Science.gov

Sample records for lacking wild-type p53

  1. Phenylbutyrate Sensitizes Human Glioblastoma Cells Lacking Wild-Type P53 Function to Ionizing Radiation

    SciTech Connect

    Lopez, Carlos A. Feng, Felix Y.; Herman, Joseph M.; Nyati, Mukesh K.; Lawrence, Theodore S.; Ljungman, Mats

    2007-09-01

    Purpose: Histone deacetylase (HDAC) inhibitors induce growth arrest, differentiation, and apoptosis in cancer cells. Phenylbutyrate (PB) is a HDAC inhibitor used clinically for treatment of urea cycle disorders. Because of its low cytotoxicity, cerebrospinal fluid penetration, and high oral bioavailability, we investigated PB as a potential radiation sensitizer in human glioblastoma cell lines. Methods and Materials: Four glioblastoma cell lines were selected for this study. Phenylbutyrate was used at a concentration of 2 mM, which is achievable in humans. Western blots were used to assess levels of acetylated histone H3 in tumor cells after treatment with PB. Flow cytometry was used for cell cycle analysis. Clonogenic assays were performed to assess the effect of PB on radiation sensitivity. We used shRNA against p53 to study the role of p53 in radiosensitization. Results: Treatment with PB alone resulted in hyperacetylation of histones, confirmed by Western blot analysis. The PB alone resulted in cytostatic effects in three cell lines. There was no evidence of G{sub 1} arrest, increase in sub-G{sub 1} fraction or p21 protein induction. Clonogenic assays showed radiosensitization in two lines harboring p53 mutations, with enhancement ratios ({+-} SE) of 1.5 ({+-} 0.2) and 1.3 ({+-} 0.1), respectively. There was no radiopotentiating effect in two cell lines with wild-type p53, but knockdown of wild-type p53 resulted in radiosensitization by PB. Conclusions: Phenylbutyrate can produce p21-independent cytostasis, and enhances radiation sensitivity in p53 mutant human glioblastoma cells in vitro. This suggests the potential application of combined PB and radiotherapy in glioblastoma harboring mutant p53.

  2. Wild type p53 reactivation: from lab bench to clinic.

    PubMed

    Selivanova, Galina

    2014-08-19

    The p53 tumor suppressor is the most frequently inactivated gene in cancer. Several mouse models have demonstrated that the reconstitution of the p53 function suppresses the growth of established tumors. These facts, taken together, promote the idea of p53 reactivation as a strategy to combat cancer. This review will focus on recent advances in the development of small molecules which restore the function of wild type p53 by blocking its inhibitors Mdm2 and MdmX or their upstream regulators and discuss the impact of different p53 functions for tumor prevention and tumor eradication. Finally, the recent progress in p53 research will be analyzed concerning the role of p53 cofactors and cellular environment in the biological response upon p53 reactivation and how this can be applied in clinic. PMID:24726725

  3. Wild-type p53 protein undergoes cytoplasmic sequestration in undifferentiated neuroblastomas but not in differentiated tumors.

    PubMed Central

    Moll, U M; LaQuaglia, M; Bénard, J; Riou, G

    1995-01-01

    Neuroblastoma (NB), a tumor arising from the sympathetic nervous system, is one of the most common malignancies in childhood. Several recent reports on the p53 genotype found virtually exclusive wild-type status in primary tumors, and it was postulated that p53 plays no role in the development of NB. Here, however, we report that the vast majority of undifferentiated NBs exhibit abnormal cytoplasmic sequestration of wild-type p53. This inability of p53 to translocate to the nucleus presumably prevents the protein from functioning as a suppressor. Thirty of 31 cases (96%) of undifferentiated NB showed elevated levels of wild-type p53 in the cytoplasm of all tumor cells concomittant with a lack of nuclear staining. p53 immunoprecipitation from tumor tissues showed a 4.5- to 8-fold increase over normal protein levels. All of 10 tumors analyzed harbored wild-type p53 by direct sequencing of full-length cDNA and Southern blot. In addition, no MDM-2 gene amplification was seen in all 11 tumors analyzed. In contrast, no p53 abnormality was detected in 14 differentiated ganglioneuroblastomas and 1 benign ganglioneuroma. We conclude that loss of p53 function seems to play a major role in the tumorigenesis of undifferentiated NB. This tumor might abrogate the transactivating function of p53 by inhibiting its access to the nucleus, rather than by gene mutation. Importantly, our results suggest that (i) this could be a general mechanism for p53 inactivation not limited to breast cancer (where we first described it) and that (ii) it is found in a tumor previously not thought to be affected by p53 alteration. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7753819

  4. Germ cell tumors of the testis overexpress wild-type p53.

    PubMed Central

    Guillou, L.; Estreicher, A.; Chaubert, P.; Hurlimann, J.; Kurt, A. M.; Metthez, G.; Iggo, R.; Gray, A. C.; Jichlinski, P.; Leisinger, H. J.; Benhattar, J.

    1996-01-01

    Several recent studies have suggested that testicular germ cell tumors express high levels of wild-type p53 protein. To clarify and confirm this unexpected result, we have investigated seminomatous and nonseminomatous germ cell tumors at the genomic, mRNA, and protein levels. Thirty-five tumors were examined for p53 overexpression using antibodies directed against the p53 (PAb1801, PAb240, and CM1), mdm2 (IF2), and p21Waf1/Clp1 (EA10) proteins. Thirty-two tumors were screened for p53 mutations by single-strand conformation polymorphism analysis. Eighteen tumors were screened with a functional assay that tests the transcriptional competence of human p53 protein expressed in yeast. On frozen sections, 100, 65, 35, 73, and 0% of tumors reacted with the CM1, PAb240, PAb1801, IF2, and EA10 antibodies, respectively. No p53 mutations were detected by single-strand conformation polymorphism or by functional assay. The fact that many tumors overexpress wild-type p53 but not mdm2 rules out mdm2 overexpression as a general explanation for the presence of wild-type p53 in these tumors. The absence of p21 overexpression suggests that p53 may be unable to activate transcription of critical target genes, which may explain why the presence of wild-type p53 is tolerated in this tumor type, although the mechanism for this transcriptional inactivity remains to be established. Images Figure 1 Figure 2 PMID:8863671

  5. Wild-type and mutant p53 mediate cisplatin resistance through interaction and inhibition of active caspase-9.

    PubMed

    Chee, Jacqueline L Y; Saidin, Suzan; Lane, David P; Leong, Sai Mun; Noll, Jacqueline E; Neilsen, Paul M; Phua, Yi Ting; Gabra, Hani; Lim, Tit Meng

    2013-01-15

    The p53 gene has been implicated in many cancers due to its frequent mutations as well as mutations in other genes whose proteins directly affect p53's functions. In addition, high expression of p53 [wild-type (WT) or mutant] has been found in the cytoplasm of many tumor cells, and studies have associated these observations with more aggressive tumors and poor prognosis. Cytoplasmic mis-localization of p53 subsequently reduced its transcriptional activity and this loss-of-function (LOF) was used to explain the lack of response to chemotherapeutic agents. However, this hypothesis seemed inadequate in explaining the apparent selection for tumor cells with high levels of p53 protein, a phenomenon that suggests a gain-of-function (GOF) of these mis-localized p53 proteins. In this study, we explored whether the direct involvement of p53 in the apoptotic response is via regulation of the caspase pathway in the cytoplasm. We demonstrate that p53, when present at high levels in the cytoplasm, has an inhibitory effect on caspase-9. Concurrently, knockdown of endogenous p53 caused an increase in the activity of caspase-9. p53 was found to interact with the p35 fragment of caspase-9, and this interaction inhibits the caspase-9 activity. In a p53-null background, the high-level expression of both exogenous WT and mutant p53 increased the resistance of these cells to cisplatin, and the data showed a correlation between high p53 expression and caspase-9 inhibition. These results suggest the inhibition of caspase-9 as a potential mechanism in evading apoptosis in tumors with high-level p53 expression that is cytoplasmically localized. PMID:23255126

  6. Wild-type and mutant p53 mediate cisplatin resistance through interaction and inhibition of active caspase-9

    PubMed Central

    Chee, Jacqueline L.Y.; Saidin, Suzan; Lane, David P.; Leong, Sai Mun; Noll, Jacqueline E.; Neilsen, Paul M.; Phua, Yi Ting; Gabra, Hani; Lim, Tit Meng

    2013-01-01

    The p53 gene has been implicated in many cancers due to its frequent mutations as well as mutations in other genes whose proteins directly affect p53’s functions. In addition, high expression of p53 [wild-type (WT) or mutant] has been found in the cytoplasm of many tumor cells, and studies have associated these observations with more aggressive tumors and poor prognosis. Cytoplasmic mis-localization of p53 subsequently reduced its transcriptional activity and this loss-of-function (LOF) was used to explain the lack of response to chemotherapeutic agents. However, this hypothesis seemed inadequate in explaining the apparent selection for tumor cells with high levels of p53 protein, a phenomenon that suggests a gain-of-function (GOF) of these mis-localized p53 proteins. In this study, we explored whether the direct involvement of p53 in the apoptotic response is via regulation of the caspase pathway in the cytoplasm. We demonstrate that p53, when present at high levels in the cytoplasm, has an inhibitory effect on caspase-9. Concurrently, knockdown of endogenous p53 caused an increase in the activity of caspase-9. p53 was found to interact with the p35 fragment of caspase-9, and this interaction inhibits the caspase-9 activity. In a p53-null background, the high-level expression of both exogenous WT and mutant p53 increased the resistance of these cells to cisplatin, and the data showed a correlation between high p53 expression and caspase-9 inhibition. These results suggest the inhibition of caspase-9 as a potential mechanism in evading apoptosis in tumors with high-level p53 expression that is cytoplasmically localized. PMID:23255126

  7. Wild-type p53 and p73 negatively regulate expression of proliferation related genes.

    PubMed

    Scian, M J; Carchman, E H; Mohanraj, L; Stagliano, K E R; Anderson, M A E; Deb, D; Crane, B M; Kiyono, T; Windle, B; Deb, S P; Deb, S

    2008-04-17

    When normal cells come under stress, the wild-type (WT) p53 level increases resulting in the regulation of gene expression responsible for growth arrest or apoptosis. Here we show that elevated levels of WT p53 or its homologue, p73, inhibit expression of a number of cell cycle regulatory and growth promoting genes. Our analysis also identified a group of genes whose expression is differentially regulated by WT p53 and p73. We have infected p53-null H1299 human lung carcinoma cells with recombinant adenoviruses expressing WT p53, p73 or beta-galactosidase, and have undertaken microarray hybridization analyses to identify genes whose expression profile is altered by p53 or p73. Quantitative real-time PCR verified the repression of E2F-5, centromere protein A and E, minichromosome maintenance proteins (MCM)-2, -3, -5, -6 and -7 and human CDC25B after p53 expression. 5-Fluorouracil treatment of colon carcinoma HCT116 cells expressing WT p53 results in a reduction of the cyclin B2 protein level suggesting that DNA damage may indeed cause repression of these genes. Transient transcriptional assays verified that WT p53 repressed promoters of a number of these genes. Interestingly, a gain-of-function p53 mutant instead upregulated a number of these promoters in transient transfection. Using promoter deletion mutants of MCM-7 we have found that WT p53-mediated repression needs a minimal promoter that contains a single E2F site and surrounding sequences. However, a single E2F site cannot be significantly repressed by WT p53. Many of the genes identified are also repressed by p21. Thus, our work shows that WT p53 and p73 repress a number of growth-related genes and that in many instances this repression may be through the induction of p21. PMID:17982488

  8. Targeting Mdmx to treat breast cancers with wild-type p53

    PubMed Central

    Haupt, S; Buckley, D; Pang, J-MB; Panimaya, J; Paul, P J; Gamell, C; Takano, E A; Ying Lee, Y; Hiddingh, S; Rogers, T-M; Teunisse, A F A S; Herold, M J; Marine, J-C; Fox, S B; Jochemsen, A; Haupt, Y

    2015-01-01

    The function of the tumor suppressor p53 is universally compromised in cancers. It is the most frequently mutated gene in human cancers (reviewed). In cases where p53 is not mutated, alternative regulatory pathways inactivate its tumor suppressive functions. This is primarily achieved through elevation in the expression of the key inhibitors of p53: Mdm2 or Mdmx (also called Mdm4) (reviewed). In breast cancer (BrCa), the frequency of p53 mutations varies markedly between the different subtypes, with basal-like BrCas bearing a high frequency of p53 mutations, whereas luminal BrCas generally express wild-type (wt) p53. Here we show that Mdmx is unexpectedly highly expressed in normal breast epithelial cells and its expression is further elevated in most luminal BrCas, whereas p53 expression is generally low, consistent with wt p53 status. Inducible knockdown (KD) of Mdmx in luminal BrCa MCF-7 cells impedes the growth of these cells in culture, in a p53-dependent manner. Importantly, KD of Mdmx in orthotopic xenograft transplants resulted in growth inhibition associated with prolonged survival, both in a preventative model and also in a treatment model. Growth impediment in response to Mdmx KD was associated with cellular senescence. The growth inhibitory capacity of Mdmx KD was recapitulated in an additional luminal BrCa cell line MPE600, which expresses wt p53. Further, the growth inhibitory capacity of Mdmx KD was also demonstrated in the wt p53 basal-like cell line SKBR7 line. These results identify Mdmx growth dependency in wt p53 expressing BrCas, across a range of subtypes. Based on our findings, we propose that Mdmx targeting is an attractive strategy for treating BrCas harboring wt p53. PMID:26181202

  9. Pharmacologic activation of wild-type p53 by nutlin therapy in childhood cancer.

    PubMed

    Van Maerken, Tom; Rihani, Ali; Van Goethem, Alan; De Paepe, Anne; Speleman, Frank; Vandesompele, Jo

    2014-03-28

    A peculiar feature of several types of childhood cancer is that loss-of-function mutations of the TP53 (p53) tumor suppressor gene are uncommon, in contrast to many adult tumors. As p53 needs to be inactivated in order for tumor cells to survive and thrive, pediatric tumors typically make use of other mechanisms to keep p53 in check. One of the critical negative regulators of p53 is the MDM2 oncoprotein. Many anticancer drug development efforts in the past decade have therefore been devoted to the discovery and optimization of small molecules that selectively disrupt the interaction between MDM2 and p53, which could provide, in principle, a potent means to restore p53 function in tumor cells with wild-type p53. The nutlins are the class of selective inhibitors of the p53-MDM2 interaction that are currently most advanced in their clinical development. We review here the preclinical data that support the potential therapeutic use of nutlin drugs in the treatment of various pediatric tumors, including neuroblastoma, retinoblastoma, osteosarcoma, Ewing's sarcoma, rhabdomyosarcoma, medulloblastoma, and childhood acute lymphoblastic leukemia. PMID:24262662

  10. Induction of breast cancer in wild type p53 cells by BRCA1-IRIS overexpression.

    PubMed

    Elshamy, Wael M

    2010-08-01

    Cells ability to evade cell death and to proliferate post geno-/cell-toxic stresses, likely leads to formation of cancer. Activation of p38MAPK and p53 following these stresses help protect cells against cancer development by initiating apoptosis. The duration of p38MAPK and p53 activation is regulated by the WIP1 phosphatase. BRCA1-IRIS triggers WIP1 expression in p53-dependent and -independent manner. BRCA1-IRIS triggers the expression and cytoplasmic localization of the mRNA stabilization and translation inducer, HuR that binds p53 and PPM1D mRNA. Hence, BRCA1-IRIS overexpression inactivates p38MAPK and/or p53 by upregulating WIP1 expression. BRCA1-IRIS abrogation of the homeostatic balance maintained by p38MAPK-p53-WIP1 pathway suppressed cell death induced by a lethal dose of UVC, high dosages of etoposide or H2O2, and allowed cells to survive and proliferate post geno-/cell-toxic stresses. This mechanism represents a new link between geno-/cell-toxic stress and aggressive breast cancer formation in p53 wild-type cells. PMID:20845286

  11. Potentiation of a tumor cell susceptibility to autologous CTL killing by restoration of wild-type p53 function.

    PubMed

    Thiery, Jérôme; Dorothée, Guillaume; Haddada, Hedi; Echchakir, Hamid; Richon, Catherine; Stancou, Rodica; Vergnon, Isabelle; Benard, Jean; Mami-Chouaib, Fathia; Chouaib, Salem

    2003-06-15

    Inactivation of p53 has been implicated in many types of tumors particularly in non-small cell lung carcinoma, one of the most common cancers in which p53 mutation has been frequently identified. The aim of this study was to investigate the influence of p53 status on the regulation of tumor susceptibility to specific CTL-mediated cell death. For this purpose, we used a cytotoxic T lymphocyte clone, Heu127, able to lyse the human autologous lung carcinoma cell line, IGR-Heu, in a HLA-A2-restricted manner. Direct genomic DNA sequencing revealed that IGR-Heu expresses a mutated p53 at codon 132 of the exon 5 which results in the loss of p53 capacity to induce the expression of the p53-regulated gene product p21(waf/CIP1). Initial experiments demonstrated that IGR-Heu was resistant to Fas, TNF, and TRAIL apoptotic pathways. This correlated with the lack of p55 TNFRI, Fas, DR4, and DR5 expression. The effect of wild-type (wt) p53 restoration on the sensitization of IGR-Heu to autologous CTL clone lysis was investigated following infection of the tumor cell line with a recombinant adenovirus encoding the wt p53 (Adwtp53). We demonstrate that the restoration of wt p53 expression and function resulted in a significant potentiation of target cell susceptibility to CTL-mediated lysis. The wt p53-induced optimization of tumor cell killing by specific CTL involves at least in part Fas-mediated pathway via induction of CD95 expression by tumor cells but does not appear to interfere with granzyme B cytotoxic pathway. PMID:12794118

  12. Cholesterol Secosterol Aldehydes Induce Amyloidogenesis and Dysfunction of Wild Type Tumor Protein p53

    PubMed Central

    Nieva, Jorge; Song, Byeong-Doo; Rogel, Joseph K.; Kujawara, David; Altobel, Lawrence; Izharrudin, Alicia; Boldt, Grant E.; Grover, Rajesh K.; Wentworth, Anita D.; Wentworth, Paul

    2011-01-01

    SUMMARY Epidemiologic and clinical evidence points to an increased risk of cancer when coupled with chronic inflammation. However, the molecular mechanisms that underpin this interrelationship remain largely unresolved. Herein we show that the inflammation-derived cholesterol 5,6-secosterol aldehydes, atheronal-A (KA) and –B (ALD), but not the PUFA-derived aldehydes 4-hydroxynonenal (HNE) and 4-hydroxyhexenal (HHE), induce misfolding of wild-type p53 into an amyloidogenic form that binds thioflavin T and Congo Red dyes but cannot bind to a consensus DNA sequence. Treatment of lung carcinoma cells with KA and ALD leads to a loss of function of extracted p53, as determined by analysis of extracted nuclear protein and in activation of p21. Our results uncover a plausible chemical link between inflammation and cancer and expands the already pivotal role of p53 dysfunction and cancer risk. PMID:21802012

  13. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

    PubMed

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

    2016-04-12

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia. PMID:26959115

  14. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53

    PubMed Central

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Casanova, M. Llanos; Paramio, Jesús M.; Bravo, Ana; Ramirez, Angel

    2016-01-01

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia. PMID:26959115

  15. Dendritic cells transduced with wild-type p53 gene elicit potent anti-tumour immune responses

    PubMed Central

    Ishida, T; Chada, S; Stipanov, M; Nadaf, S; Ciernik, F I; Gabrilovich, D I; Carbone, D P

    1999-01-01

    In this study we have tested the concept of using wild-type p53 gene for immunotherapy of cancer. Dendritic cells (DC) were transduced with a human wild-type p53 containing recombinant adenovirus (Ad-p53). About a half of DC transduced with this virus expressed p53 protein by FACS analysis 48 h after infection. Mice immunized twice with Ad-p53 DC developed substantial cytotoxic T lymphocyte (CTL) responses against tumour cells expressing wild-type and different mutant human and murine p53 genes. Very low CTL responses were observed against target cells infected with control adenovirus (Ad-c). Immunization with Ad-p53 provided complete tumour protection in 85% of mice challenged with tumour cells expressing human mutant p53 and in 72.7% of mice challenged with tumour cells with murine mutant p53. Treatment with Ad-p53-transduced DC significantly slowed the growth of established tumours. Thus, DC transduced with wild-type p53 may be a promising new tool for the immunotherapy of cancer. PMID:10444254

  16. Mitochondrially targeted wild-type p53 induces apoptosis in a solid human tumor xenograft model

    PubMed Central

    Palacios, Gustavo; Crawford, Howard C.; Vaseva, Angelina; Moll, Ute M.

    2013-01-01

    Classic but also novel roles of p53 are becoming increasingly well characterized. We previously showed that ex vivo retroviral transfer of mitochondrially targeted wild type p53 (mitop53) in the Eμ-myc mouse lymphoma model efficiently induces tumor cell killing in vivo. In an effort to further explore the therapeutic potential of mitop53 for its pro-apoptotic effect in solid tumors, we generated replication-deficient recombinant human Adenovirus type 5 vectors. We show here that adenoviral delivery of mitop53 by intratumoral injection into HCT116 human colon carcinoma xenograft tumors in nude mice is surprisingly effective, resulting in tumor cell death of comparable potency to conventional p53. These apoptotic effects in vivo were confirmed by Ad5-mitop53 mediated cell death of HCT116 cells in culture. Together, these data provide encouragement to further explore the potential for novel mitop53 proteins in cancer therapy to execute the shortest known circuitry of p53 death signaling. PMID:18719383

  17. Reactivating p53 functions by suppressing its novel inhibitor iASPP: a potential therapeutic opportunity in p53 wild-type tumors

    PubMed Central

    Dong, Peixin; Ihira, Kei; Hamada, Junichi; Watari, Hidemichi; Yamada, Takahiro; Hosaka, Masayoshi; Hanley, Sharon J.B.; Kudo, Masataka; Sakuragi, Noriaki

    2015-01-01

    Although mutational inactivation of p53 is found in 50% of all human tumors, a subset of tumors display defective p53 function, but retain wild-type (WT) p53. Here, direct and indirect mechanisms leading to the loss of WT p53 activities are discussed. We summarize the oncogenic roles of iASPP, an inhibitor of WT p53, in promoting proliferation, invasion, drug or radiation-resistance and metastasis. From the therapeutic view, we highlight promising perspectives of microRNA-124, peptide and small molecules that reduce or block iASPP for the treatment of cancer. High iASPP expression enhances proliferation, aggressive behavior, the resistance to radiation/chemotherapy and correlates with poor prognosis in a range of human tumors. Overexpression of iASPP accelerates tumorigenesis and invasion through p53-dependent and p53-independent mechanisms. MicroRNA-124 directly targets iASPP and represses the growth and invasiveness of cancer cells. The disruption of iASPP-p53 interaction by a p53-derived peptide A34 restores p53 function in cancer cells. The inhibition of iASPP phosphorylation with small molecules induces p53-dependent apoptosis and growth suppression. The mechanisms underlying aberrant expression of iASPP in human tumors should be further investigated. Reactivating WT p53 functions by targeting its novel inhibitor iASPP holds promise for potential therapeutic interventions in the treatment of WT p53-containing tumors. PMID:26343523

  18. Aspirin acetylates wild type and mutant p53 in colon cancer cells: identification of aspirin acetylated sites on recombinant p53.

    PubMed

    Ai, Guoqiang; Dachineni, Rakesh; Kumar, D Ramesh; Marimuthu, Srinivasan; Alfonso, Lloyd F; Bhat, G Jayarama

    2016-05-01

    Aspirin's ability to inhibit cell proliferation and induce apoptosis in cancer cell lines is considered to be an important mechanism for its anti-cancer effects. We previously demonstrated that aspirin acetylated the tumor suppressor protein p53 at lysine 382 in MDA-MB-231 human breast cancer cells. Here, we extended these observations to human colon cancer cells, HCT 116 harboring wild type p53, and HT-29 containing mutant p53. We demonstrate that aspirin induced acetylation of p53 in both cell lines in a concentration-dependent manner. Aspirin-acetylated p53 was localized to the nucleus. In both cell lines, aspirin induced p21(CIP1). Aspirin also acetylated recombinant p53 (rp53) in vitro suggesting that it occurs through a non-enzymatic chemical reaction. Mass spectrometry analysis and immunoblotting identified 10 acetylated lysines on rp53, and molecular modeling showed that all lysines targeted by aspirin are surface exposed. Five of these lysines are localized to the DNA-binding domain, four to the nuclear localization signal domain, and one to the C-terminal regulatory domain. Our results suggest that aspirin's anti-cancer effect may involve acetylation and activation of wild type and mutant p53 and induction of target gene expression. This is the first report attempting to characterize p53 acetylation sites targeted by aspirin. PMID:26596838

  19. Wild-type p53-mediated down-modulation of interleukin 15 and interleukin 15 receptors in human rhabdomyosarcoma cells.

    PubMed Central

    De Giovanni, C.; Nanni, P.; Sacchi, A.; Soddu, S.; Manni, I.; D'Orazi, G.; Bulfone-Paus, S.; Pohl, T.; Landuzzi, L.; Nicoletti, G.; Frabetti, F.; Rossi, I.; Lollini, P. L.

    1998-01-01

    We recently reported that rhabdomyosarcoma cell lines express and secrete interleukin 15 (IL-15), a tightly regulated cytokine with IL-2-like activity. To test whether the p53-impaired function that is frequently found in this tumour type could play a role in the IL-15 production, wild-type p53 gene was transduced in the human rhabdomyosarcoma cell line RD (which harbours a mutated p53 gene), and its effect on proliferation and expression of IL-15 was studied. Arrest of proliferation was induced by wild-type p53; increased proportions of G1-arrested cells and of apoptotic cells were observed. A marked down-modulation of IL-15 expression, at both the mRNA and protein level, was found in p53-transduced cells. Because a direct effect of IL-15 on normal muscle cells has been reported, the presence of IL-15 membrane receptors was studied by cytofluorometric analysis. Rhabdomyosarcoma cells showed IL-15 membrane receptors, which are down-modulated by wild-type p53 transfected gene. In conclusion, wild-type p53 transduction in human rhabdomyosarcoma cells induces the down-modulation of both IL-15 production and IL-15 receptor expression. Images Figure 3 PMID:9862562

  20. Adenoviral-E2F-1 radiosensitizes p53{sup wild-type} and p53{sup null} human prostate cancer cells

    SciTech Connect

    Nguyen, Khanh H.; Hachem, Paul; Khor, L.-Y.; Salem, Naji; Hunt, Kelly K.; Calkins, Peter R.; Pollack, Alan . E-mail: Alan.Pollack@fccc.edu

    2005-09-01

    Purpose: E2F-1 is a transcription factor that enhances the radiosensitivity of various cell lines by inducing apoptosis. However, there are conflicting data concerning whether this enhancement is mediated via p53 dependent pathways. Additionally, the role of E2F-1 in the response of human prostate cancer to radiation has not been well characterized. In this study, we investigated the effect of Adenoviral-E2F-1 (Ad-E2F-1) on the radiosensitivity of p53{sup wild-type} (LNCaP) and p53{sup null} (PC3) prostate cancer cell lines. Methods and Materials: LNCaP and PC3 cells were transduced with Ad-E2F-1, Adenoviral-Luciferase (Ad-Luc) control vector, or Adenoviral-p53 (Ad-p53). Expression of E2F-1 and p53 was examined by Western blot analysis. Annexin V and caspase 3 + 7 assays were performed to estimate the levels of apoptosis. Clonogenic survival assays were used to determine overall cell death. Statistical significance was determined by analysis of variance, using the Bonferroni method to correct for multiple comparisons. Results: Western blot analysis confirmed the efficacy of transductions with Ad-E2F-1 and Ad-p53. Ad-E2F-1 transduction significantly enhanced apoptosis and decreased clonogenic survival in both cell lines. These effects were compounded by the addition of RT. Although E2F-1-mediated radiosensitization was independent of p53 status, this effect was more pronounced in p53{sup wild-type} LNCaP cells. When PC3 cells were treated with Ad-p53 in combination with RT and Ad-E2F-1, there was at least an additive reduction in clonogenic survival. Conclusions: Our results suggest that Ad-E2F-1 significantly enhances the response of p53{sup wild-type} and p53{sup null} prostate cancer cells to radiation therapy, although radiosensitization is more pronounced in the presence of p53. Ad-E2F-1 may be a useful adjunct to radiation therapy in the treatment of prostate cancer.

  1. The therapeutic potential of p53 reactivation by nutlin-3a in ALK+ anaplastic large cell lymphoma with wild-type or mutated p53.

    PubMed

    Drakos, E; Atsaves, V; Schlette, E; Li, J; Papanastasi, I; Rassidakis, G Z; Medeiros, L J

    2009-12-01

    p53 is expressed frequently, but is rarely mutated in anaplastic lymphoma kinase (ALK)-positive anaplastic large cell lymphoma (ALCL) tumours. Nutlin-3a is a recently developed small molecule that targets Mdm2, a critical negative regulator of p53, and disrupts the p53-Mdm2 interaction resulting in p53 stabilization and activation. We show that nutlin-3a activates p53 in ALK+ ALCL cells carrying a wild type (wt) or mutated but partially functional p53 gene resulting in p53-dependent cell-cycle arrest and apoptosis. Cell-cycle arrest was associated with upregulation of the cyclin-dependent kinase inhibitor p21. Nutlin-3a-induced apoptotic cell death was accompanied by Bax and Puma upregulation, downregulation of Bcl-xl, survivin, and caspase-3 cleavage, and this was reduced when p53-dependent transactivation activity was inhibited by pifithrin-alpha, or when pifithrin-mu was used to inhibit direct p53 targeting of mitochondria. Nutlin-3a sensitized the activation of the extrinsic apoptotic pathway in wt-p53 ALK+ ALCL cells, in part, through upregulation of DR-5 and downregulation of c-Flip(S/L), and was synergistic with TRAIL in cell death induction. In addition, nutlin-3a treatment enhanced doxorubicin cytotoxicity against ALK+ ALCL cells harbouring mt p53, and this was associated with p73 upregulation. These data suggest that disruption of the p53-mdm2 interaction by nutlin-3a offers a novel therapeutic approach for ALK+ ALCL patients. PMID:19741726

  2. TATA-less promoters of some Ets-family genes are efficiently repressed by wild-type p53.

    PubMed

    Iotsova, V; Crépieux, P; Montpellier, C; Laudet, V; Stehelin, D

    1996-12-01

    p53 has been reported to repress a number of TATA-containing promoters in transient transfection assays. TATA-less promoters are generally believed to be refractive to p53 repression. We report here that the TATA-less promoters of Ets-family genes (Ets-1 and Ets-2) are efficiently repressed by wild-type but not mutant p53 in transient co-transfection assays. Moreover, p53 was immunologically detected in protein complexes formed on oligonucleotides from both the TATA-containing and TATA-less promoters. Our data suggest that p53 is involved in the regulation of the expression of both promoter types, most probably by protein-protein interaction. A model for p53 function in promoter repression is proposed. PMID:8957074

  3. Nitric oxide-induced p53 accumulation and regulation of inducible nitric oxide synthase expression by wild-type p53.

    PubMed Central

    Forrester, K; Ambs, S; Lupold, S E; Kapust, R B; Spillare, E A; Weinberg, W C; Felley-Bosco, E; Wang, X W; Geller, D A; Tzeng, E; Billiar, T R; Harris, C C

    1996-01-01

    The tumor suppressor gene product p53 plays an important role in the cellular response to DNA damage from exogenous chemical and physical mutagens. Therefore, we hypothesized that p53 performs a similar role in response to putative endogenous mutagens, such as nitric oxide (NO). We report here that exposure of human cells to NO generated from an NO donor or from overexpression of inducible nitric oxide synthase (NOS2) results in p53 protein accumulation. In addition, expression of wild-type (WT) p53 in a variety of human tumor cell lines, as well as murine fibroblasts, results in down-regulation of NOS2 expression through inhibition of the NOS2 promoter. These data are consistent with the hypothesis of a negative feedback loop in which endogenous NO-induced DNA damage results in WT p53 accumulation and provides a novel mechanism by which p53 safeguards against DNA damage through p53-mediated transrepression of NOS2 gene expression, thus reducing the potential for NO-induced DNA damage. Images Fig. 1 Fig. 2 Fig. 3 PMID:8637893

  4. BclxL Changes Conformation upon Binding to Wild-type but Not Mutant p53 DNA Binding Domain*

    PubMed Central

    Hagn, Franz; Klein, Christian; Demmer, Oliver; Marchenko, Natasha; Vaseva, Angelina; Moll, Ute M.; Kessler, Horst

    2010-01-01

    p53 can induce apoptosis through mitochondrial membrane permeabilization by interaction of its DNA binding region with the anti-apoptotic proteins BclxL and Bcl2. However, little is known about the action of p53 at the mitochondria in molecular detail. By using NMR spectroscopy and fluorescence polarization we characterized the binding of wild-type and mutant p53 DNA binding domains to BclxL and show that the wild-type p53 DNA binding domain leads to structural changes in the BH3 binding region of BclxL, whereas mutants fail to induce such effects due to reduced affinity. This was probed by induced chemical shift and residual dipolar coupling data. These data imply that p53 partly achieves its pro-apoptotic function at the mitochondria by facilitating interaction between BclxL and BH3-only proteins in an allosteric mode of action. Furthermore, we characterize for the first time the binding behavior of Pifithrin-μ, a specific small molecule inhibitor of the p53-BclxL interaction, and present a structural model of the protein-ligand complex. A rather unusual behavior is revealed whereby Pifithrin-μ binds to both sides of the protein-protein complex. These data should facilitate the rational design of more potent specific BclxL-p53 inhibitors. PMID:19955567

  5. BclxL changes conformation upon binding to wild-type but not mutant p53 DNA binding domain.

    PubMed

    Hagn, Franz; Klein, Christian; Demmer, Oliver; Marchenko, Natasha; Vaseva, Angelina; Moll, Ute M; Kessler, Horst

    2010-01-29

    p53 can induce apoptosis through mitochondrial membrane permeabilization by interaction of its DNA binding region with the anti-apoptotic proteins BclxL and Bcl2. However, little is known about the action of p53 at the mitochondria in molecular detail. By using NMR spectroscopy and fluorescence polarization we characterized the binding of wild-type and mutant p53 DNA binding domains to BclxL and show that the wild-type p53 DNA binding domain leads to structural changes in the BH3 binding region of BclxL, whereas mutants fail to induce such effects due to reduced affinity. This was probed by induced chemical shift and residual dipolar coupling data. These data imply that p53 partly achieves its pro-apoptotic function at the mitochondria by facilitating interaction between BclxL and BH3-only proteins in an allosteric mode of action. Furthermore, we characterize for the first time the binding behavior of Pifithrin-mu, a specific small molecule inhibitor of the p53-BclxL interaction, and present a structural model of the protein-ligand complex. A rather unusual behavior is revealed whereby Pifithrin-mu binds to both sides of the protein-protein complex. These data should facilitate the rational design of more potent specific BclxL-p53 inhibitors. PMID:19955567

  6. Two Li-Fraumeni syndrome families with novel germline p53 mutations: loss of the wild-type p53 allele in only 50% of tumours.

    PubMed Central

    Sedlacek, Z.; Kodet, R.; Kriz, V.; Seemanova, E.; Vodvarka, P.; Wilgenbus, P.; Mares, J.; Poustka, A.; Goetz, P.

