-10-25
Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53-/- cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin.
Zhou, Ruoji; Xu, An; Wang, Donghui; Zhu, Dandan; Mata, Helen; Huo, Zijun; Tu, Jian; Liu, Mo; Mohamed, Alaa M T; Jewell, Brittany E; Gingold, Julian; Xia, Weiya; Rao, Pulivarthi H; Hung, Mien-Chie; Zhao, Ruiying; Lee, Dung-Fang
2018-03-01
The tumor suppressor gene TP53 is the most frequently mutated gene in human cancers. Many hot-spot mutations of TP53 confer novel functions not found in wild-type p53 and contribute to tumor development and progression. We report on the generation of a H1 human embryonic stem cell line carrying a homozygous TP53 R282W mutation using TALEN-mediated genome editing. The generated cell line demonstrates normal karyotype, maintains a pluripotent state, and is capable of generating a teratoma in vivo containing tissues from all three germ layers. Copyright © 2018 The Author(s). Published by Elsevier B.V. All rights reserved.
WWOX and p53 Dysregulation Synergize to Drive the Development of Osteosarcoma.
Del Mare, Sara; Husanie, Hussam; Iancu, Ortal; Abu-Odeh, Mohammad; Evangelou, Konstantinos; Lovat, Francesca; Volinia, Stefano; Gordon, Jonathan; Amir, Gail; Stein, Janet; Stein, Gary S; Croce, Carlo M; Gorgoulis, Vassilis; Lian, Jane B; Aqeilan, Rami I
2016-10-15
Osteosarcoma is a highly metastatic form of bone cancer in adolescents and young adults that is resistant to existing treatments. Development of an effective therapy has been hindered by very limited understanding of the mechanisms of osteosarcomagenesis. Here, we used genetically engineered mice to investigate the effects of deleting the tumor suppressor Wwox selectively in either osteoblast progenitors or mature osteoblasts. Mice with conditional deletion of Wwox in preosteoblasts (Wwox Δosx1 ) displayed a severe inhibition of osteogenesis accompanied by p53 upregulation, effects that were not observed in mice lacking Wwox in mature osteoblasts. Deletion of p53 in Wwox Δosx1 mice rescued the osteogenic defect. In addition, the Wwox;p53 Δosx1 double knockout mice developed poorly differentiated osteosarcomas that resemble human osteosarcoma in histology, location, metastatic behavior, and gene expression. Strikingly, the development of osteosarcomas in these mice was greatly accelerated compared with mice lacking p53 only. In contrast, combined WWOX and p53 inactivation in mature osteoblasts did not accelerate osteosarcomagenesis compared with p53 inactivation alone. These findings provide evidence that a WWOX-p53 network regulates normal bone formation and that disruption of this network in osteoprogenitors results in accelerated osteosarcoma. The Wwox;p53 Δosx1 double knockout establishes a new osteosarcoma model with significant advancement over existing models. Cancer Res; 76(20); 6107-17. ©2016 AACR. ©2016 American Association for Cancer Research.
1985-01-01
SEC53, a gene that is required for completion of assembly of proteins in the endoplasmic reticulum in yeast, has been cloned, sequenced, and the product localized by cell fractionation. Complementation of a sec53 mutation is achieved with unique plasmids from genomic or cDNA expression banks. These inserts contain the authentic gene, a cloned copy of which integrates at the sec53 locus. An open reading frame in the insert predicts a 29-kD protein with no significant hydrophobic character. This prediction is confirmed by detection of a 28-kD protein overproduced in cells that carry SEC53 on a multicopy plasmid. To follow Sec53p more directly, a LacZ-SEC53 gene fusion has been constructed which allows the isolation of a hybrid protein for use in production of antibody. With such an antibody, quantitative immune decoration has shown that the sec53-6 mutation decreases the level of Sec53p at 37 degrees C, while levels comparable to wild-type are seen at 24 degrees C. An eightfold overproduction of Sec53p accompanies transformation of cells with a multicopy plasmid containing SEC53. Cell fractionation, performed with conditions that preserve the lumenal content of the endoplasmic reticulum (ER), shows Sec53p highly enriched in the cytosol fraction. We suggest that Sec53p acts indirectly to facilitate assembly in the ER, possibly by interacting with a stable ER component, or by providing a small molecule, other than an oligosaccharide precursor, necessary for the assembly event. PMID:3905826
Garby, Tamsyn J.; Matys, Emily D.; Ongley, Sarah E.; Salih, Anya; Larkum, Anthony W. D.; Walter, Malcolm R.
2017-01-01
ABSTRACT To investigate the function of 2-methylhopanoids in modern cyanobacteria, the hpnP gene coding for the radical S-adenosyl methionine (SAM) methylase protein that acts on the C-2 position of hopanoids was deleted from the filamentous cyanobacterium Nostoc punctiforme ATCC 29133S. The resulting ΔhpnP mutant lacked all 2-methylhopanoids but was found to produce much higher levels of two bacteriohopanepentol isomers than the wild type. Growth rates of the ΔhpnP mutant cultures were not significantly different from those of the wild type under standard growth conditions. Akinete formation was also not impeded by the absence of 2-methylhopanoids. The relative abundances of the different hopanoid structures in akinete-dominated cultures of the wild-type and ΔhpnP mutant strains were similar to those of vegetative cell-dominated cultures. However, the ΔhpnP mutant was found to have decreased growth rates under both pH and osmotic stress, confirming a role for 2-methylhopanoids in stress tolerance. Evidence of elevated photosystem II yield and NAD(P)H-dependent oxidoreductase activity in the ΔhpnP mutant under stress conditions, compared to the wild type, suggested that the absence of 2-methylhopanoids increases cellular metabolic rates under stress conditions. IMPORTANCE As the first group of organisms to develop oxygenic photosynthesis, Cyanobacteria are central to the evolutionary history of life on Earth and the subsequent oxygenation of the atmosphere. To investigate the origin of cyanobacteria and the emergence of oxygenic photosynthesis, geobiologists use biomarkers, the remnants of lipids produced by different organisms that are found in geologic sediments. 2-Methylhopanes have been considered indicative of cyanobacteria in some environmental settings, with the parent lipids 2-methylhopanoids being present in many contemporary cyanobacteria. We have created a Nostoc punctiforme ΔhpnP mutant strain that does not produce 2-methylhopanoids to assess the
Garby, Tamsyn J; Matys, Emily D; Ongley, Sarah E; Salih, Anya; Larkum, Anthony W D; Walter, Malcolm R; Summons, Roger E; Neilan, Brett A
2017-07-01
To investigate the function of 2-methylhopanoids in modern cyanobacteria, the hpnP gene coding for the radical S -adenosyl methionine (SAM) methylase protein that acts on the C-2 position of hopanoids was deleted from the filamentous cyanobacterium Nostoc punctiforme ATCC 29133S. The resulting Δ hpnP mutant lacked all 2-methylhopanoids but was found to produce much higher levels of two bacteriohopanepentol isomers than the wild type. Growth rates of the Δ hpnP mutant cultures were not significantly different from those of the wild type under standard growth conditions. Akinete formation was also not impeded by the absence of 2-methylhopanoids. The relative abundances of the different hopanoid structures in akinete-dominated cultures of the wild-type and Δ hpnP mutant strains were similar to those of vegetative cell-dominated cultures. However, the Δ hpnP mutant was found to have decreased growth rates under both pH and osmotic stress, confirming a role for 2-methylhopanoids in stress tolerance. Evidence of elevated photosystem II yield and NAD(P)H-dependent oxidoreductase activity in the Δ hpnP mutant under stress conditions, compared to the wild type, suggested that the absence of 2-methylhopanoids increases cellular metabolic rates under stress conditions. IMPORTANCE As the first group of organisms to develop oxygenic photosynthesis, Cyanobacteria are central to the evolutionary history of life on Earth and the subsequent oxygenation of the atmosphere. To investigate the origin of cyanobacteria and the emergence of oxygenic photosynthesis, geobiologists use biomarkers, the remnants of lipids produced by different organisms that are found in geologic sediments. 2-Methylhopanes have been considered indicative of cyanobacteria in some environmental settings, with the parent lipids 2-methylhopanoids being present in many contemporary cyanobacteria. We have created a Nostoc punctiforme Δ hpnP mutant strain that does not produce 2-methylhopanoids to assess the
p53: traffic cop at the crossroads of DNA repair and recombination.
Sengupta, Sagar; Harris, Curtis C
2005-01-01
p53 mutants that lack DNA-binding activities, and therefore, transcriptional activities, are among the most common mutations in human cancer. Recently, a new role for p53 has come to light, as the tumour suppressor also functions in DNA repair and recombination. In cooperation with its function in transcription, the transcription-independent roles of p53 contribute to the control and efficiency of DNA repair and recombination.
Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.
Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen
2017-10-15
Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and
Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ho, Dong Hwan, E-mail: ethan2887@gmail.com; Seol, Wongi; Eun, Jin Hwan
Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantlymore » increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site. - Highlights: • LPS stimulates LRRK2-mediated p53 phosphorylation and its nuclear localization. • Phosphorylation of p53 by LRRK2 in microglia enhances TNFα expression. • Microglial TNFα via LRRK2-induced p53 phosphorylation decreases neuronal survival.« less
Czyz, Jaroslaw; Guan, Kaomei; Zeng, Qinghua; Nikolova, Teodora; Meister, Armin; Schönborn, Frank; Schuderer, Jürgen; Kuster, Niels; Wobus, Anna M
2004-05-01
Effects of electromagnetic fields (EMF) simulating exposure to the Global System for Mobile Communications (GSM) signals were studied using pluripotent embryonic stem (ES) cells in vitro. Wild-type ES cells and ES cells deficient for the tumor suppressor p53 were exposed to pulse modulated EMF at 1.71 GHz, lower end of the uplink band of GSM 1800, under standardized and controlled conditions, and transcripts of regulatory genes were analyzed during in vitro differentiation. Two dominant GSM modulation schemes (GSM-217 and GSM-Talk), which generate temporal changes between GSM-Basic (active during talking phases) and GSM-DTX (active during listening phases thus simulating a typical conversation), were applied to the cells at and below the basic safety limits for local exposures as defined for the general public by the International Commission on Nonionizing Radiation Protection (ICNIRP). GSM-217 EMF induced a significant upregulation of mRNA levels of the heat shock protein, hsp70 of p53-deficient ES cells differentiating in vitro, paralleled by a low and transient increase of c-jun, c-myc, and p21 levels in p53-deficient, but not in wild-type cells. No responses were observed in either cell type after EMF exposure to GSM-Talk applied at similar slot-averaged specific absorption rates (SAR), but at lower time-averaged SAR values. Cardiac differentiation and cell cycle characteristics were not affected in embryonic stem and embryonic carcinoma cells after exposure to GSM-217 EMF signals. Our data indicate that the genetic background determines cellular responses to GSM modulated EMF. Bioelectromagnetics 25:296-307, 2004. Copyright 2004 Wiley-Liss, Inc.
Structure and stability insights into tumour suppressor p53 evolutionary related proteins.
Pagano, Bruno; Jama, Abdullah; Martinez, Pierre; Akanho, Ester; Bui, Tam T T; Drake, Alex F; Fraternali, Franca; Nikolova, Penka V
2013-01-01
The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs) of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.
Orthotopic transplantation of LH receptor knockout and wild-type ovaries.
Chudgar, Daksha; Lei, Zhenmin; Rao, Ch V
2005-10-07
Luteinizing hormone (LH) receptor knockout animals have an ovarian failure due to an arrest in folliculogenesis at the antral stage. As a result, the animals have an infertility phenotype. The present study was undertaken to determine whether this phenotype could be reversed by orthotopic transplantation of wild-type ovaries. The results revealed that transplanting wild-type ovaries into null animals did not result in resumption of estrus cycles. Although the number of different types of follicles increased, none progressed to ovulation. The serum hormone profiles improved, reflecting the ovarian changes. The wild-type animals with null ovaries also failed to cycle and their ovaries and serum hormone levels were more like null animals with their own ovaries. Although the lack of rescue of null ovaries placed into wild-type animals was predicted, the failure of wild-type ovaries placed in null animals was not, which could be due to chronic exposure of transplanted tissue to high circulating LH levels and also possibly due to altered internal milieu in null animals. These findings may have implications for potential future considerations of grafting normal donor ovaries into women who have an ovarian failure resulting from inactivating LH receptor mutations.
2011-01-01
Background Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. Results We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. Conclusions we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by
Liu, Juan; Uematsu, Hiroshi; Tsuchida, Nobuo; Ikeda, Masa-Aki
2011-07-31
Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. Our
Identification of p53 unbound to T-antigen in human cells transformed by simian virus 40 T-antigen.
O'Neill, F J; Hu, Y; Chen, T; Carney, H
1997-02-27
In several clones of SV40-transformed human cells, we investigated the relative amounts of large T-Antigen (T-Ag) and p53 proteins, both unbound and associated within complexes, with the goal of identifying changes associated with transformation and immortalization. Cells were transformed by wild type (wt) T-Ag, a functionally temperature sensitive T-Ag (tsA58) and other T-Ag variants. Western analysis showed that while most of the T-Ag was ultimately bound by p53, most of the p53 remained unbound to T-Ag. Unbound p53 remained in the supernatant after a T-Ag immunoprecipitation and p53 was present in two to fourfold excess of T-Ag. In one transformant there was five to tenfold more p53 than T-Ag. p53 was present in transformants in amounts at least 200-fold greater than in untransformed human cells. In wt and variant T-Ag transformants, including those generated with tsA58 T-Ag, large amounts of unbound p53 were present in both pre-crisis and immortal cells and when the cells were grown at permissive or non-permissive temperatures. We also found that in transformants produced by tsA58, an SV40/JCV chimeric T-Ag and other variants, T-Ag appeared to form a complex with p53 slowly perhaps because one or both proteins matured slowly. The presence in transformed human cells of large amounts of unbound p53 and in excess of T-Ag suggests that sequestration of p53 by T-Ag, resulting from complex formation, is required neither for morphological transformation nor immortalization of human cells. Rather, these results support the proposal that high levels of p53, the T-Ag/p53 complexes, or other biochemical event(s), lead to transformation and immortalization of human cells by T-Ag.
Garcia, Patrick Vianna; Seiva, Fábio Rodrigues Ferreira; Carniato, Amanda Pocol; de Mello Júnior, Wilson; Duran, Nelson; Macedo, Alda Maria; de Oliveira, Alexandre Gabarra; Romih, Rok; Nunes, Iseu da Silva; Nunes, Odilon da Silva; Fávaro, Wagner José
2016-07-07
The new modalities for treating patients with non-muscle invasive bladder cancer (NMIBC) for whom BCG (Bacillus Calmette-Guerin) has failed or is contraindicated are recently increasing due to the development of new drugs. Although agents like mitomycin C and BCG are routinely used, there is a need for more potent and/or less-toxic agents. In this scenario, a new perspective is represented by P-MAPA (Protein Aggregate Magnesium-Ammonium Phospholinoleate-Palmitoleate Anhydride), developed by Farmabrasilis (non-profit research network). This study detailed and characterized the mechanisms of action of P-MAPA based on activation of mediators of Toll-like Receptors (TLRs) 2 and 4 signaling pathways and p53 in regulating angiogenesis and apoptosis in an animal model of NMIBC, as well as, compared these mechanisms with BCG treatment. Our results demonstrated the activation of the immune system by BCG (MyD88-dependent pathway) resulted in increased inflammatory cytokines. However, P-MAPA intravesical immunotherapy led to distinct activation of TLRs 2 and 4-mediated innate immune system, resulting in increased interferons signaling pathway (TRIF-dependent pathway), which was more effective in the NMIBC treatment. Interferon signaling pathway activation induced by P-MAPA led to increase of iNOS protein levels, resulting in apoptosis and histopathological recovery. Additionally, P-MAPA immunotherapy increased wild-type p53 protein levels. The increased wild-type p53 protein levels were fundamental to NO-induced apoptosis and the up-regulation of BAX. Furthermore, interferon signaling pathway induction and increased p53 protein levels by P-MAPA led to important antitumor effects, not only suppressing abnormal cell proliferation, but also by preventing continuous expansion of tumor mass through suppression of angiogenesis, which was characterized by decreased VEGF and increased endostatin protein levels. Thus, P-MAPA immunotherapy could be considered an important therapeutic
Moretto, Roberto; Cremolini, Chiara; Rossini, Daniele; Pietrantonio, Filippo; Battaglin, Francesca; Mennitto, Alessia; Bergamo, Francesca; Loupakis, Fotios; Marmorino, Federica; Berenato, Rosa; Marsico, Valentina Angela; Caporale, Marta; Antoniotti, Carlotta; Masi, Gianluca; Salvatore, Lisa; Borelli, Beatrice; Fontanini, Gabriella; Lonardi, Sara; De Braud, Filippo; Falcone, Alfredo
2016-08-01
Right- and left-sided colorectal cancers (CRCs) differ in clinical and molecular characteristics. Some retrospective analyses suggested that patients with right-sided tumors derive less benefit from anti-epidermal growth factor receptor (EGFR) antibodies; however, molecular selection in those studies was not extensive. Patients with RAS and BRAF wild-type metastatic CRC (mCRC) who were treated with single-agent anti-EGFRs or with cetuximab-irinotecan (if refractory to previous irinotecan) were included in the study. Differences in outcome between patients with right- and left-sided tumors were investigated. Of 75 patients, 14 and 61 had right- and left-sided tumors, respectively. None of the right-sided tumors responded according to RECIST, compared with 24 left-sided tumors (overall response rate: 0% vs. 41%; p = .0032), and only 2 patients with right-sided tumors (15%) versus 47 patients with left-sided tumors (80%) achieved disease control (p < .0001). The median duration of progression-free survival was 2.3 and 6.6 months in patients with right-sided and left-sided tumors, respectively (hazard ratio: 3.97; 95% confidence interval: 2.09-7.53; p < .0001). Patients with right-sided RAS and BRAF wild-type mCRC seemed to derive no benefit from single-agent anti-EGFRs. Right- and left-sided colorectal tumors have peculiar epidemiological and clinicopathological characteristics, distinct gene expression profiles and genetic alterations, and different prognoses. This study assessed the potential predictive impact of primary tumor site with regard to anti-epidermal growth factor receptor (EGFR) monoclonal antibody treatment in patients with RAS and BRAF wild-type metastatic colorectal cancer. The results demonstrated the lack of activity of anti-EGFRs in RAS and BRAF wild-type, right-sided tumors, thus suggesting a potential role for primary tumor location in driving treatment choices. ©AlphaMed Press.
Kalmodia, Sushma; Parameswaran, Sowmya; Ganapathy, Kalaivani; Yang, Wenrong; Barrow, Colin J; Kanwar, Jagat R; Roy, Kislay; Vasudevan, Madavan; Kulkarni, Kirti; Elchuri, Sailaja V; Krishnakumar, Subramanian
2017-12-15
Inhibition of the interaction between p53 and HDM2 is an effective therapeutic strategy in cancers that harbor a wild-type p53 protein such as retinoblastoma (RB). Nanoparticle-based delivery of therapeutic molecules has been shown to be advantageous in localized delivery, including to the eye, by overcoming ocular barriers. In this study, we utilized biocompatible gold nanoparticles (GNPs) to deliver anti-HDM2 peptide to RB cells. Characterization studies suggested that GNP-HDM2 was stable in biologically relevant solvents and had optimal cellular internalization capability, the primary requirement of any therapeutic molecule. GNP-HDM2 treatment in RB cells in vitro suggested that they function by arresting RB cells at the G2M phase of the cell cycle and initiating apoptosis. Analysis of molecular changes in GNP-HDM2-treated cells by qRT-PCR and western blotting revealed that the p53 protein was upregulated; however, transactivation of its downstream targets was minimal, except for the PUMA-BCl2 and Bax axis. Global gene expression and in silico bioinformatic analysis of GNP-HDM2-treated cells suggested that upregulation of p53 might presumptively mediate apoptosis through the induction of p53-inducible miRNAs. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.
2012-01-01
During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738
Erlotinib for Patients with EGFR Wild-Type Metastatic NSCLC: a Retrospective Biomarkers Analysis.
Inno, Alessandro; Di Noia, Vincenzo; Martini, Maurizio; D'Argento, Ettore; Di Salvatore, Mariantonietta; Arena, Vincenzo; Schinzari, Giovanni; Orlandi, Armando; Larocca, Luigi Maria; Cassano, Alessandra; Barone, Carlo
2018-03-20
Erlotinib is approved for the treatment of patients with EGFR mutation positive, metastatic NSCLC. It is also approved as second/third line therapy for EGFR mutation negative patients, but in this setting the benefit of erlotinib is modest and there is no validated biomarker for selecting EGFR wild-type patients who may benefit the most from the treatment. We retrospectively assessed EGFR and K-RAS mutational status, and EGFR, c-MET and IGF1-R expression in tumor samples of 72 patients with metastatic NSCLC treated with erlotinib after at least one prior line of chemotherapy, from 2008 to 2012. We analyzed the association between biomarkers and outcome (RR, PFS, and OS). EGFR mutated patients achieved a better RR (56% vs 8%, p = .002), PFS (10 vs 3 months, HR 0.53, p = 0.48) and OS (20 vs 6 months, HR 0.55, p = .07), compared to EGFR wild-type patients. Among 63 EGFR wild-type patients, those with EGFR high-expression had a better outcome in terms of RR (40% vs 2%, p = .002), PFS (7.5 vs 2 months, HR 0.45, p = .007) and OS (30 vs 5 months, HR 0.34, p < .001) compared to patients with EGFR intermediate or low/negative-expression. IGF1-R expression, c-MET expression and K-RAS mutational status did not significantly affect the outcome; however, no patients with K-RAS mutation or c-MET high-expression achieved an objective response. In patients with metastatic, chemo-refractory EGFR wild-type NSCLC, EGFR high-expression may represent a positive predictor of activity for erlotinib, whereas K-RAS mutation and c-MET high-expression may predict lack of activity. These findings deserve further prospective evaluation.
p73 coordinates with Δ133p53 to promote DNA double-strand break repair.
Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun
2018-03-06
Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.
Eldar, Amir; Rozenberg, Haim; Diskin-Posner, Yael; Rohs, Remo; Shakked, Zippora
2013-01-01
A p53 hot-spot mutation found frequently in human cancer is the replacement of R273 by histidine or cysteine residues resulting in p53 loss of function as a tumor suppressor. These mutants can be reactivated by the incorporation of second-site suppressor mutations. Here, we present high-resolution crystal structures of the p53 core domains of the cancer-related proteins, the rescued proteins and their complexes with DNA. The structures show that inactivation of p53 results from the incapacity of the mutated residues to form stabilizing interactions with the DNA backbone, and that reactivation is achieved through alternative interactions formed by the suppressor mutations. Detailed structural and computational analysis demonstrates that the rescued p53 complexes are not fully restored in terms of DNA structure and its interface with p53. Contrary to our previously studied wild-type (wt) p53-DNA complexes showing non-canonical Hoogsteen A/T base pairs of the DNA helix that lead to local minor-groove narrowing and enhanced electrostatic interactions with p53, the current structures display Watson–Crick base pairs associated with direct or water-mediated hydrogen bonds with p53 at the minor groove. These findings highlight the pivotal role played by R273 residues in supporting the unique geometry of the DNA target and its sequence-specific complex with p53. PMID:23863845
Downregulation of VRK1 by p53 in Response to DNA Damage Is Mediated by the Autophagic Pathway
Valbuena, Alberto; Castro-Obregón, Susana; Lazo, Pedro A.
2011-01-01
Human VRK1 induces a stabilization and accumulation of p53 by specific phosphorylation in Thr18. This p53 accumulation is reversed by its downregulation mediated by Hdm2, requiring a dephosphorylated p53 and therefore also needs the removal of VRK1 as stabilizer. This process requires export of VRK1 to the cytosol and is inhibited by leptomycin B. We have identified that downregulation of VRK1 protein levels requires DRAM expression, a p53-induced gene. DRAM is located in the endosomal-lysosomal compartment. Induction of DNA damage by UV, IR, etoposide and doxorubicin stabilizes p53 and induces DRAM expression, followed by VRK1 downregulation and a reduction in p53 Thr18 phosphorylation. DRAM expression is induced by wild-type p53, but not by common human p53 mutants, R175H, R248W and R273H. Overexpression of DRAM induces VRK1 downregulation and the opposite effect was observed by its knockdown. LC3 and p62 were also downregulated, like VRK1, in response to UV-induced DNA damage. The implication of the autophagic pathway was confirmed by its requirement for Beclin1. We propose a model with a double regulatory loop in response to DNA damage, the accumulated p53 is removed by induction of Hdm2 and degradation in the proteasome, and the p53-stabilizer VRK1 is eliminated by the induction of DRAM that leads to its lysosomal degradation in the autophagic pathway, and thus permitting p53 degradation by Hdm2. This VRK1 downregulation is necessary to modulate the block in cell cycle progression induced by p53 as part of its DNA damage response. PMID:21386980
Carlson, J A; Amin, S; Malfetano, J; Tien, A T; Selkin, B; Hou, J; Goncharuk, V; Wilson, V L; Rohwedder, A; Ambros, R; Ross, J S
2001-06-01
To determine if carcinogenic events in vulvar skin precede the onset of morphologic atypia, the authors investigated for derangements in DNA content, cell proliferation, and cell death in vulvar carcinomas and surrounding skin in 140 samples of tumor and surrounding skin collected from 35 consecutive vulvectomy specimen for squamous cell carcinoma (SCC) or vulvar intraepithelial neoplasia (VIN) 3. Vulvar non-cancer excisions were used as controls. Investigations consisted of histologic classification and measurement of 9 variables--epidermal thickness (acanthosis and rete ridge length), immunolabeling index (LI) for 3 proteins (p53 protein, Ki-67, and mdm-2), pattern of p53 expression (dispersed vs. compact), DNA content index, and presence of aneuploidy by image analysis and apoptotic rate by Apotag labeling. Significant positive correlations were found for all nine variables studied versus increasing histologic severity in two proposed histologic stepwise models of vulvar carcinogenesis (lichen sclerosus (LS) and VIN 3 undifferentiated associated SCC groups). High p53 LI (>25) and the compact pattern of p53 expression (suspected oncoprotein) significantly correlated with LS and its associated vulvar samples compared with samples not associated with LS (P < or = 0.001). Furthermore, p53 LI, mdm-2 LI, and pattern of p53 expression were concordant between patient matched samples of LS and SCC. In addition, mdm-2 LI significantly correlated with dispersed pattern p53 LI suggesting a response to wild-type p53 protein accumulation. These findings support the hypothesis that neoplastic transformation occurs in sequential steps and compromises proteins involved in the cell cycle control. Concordance of p53 and mdm-2 protein expression in LS and adjacent SCC provides evidence that LS can act as a precursor lesion in the absence of morphologic atypia. Overexpression of mdm-2 with stabilization and inactivation of p53 protein may provide an alternate pathway for vulvar
NASA Astrophysics Data System (ADS)
Patil, Sachin P.; Pacitti, Michael F.; Gilroy, Kevin S.; Ruggiero, John C.; Griffin, Jonathan D.; Butera, Joseph J.; Notarfrancesco, Joseph M.; Tran, Shawn; Stoddart, John W.