    1998-01-01

    We describe two Li-Fraumeni syndrome families. Family A was remarkable for two early childhood cases of adrenocortical tumours, family B for a high incidence of many characteristic cancers, including a childhood case of choroid plexus tumour. Using direct sequencing, we analysed exons 5-9 of the p53 gene in constitutional DNA of individuals from both families and found two novel germline mutations in exon 5. In family A, we detected a point substitution in codon 138 (GCC to CCC), which resulted in the replacement of the alanine by a proline residue. Family B harboured a single-base pair deletion in codon 178 (CAC to -AC), resulting in a frameshift and premature chain termination. Three out of six tumours examined from both families, a renal cell carcinoma, a rhabdomyosarcoma and a breast cancer, showed loss of heterozygosity and contained only the mutant p53 allele. The remaining three neoplasms, both adrenocortical tumours and the choroid plexus tumour retained heterozygosity. Immunohistochemistry with anti-p53 antibody confirmed accumulation of p53 protein in tumours with loss of heterozygosity, while the remaining tumours were p53 negative. These results support the view that complete loss of activity of the wild-type p53 need not be the initial event in the formation of all tumours in Li-Fraumeni individuals. Images Figure 3 PMID:9569035

  7. Combination of galectin inhibitor GCS-100 and BH3 mimetics eliminates both p53 wild type and p53 null AML cells.

    PubMed

    Ruvolo, Peter P; Ruvolo, Vivian R; Benton, Christopher B; AlRawi, Ahmed; Burks, Jared K; Schober, Wendy; Rolke, James; Tidmarsh, George; Hail, Numsen; Davis, R Eric; Andreeff, Michael

    2016-04-01

    Galectin 3 (LGALS3) expression is prognostic for poor survival in acute myeloid leukemia (AML) patients. GCS-100 is a novel galectin inhibitor that may prove useful for AML therapy. In this study, we found that GCS-100 induced apoptosis in AML cells. The agent reduced MCL-1 expression suggesting that GCS-100 could be more effective when combined with a BH3 mimetic. Indeed, potent synergistic cytotoxicity was achieved when GCS-100 was combined with ABT-737 or ABT-199. Furthermore, the GCS-100/ABT-199 combination was effective against primary AML blast cells from patients with FLT3 ITD mutations, which is another prognostic factor for poor outcome in AML. This activity may involve wild-type p53 as shRNA knockdown of LGALS3 or galectin 1 (LGALS1) sensitized wild-type p53 OCI-AML3 cells to GCS-100/ABT-737-induced apoptosis to a much greater extent than p53 null THP-1 cells. Suppression of LGALS3 by shRNA inhibited MCL-1 expression in OCI-AML3 cells, but not THP-1 cells, suggesting the induced sensitivity to ABT-737 may involve a MCL-1 mediated mechanism. OCI-AML3 cells with LGALS1 shRNA were also sensitized to ABT-737. However, these cells exhibited increased MCL-1 expression, so MCL-1 reduction is apparently not required in this process. A role for p53 appears important as GCS-100 induces p53 expression and shRNA knockdown of p53 protected OCI-AML3 cells from the cytotoxic effects of the GCS-100/ABT-737 treatment combination. Our results suggest that galectins regulate a survival axis in AML cells, which may be targeted via combined inhibition with drugs such as GCS-100 and ABT-199. PMID:26704388

  8. Accumulation of wild-type p53 protein in astrocytomas is not mediated by MDM2 gene amplification

    SciTech Connect

    Rubio, M.P.; Louis, D.N. Harvard Medical School, Boston, MA )

    1993-05-01

    The authors have previously described ten cases of astrocytoma (three WHO grade II, four grade III and four grade IV) with seemingly contradictory results on immunohistochemical analysis of the p53 protein and molecular genetic analysis of the p53 gene. Fixed, embedded tissues from these cases were immunohistochemically positive with the PAb 1801 antibody, which supposedly implies the presence of mutant protein. These ten cases, however, did not have mutations in exons 5 through 8 of the p53 gene, the conserved regions in which almost all human mutations have been described. The authors suggested that these cases might either represent overexpression of wild-type p53 protein (since the PAb 1801 antibody reacts with both wild-type and mutant p53 protein) or mutations in less conserved regions of the gene. To investigate these possibilities further, they performed single strand conformational polymorphism analysis and DNA sequencing on p53 exons 4, 9 and 10 in the nine cases with available DNA, since rare mutations have been noted at these loci. None of the cases showed alterations, making it highly unlikely that these tumors harbor mutations in exons of the p53 gene. They also performed immunohistochemistry on frozen sections from seven available tumors, using the mutant-specific antibody PAb 240 in addition to PAb 1801. All tumors continued to show positive staining with PAb 1801, but only one tumor reacted with PAb 240. The results support the hypothesis that the accumulated p53 protein in most cases is wild-type. Because the product of the MDM2 oncogene can bind to wild-type p53 protein, and because MDM2 amplification has recently been demonstrated in human tumors, the authors evaluated MDM2 amplification in the nine astrocytomas with available DNA. Using slot blot analysis with a 96-base pair, PCR-generated probe to the first exon of the MDM2 gene, they were unable to show MDM2 gene amplification in these tumors or in other assayed astrocytomas.

  9. Cellular Oxidative Stress and the Control of Apoptosis by Wild-Type p53, Cytotoxic Compounds, and Cytokines

    NASA Astrophysics Data System (ADS)

    Lotem, Joseph; Peled-Kamar, Mira; Groner, Yoram; Sachs, Leo

    1996-08-01

    Apoptosis induced by wild-type p53 or cytotoxic compounds in myeloid leukemic cells can be inhibited by the cytokines interleukin 6, interleukin 3, granulocyte-macrophage colony-stimulating factor, and interferon γ and by antioxidants. The antioxidants and cytokines showed a cooperative protective effect against induction of apoptosis. Cells with a higher sensitivity to induction of apoptosis and required a higher cytokine concentration to inhibit apoptosis. Decreasing the intrinsic oxidative stress in cells by antioxidants thus inhibited apoptosis, whereas increasing this intrinsic stress by adding H2O2 enhanced apoptosis. Induction of apoptosis by wild-type p53 was not preceded by increased peroxide production or lipid peroxidation and the protective effect of cytokines was not associated with a decrease in these properties. The results indicate that the intrinsic degree of oxidative stress can regulate cell susceptibility to wild-type p53-dependent and p53-independent induction of apoptosis and the ability of cytokines to protect cells against apoptosis.

  10. Pharmacological activation of wild-type p53 in the therapy of leukemia.

    PubMed

    Kojima, Kensuke; Ishizawa, Jo; Andreeff, Michael

    2016-09-01

    The tumor suppressor p53 is inactivated by mutations in the majority of human solid tumors. Conversely, p53 mutations are rare in leukemias and are only observed in a small fraction of the patient population, predominately in patients with complex karyotype acute myeloid leukemia or hypodiploid acute lymphoblastic leukemia. However, the loss of p53 function in leukemic cells is often caused by abnormalities in p53-regulatory proteins, including overexpression of MDM2/MDMX, deletion of CDKN2A/ARF, and alterations in ATM. For example, MDM2 inhibits p53-mediated transcription, promotes its nuclear export, and induces proteasome-dependent degradation. The MDM2 homolog MDMX is another direct regulator of p53 that inhibits p53-mediated transcription. Several small-molecule inhibitors and stapled peptides targeting MDM2 and MDMX have been developed and have recently entered clinical trials. The clinical trial results of the first clinically used MDM2 inhibitor, RG7112, illustrated promising p53 activation and apoptosis induction in leukemia cells as proof of concept. Side effects of RG7112 were most prominent in suppression of thrombopoiesis and gastrointestinal symptoms in leukemia patients. Predictive biomarkers for response to MDM2 inhibitors have been proposed, but they require further validation both in vitro and in vivo so that the accumulated knowledge concerning pathological p53 dysregulation in leukemia and novel molecular-targeted strategies to overcome this dysregulation can be translated safely and efficiently into novel clinical therapeutics. PMID:27327543

  11. Negative growth regulation in a glioblastoma tumor cell line that conditionally expresses human wild-type p53

    SciTech Connect

    Mercer, W.E.; Shields, M.T.; Amin, M.; Sauve, G.J. ); Appella, E.; Romano, J.W.; Ullrich, S.J. )

    1990-08-01

    To investigate the effect that human wild-type p53 (wt-p53) expression has on cell proliferation the authors constructed a recombinant plasmid, pM47, in which wt-p53 cDNA is under transcriptional control of the hormone-inducible mouse mammary tumor virus promoter linked to the dominant biochemical selection marker gene Eco gpt. The pM47 plasmid was introduced into T98G cells derived from a human glioblastomas multiforme tumor, and a stable clonal cell line, GM47.23, was derived that conditionally expressed wt-p53 following exposure to dexamethasone. The authors show that induction of wt-p53 expression in exponentially growing cells inhibits cell cycle progression and that the inhibitory effect is reversible upon removal of the inducer or infection with simian virus 40. Moreover, when growth-arrested cells are stimulated to proliferate, induction of wt-p53 expression inhibits G{sub 0}/G{sub 1} progression into S phase and the cells accumulate with a DNA content equivalent to cells arrested in the G{sub 0}/G{sub 1} phase of the cell cycle. Taken together, these studies suggest that wt-p53 may play a negative role in growth regulation.

  12. Exogenous p53 and ASPP2 expression enhances rAdV-TK/GCV-induced death in hepatocellular carcinoma cells lacking functional p53

    PubMed Central

    Guo, Xianghua; Wei, Feili; Yin, Jiming; Zang, Yunjin; Li, Ning; Chen, Dexi

    2016-01-01

    Suicide gene therapy using herpes simplex virus-1 thymidine kinase (HSV-TK) in combination with ganciclovir (GCV) has emerged as a potential new method for treating cancer. We hypothesize that the efficacy of HSV-TK/GCV therapy is at least partially dependent on p53 status in hepatocellular carcinoma (HCC) patients. Using recombinant adenoviral vectors (rAdV), TK, p53, and ASPP2 were overexpressed individually and in combination in Hep3B (p53 null) and HepG2 (p53 wild-type) cell lines and in primary HCC tumor cells. p53 overexpression induced death in Hep3B cells, but not HepG2 cells. ASPP2 overexpression increased rAdV-TK/GCV-induced HepG2 cell death by interacting with endogenous p53. Similarly, ASPP2 reduced survival in rAdV-TK/GCV-treated primary HCC cells expressing p53 wild-type but not a p53 R249S mutant. Mutated p53 was unable to bind to ASPP2, suggesting that the increase in rAdV-TK/GCV-induced cell death resulting from ASPP2 overexpression was dependent on its interaction with p53. Additionally, γ-H2AX foci, ATM phosphorylation, Bax, and p21 expression increased in rAdV-TK/GCV-treated HepG2 cells as compared to Hep3B cells. This suggests that the combined use of HSV-TK, GCV, rAdV-p53 and rAdV-ASPP2 may improve therapeutic efficacy in HCC patients lacking functional p53. PMID:26934443

  13. Transient transfection of a wild-type p53 gene triggers resveratrol-induced apoptosis in cancer cells.

    PubMed

    Ferraz da Costa, Danielly Cristiny; Casanova, Fabiana Alves; Quarti, Julia; Malheiros, Maitê Santos; Sanches, Daniel; Dos Santos, Patricia Souza; Fialho, Eliane; Silva, Jerson L

    2012-01-01

    Resveratrol is a promising chemopreventive agent that mediates many cellular targets involved in cancer signaling pathways. p53 has been suggested to play a role in the anticancer properties of resveratrol. We investigated resveratrol-induced cytotoxicity in H1299 cells, which are non-small lung cancer cells that have a partial deletion of the gene that encodes the p53 protein. The results for H1299 cells were compared with those for three cell lines that constitutively express wild-type p53: breast cancer MCF-7, adenocarcinomic alveolar basal epithelia A549 and non-small lung cancer H460. Cell viability assays revealed that resveratrol reduced the viability of all four of these cell lines in a dose- and time-dependent manner. MCF-7, A549 and H460 cells were more sensitive to resveratrol than were H1299 cells when exposed to the drug for 24 h at concentrations above 100 µM. Resveratrol also increased the p53 protein levels in MCF-7 cells without altering the p53 mRNA levels, suggesting a post-translational modulation of the protein. The resveratrol-induced cytotoxicity in these cells was partially mediated by p53 and involved the activation of caspases 9 and 7 and the cleavage of PARP. In H1299 cells, resveratrol-induced cytotoxicity was less pronounced and (in contrast to MCF-7 cells) cell death was not accompanied by caspase activation. These findings are consistent with the observation that MCF-7 cells were positively labeled by TUNEL following exposure to 100 µM resveratrol whereas H1299 cells under similar conditions were not labeled by TUNEL. The transient transfection of a wild-type p53-GFP gene caused H1299 cells to become more responsive to the pro-apoptotic properties of resveratrol, similarly to findings in the p53-positive MCF-7 cells. Our results suggest a possible therapeutic strategy based on the use of resveratrol for the treatment of tumors that are typically unresponsive to conventional therapies because of the loss of normal p53 function. PMID

  14. The novel tryptamine derivative JNJ-26854165 induces wild-type p53- and E2F1-mediated apoptosis in acute myeloid and lymphoid leukemias

    PubMed Central

    Kojima, Kensuke; Burks, Jared K.; Arts, Janine; Andreeff, Michael

    2010-01-01

    Development of small-molecule activators of p53 is currently focused on malignancies containing a wild-type p53 genotype, which is present in most leukemias. JNJ-26854165 is one of such p53-activating agents, but its mechanism of action remains to be elucidated. Here, we report the effects of JNJ-26854165 in acute leukemias. JNJ-26854165 treatment induced p53-mediated apoptosis in acute leukemia cells with wild-type p53, in which p53 rapidly drives transcription-independent apoptosis followed by activation of a transcription-dependent pathway. JNJ-26854165 accelerated the proteasome-mediated degradation of p21, and antagonized the transcriptional induction of p21 by p53. Interestingly, JNJ-26854165 induced S-phase delay and upregulated E2F1 expression in p53 mutant cells, resulting in apoptosis preferentially of S-phase cells. E2F1 knockdown blocked apoptosis induced by JNJ-26854165 in p53 mutant cells. Apoptotic activity of JNJ-26854165 against primary acute leukemia cells was maintained in leukemia/stroma cocultures, unlike doxorubicin, which has reduced cytrotoxicity in coculture systems. JNJ-26854165 synergizes with AraC or doxorubicin to induce p53-mediated apoptosis. Our data suggest that JNJ-26854165 may provide a novel therapeutic approach for the treatment of acute leukemias. The presence of p53-independent apoptotic activity in addition to p53-mediated apoptosis induction, if operational in vivo, may prevent the selection of p53 mutant subclones during therapy. PMID:20736344

  15. Liposome-mediated transfection of wild-type P53 DNA into human prostate cancer cells is improved by low-frequency ultrasound combined with microbubbles

    PubMed Central

    BAI, WEN-KUN; ZHANG, WEI; HU, BING; YING, TAO

    2016-01-01

    Prostate cancer is a common type of cancer in elderly men. The aim of the present study was to evaluate the effects of ultrasound exposure in combination with SonoVue microbubbles on liposome-mediated transfection of wild-type P53 genes into human prostate cancer cells. PC-3 human prostate cancer cells were exposed to ultrasound; duty cycle was controlled at 20% (2 sec on, 8 sec off) for 5 min with and without SonoVue microbubble echo-contrast agent using a digital sonifier (frequency, 21 kHz; intensity, 46 mW/cm2). The cells were divided into eight groups, as follows: Group A (SonoVue + wild-type P53), group B (ultrasound + wild-type P53), group C (SonoVue + ultrasound + wild-type P53), group D (liposome + wild-type P53), group E (liposome + SonoVue + wild-type P53), group F (liposome + wild-type P53 + ultrasound), group G (liposome + wild-type P53 + ultrasound + SonoVue) and the control group (wild-type P53). Following treatment, a hemocytometer was used to measure cell lysis, reverse transcription-quantitative polymerase chain reaction and western blotting were performed to detect P53 gene transfection efficiency, Cell Counting Kit-8 was employed to reveal cell proliferation and Annexin V/propidium iodide staining was used to determine cell apoptosis. Cell lysis was minimal in each group. Wild-type P53 gene and protein expression were significantly increased in the PC-3 cells in group G compared with the control and all other groups (P<0.01). Cell proliferation was significantly suppressed in group G compared with the control group and all other groups (P<0.01). Cell apoptosis levels in group G were significantly improved compared with the control group and all other groups (P<0.01). Thus, the results of the present study indicate that the use of low-frequency and low-energy ultrasound in combination with SonoVue microbubbles may be a potent physical method for increasing liposome gene delivery efficiency. PMID:27313702

  16. Hydroxyurea synergizes with valproic acid in wild-type p53 acute myeloid leukaemia

    PubMed Central

    Leitch, Calum; Osdal, Tereza; Andresen, Vibeke; Molland, Maren; Kristiansen, Silje; Nguyen, Xuan Nhi; Bruserud, Øystein; Gjertsen, Bjørn Tore; McCormack, Emmet

    2016-01-01

    Palliative care in acute myeloid leukaemia (AML) is inadequate. For elderly patients, unfit for intensive chemotherapy, median survival is 2–3 months. As such, there is urgent demand for low-toxic palliative alternatives. We have repositioned two commonly administered anti-leukaemia drugs, valproic acid (VPA) and hydroxyurea (HU), as a combination therapy in AML. The anti-leukemic effect of VPA and HU was assessed in multiple AML cell lines confirming the superior anti-leukemic effect of combination therapy. Mechanistic studies revealed that VPA amplified the ability of HU to slow S-phase progression and this correlated with significantly increased DNA damage. VPA was also shown to reduce expression of the DNA repair protein, Rad51. Interestingly, the tumour suppressor protein p53 was revealed to mitigate cell cycle recovery following combination induced arrest. The efficacy of combination therapy was validated in vivo. Combination treatment increased survival in OCI-AML3 and patient-derived xenograft mouse models of AML. Therapy response was confirmed by optical imaging with multiplexed near-infrared labelled antibodies. The combination of HU and VPA indicates significant potential in preclinical models of AML. Both compounds are widely available and well tolerated. We believe that repositioning this combination could significantly enhance the palliative care of patients unsuited to intensive chemotherapy. PMID:26812881

  17. Reactivation of wild-type and mutant p53 by tryptophanolderived oxazoloisoindolinone SLMP53-1, a novel anticancer small-molecule

    PubMed Central

    Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília

    2016-01-01

    Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173

  18. The MDM2 small-molecule inhibitor RG7388 leads to potent tumor inhibition in p53 wild-type neuroblastoma

    PubMed Central

    Lakoma, A; Barbieri, E; Agarwal, S; Jackson, J; Chen, Z; Kim, Y; McVay, M; Shohet, JM; Kim, ES

    2016-01-01

    Neuroblastoma is an aggressive pediatric malignancy which is >98% p53 wild-type at diagnosis. As a primary repressor of p53 activity and part of a p53-activated negative feedback loop, targeting of mouse double minute 2 homolog (MDM2) is an attractive therapeutic approach to reactivation of p53. Since development of the first selective MDM2 inhibitor, Nutlin-3a, newer compounds have been developed for increased potency and improved bioavailability. Herein, we sought to determine the efficacy and specificity of a second-generation MDM2 inhibitor, RG7388, in neuroblastoma cell lines and xenografts and examine its effect on the p53-independent pathway of hypoxia-inducible factor-1 alpha (HIF-1α)/vascular endothelial growth factor (VEGF). Cell viability and apoptosis studies were performed on the neuroblastoma cell lines, NGP, SH-SY5Y, LAN-5, LAN-5 si-p53 (p53 silenced), and SK-N-AS (p53 null). RG7388 potently decreased cell proliferation and activated p53-dependent apoptosis. Tumor-bearing mice treated with RG7388 demonstrated significant tumor inhibition by 59% in NGP (P = 0.003), 67% in SH-SY5Y (P = 0.006), and 75% in LAN-5 (P = 0.0019) p53 wild-type xenograft tumors, but no inhibitory effect on LAN-5 si-p53 or SK-N-AS p53-silenced/null xenograft tumors. Moreover, RG7388 was found to inhibit the p53-independent pathway of HIF-1α/VEGF with decreased gene expression and alteration of angiogenesis. Our study supports the further evaluation of RG7388 as a novel treatment option in p53 wild-type neuroblastoma at diagnosis and relapse. PMID:26998348

  19. A human papillomavirus type 18 E6/E7 transgene sensitizes mouse lens cells to human wild-type p53-mediated apoptosis.

    PubMed

    Nakamura, T; Williams-Simons, L; Westphal, H

    1997-06-26

    We have studied the concerted action of factors that influence the balance between cell proliferation and cell death in the developing lens of transgenic mice. We show that a human papillomavirus type 18 (HPV18) E6/E7 transgene that predominantly expresses the viral E7 gene product triggers apoptosis in a dose dependent manner, and causes retardation of lens growth or microphakia. E7 is known to inactivate pRB, the product of the retinoblastoma gene, and to enhance the action of p53. Our earlier work had demonstrated that over-expression of p53 itself can cause apoptosis of lens cells, and that a mutant p53 allele can interfere with this process. In the present study, we examined lenses that simultaneously express different constellations of the HPV18 E6/E7, wild-type and mutant human p53, and wild-type human pRB transgenes. We observed that lens cells expressing the HPV18 transgene are more sensitive to wild-type human p53 action than normal lens cells. As a result, there is severe microphakia in lenses that express both the HPV18 and the wild-type p53 transgenes. By contrast, apoptosis was reduced in lenses that co-expressed the HPV18 and either the pRB or the mutant p53 transgene. We conclude that levels of wild-type p53 are critical, and that any excess of p53 or suppression of pRB can cause cell death. Our results encourage attempts to counteract the deleterious action of human papillomaviruses in cervical cancer by a combination of measures that decrease cell proliferation and enhance apoptosis. PMID:9223662

  20. Experimental research on wild-type p53 plasmid transfected into retinoblastoma cells and tissues using an ultrasound microbubble intensifier.

    PubMed

    Luo, J; Zhou, X; Diao, L; Wang, Z

    2010-01-01

    The transfection efficiency of wild-type p53 (wtp53) was investigated in retinoblastoma (RB) Y79 cells using an ultrasound microbubble technique. A human RB nude mouse xenograft tumour model was also used to investigate whether this technique could deliver wtp53 into solid tumours. Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated that wtp53 was successfully transfected into Y79 cells in the plasmid with microbubbles and ultrasound group and in the plasmid with liposomes group, but not in the plasmid with ultrasound group or in the untreated control group. Flow cytometry showed that apoptosis was highest in the microbubbles and ultrasound group (25.58%) compared with the plasmid with liposomes group (19.50%), and the other two groups (< 10%). RT-PCR also showed that the wtp53 gene was successfully transfected into solid tumours in the plasmid with microbubbles and ultrasound group. This study provides preliminary evidence in support of a potential new approach to RB gene therapy. PMID:20819437

  1. Mice deficient for wild-type p53-induced phosphatase 1 display elevated anxiety- and depression-like behaviors.

    PubMed

    Ruan, C S; Zhou, F H; He, Z Y; Wang, S F; Yang, C R; Shen, Y J; Guo, Y; Zhao, H B; Chen, L; Liu, D; Liu, J; Baune, B T; Xiao, Z C; Zhou, X F

    2015-05-01

    Mood disorders are a severe health burden but molecular mechanisms underlying mood dysfunction remain poorly understood. Here, we show that wild-type p53-induced phosphatase 1 (Wip1) negatively responds to the stress-induced negative mood-related behaviors. Specifically, we show that Wip1 protein but not its mRNA level was downregulated in the hippocampus but not in the neocortex after 4 weeks of chronic unpredictable mild stress (CUMS) in mice. Moreover, the CUMS-responsive WIP1 downregulation in the hippocampus was restored by chronic treatment of fluoxetine (i.p. 20 mg/kg) along with the CUMS procedure. In addition, Wip1 knockout mice displayed decreased exploratory behaviors as well as increased anxiety-like and depression-like behaviors in mice without impaired motor activities under the non-CUMS condition. Furthermore, the Wip1 deficiency-responsive anxiety-like but not depression-like behaviors were further elevated in mice under CUMS. Although limitations like male-alone sampling and multiply behavioral testing exist, the present study suggests a potential protective function of Wip1 in mood stabilization. PMID:25732137

  2. Retention of the In Vitro Radiosensitizing Potential of Gemcitabine Under Anoxic Conditions, in p53 Wild-Type and p53-Deficient Non-Small-Cell Lung Carcinoma Cells

    SciTech Connect

    Wouters, An; Pauwels, Bea; Lambrechts, Hilde A.J.; Pattyn, Greet G.O.; Ides, Johan; Baay, Marc; Meijnders, Paul; Peeters, Marc; Vermorken, Jan B.; Lardon, Filip

    2011-06-01

    Purpose: Whereas radiosensitization by gemcitabine is well studied under normal oxygen conditions, little is known about its radiosensitizing potential under reduced oxygen conditions. Therefore, the present study evaluated the impact of anoxia on gemcitabine-mediated radiosensitization. Methods and Materials: The clonogenic assay was performed in three isogenic A549 cell lines differing in p53 status (24 h, 0-15 nM gemcitabine, 0-8 Gy irradiation, normoxia vs. anoxia). Using radiosensitizing conditions, cells were collected for cell cycle analysis and apoptosis detection. Results: Whereas wild-type p53 A549-LXSN cells were more sensitive to radiation than p53-deficient A549-E6 cells, both cell lines showed similar radiosensitization by gemcitabine under normoxia and anoxia. Independent of p53 functionality, gemcitabine was able to overcome anoxia-induced G{sub 0/1} arrest and established an (early) S phase block in normoxic and anoxic cells. The percentage early and late apoptotic/necrotic cells increased with the gemcitabine/radiation combination, with a significant difference between A549-LXSN and A549-E6. Conclusions: This study is the first to show that gemcitabine retains its radiosensitizing potential under low oxygen conditions. Although radiosensitization was observed in both p53 wild-type and p53-deficient cells, p53 status might influence induction of apoptosis after gemcitabine/radiation treatment, whereas no effect on cell cycle progression was noticed.

  3. Modulation of the poly (ADP-ribose) polymerase inhibitor response and DNA recombination in breast cancer cells by drugs affecting endogenous wild-type p53.

    PubMed

    Ireno, Ivanildce Cristiane; Wiehe, Rahel Stephanie; Stahl, Andreea Iulia; Hampp, Stephanie; Aydin, Sevtap; Troester, Melissa A; Selivanova, Galina; Wiesmüller, Lisa

    2014-10-01

    Synthetic lethal interactions between poly (ADP-ribose) polymerase (PARP) and homologous recombination (HR) repair pathways have been exploited for the development of novel mono- and combination cancer therapies. The tumor suppressor p53 was demonstrated to exhibit indirect and direct regulatory activities in DNA repair, particularly in DNA double-strand break (DSB)-induced and replication-associated HR. In this study, we tested a potential influence of the p53 status on the response to PARP inhibition, which is known to cause replication stress. Silencing endogenous or inducibly expressing p53 we found a protective effect of p53 on PARP inhibitor (PARPi)-mediated cytotoxicities. This effect was specific for wild-type versus mutant p53 and observed in cancer but not in non-transformed cell lines. Enhanced cytotoxicities after treatment with the p53-inhibitory drug Pifithrinα further supported p53-mediated resistance to PARP inhibition. Surprisingly, we equally observed increased PARPi sensitivity in the presence of the p53-activating compound Nutlin-3. As a common denominator, both drug responses correlated with decreased HR activities: Pifithrinα downregulated spontaneous HR resulting in damage accumulation. Nutlin-3 induced a decrease of DSB-induced HR, which was accompanied by a severe drop in RAD51 protein levels. Thus, we revealed a novel link between PARPi responsiveness and p53-controlled HR activities. These data expand the concept of cell and stress type-dependent healer and killer functions of wild-type p53 in response to cancer therapeutic treatment. Our findings have implications for the individualized design of cancer therapies using PARPi and the potentially combined use of p53-modulatory drugs. PMID:25085902

  4. Chemical Inhibition of Wild-Type p53-Induced Phosphatase 1 (WIP1/PPM1D) by GSK2830371 Potentiates the Sensitivity to MDM2 Inhibitors in a p53-Dependent Manner.

    PubMed

    Esfandiari, Arman; Hawthorne, Thomas A; Nakjang, Sirintra; Lunec, John

    2016-03-01

    Sensitivity to MDM2 inhibitors is widely different among responsive TP53 wild-type cell lines and tumors. Understanding the determinants of MDM2 inhibitor sensitivity is pertinent for their optimal clinical application. Wild-type p53-inducible phosphatase-1 (WIP1) encoded by PPM1D, is activated, gained/amplified in a range of TP53 wild-type malignancies, and is involved in p53 stress response homeostasis. We investigated cellular growth/proliferation of TP53 wild-type and matched mutant/null cell line pairs, differing in PPM1D genetic status, in response to Nutlin-3/RG7388 ± a highly selective WIP1 inhibitor, GSK2830371. We also assessed the effects of GSK2830371 on MDM2 inhibitor-induced p53(Ser15) phosphorylation, p53-mediated global transcriptional activity, and apoptosis. The investigated cell line pairs were relatively insensitive to single-agent GSK2830371. However, a non-growth-inhibitory dose of GSK2830371 markedly potentiated the response to MDM2 inhibitors in TP53 wild-type cell lines, most notably in those harboring PPM1D-activating mutations or copy number gain (up to 5.8-fold decrease in GI50). Potentiation also correlated with significant increase in MDM2 inhibitor-induced cell death endpoints that were preceded by a marked increase in a WIP1 negatively regulated substrate, phosphorylated p53(Ser15), known to increase p53 transcriptional activity. Microarray-based gene expression analysis showed that the combination treatment increases the subset of early RG7388-induced p53 transcriptional target genes. These findings demonstrate that potent and selective WIP1 inhibition potentiates the response to MDM2 inhibitors in TP53 wild-type cells, particularly those with PPM1D activation or gain, while highlighting the mechanistic importance of p53(Ser15) and its potential use as a biomarker for response to this combination regimen. Mol Cancer Ther; 15(3); 379-91. ©2016 AACR. PMID:26832796

  5. Wild-type p53 reactivation by small-molecule Minnelide™ in human papillomavirus (HPV)-positive head and neck squamous cell carcinoma

    PubMed Central

    Caicedo-Granados, Emiro; Lin, Rui; Clements-Green, Caitlin; Yueh, Bevan; Sangwan, Veena; Saluja, Ashok

    2015-01-01

    Objectives The incidence of high-risk human papillomavirus (HR-HPV) head and neck squamous cell carcinoma (HNSCC) continues to increase, particularly oropharyngeal squamous cell carcinoma (OPSCC) cases. The inactivation of the p53 tumor suppressor gene promotes a chain of molecular events, including cell cycle progression and apoptosis resistance. Reactivation of wild-type p53 function is an intriguing therapeutic strategy. The aim of this study was to investigate whether a novel compound derived from diterpene triepoxide (Minnelide™) can reactivate wild-type p53 function in HPV-positive HNSCC. Materials and Methods For all of our in vitro experiments, we used 2 HPV-positive HNSCC cell lines, University of Michigan squamous cell carcinoma (UM-SCC) 47 and 93-VU-147, and 2 HPV-positive human cervical cancer cell lines, SiHa and CaSki. Cells were treated with different concentrations of triptolide and analyzed for p53 activation. Mice bearing UM-SCC 47 subcutaneous xenografts and HPV-positive patient-derived tumor xenografts were treated with Minnelide and evaluated for tumor growth and p53 activation. Results In HPV-positive HNSCC, Minnelide reactivated p53 by suppressing E6 oncoprotein. Activation of apoptosis followed, both in vitro and in vivo. In 2 preclinical HNSCC animal models (a subcutaneous xenograft model and a patient-derived tumor xenograft model), Minnelide reactivated p53 function and significantly decreased tumor progression and tumor volume. Conclusion Triptolide and Minnelide caused cell death in vitro and in vivo in HPV-positive HNSCC by reactivating wild-type p53 and thus inducing apoptosis. In addition, in 2 HPV-positive HNSCC animal models, Minnelide decreased tumor progression and induced apoptosis. PMID:25311433

  6. Induction of MDM2-P2 Transcripts Correlates with Stabilized Wild-Type p53 in Betel- and Tobacco-Related Human Oral Cancer

    PubMed Central

    Ralhan, Ranju; Sandhya, Agarwal; Meera, Mathur; Bohdan, Wasylyk; Nootan, Shukla K.

    2000-01-01

    MDM2, a critical element of cellular homeostasis mechanisms, is involved in complex interactions with important cell-cycle and stress-response regulators including p53. The mdm2-P2 promoter is a transcriptional target of p53. The aim of this study was to determine the association between mdm2-P2 transcripts and the status of the p53 gene in betel- and tobacco-related oral squamous cell carcinomas (SCCs) to understand the mechanism of deregulation of MDM2 and p53 expression and their prognostic implications in oral tumorigenesis. Elevated levels of MDM2 proteins were observed in 11 of 25 (44%) oral hyperplastic lesions, nine of 15 (60%) dysplastic lesions, and 71 of 100 (71%) SCCs. The intriguing feature of the study was the identification and different subcellular localization of three isoforms of MDM2 (ie, 90 kd, 76 kd, and 57 kd) in oral SCCs and their correlation with p53 overexpression in each tumor. The hallmark of the study was the detection of mdm2-P2 transcripts in 12 of 20 oral SCCs overexpressing both MDM2 and p53 proteins while harboring wild-type p53 alleles. Furthermore, mdm2 amplification was an infrequent event in betel- and tobacco-associated oral tumorigenesis. The differential compartmentalization of the three isoforms of MDM2 suggests that each has a distinct function, potentially in the regulation of p53 and other gene products implicated in oral tumorigenesis. In conclusion, we report herein the first evidence suggesting that enhanced translation of mdm2-P2 transcripts (S-mdm2) may represent an important mechanism of overexpression and consequent stabilization and functional inactivation of wild-type p53 serving as an adverse prognosticator in betel- and tobacco-related oral cancer. The clinical significance of the functional inactivation of wild-type p53 by MDM2 is underscored by the significantly shorter median disease-free survival time (16 months) observed in p53/MDM2-positive cases as compared to those which did not show co-expression of

  7. Induction of MDM2-P2 transcripts correlates with stabilized wild-type p53 in betel- and tobacco-related human oral cancer.

    PubMed

    Ralhan, R; Sandhya, A; Meera, M; Bohdan, W; Nootan, S K

    2000-08-01

    MDM2, a critical element of cellular homeostasis mechanisms, is involved in complex interactions with important cell-cycle and stress-response regulators including p53. The mdm2-P2 promoter is a transcriptional target of p53. The aim of this study was to determine the association between mdm2-P2 transcripts and the status of the p53 gene in betel- and tobacco-related oral squamous cell carcinomas (SCCs) to understand the mechanism of deregulation of MDM2 and p53 expression and their prognostic implications in oral tumorigenesis. Elevated levels of MDM2 proteins were observed in 11 of 25 (44%) oral hyperplastic lesions, nine of 15 (60%) dysplastic lesions, and 71 of 100 (71%) SCCs. The intriguing feature of the study was the identification and different subcellular localization of three isoforms of MDM2 (ie, 90 kd, 76 kd, and 57 kd) in oral SCCs and their correlation with p53 overexpression in each tumor. The hallmark of the study was the detection of mdm2-P2 transcripts in 12 of 20 oral SCCs overexpressing both MDM2 and p53 proteins while harboring wild-type p53 alleles. Furthermore, mdm2 amplification was an infrequent event in betel- and tobacco-associated oral tumorigenesis. The differential compartmentalization of the three isoforms of MDM2 suggests that each has a distinct function, potentially in the regulation of p53 and other gene products implicated in oral tumorigenesis. In conclusion, we report herein the first evidence suggesting that enhanced translation of mdm2-P2 transcripts (S-mdm2) may represent an important mechanism of overexpression and consequent stabilization and functional inactivation of wild-type p53 serving as an adverse prognosticator in betel- and tobacco-related oral cancer. The clinical significance of the functional inactivation of wild-type p53 by MDM2 is underscored by the significantly shorter median disease-free survival time (16 months) observed in p53/MDM2-positive cases as compared to those which did not show co-expression of

  8. Wild-type and mutated presenilins 2 trigger p53-dependent apoptosis and down-regulate presenilin 1 expression in HEK293 human cells and in murine neurons.