2015-02-01
The inhibition of tumor suppressor p53 protein due to its direct interaction with oncogenic murine double minute 2 (MDM2) protein, plays a central role in almost 50 % of all human tumor cells. Therefore, pharmacological inhibition of the p53-binding pocket on MDM2, leading to p53 activation, presents an important therapeutic target against these cancers expressing wild-type p53. In this context, the present study utilized an integrated virtual and experimental screening approach to screen a database of approved drugs for potential p53-MDM2 interaction inhibitors. Specifically, using an ensemble rigid-receptor docking approach with four MDM2 protein crystal structures, six drug molecules were identified as possible p53-MDM2 inhibitors. These drug molecules were then subjected to further molecular modeling investigation through flexible-receptor docking followed by Prime/MM-GBSA binding energy analysis. These studies identified fluspirilene, an approved antipsychotic drug, as a top hit with MDM2 binding mode and energy similar to that of a native MDM2 crystal ligand. The molecular dynamics simulations suggested stable binding of fluspirilene to the p53-binding pocket on MDM2 protein. The experimental testing of fluspirilene showed significant growth inhibition of human colon tumor cells in a p53-dependent manner. Fluspirilene also inhibited growth of several other human tumor cell lines in the NCI60 cell line panel. Taken together, these computational and experimental data suggest a potentially novel role of fluspirilene in inhibiting the p53-MDM2 interaction. It is noteworthy here that fluspirilene has a long history of safe human use, thus presenting immediate clinical potential as a cancer therapeutic. Furthermore, fluspirilene could also serve as a structurally-novel lead molecule for the development of more potent, small-molecule p53-MDM2 inhibitors against several types of cancer. Importantly, the combined computational and experimental screening protocol
Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C
2012-06-01
Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.
Cui, Hongmei; Li, Xingyao; Han, Chunhua; Wang, Qi-En; Wang, Hongbo; Ding, Han-Fei; Zhang, Junran; Yan, Chunhong
2016-01-01
The response to UV irradiation is important for a cell to maintain its genetic integrity when challenged by environmental genotoxins. An immediate early response to UV irradiation is the rapid induction of activating transcription factor 3 (ATF3) expression. Although emerging evidence has linked ATF3 to stress pathways regulated by the tumor suppressor p53 and the histone acetyltransferase Tip60, the role of ATF3 in the UV response remains largely unclear. Here, we report that ATF3 mediated dichotomous UV responses. Although UV irradiation enhanced the binding of ATF3 to Tip60, knockdown of ATF3 expression decreased Tip60 stability, thereby impairing Tip60 induction by UV irradiation. In line with the role of Tip60 in mediating UV-induced apoptosis, ATF3 promoted the death of p53-defective cells in response to UV irradiation. However, ATF3 could also activate p53 and promote p53-mediated DNA repair, mainly through altering histone modifications that could facilitate recruitment of DNA repair proteins (such as DDB2) to damaged DNA sites. As a result, ATF3 rather protected the p53 wild-type cells from UV-induced apoptosis. Our results thus indicate that ATF3 regulates cell fates upon UV irradiation in a p53-dependent manner. PMID:26994140
Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C
2014-01-01
In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616
Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang
2017-11-03
Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping
Hoang, Kimson; Ankney, John A.; Nguyen, Stephanie T.; Rushing, Amanda W.; Polakowski, Nicholas; Miotto, Benoit; Lemasson, Isabelle
2016-01-01
Adult T-cell leukemia (ATL) is an often fatal malignancy caused by infection with the complex retrovirus, human T-cell Leukemia Virus, type 1 (HTLV-1). In ATL patient samples, the tumor suppressor, p53, is infrequently mutated; however, it has been shown to be inactivated by the viral protein, Tax. Here, we show that another HTLV-1 protein, HBZ, represses p53 activity. In HCT116 p53+/+ cells treated with the DNA-damaging agent, etoposide, HBZ reduced p53-mediated activation of p21/CDKN1A and GADD45A expression, which was associated with a delay in G2 phase-arrest. These effects were attributed to direct inhibition of the histone acetyltransferase (HAT) activity of p300/CBP by HBZ, causing a reduction in p53 acetylation, which has be linked to decreased p53 activity. In addition, HBZ bound to, and inhibited the HAT activity of HBO1. Although HBO1 did not acetylate p53, it acted as a coactivator for p53 at the p21/CDKN1A promoter. Therefore, through interactions with two separate HAT proteins, HBZ impairs the ability of p53 to activate transcription. This mechanism may explain how p53 activity is restricted in ATL cells that do not express Tax due to modifications of the HTLV-1 provirus, which accounts for a majority of patient samples. PMID:26625199
Warenius, H M; Jones, M; Gorman, T; McLeish, R; Seabra, L; Barraclough, R; Rudland, P
2000-01-01
The tumour suppressor gene, p53, and genes coding for positive signal transduction factors can influence transit through cell-cycle checkpoints and modulate radiosensitivity. Here we examine the effects of RAF1 protein on the rate of exit from a G2/M block induced by γ-irradiation in relation to intrinsic cellular radiosensitivity in human cell lines expressing wild-type p53 (wtp53) protein as compared to mutant p53 (mutp53) protein. Cell lines which expressed mutp53 protein were all relatively radioresistant and exhibited no relationship between RAF1 protein and cellular radiosensitivity. Cell lines expressing wtp53 protein, however, showed a strong relationship between RAF1 protein levels and the radiosensitivity parameter SF2. In addition, when post-irradiation perturbation of G2/M transit was compared using the parameter T50 (time after the peak of G2/M delay at which 50% of the cells had exited from a block induced by 2 Gy of irradiation), RAF1 was related to T50 in wtp53, but not mutp53, cell lines. Cell lines which expressed wtp53 protein and high levels of RAF1 had shorter T50s and were also more radiosensitive. These results suggest a cooperative role for wtp53 and RAF1 protein in determining cellular radiosensitivity in human cells, which involves control of the G2/M checkpoint. © 2000 Cancer Research Campaign PMID:10993658
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena
2016-01-01
p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407
Lee, Kheun Byeol; Kim, Kye-Ryung; Huh, Tae-Lin; Lee, You Mie
2008-12-01
Tumor hypoxia is a main obstacle for radiation therapy. To investigate whether exposure to a proton beam can overcome radioresistance in hypoxic tumor cells, three kinds of cancer cells, Lewis lung carcinoma (LLC) cells, hepatoma HepG2 and Molt-4 leukemia cells, were treated with a proton beam (35 MeV, 1, 2, 5, 10 Gy) in the presence or absence of hypoxia. Cell death rates were determined 72 h after irradiation. Hypoxic cells exposed to the proton beam underwent a typical apoptotic program, showing condensed nuclei, fragmented DNA ladders, and poly-ADP-ribose polymerase (PARP) cleavage. Fluorescence-activated cell sorter analysis revealed a significant increase in Annexin-V-positive cells. Cells treated with the proton beam and hypoxia displayed increased expression of p53, p21 and Bax, but decreased levels of phospho-Rb, Bcl-2 and XIAP, as well as activated caspase-9 and -3. The proton beam with hypoxia induced cell death in wild-type HCT116 cells, but not in a p53 knockout cell line, demonstrating a requirement for p53. As reactive oxygen species (ROS) were also significantly increased, apoptosis could also be abolished by treatment with the anti-oxidant N-acetyl cysteine (NAC). P38 mitogen-activated protein kinase (MAPK) and c-Jun N-terminal kinase (JNK) were activated by the treatment, and their respective DN mutants restored the cell death induced by either proton therapy alone or with hypoxia. In conclusion, proton beam treatment did not differently regulate cancer cell apoptosis either in normoxic or hypoxic conditions via a p53-dependent mechanism and by the activation of p38/JNK MAPK pathways through ROS.
The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential
Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre
2015-01-01
Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205
Vuong, Linda; Brobst, Daniel E.; Saadi, Anisse; Ivanovic, Ivana; Al-Ubaidi, Muayyad R.
2012-01-01
Purpose. Because of its role in cell cycle regulation and apoptosis, p53 may be involved in maintaining the post-mitotic state of the adult eye. To shed light on the role of p53 in retinal development and maintenance, this study investigated the pattern of expression of p53, its family members, and its regulators during the development of the mouse eye. Methods. Relative quantitative real-time PCR (qRT-PCR) was used to determine the steady-state levels of target transcripts in RNA extracted from wild-type mouse whole eyes or retinas between embryonic day (E) 15 and post-natal day (P) 30. Immunoblotting was used to compare the steady-state levels of the protein to that of the transcript. Results. Transcript and protein levels for p53 in the eye were highest at E17 and E18, respectively. However, both p53 transcript and protein levels dropped precipitously thereafter, and no protein was detected on immunoblots after P3. Expression patterns of p63, p73, Mdm2, Mdm4, and Yy1 did not follow that of p53. Immunohistochemistry analysis of the developing eye showed that both p53 and Mdm2 are abundantly expressed at E18 in all layers of the retinal neuroblast. Conclusions. Downregulation of p53 in the post-mitotic retina suggests that, although p53 may be involved in ocular and retinal development, it may play a minimal role in healthy adult retinal function. PMID:22714890
FBXW7-mutated colorectal cancer cells exhibit aberrant expression of phosphorylated-p53 at Serine-15
Normatova, Makhliyo; Babaei-Jadidi, Roya; Tomlinson, Ian; Nateri, Abdolrahman S.
2015-01-01
FBXW7 mutations occur in a variety of human cancers including colorectal cancer (CRC). Elucidating its mechanism of action has become crucial for cancer therapy; however, it is also complicated by the fact that FBXW7 can influence many pathways due to its role as an E3-ubiquitin ligase in proteasome degradation. FBXW7 and TP53 are tumour suppressors intensively implicated in colorectal carcinogenesis. Deletion mutations in these two genes in animal models mark the progression from adenoma to carcinoma. Although still largely unknown, the last defense mechanism against CRC at the molecular level could be through a synergistic effect of the two genes. The underlying mechanism requires further investigation. In our laboratory, we have used a phospho-kinase profiler array to illustrate a potential molecular link between FBXW7 and p53 in CRC cells. In vitro and in vivo assessments demonstrated aberrant induction of phosphorylated p53 at Serine 15 [phospho-p53(Ser15)] in human FBXW7-deficient CRC cells as compared to their FBXW7-wild-type counterparts. FBXW7 loss in HCT116 cells promoted resistance to oxaliplatin. Immunoblotting data further confirmed that reduction of phospho-p53(Ser15) may contribute to the decreased efficacy of therapy in FBXW7-mutated CRC cells. The findings may suggest the applicability of phospho-p53(Ser15) as an indicative marker of FBXW7-mutations. Phospho-p53(Ser15) regulation by FBXW7 E3-ligase activity could provide important clues for understanding FBXW7 behavior in tumour progression and grounds for its clinical applicability thereafter. PMID:25860929
Sundin, Andrew; Grzywacz, Bartosz J; Yohe, Sophia; Linden, Michael A; Courville, Elizabeth L
2017-03-01
In this retrospective study from one institution, we performed a clinicopathological study of a cohort of patients with posttransplant lymphoproliferative disorder (PTLD) confined to the central nervous system. We also identified a comparison cohort of patients with de novo primary diffuse large B-cell lymphoma of the central nervous system. We performed a detailed morphologic review, evaluated Epstein-Barr virus (EBV) by in situ hybridization, and interpreted a panel of immunohistochemical stains in a subset of cases including Hans classification markers (CD10, BCL6, MUM1), p53, CD30, Myc, and BCL2. All 17 of the posttransplant and none of 11 de novo cases were EBV positive (P < .005). Morphologic patterns identified in the PTLD cases were monomorphic diffuse large B-cell lymphoma pattern (10 patients) and "T-cell-rich" pattern (7 patients). The monomorphic posttransplant cases were more likely to be Myc negative (P = .015) and CD30 positive (P < .005) than the de novo cases, and showed a similarly low rate of p53 positivity by immunohistochemistry. No prognostic factors for overall survival were identified. Central nervous system PTLD is EBV positive, typically lacks p53 and Myc expression by immunohistochemistry, and can present with numerous background T lymphocytes. Copyright © 2016 Elsevier Inc. All rights reserved.
Jabbur, James R; Tabor, Amy D; Cheng, Xiaodong; Wang, Hua; Uesugi, Motonari; Lozano, Guillermina; Zhang, Wei
2002-10-10
Analyses of five wild-type p53 containing cell lines revealed lineage specific differences in phosphorylation of Thr18 after treatment with ionizing (IR) or ultraviolet (UV) radiation. Importantly, Thr18 phosphorylation correlated with induction of the p53 downstream targets p21(Waf1/Cip1) (p21) and Mdm-2, suggesting a transactivation enhancing role. Thr18 phosphorylation has been shown to abolish side-chain hydrogen bonding between Thr18 and Asp21, an interaction necessary for stabilizing alpha-helical conformation within the transactivation domain. Mutagenesis-derived hydrogen bond disruption attenuated the interaction of p53 with the transactivation repressor Mdm-2 but had no direct effect on the interaction of p53 with the basal transcription factor TAF(II)31. However, prior incubation of p53 mutants with Mdm-2 modulated TAF(II)31 interaction with p53, suggesting Mdm-2 blocks the accessibility of p53 to TAF(II)31. Consistently, p53-null cells transfected with hydrogen bond disrupting p53 mutants demonstrated enhanced endogenous p21 expression, whereas p53/Mdm-2-double null cells exhibited no discernible differences in p21 expression. We conclude disruption of intramolecular hydrogen bonding between Thr18 and Asp21 enhances p53 transactivation by modulating Mdm-2 binding, facilitating TAF(II)31 recruitment.
Hardcastle, Ian R; Liu, Junfeng; Valeur, Eric; Watson, Anna; Ahmed, Shafiq U; Blackburn, Timothy J; Bennaceur, Karim; Clegg, William; Drummond, Catherine; Endicott, Jane A; Golding, Bernard T; Griffin, Roger J; Gruber, Jan; Haggerty, Karen; Harrington, Ross W; Hutton, Claire; Kemp, Stuart; Lu, Xiaohong; McDonnell, James M; Newell, David R; Noble, Martin E M; Payne, Sara L; Revill, Charlotte H; Riedinger, Christiane; Xu, Qing; Lunec, John
2011-03-10
Inhibition of the MDM2-p53 interaction has been shown to produce an antitumor effect, especially in MDM2 amplified tumors. The isoindolinone scaffold has proved to be versatile for the discovery of MDM2-p53 antagonists. Optimization of previously reported inhibitors, for example, NU8231 (7) and NU8165 (49), was guided by MDM2 NMR titrations, which indicated key areas of the binding interaction to be explored. Variation of the 2-N-benzyl and 3-alkoxy substituents resulted in the identification of 3-(4-chlorophenyl)-3-((1-(hydroxymethyl)cyclopropyl)methoxy)-2-(4-nitrobenzyl)isoindolin-1-one (74) as a potent MDM2-p53 inhibitor (IC(50) = 0.23 ± 0.01 μM). Resolution of the enantiomers of 74 showed that potent MDM2-p53 activity primarily resided with the (+)-R-enantiomer (74a; IC(50) = 0.17 ± 0.02 μM). The cellular activity of key compounds has been examined in cell lines with defined p53 and MDM2 status. Compound 74a activates p53, MDM2, and p21 transcription in MDM2 amplified cells and shows moderate selectivity for wild-type p53 cell lines in growth inhibition assays.
Kassed, C A; Willing, A E; Garbuzova-Davis, S; Sanberg, P R; Pennypacker, K R
2002-08-01
The roles of activated NF-kappaB subunits in the CNS remain to be discerned. Members of this family of transcription factors are essential to diverse physiological processes and can be activated by pathogens, stress, pharmacological agents, and trauma. We are particularly interested in long-term NF-kappaB activation and its involvement in neuroplastic changes in the brain resulting from acquisition of memory as well as injury. Here, we use lesioning by the limbic-specific neurotoxicant trimethyltin (TMT) as a model in which to examine activation of the NF-kappaB p50 subunit before, during, and after neuronal degeneration. Neurons in wild-type mice that survived TMT-induced injury contained activated p50 and did not label with Fluoro-Jade, a histochemical marker of degenerating neurons. Granule cells of the wild-type dentate gyrus subregion, an area particularly vulnerable to TMT-induced degeneration, contained less activated p50 protein than CA regions. We compared the extent of degeneration in wild-type and p50-null mice and found a fivefold increase in death of hippocampal neurons in mice lacking p50. The hippocampus is key to processes of learning and memory, and NF-kappaB has reported involvement in these processes. The enhanced hippocampal degeneration in p50-null mice prompted us to evaluate their basal learning abilities, and we discovered that difficulties in task acquisition were an additional consequence of p50 ablation. These results indicate that absence of p50 negatively modulates learning ability as well as hippocampal responsiveness to brain injury after a chemical-induced lesion.
Nayak, G; Cooper, G M
2012-10-11
The phosphatidylinositol (PI) 3-kinase/Akt signaling pathway has a prominent role in cell survival and proliferation, in part, by regulating gene expression at the transcriptional level. Previous work using global expression profiling identified FOXOs and the E-box-binding transcription factors MITF and USF1 as key targets of PI 3-kinase signaling that lead to the induction of proapoptotic and cell cycle arrest genes in response to inhibition of PI 3-kinase. In this study, we investigated the role of p53 downstream of PI 3-kinase signaling by analyzing the effects of inhibition of PI 3-kinase in Rat-1 cells, which have wild-type p53, compared with Rat-1 cells expressing a dominant-negative p53 mutant. Expression of dominant-negative p53 conferred partial resistance to apoptosis induced by inhibition of PI 3-kinase. Global gene expression profiling combined with computational and experimental analysis of transcription factor binding sites demonstrated that p53, along with FOXO, MITF and USF1, contributed to gene induction in response to PI 3-kinase inhibition. Activation of p53 was mediated by phosphorylation of the histone acetyltransferase Tip60 by glycogen synthase kinase (GSK) 3, leading to activation of p53 by acetylation. Many of the genes targeted by p53 were also targeted by FOXO and E-box-binding transcription factors, indicating that p53 functions coordinately with these factors to regulate gene expression downstream of PI 3-kinase/Akt/GSK3 signaling.
Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.
Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi
2003-04-01
Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.
Acentriolar mitosis activates a p53-dependent apoptosis pathway in the mouse embryo
Bazzi, Hisham; Anderson, Kathryn V.
2014-01-01
Centrosomes are the microtubule-organizing centers of animal cells that organize interphase microtubules and mitotic spindles. Centrioles are the microtubule-based structures that organize centrosomes, and a defined set of proteins, including spindle assembly defective-4 (SAS4) (CPAP/CENPJ), is required for centriole biogenesis. The biological functions of centrioles and centrosomes vary among animals, and the functions of mammalian centrosomes have not been genetically defined. Here we use a null mutation in mouse Sas4 to define the cellular and developmental functions of mammalian centrioles in vivo. Sas4-null embryos lack centrosomes but survive until midgestation. As expected, Sas4−/− mutants lack primary cilia and therefore cannot respond to Hedgehog signals, but other developmental signaling pathways are normal in the mutants. Unlike mutants that lack cilia, Sas4−/− embryos show widespread apoptosis associated with global elevated expression of p53. Cell death is rescued in Sas4−/− p53−/− double-mutant embryos, demonstrating that mammalian centrioles prevent activation of a p53-dependent apoptotic pathway. Expression of p53 is not activated by abnormalities in bipolar spindle organization, chromosome segregation, cell-cycle profile, or DNA damage response, which are normal in Sas4−/− mutants. Instead, live imaging shows that the duration of prometaphase is prolonged in the mutants while two acentriolar spindle poles are assembled. Independent experiments show that prolonging spindle assembly is sufficient to trigger p53-dependent apoptosis. We conclude that a short delay in the prometaphase caused by the absence of centrioles activates a previously undescribed p53-dependent cell death pathway in the rapidly dividing cells of the mouse embryo. PMID:24706806
p53 mediates bcl-2 phosphorylation and apoptosis via activation of the Cdc42/JNK1 pathway.
Thomas, A; Giesler, T; White, E
2000-11-02
A member of the small G protein family, cdc42, was isolated from a screen undertaken to identify p53-inducible genes during apoptosis in primary baby rat kidney (BRK) cells transformed with E1A and a temperature-sensitive mutant p53 using a PCR-based subtractive hybridization method. Cdc42 is a GTPase that belongs to the Rho/Rac subfamily of Ras-like GTPases. In response to external stimuli, Cdc42 is known to transduce signals to regulate the organization of the actin cytoskeleton, induce DNA synthesis in quiescent fibroblasts, and promote apoptosis in neuronal and immune cells. In this study, we have demonstrated that cdc42 mRNA and protein were up-regulated in the presence of wild-type p53 in BRK cells, followed by cytoplasmic to plasma membrane translocation of Cdc42. Overexpression of Cdc42 in the presence of a dominant-negative mutant p53 induced apoptosis rapidly, indicating that Cdc42 functions downstream of p53. Furthermore, stable expression of a dominant-negative mutant of Cdc42 partially inhibited p53-mediated apoptosis. The Bcl-2 family members Bcl-xL, and the adenovirus protein E1B 19K, inhibited Cdc42-mediated apoptosis, whereas Bcl-2 did not. We provide evidence that PAK1 and JNK1 may play a role downstream of Cdc42 to transduce its apoptotic signal. Cdc42/PAK1 activates JNK1-induced phosphorylation of Bcl-2, thereby inactivating its function, and that a phosphorylation resistant mutant (Bcl-2S70,87A,T56,74A) gains the ability to inhibit Cdc42- and p53-mediated apoptosis. Thus, one mechanism by which p53 promotes apoptosis is through activation of Cdc42 and inactivation of Bcl-2.
Iskander, Karim; Barrios, Roberto J.; Jaiswal, Anil K.
2008-01-01
NAD(P)H:quinone oxidoreductase1-null (NQO1-/-) mice exposed to 3 grays of γ-radiation demonstrated an increase in neutrophils, bone marrow hypercellularity, and enlarged lymph nodes and spleen. The spleen showed disrupted follicular structure, loss of red pulp, and granulocyte and megakarocyte invasion. Blood and histological analysis did not show any sign of infection in mice. These results suggested that exposure of NQO1-/- mice to γ-radiation led to myeloproliferative disease. Radiation-induced myeloproliferative disease was observed in 74% of NQO1-/- mice as compared to none in wild type mice. NQO1-/- mice exposed to γ-radiation also demonstrated tissues lymphoma (32%) and lung adenocarcinoma (84%). In contrast, only 11% wild type mice showed lymphoma and none showed lung adenocarcinoma. Exposure of NQO1-/- mice to γ-radiation resulted in reduced apoptosis in granulocytes and lack of induction of p53, p21, and Bax. NQO1-/- mice also demonstrated increased expression of myeloid differentiation factors C/EBPα and Pu.1. Intriguingly, exposure of NQO1-/- mice to γ-radiation failed to induce C/EBPα and Pu.1, as was observed in wild type mice. These results suggest that decreased p53/apoptosis and increased Pu.1 and C/EBPα led to myeloid hyperplasia in NQO1-/- mice. The lack of induction of apoptosis and differentiation contributed to radiation-induced myeloproliferative disease in NQO1-/- mice. PMID:18829548
Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G
2011-01-01
Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 – HdmX and Wip1, leading to efficient elimination of tumour cells. PMID:21546907
Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G
2011-11-01
Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 - HdmX and Wip1, leading to efficient elimination of tumour cells.
Firat, Elke; Tsurumi, Chizuko; Gaedicke, Simone; Huai, Jisen; Niedermann, Gabriele
2009-04-15
The giant cytosolic protease tripeptidyl peptidase II (TPPII) was recently proposed to play a role in the DNA damage response. Shown were nuclear translocation of TPPII after gamma-irradiation, lack of radiation-induced p53 stabilization in TPPII-siRNA-treated cells, and complete tumor regression in mice after gamma-irradiation when combined with TPPII-siRNA silencing or a protease inhibitor reported to inhibit TPPII. This suggested that TPPII could be a novel target for tumor radiosensitization and prompted us to study radiation responses using TPPII-knockout mice. Neither the sensitivity to total body irradiation nor the radiosensitivity of resting lymphoid cells, which both strongly depend on p53, was altered in the absence of TPPII. Functional integrity of p53 in TPPII-knockout cells is further shown by a proper G(1) arrest and by the accumulation of p53 and its transcriptional targets, p21, Bax, and Fas, on gamma-irradiation. Furthermore, we could not confirm radiation-induced nuclear translocation of TPPII. Nevertheless, after gamma-irradiation, we found slightly increased mitotic catastrophe of TPPII-deficient primary fibroblasts and increased apoptosis of TPPII-deficient activated CD8(+) T cells. The latter was accompanied by delayed resolution of the DNA double-strand break marker gammaH2AX. This could, however, be due to increased apoptotic DNA damage rather than reduced DNA damage repair. Our data do not confirm a role for TPPII in the DNA damage response based on nuclear TPPII translocation and p53 stabilization but nevertheless do show increased radiation-induced cell death of selected nontransformed cell types in the absence of the TPPII protease.
REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO
XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.
2015-01-01
The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a
2014-01-01
Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be
Rosiglitazone enhances the radiosensitivity of p53-mutant HT-29 human colorectal cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chiu, Shu-Jun, E-mail: chiusj@mail.tcu.edu.tw; Institute of Radiation Sciences, Tzu Chi Technology College, Hualien, Taiwan; Hsaio, Ching-Hui
2010-04-09
Combined-modality treatment has improved the outcome in cases of various solid tumors, and radiosensitizers are used to enhance the radiotherapeutic efficiency. Rosiglitazone, a synthetic ligand of peroxisome proliferator-activated receptors {gamma} used in the treatment of type-2 diabetes, has been shown to reduce tumor growth and metastasis in human cancer cells, and may have the potential to be used as a radiosensitizer in radiotherapy for human colorectal cancer cells. In this study, rosiglitazone treatment significantly reduced the cell viability of p53-wild type HCT116 cells but not p53-mutant HT-29 cells. Interestingly, rosiglitazone pretreatment enhanced radiosensitivity in p53-mutant HT-29 cells but not HCT116more » cells, and prolonged radiation-induced G{sub 2}/M arrest and enhanced radiation-induced cell growth inhibition in HT-29 cells. Pretreatment with rosiglitazone also suppressed radiation-induced H2AX phosphorylation in response to DNA damage and AKT activation for cell survival; on the contrary, rosiglitazone pretreatment enhanced radiation-induced caspase-8, -9, and -3 activation and PARP cleavage in HT-29 cells. In addition, pretreatment with a pan-caspase inhibitor, zVAD-fmk, attenuated the levels of caspase-3 activation and PARP cleavage in radiation-exposed cancer cells in combination with rosiglitazone pretreatment. Our results provide proof for the first time that rosiglitazone suppresses radiation-induced survival signals and DNA damage response, and enhances the radiation-induced apoptosis signaling cascade. These findings can assist in the development of rosiglitazone as a novel radiosensitizer.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leão, Mariana; Gomes, Sara; Bessa, Cláudia
In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either permore » se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.« less
Tu, Chao; Tan, Yu-Hong; Shaw, Gary; Zhou, Zheng; Bai, Yawen; Luo, Ray; Ji, Xinhua
2008-01-01
Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53. PMID:18453682
β-Catenin C-terminal signals suppress p53 and are essential for artery formation
Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.
2016-01-01
Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244
Burns, J. E.; Baird, M. C.; Clark, L. J.; Burns, P. A.; Edington, K.; Chapman, C.; Mitchell, R.; Robertson, G.; Soutar, D.; Parkinson, E. K.