    PubMed

    Alves da Costa, Cristine; Paitel, Erwan; Mattson, Mark P; Amson, Robert; Telerman, Adam; Ancolio, Karine; Checler, Frédéric; Mattson, Marc P

    2002-03-19

    Presenilins 1 and 2 are two homologous proteins that, when mutated, account for most early onset Alzheimer's disease. Several lines of evidence suggest that, among various functions, presenilins could modulate cell apoptotic responses. Here we establish that the overexpression of presenilin 2 (PS2) and its mutated form Asn-141-Ile-PS2 alters the viability of human embryonic kidney (HEK)293 cells as established by combined trypan blue exclusion, sodium 3'-[1-(phenylamino-carbonyl)-3,4-tetrazolium]-bis(4-methoxy-6-nitro)benzene sulfonic acid hydrate assay, and propidium iodide incorporation FACS analyses. The two parent proteins increase the acetyl-DEVD-al-sensitive caspase-3-like activity in both HEK293 cells and Telencephalon specific murine neurons, modulate Bax and bcl-2 expressions, and enhance cytochrome C translocation into the cytosol. We show that overexpression of both wild-type and mutated PS2 increases p53-like immunoreactivity and transcriptional activity. We also establish that wild-type- and mutated PS2-induced caspase activation is reduced by p53 antisense approach and by pifithrin-alpha, a chemical inhibitor of p53. Furthermore, mouse fibroblasts in which the PS2 gene has been knocked out exhibited strongly reduced p53-transcriptional activity. Finally, we establish that the overexpression of both wild-type and mutated PS2 is accompanied by a drastic reduction of endogenous presenilin 1 (PS1) expression. Interestingly, pifithrin-alpha diminished endogenous PS2 immunoreactivity, whereas the inhibitor increases PS1 expression. Altogether, our data demonstrate that wild-type and familial Alzheimer's disease-linked PS2 trigger apoptosis and down-regulate PS1 expression through p53-dependent mechanisms. PMID:11904448

  9. Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53

    PubMed Central

    Arya, A K; El-Fert, A; Devling, T; Eccles, R M; Aslam, M A; Rubbi, C P; Vlatković, N; Fenwick, J; Lloyd, B H; Sibson, D R; Jones, T M; Boyd, M T

    2010-01-01

    Background: Primary radiotherapy (RT) is a mainstay of treatment for laryngeal squamous cell carcinoma (LSCC). Although the cure rates for early (T1) vocal cord tumours are high, RT proves ineffective in up to a third of T3 carcinomas. Moreover, RT is associated with debilitating early- and late-treatment-related toxicity, thus finding means to de-escalate therapy, while retaining/augmenting therapeutic effectiveness, is highly desirable. p53 is a key mediator of radiation responses; we therefore investigated whether Nutlin-3, a small-molecule inhibitor of MDM2 (mouse double minute 2; an essential negative regulator of p53), might radiosensitise LSCC cells. Methods: We performed clonogenic assays to measure radiosensitivity in a panel of LSCC cell lines (for which we determined p53 mutational status) in the presence and absence of Nutlin-3. Results: LSCC cells harbouring wild-type p53 were significantly radiosensitised by Nutlin-3 (P<0.0001; log-rank scale), and displayed increased cell cycle arrest and significantly increased senescence (P<0.001) in the absence of increased apoptosis; thus, our data suggest that senescence may mediate this increased radiosensitivity. Conclusion: This is the first study showing Nutlin-3 as an effective radiosensitiser in LSCC cells that retain wild-type p53. The clinical application of Nutlin-3 might improve local recurrence rates or allow treatment de-escalation in these patients. PMID:20588277

  10. Che-1/AATF: A Critical Cofactor for Both Wild-Type- and Mutant-p53 Proteins

    PubMed Central

    Bruno, Tiziana; Iezzi, Simona; Fanciulli, Maurizio

    2016-01-01

    The p53 protein is a key player in a wide range of protein networks that allow the state of “good health” of the cell. Not surprisingly, mutations of the TP53 gene are one of the most common alterations associated to cancer cells. Mutated forms of p53 (mtp53) not only lose the ability to protect the integrity of the genetic heritage of the cell but also acquire pro-oncogenic functions, behaving like dangerous accelerators of transformation and tumor progression. In recent years, many studies focused on investigating possible strategies aiming to counteract this mutant p53 “gain of function” but the results have not always been satisfactory. Che-1/AATF is a nuclear protein that binds to RNA polymerase II and plays a role in multiple fundamental processes, including control of transcription, cell cycle regulation, DNA damage response, and apoptosis. Several studies showed Che-1/AATF as an important endogenous regulator of p53 expression and activity in a variety of biological processes. Notably, this same regulation was more recently observed also on mtp53. The depletion of Che-1/AATF strongly reduces the expression of mutant p53 in several tumors in vitro and in vivo, making the cells an easier target for chemotherapy treatments. In this mini review, we report an overview of Che-1/AATF functions and discuss a possible role of Che-1/AATF in cancer therapy, with particular regard to its action on p53/mtp53. PMID:26913241

  11. Increased expression of SIRT2 is a novel marker of cellular senescence and is dependent on wild type p53 status.

    PubMed

    Anwar, Tarique; Khosla, Sanjeev; Ramakrishna, Gayatri

    2016-07-17

    Sirtuins (SIRT) belonging to the NAD+ dependent histone deacetylase III class of enzymes have emerged as master regulators of metabolism and longevity. However, their role in prevention of organismal aging and cellular senescence still remains controversial. In the present study, we now report upregulation of SIRT2 as a specific feature associated with stress induced premature senescence but not with either quiescence or cell death. Additionally, increase in SIRT2 expression was noted in different types of senescent conditions such as replicative and oncogene induced senescence using multiple cell lines. Induction of SIRT2 expression during senescence was dependent on p53 status as depletion of p53 by shRNA prevented its accumulation. Chromatin immunoprecipitation revealed the presence of p53 binding sites on the SIRT2 promoter suggesting its regulation by p53, which was also corroborated by the SEAP reporter assay. Overexpression or knockdown of SIRT2 had no effect on stress induced premature senescence, thereby indicating that SIRT2 increase is not a cause of senescence; rather it is an effect linked to senescence-associated changes. Overall, our results suggest SIRT2 as a promising marker of cellular senescence at least in cells with wild type p53 status. PMID:27229617

  12. Lack of Transcription Factor p53 Exacerbates Elastase-Induced Emphysema in Mice.

    PubMed

    Chrusciel, Sandra; Zysman, Maéva; Caramelle, Philippe; Tiendrebeogo, Arnaud; Baskara, Indoumady; Le Gouvello, Sabine; Chabot, François; Giraudier, Stéphane; Boczkowski, Jorge; Boyer, Laurent

    2016-02-01

    The transcription factor p53 is overexpressed in the lung of patients with emphysema, but it remains unclear if it has a deleterious or protective effect in disease progression. We investigated the role of p53 in the elastase-induced emphysema model and the molecular underlining mechanisms. Wild-type (WT) and p53(-/-) mice were instilled with pancreatic porcine elastase. We quantified emphysema (morphometric analysis), chemokine (C-C motif) ligand 2 (CCL2), and TNF-α in bronchoalveolar lavage (BAL) (ELISA), oxidative stress markers [heme oxygenase 1 (HO1), NAD(P)H dehydrogenase quinone 1 (NQO1), and quantitative RT-PCR], matrix metalloproteinase 12 (MMP12) expression, and macrophage apoptosis (cleaved caspase-3, immunofluorescence). p53 gene expression was up-regulated in the lung of elastase-instilled mice. p53 deletion aggravated elastase-induced emphysema severity, pulmonary inflammation (macrophage and neutrophil numbers and CCL2 and TNF-α levels in BAL), and lung oxidative stress. These findings, except for the increase in CCL2, were reproduced in WT mice transplanted with p53(-/-) bone marrow cells. The increased number of macrophages in p53(-/-) mice was not a consequence of reduced apoptosis or an excess of chemotaxis toward CCL2. Macrophage expression of MMP12 was higher in p53(-/-) mice compared with WT mice after elastase instillation. These findings provide evidence that p53(-/-) mice and WT mice grafted with p53(-/-) bone marrow cells are more prone to developing elastase-induced emphysema, supporting a protective role of p53, and more precisely p53 expressed in macrophages, against emphysema development. The pivotal role played by macrophages in this phenomenon may involve the MMP12-TNF-α pathway. PMID:26106979

  13. Safety of intravenous administration of a canarypox virus encoding the human wild-type p53 gene in colorectal cancer patients.

    PubMed

    Menon, Anand G; Kuppen, Peter J K; van der Burg, Sjoerd H; Offringa, Rienk; Bonnet, Marie Claude; Harinck, Bert I J; Tollenaar, Rob A E M; Redeker, Anke; Putter, Hein; Moingeon, Philippe; Morreau, Hans; Melief, Cornelis J M; van de Velde, Cornelis J H

    2003-07-01

    Overexpression of p53 occurs in more than 50% of colorectal cancers. Therefore, p53 represents an attractive target antigen for immunotherapy. We assessed the safety of a canarypox virus encoding the human wild-type p53 gene given intravenously to end-stage colorectal cancer patients in a three-step dose escalation study aimed at inducing p53 immune responses. Patients with metastatic disease of p53-overexpressing colorectal cancers were vaccinated three times at 3-week intervals, each time with 10(6.5) CCID(50) (CCID(50)=cell culture infectious dose 50%; group 1, n=5), 10(7.0) CCID(50) (group 2, n=5) or 10(7.5) CCID(50) (group 3, n=6). Vital signs and the occurrence of adverse events were monitored and blood was analyzed for biochemical and hematological parameters as well as signs of auto-immune safety. In all, 16 patients were enrolled and 15 patients completed three vaccinations. No anaphylactic reaction or unwanted auto-immune reactions were observed. A total of 16 serious adverse events (SAEs) occurred: 10 in group 1, three in group 2 and three in group 3. All SAEs were tumor-related complications. There was no difference in the frequency of adverse events between the three groups, except for fever. Fever was the only vaccination-related adverse event consistently observed and was most frequent and outspoken in the group 3 patients. The majority was a grade 1 or 2 fever (93%) and grade 3 fever (7%) was observed in three patients of group 3. Some patients showed humoral and cellular responses against p53, following vaccinations. After having completed his initial treatment cycle, one patient (group 2) received a second treatment cycle of three doses of 10(7.5) CCID(50) and subsequently showed stable disease. All other patients showed progressive disease. We conclude that ALVAC-p53 can be administered intravenously to colorectal cancer patients without serious toxicity or pathological autoimmunity and can induce immune responses against p53. PMID:12833131

  14. Effects of Temperature on the p53-DNA Binding Interactions and Their Dynamical Behavior: Comparing the Wild Type to the R248Q Mutant

    PubMed Central

    Barakat, Khaled; Issack, Bilkiss B.; Stepanova, Maria; Tuszynski, Jack

    2011-01-01

    Background The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298–306 K). Methodology/Principal Findings This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. Conclusions The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure. PMID:22110706

  15. Metformin induces microRNA-34a to downregulate the Sirt1/Pgc-1α/Nrf2 pathway, leading to increased susceptibility of wild-type p53 cancer cells to oxidative stress and therapeutic agents.

    PubMed

    Do, Minh Truong; Kim, Hyung Gyun; Choi, Jae Ho; Jeong, Hye Gwang

    2014-09-01

    Sirtuin 1 (Sirt1) plays an important role in cellular redox balance and resistance to oxidative stress. Sirt1 exhibits oncogenic properties in wild-type p53 cancer cells, whereas it acts as a tumor suppressor in p53-mutated cancer cells. Here, we investigated the effects of metformin on Sirt1 expression in several cancer cell lines. Using human cancer cell lines that exhibit differential expression of p53, we found that metformin reduced Sirt1 protein levels in cancer cells bearing wild-type p53, but did not affect Sirt1 protein levels in cancer cell lines harboring mutant forms of p53. Metformin-induced p53 protein levels in wild-type p53 cancer cells resulted in upregulation of microRNA (miR)-34a. The use of a miR-34a inhibitor confirmed that metformin-induced miR-34a was required for Sirt1 downregulation. Metformin suppressed peroxisome proliferator-activated receptor γ (PPARγ) coactivator-1α (Pgc-1α) expression and its downstream target Nrf2 in MCF-7 cells. Genetic tools demonstrated that the reduction of Sirt1 and Pgc-1α by metformin caused Nrf2 downregulation via suppression of PPARγ transcriptional activity. Metformin reduced heme oxygenase-1 and superoxide dismutase 2 but upregulated catalase expression in MCF-7 cells. Metformin-treated MCF-7 cells had no increase in basal levels of reactive oxygen species but were more susceptible to oxidative stress. Furthermore, upregulation of death receptor 5 by metformin-mediated Sirt1 downregulation enhanced the sensitivity of wild-type p53 cancer cells to TRAIL-induced apoptosis. Our results demonstrated that metformin induces miR-34a to suppress the Sirt1/Pgc-1α/Nrf2 pathway and increases susceptibility of wild-type p53 cancer cells to oxidative stress and TRAIL-induced apoptosis. PMID:24970682

  16. NEK9-dependent proliferation of cancer cells lacking functional p53

    PubMed Central

    Kurioka, Daisuke; Takeshita, Fumitaka; Tsuta, Koji; Sakamoto, Hiromi; Watanabe, Shun-ichi; Matsumoto, Kenji; Watanabe, Masatoshi; Nakagama, Hitoshi; Ochiya, Takahiro; Yokota, Jun; Kohno, Takashi; Tsuchiya, Naoto

    2014-01-01

    Dysfunction of the p53 network is a major cause of cancer development, and selective elimination of p53-inactivated cancer cells therefore represents an ideal therapeutic strategy. In this study, we performed a microRNA target screen that identified NEK9 (NIMA-related kinase 9) as a crucial regulator of cell-cycle progression in p53-inactivated cancer cells. NEK9 depletion selectively inhibited proliferation in p53-deficient cancer cells both in vitro and in vivo. The resultant cell-cycle arrest occurred predominantly in G1 phase, and exhibited senescence-like features. Furthermore, NEK9 repression affected expression of a broad range of genes encoding cell-cycle regulators and factors involved in mRNA processing, suggesting a novel role for NEK9 in p53-deficient cells. Lung adenocarcinoma patients with positive staining for NEK9 and mutant p53 proteins exhibited significantly poorer prognoses, suggesting that expression of both proteins promotes tumor growth. Our findings demonstrate that a novel NEK9 network regulates the growth of cancer cells lacking functional p53. PMID:25131192

  17. NEK9-dependent proliferation of cancer cells lacking functional p53.

    PubMed

    Kurioka, Daisuke; Takeshita, Fumitaka; Tsuta, Koji; Sakamoto, Hiromi; Watanabe, Shun-ichi; Matsumoto, Kenji; Watanabe, Masatoshi; Nakagama, Hitoshi; Ochiya, Takahiro; Yokota, Jun; Kohno, Takashi; Tsuchiya, Naoto

    2014-01-01

    Dysfunction of the p53 network is a major cause of cancer development, and selective elimination of p53-inactivated cancer cells therefore represents an ideal therapeutic strategy. In this study, we performed a microRNA target screen that identified NEK9 (NIMA-related kinase 9) as a crucial regulator of cell-cycle progression in p53-inactivated cancer cells. NEK9 depletion selectively inhibited proliferation in p53-deficient cancer cells both in vitro and in vivo. The resultant cell-cycle arrest occurred predominantly in G1 phase, and exhibited senescence-like features. Furthermore, NEK9 repression affected expression of a broad range of genes encoding cell-cycle regulators and factors involved in mRNA processing, suggesting a novel role for NEK9 in p53-deficient cells. Lung adenocarcinoma patients with positive staining for NEK9 and mutant p53 proteins exhibited significantly poorer prognoses, suggesting that expression of both proteins promotes tumor growth. Our findings demonstrate that a novel NEK9 network regulates the growth of cancer cells lacking functional p53. PMID:25131192

  18. Lack of p53 Affects the Expression of Several Brain Mitochondrial Proteins: Insights from Proteomics into Important Pathways Regulated by p53

    PubMed Central

    Fiorini, Ada; Sultana, Rukhsana; Barone, Eugenio; Cenini, Giovanna; Perluigi, Marzia; Mancuso, Cesare; Cai, Jian; Klein, Jon B.; St. Clair, Daret; Butterfield, D. Allan

    2012-01-01

    The tumor suppressor protein p53 has been described “as the guardian of the genome” for its crucial role in regulating the transcription of numerous genes responsible for cells cycle arrest, senescence, or apoptosis in response to various stress signals. Although p53 promotes longevity by decreasing the risk of cancer through activation of apoptosis or cellular senescence, several findings suggest that an increase of its activity may have deleterious effects leading to selected aspects of the aging phenotype and neurodegenerative diseases. There is the link between p53 and oxidative stress, the latter a crucial factor that contributes to neurodegenerative processes like Alzheimer disease (AD). In the present study, using a proteomics approach, we analyzed the impact of lack of p53 on the expression of several brain mitochondrial proteins involved in different pathways, and how lack of p53 may present a target to restore neuronal impairments. Our investigation on isolated brain mitochondria from p53(−/−) mice also provides a better understanding of the p53-mitochondria relationship and its involvement in the development of many diseases. PMID:23209608

  19. Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

    NASA Technical Reports Server (NTRS)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

  20. Oroxylin A modulates mitochondrial function and apoptosis in human colon cancer cells by inducing mitochondrial translocation of wild-type p53

    PubMed Central

    Zhou, Yuxin; Ni, Ting; Dai, Yuanyuan; Li, Zhiyu; Guo, Qinglong; Wei, Libin

    2016-01-01

    Oroxylin A is a flavonoid extracted from the root of Scutellaria baicalensis Georgi. We previously demonstrated that oroxylin A induced apoptosis in human colon cancer cells via the mitochondrial pathway. In the present study, we investigated the underlying mechanisms responsible for the mitochondrial apoptotic pathway triggered by oroxylin A. p53 regulates mitochondrial survival, mitochondrial DNA integrity, and protection from oxidative stress. We determined that oroxylin A induces p53 mitochondrial translocation and inhibits SOD2 activity. Additionally, our studies demonstrate that oroxylin A promotes the formation and mitochondrial translocation of the p53-Recql4 complex in HCT-116 cells. Finally, we showed that oroxylin A triggers cytosolic p53 activation, thereby promoting apoptosis. Mitochondrial translocation of p53 was also validated in vivo. Thus, oroxylin A induces mitochondrial translocation of p53 and leads to mitochondrial dysfunction in human colon cancer cells. PMID:26958937

  1. Oroxylin A modulates mitochondrial function and apoptosis in human colon cancer cells by inducing mitochondrial translocation of wild-type p53.

    PubMed

    Qiao, Chen; Lu, Na; Zhou, Yuxin; Ni, Ting; Dai, Yuanyuan; Li, Zhiyu; Guo, Qinglong; Wei, Libin

    2016-03-29

    Oroxylin A is a flavonoid extracted from the root of Scutellaria baicalensis Georgi. We previously demonstrated that oroxylin A induced apoptosis in human colon cancer cells via the mitochondrial pathway. In the present study, we investigated the underlying mechanisms responsible for the mitochondrial apoptotic pathway triggered by oroxylin A. p53 regulates mitochondrial survival, mitochondrial DNA integrity, and protection from oxidative stress. We determined that oroxylin A induces p53 mitochondrial translocation and inhibits SOD2 activity. Additionally, our studies demonstrate that oroxylin A promotes the formation and mitochondrial translocation of the p53-Recql4 complex in HCT-116 cells. Finally, we showed that oroxylin A triggers cytosolic p53 activation, thereby promoting apoptosis. Mitochondrial translocation of p53 was also validated in vivo. Thus, oroxylin A induces mitochondrial translocation of p53 and leads to mitochondrial dysfunction in human colon cancer cells. PMID:26958937

  2. Synergistic anticancer effect of exogenous wild-type p53 gene combined with 5-FU in human colon cancer resistant to 5-FU in vivo

    PubMed Central

    Xie, Qi; Wu, Min-Yi; Zhang, Ding-Xuan; Yang, Yi-Ming; Wang, Bao-Shuai; Zhang, Jing; Xu, Jin; Zhong, Wei-De; Hu, Jia-Ni

    2016-01-01

    AIM To investigate the anticancer effect of a recombinant adenovirus-mediated p53 (rAd-p53) combined with 5-fluorouracil (5-FU) in human colon cancer resistant to 5-FU in vivo and the mechanism of rAd-p53 in reversal of 5-FU resistance. METHODS Nude mice bearing human colon cancer SW480/5-FU (5-FU resistant) were randomly assigned to four groups (n = 25 each): control group, 5-FU group, rAd-p53 group, and rAd-p53 + 5-FU group. At 24 h, 48 h, 72 h, 120 h and 168 h after treatment, 5 mice were randomly selected from each group and sacrificed using an overdose of anesthetics. The tumors were removed and the protein expressions of p53, protein kinase C (PKC), permeability-glycoprotein (P-gp) and multidrug resistance-associated protein 1 (MRP1) (Western blot) and apoptosis (TUNEL) were determined. RESULTS The area ratios of tumor cell apoptosis were larger in the rAd/p53 + 5-FU group than that in the control, 5-FU and rAd/p53 groups (P < 0.05), and were larger in the rAd/p53 group than that of the control group (P < 0.05) and the 5-FU group at more than 48 h (P < 0.05). The p53 expression was higher in the rAd/p53 and the rAd/p53 + 5-FU groups than that of the control and 5-FU groups (P < 0.05), and were higher in the rAd/p53 + 5-FU group than that of the rAd/p53 group (P < 0.05). Overexpression of PKC, P-gp and MRP1 was observed in the 5-FU and control groups. In the rAd/p53 + 5-FU group, the expression of P-gp and MRP1 was lower that of the control and 5-FU groups (P < 0.05), and the expression of PKC was lower than that of the control, 5-FU and rAd/p53 groups at more than 48 h (P < 0.05). In the rAd/p53 group, the expression of P-gp and MRP1 was lower that of the control and 5-FU groups at more than 48 h (P < 0.05), and the expression of PKC was lower than that of the control and 5-FU groups at more than 120 h (P < 0.05). CONCLUSION 5-FU combined with rAd-p53 has a synergistic anticancer effect in SW480/5-FU (5-FU resistance), which contributes to reversal of 5-FU

  3. The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase.

    PubMed

    Wu, Tzu-Chin; Lin, Yi-Chin; Chen, Hsiao-Ling; Huang, Pei-Ru; Liu, Shang-Yu; Yeh, Shu-Lan

    2016-02-01

    Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. PMID:26768552

  4. Regulation of Mutant p53 Protein Expression

    PubMed Central

    Vijayakumaran, Reshma; Tan, Kah Hin; Miranda, Panimaya Jeffreena; Haupt, Sue; Haupt, Ygal

    2015-01-01

    For several decades, p53 has been detected in cancer biopsies by virtue of its high protein expression level which is considered indicative of mutation. Surprisingly, however, mouse genetic studies revealed that mutant p53 is inherently labile, similar to its wild type (wt) counterpart. Consistently, in response to stress conditions, both wt and mutant p53 accumulate in cells. While wt p53 returns to basal level following recovery from stress, mutant p53 remains stable. In part, this can be explained in mutant p53-expressing cells by the lack of an auto-regulatory loop with Mdm2 and other negative regulators, which are pivotal for wt p53 regulation. Further, additional protective mechanisms are acquired by mutant p53, largely mediated by the co-chaperones and their paralogs, the stress-induced heat shock proteins. Consequently, mutant p53 is accumulated in cancer cells in response to chronic stress and this accumulation is critical for its oncogenic gain of functions (GOF). Building on the extensive knowledge regarding wt p53, the regulation of mutant p53 is unraveling. In this review, we describe the current understanding on the major levels at which mutant p53 is regulated. These include the regulation of p53 protein levels by microRNA and by enzymes controlling p53 proteasomal degradation. PMID:26734569

  5. Cisplatin-induced apoptosis in non-small-cell lung cancer cells is dependent on Bax- and Bak-induction pathway and synergistically activated by BH3-mimetic ABT-263 in p53 wild-type and mutant cells.

    PubMed

    Matsumoto, Masaru; Nakajima, Wataru; Seike, Masahiro; Gemma, Akihiko; Tanaka, Nobuyuki

    2016-04-29

    Cisplatin is a highly effective anticancer drug for treatment of various tumors including non-small-cell lung cancer (NSCLC), and is especially useful in cases nonresponsive to molecular-targeted drugs. Accumulating evidence has shown that cisplatin activates the p53-dependent apoptotic pathway, but it also induces apoptosis in p53-mutated cancer cells. Here we demonstrated that DNA-damage inducible proapoptotic BH3 (Bcl-2 homology region 3)-only Bcl-2 family members, Noxa, Puma, Bim and Bid, are not involved in cisplatin-induced apoptosis in human NSCLC cell lines. In contrast, the expression of proapoptotic multidomain Bcl-2-family members, Bak and Bax, was induced by cisplatin in p53-dependent and -independent manners, respectively. Moreover, in wild-type p53-expressing cells, cisplatin mainly used the Bak-dependent apoptotic pathway, but this apoptotic pathway shifted to the Bax-dependent pathway by loss-of-function of p53. Furthermore, both Bak- and Bax-induced apoptosis was enhanced by the antiapoptotic Bcl-2 family member, Bcl-XL knockdown, but not by Mcl-1 knockdown. From this result, we tested the effect of ABT-263 (Navitoclax), the specific inhibitor of Bcl-2 and Bcl-XL, but not Mcl-1, and found that ABT-263 synergistically enhanced cisplatin-induced apoptosis in NSCLC cells in the presence or absence of p53. These results indicate a novel regulatory system in cisplatin-induced NSCLC cell apoptosis, and a candidate efficient combination chemotherapy method against lung cancers. PMID:26996126

  6. Potent inhibitors of cyclin-dependent kinase 2 induce nuclear accumulation of wild-type p53 and nucleolar fragmentation in human untransformed and tumor-derived cells.

    PubMed

    David-Pfeuty, T

    1999-12-01

    The cdk2 gene has been identified as a human cdc2/CDC28-related gene that encodes a protein kinase essential for the G1/S transition in mammalian cells, but not for the G2/M transition, which requires Cdk1, another p34cdc2/CDC28 homolog. Novel potential functions of Cdk2 have been uncovered by using two potent and specific inhibitors of its kinase activity, roscovitine and olomoucine, on human wt p53-expresser untransformed and tumor-derived cells. At concentrations equal or superior to respectively 30- and 20-fold their in vitro IC50 values for cyclin B/Cdk1, cyclin A/Cdk2 and cyclin E/Cdk2, the Cdk inhibitors precipitately induce a dramatic nuclear accumulation of wt p53 and a delocalization of nucleolin from the nucleolus in all interphase cells, whatever their cell cycle status, acting in this way like the DNA-damaging drug, mitomycin C (7 microg/ml). These early events are soon followed by a nucleolar fragmentation in both normal and tumor cells in the presence of the Cdk inhibitors but not in the presence of the DNA-damaging drug. Yet, treatment with either type of compounds eventually triggers rapidly the death of the tumor cells and, much more slowly, that of the normal cells. The Cdk inhibitors, however, stimulate cell death from any stage of the cell cycle, whereas the DNA-damaging drug kills more efficaciously S phase cells. These observations provide a hint that the Cdk2 kinase might be involved in controlling the nuclear levels of the tumor suppressor wt p53 protein and in maintaining the nucleolar integrity and function, linking in this way the cell division cycle machinery to survival functions and overall cell metabolism via the control of nucleocytoplasmic transport and of ribosome production. PMID:10602500

  7. p53 regulates the transcription of its Delta133p53 isoform through specific response elements contained within the TP53 P2 internal promoter.

    PubMed

    Marcel, V; Vijayakumar, V; Fernández-Cuesta, L; Hafsi, H; Sagne, C; Hautefeuille, A; Olivier, M; Hainaut, P

    2010-05-01

    The tumor suppressor p53 protein is activated by genotoxic stress and regulates genes involved in senescence, apoptosis and cell-cycle arrest. Nine p53 isoforms have been described that may modulate suppressive functions of the canonical p53 protein. Among them, Delta133p53 lacks the 132 proximal residues and has been shown to modulate p53-induced apoptosis and cell-cycle arrest. Delta133p53 is expressed from a specific mRNA, p53I4, driven by an alternative promoter P2 located between intron 1 and exon 5 of TP53 gene. Here, we report that the P2 promoter is regulated in a p53-dependent manner. Delta133p53 expression is increased in response to DNA damage by doxorubicin in p53 wild-type cell lines, but not in p53-mutated cells. Chromatin immunoprecipitation and luciferase assays using P2 promoter deletion constructs indicate that p53 binds functional response elements located within the P2 promoter. We also show that Delta133p53 does not bind specifically to p53 consensus DNA sequence in vitro, but competes with wild-type p53 in specific DNA-binding assays. Finally, we report that Delta133p53 counteracts p53-dependent growth suppression in clonogenic assays. These observations indicate that Delta133p53 is a novel target of p53 that may participate in a negative feedback loop controlling p53 function. PMID:20190805

  8. MicroRNA-34a induces a senescence-like change via the down-regulation of SIRT1 and up-regulation of p53 protein in human esophageal squamous cancer cells with a wild-type p53 gene background.

    PubMed

    Ye, Zhimin; Fang, Jun; Dai, Shujun; Wang, Yuezhen; Fu, Zhenfu; Feng, Wei; Wei, Qichun; Huang, Pintong

    2016-01-28

    MiR-34a has been reported as a non-coding RNA universally expressed in normal old cells and a probable suppressor of diverse cancer cells; however, this miRNA's expression and anti-tumor mechanism in esophageal squamous cancer cells (ESCC) remains unclear. We explored these questions in three human ESCC lines, KYSE-450, KYSE-410, and ECa-109, with wild-type p53 and mutant p53 backgrounds. Through a specific stem-loop RT primer for miR-34a, we examined the relevant expression level of miR-34a in these three cell lines using real-time reverse transcription PCR (qRT-PCR). We found that the expression level of miR-34a induced by the DNA damage agent adrmycin (ADR) was both p53- and time-dependent. Following incubation with miR-34a, cellular growth inhibition was exhibited differently in the three cell lines harbored with different p53 backgrounds. Furthermore, the MTT assay demonstrated an miR-34a-related cytotoxic effect in cell growth. Senescence-associated β-galactosidase (SA-β-Gal) staining was used to examine senescence-like phenotypes induced by miR-34a. Mechanistic investigation suggested that the down-regulation of Sirtuin1 (SIRT1) and up-regulation of p53/p21 contributed to the anti-tumor mechanism of miR-34a in wild-type p53 ECa-109 cells, while neither of the apoptosis-related proteins PARP and caspase-3 caused significant changes. In summary, our findings indicated that the intrinsic expression of miR-34a was relatively low and was expressed differently among different p53 backgrounds and ADR treatment times. The anti-tumor effect of miR-34a was primarily dependent on the regulation of SIRT1 and p53/p21 protein, not apoptosis-associated proteins. PMID:26523671

  9. Lack of Major Genome Instability in Tumors of p53 Null Rats

    PubMed Central

    Hermsen, Roel; Toonen, Pim; Kuijk, Ewart; Youssef, Sameh A.; Kuiper, Raoul; van Heesch, Sebastiaan; de Bruin, Alain; Cuppen, Edwin; Simonis, Marieke

    2015-01-01

    Tumorigenesis is often associated with loss of tumor suppressor genes (such as TP53), genomic instability and telomere lengthening. Previously, we generated and characterized a rat p53 knockout model in which the homozygous rats predominantly develop hemangiosarcomas whereas the heterozygous rats mainly develop osteosarcomas. Using genome-wide analyses, we find that the tumors that arise in the heterozygous and homozygous Tp53C273X mutant animals are also different in their genomic instability profiles. While p53 was fully inactivated in both heterozygous and homozygous knockout rats, tumors from homozygous animals show very limited aneuploidy and low degrees of somatic copy number variation as compared to the tumors from heterozygous animals. In addition, complex structural rearrangements such as chromothripsis and breakage-fusion-bridge cycles were never found in tumors from homozygous animals, while these were readily detectable in tumors from heterozygous animals. Finally, we measured telomere length and telomere lengthening pathway activity and found that tumors of homozygous animals have longer telomeres but do not show clear telomerase or alternative lengthening of telomeres (ALT) activity differences as compared to the tumors from heterozygous animals. Taken together, our results demonstrate that host p53 status in this rat p53 knockout model has a large effect on both tumor type and genomic instability characteristics, where full loss of functional p53 is not the main driver of large-scale structural variations. Our results also suggest that chromothripsis primarily occurs under p53 heterozygous rather than p53 null conditions. PMID:25811670

  10. LZAP Inhibits p38 MAPK (p38) Phosphorylation and Activity by Facilitating p38 Association with the Wild-Type p53 Induced Phosphatase 1 (WIP1)

    PubMed Central

    An, Hanbing; Lu, Xinyuan; Liu, Dan; Yarbrough, Wendell G.

    2011-01-01

    LZAP (Cdk5rap3, C53) is a putative tumor suppressor that inhibits RelA, Chk1 and Chk2 and activates p53. LZAP is lost in a portion of human head and neck squamous cell carcinoma and experimental loss of LZAP expression is associated with enhanced invasion, xenograft tumor growth and angiogenesis. p38 MAPK can increase or decrease proliferation and cell death depending on cellular context. LZAP has no known enzymatic activity, implying that its biological functions are likely mediated by its protein-protein interactions. To gain further insight into LZAP activities, we searched for LZAP-associated proteins (LAPs). Here we show that the LZAP binds p38, alters p38 cellular localization, and inhibits basal and cytokine-stimulated p38 activity. Expression of LZAP inhibits p38 phosphorylation in a dose-dependent fashion while loss of LZAP enhances phosphorylation and activation with resultant phosphorylation of p38 downstream targets. Mechanistically, the ability of LZAP to alter p38 phosphorylation depended, at least partially, on the p38 phosphatase, Wip1. Expression of LZAP increased both LZAP and Wip1 binding to p38. Taken together, these data suggest that LZAP activity includes inhibition of p38 phosphorylation and activation. PMID:21283629

  11. Synergistic suppression of prostatic cancer cells by coexpression of both murine double minute 2 small interfering RNA and wild-type p53 gene in vitro and in vivo.

    PubMed

    Ji, Kun; Wang, Bo; Shao, Yue-Ting; Zhang, Ling; Liu, Ya-Nan; Shao, Chen; Li, Xiao-Jie; Li, Xin; Hu, Jia-di; Zhao, Xue-Jian; Xu, De-Qi; Li, Yang; Cai, Lu

    2011-07-01

    Our objective was to evaluate cell growth and death effects by inhibiting Murine Double Minute 2 (MDM2) expression in human prostate cancer cells overexpressing the wild-type (WT) p53 gene. Prostate PC-3 tumor cells were transfected with a plasmid containing either mdm2 small interfering (Si-mdm2) or the WT p53 gene (Pp53) alone, or both (Pmp53), using Lipofectamine in vitro and attenuated Salmonella enterica serovar Typhi vaccine strain Ty21a (Salmonella Typhi Ty21a) in vivo. Cell growth, apoptosis, and the expression of related genes and proteins were examined in vitro and in vivo by flow cytometry and Western blot assays. We demonstrated that human prostate tumors had increased expression of MDM2 and mutant p53 proteins. Transfection of the PC-3 cells with the Pmp53 plasmid in vitro offered significant inhibition of cell growth and an increase in apoptotic cell death compared with that of the Si-mdm2 or Pp53 group. These effects were associated with up-regulation of p21 and down-regulation of hypoxia-inducible factor 1α expression in Pmp53-transfected cells. To validate the in vitro findings, the nude mice implanted with PC-3 cells were treated with attenuated Salmonella Typhi Ty21a carrying the plasmids, which showed that the Pmp53 plasmid significantly inhibited the tumor growth rate in vivo compared with that of the Si-mdm2 or Pp53 plasmid alone. Tumor tissues from mice treated with the Pmp53 plasmid showed increased expression of p21 and decreased expression of hypoxia-inducible factor 1α proteins, with an increased apoptotic effect. These results suggest that knockdown of mdm2 expression by its specific small interfering RNA with overexpression of the WT p53 gene offers synergistic inhibition of prostate cancer cell growth in vitro and in vivo. PMID:21444629

  12. Regulation of P53 stability in p53 mutated human and mouse hepatoma cells.

    PubMed

    Hailfinger, Stephan; Jaworski, Maike; Marx-Stoelting, Philip; Wanke, Ines; Schwarz, Michael

    2007-04-01

    The tumor suppressor p53 is frequently mutated in cancer. We have investigated the regulation of P53 in p53 wild type mouse hepatoma cells (line 55.1c), in p53 heterozygeously mutated cells (56.1b) and in p53 defective cells (lines 56.1d, 70.4 and HUH7) under various experimental settings. The basal levels of P53 were low in 55.1c cells, but nuclear accumulation occurred upon UV-irradiation. Similarly, UV-exposure induced stabilization of P53 in the heterozygeously p53 mutated 56.1b hepatoma cells. By contrast, the 3 hepatoma lines, which lack transcriptionally active P53, demonstrated high basal nuclear concentrations of P53 protein and, unexpectedly, showed loss of P53 upon UV-irradiation. Expression of p53 mRNA was also decreased in p53 defective cells after 24 hr post UV-irradiation, which may be linked to induction of apoptosis of the irradiated cells under these conditions. Other stressors like H2O2 also mediated a decrease in P53 concentration in p53 defective cells. This effect occurred at very low concentrations and was already detectable 1-2 hr after exposure of cells. There were no signs of apoptosis of H2O2-exposed cells at this time point and no significant changes in p53 mRNA or MDM2 level. These unexpected findings indicate a new aspect related to regulation of P53 stability in cells with a defect in the tumor suppressor protein. PMID:17205518

  13. FGFR3b Extracellular Loop Mutation Lacks Tumorigenicity In Vivo but Collaborates with p53/pRB Deficiency to Induce High-grade Papillary Urothelial Carcinoma

    PubMed Central

    Zhou, Haiping; He, Feng; Mendelsohn, Cathy L.; Tang, Moon-shong; Huang, Chuanshu; Wu, Xue-Ru

    2016-01-01

    Missense mutations of fibroblast growth factor receptor 3 (FGFR3) occur in up to 80% of low-grade papillary urothelial carcinoma of the bladder (LGP-UCB) suggesting that these mutations are tumor drivers, although direct experimental evidence is lacking. Here we show that forced expression of FGFR3b-S249C, the most prevalent FGFR3 mutation in human LGP-UCB, in cultured urothelial cells resulted in slightly reduced surface translocation than wild-type FGFR3b, but nearly twice as much proliferation. When we expressed a mouse equivalent of this mutant (FGFR3b-S243C) in urothelia of adult transgenic mice in a tissue-specific and inducible manner, we observed significant activation of AKT and MAPK pathways. This was, however, not accompanied by urothelial proliferation or tumorigenesis over 12 months, due to compensatory tumor barriers in p16-pRB and p19-p53-p21 axes. Indeed, expressing FGFR3b-S249C in cultured human urothelial cells expressing SV40T, which functionally inactivates pRB/p53, markedly accelerated proliferation and cell-cycle progression. Furthermore, expressing FGFR3b-S243C in transgenic mouse urothelium expressing SV40T converted carcinoma-in-situ to high-grade papillary urothelial carcinoma. Together, our study provides new experimental evidence indicating that the FGFR3 mutations have very limited urothelial tumorigenicity and that these mutations must collaborate with other genetic events to drive urothelial tumorigenesis. PMID:27157475

  14. FGFR3b Extracellular Loop Mutation Lacks Tumorigenicity In Vivo but Collaborates with p53/pRB Deficiency to Induce High-grade Papillary Urothelial Carcinoma.