1993-01-01
Using immunocytochemical and Western blotting techniques we have demonstrated the presence of abnormally high levels of p53 protein in 8/24 (33%) of human squamous cell carcinomas (SCC) and 9/18 (50%) of SCC cell lines. There was a correlation between the immunocytochemical results obtained with eight SCC samples and their corresponding cell lines. Direct sequencing of PCR-amplified, reverse transcribed, p53 mRNA confirmed the expression of point mutations in six of the positive cell lines and detected in-frame deletions in two others. We also detected two stop mutations and three out-of-frame deletions in five lines which did not express elevated levels of p53 protein. Several of the mutations found in SCC of the tongue (3/7) were in a region (codons 144-166) previously identified as being a p53 mutational hot spot in non-small cell lung tumours (Mitsudomi et al., 1992). In 11/13 cases only the mutant alleles were expressed suggesting loss or reduced expression of the wild type alleles in these cases. Six of the mutations were also detected in the SCCs from which the lines were derived, strongly suggesting that the mutations occurred, and were selected, in vivo. The 12th mutation GTG-->GGG (valine-->glycine) at codon 216 was expressed in line SCC-12 clone B along with an apparently normal p53 allele and is to our knowledge a novel mutation. Line BICR-19 also expressed a normal p53 allele in addition to one where exon 10 was deleted. Additionally 15 of the SCC lines (including all of those which did not show elevated p53 protein levels) were screened for the presence of human papillomavirus types 16 and 18 and were found to be negative. These results are discussed in relation to the pathogenesis of SCC and the immortalisation of human keratinocytes in vitro. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:8390283
Roles of HAUSP-mediated p53 regulation in central nervous system development.
Kon, N; Zhong, J; Kobayashi, Y; Li, M; Szabolcs, M; Ludwig, T; Canoll, P D; Gu, W
2011-08-01
The deubiquitinase HAUSP (herpesvirus-associated ubiquitin-specific protease; also called USP7) has a critical role in regulating the p53-Mdm2 (murine double minute 2) pathway. By using the conventional knockout approach, we previously showed that hausp inactivation leads to early embryonic lethality. To fully understand the physiological functions of hausp, we have generated mice lacking hausp specifically in the brain and examined the impacts of this manipulation on brain development. We found that deletion of hausp in neural cells resulted in neonatal lethality. The brains from these mice displayed hypoplasia and deficiencies in development, which were mainly caused by p53-mediated apoptosis. Detailed analysis also showed an increase of both p53 levels and p53-dependent transcriptional activation in hausp knockout brains. Notably, neural cell survival and brain development of hausp-mutant mice can largely be restored in the p53-null background. Nevertheless, in contrast to the case of mdm2- and mdm4 (murine double minute 4)-mutant mice, inactivation of p53 failed to completely rescue the neonatal lethality of these hausp-mutant mice. These results indicate that HAUSP-mediated p53 regulation is crucial for brain development, and also suggest that both the p53-dependent and the p53-independent functions of HAUSP contribute to the neonatal lethality of hausp-mutant mice.
Adenovirus-mediated p53 gene delivery inhibits 9L glioma growth in rats.
Badie, B; Drazan, K E; Kramar, M H; Shaked, A; Black, K L
1995-06-01
Adenoviral vectors have recently been shown to effectively deliver genes into a variety of tissues. Since these vectors have some advantages over the more extensively investigated retroviruses, we studied the effect of two replication-defective adenovectors bearing human wild type tumor suppressor gene p53 (Adp53) and Escherichia coli beta-galactosidase gene (AdLacZ) on 9L glioma cells. Successful in vitro gene transfer was shown by DNA polymerase chain reaction (PCR), and expression was confirmed by reverse transcriptase RNA PCR and Western blot analyses. Transduction of 9L cells with the Adp53 inhibited cell growth and induced phenotypic changes consistent with cell death at low titers, while AdLacZ caused cytopathic changes only at high titers. Stereotactic injection of AdLacZ (10(7) plaque forming units) into tumor bed stained 25 to 30% of tumor cells at the site of vector delivery. Injection of Adp53 (10(7) plaque forming units), but not AdLacZ (controls), into established 4-day old 9L glioma brain tumors decreased tumor volume by 40% after 14 days. As a step toward gene therapy of brain tumors using replication-defective adenoviruses, these data support the use of tumor suppressor gene transfer for in vivo treatment of whole animal brain tumor models.
p53-repressed miRNAs are involved with E2F in a feed-forward loop promoting proliferation
Brosh, Ran; Shalgi, Reut; Liran, Atar; Landan, Gilad; Korotayev, Katya; Nguyen, Giang Huong; Enerly, Espen; Johnsen, Hilde; Buganim, Yosef; Solomon, Hilla; Goldstein, Ido; Madar, Shalom; Goldfinger, Naomi; Børresen-Dale, Anne-Lise; Ginsberg, Doron; Harris, Curtis C; Pilpel, Yitzhak; Oren, Moshe; Rotter, Varda
2008-01-01
Normal cell growth is governed by a complicated biological system, featuring multiple levels of control, often deregulated in cancers. The role of microRNAs (miRNAs) in the control of gene expression is now increasingly appreciated, yet their involvement in controlling cell proliferation is still not well understood. Here we investigated the mammalian cell proliferation control network consisting of transcriptional regulators, E2F and p53, their targets and a family of 15 miRNAs. Indicative of their significance, expression of these miRNAs is downregulated in senescent cells and in breast cancers harboring wild-type p53. These miRNAs are repressed by p53 in an E2F1-mediated manner. Furthermore, we show that these miRNAs silence antiproliferative genes, which themselves are E2F1 targets. Thus, miRNAs and transcriptional regulators appear to cooperate in the framework of a multi-gene transcriptional and post-transcriptional feed-forward loop. Finally, we show that, similarly to p53 inactivation, overexpression of representative miRNAs promotes proliferation and delays senescence, manifesting the detrimental phenotypic consequence of perturbations in this circuit. Taken together, these findings position miRNAs as novel key players in the mammalian cellular proliferation network. PMID:19034270
Expression of p53, p21 and cyclin D1 in penile cancer: p53 predicts poor prognosis.
Gunia, Sven; Kakies, Christoph; Erbersdobler, Andreas; Hakenberg, Oliver W; Koch, Stefan; May, Matthias
2012-03-01
To evaluate the role of p53, p21 and cyclin D1 expression in patients with penile cancer (PC). Paraffin-embedded tissues from PC specimens from six pathology departments were subjected to a central histopathological review performed by one pathologist. The tissue microarray technique was used for immunostaining which was evaluated by two independent pathologists and correlated with cancer-specific survival (CSS). κ-statistics were used to assess interobserver variability. Uni- and multivariable Cox proportional hazards analysis was applied to assess the independent effects of several prognostic factors on CSS over a median of 32 months (IQR 6-66 months). Specimens and clinical data from 110 men treated surgically for primary PC were collected. p53 staining was positive in 30 and negative in 62 specimens. κ-statistics showed substantial interobserver reproducibility of p53 staining evaluation (κ=0.73; p<0.001). The 5-year CSS rate for the entire study cohort was 74%. Five-year CSS was 84% in p53-negative and 51% in p53-positive PC patients (p=0.003). Multivariable analysis showed p53 (HR=3.20; p=0.041) and pT-stage (HR=4.29; p<0.001) as independent significant prognostic factors for CSS. Cyclin D1 and p21 expression were not correlated with survival. However, incorporating p21 into a multivariable Cox model did contribute to improved model quality for predicting CSS. In patients with PC, the expression of p53 in the primary tumour specimen can be reproducibly assessed and is negatively associated with cancer specific survival.
Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53
Ogasawara, Marcia A.; Liu, Jinyun; Pelicano, Helene; Hammoudi, Naima; Croce, Carlo M.; Keating, Michael J.; Huang, Peng
2016-01-01
Deletion of chromosome 17p with a loss of p53 is an unfavorable cytogenetic change in chronic lymphocytic leukemia (CLL) with poor clinical outcome. Since p53 affects mitochondrial function and integrity, we examined possible mitochondrial changes in CLL mice with TCL1-Tg/p53−/− and TCL1-Tg/p53+/+ genotypes and in primary leukemia cells from CLL patients with or without 17p-deletion. Although the expression of mitochondrial COX1, ND2, and ND6 decreased in p53−/−CLL cells, there was an increase in mitochondrial biogenesis as evidenced by higher mitochondrial mass and mtDNA copy number associated with an elevated expression of TFAM and PGC-1α. Surprisingly, the overall mitochondrial respiratory activity and maximum reserved capacity increased in p53−/− CLL cells. Our study suggests that leukemia cells lacking p53 seem able to maintain respiratory function by compensatory increase in mitochondrial biogenesis. PMID:27650502
Functional characterization of p53 pathway components in the ancient metazoan Trichoplax adhaerens
NASA Astrophysics Data System (ADS)
Siau, Jia Wei; Coffill, Cynthia R.; Zhang, Weiyun Villien; Tan, Yaw Sing; Hundt, Juliane; Lane, David; Verma, Chandra; Ghadessy, Farid
2016-09-01
The identification of genes encoding a p53 family member and an Mdm2 ortholog in the ancient placozoan Trichoplax adhaerens advocates for the evolutionary conservation of a pivotal stress-response pathway observed in all higher eukaryotes. Here, we recapitulate several key functionalities ascribed to this known interacting protein pair by analysis of the placozoan proteins (Tap53 and TaMdm2) using both in vitro and cellular assays. In addition to interacting with each other, the Tap53 and TaMdm2 proteins are also able to respectively bind human Mdm2 and p53, providing strong evidence for functional conservation. The key p53-degrading function of Mdm2 is also conserved in TaMdm2. Tap53 retained DNA binding associated with p53 transcription activation function. However, it lacked transactivation function in reporter genes assays using a heterologous cell line, suggesting a cofactor incompatibility. Overall, the data supports functional roles for TaMdm2 and Tap53, and further defines the p53 pathway as an evolutionary conserved fulcrum mediating cellular response to stress.
da Mota, Mariana F; Cortez, Alane P; Benfica, Polyana L; Rodrigues, Bruna Dos S; Castro, Thalyta F; Macedo, Larissa M; Castro, Carlos H; Lião, Luciano M; de Carvalho, Flávio S; Romeiro, Luiz A S; Menegatti, Ricardo; Verli, Hugo; Villavicencio, Bianca; Valadares, Marize C
2016-09-01
The activation of the p53 pathway through the inhibition of MDM2 has been proposed as a novel therapeutic strategy against tumours. A series of cis-imidazoline analogues, termed nutlins, were reported to displace the recombinant p53 protein from its complex with MDM2 by binding to MDM2 in the p53 pocket, and exhibited an antitumour activity both in vitro and in vivo. Thus, the purpose of this study was to evaluate the antitumour properties of LQFM030 (2), a nutlin analogue created by employing the strategy of molecular simplification. LQFM030 (2) cytotoxicity was evaluated in Ehrlich ascites tumour (EAT) cells, p53 wild type, by the trypan blue exclusion test, and the mechanisms involved in EAT cell death were investigated by light and fluorescence microscopy, flow cytometry, real-time PCR and Western blotting. Our results demonstrate that LQFM030 has dose-dependent antiproliferative activity and cytotoxic activity on EAT cells, induces the accumulation of p53 protein and promotes cell cycle arrest and apoptosis. p53 gene transcription was unaffected by LQFM030 (2); however, MDM2 mRNA increased and MDM2 protein decreased. These results suggest that the small-molecule p53 activator LQFM030 (2) has the potential for further development as a novel cancer therapeutic agent. © 2016 Royal Pharmaceutical Society.
Mao, Jiahui; Liang, Zhaofeng; Zhang, Bin; Yang, Huan; Li, Xia; Fu, Hailong; Zhang, Xu; Yan, Yongmin; Xu, Wenrong; Qian, Hui
2017-11-01
The deficiency or mutation of p53 has been linked to several types of cancers. The mesenchymal stem cell (MSC) is an important component in the tumor microenvironment, and exosomes secreted by MSCs can transfer bioactive molecules, including proteins and nucleic acid, to other cells in the tumor microenvironment to influence the progress of a tumor. However, whether the state of p53 in MSCs can impact the bioactive molecule secretion of exosomes to promote cancer progression and the regulatory mechanism remains elusive. Our study aimed to investigate the regulation of ubiquitin protein ligase E3 component n-recognin 2 (UBR2) enriched in exosomes secreted by p53 deficient mouse bone marrow MSC (p53 -/- mBMMSC) in gastric cancer progression in vivo and in vitro. We found that the concentration of exosome was significantly higher in p53 -/- mBMMSC than that in p53 wild-type mBMMSC (p53 +/+ mBMMSC). In particular, UBR2 was highly expressed in p53 -/- mBMMSC cells and exosomes. P53 -/- mBMMSC exosomes enriched UBR2 could be internalized into p53 +/+ mBMMSC and murine foregastric carcinoma (MFC) cells and induce the overexpression of UBR2 in these cells which elevated cell proliferation, migration, and the expression of stemness-related genes. Mechanistically, the downregulation of UBR2 in p53 -/- mBMMSC exosomes could reverse these actions. Moreover, a majority of Wnt family members, β-catenin, and its downstream genes (CD44, CyclinD1, CyclinD3, and C-myc) were significantly decreased in MFC knockdown UBR2 and β-catenin depletion, an additional depletion of UBR2 had no significant difference in the expression of Nanog, OCT4, Vimentin, and E-cadherin. Taken together, our findings indicated that p53 -/- mBMMSC exosomes could deliver UBR2 to target cells and promote gastric cancer growth and metastasis by regulating Wnt/β-catenin pathway. Stem Cells 2017;35:2267-2279. © 2017 AlphaMed Press.
[Interaction between p53 and MDM2 in human lung cancer cells].
Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J
2014-01-01
The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) - mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and
Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin
2014-03-18
Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.
Kashofer, Karl; Regauer, Sigrid
2017-08-01
This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.
Lack of the purinergic receptor P2X7 results in resistance to contact hypersensitivity
Weber, Felix C.; Esser, Philipp R.; Müller, Tobias; Ganesan, Jayanthi; Pellegatti, Patrizia; Simon, Markus M.; Zeiser, Robert; Idzko, Marco; Jakob, Thilo
2010-01-01
Sensitization to contact allergens requires activation of the innate immune system by endogenous danger signals. However, the mechanisms through which contact allergens activate innate signaling pathways are incompletely understood. In this study, we demonstrate that mice lacking the adenosine triphosphate (ATP) receptor P2X7 are resistant to contact hypersensitivity (CHS). P2X7-deficient dendritic cells fail to induce sensitization to contact allergens and do not release IL-1β in response to lipopolysaccharide (LPS) and ATP. These defects are restored by pretreatment with LPS and alum in an NLRP3- and ASC-dependent manner. Whereas pretreatment of wild-type mice with P2X7 antagonists, the ATP-degrading enzyme apyrase or IL-1 receptor antagonist, prevents CHS, IL-1β injection restores CHS in P2X7-deficient mice. Thus, P2X7 is a crucial receptor for extracellular ATP released in skin in response to contact allergens. The lack of P2X7 triggering prevents IL-1β release, which is an essential step in the sensitization process. Interference with P2X7 signaling may be a promising strategy for the prevention of allergic contact dermatitis. PMID:21059855
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-01-01
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
Danielsen, T.; Hvidsten, M.; Stokke, T.; Solberg, K.; Rofstad, E. K.
1998-01-01
Hypoxia has been shown to induce accumulation of p53 and of hypophosphorylated retinoblastoma protein (pRb) in tumour cells. In this study, the cell cycle dependence of p53 accumulation and pRb hypophosphorylation in four human melanoma cell lines that are wild type for p53 was investigated using two-parameter flow cytometry measurements of p53 or pRb protein content and DNA content. The hypoxia-induced increase in p53 protein was higher in S-phase than in G1 and G2 phases in all cell lines. The accumulation of p53 in S-phase during hypoxia was not related to hypoxia-induced apoptosis or substantial cell cycle specific cell inactivation during the first 24 h of reoxygenation. pRb was hypophosphorylated in all cell cycle phases by hypoxia treatment. The results did not support a direct link between p53 and pRb during hypoxia because p53 was induced in a cell cycle-specific manner, whereas no cell cycle-dependent differences in pRb hypophosphorylation were detected. Only a fraction of the cell populations (0.60+/-0.10) showed hypophosphorylated pRb. Thus, pRb is probably not the only mediator of the hypoxia-induced cell cycle block seen in all cells and all cell cycle phases. Moreover, the cell cycle-dependent induction of p53 by hypoxia suggests that the primary function of p53 accumulation during hypoxia is other than to arrest the cells. Images Figure 4 Figure 7 PMID:9862563
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen Wenshu; Yu Yichu; Lee Yijang
2010-06-01
Purpose: Radiotherapy is one of the best choices for cancer treatment. However, various tumor cells exhibit resistance to irradiation-induced apoptosis. The development of new strategies to trigger cancer cell death besides apoptosis is necessary. This study investigated the role of securin in radiation-induced apoptosis and senescence in human cancer cells. Methods and Materials: Cell survival was determined using clonogenic assays. Western blot analysis was used to analyze levels of securin, caspase-3, PARP, p53, p21, Rb, gamma-H2AX, and phospho-Chk2. Senescent cells were analyzed using a beta-galactosidase staining assay. A securin-expressed vector (pcDNA-securin) was stably transfected into securin-null HCT116 cells. Securin genemore » knockdown was performed by small interfering RNA and small hairpin RNA in HCT116 and MDA-MB-231 cells, respectively. Results: Radiation was found to induce apoptosis in securin wild type HCT116 cells but induced senescence in securin-null cells. Restoration of securin reduced senescence and increased cell survival in securin-null HCT116 cells after irradiation. Radiation-induced gamma-H2AX and Chk2 phosphorylation were induced transiently in securin-wild-type cells but exhibited sustained activation in securin-null cells. Securin gene knockdown switches irradiation-induced apoptosis to senescence in both HCT116 p53-null and MDA-MB-231 cells. Conclusions: Our results demonstrated that the level of securin expression plays a determining role in the radiosensitivity and fate of cells. Depletion of securin impairs DNA repair after irradiation, increasing DNA damage and promoting senescence in the residual surviving cells regardless of functional p53 expression. The knockdown of securin may contribute to a novel radiotherapy protocol for the treatment of human cancer cells that are resistant to irradiation.« less
Liang, Yun; Zhang, Xiaofei; Chen, Xiaoduan; Lü, Weiguo
2015-01-01
The differential diagnosis between atypical leiomyoma and leiomyosarcoma may be hard based on morphological criterion at times. It would be helpful to find out biomarkers that can be used to distinguish them. The aim of the study was to investigate the diagnostic value of progesterone receptor (PR), p16, p53 and pHH3 expression in a series of uterine smooth muscle tumors. Immunohistochemical expression of PR, p16, p53 and pHH3 was investigated on 32 atypical leiomyomas, 15 leiomyosarcomas and 15 usual leomyomas. The difference in expression was compared between atypical leiomyoma and other groups. The expression of PR, p16, and pHH3 was found significantly different between atypical leiomyomas and leiomyosarcomas, but lack of significant difference between atypical leiomyomas and usual leiomyomas. There was no significant difference with regard to p53 distribution among these uterine smooth muscle tumors. High p16, pHH3 expression and low PR expression preferred the diagnosis of leiomyosarcoma. The panel of antibodies used in this study is a useful complementary analysis in the assessment of problematic uterine smooth muscle tumors.
Liang, Yun; Zhang, Xiaofei; Chen, Xiaoduan; Lü, Weiguo
2015-01-01
The differential diagnosis between atypical leiomyoma and leiomyosarcoma may be hard based on morphological criterion at times. It would be helpful to find out biomarkers that can be used to distinguish them. The aim of the study was to investigate the diagnostic value of progesterone receptor (PR), p16, p53 and pHH3 expression in a series of uterine smooth muscle tumors. Immunohistochemical expression of PR, p16, p53 and pHH3 was investigated on 32 atypical leiomyomas, 15 leiomyosarcomas and 15 usual leomyomas. The difference in expression was compared between atypical leiomyoma and other groups. The expression of PR, p16, and pHH3 was found significantly different between atypical leiomyomas and leiomyosarcomas, but lack of significant difference between atypical leiomyomas and usual leiomyomas. There was no significant difference with regard to p53 distribution among these uterine smooth muscle tumors. High p16, pHH3 expression and low PR expression preferred the diagnosis of leiomyosarcoma. The panel of antibodies used in this study is a useful complementary analysis in the assessment of problematic uterine smooth muscle tumors. PMID:26261614
Lorenz, Laurel D.; Rivera Cardona, Jessenia; Lambert, Paul F.
2013-01-01
The human papillomavirus DNA genome undergoes three distinct stages of replication: establishment, maintenance and amplification. We show that the HPV16 E6 protein is required for the maintenance of the HPV16 DNA genome as an extrachromosomal, nuclear plasmid in its natural host cell, the human keratinocyte. Based upon mutational analyses, inactivation of p53 by E6, but not necessarily E6-mediated degradation of p53, was found to correlate with the ability of E6 to support maintenance of the HPV16 genome as a nuclear plasmid. Inactivation of p53 with dominant negative p53 rescued the ability of HPV16 E6STOP and E6SAT mutant genomes to replicate as extrachromosomal genomes, though not to the same degree as observed for the HPV16 E6 wild-type (WT) genome. Inactivation of p53 also rescued the ability of HPV18 and HPV31 E6-deficient genomes to be maintained at copy numbers comparable to that of HPV18 and HPV31 E6WT genomes at early passages, though upon further passaging copy numbers for the HPV18 and 31 E6-deficient genomes lessened compared to that of the WT genomes. We conclude that inactivation of p53 is necessary for maintenance of HPV16 and for HPV18 and 31 to replicate at WT copy number, but that additional functions of E6 independent of inactivating p53 must also contribute to the maintenance of these genomes. Together these results suggest that re-activation of p53 may be a possible means for eradicating extrachromosomal HPV16, 18 or 31 genomes in the context of persistent infections. PMID:24204267
Chan, Shu-Ting; Yang, Nae-Cherng; Huang, Chin-Shiu; Liao, Jiunn-Wang; Yeh, Shu-Lan
2013-01-01
This study investigated the effects of quercetin on the anti-tumor effect of trichostatin A (TSA), a novel anticancer drug, in vitro and in vivo and the possible mechanisms of these effects in human lung cancer cells. We first showed that quercetin (5 µM) significantly increased the growth arrest and apoptosis in A549 cells (expressing wild-type p53) induced by 25 ng/mL of (82.5 nM) TSA at 48 h by about 25% and 101%, respectively. However, such enhancing effects of quercetin (5 µM) were not significant in TSA-exposed H1299 cells (a p53 null mutant) or were much lower than in A549 cells. In addition, quercetin significantly increased TSA-induced p53 expression in A549 cells. Transfection of p53 siRNA into A549 cells significantly but not completely diminished the enhancing effects of quercetin on TSA-induced apoptosis. Furthermore, we demonstrated that quercetin enhanced TSA-induced apoptosis through the mitochondrial pathway. Transfection of p53 siRNA abolished such enhancing effects of quercetin. However, quercetin increased the acetylation of histones H3 and H4 induced by TSA in A549 cells, even with p53 siRNA transfection as well as in H1299 cells. In a xenograft mouse model of lung cancer, quercetin enhanced the antitumor effect of TSA. Tumors from mice treated with TSA in combination with quercetin had higher p53 and apoptosis levels than did those from control and TSA-treated mice. These data indicate that regulation of the expression of p53 by quercetin plays an important role in enhancing TSA-induced apoptosis in A549 cells. However, p53-independent mechanisms may also contribute to the enhancing effect of quercetin. PMID:23342112
Worrall, C; Suleymanova, N; Crudden, C; Trocoli Drakensjö, I; Candrea, E; Nedelcu, D; Takahashi, S-I; Girnita, L; Girnita, A
2017-01-01
Melanoma tumors usually retain wild-type p53; however, its tumor-suppressor activity is functionally disabled, most commonly through an inactivating interaction with mouse double-minute 2 homolog (Mdm2), indicating p53 release from this complex as a potential therapeutic approach. P53 and the tumor-promoter insulin-like growth factor type 1 receptor (IGF-1R) compete as substrates for the E3 ubiquitin ligase Mdm2, making their relative abundance intricately linked. Hence we investigated the effects of pharmacological Mdm2 release from the Mdm2/p53 complex on the expression and function of the IGF-1R. Nutlin-3 treatment increased IGF-1R/Mdm2 association with enhanced IGF-1R ubiquitination and a dual functional outcome: receptor downregulation and selective downstream signaling activation confined to the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway. This Nutlin-3 functional selectivity translated into IGF-1-mediated bioactivities with biphasic effects on the proliferative and metastatic phenotype: an early increase and late decrease in the number of proliferative and migratory cells, while the invasiveness was completely inhibited following Nutlin-3 treatment through an impaired IGF-1-mediated matrix metalloproteinases type 2 activation mechanism. Taken together, these experiments reveal the biased agonistic properties of Nutlin-3 for the mitogen-activated protein kinase pathway, mediated by Mdm2 through IGF-1R ubiquitination and provide fundamental insights into destabilizing p53/Mdm2/IGF-1R circuitry that could be developed for therapeutic gain. PMID:28092675
Mannweiler, Sebastian; Sygulla, Stephan; Winter, Elke; Regauer, Sigrid
2013-07-01
Penile squamous cell carcinomas (SCC) arise either through transforming infections with human papillomavirus (HPV) or independent of HPV, often in the background of lichen sclerosus (LS) and lichen planus (LP). Despite impact on therapy and prognosis, etiologic stratifications are missing in most histological diagnoses and publications about penile cancers/precursors. Classification of penile lesions into HPV-induced or HPV-negative via immunohistochemical demonstration of p16(ink4a) overexpression, a surrogate marker for transforming HPV-high-risk infections, and p53 expression in the absence of p16(ink4a) overexpression. Archival formalin-fixed material of 123 invasive penile cancers and 43 pre-invasive lesions was evaluated for the presence of LS, LP, 28 HPV genotypes, and expression of p53 and p16(ink4a). Seventy-two of 123 SCCs and 33 of 43 pre-invasive lesions showed p16(ink4a) overexpression independent of HPV-HR genotypes involved; 66 of 72 SCCs and 29 of 43 precursor lesions revealed a single HPV-high-risk-genotype (HPV-HR16 in 76% followed by HPV33, HPV31, HPV45, HPV18, HPV56); 5 of 72 SCCs and 4 of 43 precursor lesions revealed multiple HPV-HR-genotypes. One SCC revealed HPV-LR and HR-DNA. Fifty-one of 123 SCCs and 10 precursor lesions were p16(ink4a) negative, but showed nuclear p53 expression in tumor cells and basal keratinocytes. Forty-nine of 51 SCCs and 10 of 10 precursor lesions lacked HPV DNA. Two of 51 SCCs contained HPV18 and HPV45 DNA, respectively, but p16(ink4a) negativity classified them as non-HPV-induced. Twenty-seven of 51 SCCs showed peritumoral LS, 13 of 51 SCCs showed peritumoral LP, and 11 SCCs revealed no peritumoral tissue. Histologically, HPV-negative precursors showed hyperkeratotic, verrucous, atrophic, and basaloid differentiation. This was a retrospective study. p16(ink4a) overexpression identifies HPV-HR-induced penile carcinogenesis independent of HPV-HR genotype. p53 expression along with p16(ink4a) negativity identifies
Bosković, Radovan I; Tobutt, Kenneth R; Ortega, Encarnación; Sutherland, Bruce G; Godini, Angelo
2007-12-01
Prunus dulcis, the almond, is a predominantly self-incompatible (SI) species with a gametophytic self-incompatibility system mediated by S-RNases. The economically important allele Sf, which results in self-compatibility in P. dulcis, is said to have arisen by introgression from Prunus webbii in the Italian region of Apulia. We investigated the range of self-(in)compatibility alleles in Apulian material of the two species. About 23 cultivars of P. dulcis (14 self-compatible (SC) and nine SI) and 33 accessions of P. webbii (16 SC, two SI and 15 initially of unknown status), all from Apulia, were analysed using PCR of genomic DNA to amplify S-RNase alleles and, in most cases, IEF and staining of stylar protein extracts to detect S-RNase activity. Some amplification products were cloned and sequenced. The allele Sf was present in nearly all the SC cultivars of P. dulcis but, surprisingly, was absent from nearly all SC accessions of P. webbii. And of particular interest was the presence in many SI cultivars of P. dulcis of a new active allele, labelled S30, the sequence of which showed it to be the wild-type of Sf so that Sf can be regarded as a stylar part mutant S30 degrees . These findings indicate Sf may have arisen within P. dulcis, by mutation. One SC cultivar of P. dulcis, 'Patalina', had a new self-compatibility allele lacking RNase activity, Sn5, which could be useful in breeding programmes. In the accessions of P. webbii, some of which were known to be SC, three new alleles were found which lacked RNase activity but had normal DNA sequences.
Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R
2002-08-15
Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.
p53 protects against genome instability following centriole duplication failure
Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield
2015-01-01
Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389
Parish, Joanna L.; Kowalczyk, Anna; Chen, Hsin-Tien; Roeder, Geraldine E.; Sessions, Richard; Buckle, Malcolm; Gaston, Kevin
2006-01-01
The E2 proteins from oncogenic (high-risk) human papillomaviruses (HPVs) can induce apoptotic cell death in both HPV-transformed and non-HPV-transformed cells. Here we show that the E2 proteins from HPV type 6 (HPV6) and HPV11, two nononcogenic (low-risk) HPV types, fail to induce apoptosis. Unlike the high-risk HPV16 E2 protein, these low-risk E2 proteins fail to bind p53 and fail to induce p53-dependent transcription activation. Interestingly, neither the ability of p53 to activate transcription nor the ability of p53 to bind DNA, are required for HPV16 E2-induced apoptosis in non-HPV-transformed cells. However, mutations that reduce the binding of the HPV16 E2 protein to p53 inhibit E2-induced apoptosis in non-HPV-transformed cells. In contrast, the interaction between HPV16 E2 and p53 is not required for this E2 protein to induce apoptosis in HPV-transformed cells. Thus, our data suggest that this high-risk HPV E2 protein induces apoptosis via two pathways. One pathway involves the binding of E2 to p53 and can operate in both HPV-transformed and non-HPV-transformed cells. The second pathway requires the binding of E2 to the viral genome and can only operate in HPV-transformed cells. PMID:16611918
Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.
Suppiah, Aravind; Greenman, John
2013-08-07
Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.
Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui
2018-06-13
Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.
Markowitz, Joseph; Chen, Ijen; Gitti, Rossi; Baldisseri, Donna M; Pan, Yongping; Udan, Ryan; Carrier, France; MacKerell, Alexander D; Weber, David J
2004-10-07
The binding of S100B to p53 down-regulates wild-type p53 tumor suppressor activity in cancer cells such as malignant melanoma, so a search for small molecules that bind S100B and prevent S100B-p53 complex formation was undertaken. Chemical databases were computationally searched for potential inhibitors of S100B, and 60 compounds were selected for testing on the basis of energy scoring, commercial availability, and chemical similarity clustering. Seven of these compounds bound to S100B as determined by steady state fluorescence spectroscopy (1.0 microM < or = K(D) < or = 120 microM) and five inhibited the growth of primary malignant melanoma cells (C8146A) at comparable concentrations (1.0 microM < or = IC(50) < or = 50 microM). Additionally, saturation transfer difference (STD) NMR experiments confirmed binding and qualitatively identified protons from the small molecule at the small molecule-S100B interface. Heteronuclear single quantum coherence (HSQC) NMR titrations indicate that these compounds interact with the p53 binding site on S100B. An NMR-docked model of one such inhibitor, pentamidine, bound to Ca(2+)-loaded S100B was calculated using intermolecular NOE data between S100B and the drug, and indicates that pentamidine binds into the p53 binding site on S100B defined by helices 3 and 4 and loop 2 (termed the hinge region).
Ihling, C; Haendeler, J; Menzel, G; Hess, R D; Fraedrich, G; Schaefer, H E; Zeiher, A M
1998-07-01
Atherosclerosis is a fibroproliferative disease of the arterial intima. It was recently found that wild-type p53 (wt p53) accumulates in human atherosclerotic tissue. Wt p53 is a cell cycle regulator involved in DNA repair, DNA synthesis, cell differentiation, and apoptosis and might therefore make an important contribution to the cellularity of atherosclerotic plaques. The product of the MDM2 gene is a nuclear protein which forms a complex with p53, thereby inhibiting the negative regulatory effects of wt p53 on cell cycle progression. In order to address a potential role of the interaction of p53 with MDM2 for the regulation of cellularity in atherosclerotic tissue, 22 carotid atheromatous plaques from patients undergoing endarterectomy were studied to determine the presence of p53 immunoreactivity (IR), MDM2 IR, cell proliferation as evidenced by MIB1/Ki-67 IR and DNA fragmentation by in situ terminal transferase-mediated dUTP 3' end labelling (TUNEL), as a marker for apoptosis. p53 IR localized to areas with evidence of chronic inflammation (22/22) and was observed in virtually all cell types in 68.79 +/- 7.51 per cent of the nuclei. p53 staining in the control tissue from human internal mammary arteries was present in 0.2 +/- 0.29 per cent of the cells (P < or = 0.002). MDM2 IR was present in all cases (22/22) in macrophages and smooth muscle cells (SMCs) in 60.53 +/- 8.32 per cent of the nuclei (controls: 0.8 +/- 0.65 per cent, P < or = 0.002) and co-localized with p53 IR as shown by examination of adjacent sections and by double immunofluorescence labelling. Importantly, co-immunoprecipitation and western blot analysis revealed that p53 and MDM2 were physically associated, indicating that MDM2-p53 complex formation takes place in vivo in human atherosclerotic tissue. Positive TUNEL staining and MIB1/Ki-67 IR present in 3.01 +/- 1.27 per cent of the nuclei (controls: 0 per cent, P < or = 0.002) localized to the same plaque compartments as p53 IR and MDM2 IR
Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.
He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu
2015-02-10
Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.
ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53
Sullivan, Kelly D.; Padilla-Just, Nuria; Henry, Ryan E.; Porter, Christopher C.; Kim, Jihye; Tentler, John J.; Eckhardt, S. Gail; Tan, Aik Choon; DeGregori, James; Espinosa, Joaquín M.
2012-01-01
The p53 tumor suppressor orchestrates alternative stress responses including cell cycle arrest and apoptosis, but the mechanisms defining cell fate upon p53 activation are poorly understood. Several small molecule activators of p53 have been developed, including Nutlin-3, but their therapeutic potential is limited by the fact that they induce reversible cell cycle arrest in most cancer cell types. We report here the results of a ‘Synthetic Lethal with Nutlin-3’ genome-wide shRNA screen, which revealed that the ATM and MET kinases govern cell fate choice upon p53 activation. Genetic or pharmacological interference with ATM or MET activity converts the cellular response from cell cycle arrest into apoptosis in diverse cancer cell types without affecting expression of key p53 target genes. ATM and MET inhibitors enable Nutlin-3 to kill tumor spheroids. These results identify novel pathways controlling the cellular response to p53 activation and aid in the design of p53-based therapies. PMID:22660439
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Tzu-Chin; Lin, Yi-Chin; Chen, Hsiao-Ling
Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhancedmore » TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in
NASA Astrophysics Data System (ADS)
Takahashi, Akihisa; Ohnishi, Takeo; Suzuki, Hiromi; Omori, Katsunori; Seki, Masaya; Hashizume, Toko; Shimazu, Toru; Ishioka, Noriaki
The space environment contains two major biologically significant influences: space radiations and microgravity. A p53 tumor suppressor protein plays a role as a guardian of the genome through the activity of p53-centered signal transduction pathways. The aim of this study was to clarify the biological effects of space radiations, microgravity and a space environment on the gene and protein expression of p53-dependent regulated genes. Space experiments were performed with two human cultured lymphoblastoid cell lines: one cells line (TSCE5) bears a wild-type p53 gene status, and another cells line (WTK1) bears a mutated p53 gene status. Un-der one gravity or microgravity condition, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station (ISS) for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples also were cultured for 8 days in the CBEF on the ground during the same periods as space flight. Gene and protein expression was analyzed by using DNA chip (a 44k whole human genome microarray, Agilent Technologies Inc.) and protein chip (PanoramaTM Ab MicroArray, Sigma-Aldrich Co.), respectively. In addition, we analyzed the gene expression in cultured cells after space flight during 133 days with frozen condition. We report the results and discussion from the viewpoint of the functions of the up-regulated and down-regulated genes after an exposure to space radiations and/or microgravity. The initial goal of this space experiment was completely achieved. It is expected that data from this type of work will be helpful in designing physical protection from the deleterious effects of space radiations during long term stays in space.
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
Increased Arf/p53 activity in stem cells, aging and cancer.
Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander
2017-04-01
Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
Kumar, Ajay; Corey, Catherine; Scott, Iain; Shiva, Sruti; D'Cunha, Jonathan
2016-01-01
Minnelide/Triptolide (TL) has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC). However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS). Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2), along with diminished cellular glutathione (GSH) content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC). TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y), restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.
Peden, K W; Srinivasan, A; Vartikar, J V; Pipas, J M
1998-01-01
The simian virus 40 (SV40) large T antigen is a 708 amino-acid protein possessing multiple biochemical activities that play distinct roles in productive infection or virus-induced cell transformation. The carboxy-terminal portion of T antigen includes a domain that carries the nucleotide binding and ATPase activities of the protein, as well as sequences required for T antigen to associate with the cellular tumor suppressor p53. Consequently this domain functions both in viral DNA replication and cellular transformation. We have generated a collection of SV40 mutants with amino-acid deletions, insertions or substitutions in specific domains of the protein. Here we report the properties of nine mutants with single or multiple substitutions between amino acids 402 and 430, a region thought to be important for both the p53 binding and ATPase functions. The mutants were examined for the ability to produce infectious progeny virions, replicate viral DNA in vivo, perform in trans complementation tests, and transform established cell lines. Two of the mutants exhibited a wild-type phenotype in all these tests. The remaining seven mutants were defective for plaque formation and viral DNA replication, but in each case these defects could be complemented by a wild-type T antigen supplied in trans. One of these replication-defective mutants efficiently transformed the REF52 and C3H10T1/2 cell lines as assessed by the dense-focus assay. The remaining six mutants were defective for transforming REF52 cells and transformed the C3H10T1/2 line with a reduced efficiency. The ability of mutant T antigen to transform REF52 cells correlated with their ability to induce increased levels of p53.
Clinical utility of anti-p53 auto-antibody: Systematic review and focus on colorectal cancer
Suppiah, Aravind; Greenman, John
2013-01-01
Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance. PMID:23922463
Regulation of autophagy by cytoplasmic p53
Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2009-01-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141
Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H
1997-05-01
To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P < 0.05). Apoptotic cells were identified from routinely stained sections and by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P < 0.05). The proliferating cell nuclear antigen index, defined similarly to the TI, was 56.4 +/- 16.3% in category A, and it was significantly higher than that in category B (P < 0.05). The immunohistochemically detected expression of p21CIP1/WAP1 did not differ between the two categories, while Bax-positive tumor cells were more frequently detected in category A. These results indicate that (1) expression of a mutated p53 gene attenuates apoptotic cell death of gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.
Chaperone-mediated autophagy degrades mutant p53
Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying
2013-01-01
Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924
Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation
Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise
2016-01-01
Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201
p53 Specifically Binds Triplex DNA In Vitro and in Cells
Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej
2016-01-01
Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175
2010-01-01
by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53. PMID:20569441
Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete
2012-10-01
Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.
Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53
Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia
2015-01-01
Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255
Wang, Lei; Guo, Xiaolan; Wang, Ji; Jiang, Cheng; Bosland, Maarten C.; Lü, Junxuan; Deng, Yibin
2015-01-01
Monomethylated selenium (MM-Se) forms that are precursors of methylselenol such as methylseleninic acid (MSeA) differ in metabolism and anti-cancer activities in preclinical cell and animal models from seleno-methionine that had failed to exert preventive efficacy against prostate cancer (PCa) in North American men. Given that human PCa arises from precancerous lesions such as high-grade prostatic intraepithelial neoplasia (HG-PIN) which frequently have lost PTEN tumor suppressor permitting AKT oncogenic signaling, we tested the efficacy of MSeA to inhibit HG-PIN progression in Pten prostate specific knockout (KO) mice and assessed the mechanistic involvement of p53-mediated cellular senescence and of the androgen receptor (AR). We observed that short-term (4 weeks) oral MSeA treatment significantly increased expression of P53 and P21Cip1 proteins and senescence-associated-β-galactosidase staining, and reduced Ki-67 cell proliferation index in Pten KO prostate epithelium. Long-term (25 weeks) MSeA administration significantly suppressed HG-PIN phenotype, tumor weight, and prevented emergence of invasive carcinoma in Pten KO mice. Mechanistically, the long-term MSeA treatment not only sustained P53-mediated senescence, but also markedly reduced AKT phosphorylation and AR abundance in the Pten KO prostate. Importantly, these cellular and molecular changes were not observed in the prostate of wild type littermates which were similarly treated with MSeA. Since p53 signaling is likely to be intact in HG-PIN compared to advanced PCa, the selective super-activation of p53-mediated senescence by MSeA suggests a new paradigm of cancer chemoprevention by strengthening a cancer progression barrier through induction of irreversible senescence with additional suppression of AR and AKT oncogenic signaling. PMID:26511486
[Study on serum p53 protein in cops in Guangzhou city].
Zhu, Wen-Chang; Chen, Qing; Chu, Xin-Wei; Luo, Chen-Ling; Wu, Min; Wang, Ya-Xian; Chen, Si-Dong
2003-10-01
Serum p53 protein overexpression was detected in population exposed to traffic exhaust gas to study the relation between traffic exhaust gas and the increased risk in p53 gene mutation. Serum p53 protein expression was measured by enzyme-linked immunosorbent assay. Relationship between different types of job and serum p53 protein overexpression were studied by pearson Chi-square tests. Results on serum p53 protein overexpression on jobs outside of office (5.74%) were not significantly higher than jobs inside the office. However, it suggested that traffic police men (12.12%) working outside of office, with whose length of service longer than 30 years had a significant overexpression of serum p53 protein than the others (5.36%) whose length of service was less than 30 years (P < 0.05, OR = 2.43, 95% CI: 1.11 - 5.33). Overexpression rate of p53 protein appeared to be 6.89% in the group whose average weekly exposure hours were more than 40 hours, which was significant higher than the group whose exposed hours were less than 40 hours (P < 0.05, OR = 1.71, 95% CI: 1.03 - 2.81). The result suggested that traffic exhaust gas was likely to cause mutation of p53 gene and increasing the incidence of lung cancer.
Davaadelger, Batzaya; Duan, Lei; Perez, Ricardo E.; Gitelis, Steven; Maki, Carl G.
2016-01-01
The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is aberrantly activated in multiple cancers and can promote proliferation and chemotherapy resistance. Multiple IGF-1R inhibitors have been developed as potential therapeutics. However, these inhibitors have failed to increase patient survival when given alone or in combination with chemotherapy agents. The reason(s) for the disappointing clinical effect of these inhibitors is not fully understood. Cisplatin (CP) activated the IGF-1R/AKT/mTORC1 pathway and stabilized p53 in osteosarcoma (OS) cells. p53 knockdown reduced IGF-1R/AKT/mTORC1 activation by CP, and IGF-1R inhibition reduced the accumulation of p53. These data demonstrate positive crosstalk between p53 and the IGF-1R/AKT/mTORC1 pathway in response to CP. Further studies showed the effect of IGF-1R inhibition on CP response is dependent on p53 status. In p53 wild-type cells treated with CP, IGF-1R inhibition increased p53s apoptotic function but reduced p53-dependent senescence, and had no effect on long term survival. In contrast, in p53-null/knockdown cells, IGF-1R inhibition reduced apoptosis in response to CP and increased long term survival. These effects were due to p27 since IGF-1R inhibition stabilized p27 in CP-treated cells, and p27 depletion restored apoptosis and reduced long term survival. Together, the results demonstrate 1) p53 expression determines the effect of IGF-1R inhibition on cancer cell CP response, and 2) crosstalk between the IGF-1R/AKT/mTORC1 pathway and p53 and p27 can reduce cancer cell responsiveness to chemotherapy and may ultimately limit the effectiveness of IGF-1R pathway inhibitors in the clinic. PMID:27050276
Xie, Xiaolei; He, Guangan; Siddik, Zahid H.
2017-01-01
Dysfunctionality of the p53 tumor suppressor is a major cause of therapeutic drug resistance in cancer. Recently we reported that mutant, but otherwise functional, p53V172F was inactivated in cisplatin-resistant 2780CP/Cl-16 and 2780CP/Cl-24 human ovarian tumor cells by increased recruitment of the inhibitor MDM4. The current study demonstrates that, unlike cisplatin, platinum analogs oxaliplatin and DACH-diacetato-dichloro-Pt(IV) (DAP), strongly stabilize and activate p53V172F in resistant cells, as indicated by prolonged p53 half-life and transactivation of targets p21 (CDKN1A) and MDM2. This increase in MDM2 reduced MDM4 levels in cell lysates as well as the p53 immunocomplex and prevented reversion of p53 to the inactive p53-MDM2-MDM4 bound state. Phosphorylation of p53 at Ser15 was demonstrated by all three drugs in sensitive A2780 and corresponding resistant 2780CP/Cl-16 and 2780CP/Cl-24 cell lines. However, cisplatin induced Ser20 phosphorylation in A2780 cells only, but not in resistant cells; in contrast, both DAP and oxaliplatin induced this phosphorylation in all three cell lines. The inference that Ser20 phosphorylation is more important for p53 activation was confirmed by ectopic expression of a phosphomimetic (S20D) mutant p53 that displayed reduced binding, relative to wild-type p53, to both MDM2 and MDM4 in p53-knockout A2780 cells. In consonance, temporal studies demonstrated drug-induced Ser15 phosphorylation coincided with p53 stabilization, whereas Ser20 phosphorylation coincided with p53 transactivation. Implications Cisplatin fails to activate the pathway involved in phosphorylating mutant p53V172F at Ser20 in resistant cells, but this phosphorylation is restored by oxaliplatin and DAP that reactivates p53 function and circumvents cisplatin resistance. PMID:28031409
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.
2001-01-01
Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.
Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.
La Perle, K M; Jhiang, S M; Capen, C C
2000-08-01
Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice =28 weeks of age or p53-/- mice = 17 weeks of age; however, an older (170-day-old) male p53-/- mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas.
Dickinson, Douglas; Yu, Hongfang; Ohno, Seiji; Thomas, Cristina; DeRossi, Scott; Ma, Yat-Ho; Yates, Nicole; Hahn, Emily; Bisch, Frederick; Yamamoto, Tetsuya; Hsu, Stephen
2015-01-01
The submandibular salivary glands of non-obese diabetic (NOD) mice, a model for Sjogren’s syndrome and type-1 diabetes, show an elevated level of proliferating cell nuclear antigen (PCNA), a protein involved in cell proliferation and repair of DNA damage. We reported previously that epigallocatechin-3-gallate (EGCG), the most abundant green tea catechin, normalizes the PCNA level. PCNA’s activity can be regulated by the cyclin-dependent kinase inhibitor p21, which is also important for epithelial cell differentiation. In turn, expression of p21 and PCNA are partially regulated by Rb phosphorylation levels. EGCG was found to modulate p21 expression in epithelial cells, suggesting that EGCG-induced p21 could be associated with down-regulation of PCNA in vivo. The current study examined the protein levels of p21 and p53 (which can up-regulate p21) in NOD mice fed with either water or EGCG, and the effect of EGCG on p21 and p53 in cell line models with either normal or defective Rb. In NOD mice, the p21 level was low, and EGCG normalized it. In contrast to HSG cells with functional Rb, negligible expression of p21 in NS-SV-AC cells that lack Rb was not altered by EGCG treatment. Inhibition of p53 by siRNA demonstrated that p21 and p53 were induced independently in HSG cells by a physiological concentration range of EGCG, suggesting p53 could be an important but not conditional factor associated with p21 expression. In conclusion, PCNA and p21 levels are altered inversely in the NOD model for SS and in HSG cells, and warrant further study as candidate new markers for salivary dysfunction associated with xerostomia. Induction of p21 by EGCG could provide clinically useful normalization of salivary glands by promoting differentiation and reducing PCNA levels. PMID:24329914
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra
2017-09-29
p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Saffarini, Camelia M; Heger, Nicholas E; Yamasaki, Hideki; Liu, Tao; Hall, Susan J; Boekelheide, Kim
2012-01-01
Phthalate esters are commonly used plasticizers found in many household items, personal care products, and medical devices. Animal studies have shown that in utero exposure to di-(n-butyl) phthalate (DBP) within a critical window during gestation causes male reproductive tract abnormalities resembling testicular dysgenesis syndrome. Our studies utilized p53-deficient mice for their ability to display greater resistance to apoptosis during development. This model was chosen to determine whether multinucleated germ cells (MNG) induced by gestational DBP exposure could survive postnatally and evolve into testicular germ cell cancer. Pregnant dams were exposed to DBP (500 mg/kg/day) by oral gavage from gestational day 12 until birth. Perinatal effects were assessed on gestational day 19 and postnatal days 1, 4, 7, and 10 for the number of MNGs present in control and DBP-treated p53-heterozygous and null animals. As expected, DBP exposure induced MNGs, with greater numbers found in p53-null mice. Additionally, there was a time-dependent decrease in the incidence of MNGs during the early postnatal period. Histologic examination of adult mice exposed in utero to DBP revealed persistence of abnormal germ cells only in DBP-treated p53-null mice, not in p53-heterozygous or wild-type mice. Immunohistochemical staining of perinatal MNGs and adult abnormal germ cells was negative for both octamer-binding protein 3/4 and placental alkaline phosphatase. This unique model identified a role for p53 in the perinatal apoptosis of DBP-induced MNGs and provided insight into the long-term effects of gestational DBP exposure within a p53-null environment.
Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S
2007-11-07
Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.
Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano
2014-01-01
The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756
G9a stimulates CRC growth by inducing p53 Lys373 dimethylation-dependent activation of Plk1.
Zhang, Jie; Wang, Yafang; Shen, Yanyan; He, Pengxing; Ding, Jian; Chen, Yi
2018-01-01
Rationale: G9a is genetically deregulated in various tumor types and is important for cell proliferation; however, the mechanism underlying G9a-induced carcinogenesis, especially in colorectal cancer (CRC), is unclear. Here, we investigated if G9a exerts oncogenic effects in CRC by increasing polo-like kinase 1 (Plk1) expression. Thus, we further characterized the detailed molecular mechanisms. Methods: The role of Plk1 in G9a aberrant CRC was determined by performing different in vitro and in vivo assays, including assessment of cell growth by performing cell viability assay and assessment of signaling transduction profiles by performing immunoblotting, in the cases of pharmacological inhibition or short RNA interference-mediated suppression of G9a. Detailed molecular mechanisms underlying the effect of G9a on Plk1 expression were determined by performing point mutation analysis, chromatin immunoprecipitation analysis, and luciferase reporter assay. Correlation between G9a and Plk1 expression was determined by analyzing clinical samples of patients with CRC by performing immunohistochemistry. Results: Our study is the first to report a significant positive correlation between G9a and Plk1 levels in 89 clinical samples of patients with CRC. Moreover, G9a depletion decreased Plk1 expression and suppressed CRC cell growth both in vitro and in vivo , thus confirming the significant correlation between G9a and Plk1 levels. Further, we observed that G9a-induced Plk1 regulation depended on p53 inhibition. G9a dimethylated p53 at lysine 373, which in turn increased Plk1 expression and promoted CRC cell growth. Conclusions: These results indicate that G9a-induced and p53-dependent epigenetic programing stimulates the growth of colon cancer, which also suggests that G9a inhibitors that restore p53 activity are promising therapeutic agents for treating colon cancer, especially for CRC expressing wild-type p53.
Bromley, Dennis; Bauer, Matthias R.; Fersht, Alan R.; Daggett, Valerie
2016-01-01
The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be ‘rescued’ and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952
Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J
1998-01-01
A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested
Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D
2018-03-01
Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.
Clinical and pathologic relevance of p53 index in canine osseous tumors.
Loukopoulos, P; Thornton, J R; Robinson, W F
2003-05-01
The clinicopathologic value of the immunohistochemical (IHC) expression of p53 protein was evaluated in 167 canine osseous tumors. p53 staining frequency and intensity in tumor cells was expressed as a p53 index. p53 index was significantly higher in osteosarcomas than in other sarcomas, chondrosarcoma, multilobular tumor of bone, and tumors initially misdiagnosed as osteosarcomas as well as in appendicular versus axial and in distal versus proximal osteosarcomas. A strong correlation is demonstrated between the p53 index and a range of clinicopathologic parameters in osteosarcoma, including the tumor site, histologic grade and score, mitotic index, degree of tumor necrosis, and pleomorphism. Chondroblastic osteosarcomas had significantly higher and telangiectatic osteosarcomas significantly lower p53 index than did osteosarcomas belonging to other histopathologic subtypes, a fact that tends to reinforce the perception of these osteosarcomas as distinct clinicopathologic entities. Entire males had higher p53 index than did neutered males. p53 index was higher in Rottweilers than in Great Danes and Terriers, confirming breed susceptibilities to osteosarcoma. p53 index showed no association with age, primary or secondary site status, or the presence of metastases or other tumor types. Biopsy samples had a higher p53 index than did postmortem samples, either because of differences in sample processing or the possibility that p53 overexpression is more evident at the earlier stages of osteosarcoma pathogenesis, presumably represented by the biopsy material. IHC examination for p53 and the derived index has the potential to be used as an additional diagnostic tool and prognostic indicator for osseous tumors.
Hurth, Marco Alois; Suh, Su Jeoung; Kretzschmar, Tobias; Geis, Tina; Bregante, Monica; Gambale, Franco; Martinoia, Enrico; Neuhaus, H Ekkehard
2005-03-01
Arabidopsis (Arabidopsis thaliana) mutants lacking the tonoplastic malate transporter AttDT (A. thaliana tonoplast dicarboxylate transporter) and wild-type plants showed no phenotypic differences when grown under standard conditions. To identify putative metabolic changes in AttDT knock-out plants, we provoked a metabolic scenario connected to an increased consumption of dicarboxylates. Acidification of leaf discs stimulated dicarboxylate consumption and led to extremely low levels of dicarboxylates in mutants. To investigate whether reduced dicarboxylate concentrations in mutant leaf cells and, hence, reduced capacity to produce OH(-) to overcome acidification might affect metabolism, we measured photosynthetic oxygen evolution under conditions where the cytosol is acidified. AttDT::tDNA protoplasts showed a much stronger inhibition of oxygen evolution at low pH values when compared to wild-type protoplasts. Apparently citrate, which is present in higher amounts in knock-out plants, is not able to replace dicarboxylates to overcome acidification. To raise more information on the cellular level, we performed localization studies of carboxylates. Although the total pool of carboxylates in mutant vacuoles was nearly unaltered, these organelles contained a lower proportion of malate and fumarate and a higher proportion of citrate when compared to wild-type vacuoles. These alterations concur with the observation that radioactively labeled malate and citrate are transported into Arabidopsis vacuoles by different carriers. In addition, wild-type vacuoles and corresponding organelles from AttDT::tDNA mutants exhibited similar malate channel activities. In conclusion, these results show that Arabidopsis vacuoles contain at least two transporters and a channel for dicarboxylates and citrate and that the activity of AttDT is critical for regulation of pH homeostasis.
Wild-type cells rescue genotypically Math1-null hair cells in the inner ears of chimeric mice.
Du, Xiaoping; Jensen, Patricia; Goldowitz, Daniel; Hamre, Kristin M
2007-05-15
The transcription factor Math1 has been shown to be critical in the formation of hair cells (HCs) in the inner ear. However, the influence of environmental factors in HC specification suggests that cell extrinsic factors are also crucial to their development. To test whether extrinsic factors impact development of Math1-null (Math1(beta-Gal/beta-Gal)) HCs, we examined neonatal (postnatal ages P0-P4.5) Math1-null chimeric mice in which genotypically mutant and wild-type cells intermingle to form the inner ear. We provide the first direct evidence that Math1-null HCs are able to be generated and survive in the conducive chimeric environment. beta-Galactosidase expression was used to identify genetically mutant cells while cells were phenotypically defined as HCs by morphological characteristics notably the expression of HC-specific markers. Genotypically mutant HCs were found in all sensory epithelia of the inner ear at all ages examined. Comparable results were obtained irrespective of the wild-type component of the chimeric mice. Thus, genotypically mutant cells retain the competence to differentiate into HCs. The implication is that the lack of the Math1 gene in HC precursors can be overcome by environmental influences, such as cell-cell interactions with wild-type cells, to ultimately result in the formation of HCs.
Adiposity is associated with p53 gene mutations in breast cancer.
Ochs-Balcom, Heather M; Marian, Catalin; Nie, Jing; Brasky, Theodore M; Goerlitz, David S; Trevisan, Maurizio; Edge, Stephen B; Winston, Janet; Berry, Deborah L; Kallakury, Bhaskar V; Freudenheim, Jo L; Shields, Peter G
2015-10-01
Mutations in the p53 gene are among the most frequent genetic events in human cancer and may be triggered by environmental and occupational exposures. We examined the association of clinical and pathological characteristics of breast tumors and breast cancer risk factors according to the prevalence and type of p53 mutations. Using tumor blocks from incident cases from a case-control study in western New York, we screened for p53 mutations in exons 2-11 using the Affymetrix p53 Gene Chip array and analyzed case-case comparisons using logistic regression. The p53 mutation frequency among cases was 28.1 %; 95 % were point mutations (13 % of which were silent) and the remainder were single base pair deletions. Sixty seven percent of all point mutations were transitions; 24 % of them are G:C>A:T at CpG sites. Positive p53 mutation status was associated with poorer differentiation (OR, 95 % CI 2.29, 1.21-4.32), higher nuclear grade (OR, 95 % CI 1.99, 1.22-3.25), and increased Ki-67 status (OR, 95 % CI 1.81, 1.10-2.98). Cases with P53 mutations were more likely to have a combined ER-positive and PR-negative status (OR, 95 % CI 1.65, 1.01-2.71), and a combined ER-negative and PR-negative status (OR, 95 % CI 2.18, 1.47-3.23). Body mass index >30 kg/m(2), waist circumference >79 cm, and waist-to-hip ratio >0.86 were also associated with p53 status; obese breast cancer cases are more likely to have p53 mutations (OR, 95 % CI 1.78, 1.19-2.68). We confirmed that p53 mutations are associated with less favorable tumor characteristics and identified an association of p53 mutation status and adiposity.
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
Loss of p53 Promotes Anaplasia and Local Invasion in ret/PTC1-Induced Thyroid Carcinomas
La Perle, Krista M. D.; Jhiang, Sissy M.; Capen, Charles C.
2000-01-01
Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53−/− mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53−/− mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53−/− mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/− mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/− mice ≤28 weeks of age or p53−/− mice ≤ 17 weeks of age; however, an older (170-day-old) male p53−/− mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas. PMID:10934169
NASA Astrophysics Data System (ADS)
O'Connor, É.; Brennan, B.; Djara, V.; Cherkaoui, K.; Monaghan, S.; Newcomb, S. B.; Contreras, R.; Milojevic, M.; Hughes, G.; Pemble, M. E.; Wallace, R. M.; Hurley, P. K.
2011-01-01
In this work, we present the results of an investigation into the effectiveness of varying ammonium sulphide (NH4)2S concentrations in the passivation of n-type and p-type In0.53Ga0.47As. Samples were degreased and immersed in aqueous (NH4)2S solutions of concentrations 22%, 10%, 5%, or 1% for 20 min at 295 K, immediately prior to atomic layer deposition of Al2O3. Multi-frequency capacitance-voltage (C-V) results on capacitor structures indicate that the lowest frequency dispersion over the bias range examined occurs for n-type and p-type devices treated with the 10%(NH4)2S solution. The deleterious effect on device behavior of increased ambient exposure time after removal from 10%(NH4)2S solution is also presented. Estimations of the interface state defect density (Dit) for the optimum 10%(NH4)2S passivated In0.53Ga0.47As devices extracted using an approximation to the conductance method, and also extracted using the temperature-modified high-low frequency C-V method, indicate that the same defect is present over n-type and p-type devices having an integrated Dit of ˜2.5×1012 cm-2 (±1×1012 cm-2) with the peak density positioned in the middle of the In0.53Ga0.47As band gap at approximately 0.37 eV (±0.03 eV) from the valence band edge. Both methods used for extracting Dit show very good agreement, providing evidence to support that the conductance method can be applied to devices incorporating high-k oxides on In0.53Ga0.47As.
Novel peptides from the RAS-p21 and p53 proteins for the treatment of cancer
Bowne, Wilbur B.; Michl, Josef; Bluth, Martin H.; Zenilman, Michael E.; Pincus, Matthew R.
2007-01-01
Summary We have employed a novel computer-based molecular modeling method to design peptides from the ras-p21 and p53 proteins that block proliferation of cancer cells. The rationale of our approach is to identify peptide domains from each protein that alter conformation in response to oncogenic amino acid substitutions in their polypeptide chain. We accomplish this by first generating and comparing low energy average structures for oncogenic and wild-type proteins using conformational energy calculations. Peptides are then synthesized corresponding to these domains. These domains are then linked to a trans-membrane-penetrating sequence (called penetratin) and tested against cancer and untransformed cell lines. Remarkably, we have found that two ras-p21 peptides, 35–47 and 96–110, called PNC-7 and PNC-2, respectively, can induce phenotypic reversion of ras-transformed TUC-3 pancreatic cancer cells and ras-transformed HT1080 human fibrosarcoma cells to their untransformed phenotypes. Moreover, both peptides were found to be cytotoxic to ras-transformed human MIA-PaCa-2 pancreatic carcinoma cells and human U-251 astrocytoma cells. Importantly, these peptides have no effect on the growth of their normal cellular counterparts. We have also synthesized peptides from the p53 protein corresponding to its hdm-2-binding domain sequences (residues 12–26), also linked to the penetratin sequence. Surprisingly, we have found that these peptides induce 100 percent tumor cell necrosis, not apoptosis, in 13 different human cancer cell lines but have no effect on normal pancreatic acinar cells, breast epithelial cells, and human stem cells. Moreover, these peptides are cytotoxic to TUC-3 pancreatic tumor cells in nude mice plus eradicate these tumor cells when administered at sites near these tumors. These novel peptides appear to hold much promise as new, non-toxic anti-cancer agents. PMID:18007958
Kattanek, Maria; Richardson, Kenneth C.; Hafez, Hafez Mohamed; Plendl, Johanna; Hünigen, Hana
2017-01-01
In this study the macroscopic and microscopic structure of the heart of a fast growing, meat-type turkey line (British United turkeys BUT Big 6) and a wild-type turkey line (Canadian Wild turkey) were compared. At 8 and 16 weeks of age, 10 birds of each genotype and sex were sampled. The body mass and heart mass of the meat-type turkey both increased at a faster rate than those of the wild-type turkey. However in both turkey lines, the relative heart mass decreased slightly with age, the decrease was statistically significant only in the male turkeys. Furthermore meat-type turkeys had a significantly (p < 0.01) lower relative heart mass and relative thickness of the left ventricle compared to the wild-type turkeys of the same age. The wild-type turkeys showed no significant change in the size of cardiomyocytes (cross sectional area and diameter) from 8 weeks to 16 weeks. In contrast, the size of cardiomyocytes increased significantly (p < 0.001) with age in the meat-type turkeys. The number of capillaries in the left ventricular wall increased significantly (p < 0.001) in wild-type turkeys from 2351 per mm2 at the age of 8 weeks to 2843 per mm2 at 16 weeks. However, in the meat-type turkeys there were no significant changes, capillary numbers being 2989 per mm2 at age 8 weeks and 2915 per mm2 at age 16 weeks. Correspondingly the area occupied by capillaries in the myocardium increased in wild-type turkeys from 8.59% at the age of 8 weeks to 9.15% at 16 weeks, whereas in meat-type turkeys this area decreased from 10.4% at 8 weeks to 9.95% at 16 weeks. Our results indicate a mismatch in development between body mass and heart mass and a compromised cardiac capillary density and architecture in the meat-type turkeys in comparison to the wild-type turkeys. PMID:28118415
Cisplatin-Induced Renal Injury is Independently Mediated by OCT2 and p53
Sprowl, Sprowl; Lancaster, Cynthia S.; Pabla, Navjotsingh; Hermann, Edwin; Kosloske, Ashley M.; Gibson, Alice A.; Li, Lie; Zeeh, Dorothea; Schlatter, Eberhard; Janke, Laura J.; Ciarimboli, Giuliano; Sparreboom, Alex
2014-01-01
Purpose Tubular secretion of cisplatin is abolished in mice deficient for the organic cation transporters Oct1 and Oct2 [Oct1/2(−/−) mice], and these animals are protected from severe cisplatin-induced kidney damage. Since tubular necrosis is not completely absent in Oct1/2(−/−) mice, we hypothesized that alternate pathways are involved in the observed injury. Experimental Design Studies were done in wildtype, Oct1/2(−/−), or p53-deficient animals, all on an FVB background, receiving i.p. cisplatin at 15 mg/kg. The cisplatin metabolites were analyzed using mass spectrometry, and gene expression was assessed using Affymetrix microarrays and RT-PCR arrays. Results KEGG pathway analyses on kidneys from mice exposed to cisplatin revealed that most significantly altered genes were associated with the p53 signaling network, including Cdnk1a and Mdm2, in both wildtype (P=2.40×10–11) and Oct1/2(−/−) mice (P=1.92×10-8). This was confirmed by demonstrating that homozygosity for a p53-null allele partially reduced renal tubular damage, while loss of p53 in Oct1/2(−/−) mice [p53(−/−)/Oct1/2(−/−)] completely abolished nephrotoxicity. We found that pifithrin-α, an inhibitor of p53-dependent transcriptional activation, inhibits Oct2 and can mimic the lack of nephrotoxicity observed in p53(−/−)/Oct1/2(−/−) mice. Conclusions These findings indicate that (i) the p53 pathway plays a crucial role in the kidney in response to cisplatin treatment and (ii) clinical exploration of OCT2 inhibitors may not lead to complete nephroprotection unless the p53 pathway is simultaneously antagonized. PMID:24916697
Nucleophosmin regulates the stability and transcriptional activity of p53.
Colombo, Emanuela; Marine, Jean-Christophe; Danovi, Davide; Falini, Brunangelo; Pelicci, Pier Giuseppe
2002-07-01
Nucleophosmin (NPM) is a ubiquitously expressed nucleolar phosphoprotein that continuously shuttles between the nucleus and cytoplasm. It has been proposed to function in ribosomal protein assembly and transport, and also as a molecular chaperone that prevents proteins from aggregating in the crowded environment of the nucleolus. The NPM gene is involved in several tumour-associated chromosome translocations, which have resulted in the formation of fusion proteins that retain the amino terminus of NPM, including NPM ALK, NPM RAR and NPM MLF1 (ref. 6). It is generally thought that the NPM component is not involved in the transforming potential of these fusion proteins, but instead provides a dimerization interface for the oligomerization and the oncogenic conversion of the various NPM partners (ALK, RAR, MLF1). Here we show that NPM interacts directly with the tumour suppressor p53, regulates the increase in stability and transcriptional activation of p53 after different types of stress, and induces p53-dependent premature senescence on overexpression in diploid fibroblasts. These findings indicate that NPM is a crucial regulator of p53 and suggest that alterations of the NPM function by NPM fusion proteins might lead to deregulation of p53 in tumours.
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit
2017-01-01
Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454
Shi, Ming; Du, Libin; Liu, Dan; Qian, Lu; Hu, Meiru; Yu, Ming; Yang, Zhengyan; Zhao, Mingzhen; Chen, Changguo; Guo, Liang; Wang, Lina; Song, Lun; Ma, Yuanfang; Guo, Ning
2012-10-01
Glucocorticoids are stress-responsive neuroendocrine mediators and play an important role in malignant progression, especially in solid tumours. We demonstrate a novel mechanism by which glucocorticoids modulate p53-dependent miR-145 expression in HPV-positive cervical cancer cells through induction of E6 proteins. We found that expression of miR-145 was reduced in cervical cancer tissues. Cortisol induced HPV-E6 expression and suppressed p53 and miR-145 in cervical cancer cells. MiR-145 expression in cervical cancer cells was wild-type p53-dependent, and cortisol-induced down-regulation of miR-145 expression prevented chemotherapy-induced apoptosis, whereas over-expression of miR-145 enhanced sensitivity to mitomycin and reversed the chemoresistance induced by glucocorticoids. We also show that miR-145 augments the effects of p53 by suppressing the inhibitors of p53 in cervical cancer cells, suggesting that miR-145 plays a role in p53 tumour suppression. Finally, we demonstrate that miR-145 inhibits both the motility and invasion of cervical cancer cells. Our findings identify a novel pathway through which the neuroendocrine macroenvironment affects cervical tumour growth, invasion and therapy resistance and show that miR-145 may serve as a target for cervical cancer therapy. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
p53-independent p21 induction by MELK inhibition.
Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun
2017-08-29
MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated.
p53-independent p21 induction by MELK inhibition
Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun
2017-01-01
MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated. PMID:28938528
Hattori, Hiroyoshi; Janky, Rekin's; Nietfeld, Wilfried; Aerts, Stein; Madan Babu, M; Venkitaraman, Ashok R
2014-01-01
The human DNA damage response (DDR) triggers profound changes in gene expression, whose nature and regulation remain uncertain. Although certain micro-(mi)RNA species including miR34, miR-18, miR-16 and miR-143 have been implicated in the DDR, there is as yet no comprehensive description of genome-wide changes in the expression of miRNAs triggered by DNA breakage in human cells. We have used next-generation sequencing (NGS), combined with rigorous integrative computational analyses, to describe genome-wide changes in the expression of miRNAs during the human DDR. The changes affect 150 of 1523 miRNAs known in miRBase v18 from 4-24 h after the induction of DNA breakage, in cell-type dependent patterns. The regulatory regions of the most-highly regulated miRNA species are enriched in conserved binding sites for p53. Indeed, genome-wide changes in miRNA expression during the DDR are markedly altered in TP53-/- cells compared to otherwise isogenic controls. The expression levels of certain damage-induced, p53-regulated miRNAs in cancer samples correlate with patient survival. Our work reveals genome-wide and cell type-specific alterations in miRNA expression during the human DDR, which are regulated by the tumor suppressor protein p53. These findings provide a genomic resource to identify new molecules and mechanisms involved in the DDR, and to examine their role in tumor suppression and the clinical outcome of cancer patients.
Rigor of cell fate decision by variable p53 pulses and roles of cooperative gene expression by p53
Murakami, Yohei; Takada, Shoji
2012-01-01
Upon DNA damage, the cell fate decision between survival and apoptosis is largely regulated by p53-related networks. Recent experiments found a series of discrete p53 pulses in individual cells, which led to the hypothesis that the cell fate decision upon DNA damage is controlled by counting the number of p53 pulses. Under this hypothesis, Sun et al. (2009) modeled the Bax activation switch in the apoptosis signal transduction pathway that can rigorously “count” the number of uniform p53 pulses. Based on experimental evidence, here we use variable p53 pulses with Sun et al.’s model to investigate how the variability in p53 pulses affects the rigor of the cell fate decision by the pulse number. Our calculations showed that the experimentally anticipated variability in the pulse sizes reduces the rigor of the cell fate decision. In addition, we tested the roles of the cooperativity in PUMA expression by p53, finding that lower cooperativity is plausible for more rigorous cell fate decision. This is because the variability in the p53 pulse height is more amplified in PUMA expressions with more cooperative cases. PMID:27857606
DOE Office of Scientific and Technical Information (OSTI.GOV)
Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.
2009-09-07
The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expressionmore » levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.« less
Mohammad, Naoshad; Vikram Singh, Shivendra; Malvi, Parmanand; Chaube, Balkrishna; Athavale, Dipti; Vanuopadath, Muralidharan; Nair, Sudarslal Sadasivan; Nair, Bipin; Bhat, Manoj Kumar
2015-01-01
Doxorubicin (DOX) is one of the preferred drugs for treating breast and liver cancers. However, its clinical application is limited due to severe side effects and the accompanying drug resistance. In this context, we investigated the effect on therapeutic efficacy of DOX by cholesterol depleting agent methyl-β-cyclodextrin (MCD), and explored the involvement of p53. MCD sensitizes MCF-7 and Hepa1–6 cells to DOX, Combination of MCD and marginal dose of DOX reduces the cell viability, and promoted apoptosis through induction of pro-apoptotic protein, Bax, activation of caspase-8 and caspase-7, down regulation of anti-apoptotic protein Bcl-2 and finally promoting PARP cleavage. Mechanistically, sensitization to DOX by MCD was due to the induction of FasR/FasL pathway through p53 activation. Furthermore, inhibition of p53 by pharmacological inhibitor pifithrin-α (PFT-α) or its specific siRNA attenuated p53 function and down-regulated FasR/FasL, thereby preventing cell death. Animal experiments were performed using C57BL/6J mouse isografted with Hepa1–6 cells. Tumor growth was retarded and survival increased in mice administered MCD together with DOX to as compared to either agent alone. Collectively, these results suggest that MCD enhances the sensitivity to DOX for which wild type p53 is an important determinant. PMID:26149967
Valosin-Containing Protein (VCP/p97) Is an Activator of Wild-Type Ataxin-3
Laço, Mário N.; Cortes, Luisa; Travis, Sue M.; Paulson, Henry L.; Rego, A. Cristina
2012-01-01
Alterations in the ubiquitin-proteasome system (UPS) have been reported in several neurodegenerative disorders characterized by protein misfolding and aggregation, including the polylgutamine diseases. Machado-Joseph disease (MJD) or Spinocerebellar Ataxia type 3 is caused by a polyglutamine-encoding CAG expansion in the ATXN3 gene, which encodes a 42 kDa deubiquitinating enzyme (DUB), ataxin-3. We investigated ataxin-3 deubiquitinating activity and the functional relevance of ataxin-3 interactions with two proteins previously described to interact with ataxin-3, hHR23A and valosin-containing protein (VCP/p97). We confirmed ataxin-3 affinity for both hHR23A and VCP/p97. hHR23A and ataxin-3 were shown to co-localize in discrete nuclear foci, while VCP/p97 was primarily cytoplasmic. hHR23A and VCP/p97 recombinant proteins were added, separately or together, to normal and expanded ataxin-3 in in vitro deubiquitination assays to evaluate their influence on ataxin-3 activity. VCP/p97 was shown to be an activator specifically of wild-type ataxin-3, exhibiting no effect on expanded ataxin-3, In contrast, we observed no significant alterations in ataxin-3 enzyme kinetics or substrate preference in the presence of hHR23A alone or in combination with VCP. Based on our results we propose a model where ataxin-3 normally functions with its interactors to specify the cellular fate of ubiquitinated proteins. PMID:22970133
p53 mutation and expression in lymphoma.
Adamson, D. J.; Thompson, W. D.; Dawson, A. A.; Bennett, B.; Haites, N. E.
1995-01-01
Mutation and abnormal expression of p53 was studied in 38 lymphomas [five Hodgkin's disease and 33 non-Hodgkin's lymphoma (NHL)]. CM1 polyclonal antibody was used to detect overexpression of p53. Three missense mutations were characterised in three cases of NHL after screening exons 5-8 of p53 of all the tumours with single-strand conformation polymorphism (SSCP) analysis. Only two out of three tumours with a missense mutation showed abnormal expression of p53 as measured by CM1. Conversely, seven out of nine tumours with positive CM1 staining had no point mutation demonstrated. Overexpression of p53 in the cases of NHL occurred in three out of twenty four low-grade tumours and five out of nine high-grade tumours (Kiel classification). The results suggest that abnormalities of p53 are commoner in high-grade than low-grade NHL, and that positive immunocytochemistry cannot be used to determine which tumours have mutations of p53. Images Figure 1 Figure 2 PMID:7599045
Gallo, O; Sardi, I; Pepe, G; Franchi, A; Attanasio, M; Giusti, B; Bocciolini, C; Abbate, R
1999-07-19
Head-and-neck cancer (HNC) patients have a high risk of developing second primary tumors of the upper aerodigestive tract, the main cause of death. Although the roles of tobacco and diet in multiple head-and-neck carcinogenesis have been thoroughly investigated, little is known about individual genetic susceptibility factors involved in this process. Genomic instability, reflecting the propensity and the susceptibility of the genome to acquire multiple alterations, could be considered a driving force behind multiple carcinogenesis. Mutation of the p53 tumor-suppressor gene has been proposed to play an important role in this process. Therefore, we evaluated the incidence of inherited p53 germ-line alteration(s) in a population of 24 consecutive HNC patients and their first-degree relatives affected by multiple malignancies as well as the occurrence of p53 somatic acquired mutation(s) in 16 cancers, including first and second primaries from 5 HNCs of the same group. Mutations in exons 4-11 of the p53 gene were investigated using SSCP-PCR analysis and DNA sequencing. Analysis was extended to the peripheral blood and cancer biopsies available from first-degree relatives of cancer-prone families with p53 germ-line mutations. p53 germ-line mutations were identified in the peripheral blood and corresponding cancers of 3 HNC patients who had multiple malignancies. The only missense mutation detected was mapped in exon 6; it is a GTG to GAG substitution with an amino acid change from Val to Glu at codon 197. The remaining 2 p53 germ-line mutations were single-nucleotide substitutions without amino acid change in exon 6 (codon 213, CGA to CGG) and in exon 8 (codon 295, CCT to CCC), respectively. These mutations were found in HNC patients with a family history of cancer. Abnormal expression of wild-type p53 protein in normal and pathological tissues from patients with the same sense single-nucleotide substitutions was detected by immuno-histochemistry.
Nijhuis, E H A; Poot, A A; Feijen, J; Vermes, I
2008-02-01
The effect of heat treatment in combination with X-irradiation was examined with regard to expression of p53, a tumor suppressor gene product, and Hsp70, a heat-shock protein, in association with the occurrence of programmed cell death (apoptosis). Three hematopoietic cell lines (HSB2, HL60 and Kasumi-1), which differ in p53 status, were exposed to 42.5 degrees C during one hour and/or X-radiation (total dose 8 Gy). After exposure, both mRNA and protein expression levels of Hsp70 and p53 were investigated by real-time PCR (polymerase chain reaction) and Western blotting. Apoptosis was simultaneously analyzed by observation of cell morphology as well as flowcytometric determination of Annexin V binding to phosphatidylserine and propidium iodide exclusion. Both HL60 and HSB2 cell lines with a low p53 status and a quick response to heat treatment with Hsp70 over-expression are less susceptible to heat-induced apoptosis compared to Kasumi-1 cells with wild-type p53 protein and no Hsp70 response. The combination of first applying X-irradiation followed by heat treatment resulted in the most effective induction of apoptosis due to impairment of the Hsp70 response in all three cell lines. These results indicate that the Hsp70 response and p53 status mediate the susceptibility of hematopoietic cells to undergo heat-induced apoptosis. Therefore, these parameters can be used as markers to predict the effectiveness of hyperthermia in cancer treatment.
p53 status determines the role of autophagy in pancreatic tumour development
NASA Astrophysics Data System (ADS)
Rosenfeldt, Mathias T.; O'Prey, Jim; Morton, Jennifer P.; Nixon, Colin; Mackay, Gillian; Mrowinska, Agata; Au, Amy; Rai, Taranjit Singh; Zheng, Liang; Ridgway, Rachel; Adams, Peter D.; Anderson, Kurt I.; Gottlieb, Eyal; Sansom, Owen J.; Ryan, Kevin M.
2013-12-01
Macroautophagy (hereafter referred to as autophagy) is a process in which organelles termed autophagosomes deliver cytoplasmic constituents to lysosomes for degradation. Autophagy has a major role in cellular homeostasis and has been implicated in various forms of human disease. The role of autophagy in cancer seems to be complex, with reports indicating both pro-tumorigenic and tumour-suppressive roles. Here we show, in a humanized genetically-modified mouse model of pancreatic ductal adenocarcinoma (PDAC), that autophagy's role in tumour development is intrinsically connected to the status of the tumour suppressor p53. Mice with pancreases containing an activated oncogenic allele of Kras (also called Ki-Ras)--the most common mutational event in PDAC--develop a small number of pre-cancerous lesions that stochastically develop into PDAC over time. However, mice also lacking the essential autophagy genes Atg5 or Atg7 accumulate low-grade, pre-malignant pancreatic intraepithelial neoplasia lesions, but progression to high-grade pancreatic intraepithelial neoplasias and PDAC is blocked. In marked contrast, in mice containing oncogenic Kras and lacking p53, loss of autophagy no longer blocks tumour progression, but actually accelerates tumour onset, with metabolic analysis revealing enhanced glucose uptake and enrichment of anabolic pathways, which can fuel tumour growth. These findings provide considerable insight into the role of autophagy in cancer and have important implications for autophagy inhibition in cancer therapy. In this regard, we also show that treatment of mice with the autophagy inhibitor hydroxychloroquine, which is currently being used in several clinical trials, significantly accelerates tumour formation in mice containing oncogenic Kras but lacking p53.
p53 genes function to restrain mobile elements
Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.
2016-01-01
Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264
Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan
2018-03-23
p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila
2016-10-15
Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, withmore » a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.« less
[Effect of tagalsin on p53 and Bcl-2 expression in hepatoma H(22) tumor-bearing mice].
Song, Xiu-qi; Guo, Yun-liang; Wang, Bing-gao; Sun, Shao-jie; Yao, Ru-yong
2011-07-01
To explore the effect and mechanism of tagalsin on hepatoma cells. The animal models were established by transplanting H(22) mouse hepatoma cells to mouse liver, and ten days later the mice were randomly divided into five groups: blank group, carmofur positive group and tagalsin groups, including low-dose, middle-dose and high-dose groups. Then medicine or oil was given to the mice by gastric gavage in consecutive 5 days with a 2-days interval as a course of treatment, two courses in all. All mice were killed at 24 hours after medication, and the survival period, ascites conditions, aggressive conditions intra- or extra-liver, weight changes, tumor volume and spleen index of the tumor-bearing mice were observed. Pathological changes of the tumors were examined. Apoptotic factors p53 and Bcl-2 protien and mRNA were detected by immunohistochemistry and reverse transcription polymerase chain reaction (RT-PCR). tagalsin inhibited the hepatoma growth effectively without influencing spleen index to some extent. The tumor inhibition rate of tagalsin low, middle and high dose groups were 17.9%, 63.1% and 71.8%, respectively. Immunohistochemical results showed that the p53 and Bcl-2 protein positive cell counts of the positive control and experimental groups were significantly lower than those of the blank group (P < 0.01). RT-PCR results showed that the p53 mRNA expression was significantly enhanced and Bcl-2 mRNA expression was decreased in the positive control groups and tagalsin treatment groups, especially in the high dose group, compared with those of the blank group (P < 0.05). tagalsin can inhibit the growth of mouse hepatoma cells significantly. The mechanism of its anti-tumor effect may work via up-regulating the wild type p53 gene expression and down-regulating Bcl-2 gene expression and thus regulating tumor cell apoptosis.