    PubMed

    Zhou, Haiping; He, Feng; Mendelsohn, Cathy L; Tang, Moon-Shong; Huang, Chuanshu; Wu, Xue-Ru

    2016-01-01

    Missense mutations of fibroblast growth factor receptor 3 (FGFR3) occur in up to 80% of low-grade papillary urothelial carcinoma of the bladder (LGP-UCB) suggesting that these mutations are tumor drivers, although direct experimental evidence is lacking. Here we show that forced expression of FGFR3b-S249C, the most prevalent FGFR3 mutation in human LGP-UCB, in cultured urothelial cells resulted in slightly reduced surface translocation than wild-type FGFR3b, but nearly twice as much proliferation. When we expressed a mouse equivalent of this mutant (FGFR3b-S243C) in urothelia of adult transgenic mice in a tissue-specific and inducible manner, we observed significant activation of AKT and MAPK pathways. This was, however, not accompanied by urothelial proliferation or tumorigenesis over 12 months, due to compensatory tumor barriers in p16-pRB and p19-p53-p21 axes. Indeed, expressing FGFR3b-S249C in cultured human urothelial cells expressing SV40T, which functionally inactivates pRB/p53, markedly accelerated proliferation and cell-cycle progression. Furthermore, expressing FGFR3b-S243C in transgenic mouse urothelium expressing SV40T converted carcinoma-in-situ to high-grade papillary urothelial carcinoma. Together, our study provides new experimental evidence indicating that the FGFR3 mutations have very limited urothelial tumorigenicity and that these mutations must collaborate with other genetic events to drive urothelial tumorigenesis. PMID:27157475

  15. The p53-dependent radioadaptive response

    NASA Astrophysics Data System (ADS)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  16. p73 Protein Expression Correlates With Radiation-Induced Apoptosis in the Lack of p53 Response to Radiation Therapy for Cervical Cancer

    SciTech Connect

    Wakatsuki, Masaru; Ohno, Tatsuya Iwakawa, Mayumi; Ishikawa, Hitoshi; Noda, Shuhei; Ohta, Toshie; Kato, Shingo; Tsujii, Hirohiko; Imai, Takashi; Nakano, Takashi

    2008-03-15

    Purpose: p73 belongs to the p53 tumor suppressor family of genes and can inhibit cell growth in a p53-like manner by inducing apoptosis or cell cycle arrest. Here, we investigated whether p73 could compensate for impaired p53 function in apoptosis induced by radiation therapy (RT) for cervical cancer. Methods and Materials: Sixty-eight patients with squamous cell carcinoma of the cervix who received definitive RT combined with (n = 37) or without (n = 31) cisplatin were investigated. Biopsy specimens were excised from the cervical tumor before RT and after 9 Gy. Results: Mean apoptosis index (AI) was 0.93% before RT and 1.97% after 9 Gy with a significant increase (p < 0.001). For all patients, there was a significant correlation between p73 expression positivity after 9 Gy and AI ratio (AI after 9 Gy/AI before RT) (p = 0.021). Forty-one patients were regarded as the p53-responding group according to the expression of p53 after 9 Gy, whereas the remaining 27 patients were regarded as the p53-nonresponding group. A significant correlation between p73 expression after 9 Gy and AI ratio was observed in the p53-non-responding group (p < 0.001) but not in the p53-responding group (p = 0.940). Conclusion: Our results suggest that p73 plays an important role in compensating for the lack of p53 function in radiation-induced apoptosis of cervical cancer.

  17. Effect of oxygen pressure during incubation with a (10)B-carrier on (10)B uptake capacity of cultured p53 wild-type and mutated tumor cells: dependency on p53 status of tumor cells and types of (10)B-carriers.

    PubMed

    Masunaga, Shin-ichiro; Tatebe, Hitoshi; Nishimura, Yasumasa; Tano, Keizo; Sanada, Yu; Moriwaki, Takahiro; Sakurai, Yoshinori; Tanaka, Hiroki; Suzuki, Minoru; Kondo, Natsuko; Maruhashi, Akira; Ono, Koji

    2016-01-01

    Purpose To evaluate the effect of oxygen pressure during incubation with a (10)B-carrier on (10)B uptake capacity of cultured p53 wild-type and mutated tumor cells. Materials and methods Cultured human head and neck squamous cell carcinoma cell line transfected with mutant TP53 (SAS/mp53), or with a neo vector as a control (SAS/neo) was incubated with L-para-boronophenylalanine-(10)B (BPA) or sodium mercaptoundecahydrododecaborate-(10)B (BSH) as a (10)B-carrier at the (10)B concentration of 60 ppm for 24 h under aerobic (20.7% of oxygen) or hypoxic (0.28% of oxygen) conditions. Immediately after incubation, cultured tumor cells received reactor thermal neutron beams, and a cell survival assay was performed. (10)B concentration of cultured SAS/neo or SAS/mp53 cells incubated under aerobic or hypoxic conditions was determined with a thermal neutron guide tube. Results Hypoxic incubation significantly decreased (10)B concentration of cultured cells with a clearer tendency observed following BPA than BSH treatment in both SAS/neo and SAS/mp53 cells. Following neutron beam irradiation, SAS/mp53 cells showed significantly higher relative biological effectiveness values than SAS/neo cells because of the significantly lower radiosensitivity of SAS/mp53 to γ-rays than SAS/neo cells. Conclusion Oxygen pressure during incubation with a (10)B-carrier had a critical impact on (10)B uptake of cultured tumor cells. PMID:26887694

  18. Lack of functional p53 renders DENSpm-induced autophagy and apoptosis in time dependent manner in colon cancer cells.

    PubMed

    Çoker-Gürkan, Ajda; Arisan, Elif Damla; Obakan, Pınar; Palavan-Unsal, Narçin

    2015-01-01

    Polyamines (PAs), such as putrescine, spermidine and spermine, are alkyl-amines that are essential for cell growth, proliferation, differentiation and cancer progression in eukaryotic cells. A designed PA analogue; DENSpm, induces cell cycle arrest, inhibits proliferation and induces apoptosis in melanoma, breast, prostate, lung and colon cancer cells. Although the mechanism by which DENSpm induces apoptosis has been examined, the effect of DENSpm on autophagy has not been investigated yet. Therefore, in this study, our objective was to determine the role of p53 in the DENSpm-induced autophagy/apoptotic regulation in a time-dependent manner in colon cancer cells. Exposure of HCT 116 colon cancer cells to DENSpm decreased cell viability in a dose- and time-dependent manner. However, the p53 mutant, SW480, and deficient HCT 116 p53(-/-) cells were more resistant to DENSpm treatment compared to HCT 116 p53(+/+) cells. The resistant profile caused by p53 defect also caused a cell type-specific response to PA pool depletion and SSAT overexpression. In addition to PA depletion, DENSpm induced apoptosis by activating the mitochondria-mediated pathway in a caspase-dependent manner regardless of p53 expression in colon cancer cells. Concomitantly, we determined that DENSpm also affected autophagy in HCT 116 p53(+/+), SW480 and HCT 116 p53(-/-) colon cancer cells for different periods of exposure to DENSpm. Therefore, this study revealed that effect of DENSpm on cell death differs due to p53 protein expression profile. In addition, DENSpm-induced autophagy may be critical in drug resistance in colon cancer cells. PMID:25311224

  19. Upregulation of CYP2S1 by oxaliplatin is associated with p53 status in colorectal cancer cell lines

    PubMed Central

    Yang, Chao; Zhou, Qian; Li, Minle; Tong, Xuemei; Sun, Jiayi; Qing, Yin; Sun, Liya; Yang, Xuhan; Hu, Xiaowen; Jiang, Jie; Yan, Xiaomei; He, Lin; Wan, Chunling

    2016-01-01

    Oxaliplatin displays a wide spectrum of antitumor activities and is widely used in the treatment of metastatic colorectal cancer (CRC). However, tumor responses to this agent are variable, and the underlying mechanisms are poorly understood. In the present study, oxaliplatin was found to strongly inhibit the growth of HCT116 cells harboring wild-type p53 but to only weakly inhibit SW480 cells, HT29 cells or p53−/− HCT116 cells, which all lack p53 expression. Administration of oxaliplatin significantly induced p53 accumulation and enhanced expression of CYP2S1 in HCT116 cells with wild-type p53. CYP2S1 knockdown conferred a cell survival advantage after oxaliplatin treatment to cells harboring wild-type p53 in vitro and in vivo. Interestingly, enzyme immunoassays, TOPFlash/FOPFlash reporter activity assays and western blotting analysis demonstrated oxaliplatin-mediated downregulation of PGE2 and Wnt/β-catenin signaling in a manner dependent on p53. Moreover, oxaliplatin treatment of mice with subcutaneous tumor xenografts drastically reduced the volume of wild-type p53 HCT116 tumors but had no effect on isogenic p53−/− HCT116 tumors. These results suggest that oxaliplatin exerts its inhibitory effects in human CRC cells via upregulation of CYP2S1 expression in a p53-dependent manner. PMID:27609465

  20. Upregulation of CYP2S1 by oxaliplatin is associated with p53 status in colorectal cancer cell lines.

    PubMed

    Yang, Chao; Zhou, Qian; Li, Minle; Tong, Xuemei; Sun, Jiayi; Qing, Yin; Sun, Liya; Yang, Xuhan; Hu, Xiaowen; Jiang, Jie; Yan, Xiaomei; He, Lin; Wan, Chunling

    2016-01-01

    Oxaliplatin displays a wide spectrum of antitumor activities and is widely used in the treatment of metastatic colorectal cancer (CRC). However, tumor responses to this agent are variable, and the underlying mechanisms are poorly understood. In the present study, oxaliplatin was found to strongly inhibit the growth of HCT116 cells harboring wild-type p53 but to only weakly inhibit SW480 cells, HT29 cells or p53-/- HCT116 cells, which all lack p53 expression. Administration of oxaliplatin significantly induced p53 accumulation and enhanced expression of CYP2S1 in HCT116 cells with wild-type p53. CYP2S1 knockdown conferred a cell survival advantage after oxaliplatin treatment to cells harboring wild-type p53 in vitro and in vivo. Interestingly, enzyme immunoassays, TOPFlash/FOPFlash reporter activity assays and western blotting analysis demonstrated oxaliplatin-mediated downregulation of PGE2 and Wnt/β-catenin signaling in a manner dependent on p53. Moreover, oxaliplatin treatment of mice with subcutaneous tumor xenografts drastically reduced the volume of wild-type p53 HCT116 tumors but had no effect on isogenic p53-/- HCT116 tumors. These results suggest that oxaliplatin exerts its inhibitory effects in human CRC cells via upregulation of CYP2S1 expression in a p53-dependent manner. PMID:27609465

  1. Lack of sequence variation in sporadic bovine leucosis in regions of tumour suppressor genes p53 and p16.

    PubMed

    Mayr, B; Grüneis, C; Brem, G; Reifinger, M; Schaffner, G; Hochsteiner, W

    2001-08-01

    Regions of the promoter and exons 5-8 of the tumour suppressor gene p53 were analysed in 25 cases of sporadic bovine leucosis. The study included 17 cases of juvenile leucosis, five cases of adult leucosis and three cases of skin leucosis. Exon 2 of tumour suppressor gene p16 was also investigated in the same samples. No sequence variations were present in the analysed areas of the genes. In p53, this fact represents a clear difference in comparison with enzootic bovine leucosis. In p16, no comparative data are available. PMID:11554494

  2. Radiation response and cell cycle regulation of p53 rescued malignant keratinocytes

    SciTech Connect

    Niemantsverdriet, Maarten; Jongmans, Wim; Backendorf, Claude . E-mail: backendo@chem.leidenuniv.nl

    2005-10-15

    Mutations in the tumor suppressor gene p53 were found in more than 90% of all human squamous cell carcinomas (SCC). To study the function of p53 in a keratinocyte background, a tetracycline-controlled p53 transgene was introduced into a human SCC cell line (SCC15), lacking endogenous p53. Conditional expression of wild-type p53 protein upon withdrawal of tetracycline was accompanied with increased expression of p21{sup WAF1/Cip1} resulting in reduced cell proliferation. Flow-cytometric analysis revealed that these cells were transiently arrested in the G1/S phase of the cell cycle. However, when SCC15 cells expressing p53 were exposed to ionizing radiation (IR), a clear shift from a G1/S to a G2/M cell cycle arrest was observed. This effect was greatly depending on the presence of wild-type p53, as it was not observed to the same extent in SCC15 cells lacking p53. Unexpectedly, the p53- and IR-dependent G2/M cell cycle arrest in the keratinocyte background was not depending on increased expression or stabilization of 14-3-3{sigma}, a p53-regulated effector of G2/M progression in colorectal cancer cells. In keratinocytes, 14-3-3{sigma} (stratifin) is involved in terminal differentiation and its cell cycle function in this cell type might diverge from the one it fulfills in other cellular backgrounds.

  3. Adenovirus-mediated wild-type p53 gene transfer in combination with bronchial arterial infusion for treatment of advanced non-small-cell lung cancer, one year follow-up

    PubMed Central

    Guan, Yong-song; Liu, Yuan; Zou, Qing; He, Qing; La, Zi; Yang, Lin; Hu, Ying

    2009-01-01

    Objective: In the present study, we have examined the safety and efficacy of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) injection in patients with advanced non-small-cell lung cancer (NSCLC) in the combination with the therapy of bronchial arterial infusion (BAI). Methods: A total of 58 patients with advanced NSCLC were enrolled in a non-randomized, two-armed clinical trial. Of which, 19 received a combination treatment of BAI and rAd-p53 (the combo group), while the remaining 39 were treated with only BAI (the control group). Patients were followed up for 12 months, with safety and local response evaluated by the National Cancer Institute’s Common Toxicity Criteria and response evaluation criteria in solid tumor (RECIST), respectively. Time to progression (TTP) and survival rates were also analyzed by Kaplan-Meier method. Results: In the combo group, 19 patients received a total of 49 injections of rAd-p53 and 46 times of BAI, respectively, while 39 patients in the control group received a total of 113 times of BAI. The combination treatment was found to have less adverse events such as anorexia, nausea and emesis, pain, and leucopenia (P<0.05) but more arthralgia, fever, influenza-like symptom, and myalgia (P<0.05), compared with the control group. The overall response rates (complete response (CR)+partial response (PR)) were 47.3% and 38.4% for the combo group and the control group, respectively (P>0.05). Patients in the combo group had a longer TTP than those in the control group (a median 7.75 vs 5.5 months, P=0.018). However, the combination treatment did not lead to better survival, with survival rates at 3, 6, and 12 months in the combo group being 94.74%, 89.47%, and 52.63%, respectively, compared with 92.31%, 69.23%, and 38.83% in the control group (P=0.224). Conclusion: Our results show that the combination of rAd-p53 and BAI was well tolerated in patients with NSCLC and may have improved the quality of life and delayed

  4. Transcriptional regulation of thymine DNA glycosylase (TDG) by the tumor suppressor protein p53.

    PubMed

    da Costa, Nathalia Meireles; Hautefeuille, Agnès; Cros, Marie-Pierre; Melendez, Matias Eliseo; Waters, Timothy; Swann, Peter; Hainaut, Pierre; Pinto, Luis Felipe Ribeiro

    2012-12-15

    Thymine DNA glycosylase (TDG) belongs to the superfamily of uracil DNA glycosylases (UDG) and is the first enzyme in the base-excision repair pathway (BER) that removes thymine from G:T mismatches at CpG sites. This glycosylase activity has also been found to be critical for active demethylation of genes involved in embryonic development. Here we show that wild-type p53 transcriptionally regulates TDG expression. Chromatin immunoprecipitation (ChIP) and luciferase assays indicate that wild-type p53 binds to a domain of TDG promoter containing two p53 consensus response elements (p53RE) and activates its transcription. Next, we have used a panel of cell lines with different p53 status to demonstrate that TDG mRNA and protein expression levels are induced in a p53-dependent manner under different conditions. This panel includes isogenic breast and colorectal cancer cell lines with wild-type or inactive p53, esophageal squamous cell carcinoma cell lines lacking p53 or expressing a temperature-sensitive p53 mutant and normal human bronchial epithelial cells. Induction of TDG mRNA expression is accompanied by accumulation of TDG protein in both nucleus and cytoplasm, with nuclear re-localization occurring upon DNA damage in p53-competent, but not -incompetent, cells. These observations suggest a role for p53 activity in TDG nuclear translocation. Overall, our results show that TDG expression is directly regulated by p53, suggesting that loss of p53 function may affect processes mediated by TDG, thus negatively impacting on genetic and epigenetic stability. PMID:23165212

  5. Transcriptional regulation of thymine DNA glycosylase (TDG) by the tumor suppressor protein p53

    PubMed Central

    da Costa, Nathalia Meireles; Hautefeuille, Agnès; Cros, Marie-Pierre; Melendez, Matias Eliseo; Waters, Timothy; Swann, Peter; Hainaut, Pierre; Pinto, Luis Felipe Ribeiro

    2012-01-01

    Thymine DNA glycosylase (TDG) belongs to the superfamily of uracil DNA glycosylases (UDG) and is the first enzyme in the base-excision repair pathway (BER) that removes thymine from G:T mismatches at CpG sites. This glycosylase activity has also been found to be critical for active demethylation of genes involved in embryonic development. Here we show that wild-type p53 transcriptionally regulates TDG expression. Chromatin immunoprecipitation (ChIP) and luciferase assays indicate that wild-type p53 binds to a domain of TDG promoter containing two p53 consensus response elements (p53RE) and activates its transcription. Next, we have used a panel of cell lines with different p53 status to demonstrate that TDG mRNA and protein expression levels are induced in a p53-dependent manner under different conditions. This panel includes isogenic breast and colorectal cancer cell lines with wild-type or inactive p53, esophageal squamous cell carcinoma cell lines lacking p53 or expressing a temperature-sensitive p53 mutant and normal human bronchial epithelial cells. Induction of TDG mRNA expression is accompanied by accumulation of TDG protein in both nucleus and cytoplasm, with nuclear re-localization occurring upon DNA damage in p53-competent, but not -incompetent, cells. These observations suggest a role for p53 activity in TDG nuclear translocation. Overall, our results show that TDG expression is directly regulated by p53, suggesting that loss of p53 function may affect processes mediated by TDG, thus negatively impacting on genetic and epigenetic stability. PMID:23165212

  6. The induction of polyploidy or apoptosis by the Aurora A kinase inhibitor MK8745 is p53-dependent

    PubMed Central

    Ho, Alan L; Schwartz, Gary K

    2012-01-01

    Aurora kinases are mitotic serine/threonine protein kinases and are attractive novel targets for anticancer therapy. Many small-molecule inhibitors of Aurora kinases are currently undergoing clinical trials. Aurora A kinase is essential for successful mitotic transition. MK8745 is a novel and selective small-molecule inhibitor of Aurora A kinase. MK8745 induced apoptotic cell death in a p53-dependent manner when tested in vitro in cell lines of multiple lineages. Cells expressing wild-type p53 showed a short delay in mitosis followed by cytokinesis, resulting in 2N cells along with apoptosis. However, cells lacking or with mutant p53 resulted in a prolonged arrest in mitosis followed by endoreduplication and polyploidy. Cytokinesis was completely inhibited in p53-deficient cells, as observed by the absence of 2N cell population. The induction of apoptosis in p53-proficient cells was associated with activation of caspase 3 and release of cytochrome c but was independent of p21. Exposure of p53 wild-type cells to MK8745 resulted in the induction of p53 phosphorylation (ser15) and an increase in p53 protein expression. p53-dependent apoptosis by MK8745 was further confirmed in HCT 116 p53−/− cells transfected with wild-type p53. Transient knockdown of Aurora A by specific siRNA recapitulated these p53-dependent effects, with greater percent induction of apoptosis in p53 wild-type cells. In conclusion, our studies show p53 as a determining factor for induction of apoptosis vs. polyploidy upon inhibition of Aurora A. PMID:22293494

  7. Quadruple wild-type (WT) GIST: defining the subset of GIST that lacks abnormalities of KIT, PDGFRA, SDH, or RAS signaling pathways

    PubMed Central

    Pantaleo, Maria A; Nannini, Margherita; Corless, Christopher L; Heinrich, Michael C

    2015-01-01

    A subset of GISTs lack mutations in the KIT/PDGFRA or RAS pathways and yet retain an intact succinate dehydrogensase (SDH) complex. We propose that these KIT/PDGFRA/SDH/RAS-P WT GIST tumors be designated as quadruple wild-type (WT) GIST. Further molecular and clinicophatological characterization of quadruple WT GIST will help to determine their prognosis as well as assist in the optimization of medical management, including clinical test of novel therapies. PMID:25165019

  8. Quadruple wild-type (WT) GIST: defining the subset of GIST that lacks abnormalities of KIT, PDGFRA, SDH, or RAS signaling pathways.

    PubMed

    Pantaleo, Maria A; Nannini, Margherita; Corless, Christopher L; Heinrich, Michael C

    2015-01-01

    A subset of GISTs lack mutations in the KIT/PDGFRA or RAS pathways and yet retain an intact succinate dehydrogensase (SDH) complex. We propose that these KIT/PDGFRA/SDH/RAS-P WT GIST tumors be designated as quadruple wild-type (WT) GIST. Further molecular and clinicophatological characterization of quadruple WT GIST will help to determine their prognosis as well as assist in the optimization of medical management, including clinical test of novel therapies. PMID:25165019

  9. Analysis of mitochondrial DNA nucleoids in wild-type and a mutant strain of Saccharomyces cerevisiae that lacks the mitochondrial HMG box protein Abf2p.

    PubMed Central

    Newman, S M; Zelenaya-Troitskaya, O; Perlman, P S; Butow, R A

    1996-01-01

    DNA-protein complexes (nucleoids) are believed to be the segregating unit of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae. A mitochondrial HMG box protein, Abf2p, is needed for maintenance of mtDNA in cells grown on rich dextrose medium, but is dispensible in glycerol grown cells. As visualized by 4',6'-diamino-2-phenylindole staining, mtDNA nucleoids in mutant cells lacking Abf2p ( delta abf2) are diffuse compared with those in wild-type cells. We have isolated mtDNA nucleoids and characterized two mtDNA-protein complexes, termed NCLDp-2 and NCLDs-2, containing distinct but overlapping sets of polypeptides. This protocol yields similar nucleoid complexes from the delta abf2 mutant, although several proteins appear lacking from NCLDs-2. Segments of mtDNA detected with probes to COXII, VAR1 and ori5 sequences are equally sensitive to DNase I digestion in NCLDs-2 and NCLDp-2 from wild-type cells and from the delta abf2 mutant. However, COXII and VAR1 sequences are 4-to 5-fold more sensitive to DNase I digestion of mtDNA in toluene-permeabilized mitochondria from the delta abf2 mutant than from wild-type cells, but no difference in DNase I sensitivity was detected with the ori5 probe. These results provide a first indication that Abf2p influences differential organization of mtDNA sequences. PMID:8628667

  10. Mice Lacking Dystrophin or α Sarcoglycan Spontaneously Develop Embryonal Rhabdomyosarcoma with Cancer-Associated p53 Mutations and Alternatively Spliced or Mutant Mdm2 Transcripts

    PubMed Central

    Fernandez, Karen; Serinagaoglu, Yelda; Hammond, Sue; Martin, Laura T.; Martin, Paul T.

    2010-01-01

    Altered expression of proteins in the dystrophin-associated glycoprotein complex results in muscular dystrophy and has more recently been implicated in a number of forms of cancer. Here we show that loss of either of two members of this complex, dystrophin in mdx mice or α sarcoglycan in Sgca−/− mice, results in the spontaneous development of muscle-derived embryonal rhabdomyosarcoma (RMS) after 1 year of age. Many mdx and Sgca−/− tumors showed increased expression of insulin-like growth factor 2, retinoblastoma protein, and phosphorylated Akt and decreased expression of phosphatase and tensin homolog gene, much as is found in a human RMS. Further, all mdx and Sgca−/− RMS analyzed had increased expression of p53 and murine double minute (mdm)2 protein and contained missense p53 mutations previously identified in human cancers. The mdx RMS also contained missense mutations in Mdm2 or alternatively spliced Mdm2 transcripts that lacked an exon encoding a portion of the p53-binding domain. No Pax3:Fkhr or Pax7:Fkhr translocation mRNA products were evident in any tumor. Expression of natively glycosylated α dystroglycan and α sarcoglycan was reduced in mdx RMS, whereas dystrophin expression was absent in almost all human RMS, both for embryonal and alveolar RMS subtypes. These studies show that absence of members of the dystrophin-associated glycoprotein complex constitutes a permissive environment for spontaneous development of embryonal RMS associated with mutation of p53 and mutation or altered splicing of Mdm2. PMID:20019182

  11. Wild-Type-Like Viral Replication Potential of Human Immunodeficiency Virus Type 1 Envelope Mutants Lacking Palmitoylation Signals

    PubMed Central

    Chan, Woan-Eng; Lin, Hui-Hua; Chen, Steve S.-L.

    2005-01-01

    Palmitoylation of the cytoplasmic domain of the human immunodeficiency type virus type 1 (HIV-1) envelope (Env) transmembrane protein, gp41, has been implicated in Env targeting to detergent-resistant lipid rafts, Env incorporation into the virus, and viral infectivity. In contrast, we provide evidence here to show that HIV-1 infectivity, Env targeting to lipid rafts, and Env incorporation into the virus are independent of cytoplasmic tail palmitoylation. The T-cell (T)-tropic HXB2-based virus, which utilizes CXCR4 as the entry coreceptor, carrying a Cys-to-Ser mutation at residue 764 or 837 or at both replicated with wild-type (WT) virus replication kinetics in CD4+ T cells. The properties of Env expression, precursor processing, cell surface expression, and Env incorporation of these three mutant viruses were normal compared to those of the WT virus. These three mutant Env proteins all effectively mediated one-cycle virus infection. When the Cys residues were replaced by Ala residues, all single and double mutants still retained the phenotypes of infectivity, Env incorporation, and lipid raft localization of the WT Env. When Cys-to-Ala substitutions were introduced into the macrophage (M)-tropic ConB virus, which utilizes CCR5 as the coreceptor, these mutations did not affect the replication potential, Env phenotypes, lipid raft targeting, or Env assembly into the virus of the WT Env. These T- and M-tropic mutants also productively replicated in human primary CD4+ T cells. Moreover, mutations at both Cys residues significantly reduced the level of palmitoylation of the Env. Our results together support the notion that palmitoylation of the cytoplasmic tail of the HIV-1 Env is not essential for the HIV-1 virus life cycle. PMID:15956582

  12. Lysosomal destabilization in p53-induced apoptosis

    PubMed Central

    Yuan, Xi-Ming; Li, Wei; Dalen, Helge; Lotem, Joseph; Kama, Rachel; Sachs, Leo; Brunk, Ulf T.

    2002-01-01

    The tumor suppressor wild-type p53 can induce apoptosis. M1-t-p53 myeloid leukemic cells have a temperature-sensitive p53 protein that changes its conformation to wild-type p53 after transfer from 37°C to 32°C. We have now found that these cells showed an early lysosomal rupture after transfer to 32°C. Mitochondrial damage, including decreased membrane potential and release of cytochrome c, and the appearance of apoptotic cells occurred later. Lysosomal rupture, mitochondrial damage, and apoptosis were all inhibited by the cytokine IL-6. Some other compounds can also inhibit apoptosis induced by p53. The protease inhibitor N-tosyl-l-phenylalanine chloromethyl ketone inhibited the decrease in mitochondrial membrane potential and cytochrome c release, the Ca2+-ATPase inhibitor thapsigargin inhibited only cytochrome c release, and the antioxidant butylated hydroxyanisole inhibited only the decrease in mitochondrial membrane potential. In contrast to IL-6, these other compounds that inhibited some of the later occurring mitochondrial damage did not inhibit the earlier p53-induced lysosomal damage. The results indicate that apoptosis is induced by p53 through a lysosomal-mitochondrial pathway that is initiated by lysosomal destabilization, and that this pathway can be dissected by using different apoptosis inhibitors. These findings on the induction of p53-induced lysosomal destabilization can also help to formulate new therapies for diseases with apoptotic disorders. PMID:11959917

  13. Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line

    SciTech Connect

    Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira . E-mail: akiranak@chiba-cc.jp

    2007-03-23

    p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53{delta}C) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53{delta}C was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain.

  14. Iron Metabolism Regulates p53 Signaling through Direct Heme-p53 Interaction and Modulation of p53 Localization, Stability, and Function

    PubMed Central

    Shen, Jia; Sheng, Xiangpeng; Chang, ZeNan; Wu, Qian; Wang, Sheng; Xuan, Zongliang; Li, Dan; Wu, Yalan; Shang, Yongjia; Kong, Xiangtao; Yu, Long; Li, Lin; Ruan, Kangchen; Hu, Hongyu; Huang, Ying; Hui, Lijian; Xie, Dong; Wang, Fudi; Hu, Ronggui

    2014-01-01

    SUMMARY Iron excess is closely associated with tumorigenesis in multiple types of human cancers, with underlying mechanisms yet unclear. Recently, iron deprivation has emerged as a major strategy for chemotherapy, but it exerts tumor suppression only on select human malignancies. Here, we report that the tumor suppressor protein p53 is downregulated during iron excess. Strikingly, the iron polyporphyrin heme binds to p53 protein, interferes with p53-DNA interactions, and triggers both nuclear export and cytosolic degradation of p53. Moreover, in a tumorigenicity assay, iron deprivation suppressed wild-type p53-dependent tumor growth, suggesting that upregulation of wild-type p53 signaling underlies the selective efficacy of iron deprivation. Our findings thus identify a direct link between iron/heme homeostasis and the regulation of p53 signaling, which not only provides mechanistic insights into iron-excess-associated tumorigenesis but may also help predict and improve outcomes in iron-deprivation-based chemotherapy. PMID:24685134

  15. FAK and p53 Synergistically Decrease Neuroblastoma Cell Survival

    PubMed Central

    Gillory, Lauren A.; Stewart, Jerry E.; Megison, Michael L.; Waters, Alicia M.; Beierle, Elizabeth A.

    2015-01-01

    Neuroblastoma is the most common extracranial solid tumor of childhood and is responsible for over 15% of pediatric cancer deaths. Focal adhesion kinase (FAK) is a non-receptor tyrosine kinase that is important in many facets of neuroblastoma tumor development and progression. The p53 oncogene, although wild type in most neuroblastomas, lacks significant function as a tumor suppressor in these tumors. Recent reports have found that FAK and p53 interact in some tumor types. We have hypothesized FAK and p53 coordinately control each other’s expression and also interact in neuroblastoma. In the current study, we showed that not only do FAK and p53 interact but each one controls the expression of the other. In addition, we also examined the effects of FAK inhibition combined with p53 activation in neuroblastoma and showed that these two, in combination, had a synergistic effect upon neuroblastoma cell survival. The findings from this current study help to further our understanding of the regulation of neuroblastoma tumorigenesis, and may provide novel therapeutic strategies and targets for neuroblastoma and other pediatric solid tumors. PMID:25862488

  16. p53 Prevents Entry into Mitosis with Uncapped Telomeres

    PubMed Central

    Thanasoula, Maria; Escandell, Jose Miguel; Martinez, Paula; Badie, Sophie; Muñoz, Purificacion; Blasco, María A.; Tarsounas, Madalena

    2016-01-01

    Summary Telomeres are protected by capping structures consisting of core protein complexes that bind with sequence specificity to telomeric DNA (reviewed in [1]). In their absence, telomeres trigger a DNA damage response, materialized in accumulation at the telomere of damage response proteins, e.g., phosphorylated histone H2AX (γH2AX), into telomere-dysfunction-induced foci [2, 3]. Telomere uncapping occurs transiently in every cell cycle in G2 [4], following DNA replication, but little is known about how protective structures are reassembled or whether this process is controlled by the cell-cycle surveillance machinery. Here, we report that telomere capping is monitored at the G2/M transition by the p53/p21 damage response pathway. Unlike their wild-type counterparts, human and mouse cells lacking p53 or p21 progress into mitosis prematurely with persisting uncapped telomeres. Furthermore, artificially uncapped telomeres delay mitotic entry in a p53- and p21-dependent manner. Uncapped telomeres that persist in mitotic p53-deficient cells are shorter than average and religate to generate end-to-end fusions. These results suggest that a p53-dependent pathway monitors telomere capping after DNA replication and delays G2/M progression in the presence of unprotected telomeres. This mechanism maintains a cell-cycle stage conducive for capping reactions and prevents progression into stages during which uncapped telomeres are prone to deleterious end fusions. PMID:20226664

  17. Targeting Oncogenic Mutant p53 for Cancer Therapy

    PubMed Central

    Parrales, Alejandro; Iwakuma, Tomoo

    2015-01-01

    Among genetic alterations in human cancers, mutations in the tumor suppressor p53 gene are the most common, occurring in over 50% of human cancers. The majority of p53 mutations are missense mutations and result in the accumulation of dysfunctional p53 protein in tumors. These mutants frequently have oncogenic gain-of-function activities and exacerbate malignant properties of cancer cells, such as metastasis and drug resistance. Increasing evidence reveals that stabilization of mutant p53 in tumors is crucial for its oncogenic activities, while depletion of mutant p53 attenuates malignant properties of cancer cells. Thus, mutant p53 is an attractive druggable target for cancer therapy. Different approaches have been taken to develop small-molecule compounds that specifically target mutant p53. These include compounds that restore wild-type conformation and transcriptional activity of mutant p53, induce depletion of mutant p53, inhibit downstream pathways of oncogenic mutant p53, and induce synthetic lethality to mutant p53. In this review article, we comprehensively discuss the current strategies targeting oncogenic mutant p53 in cancers, with special focus on compounds that restore wild-type p53 transcriptional activity of mutant p53 and those reducing mutant p53 levels. PMID:26732534

  18. Pharmacological Activation of p53 in Cancer Cells

    PubMed Central

    Athar, Mohammad; Elmets, Craig A.; Kopelovich, Levy

    2013-01-01

    Tumor suppressor p53 is a transcription factor that regulates a large number of genes and guards against genomic instability. Under multiple cellular stress conditions, p53 functions to block cell cycle progression transiently unless proper DNA repair occurs. Failure of DNA repair mechanisms leads to p53-mediated induction of cell death programs. p53 also induces permanent cell cycle arrest known as cellular senescence. During neoplastic progression, p53 is often mutated and fails to efficiently perform these functions. It has been observed that cancers carrying a wild-type p53 may also have interrupted downstream p53 regulatory signaling leading to disruption in p53 functions. Therefore, strategies to reactivate p53 provide an attractive approach for blocking tumor pathogenesis and its progression. p53 activation may also lead to regression of existing early neoplastic lesions and therefore may be important in developing cancer chemoprevention protocols. A large number of small molecules capable of reactivating p53 have been developed and some are progressing through clinical trials for prospective human applications. However, several questions remain to be answered at this stage. For example, it is not certain if pharmacological activation of p53 will restore all of its multifaceted biological responses, assuming that the targeted cell is not killed following p53 activation. It remains to be demonstrated whether the distinct biological effects regulated by specific post-transnationally modified p53 can effectively be restored by refolding mutant p53. Mutant p53 can be classified as a loss of function or gain of function protein depending on the type of mutation. It is also unclear whether reactivation of mutant p53 has similar consequences in cells carrying gain-of-function and loss-of-function p53 mutants. This review provides a description of various pharmacological approaches tested to activate p53 (both wild-type and mutant) and to assess the effects of

  19. Chemical Variations on the p53 Reactivation Theme

    PubMed Central

    Ribeiro, Carlos J. A.; Rodrigues, Cecília M. P.; Moreira, Rui; Santos, Maria M. M.

    2016-01-01

    Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX). Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented. PMID:27187415

  20. Impact of p53 status on heavy-ion radiation-induced micronuclei in circulating erythrocytes

    NASA Technical Reports Server (NTRS)

    Chang, P. Y.; Torous, D.; Lutze-Mann, L.; Winegar, R.

    2000-01-01

    Transgenic mice that differed in their p53 genetic status were exposed to an acute dose of highly charged and energetic (HZE) iron particle radiation. Micronuclei (MN) in two distinct populations of circulating peripheral blood erythrocytes, the immature reticulocytes (RETs) and the mature normochromatic erythrocytes (NCEs), were measured using a simple and efficient flow cytometric procedure. Our results show significant elevation in the frequency of micronucleated RETs (%MN-RETs) at 2 and 3 days post-radiation. At 3 days post-irradiation, the magnitude of the radiation-induced MN-RET was 2.3-fold higher in the irradiated p53 wild-type animals compared to the unirradiated controls, 2.5-fold higher in the p53 hemizygotes and 4.3-fold higher in the p53 nullizygotes. The persistence of this radiation-induced elevation of MN-RETs is dependent on the p53 genetic background of the animal. In the p53 wild-type and p53 hemizygotes, %MN-RETs returned to control levels by 9 days post-radiation. However, elevated levels of %MN-RETs in p53 nullizygous mice persisted beyond 56 days post-radiation. We also observed elevated MN-NCEs in the peripheral circulation after radiation, but the changes in radiation-induced levels of MN-NCEs appear dampened compared to those of the MN-RETs for all three strains of animals. These results suggest that the lack of p53 gene function may play a role in the iron particle radiation-induced genomic instability in stem cell populations in the hematopoietic system.