Dumble, Melissa L; Croager, Emma J; Yeoh, George C T; Quail, Elizabeth A
2002-03-01
Oval cells are bipotential liver stem cells able to differentiate into hepatocytes and bile duct epithelia. In normal adult liver oval cells are quiescent, existing in low numbers around the periportal region, and proliferate following severe, prolonged liver trauma. There is evidence implicating oval cells in the development of hepatocellular carcinoma, and hence the availability of an immortalized oval cell line would be invaluable for the study of liver cell lineage differentiation and carcinogenesis. A novel approach in the generation of cell lines is the use of the p53 knockout mouse. Absence of p53 allows a cell to cycle past the normal Hayflick limit, rendering it immortalized, although subsequent genetic alterations are thought necessary for transformation. p53 knockout mice were fed a choline-deficient, ethionine-supplemented diet, previously shown to increase oval cell numbers in wild-type mice. The oval cells were isolated by centrifugal elutriation and maintained in culture. Colonies of hepatic cells were isolated and characterized with respect to phenotype, growth characteristics and tumorigenicity. Analysis of gene expression by Northern blotting and immunocytochemistry suggests they are oval-like cells by virtue of albumin and transferrin expression, as well as the oval cell markers alpha fetoprotein, M(2)-pyruvate kinase and A6. Injection into athymic nude mice shows the cell lines are capable of forming tumors which phenotypically resemble hepatocellular carcinoma. Thus, the use of p53 null hepatic cells successfully generated immortalized and tumorigenic hepatic stem cell lines. The results presented support the idea that deleting p53 allows immortalization and contributes to the transformation of the oval-like cell lines. Further, the tumorigenic status of the cell lines is direct evidence for the participation of oval cells in the formation of hepatocellular carcinoma.
Hurth, Marco Alois; Suh, Su Jeoung; Kretzschmar, Tobias; Geis, Tina; Bregante, Monica; Gambale, Franco; Martinoia, Enrico; Neuhaus, H. Ekkehard
2005-01-01
Arabidopsis (Arabidopsis thaliana) mutants lacking the tonoplastic malate transporter AttDT (A. thaliana tonoplast dicarboxylate transporter) and wild-type plants showed no phenotypic differences when grown under standard conditions. To identify putative metabolic changes in AttDT knock-out plants, we provoked a metabolic scenario connected to an increased consumption of dicarboxylates. Acidification of leaf discs stimulated dicarboxylate consumption and led to extremely low levels of dicarboxylates in mutants. To investigate whether reduced dicarboxylate concentrations in mutant leaf cells and, hence, reduced capacity to produce OH− to overcome acidification might affect metabolism, we measured photosynthetic oxygen evolution under conditions where the cytosol is acidified. AttDT::tDNA protoplasts showed a much stronger inhibition of oxygen evolution at low pH values when compared to wild-type protoplasts. Apparently citrate, which is present in higher amounts in knock-out plants, is not able to replace dicarboxylates to overcome acidification. To raise more information on the cellular level, we performed localization studies of carboxylates. Although the total pool of carboxylates in mutant vacuoles was nearly unaltered, these organelles contained a lower proportion of malate and fumarate and a higher proportion of citrate when compared to wild-type vacuoles. These alterations concur with the observation that radioactively labeled malate and citrate are transported into Arabidopsis vacuoles by different carriers. In addition, wild-type vacuoles and corresponding organelles from AttDT::tDNA mutants exhibited similar malate channel activities. In conclusion, these results show that Arabidopsis vacuoles contain at least two transporters and a channel for dicarboxylates and citrate and that the activity of AttDT is critical for regulation of pH homeostasis. PMID:15728336
JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation.
Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng
2009-06-23
The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types--MDM2, Pirh2, and COP1--and the HECT-domain type--ARF-BP1--have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G(1) phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation.
Wip1 and p53 contribute to HTLV-1 Tax-induced tumorigenesis
2012-01-01
Background Human T-cell Leukemia Virus type 1 (HTLV-1) infects 20 million individuals world-wide and causes Adult T-cell Leukemia/Lymphoma (ATLL), a highly aggressive T-cell cancer. ATLL is refractory to treatment with conventional chemotherapy and fewer than 10% of afflicted individuals survive more than 5 years after diagnosis. HTLV-1 encodes a viral oncoprotein, Tax, that functions in transforming virus-infected T-cells into leukemic cells. All ATLL cases are believed to have reduced p53 activity although only a minority of ATLLs have genetic mutations in their p53 gene. It has been suggested that p53 function is inactivated by the Tax protein. Results Using genetically altered mice, we report here that Tax expression does not achieve a functional equivalence of p53 inactivation as that seen with genetic mutation of p53 (i.e. a p53−/− genotype). Thus, we find statistically significant differences in tumorigenesis between Tax+p53+/+versus Tax+p53−/− mice. We also find a role contributed by the cellular Wip1 phosphatase protein in tumor formation in Tax transgenic mice. Notably, Tax+Wip1−/− mice show statistically significant reduced prevalence of tumorigenesis compared to Tax+Wip1+/+ counterparts. Conclusions Our findings provide new insights into contributions by p53 and Wip1 in the in vivo oncogenesis of Tax-induced tumors in mice. PMID:23256545
Koga, T; Hashimoto, S; Sugio, K; Yoshino, I; Nakagawa, K; Yonemitsu, Y; Sugimachi, K; Sueishi, K
2001-07-20
Although the tumor suppressor p53 protein (P53) immunoreactivity and its gene (p53) mutation were reported to be significant prognostic indicators for human lung adenocarcinomas, little is known regarding the relationship between the heterogeneous distribution of P53 and its genetic status in each tumor focus and the clinicopathological significance. To determine how P53 is heterogeneously stabilized in patients, we compared P53 expression to both the p53 allelic mutation in exon 2 approximately 9 by polymerase chain reaction-single strand conformation polymorphism using microdissected DNA fractions, and the immunohistochemical MDM2 expression. Of the 48 positive to P53 in 118 lung adenocarcinomas examined, 10 with heterogeneous P53 expression were closely examined. The higher P53 expression foci in 7 of 10 cases were less differentiated, histologically in respective cases, and were frequently associated with fibrous stroma. Two had genetic mutations in exon 7 of the p53 gene in both the high and low P53 expression foci of cancer tissue indicating no apparent correlation between heterogeneous P53 expression and the occurrence of gene mutation. Immunohistochemical expression of MDM2 was significantly lower in high P53 expression areas (p < 0.05, the mean labeling indices of high and low P53 expression areas being 4.2 +/- 5.4% and 13.6 +/- 12.2%, respectively). In addition, among all the 118 cases examined, MDM2 expression was significantly suppressed in cases of p53 gene mutation, simultaneously with P53 overexpression, as compared with cases without both the p53 mutation and expression (p < 0.001). These findings suggest that the heterogeneous stabilization of P53 in human lung adenocarcinomas could be partly due to suppressed MDM2 expression. The overexpression of non-mutated P53 may afford a protective mechanism in human lung adenocarcinomas. Copyright 2001 Wiley-Liss, Inc.
Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun
2016-11-22
Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.
Uo, Takuma; Veenstra, Timothy D; Morrison, Richard S
2009-03-04
Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and p53-independent intrinsic apoptotic programs require the proapoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing postmitochondrial events including cleavage of caspase-9 and caspase-3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions.
Comparison of body weight and gene expression in amelogenin null and wild-type mice.
Li, Yong; Yuan, Zhi-An; Aragon, Melissa A; Kulkarni, Ashok B; Gibson, Carolyn W
2006-05-01
Amelogenin (AmelX) null mice develop hypomineralized enamel lacking normal prism structure, but are healthy and fertile. Because these mice are smaller than wild-type mice prior to weaning, we undertook a detailed analysis of the weight of mice and analyzed AmelX expression in non-dental tissues. Wild-type mice had a greater average weight each day within the 3-wk period. Using reverse transcription-polymerase chain reaction (RT-PCR), products of approximately 200 bp in size were generated from wild-type teeth, brain, eye, and calvariae. DNA sequence analysis of RT-PCR products from calvariae indicated that the small amelogenin leucine-rich amelogenin peptide (LRAP), both with and without exon 4, was expressed. No products were obtained from any of the samples from the AmelX null mice. We also isolated mRNAs that included AmelX exons 8 and 9, and identified a duplication within the murine AmelX gene with 91% homology. Our results add additional support to the hypothesis that amelogenins are multifunctional proteins, with potential roles in non-ameloblasts and in non-mineralizing tissues during development. The smaller size of AmelX null mice could potentially be explained by the lack of LRAP expression in some of these tissues, leading to a delay in development.
Schlegel, Victoria; Thieme, Markus; Holzmann, Carsten; Witt, Martin; Grittner, Ulrike; Rolfs, Arndt; Wree, Andreas
2016-11-09
Niemann-Pick Type C1 (NPC1) is an autosomal recessive inherited disorder characterized by accumulation of cholesterol and glycosphingolipids. Previously, we demonstrated that BALB/c-npc1 nih Npc1 -/- mice treated with miglustat, cyclodextrin and allopregnanolone generally performed better than untreated Npc1 -/- animals. Unexpectedly, they also seemed to accomplish motor tests better than their sham-treated wild-type littermates. However, combination-treated mutant mice displayed worse cognition performance compared to sham-treated ones. To evaluate effects of these drugs in healthy BALB/c mice, we here analyzed pharmacologic effects on motor and cognitive behavior of wild-type mice. For combination treatment mice were injected with allopregnanolone/cyclodextrin weekly, starting at P7. Miglustat injections were performed daily from P10 till P23. Starting at P23, miglustat was embedded in the chow. Other mice were treated with miglustat only, or sham-treated. The battery of behavioral tests consisted of accelerod, Morris water maze, elevated plus maze, open field and hot-plate tests. Motor capabilities and spontaneous motor behavior were unaltered in both drug-treated groups. Miglustat-treated wild-type mice displayed impaired spatial learning compared to sham- and combination-treated mice. Both combination- and miglustat-treated mice showed enhanced anxiety in the elevated plus maze compared to sham-treated mice. Additionally, combination treatment as well as miglustat alone significantly reduced brain weight, whereas only combination treatment reduced body weight significantly. Our results suggest that allopregnanolone/cyclodextrin ameliorate most side effects of miglustat in wild-type mice.
TRIM65 negatively regulates p53 through ubiquitination
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yang; Ma, Chengyuan; Zhou, Tong
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediatedmore » degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.« less
Lehmann-Che, Jacqueline; André, Fabrice; Desmedt, Christine; Mazouni, Chafika; Giacchetti, Sylvie; Turpin, Elisabeth; Espié, Marc; Plassa, Louis-François; Marty, Michel; Bertheau, Philippe; Sotiriou, Christos; Piccart, Martine; Symmans, W Fraser; Pusztai, Lajos; de Thé, Hugues
2010-01-01
The predictive value of p53 for the efficacy of front-line anthracycline-based chemotherapy regimens has been a matter of significant controversy. Anthracyclines are usually combined with widely different doses of alkylating agents, which may significantly modulate tumor response to these combinations. We analyzed three series of de novo stage II-III breast cancer patients treated front line with anthracycline-based regimens of various cyclophosphamide dose intensities: 65 patients with estrogen receptor (ER)(-) tumors treated with anthracyclines alone (Institut Jules Bordet, Brussels), 51 unselected breast cancer patients treated with intermediate doses of cyclophosphamide (MD Anderson Cancer Center, Houston, TX), and 128 others treated with a dose-dense anthracycline-cyclophosphamide combination (St. Louis, Paris). After chemotherapy and surgery, pathologic complete response (pCR) was evaluated. p53 status was determined by a yeast functional assay on the pretreatment tumor sample. In a multivariate analysis of the pooled results, a lack of ER expression and high-dose cyclophosphamide administration were associated with a higher likelihood of pCR. A sharp statistical interaction was detected between p53 status and cyclophosphamide dose intensity. Indeed, when restricting our analysis to patients with ER(-) tumors, we confirmed that a mutant p53 status was associated with anthracycline resistance, but found that p53 inactivation was required for response to the dose-intense alkylating regimen. The latter allowed very high levels of pCR in triple-negative tumors. Thus, our data strongly suggest that cyclophosphamide dose intensification in ER(-) p53-mutated breast cancer patients could significantly improve their response.
Brilliant, M H
2001-04-01
Recessive mutations of the mouse p (pink-eyed dilution) gene lead to hypopigmentation of the eyes, skin, and fur. Mice lacking a functional p protein have pink eyes and light gray fur (if non-agouti) or cream-colored fur (if agouti). The human orthologue is the P protein. Humans lacking a functional P protein have oculocutaneous albinism type 2 (OCA2). Melanocytes from p-deficient mice or OCA2 individuals contain small, minimally pigmented melanosomes. The mouse and human proteins are predicted to have 12 membrane spanning domains and possess significant sequence homology to a number of membrane transport proteins, some of which are involved in the transport of anions. The p protein has been localized to the melanosome membrane. Recently, it has been shown that melanosomes from p protein-deficient melanocytes have an abnormal pH. Melanosomes in cultured melanocytes derived from wild-type mice are typically acidic, whereas melanosomes from p protein-deficient mice are non-acidic. Melanosomes and related endosome-derived organelles (i.e., lysosomes) are thought to have an adenosine triphosphate (ATP)-driven proton pump that helps to generate an acidic lumen. To compensate for the charge of these protons, anions must also be transported to the lumen of the melanosome. In light of these observations, a model of p protein function is presented in which the p protein, together with the ATP-driven proton pump, regulates the pH of the melanosome.
Farchoukh, Lama; Kuan, Shih-Fan; Dudley, Beth; Brand, Randall; Nikiforova, Marina; Pai, Reetesh K
2016-10-01
Between 10% and 15% of colorectal carcinomas demonstrate sporadic DNA mismatch-repair protein deficiency as a result of MLH1 promoter methylation and are thought to arise from sessile serrated adenomas, termed the serrated neoplasia pathway. Although the presence of the BRAF V600E mutation is indicative of a sporadic cancer, up to 30% to 50% of colorectal carcinomas with MLH1 promoter hypermethylation will lack a BRAF mutation. We report the clinicopathologic and molecular features of MLH1-deficient colorectal carcinoma with wild-type BRAF and MLH1 promoter hypermethylation (referred to as MLH1-hypermethylated BRAF wild-type colorectal carcinoma, n=36) in comparison with MLH1-deficient BRAF-mutated colorectal carcinoma (n=113) and Lynch syndrome-associated colorectal carcinoma (n=36). KRAS mutations were identified in 31% of MLH1-hypermethylated BRAF wild-type colorectal carcinomas compared with 0% of MLH1-deficient BRAF-mutated colorectal carcinomas and 37% of Lynch syndrome-associated colorectal carcinomas. When a precursor polyp was identified, MLH1-hypermethylated BRAF wild-type colorectal carcinomas arose from precursor polyps resembling conventional tubular/tubulovillous adenomas in contrast to MLH1-deficient BRAF-mutated colorectal carcinomas, which arose from precursor sessile serrated adenomas (P<0.001). Both MLH1-hypermethylated BRAF wild-type colorectal carcinoma and MLH1-deficient BRAF-mutated colorectal carcinoma had a predilection for the right colon compared with Lynch syndrome-associated colorectal carcinoma (86% vs. 92% vs. 49%, P<0.001). There was no significant difference in mucinous differentiation, tumor-infiltrating lymphocytes, Crohn-like reaction, and medullary differentiation between the 3 tumor groups. Using Kaplan-Meier survival functions, there was no significant difference in disease-specific survival between the 3 patient groups (P>0.05). In conclusion, our results indicate that MLH1-hypermethylated BRAF wild-type colorectal carcinomas
Nuclear Interaction between ADR-Induced p65 and p53 Mediates Cardiac Injury in iNOS (−/−) Mice
Cole, Marsha P.; Tangpong, Jitbanjong; Oberley, Terry D.; Chaiswing, Luksana; Kiningham, Kinsley K.; St. Clair, Daret K.
2014-01-01
Adriamycin (ADR) treatment causes an imbalance in the levels of nitric oxide (•NO) and superoxide (O2 •−) production leading to cardiac injury. Previously we demonstrated that mice lacking inducible nitric oxide synthase (iNOS) have increased oxidative stress and mitochondrial injury. The molecular events leading to increased mitochondrial injury in iNOS deficient mice is unknown. ADR in the absence of iNOS preferentially activates a proapoptotic pathway without a concurrent increase in prosurvival pathways. Treatment with ADR leads to an increase in DNA binding activity of nuclear factor kappa B (NFκB) and p53 in wildtype mice. Following ADR treatment, p53, but not NFκB DNA binding activity, as well as the level of Bax, a p53 target gene, was increased in iNOS (−/−) mice. This apoptotic signaling effect in iNOS (−/−) is alleviated by overexpression of manganese superoxide dismutase (MnSOD). Increases in NFκB and p53 in ADR-treated wildtype mice did not lead to increases in target genes such as MnSOD, bcl-xL, or Bax. Moreover, co-immunoprecipitation analysis revealed that p65, a prominent member of the NFκB family, interacts with p53 in the nucleus. These results suggest that NFκB and p53 may counter act one another's actions in ADR-treated wildtype (WT) mice. Further, these results identify a novel mechanism by which oxidative stress may regulate transcription of proapoptotic genes. PMID:24586632
Reversible p53 inhibition prevents cisplatin ototoxicity without blocking chemotherapeutic efficacy.
Benkafadar, Nesrine; Menardo, Julien; Bourien, Jérôme; Nouvian, Régis; François, Florence; Decaudin, Didier; Maiorano, Domenico; Puel, Jean-Luc; Wang, Jing
2017-01-01
Cisplatin is a widely used chemotherapy drug, despite its significant ototoxic side effects. To date, the mechanism of cisplatin-induced ototoxicity remains unclear, and hearing preservation during cisplatin-based chemotherapy in patients is lacking. We found activation of the ATM-Chk2-p53 pathway to be a major determinant of cisplatin ototoxicity. However, prevention of cisplatin-induced ototoxicity is hampered by opposite effects of ATM activation upon sensory hair cells: promoting both outer hair cell death and inner hair cell survival. Encouragingly, however, genetic or pharmacological ablation of p53 substantially attenuated cochlear cell apoptosis, thus preserving hearing. Importantly, systemic administration of a p53 inhibitor in mice bearing patient-derived triple-negative breast cancer protected auditory function, without compromising the anti-tumor efficacy of cisplatin. Altogether, these findings highlight a novel and effective strategy for hearing protection in cisplatin-based chemotherapy. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.
Suppression of Familial Adenomatous Polyposis by CP-31398, a TP53 modulator, in APCmin/+ Mice1
Rao, Chinthalapally V.; Swamy, Malisetty V.; Patlolla, Jagan M.R.; Kopelovich, Levy
2008-01-01
p53 mutations occur in a large number of human malignancies. Mutant p53 is unable to affect downstream genes necessary for DNA repair, cell cycle regulation, and apoptosis. The styrylquinazoline CP-31398 can rescue destabilized mutant p53 expression and promote activity of wild-type p53. The present study examines chemopreventive effects of CP-31398 on intestinal adenoma development in an animal model of familial adenomatous polyposis (FAP). Effects were examined at both early and late stages of adenoma formation. Effects of CP-31398 on early-stage adenomas were determined by feeding 7-week-old female C57B/6J-APCmin (heterozygous) and wild-type C57BL/6J mice with American Institute of Nutrition (AIN)-76A diets containing 0, 100, or 200 ppm CP-31398 for 75 days. To examine activity toward late-stage adenomas, CP31398 administration was delayed until 15 weeks of age and continued for 50 days. During early-stage intervention, dietary CP-31398 suppressed development of intestinal tumors by 36% (p < 0.001) and 75% (p < 0.0001), at low and high dose, respectively. During late-stage intervention, CP-31398 also significantly suppressed intestinal polyp formation, albeit to a lesser extent than observed with early intervention. Adenomas in treated mice showed increased apoptotic cell death and decreased proliferation in conjunction with increased expression of p53, p21WAF1/CIP, cleaved caspase-3, and cleaved poly (ADP-ribose) polymerase (PARP). These observations demonstrate for the first time that the p53-modulating agent CP-31398 possesses significant chemopreventive activity in vivo against intestinal neoplastic lesions in genetically-predisposed APCmin/+ mice. Chemopreventive activity of other agents that restore tumor suppressor functions of mutant p53 in tumor cells is currently under investigation. PMID:18794156
The UMD-p53 database: new mutations and analysis tools.
Béroud, Christophe; Soussi, Thierry
2003-03-01
The tumor suppressor gene TP53 (p53) is the most extensively studied gene involved in human cancers. More than 1,400 publications have reported mutations of this gene in 150 cancer types for a total of 14,971 mutations. To exploit this huge bulk of data, specific analytic tools were highly warranted. We therefore developed a locus-specific database software called UMD-p53. This database compiles all somatic and germline mutations as well as polymorphisms of the TP53 gene which have been reported in the published literature since 1989, or unpublished data submitted to the database curators. The database is available at www.umd.necker.fr or at http://p53.curie.fr/. In this paper, we describe recent developments of the UMD-p53 database. These developments include new fields and routines. For example, the analysis of putative acceptor or donor splice sites is now automated and gives new insight for the causal role of "silent mutations." Other routines have also been created such as the prescreening module, the UV module, and the cancer distribution module. These new improvements will help users not only for molecular epidemiology and pharmacogenetic studies but also for patient-based studies. To achieve theses purposes we have designed a procedure to check and validate data in order to reach the highest quality data. Copyright 2003 Wiley-Liss, Inc.
Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G
2000-03-01
Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.
p53-mediated inhibition of angiogenesis through up-regulation of a collagen prolyl hydroxylase.
Teodoro, Jose G; Parker, Albert E; Zhu, Xiaochun; Green, Michael R
2006-08-18
Recent evidence suggests that antiangiogenic therapy is sensitive to p53 status in tumors, implicating a role for p53 in the regulation of angiogenesis. Here we show that p53 transcriptionally activates the alpha(II) collagen prolyl-4-hydroxylase [alpha(II)PH] gene, resulting in the extracellular release of antiangiogenic fragments of collagen type 4 and 18. Conditioned media from cells ectopically expressing either p53 or alpha(II)PH selectively inhibited growth of primary human endothelial cells. When expressed intracellularly or exogenously delivered, alpha(II)PH significantly inhibited tumor growth in mice. Our results reveal a genetic and biochemical linkage between the p53 tumor suppressor pathway and the synthesis of antiangiogenic collagen fragments.
Characterizing genomic differences of human cancer stratified by the TP53 mutation status.
Wang, Mengyao; Yang, Chao; Zhang, Xiuqing; Li, Xiangchun
2018-06-01
The key roles of the TP53 mutation in cancer have been well established. TP53 is the most frequently mutated gene, and its inactivation is widespread among human cancer types. However, the landscape of genomic alterations in human cancers stratified by the TP53 mutation has not yet been described. We obtained somatic mutation and copy number change data of 6551 regular-mutated samples from the Cancer Genome Atlas (TCGA) and compared significantly mutated genes (SMGs), copy number alterations, mutational signatures and mutational strand asymmetries between cancer samples with and without the TP53 mutation. We identified 126 SMGs, 30 of which were statistically significant in both the TP53 mutant and wild-type groups. Several SMGs, such as VHL, SMAD4 and PTEN, showed a mutation bias towards the TP53 wild-type group, whereas ATRX, IDH1 and RB1 were more prevalent in the TP53 mutant group. Five mutational signatures were extracted from the combined TCGA dataset on which mutational asymmetry analysis was performed, revealing that the TP53 mutant group exhibited substantially greater replication and transcription biases. Furthermore, we found that alterations of multiple genes in a merged mutually exclusive network composed of BRAF, EGFR, PAK1, PIK3CA, PTEN, APC and TERT were related to shortened survival in the TP53 wild-type group. In summary, we characterized the genomic differences and similarities underlying human cancers stratified by the TP53 mutation and identified multi-gene alterations of a merged mutually exclusive network to be a poor prognostic factor for the TP53 wild-type group.
Chagtai, Tasnim; Popov, Sergey D.; Sebire, Neil J.; Vujanic, Gordan; Perlman, Elizabeth; Anderson, James R.; Grundy, Paul; Dome, Jeffrey S.; Pritchard-Jones, Kathy
2014-01-01
Purpose The presence of diffuse anaplasia in Wilms tumours (DAWT) is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information. Patients and Methods We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32) and gene expression (n = 36) arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling. Results From the 40 cases, 22 (55%) had TP53 mutations (2 detected only after deep-sequencing), 20 of which also had 17p loss (91%); 18 (45%) cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25) had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR), 3.89; 95% confidence interval (CI), 1.26–16.0) and death (p = 0.04, HR, 4.95; 95% CI, 1.36–31.7) compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03). These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes. Conclusion This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker. PMID:25313908
Maschietto, Mariana; Williams, Richard D; Chagtai, Tasnim; Popov, Sergey D; Sebire, Neil J; Vujanic, Gordan; Perlman, Elizabeth; Anderson, James R; Grundy, Paul; Dome, Jeffrey S; Pritchard-Jones, Kathy
2014-01-01
The presence of diffuse anaplasia in Wilms tumours (DAWT) is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information. We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32) and gene expression (n = 36) arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling. From the 40 cases, 22 (55%) had TP53 mutations (2 detected only after deep-sequencing), 20 of which also had 17p loss (91%); 18 (45%) cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25) had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR), 3.89; 95% confidence interval (CI), 1.26-16.0) and death (p = 0.04, HR, 4.95; 95% CI, 1.36-31.7) compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03). These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes. This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker.
Francis, Brian R; White, Karen H; Thorsness, Peter E
2007-04-01
ATP1-111, a suppressor of the slow-growth phenotype of yme1Delta lacking mitochondrial DNA is due to the substitution of phenylalanine for valine at position 111 of the alpha-subunit of mitochondrial ATP synthase (Atp1p in yeast). The suppressing activity of ATP1-111 requires intact beta (Atp2p) and gamma (Atp3p) subunits of mitochondrial ATP synthase, but not the stator stalk subunits b (Atp4p) and OSCP (Atp5p). ATP1-111 and other similarly suppressing mutations in ATP1 and ATP3 increase the growth rate of wild-type strains lacking mitochondrial DNA. These suppressing mutations decrease the growth rate of yeast containing an intact mitochondrial chromosome on media requiring oxidative phosphorylation, but not when grown on fermentable media. Measurement of chronological aging of yeast in culture reveals that ATP1 and ATP3 suppressor alleles in strains that contain mitochondrial DNA are longer lived than the isogenic wild-type strain. In contrast, the chronological life span of yeast cells lacking mitochondrial DNA and containing these mutations is shorter than that of the isogenic wild-type strain. Spore viability of strains bearing ATP1-111 is reduced compared to wild type, although ATP1-111 enhances the survival of spores that lacked mitochondrial DNA.
Bill, Kate Lynn J.; Garnett, Jeannine; Meaux, Isabelle; Ma, XiaoYen; Creighton, Chad J.; Bolshakov, Svetlana; Barriere, Cedric; Debussche, Laurent; Lazar, Alexander J.; Prudner, Bethany C.; Casadei, Lucia; Braggio, Danielle; Lopez, Gonzalo; Zewdu, Abbie; Bid, Hemant; Lev, Dina; Pollock, Raphael E.
2016-01-01
Purpose Dedifferentiated liposarcoma (DDLPS) is an aggressive malignancy that can recur locally or disseminate even after multidisciplinary care. Genetically amplified and expressed MDM2, often referred to as a “hallmark” of DDLPS, mostly sustains a wild-type p53 genotype, substantiating the p53-MDM2 axis as a potential therapeutic target for DDLPS. Here we report on the preclinical effects of SAR405838, a novel and highly selective MDM2 small-molecule inhibitor, in both in vitro and in vivo DDLPS models. Experimental Design The therapeutic effectiveness of SAR405838 was compared to the known MDM2 antagonists Nutlin-3a and MI-219. The effects of MDM2 inhibition were assessed in both in vitro and in vivo. In vitro and in vivo microarray analyses were performed to assess differentially expressed genes induced by SAR405838, as well as the pathways that these modulated genes enriched. Results SAR405838 effectively stabilized p53 and activated the p53 pathway, resulting in abrogated cellular proliferation, cell cycle arrest, and apoptosis. Similar results were observed with Nutlin-3a and MI-219; however, significantly higher concentrations were required. In vitro effectiveness of SAR405838 activity was recapitulated in DDLPS xenograft models where significant decreases in tumorigenicity were observed. Microarray analyses revealed genes enriching the p53 signaling pathway as well as genomic stability and DNA damage following SAR405838 treatment. Conclusion SAR405838 is currently in early phase clinical trials for a number of malignancies, including sarcoma, and our in vitro and in vivo results support its use as a potential therapeutic strategy for the treatment of DDLPS. PMID:26475335
Bill, Kate Lynn J; Garnett, Jeannine; Meaux, Isabelle; Ma, XiaoYen; Creighton, Chad J; Bolshakov, Svetlana; Barriere, Cedric; Debussche, Laurent; Lazar, Alexander J; Prudner, Bethany C; Casadei, Lucia; Braggio, Danielle; Lopez, Gonzalo; Zewdu, Abbie; Bid, Hemant; Lev, Dina; Pollock, Raphael E
2016-03-01
Dedifferentiated liposarcoma (DDLPS) is an aggressive malignancy that can recur locally or disseminate even after multidisciplinary care. Genetically amplified and expressed MDM2, often referred to as a "hallmark" of DDLPS, mostly sustains a wild-type p53 genotype, substantiating the MDM2:p53 axis as a potential therapeutic target for DDLPS. Here, we report on the preclinical effects of SAR405838, a novel and highly selective MDM2 small-molecule inhibitor, in both in vitro and in vivo DDLPS models. The therapeutic effectiveness of SAR405838 was compared with the known MDM2 antagonists Nutlin-3a and MI-219. The effects of MDM2 inhibition were assessed in both in vitro and in vivo. In vitro and in vivo microarray analyses were performed to assess differentially expressed genes induced by SAR405838, as well as the pathways that these modulated genes enriched. SAR405838 effectively stabilized p53 and activated the p53 pathway, resulting in abrogated cellular proliferation, cell-cycle arrest, and apoptosis. Similar results were observed with Nutlin-3a and MI-219; however, significantly higher concentrations were required. In vitro effectiveness of SAR405838 activity was recapitulated in DDLPS xenograft models where significant decreases in tumorigenicity were observed. Microarray analyses revealed genes enriching the p53 signaling pathway as well as genomic stability and DNA damage following SAR405838 treatment. SAR405838 is currently in early-phase clinical trials for a number of malignancies, including sarcoma, and our in vitro and in vivo results support its use as a potential therapeutic strategy for the treatment of DDLPS. ©2015 American Association for Cancer Research.
Romeo, Megan; Hutchison, Tetiana; Malu, Aditi; White, Averi; Kim, Janice; Gardner, Rachel; Smith, Katie; Nelson, Katherine; Bergeson, Rachel; McKee, Ryan; Harrod, Carolyn; Ratner, Lee; Lüscher, Bernhard; Martinez, Ernest; Harrod, Robert
2018-05-01
In normal cells, aberrant oncogene expression leads to the accumulation of cytotoxic metabolites, including reactive oxygen species (ROS), which can cause oxidative DNA-damage and apoptosis as an intrinsic barrier against neoplastic disease. The c-Myc oncoprotein is overexpressed in many lymphoid cancers due to c-myc gene amplification and/or 8q24 chromosomal translocations. Intriguingly, p53 is a downstream target of c-Myc and hematological malignancies, such as adult T-cell leukemia/lymphoma (ATL), frequently contain wildtype p53 and c-Myc overexpression. We therefore hypothesized that p53-regulated pro-survival signals may thwart the cell's metabolic anticancer defenses to support oncogene-activation in lymphoid cancers. Here we show that the Tp53-induced glycolysis and apoptosis regulator (TIGAR) promotes c-myc oncogene-activation by the human T-cell leukemia virus type-1 (HTLV-1) latency-maintenance factor p30 II , associated with c-Myc deregulation in ATL clinical isolates. TIGAR prevents the intracellular accumulation of c-Myc-induced ROS and inhibits oncogene-induced cellular senescence in ATL, acute lymphoblastic leukemia, and multiple myeloma cells with elevated c-Myc expression. Our results allude to a pivotal role for p53-regulated antioxidant signals as mediators of c-Myc oncogenic functions in viral and non-viral lymphoid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.
Coelho, J C; Tucker, R; Mattoon, J; Roberts, G; Waiting, D K; Mealey, K L
2009-10-01
P-glycoprotein (P-gp), the product of ABCB1 gene, is thought to play a role in the biliary excretion of a variety of drugs, but specific studies in dogs have not been performed. Because a number of endogenous (ABCB1 polymorphisms) and exogenous (pharmacological P-gp inhibition) factors can interfere with normal P-gp function, a better understanding of P-gp's role in biliary drug excretion is crucial in preventing adverse drug reactions and drug-drug interactions in dogs. The objectives of this study were to compare biliary excretion of technetium-99m-sestamibi ((99m)Tc-MIBI), a radio-labelled P-gp substrate, in wild-type dogs (ABCB1 wild/wild), and dogs with intrinsic and extrinsic deficiencies in P-gp function. Dogs with intrinsic P-gp deficiency included ABCB1 mut/mut dogs, and dogs with presumed intermediate P-gp phenotype (ABCB1 mut/wild). Dogs with extrinsic P-gp deficiency were considered to be ABCB1 wild/wild dogs treated with the P-gp inhibitor ketoconazole (5 mg/kg PO q12h x 9 doses). Results from this study indicate that ABCB1 mut/mut dogs have significantly decreased biliary excretion of (99m)Tc-MIBI compared with ABCB1 wild/wild dogs. Treatment with ketoconazole significantly decreased biliary excretion of (99m)Tc-MIBI in ABCB1 wild/wild dogs. P-gp appears to play an important role in the biliary excretion of (99m)Tc-MIBI in dogs. It is likely that concurrent administration of a P-gp inhibitor such as ketoconazole will decrease P-gp-mediated biliary excretion of other substrate drugs as well.
Detection of p53 mutations in proliferating vascular cells in glioblastoma multiforme.
Kawasoe, Takuma; Takeshima, Hideo; Yamashita, Shinji; Mizuguchi, Sohei; Fukushima, Tsuyoshi; Yokogami, Kiyotaka; Yamasaki, Kouji
2015-02-01
Glioblastoma multiforme (GBM), one of the most aggressive tumors in humans, is highly angiogenic. However, treatment with the angiogenesis inhibitor bevacizumab has not significantly prolonged overall patient survival times. GBM resistance to angiogenesis inhibitors is attributed to multiple interacting mechanisms. Although mesenchymal transition via glioma stem-like cells has attracted attention, it is considered a poor biomarker. There is no simple method for differentiating tumor-derived and reactive vascular cells from normal cells. The authors attempted to detect the mesenchymal transition of tumor cells by means of p53 and isocitrate dehydrogenase 1 (IDH1) immunohistochemistry. Using antibody against p53 and IDH1 R132H, the authors immunohistochemically analyzed GBM tissue from patients who had undergone surgery at the University of Miyazaki Hospital during August 2005-December 2011. They focused on microvascular proliferation with a p53-positive ratio exceeding 50%. They compared TP53 mutations in original tumor tissues and in p53-positive and p53-negative microvascular proliferation cells collected by laser microdissection. Among 61 enrolled GBM patients, the first screening step (immunostaining) identified 46 GBMs as p53 positive, 3 of which manifested areas of prominent p53-positive microvascular proliferation (>50%). Histologically, areas of p53-positive microvascular proliferation tended to be clustered, and they coexisted with areas of p53-negative microvascular proliferation. Both types of microvascular proliferation cells were clearly separated from original tumor cells by glial fibrillary acidic protein, epidermal growth factor receptor, and low-/high-molecular-weight cytokeratin. DNA sequencing analysis disclosed that p53-positive microvascular proliferation cells exhibited TP53 mutations identical to those observed in the original tumor; p53-negative microvascular proliferation cells contained a normal allele. Although immunostaining indicated
The impact of p53 protein core domain structural alteration on ovarian cancer survival.
Rose, Stephen L; Robertson, Andrew D; Goodheart, Michael J; Smith, Brian J; DeYoung, Barry R; Buller, Richard E
2003-09-15
Although survival with a p53 missense mutation is highly variable, p53-null mutation is an independent adverse prognostic factor for advanced stage ovarian cancer. By evaluating ovarian cancer survival based upon a structure function analysis of the p53 protein, we tested the hypothesis that not all missense mutations are equivalent. The p53 gene was sequenced from 267 consecutive ovarian cancers. The effect of individual missense mutations on p53 structure was analyzed using the International Agency for Research on Cancer p53 Mutational Database, which specifies the effects of p53 mutations on p53 core domain structure. Mutations in the p53 core domain were classified as either explained or not explained in structural or functional terms by their predicted effects on protein folding, protein-DNA contacts, or mutation in highly conserved residues. Null mutations were classified by their mechanism of origin. Mutations were sequenced from 125 tumors. Effects of 62 of the 82 missense mutations (76%) could be explained by alterations in the p53 protein. Twenty-three (28%) of the explained mutations occurred in highly conserved regions of the p53 core protein. Twenty-two nonsense point mutations and 21 frameshift null mutations were sequenced. Survival was independent of missense mutation type and mechanism of null mutation. The hypothesis that not all missense mutations are equivalent is, therefore, rejected. Furthermore, p53 core domain structural alteration secondary to missense point mutation is not functionally equivalent to a p53-null mutation. The poor prognosis associated with p53-null mutation is independent of the mutation mechanism.
Noda, Takeshi
2011-12-01
I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.
Disruption of p53 function sensitizes breast cancer MCF-7 cells to cisplatin and pentoxifylline.
Fan, S; Smith, M L; Rivet, D J; Duba, D; Zhan, Q; Kohn, K W; Fornace, A J; O'Connor, P M
1995-04-15
The possibility that appropriately designed chemotherapy could act selectively against p53-defective tumor cells was explored in MCF-7 human breast cancer cells. These cells were chosen because they have normal p53 function but are representative of a tumor cell type that does not readily undergo p53-dependent apoptosis. Two sublines (MCF-7/E6 and MCF-7/mu-p53) were established in which p53 function was disrupted by transfection with either the human papillomavirus type-16 E6 gene or a dominant-negative mutant p53 gene. p53 function in MCF-7/E6 and MCF-7/mu-p53 cells was defective relative to control cells in that there were no increases in p53 or p21Waf1/Cip1 protein levels and no G1 arrest following exposure to ionizing radiation. Survival assays showed that p53 disruption sensitized MCF-7 cells to cisplatin (CDDP) but not to several other DNA-damaging agents. CDDP sensitization was not limited to MCF-7 cells since p53 disruption in human colon carcinoma RKO cells also enhanced sensitivity to CDDP. Contrary to the other DNA-damaging agents tested, CDDP-induced DNA lesions are repaired extensively by nucleotide excision, and in agreement with a defect in this process, MCF-7/E6 and MCF-7/mu-p53 cells exhibited a reduced ability to repair a CDDP-damaged chloramphenicol acetyltransferase-reporter plasmid transfected into the cells. Therefore, we attributed the increased CDDP sensitivity of MCF-7 cells with disrupted p53 to defects in G1 checkpoint control, nucleotide excision repair, or both. The G2 checkpoint inhibitor pentoxifylline exhibited synergism with CDDP in killing MCF-7/E6 cells but did not affect sensitivity of the control cells. Moreover, pentoxifylline inhibited G2 checkpoint function to a greater extent in MCF-7/E6 than in the parental cells. These results suggested that, in the absence of p53 function, cancer cells are more vulnerable to G2 checkpoint abrogators. Our results show that a combination of CDDP and pentoxifylline is capable of synergistic
1994-01-01
Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have
Smoking, p53 Mutation, and Lung Cancer
Gibbons, Don L.; Byers, Lauren A.; Kurie, Jonathan M.
2014-01-01
This issue marks the 50th Anniversary of the release of the U.S. Surgeon General’s Report on Smoking and Health. Perhaps no other singular event has done more to highlight the effects of smoking on the development of cancer. Tobacco exposure is the leading cause of cancers involving the oral cavity, conductive airways and the lung. Owing to the many carcinogens in tobacco smoke, smoking-related malignancies have a high genome-wide burden of mutations, including in the gene encoding for p53. The p53 protein is the most frequently mutated tumor suppressor in cancer, responsible for a range of critical cellular functions that are compromised by the presence of a mutation. Herein we review the epidemiologic connection between tobacco exposure and cancer, the molecular basis of p53 mutation in lung cancer, and the normal molecular and cellular roles of p53 that are abrogated during lung tumor development and progression as defined by in vitro and in vivo studies. We also consider the therapeutic potential of targeting mutant p53 in a clinical setting based upon the cellular role of mutant p53 and data from genetic murine models. PMID:24442106
Lai, Jonathan H; Fleming, Kirsten E; Ly, Thai Yen; Pasternak, Sylvia; Godlewski, Marek; Doucette, Steve; Walsh, Noreen M
2015-09-01
Merkel cell polyomavirus is of oncogenic significance in approximately 80% of Merkel cell carcinomas. Morphological subcategories of the tumor differ in regard to viral status, the rare combined type being uniformly virus negative and the predominant pure type being mainly virus positive. Indications that different biological subsets of the tumor exist led us to explore this diversity. In an Eastern Canadian cohort of cases (75 patients; mean age, 76 years [range, 43-91]; male/female ratio, 43:32; 51 [68%] pure and 24 [34%] combined tumors), we semiquantitatively compared the immunohistochemical expression of 3 cellular proteins (p53, Bcl-2, and c-kit) in pure versus combined groups. Viral status was known in a subset of cases. The significant overexpression of p53 in the combined group (mean [SD], 153.8 [117.8] versus 121.6 [77.9]; P = .01) and the increased epidermal expression of this protein (p53 patches) in the same group lend credence to a primary etiologic role for sun damage in these cases. Expression of Bcl-2 and c-kit did not differ significantly between the 2 morphological groups. A relative increase in c-kit expression was significantly associated with a virus-negative status (median [interquartile range], 100 [60-115] versus 70 [0-100]; P = .03). Emerging data reveal divergent biological pathways in Merkel cell carcinoma, each with a characteristic immunohistochemical profile. Virus-positive tumors (all pure) exhibit high retinoblastoma protein and low p53 expression, whereas virus-negative cases (few pure and all combined) show high p53 and relatively high c-kit expression. The potential biological implications of this dichotomy call for consistent stratification of these tumors in future studies. Copyright © 2015 Elsevier Inc. All rights reserved.
Kraljević Pavelić, Sandra; Marjanović, Marko; Poznić, Miroslav; Kralj, Marijeta
2009-12-01
p53 gene plays a crucial role in the response to therapy. Since it is inactivated in the majority of human cancers, it is strongly believed that the p53 mutations confer resistance to therapeutics. In this paper we analyzed the influence of two mechanistically diverse antitumor agents--cisplatin and methotrexate on the proliferation and cell cycle of two head and neck squamous cancer cell lines HEp-2 (wild type p53 gene, but HPV 18/E6-inactivated protein) and CAL 27 (mutated p53 gene), along with the influence of adenovirally mediated p53 overexpression in modulation of cisplatin and methoterexate effects, whereby subtoxic vector/compound concentrations were employed. p53 gene was introduced into tumor cells using adenoviral vector (AdCMV-p53). The cell cycle perturbations were measured by two parameter flow cytometry. The expression of p53, p21(WAF1/CIP1) and cyclin B1 proteins was examined using immunocytochemistry and western blot methods. In CAL 27 cells overexpression of p53 completely abrogated high S phase content observed in methotrexate-treated cells into a G1 and slight G2 arrest, while it sustained G2 arrest of the cells treated with cisplatin, along with the reduction of DNA synthesis and cyclin B1 expression. On the other hand, in HEp-2 cell line p53 overexpression slightly slowed down the progression through S phase in cells treated with methotrexate, decreased the cyclin B1 expression only after 24 h, and failed to sustain the G2 arrest after treatment with cisplatin alone. Instead, it increased the population of S phase cells that were not actively synthesizing DNA, sustained cyclin B1 expression and allowed the G2 cells to progress through mitosis. This study demonstrates that adenovirally mediated p53 overexpression at sub-cytotoxic levels enhanced the activity of low doses of cisplatin and methotrexate in HEp-2 and CAL 27 cells through changes in the cell cycle. However, the mechanisms of these effects differ depending on the genetic context and
Kanemitsu, H; Yamauchi, H; Komatsu, M; Yamamoto, S; Okazaki, S; Uchida, K; Nakayama, H
2009-01-01
6-mercaptopurine (6-MP), a DNA-damaging agent, induces apoptosis of neural progenitor cells, and causes malformation in the fetal brain. The aim of the present study is to clarify the molecular pathway of 6-MP-induced apoptosis of neural progenitor cells in the fetal telencephalon of rats and mice. p53 protein is activated by DNA damage and induces apoptosis through either the intrinsic pathway involving the mitochondria or the extrinsic pathway triggered by death receptors. In this study, the expression of puma and cleaved caspase-9 proteins, which are specific intrinsic pathway factors, increased in the rat telencephalon after 6-MP treatment. 6-MP-induced apoptosis of neural progenitor cells was completely absent in p53-deficient mice. On the other hand, the expression of Fas protein, an extrinsic pathway factor, did not change throughout the experimental period in the rat telencephalon treated with 6-MP. The number of apoptotic neural progenitor cells was similar among Fas-mutated lpr/lpr and wild-type mice, suggesting that the Fas pathway does not play a significant role in 6-MP-induced apoptosis of neural progenitor cells. These results may suggest that the p53-mediated intrinsic pathway is essential for 6-MP-induced apoptosis of neural progenitor cells in the developing telencephalon of rats and mice.
The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.
Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang
2017-05-01
This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Parroche, Peggy; Institut Federatif de Recherche 128 BioSciences Gerland-Lyon Sud; Touka, Majid
2011-09-01
HPV16 E6 deregulates G1/S cell cycle progression through p53 degradation preventing transcription of the CDK inhibitor p21{sup WAF1}. However, additional mechanisms independent of p53 inactivation appear to exist. Here, we report that HPV16 E6 targets the cellular factor p150{sup Sal2}, which positively regulates p21{sup WAF1} transcription. HPV16 E6 associates with p150{sup Sal2}, inducing its functional inhibition by preventing its binding to cis elements on the p21{sup WAF1} promoter. A HPV16 E6 mutant, L110Q, which was unable to bind p150{sup Sal2}, did not affect the ability of the cellular protein to bind p21{sup WAF1} promoter, underlining the linkage between these events.more » These data describe a novel mechanism by which HPV16 E6 induces cell cycle deregulation with a p53-independent pathway. The viral oncoprotein targets p150{sup Sal2}, a positive transcription regulator of p21{sup WAF1} gene, preventing G1/S arrest and allowing cellular proliferation and efficient viral DNA replication.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuan, Man I; O’Dowd, John M.; Fortunato, Elizabeth
Our electron microscopy study (Kuan et al., 2016) found HCMV nuclear capsid egress was significantly reduced in p53 knockout cells (p53KOs), correlating with inhibited formation of infoldings of the inner nuclear membrane (IINMs). Molecular examination of these phenomena has found p53KOs expressed UL97 and phosphorylated lamins, however the lamina failed to remodel. The nuclear egress complex (NEC) protein UL50 was expressed in almost all cells. UL50 re-localized to the inner nuclear membrane (INM) in ~90% of wt cells, but only ~35% of p53KOs. UL53 expression was significantly reduced in p53KOs, and cells lacking UL50 nuclear staining, expressed no UL53. Re-introductionmore » of p53 into p53KOs largely recovered UL53 positivity and UL50 nuclear re-localization. Nuclear rim located UL50/53 puncta, which co-localized with the major capsid protein, were largely absent in p53KOs. We believe these puncta were IINMs. In the absence of p53, UL53 expression was inhibited, disrupting formation of the NEC/IINMs, and reducing functional virion secretion. -- Highlights: •Phosphorylated nuclear lamins were inefficiently remodeled in p53KO cells. •p53KO cells expressed UL50, but it was not efficiently targeted to the nuclear rim. •UL53 was not expressed in the large majority of p53KO cells. •Cells failing to express UL53 did not localize UL50 to the nucleus. •NEC puncta/infoldings of the inner nuclear membrane were scarce in p53KO cells.« less
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
Wild-type myoblasts rescue the ability of myogenin-null myoblasts to fuse in vivo.
Myer, A; Wagner, D S; Vivian, J L; Olson, E N; Klein, W H
1997-05-15
Skeletal muscle is formed via a complex series of events during embryogenesis. These events include commitment of mesodermal precursor cells, cell migration, cell-cell recognition, fusion of myoblasts, activation of structural genes, and maturation. In mice lacking the bHLH transcription factor myogenin, myoblasts are specified and positioned correctly, but few fuse to form multinucleated fibers. This indicates that myogenin is critical for the fusion process and subsequent differentiation events of myogenesis. To further define the nature of the myogenic defects in myogenin-null mice, we investigated whether myogenin-null myoblasts are capable of fusing with wild-type myoblasts in vivo using chimeric mice containing mixtures of myogenin-null and wild-type cells. Chimeric embryos demonstrated that myogenin-null myoblasts readily fused in the presence of wild-type myoblasts. However, chimeric myofibers did not express wild-type levels of muscle-specific gene products, and myofibers with a high percentage of mutant nuclei appeared abnormal, suggesting that the wild-type nuclei could not fully rescue mutant nuclei in the myofibers. These data demonstrate that myoblast fusion can be uncoupled from complete myogenic differentiation and that myogenin regulates a specific subset of genes with diverse function. Thus, myogenin appears to control not only transcription of muscle structural genes but also the extracellular environment in which myoblast fusion takes place. We propose that myogenin regulates the expression of one or more extracellular or cell surface proteins required to initiate the muscle differentiation program.
Chen, Bo; Simpson, Dennis A.; Zhou, Yingchun; Mitra, Amritava; Mitchell, David L.; Cordeiro-Stone, Marila; Kaufmann, William K.
2015-01-01
After treatment with ultraviolet radiation (UV), human fibroblasts that express the HPV type 16 E6 oncoprotein display defects in repair of cyclobutane pyrimidine dimers, hypersensitivity to inactivation of clonogenic survival and an inability to sustain DNA replication. To determine whether these effects are specific to depletion of p53 or inactivation of its function, fibroblast lines were constructed with ectopic expression of a dominant-negative p53 allele (p53-H179Q) to inactivate function or a short-hairpin RNA (p53-RNAi) to deplete expression of p53. Only the expression of HPV16E6 sensitized fibroblasts to UV or the chemical carcinogen, benzo[a]pyrene diolepoxide I (BPDE). Carcinogen-treated cells expressing p53-H179Q or p53-RNAi were resistant to inactivation of colony formation and did not suffer replication arrest. CHK1 is a key checkpoint kinase in the response to carcinogen-induced DNA damage. Control and p53-RNAi-expressing fibroblasts displayed phosphorylation of Ser345 on CHK1 45–120 min after carcinogen treatment with a return to near baseline phosphorylation by 6 h after treatment. HPV16E6-expressing fibroblasts displayed enhanced and sustained phosphorylation of CHK1. This was associated with enhanced phosphorylation of Thr68 on CHK2 and Ser139 on H2AX, both markers of severe replication stress and DNA double strand breaks. Incubation with the phosphatase inhibitor okadaic acid produced more phosphorylation of CHK1 in UV-treated HPV16E6-expressing cells than in p53-H179Q-expressing cells suggesting that HPV16E6 may interfere with the recovery of coupled DNA replication at replication forks that are stalled at [6-4]pyrimidine-pyrimidone photoproducts and BPDE-DNA adducts. The results indicate that HPV16E6 targets a protein or proteins other than p53 to deregulate the activity of CHK1 in carcinogen-damaged cells. PMID:19411857
Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L
2018-05-31
The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
NASA Astrophysics Data System (ADS)
Lee, Changmin; An, Youngseo; Choi, Sungho; Kim, Hyoungsub
2018-06-01
The number of atomic layer deposition (ALD) cycles for ZnO treatment was changed to study its merits and demerits as a passivation layer prior to the deposition of a HfO2 film on a p-type In0.53Ga0.47As substrate. Even a few cycles of ZnO ALD treatment was effective in improving the capacitance–voltage (C–V) characteristics by suppressing strong Fermi-level pinning, which occurred because of a high interface state density near the lower half of the In0.53Ga0.47As band gap. Increases in the number of ZnO ALD cycles induced an increase in the minimum capacitance and response of minority carriers at higher frequencies in the inversion region of the C–V characteristics. According to various temperature- and frequency-dependent C–V analyses, these changes were explained by the shallow p-type doping effect of Zn atoms in the In0.53Ga0.47As substrate. As a disadvantage, ZnO ALD treatment caused a slight increase in the dielectric leakage current.
Transcriptional specificity in various p53-mutant cells.
Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi
2013-03-01
Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.
Treatment of acute lung injury by targeting MG53-mediated cell membrane repair
Lieber, Gissela; Nishi, Miyuki; Yan, Rosalie; Wang, Zhen; Yao, Yonggang; Li, Yu; Whitson, Bryan A.; Duann, Pu; Li, Haichang; Zhou, Xinyu; Zhu, Hua; Takeshima, Hiroshi; Hunter, John C.; McLeod, Robbie L.; Weisleder, Noah; Zeng, Chunyu; Ma, Jianjie
2014-01-01
Injury to lung epithelial cells has a role in multiple lung diseases. We previously identified mitsugumin 53 (MG53) as a component of the cell membrane repair machinery in striated muscle cells. Here we show that MG53 also has a physiological role in the lung and may be used as a treatment in animal models of acute lung injury. Mice lacking MG53 show increased susceptibility to ischemia-reperfusion and over-ventilation induced injury to the lung when compared with wild type mice. Extracellular application of recombinant human MG53 (rhMG53) protein protects cultured lung epithelial cells against anoxia/reoxygenation-induced injuries. Intravenous delivery or inhalation of rhMG53 reduces symptoms in rodent models of acute lung injury and emphysema. Repetitive administration of rhMG53 improves pulmonary structure associated with chronic lung injury in mice. Our data indicate a physiological function for MG53 in the lung and suggest that targeting membrane repair may be an effective means for treatment or prevention of lung diseases. PMID:25034454
Yao, Pei-Li; Chen, Liping; Dobrzański, Tomasz P; Zhu, Bokai; Kang, Boo-Hyon; Müller, Rolf; Gonzalez, Frank J; Peters, Jeffrey M
2017-05-01
Neuroblastoma is a common childhood cancer typically treated by inducing differentiation with retinoic acid (RA). Peroxisome proliferator-activated receptor-β/δ, (PPARβ/δ) is known to promote terminal differentiation of many cell types. In the present study, PPARβ/δ was over-expressed in three human neuroblastoma cell lines, NGP, SK-N-BE(2), and IMR-32, that exhibit high, medium, and low sensitivity, respectively, to retinoic acid-induced differentiation to determine if PPARβ/δ and retinoic acid receptors (RARs) could be jointly targeted to increase the efficacy of treatment. All-trans-RA (atRA) decreased expression of SRY (sex determining region Y)-box 2 (SOX2), a stem cell regulator and marker of de-differentiation, in NGP and SK-N-BE(2) cells with inactive or mutant tumor suppressor p53, respectively. However, atRA did not suppress SOX2 expression in IMR-32 cells carrying wild-type p53. Over-expression and/or ligand activation of PPARβ/δ reduced the average volume and weight of ectopic tumor xenografts from NGP, SK-N-BE(2), or IMR-32 cells compared to controls. Compared with that found with atRA, PPARβ/δ suppressed SOX2 expression in NGP and SK-N-BE(2) cells and ectopic xenografts, and was also effective in suppressing SOX2 expression in IMR-32 cells that exhibit higher p53 expression compared to the former cell lines. Combined, these observations demonstrate that activating or over-expressing PPARβ/δ induces cell differentiation through p53- and SOX2-dependent signaling pathways in neuroblastoma cells and tumors. This suggests that combinatorial activation of both RARα and PPARβ/δ may be suitable as an alternative therapeutic approach for RA-resistant neuroblastoma patients. Published [2016]. This article is a U.S. Government work and is in the public domain in the USA.