  1. Reactive oxygen species and transcript analysis upon excess light treatment in wild-type Arabidopsis thaliana vs a photosensitive mutant lacking zeaxanthin and lutein

    PubMed Central

    2011-01-01

    Background Reactive oxygen species (ROS) are unavoidable by-products of oxygenic photosynthesis, causing progressive oxidative damage and ultimately cell death. Despite their destructive activity they are also signalling molecules, priming the acclimatory response to stress stimuli. Results To investigate this role further, we exposed wild type Arabidopsis thaliana plants and the double mutant npq1lut2 to excess light. The mutant does not produce the xanthophylls lutein and zeaxanthin, whose key roles include ROS scavenging and prevention of ROS synthesis. Biochemical analysis revealed that singlet oxygen (1O2) accumulated to higher levels in the mutant while other ROS were unaffected, allowing to define the transcriptomic signature of the acclimatory response mediated by 1O2 which is enhanced by the lack of these xanthophylls species. The group of genes differentially regulated in npq1lut2 is enriched in sequences encoding chloroplast proteins involved in cell protection against the damaging effect of ROS. Among the early fine-tuned components, are proteins involved in tetrapyrrole biosynthesis, chlorophyll catabolism, protein import, folding and turnover, synthesis and membrane insertion of photosynthetic subunits. Up to now, the flu mutant was the only biological system adopted to define the regulation of gene expression by 1O2. In this work, we propose the use of mutants accumulating 1O2 by mechanisms different from those activated in flu to better identify ROS signalling. Conclusions We propose that the lack of zeaxanthin and lutein leads to 1O2 accumulation and this represents a signalling pathway in the early stages of stress acclimation, beside the response to ADP/ATP ratio and to the redox state of both plastoquinone pool. Chloroplasts respond to 1O2 accumulation by undergoing a significant change in composition and function towards a fast acclimatory response. The physiological implications of this signalling specificity are discussed. PMID:21481232

  2. Decreased virus population diversity in p53-null mice infected with weakly oncogenic Abelson virus.

    PubMed

    Marchlik, Erica; Kalman, Richard; Rosenberg, Naomi

    2005-09-01

    The Abelson murine leukemia virus (Ab-MLV), like other retroviruses that contain v-onc genes, arose following a recombination event between a replicating retrovirus and a cellular oncogene. Although experimentally validated models have been presented to address the mechanism by which oncogene capture occurs, very little is known about the events that influence emerging viruses following the recombination event that incorporates the cellular sequences. One feature that may play a role is the genetic makeup of the host in which the virus arises; a number of host genes, including oncogenes and tumor suppressor genes, have been shown to affect the pathogenesis of many murine leukemia viruses. To examine how a host gene might affect an emerging v-onc gene-containing retrovirus, we studied the weakly oncogenic Ab-MLV-P90A strain, a mutant that generates highly oncogenic variants in vivo, and compared the viral populations in normal mice and mice lacking the p53 tumor suppressor gene. While variants arose in both p53+/+ and p53-/- tumors, the samples from the wild-type animals contained a more diverse virus population. Differences in virus population diversity were not observed when wild-type and null animals were infected with a highly oncogenic wild-type strain of Ab-MLV. These results indicate that p53, and presumably other host genes, affects the selective forces that operate on virus populations in vivo and likely influences the evolution of oncogenic retroviruses such as Ab-MLV. PMID:16140739

  3. p53 modulates homologous recombination by transcriptional regulation of the RAD51 gene

    PubMed Central

    Arias-Lopez, Carmen; Lazaro-Trueba, Iciar; Kerr, Peter; Lord, Christopher J; Dexter, Tim; Iravani, Marjan; Ashworth, Alan; Silva, Augusto

    2006-01-01

    DNA repair by homologous recombination is involved in maintaining genome stability. Previous data report that wild-type p53 suppresses homologous recombination and physically interacts with Rad51. Here, we show the in vivo binding of wild-type p53 to a p53 response element in the promoter of Rad51 and the downregulation of Rad51 messenger RNA and protein by wild-type p53, favoured by DNA damage. Moreover, wild-type p53 inhibits Rad51 foci formation in response to double-strand breaks, whereas p53 contact mutant R280K fails to repress Rad51 mRNA and protein expression and Rad51 foci formation. We propose that transcriptional repression of Rad51 by p53 participates in regulating homologous recombination, and impaired Rad51 repression by p53 mutants may contribute to malignant transformation. PMID:16322760

  4. p53 Loss Increases the Osteogenic Differentiation of BMSCs

    PubMed Central

    He, Yunlong; de Castro, Luis F; Shin, Min Hwa; Dubois, Wendy; Yang, Howard H.; Jiang, Shunlin; Mishra, Pravin J.; Ren, Ling; Gou, Hongfeng; Lal, Ashish; Khanna, Chand; Merlino, Glenn; Lee, Maxwell; Robey, Pamela G.; Huang, Jing

    2014-01-01

    The tumor suppressor, p53, plays a critical role in suppressing osteosarcoma. Bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells) have been suggested to give rise to osteosarcomas. However, the role of p53 in BMSCs has not been extensively explored. Here, we report that p53 regulates the lineage choice of mouse BMSCs (mBMSCs). Compared to mBMSCs with wild type p53, mBMSCs deficient in p53 have enhanced osteogenic differentiation, but with similar adipogenic and chondrogenic differentiation. The role of p53 in inhibiting osteogenic lineage differentiation is mainly through the action of Runx2, a master transcription factor required for the osteogenic differentiation of mBMSCs. We find that p53 indirectly represses the expression of Runx2 by activating the microRNA-34 family, which suppresses the translation of Runx2. Since osteosarcoma may derive from BMSCs, we examined whether p53 has a role in the osteogenic differentiation of osteosarcoma cells and found that osteosarcoma cells with p53 deletion have higher levels of Runx2 and faster osteogenic differentiation than those with wild type p53. A systems biology approach reveals that p53-deficient mBMSCs are more closely related to human osteosarcoma while mBMSCs with wild type p53 are similar to normal human BMSCs. In summary, our results indicate that p53 activity can influence cell fate specification of mBMSCs, and provide molecular and cellular insights into the observation that p53 loss is associated with increased osteosarcoma incidence. PMID:25524638

  5. Encapsulated Brucella ovis Lacking a Putative ATP-Binding Cassette Transporter (ΔabcBA) Protects against Wild Type Brucella ovis in Rams

    PubMed Central

    Silva, Ana Patrícia C.; Macêdo, Auricélio A.; Costa, Luciana F.; Rocha, Cláudia E.; Garcia, Luize N. N.; Farias, Jade R. D.; Gomes, Priscilla P. R.; Teixeira, Gustavo C.; Fonseca, Kessler W. J.; Maia, Andréa R. F.; Neves, Gabriela G.; Romão, Everton L.; Silva, Teane M. A.; Mol, Juliana P. S.; Oliveira, Renata M.; Araújo, Márcio S. S.; Nascimento, Ernane F.; Martins-Filho, Olindo A.; Brandão, Humberto M.; Paixão, Tatiane A.; Santos, Renato L.

    2015-01-01

    This study aimed to evaluate protection induced by the vaccine candidate B. ovis ΔabcBA against experimental challenge with wild type B. ovis in rams. Rams were subcutaneously immunized with B. ovis ΔabcBA encapsulated with sterile alginate or with the non encapsulated vaccine strain. Serum, urine, and semen samples were collected during two months after immunization. The rams were then challenged with wild type B. ovis (ATCC25840), and the results were compared to non immunized and experimentally challenged rams. Immunization, particularly with encapsulated B. ovis ΔabcBA, prevented infection, secretion of wild type B. ovis in the semen and urine, shedding of neutrophils in the semen, and the development of clinical changes, gross and microscopic lesions induced by the wild type B. ovis reference strain. Collectively, our data indicates that the B. ovis ΔabcBA strain is an exceptionally good vaccine strain for preventing brucellosis caused by B. ovis infection in rams. PMID:26317399

  6. Mutant p53: One, No One, and One Hundred Thousand

    PubMed Central

    Walerych, Dawid; Lisek, Kamil; Del Sal, Giannino

    2015-01-01

    Encoded by the mutated variants of the TP53 tumor suppressor gene, mutant p53 proteins are getting an increased experimental support as active oncoproteins promoting tumor growth and metastasis. p53 missense mutant proteins are losing their wild-type tumor suppressor activity and acquire oncogenic potential, possessing diverse transforming abilities in cell and mouse models. Whether various mutant p53s differ in their oncogenic potential has been a matter of debate. Recent discoveries are starting to uncover the existence of mutant p53 downstream programs that are common to different mutant p53 variants. In this review, we discuss a number of studies on mutant p53, underlining the advantages and disadvantages of alternative experimental approaches that have been used to describe the numerous mutant p53 gain-of-function activities. Therapeutic possibilities are also discussed, taking into account targeting either individual or multiple mutant p53 proteins in human cancer. PMID:26734571

  7. Clonal dynamics following p53 loss of heterozygosity in Kras-driven cancers.

    PubMed

    Muzumdar, Mandar Deepak; Dorans, Kimberly Judith; Chung, Katherine Minjee; Robbins, Rebecca; Tammela, Tuomas; Gocheva, Vasilena; Li, Carman Man-Chung; Jacks, Tyler

    2016-01-01

    Although it has become increasingly clear that cancers display extensive cellular heterogeneity, the spatial growth dynamics of genetically distinct clones within developing solid tumours remain poorly understood. Here we leverage mosaic analysis with double markers (MADM) to trace subclonal populations retaining or lacking p53 within oncogenic Kras-initiated lung and pancreatic tumours. In both models, p53 constrains progression to advanced adenocarcinomas. Comparison of lineage-related p53 knockout and wild-type clones reveals a minor role of p53 in suppressing cell expansion in lung adenomas. In contrast, p53 loss promotes both the initiation and expansion of low-grade pancreatic intraepithelial neoplasia (PanINs), likely through differential expression of the p53 regulator p19ARF. Strikingly, lineage-related cells are often dispersed in lung adenomas and PanINs, contrasting with more contiguous growth of advanced subclones. Together, these results support cancer type-specific suppressive roles of p53 in early tumour progression and offer insights into clonal growth patterns during tumour development. PMID:27585860

  8. Targeting the p53 Pathway in Ewing Sarcoma

    PubMed Central

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  9. Ultrastructure - function relationship in Chlamydomonas reinhartii thylakoids, by means of a comparison between the wild type and the F34 mutant which lacks the photosystem II reaction center.

    PubMed

    Olive, J; Wollman, F A; Bennoun, P; Recouvreur, M

    1979-08-31

    The F34 mutant strain of Chlamydomonas reinhartii is deficient in photosystem II reaction centers. The E fracture faces of the thylakoid membranes of this mutant show a considerable reduction in the number of particles present ant in their size compared with the wild type. We conclude that the polypeptides associated with photosystem II reaction centers, which are missing in SDS polyacrylamide gel electrophoresis patterns of proteins from this mutant strain, are part of the EF particles and are required for assembly of these particles. PMID:492157

  10. Loss of p53 protein during radiation transformation of primary human mammary epithelial cells

    SciTech Connect

    Wazer, D.E.; Chu, Qiuming; Liu, Xiao Long; Gao, Qingshen; Safaii, H.; Band, V. )

    1994-04-01

    The causative factors leading to breast cancer are largely unknown. Increased incidence of breast cancer following diagnostic or therapeutic radiation suggests that radiation may contribute to mammary oncogenesis. This report describes the in vitro neoplastic transformation of a normal human mammary epithelial cell strain, 76N, by fractionated [gamma]-irradiation at a clinically used dose (30 Gy). The transformed cells (76R-30) were immortal, had reduced growth factor requirements, and produced tumors in nude mice. Remarkably, the 76R-30 cells completely lacked the p53 tumor suppressor protein. Loss of p53 was due to deletion of the gene on one allele and a 26-bp deletion within the third intron on the second allele which resulted in abnormal splicing out of either the third or fourth exon from the mRNA. PCR with a mutation-specific primer showed that intron 3 mutation was present in irradiated cells before selection for immortal phenotype. 76R-30 cells did not exhibit G[sub 1] arrest in response to radiation, indicating a loss of p53-mediated function. Expression of the wild-type p53 gene in 76R-30 cells led to their growth inhibition. Thus, loss of p53 protein appears to have contributed to neoplastic transformation of these cells. This unique model should facilitate analyses of molecular mechanisms of radiation-induced breast cancer and allow identification of p53-regulated cellular genes in breast cells. 44 refs., 8 figs., 1 tab.

  11. The state of the p53 and retinoblastoma genes in human cervical carcinoma cell lines

    SciTech Connect

    Scheffner, M.; Muenger, K.; Byrne, J.C.; Howley, P.M. )

    1991-07-01

    Human cervical carcinoma cell lines that were either positive or negative for human papillomavirus (HPV) DNA sequences were analyzed for evidence of mutation of the p53 and retinoblastoma genes. Each of five HPV-positive cervical cancer cell lines expressed normal pRB and low levels of wild-type p53 proteins, which are presumed to be altered in function as a consequence of association with HPV E7 and E6 oncoproteins, respectively. In contrast, mutations were identified in the p53 and RB genes expressed in the C-33A and HT-3 cervical cancer cell lines, which lack HPV DNA sequences. Mutations in the p53 genes mapped to codon 273 and codon 245 in the C33-A and HT-3 cell lines, respectively, located in the highly conserved regions of p53, where mutations appear in a variety of human cancers. Mutations in RB occurred at splice junctions, resulting in in-frame deletions, affecting exons 13 and 20 in the HT-3 and C-33A cell lines, respectively. These mutations resulted in aberrant proteins that were not phosphorylated and were unable to complex with the adenovirus E1A oncoprotein. These results support the hypothesis that the inactivation of the normal functions of the tumor-suppressor proteins pRB and p53 are important steps in human cervical carcinogenesis, either by mutation or from complex formation with the HPV E6 and E7 oncoproteins.

  12. Antifolates targeting purine synthesis allow entry of tumor cells into S phase regardless of p53 function.

    PubMed

    Bronder, Julie L; Moran, Richard G

    2002-09-15

    The class of folate antimetabolites typified by (6R)-dideazatetrahydrofolate (lometrexol, DDATHF) are specific inhibitors of de novo purine synthesis because of potent inhibition of glycinamide ribonucleotide formyltransferase (GART) but do not induce detectable levels of DNA strand breaks. As such, they are a test case of the concept that ribonucleotide depletion can be sensed by p53, resulting in a G(1) cell cycle block. The GART inhibitors have been proposed previously to be cytotoxic in tumor cells lacking p53 function but only cytostatic in p53 wild-type tumor cells. We have investigated this concept. Cell cycle progression into and through S phase was slowed by DDATHF, but both p53 +/+ and -/- human colon carcinoma cells entered and completed one S phase in the presence of drug. This inability of p53 to initiate a G(1) arrest after DDATHF treatment was mirrored by an independence of the cytotoxicity of DDATHF on p53 function. We conclude that carcinoma cells are killed equally well by DDATHF and related compounds whether or not the p53 pathway is intact and that the utility of GART inhibitors would not be limited to p53-negative tumors. PMID:12234990

  13. Mutant p53: Multiple Mechanisms Define Biologic Activity in Cancer

    PubMed Central

    Kim, Michael Paul; Zhang, Yun; Lozano, Guillermina

    2015-01-01

    The functional importance of p53 as a tumor suppressor gene is evident through its pervasiveness in cancer biology. The p53 gene is the most commonly altered gene in human cancer; however, not all genetic alterations are biologically equivalent. The majority of alterations involve p53 missense mutations that result in the production of mutant p53 proteins. Such mutant p53 proteins lack normal p53 function and may concomitantly gain novel functions, often with deleterious effects. Here, we review characterized mechanisms of mutant p53 gain of function in various model systems. In addition, we review mutant p53 addiction as emerging evidence suggests that tumors may depend on sustained mutant p53 activity for continued growth. We also discuss the role of p53 in stromal elements and their contribution to tumor initiation and progression. Lastly, current genetic mouse models of mutant p53 in various organ systems are reviewed and their limitations discussed. PMID:26618142

  14. [Bcl-2 inhibits p53-induced apoptosis after genotoxic damage by inhibitors of nuclear import of p53].

    PubMed

    Beham, A; Schumacher, G; McDonnell, T J; Marin, M C; Jauch, K W

    1998-01-01

    The tumor suppressor gene p53 in overexpressed in 50% of colorectal carcinomas and is an interesting target for gene therapeutic approaches. Furthermore the protooncogen bcl-2 is known to inhibit p53 induced apoptosis and is expressed in some colorectal carcinomas. In this study mechanism of bcl-2 cell death inhibition after p53 induction were evaluated. The human colon carcinoma cell line RKO posses wild-type p53 and also expresses bcl-2 protein. RKO cells were treated with liposomal bcl-2 antisense oligonucleotides (AS), control oligonucleotides (CO) and empty liposomes (EL) resulting in decreased bcl-2 expression. After induction of p53 with gamma-irradiation p53 protein expression was induced in AS, CO and EL pretreated cells. Microscopy and immunoblotting was used to characterize subcellular localization of p53 protein. Further p53 subcellular localisation was examined after p53 transfer of wt p53 cDNA in three bcl-2 expressing cell lines. Most of the p53 protein remained localized in the cytosol and apoptosis was decreased in bcl-2 expressing cells assessed by flow cytometric analysis (Ao). Our data suggests that bcl-2 is able to modulate transmembrane trafficking of p53. This resulted in inhibition of cell death implicating that bcl-2 function is involved in regulation of transmembrane gradients. PMID:14518224

  15. The tumour-suppressor p53 is not required for pancreatic β cell death during diabetes and upon irradiation

    PubMed Central

    Nam, Shin Yuen; Lee, Ming Kei; Sabapathy, Kanaga

    2008-01-01

    Immune-independent diabetes often occurs via pancreatic β cell dysfunction. However, the role of the tumour suppressor p53 that regulates cellular life and death in multiple tissues, in pancreatic cell death and diabetes has not been clarified. We have therefore utilized an established mouse model for diabetes in which the MHC class I antigen is overexpressed in pancreatic β cells under the rat insulin promoter, to investigate the role of p53. We show that pancreatic β cell death, as determined by TUNEL staining, is elevated in transgenic mice compared to wild-type mice. However, there was no increase in immuno-reactivity towards anti-p53 antibodies in the pancreas of transgenic mice over the course of diabetes formation and β cell death, suggesting that p53 may not be involved in these processes. Interestingly, p53 expression was also not induced in pancreas upon γ-irradiation, which resulted in a massive increase in the number of TUNEL-positive cells, suggesting that the p53 pathway may not be causally involved in pancreatic cell death. To further confirm these findings, we generated MHC class I transgenic mice lacking p53 expression. Absence of p53 did not result in any significant changes in pancreatic morphology or affect cell death levels. Importantly, p53 absence did not rescue the diabetic phenotype of the transgenic mice. The results therefore demonstrate that p53 may not be causally involved in pancreatic β cell death, and suggests that the classical cell death pathway dependent on p53 may not be operating in pancreatic β cells. PMID:18006584

  16. Hdm2 and Nitric Oxide Radicals Contribute to the P53-Dependent Radioadaptive Response

    SciTech Connect

    Takahashi, Akihisa; Matsumoto, Hideki; Ohnishi, Takeo

    2008-06-01

    Purpose: The aim of this work was to characterize the radioadaptive response at the molecular level. Methods and Materials: We used wild-type (wt) p53 and mutated (m) p53-containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulations of p53, the human homolog of endogenous murine double minute 2 (Hdm2), and inducible nitric oxide synthase were analyzed with Western blotting. Quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. Results: In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low-dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about two- to fourfold after challenging irradiation subsequent to a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of 5, 5'-(2, 5-Furanidiyl)bis-2-thiophenemethanol (RITA) or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an inducible nitric oxide synthase inhibitor), and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover radioresistance developed when wtp53 cells were treated with isosorbide dinitrate (an NO-generating agent) alone. Conclusions: These findings suggest that NO radicals are initiators of the radioadaptive response, acting through the activation of Hdm2 and the depression of p53 accumulations.

  17. Guilty as CHARGED: p53's expanding role in disease

    PubMed Central

    Van Nostrand, Jeanine L; Attardi, Laura D

    2014-01-01

    Unrestrained p53 activity during development, as occurs upon loss of the p53 negative regulators Mdm2 or Mdmx, causes early embryonic lethality. Surprisingly, co-expression of wild-type p53 and a transcriptionally-dead variant of p53, with mutations in both transactivation domains (p53L25Q,W26S,F53Q,F54S), also causes lethality, but later in gestation and in association with a host of very specific phenotypes reminiscent of a syndrome known as CHARGE. Molecular analyses revealed that wild-type p53 is inappropriately activated in p535,26,53,54/+ embryos, triggering cell-cycle arrest or apoptosis during development to cause CHARGE phenotypes. In addition, CHARGE syndrome is typically caused by mutations in the CHD7 chromatin remodeler, and we have shown that activated p53 contributes to phenotypes caused by CHD7-deficiency. Together, these studies provide new insight into CHARGE syndrome and expand our understanding of the role of p53 in diseases other than cancer. PMID:25483057

  18. Small-Molecule NSC59984 Restores p53 Pathway Signaling and Antitumor Effects against Colorectal Cancer via p73 Activation and Degradation of Mutant p53.

    PubMed

    Zhang, Shengliang; Zhou, Lanlan; Hong, Bo; van den Heuvel, A Pieter J; Prabhu, Varun V; Warfel, Noel A; Kline, Christina Leah B; Dicker, David T; Kopelovich, Levy; El-Deiry, Wafik S

    2015-09-15

    The tumor-suppressor p53 prevents cancer development via initiating cell-cycle arrest, cell death, repair, or antiangiogenesis processes. Over 50% of human cancers harbor cancer-causing mutant p53. p53 mutations not only abrogate its tumor-suppressor function, but also endow mutant p53 with a gain of function (GOF), creating a proto-oncogene that contributes to tumorigenesis, tumor progression, and chemo- or radiotherapy resistance. Thus, targeting mutant p53 to restore a wild-type p53 signaling pathway provides an attractive strategy for cancer therapy. We demonstrate that small-molecule NSC59984 not only restores wild-type p53 signaling, but also depletes mutant p53 GOF. NSC59984 induces mutant p53 protein degradation via MDM2 and the ubiquitin-proteasome pathway. NSC59984 restores wild-type p53 signaling via p73 activation, specifically in mutant p53-expressing colorectal cancer cells. At therapeutic doses, NSC59984 induces p73-dependent cell death in cancer cells with minimal genotoxicity and without evident toxicity toward normal cells. NSC59984 synergizes with CPT11 to induce cell death in mutant p53-expressing colorectal cancer cells and inhibits mutant p53-associated colon tumor xenograft growth in a p73-dependent manner in vivo. We hypothesize that specific targeting of mutant p53 may be essential for anticancer strategies that involve the stimulation of p73 in order to efficiently restore tumor suppression. Taken together, our data identify NSC59984 as a promising lead compound for anticancer therapy that acts by targeting GOF-mutant p53 and stimulates p73 to restore the p53 pathway signaling. PMID:26294215

  19. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation

    PubMed Central

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M.; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge

    2015-01-01

    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  20. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture

    PubMed Central

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan

    2014-01-01

    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  1. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture.

    PubMed

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan

    2014-11-10

    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds 'structural' mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  2. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation.

    PubMed

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge

    2015-08-11

    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  3. Mitofusin-2 is a novel direct target of p53

    SciTech Connect

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-10-01

    Research highlights: {yields} Mfn2 is a novel target gene of p53. {yields} Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. {yields} Mfn2 promoter activity can be elevated by the p53 protein. {yields} P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  4. Change in oligomerization specificity of the p53 tetramerization domain by hydrophobic amino acid substitutions.

    PubMed Central

    Stavridi, E. S.; Chehab, N. H.; Caruso, L. C.; Halazonetis, T. D.

    1999-01-01

    The tumor suppressor function of the wild-type p53 protein is transdominantly inhibited by tumor-derived mutant p53 proteins. Such transdominant inhibition limits the prospects for gene therapy approaches that aim to introduce wild-type p53 into cancer cells. The molecular mechanism for transdominant inhibition involves sequestration of wild-type p53 subunits into inactive wild-type/mutant hetero-tetramers. Thus, p53 proteins, whose oligomerization specificity is altered so they cannot interact with tumor-derived mutant p53, would escape transdominant inhibition. Aided by the known three-dimensional structure of the p53 tetramerization domain and by trial and error we designed a novel domain with seven amino acid substitutions in the hydrophobic core. A full-length p53 protein bearing this novel domain formed homo-tetramers and had tumor suppressor function, but did not hetero-oligomerize with tumor-derived mutant p53 and resisted transdominant inhibition. Thus, hydrophobic core residues influence the oligomerization specificity of the p53 tetramerization domain. PMID:10493578

  5. Activation of p53-dependent responses in tumor cells treated with a PARC-interacting peptide

    SciTech Connect

    Vitali, Roberta; Cesi, Vincenzo; Tanno, Barbara; Ferrari-Amorotti, Giovanna; Dominici, Carlo; Calabretta, Bruno; Raschella, Giuseppe

    2008-04-04

    We tested the activity of a p53 carboxy-terminal peptide containing the PARC-interacting region in cancer cells with wild type cytoplasmic p53. Peptide delivery was achieved by fusing it to the TAT transduction domain (TAT-p53-C-ter peptide). In a two-hybrid assay, the tetramerization domain (TD) of p53 was necessary and sufficient to bind PARC. The TAT-p53-C-ter peptide disrupted the PARC-p53 complex. Peptide treatment caused p53 nuclear relocation, p53-dependent changes in gene expression and enhancement of etoposide-induced apoptosis. These studies suggest that PARC-interacting peptides are promising candidates for the enhancement of p53-dependent apoptosis in tumors with wt cytoplasmic p53.

  6. Activation of p53-dependent responses in tumor cells treated with a PARC-interacting peptide.

    PubMed

    Vitali, Roberta; Cesi, Vincenzo; Tanno, Barbara; Ferrari-Amorotti, Giovanna; Dominici, Carlo; Calabretta, Bruno; Raschellà, Giuseppe

    2008-04-01

    We tested the activity of a p53 carboxy-terminal peptide containing the PARC-interacting region in cancer cells with wild type cytoplasmic p53. Peptide delivery was achieved by fusing it to the TAT transduction domain (TAT-p53-C-ter peptide). In a two-hybrid assay, the tetramerization domain (TD) of p53 was necessary and sufficient to bind PARC. The TAT-p53-C-ter peptide disrupted the PARC-p53 complex. Peptide treatment caused p53 nuclear relocation, p53-dependent changes in gene expression and enhancement of etoposide-induced apoptosis. These studies suggest that PARC-interacting peptides are promising candidates for the enhancement of p53-dependent apoptosis in tumors with wt cytoplasmic p53. PMID:18230339

  7. Simulated sunlight and benzo[a]pyrene diol epoxide induced mutagenesis in the human p53 gene evaluated by the yeast functional assay: lack of correspondence to tumor mutation spectra.

    PubMed

    Yoon, Jung-Hoon; Lee, Chong-Soon; Pfeifer, Gerd P

    2003-01-01

    Many mutations in the p53 gene destroy the transcriptional transactivation function of the p53 protein. This function of p53 can be determined in a yeast assay using a p53 responsive reporter gene. The yeast assay could hold promise for the identification of mutagens implicated in human cancer if the p53 mutational spectra obtained with this assay would match human tumor mutation data. Ultraviolet (UV) light from the sun and polycyclic aromatic hydrocarbons, such as benzo[a]pyrene, are strongly implicated in the spectrum of p53 mutations found in human non-melanoma skin cancers and smoking-associated lung cancers, respectively. We have used these two model mutagens to assess the feasibility of using the p53 yeast assay in cancer epidemiology. After treatment of CpG methylated p53 DNA with a solar UV simulator or with benzo[a]pyrene diol epoxide (BPDE), the modified p53 sequences were assayed in yeast for mutational outcome. As expected, BPDE produced predominantly G to T transversions and simulated sunlight produced mostly C to T transitions at dipyrimidine sites in the p53 coding sequence. However, the preferentially mutated p53 sequences (hotspots) in the yeast assay were completely different from those in the mutational spectra found in human lung and skin cancers. The data indicate that this assay is not a reliable measurement of p53 mutagenesis in human tissues and that, perhaps, transcriptional activation is not the primary function of p53 in tumor suppression. PMID:12538356

  8. Targeting the p53 pathway.

    PubMed

    Golubovskaya, Vita M; Cance, William G

    2013-10-01

    This article summarizes data on translational studies to target the p53 pathway in cancer. It describes the functions of the p53 and Mdm-2 signaling pathways, and discusses current therapeutic approaches to target p53 pathways, including reactivation of p53. In addition, direct interaction and colocalization of the p53 and focal adhesion kinase proteins in cancer cells have been demonstrated, and different approaches to target this interaction are reviewed. This is a broad review of p53 function as it relates to the diagnosis and treatment of a wide range of cancers. PMID:24012397

  9. High levels of p53 protein expression do not correlate with p53 gene mutations in anaplastic large cell lymphoma.

    PubMed Central

    Cesarman, E.; Inghirami, G.; Chadburn, A.; Knowles, D. M.

    1993-01-01

    Strong immunohistochemical reactivity for p53 tumor suppressor gene product has been reported in a variety of different human malignancies including CD30- (Ki-1) positive anaplastic large cell lymphoma (ALCL). Although high levels of p53 protein have been interpreted as abnormal, rapidly proliferating benign and neoplastic lymphoid cells may have increased p53 expression in the absence of structural alterations. On the other hand, mutations in the p53 gene can lead to a lack of p53 protein production. Structural alterations of the p53 gene have not been documented in cases of ALCL and the mechanism for an abnormal pattern of p53 expression in these lymphomas has not been elucidated. Therefore, to determine whether an altered pattern of p53 expression correlates with mutations in the p53 locus in ALCL, we analyzed the expression of p53 protein immunohistochemically, compared it with the proliferation index using monoclonal antibody Ki-67, and assessed the presence of mutations in exons 5 though 9 of the p53 gene using a single-strand conformation polymorphism assay in a panel of 17 ALCLs. Furthermore, we studied the presence of allelic deletions of chromosome 17p by restriction fragment length polymorphism analysis. We found significant levels of p53 protein expression in 12 of the 15 cases studied, but identified mutations in only one of 17 cases. An allelic deletion in chromosome 17p was identified only in the one case containing a mutated p53 gene. Whereas the case containing structural alterations in the p53 gene did have strong p53 immunoreactivity, 11 cases that lacked p53 mutations in the regions examined also had significant levels of p53. Thus, our studies indicate that strong immunohistochemical reactivity for p53 is not a reliable indicator of the presence of structural alterations of p53 gene exons 5 through 9 in ALCL. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:8103295

  10. Nucleolar stress with and without p53.

    PubMed

    James, Allison; Wang, Yubo; Raje, Himanshu; Rosby, Raphyel; DiMario, Patrick

    2014-01-01

    A veritable explosion of primary research papers within the past 10 years focuses on nucleolar and ribosomal stress, and for good reason: with ribosome biosynthesis consuming ~80% of a cell's energy, nearly all metabolic and signaling pathways lead ultimately to or from the nucleolus. We begin by describing p53 activation upon nucleolar stress resulting in cell cycle arrest or apoptosis. The significance of this mechanism cannot be understated, as oncologists are now inducing nucleolar stress strategically in cancer cells as a potential anti-cancer therapy. We also summarize the human ribosomopathies, syndromes in which ribosome biogenesis or function are impaired leading to birth defects or bone narrow failures; the perplexing problem in the ribosomopathies is why only certain cells are affected despite the fact that the causative mutation is systemic. We then describe p53-independent nucleolar stress, first in yeast which lacks p53, and then in other model metazoans that lack MDM2, the critical E3 ubiquitin ligase that normally inactivates p53. Do these presumably ancient p53-independent nucleolar stress pathways remain latent in human cells? If they still exist, can we use them to target >50% of known human cancers that lack functional p53? PMID:25482194

  11. Nucleolar stress with and without p53

    PubMed Central

    James, Allison; Wang, Yubo; Raje, Himanshu; Rosby, Raphyel; DiMario, Patrick

    2014-01-01

    A veritable explosion of primary research papers within the past 10 years focuses on nucleolar and ribosomal stress, and for good reason: with ribosome biosynthesis consuming ~80% of a cell’s energy, nearly all metabolic and signaling pathways lead ultimately to or from the nucleolus. We begin by describing p53 activation upon nucleolar stress resulting in cell cycle arrest or apoptosis. The significance of this mechanism cannot be understated, as oncologists are now inducing nucleolar stress strategically in cancer cells as a potential anti-cancer therapy. We also summarize the human ribosomopathies, syndromes in which ribosome biogenesis or function are impaired leading to birth defects or bone narrow failures; the perplexing problem in the ribosomopathies is why only certain cells are affected despite the fact that the causative mutation is systemic. We then describe p53-independent nucleolar stress, first in yeast which lacks p53, and then in other model metazoans that lack MDM2, the critical E3 ubiquitin ligase that normally inactivates p53. Do these presumably ancient p53-independent nucleolar stress pathways remain latent in human cells? If they still exist, can we use them to target >50% of known human cancers that lack functional p53? PMID:25482194

  12. Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype

    PubMed Central

    Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

    2015-01-01

    Background A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. Methods The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. Results p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. Conclusion In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways. PMID:26447864

  13. 9-Hydroxyellipticine alters the conformation and DNA binding characteristics of mutated p53 protein.

    PubMed

    Sugikawa, E; Tsunoda, S; Nakanishi, N; Ohashi, M

    2001-01-01

    The tumor suppressor protein p53 is a phosphoprotein which shows growth and transformation suppression functions. Mutational loss of p53 function is the most frequently detected genetic event in human cancers. We examined whether 9-hydroxyellipticine (9HE), a cytotoxic agent, affected the tertiary structure of mutant p53 and DNA binding characteristics. Although several types of p53 mutants were resistant to degradation by calpain, the p53 mutants treated with 9HE were markedly sensitive to calpain as well as wild-type p53. Furthermore, mutant p53 proteins isolated from 9HE-treated cells regained the ability to bind a wild-type-specific p53 DNA consensus sequence. Wild-type p53 proteins prepared from both untreated and 9HE-treated cells bound the p53 consensus sequence and were degradaded by calpain equally well. These results suggest that 9HE affects the tertiary structure of mutated p53, which results in the restoration of DNA binding characteristics. PMID:11724337

  14. Characterization of p53 mutations in colorectal liver metastases and correlation with clinical parameters.

    PubMed

    Tullo, A; D'Erchia, A M; Honda, K; Mitry, R R; Kelly, M D; Habib, N A; Saccone, C; Sbisà, E

    1999-11-01

    The presence and type of mutations of the p53 tumor suppressor gene were determined in 40 patients undergoing curative hepatic resection for metastatic colorectal carcinoma. This represents the largest series in the literature on the screening of p53 mutations for liver metastases. The analysis was performed in exons 5-9 by denaturing gradient gel electrophoresis followed by direct sequencing. Forty-five percent of tumors showed mutation in p53, and this was observed only in exons 5-8. Mutations at codon positions 167, 196, 204, 213, 245, 281, 282, 286, and 306; deletion of codon 251 and of the first nucleotide of codon 252; and Leu residue (CTC) insertion downstream codon 252 are reported for the first time in colorectal liver metastasis. Mutations at codon positions 163, 248, and 273 have been reported previously. Correlation of p53 status with clinical parameters showed that patients with mutated p53 had a statistically higher number of lesions when compared with patients with wild-type p53 (P<0.050). In particular, of patients with mutated p53, 41% had three or more metastases compared with 14% of patients with wild-type p53. Synchronous metastases were present in 70% of the patients with p53 mutations and in only 29% of patients with wild-type p53 (P<0.025). In addition, patients with p53 mutations are more likely to develop recurrence (73%) compared with patients with wild-type p53 (33%; P<0.001). Other factors considered, including preoperative carcinoembryonic antigen level, bilobar distribution, and size of the lesion(s), did not show significant correlation with p53 status. These results suggest that p53 status might be an important prognostic indicator to predict the pattern and likelihood of treatment failure after hepatic resection. PMID:10589767

  15. Loss of interactions between p53 and survivin gene in mesenchymal stem cells after spontaneous transformation in vitro.