Salih, Barik A; Gucin, Zuhal; Bayyurt, Nizamettin
2013-09-16
Helicobacter pylori cause damage to gastric epithelial cells and alterations in the p53 gene that lead to cancer development. This study aimed to determine the correlation of p53 expression with H. pylori using immunohistochemistry, RFLP-PCR, and histopathology. Gastric biopsy samples from gastric cancer (GC) (n = 54) and gastritis (n = 31) patients were examined for histopathological changes and expression of p53 protein by immunohistochemistry. Immunohistochemical analysis of p53 protein expression in H. pylori-positive GC sections showed an average of 44.3% positive cells in tumors and 6.9% in normal tissues, as compared to 16.4% and 4.4% in H. pylori-negative sections. P53 expression showed significant association with H. pylori (P = 0.005), invasion depth (P = 0.029) and inflammation reaction (P = 0.008). In gastritis sections, no difference in the average p53 staining in H. pylori-positive or -negative sections was seen. PCR-RFLP results also showed no difference in genotype frequencies of p53 in H. pylori-positive or -negative gastritis sections. Histopathology study of H. pylori-positive GC sections showed that 97.2% were the intestinal type and 2.8% the diffuse type, while in H. pylori-negative sections 35.2% were the intestinal type and 64.8% the diffuse type. Biopsy sections from H. pylori-positive gastritis patients revealed more severe inflammation than those of H. pylori-negative patients. Our results show that H. pylori infection affects p53 expression in GC. The average p53 expression was significantly higher in tumor than in normal tissues. In gastritis sections p53 expression was significantly associated with H. pylori.
The nucleolus directly regulates p53 export and degradation.
Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P
2011-09-05
The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.
Immunohistochemical analysis of P53 protein in odontogenic cysts
Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.
2010-01-01
The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493
The Role of JMY in p53 Regulation.
Adighibe, Omanma; Pezzella, Francesco
2018-05-31
Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.
Meng, X; Carlson, NR; Dong, J; Zhang, Y
2016-01-01
The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly similar paces with median survival around 10 and 11 weeks, respectively, compared to 20 weeks for Eμ-myc transgenic mice. Because p19Arf can inhibit ribosomal biogenesis through its interaction with nucleophosmin (NPM/B23), RNA helicase DDX5 and RNA polymerase I transcription termination factor (TTF-I), it has been speculated that the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 pathways might be a single p19Arf–RP–Mdm2–p53 pathway, in which p19Arf activates p53 by inhibiting RP biosynthesis; thus, p19Arf deletion or Mdm2C305F mutation would result in similar consequences. Here, we generated mice with concurrent p19Arf deletion and Mdm2C305F mutation and investigated the compound mice for tumorigenesis in the absence and the presence of oncogenic c-Myc overexpression. In the absence of Eμ-myc transgene, the Mdm2C305F mutation did not elicit spontaneous tumors in mice, nor did it accelerate spontaneous tumors in mice with p19Arf deletion. In the presence of Eμ-myc transgene, however, Mdm2C305F mutation significantly accelerated p19Arf deletion-induced lymphomagenesis and promoted rapid metastasis. We found that when p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways are independently disrupted, oncogenic c-Myc-induced p53 stabilization and activation is only partially attenuated. When both pathways are concurrently disrupted, however, c-Myc-induced p53 stabilization and activation are essentially obliterated. Thus, the p19Arf–Mdm2–p53 and the RP–Mdm2–p53
Nguyen, David H.; Ouyang, Haoxu; Mao, Jian-Hua; ...
2014-12-01
Age and physiologic status, such as menopause, are risk factors for breast cancer. Less clear is what factors influence the diversity of breast cancer. In this study, we investigated the effect of host age on the distribution of tumor subtypes in mouse mammary chimera consisting of wild-type hosts and Trp53 nullizygous epithelium, which undergoes a high rate of neoplastic transformation. Wild-type mammary glands cleared of endogenous epithelium at 3 weeks of age were subsequently transplanted during puberty (5 weeks) or at maturation (10 weeks) with syngeneic Trp53-null mammary tissue fragments and monitored for one year. Tumors arose sooner from adultmore » hosts (AH) compared with juvenile hosts (JH). However, compared with AH tumors, JH tumors grew several times faster, were more perfused, exhibited a two-fold higher mitotic index, and were more highly positive for insulin-like growth factor receptor phosphorylation. Most tumors in each setting were estrogen receptor (ER)-positive (80% JH vs. 70% AH), but JH tumors were significantly more ER-immunoreactive (P = 0.0001) than AH tumors. A differential expression signature (JvA) of juvenile versus adult tumors revealed a luminal transcriptional program. Centroids of the human homologs of JvA genes showed that JH tumors were more like luminal A tumors and AH tumors were more like luminal B tumors. Hierarchical clustering with the JvA human ortholog gene list segregated luminal A and luminal B breast cancers across datasets. Lastly, these data support the notion that age-associated host physiology greatly influences the intrinsic subtype of breast cancer.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nguyen, David H.; Ouyang, Haoxu; Mao, Jian-Hua
Age and physiologic status, such as menopause, are risk factors for breast cancer. Less clear is what factors influence the diversity of breast cancer. In this study, we investigated the effect of host age on the distribution of tumor subtypes in mouse mammary chimera consisting of wild-type hosts and Trp53 nullizygous epithelium, which undergoes a high rate of neoplastic transformation. Wild-type mammary glands cleared of endogenous epithelium at 3 weeks of age were subsequently transplanted during puberty (5 weeks) or at maturation (10 weeks) with syngeneic Trp53-null mammary tissue fragments and monitored for one year. Tumors arose sooner from adultmore » hosts (AH) compared with juvenile hosts (JH). However, compared with AH tumors, JH tumors grew several times faster, were more perfused, exhibited a two-fold higher mitotic index, and were more highly positive for insulin-like growth factor receptor phosphorylation. Most tumors in each setting were estrogen receptor (ER)-positive (80% JH vs. 70% AH), but JH tumors were significantly more ER-immunoreactive (P = 0.0001) than AH tumors. A differential expression signature (JvA) of juvenile versus adult tumors revealed a luminal transcriptional program. Centroids of the human homologs of JvA genes showed that JH tumors were more like luminal A tumors and AH tumors were more like luminal B tumors. Hierarchical clustering with the JvA human ortholog gene list segregated luminal A and luminal B breast cancers across datasets. Lastly, these data support the notion that age-associated host physiology greatly influences the intrinsic subtype of breast cancer.« less
Involvement of stromal p53 in tumor-stroma interactions
Bar, Jair; Moskovits, Neta; Oren, Moshe
2009-01-01
p53 is a major tumor-suppressor gene, inactivated by mutations in about half of all human cancer cases, and probably incapacitated by other means in most other cases. Most research regarding the role of p53 in cancer has focused on its ability to elicit apoptosis or growth arrest of cells that are prone to become malignant owing to DNA damage or oncogene activation, i.e. cell-autonomous activities of p53. However, p53 activation within a cell can also exert a variety of effects upon neighboring cells, through secreted factors and paracrine and endocrine mechanisms. Of note, p53 within cancer stromal cells can inhibit tumor growth and malignant progression. Cancer cells that evolve under this inhibitory influence acquire mechanisms to silence stromal p53, either by direct inhibition of p53 within stromal cells, or through pressure for selection of stromal cells with compromised p53 function. Hence, activation of stromal p53 by chemotherapy or radiotherapy might be part of the mechanisms by which these treatments cause cancer regression. However, in certain circumstances, activation of stromal p53 by cytotoxic anti-cancer agents might actually promote treatment resistance, probably through stromal p53-mediated growth arrest of the cancer cells or through protection of the tumor vasculature. Better understanding of the underlying molecular mechanisms is thus required. Hopefully, this will allow their manipulation towards better inhibition of cancer initiation, progression and metastasis. PMID:19914385
Sur, Monalisa; Sur, Ranjan K; Cooper, Kum; Bizos, Damon
2003-02-01
Pre-brachytherapy biopsies and post-brachytherapy oesophagectomy specimens of 10 patients with early squamous cell carcinoma of the middle third of the oesophagus were examined for the expression of p53, bcl-2 and apoptosis using immunohistochemical markers. There was no expression of p53 in one patient in both pre- and post-brachytherapy specimens. In 8 patients, p53 staining was strongly positive (3+) with approximately 50% or more cells, and with diffuse and no specific pattern in the pre-brachytherapy biopsies. The tumour areas of the post-brachytherapy specimens of this group showed strong 3+ positivity with p53 (10-50% positive cell count), with the pattern being focal and peripheral in the tumour islands. The centre of the tumour islands showed necrosis and/or keratinisation. In one patient, the pre-brachytherapy biopsy showed expression of p53 while the post-brachytherapy specimen was negative. bcl-2 expression in both pre- and post-brachytherapy was equivocal and inconclusive in both the pre- and post-brachytherapy specimens. Apoptosis was negative in all the pre- and post-brachytherapy tissue sections in the presence of positive controls. Brachytherapy does not cause cell death by apoptosis but by necrosis and maturation of the cells into better differentiated cells, which is caused by OH free radical, and induction of the keratin gene respectively. It is possible that brachytherapy may cause destruction of cells containing wild-type p53, while mutant p53 in cells located at the tumour periphery escape the effect of brachytherapy. This may be responsible for the high incidence of local recurrence and distant metastasis in oesophageal cancer treated with radiotherapy. There is no effect of brachytherapy on bcl-2 expression in oesophageal cancer.
P53 Suppression of Homologous Recombination and Tumorigenesis
2013-01-01
absence or mutation of p53 and the mechanism of p53 control of HR in an in vivo system. p53 is often a targeted therapy and further insight into the...function of p53 in DNA repair pathways can be vital to finding novel points of targeted therapy . Our data will add insight to the important paradigm...cancers. Cisplatin works by the aquation of a chloride ligand that results in the formation of a DNA adduct, usually crosslinking the DNA, which impedes
The Transcription Factor p53 Influences Microglial Activation Phenotype
Jayadev, Suman; Nesser, Nicole K.; Hopkins, Stephanie; Myers, Scott J.; Case, Amanda; Lee, Rona J.; Seaburg, Luke A.; Uo, Takuma; Murphy, Sean P.; Morrison, Richard S.; Garden, Gwenn A.
2011-01-01
Several neurodegenerative diseases are influenced by the innate immune response in the central nervous system (CNS). Microglia, have pro-inflammatory and subsequently neurotoxic actions as well as anti-inflammatory functions that promote recovery and repair. Very little is known about the transcriptional control of these specific microglial behaviors. We have previously shown that in HIV associated neurocognitive disorders (HAND), the transcription factor p53 accumulates in microglia and that microglial p53 expression is required for the in vitro neurotoxicity of the HIV coat glycoprotein gp120. These findings suggested a novel function for p53 in regulating microglial activation. Here we report that in the absence of p53, microglia demonstrate a blunted response to interferon-γ, failing to increase expression of genes associated with classical macrophage activation or secrete pro-inflammatory cytokines. Microarray analysis of global gene expression profiles revealed increased expression of genes associated with anti-inflammatory functions, phagocytosis and tissue repair in p53 knockout (p53−/−) microglia compared with those cultured from strain matched p53 expressing (p53+/+) mice. We further observed that p53−/− microglia demonstrate increased phagocytic activity in vitro and expression of markers for alternative macrophage activation both in vitro and in vivo. In HAND brain tissue, the alternative activation marker CD163 was expressed in a separate subset of microglia than those demonstrating p53 accumulation. These data suggest that p53 influences microglial behavior, supporting the adoption of a pro-inflammatory phenotype, while p53 deficiency promotes phagocytosis and gene expression associated with alternative activation and anti-inflammatory functions. PMID:21598312
Relationships between p53 mutation, HPV status and outcome in oropharyngeal squamous cell carcinoma.
Hong, Angela; Zhang, Xiaoying; Jones, Deanna; Veillard, Anne-Sophie; Zhang, Mei; Martin, Andrew; Lyons, J Guy; Lee, C Soon; Rose, Barbara
2016-02-01
This study aimed to examine the rate and type of p53 mutation in oropharyngeal cancer (OSCC). Relationships were sought between human papillomavirus (HPV) status and p53 mutation. The role of p53 mutation as a prognostic factor independent of HPV status and as a modifier of the effect of HPV on outcomes was also examined. The HPV status of 202 cases was determined by HPV DNA by RT-PCR and p16 immunohistochemistry. P53 mutation in exon 5-8 was determined by pyrosequencing. Findings were correlated with known clinicopathological factors and outcomes. 48% of the cases were HPV positive and they were significantly less likely to have a p53 mutation than HPV-negative OSCCs (25.8% vs 46.7%, p=0.0021). Mutation was most common in exon 5. Among patients with HPV-positive OSCC, there was no significant difference in p53 mutation by smoking status (22.2% for never smokers and 30.8% for current or ex-smokers). Patients with p53 mutant OSCC had significantly worse overall survival (p=0.01). There was no statistical evidence that p53 mutation modified the effect of HPV status on outcomes. In the multivariate analysis, positive HPV status remained the strongest predictor of outcomes. p53 mutation status was not a significant predictor of outcome after adjusting for age, gender, T stage, N stage and HPV status. In summary, HPV-positive OSCC are less likely to have mutant p53 than HPV-negative OSCC. Our study did not show any evidence that p53 mutation could modify the effect of HPV status on outcomes. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Sakitani, Kosuke; Hirata, Yoshihiro; Hikiba, Yohko; Hayakawa, Yoku; Ihara, Sozaburo; Suzuki, Hirobumi; Suzuki, Nobumi; Serizawa, Takako; Kinoshita, Hiroto; Sakamoto, Kei; Nakagawa, Hayato; Tateishi, Keisuke; Maeda, Shin; Ikenoue, Tsuneo; Kawazu, Shoji; Koike, Kazuhiko
2015-10-24
Although some molecularly targeted drugs for colorectal cancer are used clinically and contribute to a better prognosis, the current median survival of advanced colorectal cancer patients is not sufficient. Autophagy, a basic cell survival mechanism mediated by recycling of cellular amino acids, plays an important role in cancer. Recently, autophagy has been highlighted as a promising new molecular target. The unfolded protein response (UPR) reportedly act in complementary fashion with autophagy in intestinal homeostasis. However, the roles of UPR in colon cancer under autophagic inhibition remain to be elucidated. We aim to clarify the inhibitory effect of autophagy on colon cancer. We crossed K19 (CreERT) and Atg5 (flox/flox) mice to generate Atg5 (flox/flox)/K19 (CreERT) mice. Atg5 (flox/flox)/K19 (CreERT) mice were first treated with azoxymethane/dextran sodium sulfate and then injected with tamoxifen to inhibit autophagy in CK19-positive epithelial cells. To examine the anti-cancer mechanisms of autophagic inhibition, we used colon cancer cell lines harboring different p53 gene statuses, as well as small interfering RNAs (siRNAs) targeting Atg5 and immunoglobulin heavy-chain binding protein (BiP), a chaperone to aid folding of unfolded proteins. Colon tumors in Atg5 (flox/flox)/K19 (CreERT) mice showed loss of autophagic activity and decreased tumor size (the total tumor diameter was 28.1 mm in the control and 20.7 mm in Atg5 (flox/flox)/K19 (CreERT) mice, p = 0.036). We found that p53 and UPR/endoplasmic reticulum (ER) stress-related proteins, such as cleaved caspase 3, and CAAT/enhancer-binding protein homologous protein, are up-regulated in colon tumors of Atg5 (flox/flox)/K19 (CreERT) mice. Although Atg5 and BiP silencing, respectively, increased apoptosis in p53 wild type cells, Atg5 silencing alone did not show the same effect on apoptosis in p53 mutant cells. However, co-transfection of Atg5 and BiP siRNAs led to increased apoptosis in p53 mutant cells
p53-Regulated Apoptosis Is Differentiation Dependent in Ultraviolet B-Irradiated Mouse Keratinocytes
Tron, Victor A.; Trotter, Martin J.; Tang, Liren; Krajewska, Maryla; Reed, John C.; Ho, Vincent C.; Li, Gang
1998-01-01
Previous studies from our laboratory, using p53 transgenic mice, have suggested that ultraviolet (UV) light-induced keratinocyte apoptosis in the skin is not affected by overexpression of mutant p53 protein. To further elucidate a possible role for p53 in UV-induced keratinocyte cell death, we now examine apoptosis in skin and isolated keratinocytes from p53 null (−/−) mice and assess the influence of cell differentiation on this process. In vivo, using this knockout model, epidermal keratinocytes in p53−/− mice exhibited only a 5.2-fold increase in apoptosis after 2000 J/m2 UVB irradiation compared with a 26.3-fold increase in normal control animals. If this p53-dependent apoptosis is important in elimination of precancerous, UV-damaged keratinocytes, then it should be active in the undifferentiated cells of the epidermal basal layer. To test this hypothesis, we examined the effect of differentiation on UV-induced apoptosis in primary cultures of murine and human keratinocytes. Apoptosis was p53-independent in undifferentiated murine keratinocytes, which exhibited relative resistance to UVB-induced killing with only a 1.5-fold increase in apoptosis in p53+/+ cells and a 1.4-fold increase in p53−/− cells. Differentiated keratinocytes, in contrast, showed a 9.4-fold UVB induction of apoptosis in p53+/+ cells, almost three times the induction observed in p53−/− cells. This UV-induced difference in apoptosis was observed when keratinocytes were cultured on type IV collagen substrate, but not on plastic alone. Western blotting of UV-irradiated, differentiated keratinocytes did not support a role for either Bax or Bcl-2 in this process. In support of these findings in mice, cell death in human cultured keratinocytes also occurred in a differentiation-associated fashion. We conclude that p53-induced apoptosis eliminates damaged keratinocytes in the differentiated cell compartment, but this mechanism is not active in the basal, undifferentiated cells and
Shirakawa, T; Gotoh, A; Gardner, T A; Kao, C; Zhang, Z J; Matsubara, S; Wada, Y; Hinata, N; Fujisawa, M; Hanioka, K; Matsuo, M; Kamidono, S
2000-01-01
Benign prostatic hyperplasia (BPH) is the most common proliferative disease affecting men. Numerous minimally invasive technologies are being developed or are currently in use to obviate the need for transurethral surgery. The goal of the present study was to develop a novel molecular based approach for the treatment of BPH using recombinant p53 adenoviral vector. The over-expression of wt-p53 can cause cell apoptosis or cell growth arrest, thus preventing the uncontrolled cell proliferation underlying BPH pathophysiology. Ad-CMV-p53, a replication-deficient recombinant adenovirus containing cytomegalovirus promoter driving p53 gene, was used. Human prostate stromal (PS) cells were evaluated for apoptosis (TUNEL assay), mRNA levels of key cell cycle regulators influencing apoptosis (p-53, Bax and Bcl-2) using quantitative RT-PCR and cytotoxicity after Ad-CMV-p53. Ad-CMV-p53 was unilaterally injected into rat ventral prostates and growth inhibition was measured by prostate weight 3 weeks after injection. In vitro exposure to Ad-CMV-p53 significantly inhibited the proliferation of PS cells, induced mRNA over-expression of both wt-p53 and Bax, and increased the proportion of apoptotic cells. A 30% decrease in average prostate weight was demonstrated in rodents after Ad-CMV-p53 injection. The results suggest that further investigation of molecular gene therapy with recombinant wt-p53 adenovirus for the treatment of BPH is warranted.
Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.
Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K
2010-12-01
Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Lin, Jinshun; Jin, Xiuli; Bu, Yiwen; Cao, Deliang; Zhang, Nannan; Li, Shangfu; Sun, Qinsheng; Tan, Chunyan; Gao, Chunmei; Jiang, Yuyang
2012-12-28
A novel approach to synthesize RITA by practical palladium-catalyzed C-C bond-forming Suzuki reactions at room temperature was developed, which was used for deriving a series of substituted tricyclic α-heteroaryl (furan/thiophene) analogues of RITA under mild conditions. These novel analogues showed notable antiproliferative activity against cancer cell lines with wild-type p53 (i.e., HCT116, A549, MCF-7 and K562), but much less activity in HCT116/p53(-/-) cells. In particular, compound 1f demonstrated promising antiproliferative activity compared to RITA, with IC(50) = 28 nM in MCF-7 vs. 54 nM for RITA, and cancer cell selectivity. Compound 1f markedly activated p53 in HCT116 cells at 100 nM, triggering apoptosis. Importantly, we found that both RITA and compound 1f induced G(0)/G(1) cell cycle arrest by up-regulating miR-34a, which in turn down-regulated the expression of cell cycle-related proteins CDK4 and E2F1. In summary, this study reports an effective synthetic approach for RITA and its analogues, and elucidates a novel antiproliferative mechanism of these compounds.
NASA Technical Reports Server (NTRS)
Moore, R.
1989-01-01
Primary roots of a starchless mutant of Arabidopsis thaliana L. are strongly graviresponsive despite lacking amyloplasts in their columella cells. The ultrastructures of calyptrogen and peripheral cells in wild-type as compared to mutant seedlings are not significantly different. The largest difference in cellular differentiation in caps of mutant and wild-type roots is the relative volume of plastids in columella cells. Plastids occupy 12.3% of the volume of columella cells in wild-type seedlings, but only 3.69% of columella cells in mutant seedlings. These results indicate that: (1) amyloplasts and starch are not necessary for root graviresponsiveness; (2) the increase in relative volume of plastids that usually accompanies differentiation of columella cells is not necessary for root graviresponsiveness; and (3) the absence of starch and amyloplasts does not affect the structure of calyptrogen (i.e. meristematic) and secretory (i.e. peripheral) cells in root caps. These results are discussed relative to proposed models for root gravitropism.
The anticancer effect of saffron in two p53 isogenic colorectal cancer cell lines
2012-01-01
Background Saffron extract, a natural product, has been shown to induce apoptosis in several tumor cell lines. Nevertheless, the p53-dependency of saffron’s mechanism of action in colon cancer remains unexplored. Material and methods In order to examine saffron’s anti-proliferative and pro-apoptotic effects in colorectal cancer cells, we treated two p53 isogenic HCT116 cell lines (HCT wildtype and HCT p53−/−) with different doses of the drug and analyzed cell proliferation and apoptosis in a time-dependent manner. MTT viability and crystal violet assays were performed in order to determine the effective dose of saffron on both cell lines. The cell cycle progress was examined by Flow cytometric analysis. Apoptosis was assessed using Annexin-PI-staining and Western Blotting for caspase 3 and PARP cleavage. Autophagy was determined by Western Blotting of the light chain 3 (LC3)-II and Beclin 1 proteins. The protein content of phospho-H2AX (γH2AX), a sensor of DNA double strand breaks, was also analyzed by Western Blotting. Results Saffron extract induced a p53-dependent pattern of cell cycle distribution with a full G2/M stop in HCT116 p53 wildtype cells. However, it induced a remarkable delay in S/G2 phase transit with entry into mitosis in HCT116 p53 −/− cells. The apoptotic Pre-G1 cell fraction as well as Annexin V staining and caspase 3 cleavage showed a more pronounced apoptosis induction in HCT116 p53 wildtype cells. Obviously, the significantly higher DNA-damage, reflected by ɣH2AX protein levels in cells lacking p53, was coped by up-regulation of autophagy. The saffron-induced LC3-II protein level was a remarkable indication of the accumulation of autophagosomes, a response to the cellular stress condition of drug treatment. Conclusions This is the first study showing the effect of saffron in HCT116 colorectal cancer cells with different p53 status. Saffron induced DNA-damage and apoptosis in both cell lines. However, autophagy has delayed the
HIPK2 modulates p53 activity towards pro-apoptotic transcription.
Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella
2009-10-14
Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co
Control of G1 arrest after DNA damage.
Kastan, M B; Kuerbitz, S J
1993-01-01
The temporal relationship between DNA damage and DNA replication may be critical in determining whether the genetic changes necessary for cellular transformation occur after DNA damage. Recent characterization of the mechanisms responsible for alterations in cell-cycle progression after DNA damage in our laboratory have implicated the p53 (tumor suppressor) protein in the G1 arrest that occurs after certain types of DNA damage. In particular, we found that levels of p53 protein increased rapidly and transiently after nonlethal doses of gamma irradiation (XRT) in hematopoietic cells with wild-type, but not mutant, p53 genes. These changes in p53 protein levels were temporally linked to a transient G1 arrest in these cells. Hematopoietic cells with mutant or absent p53 genes did not exhibit this G1 arrest, through they continued to demonstrate a G2 arrest. We recently extended these observations of a tight correlation between the status of the endogenous p53 genes and this G1 arrest after XRT and this cell-cycle alteration after XRT was then established by transfecting cells lacking endogenous p53 genes with a wild-type gene and observing acquisition of the G1 arrest and by transfecting cells processing endogenous wild-type p53 genes with a mutant p53 gene and observing loss of the G1 arrest after XRT. These observations and their significance for our understanding of the mechanisms of DNA damage-induced cellular transformation are discussed. PMID:8013425
Super p53 for Treatment of Ovarian Cancer
2016-07-01
WSLP ( polymer ) has been successfully synthesized, and a subset of adenoviral constructs have been cloned (p53, p53-CC, EGFP control). Major results...therapy, carboplatin, paclitaxel, polymeric drug delivery, polymer -adenovirus hybrid 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18...modified p53, tumor suppressor, high grade serous carcinoma, combination therapy, carboplatin, paclitaxel, polymeric drug delivery, polymer
Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death.
Garner, Elizabeth; Raj, Kenneth
2008-02-01
There have been innumerate demonstrations of p53's activity as a tumour suppressor protein with the ability to stimulate cell signalling that can lead to cell cycle arrest and cell death in the event of DNA damage. Despite the solid body of evidence to support these properties of p53, reports have emerged that suggest a role for p53 in protecting cells from cell death. Our recent report highlighted a mechanism by which p53 activity can promote cell survival in the event of DNA damage. Here we present the various mechanisms that are activated by p53 signalling that can confer protection to cells with damaged DNA and emphasise the practical and clinical implications of a more balanced and context-dependent understanding of p53's pro-apoptotic and pro-survival activities.