    PubMed

    He, Liu; Zhao, Fangyu; Zheng, Yong; Wan, Yu; Song, Jian

    2016-06-01

    Mesenchymal stem cells (MSC) from various animals undergo a spontaneous transformation in long-term culture. The transformed MSCs are highly tumorigenic and are likely to be the tumor-initiating cells of sarcoma. To explain why the transformed MSCs become tumorigenic, the present study investigated the characteristics of rat MSCs before and after spontaneous transformation. It was shown that although the transformed MSCs maintained typical surface markers of MSC, they exhibited some cancer stem cell-like characteristics such as loss of contact inhibition and multi-potency to mesenchymal lineages, and acquirement of ability of anchorage-independent growth. The expression of a key senescence regulator p16 almost disappeared, but the other one, p53 abnormally increased in the transformed MSCs. ChIP assay demonstrated that a normal negative regulation of p53 on survivin gene disappeared in the transformed cells due to a lack of p53 binding to the promoter of survivin gene. DNA sequencing revealed that the p53 gene in transformed MSCs was not a wild-type, but a 942C>T mutant with the mutation located in the sequence coding p53 protein's DNA-binding domain. These findings indicate that the transformed MSCs express high levels of a p53 mutant that loses the ability to bind survivin gene, leading to an abnormally upregulated expression of survivin, which is a key reason for the cell's unlimited proliferation. PMID:27046449

  16. Inhibition of p53 transcriptional activity by human cytomegalovirus UL44.

    PubMed

    Kwon, Yejin; Kim, Mi-Na; Young Choi, Eun; Heon Kim, Jung; Hwang, Eung-Soo; Cha, Chang-Yong

    2012-05-01

    Human cytomegalovirus (HCMV) stimulates cellular synthesis of DNA and proteins and induces transition of the cell cycle from G(1) to S and G(2) /M phase, in spite of increased amounts of p53 in the infected cells. The immediate early protein IE2-86  kDa (IE86) tethers a transcriptional repression domain to p53; however, its repression of p53 function is not enough to abrogate the G(1) checkpoint function of p53. Other HCMV proteins that suppress the activity of p53 were investigated in this study. Of the HCMV proteins that bind to p53 when assessed by immunoprecipitation and immunoblot analysis, HCMV UL44 was chosen as a candidate protein. It was found that reporter gene containing p53 consensus sequence was activated by transfection with wild type p53, but when plasmids of p53 with IE86 or UL44 were co-transfected, p53 transcriptional activity was decreased to 3-7% of the p53 control in a dose-dependent manner. When the deletion mutant of UL44 was co-transected with p53, the carboxyl one-third portion of UL44 had little effect on inhibition of p53 transcriptional activity. The amount of mRNA p21 was measured in H1299 by real time PCR after transfection of the combination of p53 and UL44 vectors and it was found that p21 transcription by p53 was inhibited dose-dependently by UL44. Increased G0/G1 and decreased S phases in p53 wild type-transfected H1299 cells were recovered to the level of p53 mutant type-transfected ones by the additional transfection of UL44 in a dose-dependent manner. In conclusion, the transcriptional activity of p53 is suppressed by UL44 as well as by IE86. PMID:22376288

  17. EWS-FLI1 Suppresses NOTCH-Activated p53 in Ewing’s Sarcoma

    PubMed Central

    Ban, Jozef; Bennani-Baiti, Idriss M.; Kauer, Max; Schaefer, Karl-Ludwig; Poremba, Christopher; Jug, Gunhild; Schwentner, Raphaela; Smrzka, Oskar; Muehlbacher, Karin; Aryee, Dave N.T.; Kovar, Heinrich

    2016-01-01

    Although p53 is the most frequently mutated gene in cancer, half of human tumors retain wild-type p53, whereby it is unknown whether normal p53 function is compromised by other cancer-associated alterations. One example is Ewing’s sarcoma family tumors (ESFT), where 90% express wild-type p53. ESFT are characterized by EWS-FLI1 oncogene fusions. Studying 6 ESFT cell lines, silencing of EWS-FLI1 in a wild-type p53 context resulted in increased p53 and p21WAF1/CIP1 levels, causing cell cycle arrest. Using a candidate gene approach, HEY1 was linked to p53 induction. HEY1 was rarely expressed in 59 primary tumors, but consistently induced upon EWS-FLI1 knockdown in ESFT cell lines. The NOTCH signaling pathway targets HEY1, and we show NOTCH2 and NOTCH3 to be expressed in ESFT primary tumors and cell lines. Upon EWS-FLI1 silencing, NOTCH3 processing accompanied by nuclear translocation of the activated intracellular domain was observed in all but one p53-mutant cell line. In cell lines with the highest HEY1 induction, NOTCH3 activation was the consequence of JAG1 transcriptional induction. JAG1 modulation by specific siRNA, NOTCH-processing inhibition by either GSI or ectopic NUMB1, and siRNA-mediated HEY1 knockdown all inhibited p53 and p21WAF1/CIP1 induction. Conversely, forced expression of JAG1, activated NOTCH3, or HEY1 induced p53 and p21WAF1/CIP1. These results indicate that suppression of EWS-FLI1 reactivates NOTCH signaling in ESFT cells, resulting in p53-dependent cell cycle arrest. Our data link EWS-FLI1 to the NOTCH and p53 pathways and provide a plausible basis both for NOTCH tumor suppressor effects and oncogenesis of cancers that retain wild-type p53. PMID:18757425

  18. Aberrant splicing of the DMP1-ARF-MDM2-p53 pathway in cancer.

    PubMed

    Inoue, Kazushi; Fry, Elizabeth A

    2016-07-01

    Alternative splicing (AS) of mRNA precursors is a ubiquitous mechanism for generating numerous transcripts with different activities from one genomic locus in mammalian cells. The gene products from a single locus can thus have similar, dominant-negative or even opposing functions. Aberrant AS has been found in cancer to express proteins that promote cell growth, local invasion and metastasis. This review will focus on the aberrant splicing of tumor suppressor/oncogenes that belong to the DMP1-ARF-MDM2-p53 pathway. Our recent study shows that the DMP1 locus generates both tumor-suppressive DMP1α (p53-dependent) and oncogenic DMP1β (p53-independent) splice variants, and the DMP1β/α ratio increases with neoplastic transformation of breast epithelial cells. This process is associated with high DMP1β protein expression and shorter survival of breast cancer (BC) patients. Accumulating pieces of evidence show that ARF is frequently inactivated by aberrant splicing in human cancers, demonstrating its involvement in human malignancies. Splice variants from the MDM2 locus promote cell growth in culture and accelerate tumorigenesis in vivo. Human cancers expressing these splice variants are associated with advanced stage/metastasis, and thus have negative clinical impacts. Although they lack most of the p53-binding domain, their activities are mostly dependent on p53 since they bind to wild-type MDM2. The p53 locus produces splice isoforms that have either favorable (β/γ at the C-terminus) or negative impact (Δ40, Δ133 at the N-terminus) on patients' survival. As the oncogenic AS products from these loci are expressed only in cancer cells, they may eventually become targets for molecular therapies. PMID:26802432

  19. Pharmacological and Genetic Manipulation of p53 in Brown Fat at Adult But Not Embryonic Stages Regulates Thermogenesis and Body Weight in Male Mice.

    PubMed

    Al-Massadi, Omar; Porteiro, Begoña; Kuhlow, Doreen; Köhler, Markus; Gonzalez-Rellan, María J; Garcia-Lavandeira, Montserrat; Díaz-Rodríguez, Esther; Quiñones, Mar; Senra, Ana; Alvarez, Clara V; López, Miguel; Diéguez, Carlos; Schulz, Tim J; Nogueiras, Rubén

    2016-07-01

    p53 is a well-known tumor suppressor that plays multiple biological roles, including the capacity to modulate metabolism at different levels. However, its metabolic role in brown adipose tissue (BAT) remains largely unknown. Herein we sought to investigate the physiological role of endogenous p53 in BAT and its implication on BAT thermogenic activity and energy balance. To this end, we generated and characterized global p53-null mice and mice lacking p53 specifically in BAT. Additionally we performed gain-and-loss-of-function experiments in the BAT of adult mice using virogenetic and pharmacological approaches. BAT was collected and analyzed by immunohistochemistry, thermography, real-time PCR, and Western blot. p53-deficient mice were resistant to diet-induced obesity due to increased energy expenditure and BAT activity. However, the deletion of p53 in BAT using a Myf5-Cre driven p53 knockout did not show any changes in body weight or the expression of thermogenic markers. The acute inhibition of p53 in the BAT of adult mice slightly increased body weight and inhibited BAT thermogenesis, whereas its overexpression in the BAT of diet-induced obese mice reduced body weight and increased thermogenesis. On the other hand, pharmacological activation of p53 improves body weight gain due to increased BAT thermogenesis by sympathetic nervous system in obese adult wild-type mice but not in p53(-/-) animals. These results reveal that p53 regulates BAT metabolism by coordinating body weight and thermogenesis, but these metabolic actions are tissue specific and also dependent on the developmental stage. PMID:27183316

  20. p53 Promotes Cell Survival Due to the Reversibility of its Cell Cycle Checkpoints

    PubMed Central

    Lukin, Dana J.; Carvajal, Luis A.; Liu, Wen-jun; Resnick-Silverman, Lois; Manfredi, James J.

    2014-01-01

    The tumor suppressor p53 (TP53) has a well-studied role in triggering cell cycle checkpoint in response to DNA damage. Previous studies have suggested that functional p53 enhances chemosensitivity. In contrast, data are presented to show that p53 can be required for cell survival following DNA damage due to activation of reversible cell cycle checkpoints. The cellular outcome to DNA damage is determined by the duration and extent of the stimulus in a p53-dependent manner. In response to transient or low levels of DNA damage, p53 triggers a reversible G2 arrest whereas a sustained p53-dependent cell cycle arrest and senescence follows prolonged or high levels of DNA damage. Regardless of the length of treatment, p53-null cells arrest in G2, but ultimately adapt and proceed into mitosis. Interestingly, they fail to undergo cytokinesis, become multinucleated, and then die from apoptosis. Upon transient treatment with DNA damaging agents, wild-type p53 cells reversibly arrest and repair the damage, whereas p53-null cells fail to do so and die. These data indicate that p53 can promote cell survival by inducing reversible cell cycle arrest, thereby allowing for DNA repair. Thus, transient treatments may exploit differences between wild-type p53 and p53-null cells. PMID:25158956

  1. Zn(II)-curc targets p53 in thyroid cancer cells

    PubMed Central

    GARUFI, ALESSIA; D'ORAZI, VALERIO; CRISPINI, ALESSANDRA; D'ORAZI, GABRIELLA

    2015-01-01

    TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers. PMID:26314369

  2. PILOT STUDY FOR ARSENIC CARCINOGENESIS IN P53 HETEROZYGOTE DEFICIENT MICE

    EPA Science Inventory

    40 p53 heterozygous knockout mice and 40 p53 wild-type controls were exposed to 4 arsenicals in drinking water at a single dose, the maximum tolerated dose (MTD), in a chronic lifetime tumor bioassay, and animals were subjected to necropsy and limited pathologic examination of th...

  3. The mitochondrial p53 pathway

    PubMed Central

    Vaseva, Angelina V.; Moll, Ute M.

    2010-01-01

    p53 is one of the most mutated tumor suppressors in human cancers and as such has been intensively studied for a long time. p53 is a major orchestrator of the cellular response to a broad array of stress types by regulating apoptosis, cell cycle arrest, senescence, DNA repair and genetic stability. For a long time it was thought that these functions of p53 solely rely on its function as a transcription factor, and numerous p53 target genes have been identified [1]. In the last 8 years however, a novel transcription-independent proapoptotic function mediated by the cytoplasmic pool of p53 has been revealed. p53 participates directly in the intrinsic apoptosis pathway by interacting with the multidomain members of the Bcl-2 family to induce mitochondrial outer membrane permeabilization. Our review will discuss these studies, focusing on recent advances in the field. PMID:19007744

  4. Deregulation of Internal Ribosome Entry Site-Mediated p53 Translation in Cancer Cells with Defective p53 Response to DNA Damage

    PubMed Central

    Halaby, Marie-Jo; Harris, Benjamin R. E.; Miskimins, W. Keith; Cleary, Margot P.

    2015-01-01

    Synthesis of the p53 tumor suppressor and its subsequent activation following DNA damage are critical for its protection against tumorigenesis. We previously discovered an internal ribosome entry site (IRES) at the 5′ untranslated region of the p53 mRNA. However, the connection between IRES-mediated p53 translation and p53's tumor suppressive function is unknown. In this study, we identified two p53 IRES trans-acting factors, translational control protein 80 (TCP80), and RNA helicase A (RHA), which positively regulate p53 IRES activity. Overexpression of TCP80 and RHA also leads to increased expression and synthesis of p53. Furthermore, we discovered two breast cancer cell lines that retain wild-type p53 but exhibit defective p53 induction and synthesis following DNA damage. The levels of TCP80 and RHA are extremely low in both cell lines, and expression of both proteins is required to significantly increase the p53 IRES activity in these cells. Moreover, we found cancer cells transfected with a shRNA against TCP80 not only exhibit decreased expression of TCP80 and RHA but also display defective p53 induction and diminished ability to induce senescence following DNA damage. Therefore, our findings reveal a novel mechanism of p53 inactivation that links deregulation of IRES-mediated p53 translation with tumorigenesis. PMID:26391949

  5. p53 regulates expression of uncoupling protein 1 through binding and repression of PPARγ coactivator-1α.

    PubMed

    Hallenborg, Philip; Fjære, Even; Liaset, Bjørn; Petersen, Rasmus Koefoed; Murano, Incoronata; Sonne, Si Brask; Falkerslev, Mathias; Winther, Sally; Jensen, Benjamin Anderschou Holbech; Ma, Tao; Hansen, Jacob B; Cinti, Saverio; Blagoev, Blagoy; Madsen, Lise; Kristiansen, Karsten

    2016-01-15

    The tumor suppressor p53 (TRP53 in mice) is known for its involvement in carcinogenesis, but work during recent years has underscored the importance of p53 in the regulation of whole body metabolism. A general notion is that p53 is necessary for efficient oxidative metabolism. The importance of UCP1-dependent uncoupled respiration and increased oxidation of glucose and fatty acids in brown or brown-like adipocytes, termed brite or beige, in relation to energy balance and homeostasis has been highlighted recently. UCP1-dependent uncoupled respiration in classic interscapular brown adipose tissue is central to cold-induced thermogenesis, whereas brite/beige adipocytes are of special importance in relation to diet-induced thermogenesis, where the importance of UCP1 is only clearly manifested in mice kept at thermoneutrality. We challenged wild-type and TRP53-deficient mice by high-fat feeding under thermoneutral conditions. Interestingly, mice lacking TRP53 gained less weight compared with their wild-type counterparts. This was related to an increased expression of Ucp1 and other PPARGC1a and PPARGC1b target genes but not Ppargc1a or Ppargc1b in inguinal white adipose tissue of mice lacking TRP53. We show that TRP53, independently of its ability to bind DNA, inhibits the activity of PPARGC1a and PPARGC1b. Collectively, our data show that TRP53 has the ability to regulate the thermogenic capacity of adipocytes through modulation of PPARGC1 activity. PMID:26578713

  6. p53 Loss in MYC-Driven Neuroblastoma Leads to Metabolic Adaptations Supporting Radioresistance.

    PubMed

    Yogev, Orli; Barker, Karen; Sikka, Arti; Almeida, Gilberto S; Hallsworth, Albert; Smith, Laura M; Jamin, Yann; Ruddle, Ruth; Koers, Alexander; Webber, Hannah T; Raynaud, Florence I; Popov, Sergey; Jones, Chris; Petrie, Kevin; Robinson, Simon P; Keun, Hector C; Chesler, Louis

    2016-05-15

    Neuroblastoma is the most common childhood extracranial solid tumor. In high-risk cases, many of which are characterized by amplification of MYCN, outcome remains poor. Mutations in the p53 (TP53) tumor suppressor are rare at diagnosis, but evidence suggests that p53 function is often impaired in relapsed, treatment-resistant disease. To address the role of p53 loss of function in the development and pathogenesis of high-risk neuroblastoma, we generated a MYCN-driven genetically engineered mouse model in which the tamoxifen-inducible p53ER(TAM) fusion protein was expressed from a knock-in allele (Th-MYCN/Trp53(KI)). We observed no significant differences in tumor-free survival between Th-MYCN mice heterozygous for Trp53(KI) (n = 188) and Th-MYCN mice with wild-type p53 (n = 101). Conversely, the survival of Th-MYCN/Trp53(KI/KI) mice lacking functional p53 (n = 60) was greatly reduced. We found that Th-MYCN/Trp53(KI/KI) tumors were resistant to ionizing radiation (IR), as expected. However, restoration of functional p53ER(TAM) reinstated sensitivity to IR in only 50% of Th-MYCN/Trp53(KI/KI) tumors, indicating the acquisition of additional resistance mechanisms. Gene expression and metabolic analyses indicated that the principal acquired mechanism of resistance to IR in the absence of functional p53 was metabolic adaptation in response to chronic oxidative stress. Tumors exhibited increased antioxidant metabolites and upregulation of glutathione S-transferase pathway genes, including Gstp1 and Gstz1, which are associated with poor outcome in human neuroblastoma. Accordingly, glutathione depletion by buthionine sulfoximine together with restoration of p53 activity resensitized tumors to IR. Our findings highlight the complex pathways operating in relapsed neuroblastomas and the need for combination therapies that target the diverse resistance mechanisms at play. Cancer Res; 76(10); 3025-35. ©2016 AACR. PMID:27197232

  7. Nerve growth factor receptor negates the tumor suppressor p53 as a feedback regulator

    PubMed Central

    Zhou, Xiang; Hao, Qian; Liao, Peng; Luo, Shiwen; Zhang, Minhong; Hu, Guohui; Liu, Hongbing; Zhang, Yiwei; Cao, Bo; Baddoo, Melody; Flemington, Erik K; Zeng, Shelya X; Lu, Hua

    2016-01-01

    Cancer develops and progresses often by inactivating p53. Here, we unveil nerve growth factor receptor (NGFR, p75NTR or CD271) as a novel p53 inactivator. p53 activates NGFR transcription, whereas NGFR inactivates p53 by promoting its MDM2-mediated ubiquitin-dependent proteolysis and by directly binding to its central DNA binding domain and preventing its DNA-binding activity. Inversely, NGFR ablation activates p53, consequently inducing apoptosis, attenuating survival, and reducing clonogenic capability of cancer cells, as well as sensitizing human cancer cells to chemotherapeutic agents that induce p53 and suppressing mouse xenograft tumor growth. NGFR is highly expressed in human glioblastomas, and its gene is often amplified in breast cancers with wild type p53. Altogether, our results demonstrate that cancers hijack NGFR as an oncogenic inhibitor of p53. DOI: http://dx.doi.org/10.7554/eLife.15099.001 PMID:27282385

  8. Reactivating mutant p53 using small molecules as zinc metallochaperones: awakening a sleeping giant in cancer

    PubMed Central

    Blanden, Adam R.; Yu, Xin; Loh, Stewart N.; Levine, Arnold J.; Carpizo, Darren R.

    2016-01-01

    Tumor protein p53 (TP53) is the most commonly mutated gene in human cancer. The majority of mutations are missense, and generate a defective protein that is druggable. Yet, for decades, the small-molecule restoration of wild-type (WT) p53 function in mutant p53 tumors (so-called p53 mutant ‘reactivation’) has been elusive to researchers. The p53 protein requires the binding of a single zinc ion for proper folding, and impairing zinc binding is a major mechanism for loss of function in missense mutant p53. Here, we describe recent work defining a new class of drugs termed zinc metallochaperones that restore WT p53 structure and function by restoring Zn2+ to Zn2+-deficient mutant p53. PMID:26205328

  9. [NEGATIVE REGULATORS OF TUMOR SUPPRESSOR P53 IN THE CONTEXT OF ANTICANCER THERAPY].

    PubMed

    Shuvalov, O Yu; Fedorova, O A; Petukhov, A V; Daks, A A; Vasilieva, E A; Grigorieva, T A; Ivanov, G S; Barlev, N A

    2015-01-01

    P53 protein is considered to be the major tumor suppressor in human cells. Cancer cells do not survive if the p53-mediated signaling pathways function properly. However, about half of all malignancies still express wild type p53. One of the explanations to this is that p53 is suppressed by overexpression of p53-specific E3-ubiquitin ligases: Mdm2, MdmX, Pirh2 and Cop1. Pharmacological inhibition of protein-protein interactions between p53 and these negative regulators is a promising therapeutic approach to treat cancers retaining wild type p53. To date, a series of chemical inhibitors of p53 interactions with Mdm2 and MdmX E3-ubiquitin ligases have been discovered and characterized. Several of them are in the early stages of clinical trials. Despite this fact, their clinical efficacy may be hampered by a number of reasons, including tumor-specific expression of multiple isoforms of the target E3-ligases, which become inert to treatment with small molecules. This and other biochemical mechanisms of possible resistance of tumor cells with wild type p53 to small molecules against its negative regulators will be discussed in this review. PMID:26995961

  10. The p53 circuit board

    PubMed Central

    Sullivan, Kelly D.; Gallant-Behm, Corrie L.; Henry, Ryan E.; Fraikin, Jean-Luc; Espinosa, Joaquín M.

    2012-01-01

    The p53 tumor suppressor is embedded in a large gene network controlling diverse cellular and organismal phenotypes. Multiple signaling pathways converge onto p53 activation, mostly by relieving the inhibitory effects of its repressors, MDM2 and MDM4. In turn, signals originating from increased p53 activity diverge into distinct effector pathways to deliver a specific cellular response to the activating stimuli. Much attention has been devoted to dissecting how the various input pathways trigger p53 activation and how the activity of the p53 protein itself can be modulated by a plethora of co-factors and post-translational modifications. In this review we will focus instead on the multiple configurations of the effector pathways. We will discuss how p53-generated signals are transmitted, amplified, resisted and eventually integrated by downstream gene circuits operating at the transcriptional, post-transcriptional and post-translational level. We will also discuss how context-dependent variations in these gene circuits define the cellular response to p53 activation and how they may impact the clinical efficacy of p53-based targeted therapies. PMID:22333261

  11. Tetramerization-defects of p53 result in aberrant ubiquitylation and transcriptional activity.

    PubMed

    Lang, Valérie; Pallara, Chiara; Zabala, Amaia; Lobato-Gil, Sofia; Lopitz-Otsoa, Fernando; Farrás, Rosa; Hjerpe, Roland; Torres-Ramos, Monica; Zabaleta, Lorea; Blattner, Christine; Hay, Ronald T; Barrio, Rosa; Carracedo, Arkaitz; Fernandez-Recio, Juan; Rodríguez, Manuel S; Aillet, Fabienne

    2014-07-01

    The tumor suppressor p53 regulates the expression of genes involved in cell cycle progression, senescence and apoptosis. Here, we investigated the effect of single point mutations in the oligomerization domain (OD) on tetramerization, transcription, ubiquitylation and stability of p53. As predicted by docking and molecular dynamics simulations, p53 OD mutants show functional defects on transcription, Mdm2-dependent ubiquitylation and 26S proteasome-mediated degradation. However, mutants unable to form tetramers are well degraded by the 20S proteasome. Unexpectedly, despite the lower structural stability compared to WT p53, p53 OD mutants form heterotetramers with WT p53 when expressed transiently or stably in cells wild type or null for p53. In consequence, p53 OD mutants interfere with the capacity of WT p53 tetramers to be properly ubiquitylated and result in changes of p53-dependent protein expression patterns, including the pro-apoptotic proteins Bax and PUMA under basal and adriamycin-induced conditions. Importantly, the patient derived p53 OD mutant L330R (OD1) showed the more severe changes in p53-dependent gene expression. Thus, in addition to the well-known effects on p53 stability, ubiquitylation defects promote changes in p53-dependent gene expression with implications on some of its functions. PMID:24816189

  12. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

    PubMed Central

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  13. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis.

    PubMed

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  14. p53MVA therapy in patients with refractory gastrointestinal malignancies elevates p53-specific CD8+ T cell responses

    PubMed Central

    Hardwick, Nicola R; Carrol, Mary; Kaltcheva, Teodora; Qian, Dajun; Lim, Dean; Leong, Lucille; Chu, Peiguo; Kim, Joseph; Chao, Joseph; Fakih, Marwan; Yen, Yun; Espenschied, Jonathan; Ellenhorn, Joshua D I; Diamond, Don J; Chung, Vincent

    2014-01-01

    PURPOSE: To conduct a Phase I trial of a Modified Vaccinia Ankara vaccine delivering wild type human p53 (p53MVA) in patients with refractory gastrointestinal cancers. EXPERIMENTAL DESIGN: Three patients were vaccinated with 1.0 × 108 pfu p53MVA followed by nine patients at 5.6 × 108 pfu. Toxicity was classified using the NCI Common Toxicity Criteria and clinical responses were assessed by CT scan. Peripheral blood samples were collected pre- and post-immunization for immunophenotyping, monitoring of p53MVA induced immune response and examination of PD-1 checkpoint inhibition in vitro. RESULTS: p53MVA immunization was well tolerated at both doses, with no adverse events above grade 2. CD4+ and CD8+ T cells showing enhanced recognition of a p53 overlapping peptide library were detectable after the first immunization, particularly in the CD8+ T cell compartment (p=0.03). However in most patients this did not expand further with the second and third immunization. The frequency of PD-1+ T cells detectable in patients PBMC was significantly higher than in healthy controls. Furthermore, the frequency of PD-1+ CD8+ T cells showed an inverse correlation with the peak CD8+ p53 response (p=0.02) and antibody blockade of PD-1 in vitro increased the p53 immune responses detected after the second or third immunizations. Induction of strong T cell and antibody responses to the MVA backbone were also apparent. CONCLUSION: p53MVA was well tolerated and induced robust CD8+ T cell responses. Combination of p53MVA with immune checkpoint inhibition could help sustain immune responses and lead to enhanced clinical benefit. PMID:24987057

  15. Absence of p21 expression is associated with abnormal p53 in human breast carcinomas.

    PubMed Central

    Ellis, P. A.; Lonning, P. E.; Borresen-Dale, A.; Aas, T.; Geisler, S.; Akslen, L. A.; Salter, I.; Smith, I. E.; Dowsett, M.

    1997-01-01

    The p53 tumour-suppressor gene is important in the regulation of cell growth and apoptosis, and loss of functional wild-type activity may be associated with tumour formation and resistance to therapy. Differentiation of functionally normal wild-type protein from mutant or abnormal protein remains difficult using either immunohistochemical assays or mutational DNA sequencing. p21(WAF1/CIP1) (p21) is induced by wild type p53 and plays an important role in promoting cell cycle arrest. To test the hypothesis that p21 protein expression may act as a downstream marker of tumours from patients with locally advanced breast cancer before treatment with doxorubicin, pretreatment p53 status had been characterized in 63 tumours by p53 protein immunostaining and DNA mutational analysis. There was a significant association between immunostaining for p53 and the presence of p53 mutations (P = 0.01). Of 56 patients available for determination of p21, 31 (55%) expressed p21 protein. Twenty-eight out of 31 patients (90%) positive for p21 had low negative p53 protein expression, whereas only 3 of 13 patients (23%) with high p53 expressed p21 (P = 0.009). No association was seen between p21 protein expression and p53 mutations (P = 0.24). The combination of p53 and p21 immunostaining results improved the specificity of the immunostaining but at a cost of significant reduction in sensitivity. Immunohistochemical assessment of p21 protein expression is inversely associated with abnormal p53 protein in human breast cancer. The detection of p21 protein expression in combination with p53 protein expression did not improve the ability of immunohistochemistry (IHC) to differentiate between normal and mutant p53 protein. Images Figure 1 PMID:9275025

  16. Splice-acceptor site mutation in p53 gene of hu888 zebrafish line.

    PubMed

    Piasecka, Alicja; Brzuzan, Paweł; Woźny, Maciej; Ciesielski, Sławomir; Kaczmarczyk, Dariusz

    2015-02-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response, which has been a subject of intense research for over 30 years. Recently, a zebrafish line which carries splice site mutation (G>T) in intron 8 of p53 gene (p53 (hu888) ), encoding the p53 paralogue, was developed (The Zebrafish Mutation Project). To uncover molecular effects of the mutation, we raised hu888 zebrafish line to adulthood and analyzed DNA, mRNA data, and protein levels of p53 to assess their potential contribution in molecular mechanisms of the mutant fish. To obtain zebrafish individuals homozygous for the point mutation, p53 (hu888) carriers were repeatedly incrossed but only heterozygous mutants (p53 (hu888/+) ) or p53-wild type hu888 zebrafish (p53 (+/+) ) were identified in their progeny. By evaluation of p53 expression changes in the liver of mutant and wild type hu888 zebrafish as well as of Tübingen reference strain, we demonstrated that two types of splicing occurred in each case: a classical one and the alternative splicing which involves the activation of cryptic splice-acceptor site in the exon 9 of zebrafish p53 pre-mRNA. The alternative splicing event results in a deletion 12 nucleotides in the mature mRNA, and produces a shortened variant of p53 protein. Interestingly, expression of p53 protein in liver of both heterozygous and wild type hu888 zebrafish was highly reduced compared to that in the reference strain. PMID:25183022

  17. Functional studies of a germ-line polymorphism at codon 47 within the p53 gene

    SciTech Connect

    Felley-Bosco, E.; Weston, A.; Cawley, H.M.; Bennett, W.P.; Harris, C.C.

    1993-09-01

    A rare germ-line polymorphism in codon 47 of the p53 gene replaces the wild-type proline (CCG) with a serine (TCG). Restriction analysis of 101 human samples revealed the frequency of the rare allele to be 0% (n = 69) in Causasians and 4.7% (3/64, n = 32) among African-Americans. To investigate the consequence of this amino acid substitution, a cDNA construct (p53 mut47ser) containing the mutation was introduced into a lung adenocarcinoma cell line (Calu-6) that does not express p53. A growth suppression similar to that obtained after introduction of a wild-type p53 cDNA construct was observed, in contrast to the result obtained by introduction of p53 mut143ala. Furthermore, expression of neither p53 mut47ser nor wild-type p53 was tolerated by growing cells. In transient expression assays, both mut47ser and wild-type p53 activated the expression of a reporter gene linked to a p53 binding sequence (PG13-CAT) and inhibited the expression of the luciferase gene under the control of the Rous sarcoma virus promoter (RSVluc). In the same assay, mut143ala did not activate the expression of PG13-CAT and produced only a slight inhibitory effect on RSVluc. These findings indicate that the p53 variant with a serine at codon 47 should be considered as a rare germ-line polymorphism that does not alter the growth-suppression activity of p53. 30 refs., 3 figs., 3 tabs.

  18. Augmented DNA-binding activity of p53 protein encoded by a carboxyl-terminal alternatively spliced mRNA is blocked by p53 protein encoded by the regularly spliced form.

    PubMed Central

    Wolkowicz, R; Peled, A; Elkind, N B; Rotter, V

    1995-01-01

    DNA-binding activity of the wild-type p53 is central to its function in vivo. However, recombinant or in vitro translated wild-type p53 proteins, unless modified, are poor DNA binders. The fact that the in vitro produced protein gains DNA-binding activity upon modification at the C terminus raises the possibility that similar mechanisms may exist in the cell. Data presented here show that a C-terminal alternatively spliced wild-type p53 (ASp53) mRNA expressed by bacteria or transcribed in vitro codes for a p53 protein that efficiently binds DNA. Our results support the conclusion that the augmented DNA binding activity of an ASp53 protein is probably due to attenuation of the negative effect residing at the C terminus of the wild-type p53 protein encoded by the regularly spliced mRNA (RSp53) rather than acquisition of additional functionality by the alternatively spliced C' terminus. In addition, we found that ASp53 forms a complex with the non-DNA-binding RSp53, which in turn blocks the DNA-binding activity of ASp53. Interaction between these two wild-type p53 proteins may underline a mechanism that controls the activity of the wild-type p53 protein in the cell. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7624329

  19. Immunohistochemical detection of p53 in Wilms' tumors correlates with unfavorable outcome.

    PubMed Central

    Lahoti, C.; Thorner, P.; Malkin, D.; Yeger, H.

    1996-01-01

    The role of p53 in the pathogenesis and progression of Wilms' tumors is only partly understood. Although p53 mutations were initially reported only in anaplastic Wilms' tumors, we had reported that, of two of twenty-one cases that had a p53 mutation, one tumor showed no evidence of anaplasia. To determine the significance of p53 expression in all clinical stages of Wilms' tumor, twenty-eight cases were analyzed for p53 immunoreactivity. Paraffin sections were immunolabeled with two different monoclonal antibodies, recognizing both mutant and wild-type p53. Fifteen of sixteen tumors in the recurrent/metastatic group and three of twelve tumors in the nonmetastatic/nonrecurrent group showed p53 immunopositivity. Only one of three positive tumors in the latter group showed moderate to strong positivity, whereas twelve of sixteen metastatic/recurrent tumors revealed a similar degree of p53 positivity. The positivity was stronger in the metastasis/recurrences as compared with the corresponding primary tumor. Western blot analysis revealed p53 expression in all of the Wilms' tumors tested, suggesting its involvement in the development of Wilms' tumors. Single-strand conformation polymorphism analysis performed on twenty-three of these tumors revealed p53 mutations in four of fourteen recurrent/metastatic tumors and none in the nonmetastatic/nonrecurrent group. Our results show that, whereas 60% of cases were immunopositive for p53 protein, mutations were detected in only 16% of tumors, indicating that wild-type p53 protein is retained in the other tumors. We conclude that p53 immunopositivity strongly correlates with recurrence/metastasis in Wilms' tumors. Furthermore, the accumulation of p53 in these tumors is not only due to mutations but may also involve stabilization of normal p53 with other proteins. Images Figure 1 Figure 2 Figure 3 PMID:8623926

  20. The 7-amino-acid site in the proline-rich region of the N-terminal domain of p53 is involved in the interaction with FAK and is critical for p53 functioning.

    PubMed

    Golubovskaya, Vita M; Finch, Richard; Zheng, Min; Kurenova, Elena V; Cance, William G

    2008-04-01

    It is known that p53 alterations are commonly found in tumour cells. Another marker of tumorigenesis is FAK (focal adhesion kinase), a non-receptor kinase that is overexpressed in many types of tumours. Previously we determined that the N-terminal domain of FAK physically interacted with the N-terminal domain of p53. In the present study, using phage display, sitedirected mutagenesis, pulldown and immunoprecipitation assays we localized the site of FAK binding to a 7-amino-acid region(amino acids 65-71) in the N-terminal proline-rich domain of human p53. Mutation of the binding site in p53 reversed the suppressive effect of FAK on p53-mediated transactivation ofp21, BAX (Bcl-2-associated X protein) and Mdm2 (murine double minute 2) promoters. In addition, to functionally test this p53 site, we conjugated p53 peptides [wild-type (containing the wild-type binding site) and mutant (with a mutated 7-aminoacid binding site)] to a TAT peptide sequence to penetrate the cells, and demonstrated that the wild-type p53 peptide disrupted binding of FAK and p53 proteins and significantly inhibited cell viability of HCT116 p53+/+ cells compared with the control mutant peptide and HCT116 p53-/- cells. Furthermore, the TAT-p53 peptide decreased the viability of MCF-7 cells, whereas the mutant peptide did not cause this effect. Normal fibroblast p53+/+ and p53-/- MEF (murine embryonic fibroblast) cells and breast MCF10A cells were not sensitive to p53 peptide. Thus, for the first time, we have identified the binding site of the p53 andFAK interaction and have demonstrated that mutating this site and targeting the site with peptides affects p53 functioning and viability in the cells. PMID:18215142

  1. ZASP Interacts with the Mechanosensing Protein Ankrd2 and p53 in the Signalling Network of Striated Muscle

    PubMed Central

    Martinelli, Valentina C.; Kyle, W. Buck; Kojic, Snezana; Vitulo, Nicola; Li, Zhaohui; Belgrano, Anna; Maiuri, Paolo; Banks, Lawrence; Vatta, Matteo; Valle, Giorgio; Faulkner, Georgine

    2014-01-01

    ZASP is a cytoskeletal PDZ-LIM protein predominantly expressed in striated muscle. It forms multiprotein complexes and plays a pivotal role in the structural integrity of sarcomeres. Mutations in the ZASP protein are associated with myofibrillar myopathy, left ventricular non-compaction and dilated cardiomyopathy. The ablation of its murine homologue Cypher results in neonatal lethality. ZASP has several alternatively spliced isoforms, in this paper we clarify the nomenclature of its human isoforms as well as their dynamics and expression pattern in striated muscle. Interaction is demonstrated between ZASP and two new binding partners both of which have roles in signalling, regulation of gene expression and muscle differentiation; the mechanosensing protein Ankrd2 and the tumour suppressor protein p53. These proteins and ZASP form a triple complex that appears to facilitate poly-SUMOylation of p53. We also show the importance of two of its functional domains, the ZM-motif and the PDZ domain. The PDZ domain can bind directly to both Ankrd2 and p53 indicating that there is no competition between it and p53 for the same binding site on Ankrd2. However there is competition for this binding site between p53 and a region of the ZASP protein lacking the PDZ domain, but containing the ZM-motif. ZASP is negative regulator of p53 in transactivation experiments with the p53-responsive promoters, MDM2 and BAX. Mutations in the ZASP ZM-motif induce modification in protein turnover. In fact, two mutants, A165V and A171T, were not able to bind Ankrd2 and bound only poorly to alpha-actinin2. This is important since the A165V mutation is responsible for zaspopathy, a well characterized autosomal dominant distal myopathy. Although the mechanism by which this mutant causes disease is still unknown, this is the first indication of how a ZASP disease associated mutant protein differs from that of the wild type ZASP protein. PMID:24647531

  2. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    SciTech Connect

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  3. STAT5A is regulated by DNA damage via the tumor suppressor p53.

    PubMed

    Mukhopadhyay, Utpal K; Cass, Jamaica; Raptis, Leda; Craig, Andrew W; Bourdeau, Véronique; Varma, Sonal; SenGupta, Sandip; Elliott, Bruce E; Ferbeyre, Gerardo

    2016-06-01

    Here we report that the STAT5A transcription factor is a direct p53 transcriptional target gene. STAT5A is well expressed in p53 wild type cells but not in p53-null cells. Inhibition of p53 reduces STAT5A expression. DNA damaging agents such as doxorubicin also induced STAT5A expression in a p53 dependent manner. Two p53 binding sites were mapped in the STAT5A gene and named PBS1 and PBS2; these sites were sufficient to confer p53 responsiveness in a luciferase reporter gene. Chromatin immunoprecipitation experiments revealed that PBS2 has constitutive p53 bound to it, while p53 binding to PBS1 required DNA damage. In normal human breast lobules, weak p53 staining correlated with regions of intense STAT5A staining. Interestingly, in a cohort of triple negative breast tumor tissues there was little correlation between regions of p53 and STAT5A staining, likely reflecting a high frequency of p53 mutations that stabilize the protein in these tumors. We thus reveal an unexpected connection between cytokine signaling and p53. PMID:26876578

  4. Estradiol induces functional inactivation of p53 by intracellular redistribution.

    PubMed

    Molinari, A M; Bontempo, P; Schiavone, E M; Tortora, V; Verdicchio, M A; Napolitano, M; Nola, E; Moncharmont, B; Medici, N; Nigro, V; Armetta, I; Abbondanza, C; Puca, G A

    2000-05-15

    Estrogen treatment of MCF-7 cells grown in serum-free medium induced a modification of the intracellular distribution of p53 protein. Western blot analysis and immunofluorescence staining showed that p53 was localized in the nucleus of untreated cell and that after 48 h of hormone treatment, it was mostly localized in the cytoplasm. This effect was blocked by the antiestrogen ICI182,780. Intracellular redistribution of p53 was correlated to a reduced expression of the WAF1/CIP1 gene product and to the presence of degradation fragments of p53 in the cytosol. Estradiol treatment prevented the growth inhibition induced by oligonucleotide transfection, simulating DNA damage. This observation indicated that the wild-type p53 gene product present in the MCF-7 cell could be inactivated by estradiol through nuclear exclusion to permit the cyclin-dependent phosphorylation events leading to the G1-S transition. In addition, the estradiol-induced inactivation of p53 could be involved in the tumorigenesis of estrogen-dependent neoplasm. PMID:10825127

  5. Restoring p53 function in cancer: novel therapeutic approaches for applying the brakes to tumorigenesis.

    PubMed

    Di Cintio, Alessandra; Di Gennaro, Elena; Budillon, Alfredo

    2010-01-01

    p53 tumor suppressor gene encodes for a critical cellular protein that regulate the integrity of the cell and can induce cell cycle arrest and/or apoptosis upon cellular stresses of several origins, including chemotherapeutics. Loss of p53 function occurs in an estimated 50% of all cancers by mutations and deletions while in the presence of wild-type p53 alleles other mechanisms may affect the expression and activity of p53. Alternate mechanisms include methylation of the promoter of p53, deletion or epigenetic inactivation of the p53-positive regulator p14/ARF, elevated expression of the p53 regulators murine double minute 2 (MDM2) and MDMX, or alteration of upstream regulators of p53 such as the kinase ATM. MDM2 is a p53 E3 ubiquitin ligase that mediates the ubiquitin-dependent degradation of p53 while p14/ARF is a small MDM2-binding protein that controls the activity of MDM2 by displacing p53 and preventing its degradation. MDMX antagonize p53-dependent transcriptional control by interfering with p53 transactivation function. The understanding of the key role of p53 inactivation in cancer development generated considerable interest in developing compounds that are capable of restoring the p53 functions. Several patents have been issued on such compounds. Adenovirus-based p53 gene therapy as well as small molecules such as PRIMA that can restore the transcriptional transactivation function to mutant p53, or NUTLIN and RITA that interfere with MDM2-directed p53 degradation, have tested in a preclinical setting and some of these approaches are currently in clinical development. PMID:19663772

  6. Enhanced radiosensitization of p53 mutant cells by oleamide

    SciTech Connect

    Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil . E-mail: yslee@kcch.re.kr

    2006-04-01

    Purpose: Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. Methods and Materials: NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Results: Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Conclusions: Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.

  7. p53-Mediated Cellular Response to DNA Damage in Cells with Replicative Hepatitis B Virus

    NASA Astrophysics Data System (ADS)

    Puisieux, Alain; Ji, Jingwei; Guillot, Celine; Legros, Yann; Soussi, Thierry; Isselbacher, Kurt; Ozturk, Mehmet

    1995-02-01

    Wild-type p53 acts as a tumor suppressor gene by protecting cells from deleterious effects of genotoxic agents through the induction of a G_1/S arrest or apoptosis as a response to DNA damage. Transforming proteins of several oncogenic DNA viruses inactivate tumor suppressor activity of p53 by blocking this cellular response. To test whether hepatitis B virus displays a similar effect, we studied the p53-mediated cellular response to DNA damage in 2215 hepatoma cells with replicative hepatitis B virus. We demonstrate that hepatitis B virus replication does not interfere with known cellular functions of p53 protein.

  8. Mutant p53 Drives Cancer by Subverting Multiple Tumor Suppression Pathways

    PubMed Central

    Haupt, Sue; Raghu, Dinesh; Haupt, Ygal

    2016-01-01

    The tumor suppressor p53 normally acts as a brake to halt damaged cells from perpetrating their genetic errors into future generations. If p53 is disrupted by mutation, it may not only lose these corrective powers, but counterproductively acquire new capacities that drive cancer. A newly emerging manner in which mutant p53 executes its cancer promoting functions is by harnessing key proteins, which normally partner with its wild type, tumor-inhibiting counterpart. In association with the subverted activities of these protein partners, mutant p53 is empowered to act across multiple fundamental cellular pathways (regulating cell division and metabolism) and corrupt them to become cancer promoting. PMID:26858938

  9. The tumor suppressor, p53 regulates the γA-crystallin gene during mouse lens development.

    PubMed

    Hu, X-H; Nie, Q; Yi, M; Li, T-T; Wang, Z-F; Huang, Z-X; Gong, X-D; Zhou, L; Ji, W-K; Hu, W-F; Liu, J-F; Wang, L; Woodward, Z; Zhu, J; Liu, W-B; Nguyen, Q D; Li, D W-C

    2014-01-01

    The tumor suppressor, p53 regulates a large number of target genes to control cell proliferation and apoptosis. In addition, it is also implicated in the regulation of cell differentiation in muscle, the circulatory system and various carcinoma tissues. We have recently shown that p53 also controls lens differentiation. Regarding the mechanism, we reveal that p53 directly regulates several genes including c-Maf and Prox1, two important transcription factors for lens differentiation, and αA and βA3/A1, the lens differentiation markers. In the present study, we present evidence to show that the γA-crystallin gene distal promoter and the first intron also contain p53 binding sites and are capable of mediating p53 control during mouse lens development. First, gel mobility shifting assays revealed that the p53 protein in nuclear extracts from human lens epithelial cells (HLE) directly binds to the p53 binding sites present in the γA-crystallin gene. Second, the exogenous wild type p53 induces the dose-dependent expression of the luciferase reporter gene driven by the basic promoter containing the γA-crystallin gene p53 binding site. In contrast, the exogenous dominant negative mutant p53 causes a dose-dependent inhibition of the same promoter. Third, ChIP assays revealed that p53 binds to the γA-crystallin gene promoter in vivo. Finally, in the p53 knockout mouse lenses, the expression level of the γAcrystallin gene was found attenuated in comparison with that in the wild type mouse lenses. Together, our results reveal that p53 regulates γA-crystallin gene expression during mouse lens development. Thus, p53 directly regulates all 3 types of crystallin genes to control lens differentiation. PMID:25336329

  10. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    SciTech Connect

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut

    2013-10-01

    X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the

  11. p53 protein oxidation in cultured cells in response to pyrrolidine dithiocarbamate: a novel method for relating the amount of p53 oxidation in vivo to the regulation of p53-responsive genes.

    PubMed Central

    Wu, H H; Thomas, J A; Momand, J

    2000-01-01

    A novel method was developed to determine the oxidation status of proteins in cultured cells. Methoxy-polyethylene glycol-maleimide MW 2000 (MAL-PEG) was used to covalently tag p53 protein that was oxidized at cysteine residues in cultured cells. Treatment of MCF7 breast cancer cells with pyrrolidine dithiocarbamate (PDTC), a metal chelator, resulted in a minimum of 25% oxidation of p53. The oxidized p53 had an average of one cysteine residue oxidized per p53 protein molecule. The effect of PDTC treatment on downstream components of the p53 signal-transduction pathway was tested. PDTC treatment prevented actinomycin D-mediated up-regulation of two p53 effector gene products, murine double minute clone 2 oncoprotein and p21(WAF1/CIP1) (where WAF1 corresponds to wild-type p53-activated fragment 1 and CIP1 corresponds to cyclin-dependent kinase-interacting protein 1). Actinomycin D treatment led to accumulation of p53 protein in the nucleus. However, when cells were simultaneously treated with PDTC and actinomycin D, p53 accumulated in both the nucleus and the cytoplasm. The data indicate that an average of one cysteine residue per p53 protein molecule is highly sensitive to oxidation and that p53 can be efficiently oxidized by PDTC in cultured cells. PDTC-mediated oxidation of p53 correlates with altered p53 subcellular localization and reduced activation of p53 downstream effector genes. The novel method for detecting protein oxidation detailed in the present study may be used to determine the oxidation status of specific proteins in cells. PMID:10998350

  12. Roscovitine-activated HIP2 kinase induces phosphorylation of wt p53 at Ser-46 in human MCF-7 breast cancer cells.

    PubMed

    Wesierska-Gadek, Józefa; Schmitz, M Lienhard; Ranftler, Carmen

    2007-03-01

    Human MCF-7 breast cancer cells are relatively resistant to conventional chemotherapy due to the lack of caspase-3 activity. We reported recently that roscovitine (ROSC), a potent cyclin-dependent kinase 2 inhibitor, arrests human MCF-7 breast cancer cells in the G(2) phase of the cell cycle and concomitantly induces apoptosis. Exposure of MCF-7 cells to ROSC also strongly activates the wt p53 tumor suppressor protein in a time- and dose-dependent manner. The p53 level increased despite upregulation of Hdm-2 protein and was attributable to the site-specific phosphorylation at Ser-46. The p53 protein phosphorylated at serine 46 causes the up-regulation of the p53AIP1 protein, a component of mitochondria. In the present study we identified the pathway mediating ROSC-induced p53 activation. Exposure of MCF-7 cells to ROSC activated homeodomain-intereacting protein kinase-2 (HIPK2). The overexpression of wild-type but not kinase inactive HIPK2 increased the basal and ROSC-induced level of p53 phosphorylation at Ser-46 and strongly enhanced the rate of apoptosis in cells exposed to ROSC. We show that HIPK2 is activated by ROSC and mediates ROSC-induced P-Ser-46-p53, thereby stabilizing wt p53 and increasing the efficacy of drug-induced apoptosis in MCF-7 cells. These results identify HIPK2 as a component of the ROSC-induced signaling pathway leading to the stabilization and activation of wt p53 protein. PMID:17203463

  13. Suppression of tumorigenicity of breast cancer cells by transfer of human chromosome 17 does not require transferred BRCA1 and p53 genes.

    PubMed

    Theile, M; Hartmann, S; Scherthan, H; Arnold, W; Deppert, W; Frege, R; Glaab, F; Haensch, W; Scherneck, S

    1995-02-01

    A number of candidate tumor suppressor genes located on the human chromosome 17 are thought to have a role to play in the development of breast cancer. In addition to the p53 gene on 17p13.1 and the BRCA1 gene mapped to 17q12-21, other chromosomal regions for tumor suppressor genes have been suggested to exist on 17p13.3 and both the central and the distal parts of 17q, although definitive functional proof of their involvement in breast cancer tumorigenesis is still lacking. In this report we show that microcell transfer of a human chromosome 17 into wild-type p53 breast cancer cells CAL51 results in loss of tumorigenicity and anchorage-independent growth, changes in cell morphology and a reduction of cell growth rates of the neo-selected microcell hybrids. In the hybrid cells, which express the p53 wild-type protein, only the p- and the distal parts of the q arm of donor chromosome 17 are transferred. Thus, our results provide functional evidence for the presence of one or more tumor suppressor gene(s) on chromosome 17, which are distinct from the p53 and the BRCA1 genes. PMID:7845668

  14. An extra copy of p53 suppresses development of spontaneous Kras-driven but not radiation-induced cancer

    PubMed Central

    Moding, Everett J.; Min, Hooney D.; Castle, Katherine D.; Ali, Moiez; Woodlief, Loretta; Williams, Nerissa; Ma, Yan; Kim, Yongbaek; Lee, Chang-Lung; Kirsch, David G.

    2016-01-01

    The tumor suppressor p53 blocks tumor progression in multiple tumor types. Radiation-induced cancer following exposure to radiation therapy or space travel may also be regulated by p53 because p53 has been proposed to respond to DNA damage to suppress tumorigenesis. Here, we investigate the role of p53 in lung carcinogenesis and lymphomagenesis in LA-1 KrasG12D mice with wild-type p53 or an extra copy of p53 (super p53) exposed to fractionated total body irradiation with low linear energy transfer (low-LET) X-rays or high-LET iron ions and compared tumor formation in these mice with unirradiated controls. We found that an additional copy of p53 suppressed both Kras-driven lung tumor and lymphoma development in the absence of radiation. However, an additional copy of p53 did not affect lymphoma development following low- or high-LET radiation exposure and was unable to suppress radiation-induced expansion of thymocytes with mutated Kras. Moreover, radiation exposure increased lung tumor size in super p53 but not wild-type p53 mice. These results demonstrate that although p53 suppresses the development of spontaneous tumors expressing KrasG12D, in the context of exposure to ionizing radiation, an extra copy of p53 does not protect against radiation-induced lymphoma and may promote KrasG12D mutant lung cancer. PMID:27453951

  15. A spatiotemporal characterization of the effect of p53 phosphorylation on its interaction with MDM2

    PubMed Central

    ElSawy, Karim M; Sim, Adelene; Lane, David P; Verma, Chandra S; Caves, Leo SD

    2015-01-01

    The interaction of p53 and MDM2 is modulated by the phosphorylation of p53. This mechanism is key to activating p53, yet its molecular determinants are not fully understood. To study the spatiotemporal characteristics of this molecular process we carried out Brownian dynamics simulations of the interactions of the MDM2 protein with a p53 peptide in its wild type state and when phosphorylated at Thr18 (pThr18) and Ser20 (pSer20). We found that p53 phosphorylation results in concerted changes in the topology of the interaction landscape in the diffusively bound encounter complex domain. These changes hinder phosphorylated p53 peptides from binding to MDM2 well before reaching the binding site. The underlying mechanism appears to involve shift of the peptide away from the vicinity of the MDM2 protein, peptide reorientation, and reduction in peptide residence time relative to wild-type p53 peptide. pThr18 and pSr20 p53 peptides experience reduction in residence times by factors of 13.6 and 37.5 respectively relative to the wild-type p53 peptide, indicating a greater role for Ser20 phosphorylation in abrogating p53 MDM2 interactions. These detailed insights into the effect of phosphorylation on molecular interactions are not available from conventional experimental and theoretical approaches and open up new avenues that incorporate molecular interaction dynamics, for stabilizing p53 against MDM2, which is a major focus of anticancer drug lead development. PMID:25584963

  16. Autophagy induced by p53-reactivating molecules protects pancreatic cancer cells from apoptosis.

    PubMed

    Fiorini, Claudia; Menegazzi, Marta; Padroni, Chiara; Dando, Ilaria; Dalla Pozza, Elisa; Gregorelli, Alex; Costanzo, Chiara; Palmieri, Marta; Donadelli, Massimo

    2013-03-01

    TP53 mutations compromising p53 transcriptional function occur in more than 50 % of human cancers, including pancreatic adenocarcinoma, and render cancer cells more resistant to conventional therapy. In the last few years, many efforts have been addressed to identify p53-reactivating molecules able to restore the wild-type transcriptionally competent conformation of the mutated proteins. Here, we show that two of these compounds, CP-31398 and RITA, induce cell growth inhibition, apoptosis, and autophagy by activating p53/DNA binding and p53 phosphorylation (Ser15), without affecting the total p53 amount. These effects occur in both wild-type and mutant p53 pancreatic adenocarcinoma cell lines, whereas they are much less pronounced in normal human primary fibroblasts. Furthermore, CP-31398 and RITA regulate the axis SESN1-2/AMPK/mTOR by inducing AMPK phosphorylation on Thr172, which has a crucial role in the autophagic response. The protective role of autophagy in cell growth inhibition by CP-31398 and RITA is supported by the finding that the AMPK inhibitor compound C or the autophagy inhibitors chloroquine or 3-methyladenine sensitize both pancreatic adenocarcinoma cell lines to the apoptotic response induced by p53-reactivating molecules. Our results demonstrate for the first time a survival role for autophagy induced by p53-reactivating molecules, supporting the development of an anti-cancer therapy based on autophagy inhibition associated to p53 activation. PMID:23238993

  17. p53: Guardian of Ploidy

    PubMed Central

    Aylon, Yael; Oren, Moshe

    2011-01-01

    Aneuploidy, often preceded by tetraploidy, is one of the hallmarks of solid tumors. Indeed, both aneuploidy and tetraploidy are oncogenic occurrences that are sufficient to drive neoplastic transformation and cancer progression. True to form, the tumor suppressor p53 obstructs propagation of these dangerous chromosomal events by either instigating irreversible cell cycle arrest or apoptosis. The tumor suppressor Lats2, along with other tumor inhibitory proteins such as BRCA1/2 and BubR1, are central to p53-dependent elimination of tetraploid cells. Not surprisingly, these proteins are frequently inactivated or downregulated in tumors, synergizing with p53 inactivation to establish an atmosphere of “tolerance” for a nondiploid state. PMID:21852209

  18. P53 dependent and independent apoptosis induced by lidamycin in human colorectal cancer cells.

    PubMed

    Chen, Lihui; Jiang, Jianming; Cheng, Chunlei; Yang, Ajing; He, Qiyang; Li, Diandong; Wang, Zhen

    2007-06-01

    Enediyne compound is one class of antibiotics with very potent anti-cancer activity. However, the role of p53 in enediyne antibiotic-induced cell killing remains elusive. Here we reported the involvement of p53 signaling pathway in apoptosis induction by lidamycin (LDM), a member of the enediyne antibiotic family. We found that LDM at low drug concentration of 10 nmol/L induces apoptotic cell death much more effectively in human colorectal cancer cells with wild type p53 than those with mutant or deleted p53. p53 is functionally activated as an early event in response to low dose LDM that precedes the significant apoptosis induction. The primarily activation of mitochondria as well as the activation of p53 transcriptional targets such as Puma, Bad and Bax in HCT116 p53 wild type cells further demonstrates the key role of p53 in mediating the compound-induced apoptosis. This is further supported by the observation that the absence of Bax or Puma decreases apoptosis dramatically while Bcl-2 overexpression confers partially resistance after drug treatment. Activation of p53 signaling pathway leads to activation of caspases and caspases inhibitor VAD-fmk completely blocks low dose LDM induced apoptosis through the inhibition of mitochondria pathway. In contrast, LDM at higher concentration causes rapid apoptosis through more direct DNA damaging mechanism that is independent of activation of p53 and caspases and cannot be blocked by caspase inhibitor. Taken together, LDM induces apoptosis in a p53-dependent manner when given at low doses, but in a p53-independent manner when given at high doses. This dosage-dependent regimen can be applied to cancer clinic based upon the p53 status of cancer patients. PMID:17534142

  19. The evolution of thymic lymphomas in p53 knockout mice.

    PubMed

    Dudgeon, Crissy; Chan, Chang; Kang, Wenfeng; Sun, Yvonne; Emerson, Ryan; Robins, Harlan; Levine, Arnold J

    2014-12-01

    Germline deletion of the p53 gene in mice gives rise to spontaneous thymic (T-cell) lymphomas. In this study, the p53 knockout mouse was employed as a model to study the mutational evolution of tumorigenesis. The clonality of the T-cell repertoire from p53 knockout and wild-type thymic cells was analyzed at various ages employing TCRβ sequencing. These data demonstrate that p53 knockout thymic lymphomas arose in an oligoclonal fashion, with tumors evolving dominant clones over time. Exon sequencing of tumor DNA revealed that all of the independently derived oligoclonal mouse tumors had a deletion in the Pten gene prior to the formation of the TCRβ rearrangement, produced early in development. This was followed in each independent clone of the thymic lymphoma by the amplification or overexpression of cyclin Ds and Cdk6. Alterations in the expression of Ikaros were common and blocked further development of CD-4/CD-8 T cells. While the frequency of point mutations in the genome of these lymphomas was one per megabase, there were a tremendous number of copy number variations producing the tumors' driver mutations. The initial inherited loss of p53 functions appeared to delineate an order of genetic alterations selected for during the evolution of these thymic lymphomas. PMID:25452272

  20. Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

    PubMed Central

    Stegh, Alexander H.

    2012-01-01

    Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

  1. Adenovirus type 5 early region 4 is responsible for E1A-induced p53-independent apoptosis.

    PubMed Central

    Marcellus, R C; Teodoro, J G; Wu, T; Brough, D E; Ketner, G; Shore, G C; Branton, P E

    1996-01-01

    In the absence of E1B, the 289- and 243-residue E1A products of human adenovirus type 5 induce p53-dependent apoptosis. However, our group has shown recently that the 289-residue E1A protein is also able to induce apoptosis by a p53-independent mechanism (J. G. Teodoro, G. C. Shore, and P. E. Branton, Oncogene 11:467-474, 1995). Preliminary results suggested that p53-independent cell death required expression of one or more additional adenovirus early gene products. Here we show that both the E1B 19-kDa protein and cellular Bcl-2 inhibit or significantly delay p53-independent apoptosis. Neither early region E2 or E3 appeared to be necessary for such cell death. Analysis of a series of E1A mutants indicated that mutations in the transactivation domain and other regions of E1A correlated with E1A-mediated transactivation of E4 gene expression. Furthermore, p53-deficient human SAOS-2 cells infected with a mutant which expresses E1B but none of the E4 gene products remained viable for considerably longer times than those infected with wild-type adenovirus type 5. In addition, an adenovirus vector lacking both E1 and E4 was unable to induce DNA degradation and cell killing in E1A-expressing cell lines. These data showed that an E4 product is essential for E1A-induced p53-independent apoptosis. PMID:8709247

  2. Thioredoxin reductase is required for the inactivation of tumor suppressor p53 and for apoptosis induced by endogenous electrophiles.

    PubMed

    Cassidy, Pamela B; Edes, Kornelia; Nelson, Chad C; Parsawar, Krishna; Fitzpatrick, F A; Moos, Philip J

    2006-12-01

    Previous studies demonstrate that the covalent modification of thioredoxin reductase (TrxR) by both endogenous and exogenous electrophiles results in disruption of the conformation of the tumor suppressor protein p53. Here we report that the loss of normal cellular TrxR enzymatic activity by electrophilic modification or deletion of the C-terminal catalytic selenocysteine residue has functional consequences that are distinct from those resulting from depletion of TrxR protein in human RKO colon cancer cells. A thorough kinetic analysis was performed on purified TrxR in order to characterize the mechanism of its inhibition by electrophiles. Furthermore, electrospray mass spectrometry confirmed the alkylation of TrxR by lipid electrophiles and liquid chromatography-mass spectrometry/mass spectrometry identified the C-terminus as one target for alkylation. Then the consequences of TrxR modification by electrophiles on p53 conformation, transactivation and apoptosis were compared and contrasted with the effects of depletion of TrxR protein by treatment of cells with small interfering RNA directed against TrxR1. We found that cells depleted of TrxR were actually less sensitive to electrophile-induced disruption of p53 conformation and apoptosis than were cells expressing normal levels of TrxR. When RKO cells depleted of wild-type TrxR were transfected with C-terminal mutants of TrxR lacking the catalytic selenocysteine, p53 was found to be conformationally deranged, similar to cells treated with electrophiles. These results lead us to conclude that C-terminal modification of TrxR is both necessary and sufficient for the disruption of p53 and for the induction of apoptosis. Endogenous lipid electrophiles have been our primary focus; however, metabolic activation of hormones can generate endogenous mutagens, and we demonstrate that estrone-quinone attenuates p53 function in human MCF7 cells. PMID:16777982

  3. Modulation of cellular and viral promoters by mutant human p53 proteins found in tumor cells.

    PubMed Central

    Deb, S; Jackson, C T; Subler, M A; Martin, D W

    1992-01-01

    Wild-type p53 has recently been shown to repress transcription from several cellular and viral promoters. Since p53 mutations are the most frequently reported genetic defects in human cancers, it becomes important to study the effects of mutations of p53 on promoter functions. We, therefore, have studied the effects of wild-type and mutant human p53 on the human proliferating-cell nuclear antigen (PCNA) promoter and on several viral promoters, including the herpes simplex virus type 1 UL9 promoter, the human cytomegalovirus major immediate-early promoter-enhancer, and the long terminal repeat promoters of Rous sarcoma virus and human T-cell lymphotropic virus type I. HeLa cells were cotransfected with a wild-type or mutant p53 expression vector and a plasmid containing a chloramphenicol acetyltransferase reporter gene under viral (or cellular) promoter control. As expected, expression of the wild-type p53 inhibited promoter function. Expression of a p53 with a mutation at any one of the four amino acid positions 175, 248, 273, or 281, however, correlated with a significant increase of the PCNA promoter activity (2- to 11-fold). The viral promoters were also activated, although to a somewhat lesser extent. We also showed that activation by a mutant p53 requires a minimal promoter containing a lone TATA box. A more significant increase (25-fold) in activation occurs when the promoter contains a binding site for the activating transcription factor or cyclic AMP response element-binding protein. Using Saos-2 cells that do not express p53, we showed that activation by a mutant p53 was a direct enhancement. The mutant forms of p53 used in this study are found in various cancer cells. The activation of PCNA by mutant p53s may indicate a way to increase cell proliferation by the mutant p53s. Thus, our data indicate a possible functional role for the mutants of p53 found in cancer cells in activating several important loci, including PCNA. Images PMID:1356162

  4. Aciculatin Induces p53-Dependent Apoptosis via MDM2 Depletion in Human Cancer Cells In Vitro and In Vivo

    PubMed Central

    Lai, Chin-Yu; Tsai, An-Chi; Chen, Mei-Chuan; Chang, Li-Hsun; Sun, Hui-Lung; Chang, Ya-Ling; Chen, Chien-Chih

    2012-01-01

    Aciculatin, a natural compound extracted from the medicinal herb Chrysopogon aciculatus, shows potent anti-cancer potency. This study is the first to prove that aciculatin induces cell death in human cancer cells and HCT116 mouse xenografts due to G1 arrest and subsequent apoptosis. The primary reason for cell cycle arrest and cell death was p53 accumulation followed by increased p21 level, dephosphorylation of Rb protein, PUMA expression, and induction of apoptotic signals such as cleavage of caspase-9, caspase-3, and PARP. We demonstrated that p53 allele-null (−/−) (p53-KO) HCT116 cells were more resistant to aciculatin than cells with wild-type p53 (+/+). The same result was achieved by knocking down p53 with siRNA in p53 wild-type cells, indicating that p53 plays a crucial role in aciculatin-induced apoptosis. Although DNA damage is the most common event leading to p53 activation, we found only weak evidence of DNA damage after aciculatin treatment. Interestingly, the aciculatin-induced downregulation of MDM2, an important negative regulator of p53, contributed to p53 accumulation. The anti-cancer activity and importance of p53 after aciculatin treatment were also confirmed in the HCT116 xenograft models. Collectively, these results indicate that aciculatin treatment induces cell cycle arrest and apoptosis via inhibition of MDM2 expression, thereby inducing p53 accumulation without significant DNA damage and genome toxicity. PMID:22912688

  5. Alterations in Mitochondrial and Endoplasmic Reticulum Signaling by p53 Mutants

    PubMed Central

    Giorgi, Carlotta; Bonora, Massimo; Missiroli, Sonia; Morganti, Claudia; Morciano, Giampaolo; Wieckowski, Mariusz R.; Pinton, Paolo

    2016-01-01

    The p53 protein is probably the most important tumor suppressor, acting as a nuclear transcription factor primarily through the modulation of cell death. However, currently, it is well accepted that p53 can also exert important transcription-independent pro-cell death actions. Indeed, cytosolic localization of endogenous wild-type or transactivation-deficient p53 is necessary and sufficient for the induction of apoptosis and autophagy. Here, we present the extra-nuclear activities of p53 associated with the mitochondria and the endoplasmic reticulum, highlighting the activities of the p53 mutants on these compartments. These two intracellular organelles play crucial roles in the regulation of cell death, and it is now well established that they also represent sites where p53 can accumulate. PMID:26942128

  6. R248Q mutation--Beyond p53-DNA binding.

    PubMed

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

    2015-12-01

    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. PMID:26442703

  7. The anti-leukemic activity of sodium dichloroacetate in p53mutated/null cells is mediated by a p53-independent ILF3/p21 pathway

    PubMed Central

    Agnoletto, Chiara; Brunelli, Laura; Melloni, Elisabetta; Pastorelli, Roberta; Casciano, Fabio; Rimondi, Erika; Rigolin, Gian Matteo; Cuneo, Antonio; Secchiero, Paola; Zauli, Giorgio

    2015-01-01

    B-chronic lymphocytic leukemia (B-CLL) patients harboring p53 mutations are invariably refractory to therapies based on purine analogues and have limited treatment options and poor survival. Having recently demonstrated that the mitochondria-targeting small molecule sodium dichloroacetate (DCA) exhibits anti-leukemic activity in p53wild-type B-CLL cells, the aim of this study was to evaluate the effect of DCA in p53mutated B-CLL cells and in p53mutated/null leukemic cell lines. DCA exhibited comparable cytotoxicity in p53wild-type and p53mutated B-CLL patient cell cultures, as well as in p53mutated B leukemic cell lines (MAVER, MEC-1, MEC-2). At the molecular level, DCA promoted the transcriptional induction of p21 in all leukemic cell types investigated, including p53null HL-60. By using a proteomic approach, we demonstrated that DCA up-regulated the ILF3 transcription factor, which is a known regulator of p21 expression. The role of the ILF3/p21 axis in mediating the DCA anti-leukemic activity was underscored by knocking-down experiments. Indeed, transfection with ILF3 and p21 siRNAs significantly decreased both the DCA-induced p21 expression and the DCA-mediated cytotoxicity. Taken together, our results emphasize that DCA is a small molecule that merits further evaluation as a therapeutic agent also for p53mutated leukemic cells, by acting through the induction of a p53-independent pathway. PMID:25544776

  8. Phosphorylation of p53: a Novel Pathway for p53 Inactivation in Human T-Cell Lymphotropic Virus Type 1-Transformed Cells

    PubMed Central

    Pise-Masison, Cynthia A.; Radonovich, Michael; Sakaguchi, Kazuyasu; Appella, Ettore; Brady, John N.

    1998-01-01

    Inhibition of p53 function, through either mutation or interaction with viral or cellular transforming proteins, correlates strongly with the oncogenic potential. Only a small percentage of human T-cell lymphotropic virus type 1 (HTLV-1)-transformed cells carry p53 mutations, and mutated p53 genes have been found in only one-fourth of adult T-cell leukemia cases. In previous studies, we demonstrated that wild-type p53 is stabilized and transcriptionally inactive in HTLV-1-transformed cells. Further, the viral transcriptional activator Tax plays a role in both the stabilization and inactivation of p53 through a mechanism involving the first 52 amino acids of p53. Here we show for the first time that phosphorylation of p53 inactivates p53 by blocking its interaction with basal transcription factors. Using two-dimensional peptide mapping, we demonstrate that peptides corresponding to amino acids 1 to 19 and 387 to 393 are hyperphosphorylated in HTLV-1-transformed cells. Moreover, using antibodies specific for phosphorylated Ser15 and Ser392, we demonstrate increased phosphorylation of these amino acids. Since HTLV-1 p53 binds DNA in a sequence-specific manner but fails to interact with TFIID, we tested whether phosphorylation of the N terminus of p53 affected p53-TFIID interaction. Using biotinylated peptides, we show that phosphorylation of Ser15 alone inhibits p53-TFIID interaction. In contrast, phosphorylation at Ser15 and -37 restores TFIID binding and blocks MDM2 binding. Our studies provide evidence that HTLV-1 utilizes the posttranslational modification of p53 in vivo to inactivate function of the tumor suppressor protein. PMID:9658074

  9. Isolation, characterization and functional analysis of full length p53 cDNA from Bubalus bubalis.

    PubMed

    Singh, Minu; Aggarwal, Suruchi; Mohanty, Ashok K; Mukhopadhyay, Tapas

    2015-09-01

    p53 plays a pivotal role in maintaining the genomic integrity of the cell and has an important role in cellular transformation. We isolated and cloned a full length p53 cDNA (Bp53) from water buffalo in expression vectors designed to generate tagged proteins with FLAG or GFP. Bp53 was found to be 1161 nucleotide long and codes for 386 amino acid residues with 79% homology with human p53 containing 393 amino acids. Although Bp53 has some inherent differences in amino acid composition in different functional domains as compared to human p53 but the total electrostatic charge of amino acids has been maintained. Bp53 cDNA was transiently transfected in a p53 null human NSCLC cell line and as expected, it was predominantly localized in the nucleus. Besides, Bp53 effectively transactivates a number of target genes similar to human p53 and exerts most of its anti-tumorigenic potential in culture as observed in clonogenic and cell viability assays. Like human p53 mutants, core domain mutant version of Bp53 was found to be mis-localized to cytoplasm with diminished tumor suppressor activity. However, Bp53 appeared to be more sensitive to mdm2 mediated degradation and as a result, this protein was less stable as compared to human p53. For the first time we have characterized a functionally efficient wild-type p53 from buffalo having lower stability than human p53 and thus, buffalo p53 could be used as a model system for further insight to the molecular basis of wild-type p53 instability. PMID:26003295

  10. p53- and PAI-1-mediated induction of C-X-C chemokines and CXCR2: importance in pulmonary inflammation due to cigarette smoke exposure.

    PubMed

    Tiwari, Nivedita; Marudamuthu, Amarnath S; Tsukasaki, Yoshikazu; Ikebe, Mitsuo; Fu, Jian; Shetty, Sreerama

    2016-03-15

    We previously demonstrated that tumor suppressor protein p53 augments plasminogen activator inhibitor-1 (PAI-1) expression in alveolar epithelial cells (AECs) during chronic cigarette smoke (CS) exposure-induced lung injury. Chronic lung inflammation with elevated p53 and PAI-1 expression in AECs and increased susceptibility to and exacerbation of respiratory infections are all associated with chronic obstructive pulmonary disease (COPD). We recently demonstrated that preventing p53 from binding to the endogenous PAI-1 mRNA in AECs by either suppressing p53 expression or blockading p53 interactions with the PAI-1 mRNA mitigates apoptosis and lung injury. Within this context, we now show increased expression of the C-X-C chemokines (CXCL1 and CXCL2) and their receptor CXCR2, and the intercellular cellular adhesion molecule-1 (ICAM-1), in the lung tissues of patients with COPD. We also found a similar increase in lung tissues and AECs from wild-type (WT) mice exposed to passive CS for 20 wk and in primary AECs treated with CS extract in vitro. Interestingly, passive CS exposure of mice lacking either p53 or PAI-1 expression resisted an increase in CXCL1, CXCL2, CXCR2, and ICAM-1. Furthermore, inhibition of p53-mediated induction of PAI-1 expression by treatment of WT mice exposed to passive CS with caveolin-1 scaffolding domain peptide reduced CXCL1, CXCL2, and CXCR2 levels and lung inflammation. Our study reveals that p53-mediated induction of PAI-1 expression due to chronic CS exposure exacerbates lung inflammation through elaboration of CXCL1, CXCL2, and CXCR2. We further provide evidence that targeting this pathway mitigates lung injury associated with chronic CS exposure. PMID:26747783

  11. Cardiac glycosides inhibit p53 synthesis by a mechanism relieved by Src or MAPK inhibition

    PubMed Central

    Wang, Zhen; Zheng, Min; Li, Zhichuan; Li, Ruiguo; Jia, Lijun; Xiong, Xiufang; Southall, Noel; Wang, Shaomeng; Xia, Menghang; Austin, Christopher P.; Zheng, Wei; Xie, Zijian; Sun, Yi

    2009-01-01

    p53 is regulated at the multiple levels. We report here that p53 in multiple lines of human cancer cells is down-regulated by cardiac glycoside drugs, digoxin or ouabain, the potent inhibitors of Na+/K+-ATPase. These drugs reduced the basal levels of p53 protein at nanomolar concentrations in a dose-, time- and cancer cell line-dependent manner, but independent of p53 status of wild type (wt) or mutant. The drugs also reduced the levels of p53 induced by its activators as well as p53 transfected into human cancer cells, regardless of its status. Interestingly, the drugs had no effect on endogenous p53 in two immortalized human cell lines. Mechanistically, p53 reduction did not occur at the mRNA levels, but at the protein levels, as a result of reduced protein synthesis rather than enhanced degradation. The cellular sensitivity to drug-induced p53 reduction was not associated with the levels of α subunits of Na+/K+-ATPase in different cell lines. While lowering extracellular K+ did not reduce p53 as did ouabain and digoxin, it did potentiate both digoxin and ouabain-induced p53 reduction in sensitive lines. Finally, p53 reduction appears to be triggered by activation of Src/MAPK signaling pathways upon drug binding to the Na+/K+-ATPase and can be completely blocked by the inhibitors of Src or MEK. This is the first report that cardiac glycoside drugs, by initiating the Src/MAPK signaling pathways, reduce the p53 levels via inhibition of p53 protein synthesis. The drugs may be useful in the treatment of human cancers with a gain-of-function p53 mutation. PMID:19679550

  12. Counteracting MDM2-induced HIPK2 downregulation restores HIPK2/p53 apoptotic signaling in cancer cells.

    PubMed

    Nardinocchi, Lavinia; Puca, Rosa; Givol, David; D'Orazi, Gabriella

    2010-10-01

    Homeodomain-interacting protein kinase-2 (HIPK2) is a crucial regulator of p53 apoptotic function by phosphorylating serine 46 (Ser46) in response to DNA damage. In tumors with wild-type p53, its tumor suppressor function is often impaired by MDM2 overexpression that targets p53 for proteasomal degradation. Likewise, MDM2 targets HIPK2 for protein degradation impairing p53-apoptotic function. Here we report that zinc antagonised MDM2-induced HIPK2 degradation as well as p53 ubiquitination. The zinc inhibitory effect on MDM2 activity leads to HIPK2-induced p53Ser46 phosphorylation and p53 pro-apoptotic transcriptional activity. These results suggest that zinc derivatives are potential molecules to target the MDM2-induced HIPK2/p53 inhibition. PMID:20849851

  13. Correlation analysis of p53 protein isoforms with NPM1/FLT3 mutations and therapy response in acute myeloid leukemia.

    PubMed

    Ånensen, N; Hjelle, S M; Van Belle, W; Haaland, I; Silden, E; Bourdon, J-C; Hovland, R; Taskén, K; Knappskog, S; Lønning, P E; Bruserud, Ø; Gjertsen, B T

    2012-03-22

    The wild-type tumor-suppressor gene TP53 encodes several isoforms of the p53 protein. However, while the role of p53 in controlling normal cell cycle progression and tumor suppression is well established, the clinical significance of p53 isoform expression is unknown. A novel bioinformatic analysis of p53 isoform expression in 68 patients with acute myeloid leukemia revealed distinct p53 protein biosignatures correlating with clinical outcome. Furthermore, we show that mutated FLT3, a prognostic marker for short survival in AML, is associated with expression of full-length p53. In contrast, mutated NPM1, a prognostic marker for long-term survival, correlated with p53 isoforms β and γ expression. In conclusion, p53 biosignatures contain useful information for cancer evaluation and prognostication. PMID:21860418

  14. Post-thymic T cell lymphomas frequently overexpress p53 protein but infrequently exhibit p53 gene mutations.

    PubMed Central

    Matsushima, A. Y.; Cesarman, E.; Chadburn, A.; Knowles, D. M.

    1994-01-01

    We recently demonstrated that only one of 36 T-cell neoplasms contained p53 gene mutations. Although p53 gene mutations are known to result in overexpression of the p53 gene product, we also recently discovered that p53 protein overexpression does not correlate with p53 gene mutations, but does correlate with proliferation (r = 0.92), in anaplastic large cell lymphoma. In view of these findings, we investigated 34 non-human T-cell lymphotropic virus type I (HTLV-I) related postthymic T-cell lymphomas immunohistochemically for p53 protein, using monoclonal antibody 1801, and for proliferation, using monoclonal antibody Ki-67, and quantitated the results with the CAS-200 computerized image analysis system. We evaluated the presence of mutations in conserved exons 5 to 9 of the p53 gene using single-strand conformation polymorphism analysis and DNA sequencing. p53 mutations were detected in three of 34 cases, including two that contained deletions. p53 protein overexpression was detected in 17 of 34 cases, including the three mutated cases, with reactivities ranging from 10% to 48%. However, many cases in which a structural alteration could not be detected demonstrated levels of p53 protein expression comparable to those cases that were mutated. Correlation of p53 protein expression and proliferation, as assessed by Ki-67 expression, in this group of lymphomas was poor (r = 0.34). Whether alternative mechanisms of p53 protein inactivation are causing phenotypic overexpression of the p53 protein in these malignant lymphomas is unknown, although preliminary studies do not support a major role for such mechanisms. Therefore, the etiology and the significance of p53 protein overexpression in the cases that lack a demonstrable mutation is unclear. Nevertheless, as in anaplastic large cell lymphoma, overexpression of the p53 gene product is not a reliable predictor of the presence of mutations in conserved portions of the p53 gene in non-HTLV-I associated post-thymic T

  15. Assessing mutant p53 in primary high-grade serous ovarian cancer using immunohistochemistry and massively parallel sequencing

    PubMed Central

    Cole, Alexander J.; Dwight, Trisha; Gill, Anthony J.; Dickson, Kristie-Ann; Zhu, Ying; Clarkson, Adele; Gard, Gregory B.; Maidens, Jayne; Valmadre, Susan; Clifton-Bligh, Roderick; Marsh, Deborah J.

    2016-01-01

    The tumour suppressor p53 is mutated in cancer, including over 96% of high-grade serous ovarian cancer (HGSOC). Mutations cause loss of wild-type p53 function due to either gain of abnormal function of mutant p53 (mutp53), or absent to low mutp53. Massively parallel sequencing (MPS) enables increased accuracy of detection of somatic variants in heterogeneous tumours. We used MPS and immunohistochemistry (IHC) to characterise HGSOCs for TP53 mutation and p53 expression. TP53 mutation was identified in 94% (68/72) of HGSOCs, 62% of which were missense. Missense mutations demonstrated high p53 by IHC, as did 35% (9/26) of non-missense mutations. Low p53 was seen by IHC in 62% of HGSOC associated with non-missense mutations. Most wild-type TP53 tumours (75%, 6/8) displayed intermediate p53 levels. The overall sensitivity of detecting a TP53 mutation based on classification as ‘Low’, ‘Intermediate’ or ‘High’ for p53 IHC was 99%, with a specificity of 75%. We suggest p53 IHC can be used as a surrogate marker of TP53 mutation in HGSOC; however, this will result in misclassification of a proportion of TP53 wild-type and mutant tumours. Therapeutic targeting of mutp53 will require knowledge of both TP53 mutations and mutp53 expression. PMID:27189670

  16. The transcription-independent mitochondrial p53 program is a major contributor to nutlin-induced apoptosis in tumor cells

    PubMed Central

    Vaseva, Angelina V.; Marchenko, Natalia D.; Moll, Ute M.

    2010-01-01

    Strategies to induce p53 activation in tumors that retain wild-type p53 are promising for cancer therapy. Nutlin is a potent and selective pharmacological MDM2 inhibitor that competitively binds to its p53-binding pocket, thereby leading to non-genotoxic p53 stabilization and activation of growth arrest and apoptosis pathways. Nutlin-induced apoptosis is thought to occur via p53’s transcriptional program. Here we report that the transcription-independent mitochondrial p53 program plays an important role in Nutlin-induced p53-mediated tumor cell death. Aside from nuclear stabilization, Nutlin causes cytoplasmic p53 accumulation and translocation to mitochondria. Monoubiquitinated p53, originating from a distinct cytoplasmic pool, is the preferred p53 species that translocates to mitochondria in response to stress. Nutlin does not interfere with MDM2’s ability to monoubiquitinate p53, due to the fact that MDM2-p53 complexes are only partially disrupted and that Nutlin-stabilized MDM2 retains its E3 ubiquitin ligase activity. Nutlin-induced mitochondrial p53 translocation is rapid and associated with cytochrome C release that precedes induction of p53 target genes. Specific inhibition of mitochondrial p53 translocation by Pifithrin μ reduces the apoptotic Nutlin response by 2.5-fold, underlining the significance of p53’s mitochondrial program in Nutlin-induced apoptosis. Surprisingly, blocking the transcriptional arm of p53, either via α-Amanitin or the p53-specific transcriptional inhibitor Pifithrin α, not only fails to inhibit, but greatly potentiates Nutlin-induced apoptosis. In sum, the direct mitochondrial program is a major mechanism in Nutlin-induced p53-mediated apoptosis. Moreover, at least in some tumors the transcriptional p53 activities in net balance not only are dispensable for the apoptotic Nutlin response, but appear to actively block its therapeutic effect. PMID:19411846

  17. The transcription-independent mitochondrial p53 program is a major contributor to nutlin-induced apoptosis in tumor cells.

    PubMed

    Vaseva, Angelina V; Marchenko, Natalia D; Moll, Ute M

    2009-06-01

    Strategies to induce p53 activation in tumors that retain wild-type p53 are promising for cancer therapy. Nutlin is a potent and selective pharmacological MDM2 inhibitor that competitively binds to its p53-binding pocket, thereby leading to non-genotoxic p53 stabilization and activation of growth arrest and apoptosis pathways. Nutlin-induced apoptosis is thought to occur via p53's transcriptional program. Here we report that the transcription-independent mitochondrial p53 program plays an important role in Nutlin-induced p53-mediated tumor cell death. Aside from nuclear stabilization, Nutlin causes cytoplasmic p53 accumulation and translocation to mitochondria. Monoubiquitinated p53, originating from a distinct cytoplasmic pool, is the preferred p53 species that translocates to mitochondria in response to stress. Nutlin does not interfere with MDM2's ability to monoubiquitinate p53, due to the fact that MDM2-p53 complexes are only partially disrupted and that Nutlin-stabilized MDM2 retains its E3 ubiquitin ligase activity. Nutlin-induced mitochondrial p53 translocation is rapid and associated with cytochrome C release that precedes induction of p53 target genes. Specific inhibition of mitochondrial p53 translocation by Pifithrin mu reduces the apoptotic Nutlin response by 2.5-fold, underlining the significance of p53's mitochondrial program in Nutlin-induced apoptosis. Surprisingly, blocking the transcriptional arm of p53, either via alpha-Amanitin or the p53-specific transcriptional inhibitor Pifithrin alpha, not only fails to inhibit, but greatly potentiates Nutlin-induced apoptosis. In sum, the direct mitochondrial program is a major mechanism in Nutlin-induced p53-mediated apoptosis. Moreover, at least in some tumors the transcriptional p53 activities in net balance not only are dispensable for the apoptotic Nutlin response, but appear to actively block its therapeutic effect. PMID:19411846

  18. p53 Regulates Period2 Expression and the Circadian Clock

    PubMed Central

    Miki, Takao; Matsumoto, Tomoko; Zhao, Zhaoyang; Lee, Cheng Chi

    2013-01-01

    The mechanistic interconnectivity between circadian regulation and the genotoxic stress response remains poorly understood. Here we show that the expression of Period 2 (Per2), a circadian regulator, is directly regulated by p53 binding to a response element in the Per2 promoter. This p53 response element is evolutionarily conserved and overlaps with the E-Box element critical for BMAL1/CLOCK binding and its transcriptional activation of Per2 expression. Our studies reveal that p53 blocks BMAL1/CLOCK binding to the Per2 promoter leading to repression of Per2 expression. In the suprachiasmatic nucleus (SCN), p53 expression and its binding to the Per2 promoter are under circadian control. Per2 expression in the SCN is altered by p53 deficiency or stabilization of p53 by Nutlin-3. Behaviorally, p53−/− mice have a shorter period length that lacks stability and they exhibit impaired photo-entrainment to a light pulse under a free-running state. Our studies demonstrate that p53 modulates mouse circadian behavior. PMID:24051492

  19. p53 downregulates the Fanconi anaemia DNA repair pathway

    PubMed Central

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-01-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

  20. Mutation of p53 Tumor Suppressor Gene in Hepatocellular Carcinoma.

    PubMed

    Tullo, A; Sbisà, E

    2000-01-01

    In recent years, the most commonly observed genetic alteration in hepatocellular carcinoma (HCC), as in many other tumors affecting man, has been reported to be the mutation of the p53 coding gene (1,2). This gene has the features of a recessive oncosuppressor in its wild-type form and can be a dominant oncogene in its mutated form. The gene (20 kb) is located in a single copy on the short arm of chromosome 17 and contains 11 exons interrupted by 10 introns. The mRNA (2.8 kb) codes for a protein of 393 amino acids, which is expressed at relatively low levels in all tissues. p53 product is a 53-kDa phosphoprotein involved in the regulation of cell cycle, in DNA synthesis and repair, and in cell differentiation and apoptosis (see refs. 3-6, for reviews). PMID:21341051

  1. EBNA3C regulates p53 through induction of Aurora kinase B.

    PubMed

    Jha, Hem C; Yang, Karren; El-Naccache, Darine W; Sun, Zhiguo; Robertson, Erle S

    2015-03-20

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

  2. Lysines in the tetramerization domain of p53 selectively modulate G1 arrest.

    PubMed

    Beckerman, Rachel; Yoh, Kathryn; Mattia-Sansobrino, Melissa; Zupnick, Andrew; Laptenko, Oleg; Karni-Schmidt, Orit; Ahn, Jinwoo; Byeon, In-Ja; Keezer, Susan; Prives, Carol

    2016-06-01

    Functional in a tetrameric state, the protein product of the p53 tumor suppressor gene confers its tumor-suppressive activity by transactivating genes which promote cell-cycle arrest, senescence, or programmed cell death. How p53 distinguishes between these divergent outcomes is still a matter of considerable interest. Here we discuss the impact of 2 mutations in the tetramerization domain that confer unique properties onto p53. By changing lysines 351 and 357 to arginine, thereby blocking all post-translational modifications of these residues, DNA binding and transcriptional regulation by p53 remain virtually unchanged. On the other hand, by changing these lysines to glutamine (2KQ-p53), thereby neutralizing their positive charge and potentially mimicking acetylation, p53 is impaired in the induction of cell cycle arrest and yet can still effectively induce cell death. Surprisingly, when 2KQ-p53 is expressed at high levels in H1299 cells, it can bind to and transactivate numerous p53 target genes including p21, but not others such as miR-34a and cyclin G1 to the same extent as wild-type p53. Our findings show that strong induction of p21 is not sufficient to block H1299 cells in G1, and imply that modification of one or both of the lysines within the tetramerization domain may serve as a mechanism to shunt p53 from inducing cell cycle arrest. PMID:27210019

  3. Cancer therapeutic approach based on conformational stabilization of mutant p53 protein by small peptides

    PubMed Central

    Tal, Perry; Eizenberger, Shay; Cohen, Elad; Goldfinger, Naomi; Pietrokovski, Shmuel; Oren, Moshe; Rotter, Varda

    2016-01-01

    The p53 tumor suppressor serves as a major barrier against malignant transformation. Over 50% of tumors inactivate p53 by point mutations in its DNA binding domain. Most mutations destabilize p53 protein folding, causing its partial denaturation at physiological temperature. Thus a high proportion of human tumors overexpress a potential potent tumor suppressor in a non-functional, misfolded form. The equilibrium between the properly folded and misfolded states of p53 may be affected by molecules that interact with p53, stabilizing its native folding and restoring wild type p53 activity to cancer cells. To select for mutant p53 (mutp53) reactivating peptides, we adopted the phage display technology, allowing interactions between mutp53 and random peptide libraries presented on phages and enriching for phage that favor the correctly folded p53 conformation. We obtained a large database of potential reactivating peptides. Lead peptides were synthesized and analyzed for their ability to restore proper p53 folding and activity. Remarkably, many enriched peptides corresponded to known p53-binding proteins, including RAD9. Importantly, lead peptides elicited dramatic regression of aggressive tumors in mouse xenograft models. Such peptides might serve as novel agents for human cancer therapy. PMID:26943582

  4. Cytoplasmic CUL9/PARC ubiquitin ligase is a tumor suppressor and promotes p53-dependent apoptosis

    PubMed Central

    Pei, Xin-Hai; Bai, Feng; Li, Zhijun; Smith, Matthew D.; Whitewolf, Gabrielle; Jin, Ran; Xiong, Yue

    2011-01-01

    A wide range of cell stresses, including DNA damage, signal to p53 through post-translational modification of p53. The cytoplasmic functions of p53 are emerging as an important constituent of p53’s role in tumor suppression. Here we report that deletion of the Cul9 (formerly Parc) gene, which encodes an E3 ubiquitin ligase that binds to p53 and localizes in the cytoplasm, resulted in spontaneous tumor development, accelerated Eμ-Myc-induced lymphomagenesis and rendered mice susceptible to carcinogenesis. Cul9-p53 double mutant mice exhibited indistinguishable tumor phenotypes as p53 single mutant mice, indicating that the function of Cul9 in tumor suppression is largely mediated by p53. Deletion of Cul9 had no significant effect on cell cycle progression, but attenuated DNA damage-induced apoptosis. Ectopic expression of wild-type CUL9, but not a point mutant CUL9 deficient in p53 binding, promotes apoptosis. These results demonstrate CUL9 as a potential p53 activating E3 ligase in the cytoplasm. PMID:21487039

  5. Cancer therapeutic approach based on conformational stabilization of mutant p53 protein by small peptides.

    PubMed

    Tal, Perry; Eizenberger, Shay; Cohen, Elad; Goldfinger, Naomi; Pietrokovski, Shmuel; Oren, Moshe; Rotter, Varda

    2016-03-15

    The p53 tumor suppressor serves as a major barrier against malignant transformation. Over 50% of tumors inactivate p53 by point mutations in its DNA binding domain. Most mutations destabilize p53 protein folding, causing its partial denaturation at physiological temperature. Thus a high proportion of human tumors overexpress a potential potent tumor suppressor in a non-functional, misfolded form. The equilibrium between the properly folded and misfolded states of p53 may be affected by molecules that interact with p53, stabilizing its native folding and restoring wild type p53 activity to cancer cells. To select for mutant p53 (mutp53) reactivating peptides, we adopted the phage display technology, allowing interactions between mutp53 and random peptide libraries presented on phages and enriching for phage that favor the correctly folded p53 conformation. We obtained a large database of potential reactivating peptides. Lead peptides were synthesized and analyzed for their ability to restore proper p53 folding and activity. Remarkably, many enriched peptides corresponded to known p53-binding proteins, including RAD9. Importantly, lead peptides elicited dramatic regression of aggressive tumors in mouse xenograft models. Such peptides might serve as novel agents for human cancer therapy. PMID:26943582

  6. EBNA3C regulates p53 through induction of Aurora kinase B

    PubMed Central

    Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

    2015-01-01

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

  7. Reciprocal modulations between p53 and Tat of human immunodeficiency virus type 1.

    PubMed Central

    Li, C J; Wang, C; Friedman, D J; Pardee, A B

    1995-01-01

    Infection by human immunodeficiency virus type 1 (HIV-1) causes acquired immunodeficiency syndrome (AIDS) after a long clinical latency. This disease is associated with a spectrum of cancers. Here we report that wild-type p53 is a potent suppressor of Tat, a major transactivator of HIV-1. Reciprocally, Tat inhibits the transcription of p53. Downregulation of p53 by upregulated tat may be important for the establishment of productive viral infection in a cell and also may be involved in the development of AIDS-related malignancies. Images Fig. 2 Fig. 3 Fig. 4 PMID:7777531

  8. PPM1D phosphatase, a target of p53 and RBM38 RNA-binding protein, inhibits p53 mRNA translation via dephosphorylation of RBM38

    PubMed Central

    Zhang, Min; Xu, Enshun; Zhang, Jin; Chen, Xinbin

    2015-01-01

    PPM1D phosphatase, also called wild-type p53-induced phosphatase 1 (Wip1), promotes tumor development by inactivating the p53 tumor suppressor pathway. RBM38 RNA-binding protein, also called RNPC1 and a target of p53, inhibits p53 mRNA translation, which can be reversed by GSK3 protein kinase via phosphorylation of RBM38 at serine 195. Here we showed that ectopic expression of RBM38 increases, whereas knockdown of RBM38 inhibits, PPM1D mRNA translation. Consistent with this, we found that RBM38 directly binds to PPM1D 3' untranslated region (3’UTR) and promotes expression of a heterologous reporter gene that carries PPM1D 3’UTR in a dose-dependent manner. Interestingly, we showed that PPM1D directly interacts with and dephosphorylates RBM38 at serine 195. Furthermore, we showed that PPM1D modulates p53 mRNA translation and p53-dependent growth suppression through dephosphorylation of RBM38. These findings provide evidence that the crosstalk between PPM1D and RBM38, both of which are targets and modulators of p53, plays a critical role in p53 expression and activity. PMID:25823026

  9. Role of p16INK4A in Replicative Senescence and DNA Damage-Induced Premature Senescence in p53-Deficient Human Cells

    PubMed Central

    Mirzayans, Razmik; Andrais, Bonnie; Hansen, Gavin; Murray, David

    2012-01-01

    The p16INK4A (hereafter p16) tumor suppressor is encoded by the INK4A/ARF locus which is among the most commonly dysregulated sequences in human cancer. By inhibiting cyclin-dependent kinases, p16 activates the G1-S checkpoint, and this response is often considered to be critical for establishing a senescence-like growth arrest. Not all studies support a universal role for p16 in senescence. Single-cell analysis of noncancerous human fibroblast cultures undergoing senescence as a function of culture age (replicative senescence) has revealed that p16 is not expressed in the majority (>90%) of cells that exhibit features of senescence (e.g., flattened and enlarged morphology coupled with senescence-associated β-galactosidase expression), ruling out a requirement for p16 in this process. In addition, ionizing radiation triggers premature senescence in human cancer cell lines that do not express p16. These observations are made with cells that express wild-type p53, a key mediator of the DNA damage response. In this paper, we examine the growing evidence suggesting a negative regulatory relationship between p16 and p53 and discuss recent reports that implicate a role for p16 in replicative senescence and ionizing radiation-induced premature senescence in human cells that lack wild-type p53 function. PMID:22924132

  10. p53 activation contributes to patulin-induced nephrotoxicity via modulation of reactive oxygen species generation

    PubMed Central

    Jin, Huan; Yin, Shutao; Song, Xinhua; Zhang, Enxiang; Fan, Lihong; Hu, Hongbo

    2016-01-01

    Patulin is a major mycotoxin found in fungal contaminated fruits and their derivative products. Previous studies showed that patulin was able to induce increase of reactive oxygen species (ROS) generation and oxidative stress was suggested to play a pivotal role in patulin-induced multiple toxic signaling. The objective of the present study was to investigate the functional role of p53 in patulin-induced oxidative stress. Our study demonstrated that higher levels of ROS generation and DNA damage were induced in wild-type p53 cell lines than that found in either knockdown or knockout p53 cell lines in response to patulin exposure, suggesting p53 activation contributed to patulin-induced ROS generation. Mechanistically, we revealed that the pro-oxidant role of p53 in response to patulin was attributed to its ability to suppress catalase activity through up-regulation of PIG3. Moreover, these in vitro findings were further validated in the p53 wild-type/knockout mouse model. To the best of our knowledge, this is the first report addressing the functional role of p53 in patulin-induced oxidative stress. The findings of the present study provided novel insights into understanding mechanisms behind oxidative stress in response to patulin exposure. PMID:27071452

  11. Pathologies Associated with the p53 Response

    PubMed Central

    Gudkov, Andrei V.; Komarova, Elena A.

    2010-01-01

    Although p53 is a major cancer preventive factor, under certain extreme stress conditions it may induce severe pathologies. Analyses of animal models indicate that p53 is largely responsible for the toxicity of ionizing radiation or DNA damaging drugs contributing to hematopoietic component of acute radiation syndrome and largely determining severe adverse effects of cancer treatment. p53-mediated damage is strictly tissue specific and occurs in tissues prone to p53-dependent apoptosis (e.g., hematopoietic system and hair follicles); on the contrary, p53 can serve as a survival factor in tissues that respond to p53 activation by cell cycle arrest (e.g., endothelium of small intestine). There are multiple experimental indications that p53 contributes to pathogenicity of acute ischemic diseases. Temporary reversible suppression of p53 by small molecules can be an effective and safe approach to reduce severity of p53-associated pathologies. PMID:20595398

  12. Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury

    SciTech Connect

    Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.; Fu, Jian; Pinson, Barbara M.; Levin, Jeffrey; Shetty, Sreerama

    2015-03-01

    Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acute and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new role of

  13. Design, Synthesis and In Vitro Activity of Anticancer Styrylquinolines. The p53 Independent Mechanism of Action

    PubMed Central

    Mrozek-Wilczkiewicz, Anna; Rams-Baron, Marzena; Kryštof, Vladimír; Musiol, Robert

    2015-01-01

    A group of styrylquinolines were synthesized and tested for their anti-proliferative activity. Anti-proliferative activity was evaluated against the human colon carcinoma cell lines that had a normal expression of the p53 protein (HCT116 p53+/+) and mutants with a disabled TP53 gene (HCT116 p53-/-) and against the GM 07492 normal human fibroblast cell line. A SAR study revealed the importance of Cl and OH as substituents in the styryl moiety. Several of the compounds that were tested were found to have a marked anti-proliferative activity that was similar to or better than doxorubicin and were more active against the p53 null than the wild type cells. The cellular localization tests and caspase activity assays suggest a mechanism of action through the mitochondrial pathway of apoptosis in a p53-independent manner. The activity of the styrylquinoline compounds may be associated with their DNA intercalating ability. PMID:26599982

  14. Transcriptional regulation of mitotic checkpoint gene MAD1 by p53.

    PubMed

    Chun, Abel C S; Jin, Dong-Yan

    2003-09-26

    p53 regulates a number of genes through transcriptional activation and repression. p53-dependent mitotic checkpoint has been described, but the underlying mechanism is still obscure. Here we examined the effect of p53 on the expression of a human mitotic checkpoint protein, Mitosis Arrest Deficiency 1 (MAD1), in cultured human cells. The expression of MAD1 was reduced when the cells were overexpressing exogenously introduced wild-type p53. The same reduction was also observed when the cells were treated with anticancer agents 5-fluorouracil and cisplatin or were irradiated with UV. Consistently, MAD1 promoter activity diminished in a dose-dependent manner when induced by p53, indicating that p53 repressed MAD1 at a transcriptional level. Intriguingly, several tumor hot spot mutations in p53 (V143A, R175H, R248W, and R273H) did not abolish the ability of p53 to repress MAD1 expression. By serial truncation of the MAD1 promoter, we confined the p53-responsive element to a 38-bp region that represents a novel sequence distinct from the known p53 consensus binding site. Trichostatin A, a histone deacetylase inhibitor, relieved the p53 transrepression activity on MAD1. Chromatin immunoprecipitation assay revealed that p53, histone deacetylase 1, and co-repressor mSin3a associated with the MAD1 promoter in vivo. Taken together, our findings suggest a regulatory mechanism for the mitotic checkpoint in which MAD1 is inhibited by p53. PMID:12876282

  15. p53 Protein-mediated regulation of phosphoglycerate dehydrogenase (PHGDH) is crucial for the apoptotic response upon serine starvation.

    PubMed

    Ou, Yang; Wang, Shang-Jui; Jiang, Le; Zheng, Bin; Gu, Wei

    2015-01-01

    Although p53 is frequently mutated in human cancers, about 80% of human melanomas retain wild-type p53. Here we report that PHGDH, the key metabolic enzyme that catalyzes the rate-limiting step of the serine biosynthesis pathway, is a target of p53 in human melanoma cells. p53 suppresses PHGDH expression and inhibits de novo serine biosynthesis. Notably, upon serine starvation, p53-mediated cell death is enhanced dramatically in response to Nutlin-3 treatment. Moreover, PHGDH has been found recently to be amplified frequently in human melanomas. We found that PHGDH overexpression significantly suppresses the apoptotic response, whereas RNAi-mediated knockdown of endogenous PHGDH promotes apoptosis under the same treatment. These results demonstrate an important role of p53 in regulating the serine biosynthesis pathway through suppressing PHGDH expression and reveal serine deprivation as a novel approach to sensitize p53-mediated apoptotic responses in human melanoma cells. PMID:25404730

  16. Genetic and immunochemical analysis of mutant p53 in human breast cancer cell lines.

    PubMed

    Bartek, J; Iggo, R; Gannon, J; Lane, D P

    1990-06-01

    The expression of the tumour suppressor gene p53 was analysed in 11 human breast cancer cell lines by immunohistochemistry, immunoprecipitation and cDNA sequencing. We used a panel of anti-p53 monoclonal antibodies for cell staining and found abnormalities in every case. Eight of the cell lines produce a form of p53 which can be immunoprecipitated by the monoclonal antibody PAb240 but not by PAb1620. In the murine system PAb240 only immunoprecipitates mutant p53. We sequenced p53 cDNA directly from four of the PAb240 positive cell lines using asymmetric PCR templates. All four contained missense mutations in p53 RNA, with no detectable expression of the wild type sequence. Different residues were affected in each cell line, but all the mutations changed amino acids conserved from man to Xenopus. These results imply that as in the murine system, the PAb240 antibody reliably detects a wide variety of p53 mutations and that these mutations have a common effect on the structure of p53. Immunohistochemical data suggest that p53 mutation is the commonest genetic alteration so far detected in primary breast cancer. PMID:1694291

  17. MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis

    PubMed Central

    2013-01-01

    Background Tumor suppressor p53 is mutated in a wide variety of human cancers and plays a critical role in anoikis, which is essential for preventing tumorigenesis. Recently, we found that a nucleolar protein, Myb-binding protein 1a (MYBBP1A), was involved in p53 activation. However, the function of MYBBP1A in cancer prevention has not been elucidated. Methods Relationships between MYBBP1A expression levels and breast cancer progression were examined using patient microarray databases and tissue microarrays. Colony formation, xenograft, and anoikis assays were conducted using cells in which MYBBP1A was either knocked down or overexpressed. p53 activation and interactions between p53 and MYBBP1A were assessed by immunoprecipitation and western blot. Results MYBBP1A expression was negatively correlated with breast cancer tumorigenesis. In vivo and in vitro experiments using the breast cancer cell lines MCF-7 and ZR-75-1, which expresses wild type p53, showed that tumorigenesis, colony formation, and anoikis resistance were significantly enhanced by MYBBP1A knockdown. We also found that MYBBP1A binds to p53 and enhances p53 target gene transcription under anoikis conditions. Conclusions These results suggest that MYBBP1A is required for p53 activation during anoikis; therefore, it is involved in suppressing colony formation and the tumorigenesis of breast cancer cells. Collectively, our results suggest that MYBBP1A plays a role in tumor prevention in the context of p53 activation. PMID:23388179

  18. Allele Specific p53 Mutant Reactivation

    PubMed Central

    Yu, Xin; Vazquez, Alexei; Levine, Arnold J.; Carpizo, Darren R.

    2012-01-01

    Summary Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Using the NCI anticancer drug screen data, we identified two compounds from the thiosemicarbazone family that manifest increased growth inhibitory activity in mutant p53 cells, particularly for the p53R175 mutant. Mechanistic studies reveal that NSC319726 restores WT structure and function to the p53R175 mutant. This compound kills p53R172H knock-in mice with extensive apoptosis and inhibits xenograft tumor growth in a 175-allele specific mutant p53 dependent manner. This activity depends upon the zinc ion chelating properties of the compound as well as redox changes. These data identify NSC319726 as a p53R175 mutant reactivator and as a lead compound for p53 targeted drug development. PMID:22624712

  19. Prospective therapeutic applications of p53 inhibitors

    SciTech Connect

    Gudkov, Andrei V. . E-mail: gudkov@ccf.org; Komarova, Elena A.

    2005-06-10

    p53, in addition to being a key cancer preventive factor, is also a determinant of cancer treatment side effects causing excessive apoptotic death in several normal tissues during cancer therapy. p53 inhibitory strategy has been suggested to protect normal tissues from chemo- and radiotherapy, and to treat other pathologies associated with stress-mediated activation of p53. This strategy was validated by isolation and testing of small molecule p53 inhibitor pifithrin-{alpha} that demonstrated broad tissue protecting capacity. However, in some normal tissues and tumors p53 plays protective role by inducing growth arrest and preventing cells from premature entrance into mitosis and death from mitotic catastrophe. Inhibition of this function of p53 can sensitize tumor cells to chemo- and radiotherapy, thus opening new potential application of p53 inhibitors and justifying the need in pharmacological agents targeting specifically either pro-apoptotic or growth arrest functions of p53.

  20. Rodent p53 suppresses the transforming activity of the activated Neu oncogene by modulating the Basal promoter activity of Neu.

    PubMed

    Matin, A; Xie, Y; Kao, M; Hung, M

    1995-05-01

    The rat neu oncogene encodes a dominant transforming oncogene. The mouse wild-type p53 suppresses the transforming activity of the neu oncogene while different p53 mutants demonstrate varying ability to repress neu-induced transformation. Suppression of neu-transforming activity is due to inhibition of transcription. Deletion analysis of the rat neu promoter shows that p53 represses the basal promoter activity of neu. Therefore, rodent p53 suppresses the transforming potential of neu by inhibiting transcription from the basal promoter of neu. PMID:21556644

  1. Pla2g16 phospholipase mediates gain-of-function activities of mutant p53.

    PubMed

    Xiong, Shunbin; Tu, Huolin; Kollareddy, Madhusudhan; Pant, Vinod; Li, Qin; Zhang, Yun; Jackson, James G; Suh, Young-Ah; Elizondo-Fraire, Ana C; Yang, Peirong; Chau, Gilda; Tashakori, Mehrnoosh; Wasylishen, Amanda R; Ju, Zhenlin; Solomon, Hilla; Rotter, Varda; Liu, Bin; El-Naggar, Adel K; Donehower, Lawrence A; Martinez, Luis Alfonso; Lozano, Guillermina

    2014-07-29

    p53(R172H/+) mice inherit a p53 mutation found in Li-Fraumeni syndrome and develop metastatic tumors at much higher frequency than p53(+/-) mice. To explore the mutant p53 metastatic phenotype, we used expression arrays to compare primary osteosarcomas from p53(R172H/+) mice with metastasis to osteosarcomas from p53(+/-) mice lacking metastasis. For this study, 213 genes were differentially expressed with a P value <0.05. Of particular interest, Pla2g16, which encodes a phospholipase that catalyzes phosphatidic acid into lysophosphatidic acid and free fatty acid (both implicated in metastasis), was increased in p53(R172H/+) osteosarcomas. Functional analyses showed that Pla2g16 knockdown decreased migration and invasion in mutant p53-expressing cells, and vice versa: overexpression of Pla2g16 increased the invasion of p53-null cells. Furthermore, Pla2g16 levels were increased upon expression of mutant p53 in both mouse and human osteosarcoma cell lines, indicating that Pla2g16 is a downstream target of the mutant p53 protein. ChIP analysis revealed that several mutant p53 proteins bind the Pla2g16 promoter at E26 transformation-specific (ETS) binding motifs and knockdown of ETS2 suppressed mutant p53 induction of Pla2g16. Thus, our study identifies a phospholipase as a transcriptional target of mutant p53 that is required for metastasis. PMID:25024203

  2. Transcriptional activation by p53 of the human type IV collagenase (gelatinase A or matrix metalloproteinase 2) promoter.

    PubMed Central

    Bian, J; Sun, Y

    1997-01-01

    p53, a tumor suppressor and a transcription factor, has been shown to transcriptionally activate the expression of a number of important genes involved in the regulation of cell growth, DNA damage, angiogenesis, and apoptosis. In a computer search for other potential p53 target genes, we identified a perfect p53 binding site in the promoter of the human type IV collagenase (also called 72-kDa gelatinase or matrix metalloproteinase 2 [MMP-2]) gene. This p53 binding site was found to specifically bind to p53 protein in a gel shift assay. Transcription assays with luciferase reporters driven by the promoter or enhancer of the type IV collagenase gene revealed that (i) activation of the promoter activity is p53 binding site dependent in p53-positive cells but not in p53-negative cells and (ii) wild-type p53, but not p53 mutants commonly found in human cancers, transactivates luciferase expression driven by the type IV collagenase promoter as well as by a p53 site-containing enhancer element in the promoter. Significantly, expression of the endogenous type IV collagenase is also under the control of p53. Treatment of U2-OS cells, a wild-type p53-containing osteogenic sarcoma line, with a common p53 inducer, etoposide, induced p53 DNA binding and transactivation activities in a time-dependent manner. Induction of type IV collagenase expression followed the p53 activation pattern. No induction of type IV collagenase expression can be detected under the same experimental conditions in p53-negative Saos-2 cells. All these in vitro and in vivo assays strongly suggest that the type IV collagenase gene is a p53 target gene and that its expression is subject to p53 regulation. Our finding links p53 to a member of the MMP genes, a family of genes implicated in trophoblast implantation, wound healing, angiogenesis, arthritis, and tumor cell invasion. p53 may regulate these processes by upregulating expression of type IV collagenase. PMID:9343394

  3. Cisplatin modulates B-cell translocation gene 2 to attenuate cell proliferation of prostate carcinoma cells in both p53-dependent and p53-independent pathways.

    PubMed

    Chiang, Kun-Chun; Tsui, Ke-Hung; Chung, Li-Chuan; Yeh, Chun-Nan; Feng, Tsui-Hsia; Chen, Wen-Tsung; Chang, Phei-Lang; Chiang, Hou-Yu; Juang, Horng-Heng

    2014-01-01

    Cisplatin is a widely used anti-cancer drug. The B-cell translocation gene 2 (BTG2) is involved in the cell cycle transition regulation. We evaluated the cisplatin effects on prostate cancer cell proliferation and the expressions of BTG2, p53, androgen receptor (AR) and prostate specific antigen (PSA) in prostate carcinoma, p53 wild-type LNCaP or p53-null PC-3, cells. Cisplatin treatments attenuated cell prostate cancer cell growth through inducing Go/G1 cell cycle arrest in lower concentration and apoptosis at higher dosage. Cisplatin treatments enhanced p53 and BTG2 expression, repressed AR and PSA expression, and blocked the activation of androgen on the PSA secretion in LNCaP cells. BTG2 knockdown in LNCaP cells attenuated cisplatin-mediated growth inhibition. Cisplatin enhanced BTG2 gene expression dependent on the DNA fragment located within -173 to -82 upstream of BTG2 translation initiation site in prostate cancer cells. Mutation of the p53 response element from GGGCAGAGCCC to GGGCACC or mutation of the NFκB response element from GGAAAGTCC to GGAAAGGAA by site-directed mutagenesis abolished the stimulation of cisplatin on the BTG2 promoter activity in LNCaP or PC-3 cells, respectively. Our results indicated that cisplatin attenuates prostate cancer cell proliferation partly mediated by upregulation of BTG2 through the p53-dependent pathway or p53-independent NFκB pathway. PMID:24981574

  4. Cisplatin modulates B-cell translocation gene 2 to attenuate cell proliferation of prostate carcinoma cells in both p53-dependent and p53-independent pathways

    PubMed Central

    Chiang, Kun-Chun; Tsui, Ke-Hung; Chung, Li-Chuan; Yeh, Chun-Nan; Feng, Tsui-Hsia; Chen, Wen-Tsung; Chang, Phei-Lang; Chiang, Hou-Yu; Juang, Horng-Heng

    2014-01-01

    Cisplatin is a widely used anti-cancer drug. The B-cell translocation gene 2 (BTG2) is involved in the cell cycle transition regulation. We evaluated the cisplatin effects on prostate cancer cell proliferation and the expressions of BTG2, p53, androgen receptor (AR) and prostate specific antigen (PSA) in prostate carcinoma, p53 wild-type LNCaP or p53-null PC-3, cells. Cisplatin treatments attenuated cell prostate cancer cell growth through inducing Go/G1 cell cycle arrest in lower concentration and apoptosis at higher dosage. Cisplatin treatments enhanced p53 and BTG2 expression, repressed AR and PSA expression, and blocked the activation of androgen on the PSA secretion in LNCaP cells. BTG2 knockdown in LNCaP cells attenuated cisplatin-mediated growth inhibition. Cisplatin enhanced BTG2 gene expression dependent on the DNA fragment located within -173 to -82 upstream of BTG2 translation initiation site in prostate cancer cells. Mutation of the p53 response element from GGGCAGAGCCC to GGGCACC or mutation of the NFκB response element from GGAAAGTCC to GGAAAGGAA by site-directed mutagenesis abolished the stimulation of cisplatin on the BTG2 promoter activity in LNCaP or PC-3 cells, respectively. Our results indicated that cisplatin attenuates prostate cancer cell proliferation partly mediated by upregulation of BTG2 through the p53-dependent pathway or p53-independent NFκB pathway. PMID:24981574

  5. Comparison of Effects of p53 Null and Gain-of-Function Mutations on Salivary Tumors in MMTV-Hras Transgenic Mice

    PubMed Central

    Jiang, Dadi; Dumur, Catherine I.; Massey, H. Davis; Ramakrishnan, Viswanathan; Subler, Mark A.; Windle, Jolene J.

    2015-01-01

    p53 is an important tumor suppressor gene which is mutated in ~50% of all human cancers. Some of these mutants appear to have acquired novel functions beyond merely losing wild-type functions. To investigate these gain-of-function effects in vivo, we generated mice of three different genotypes: MMTV-Hras/p53+/+, MMTV-Hras/p53-/-, and MMTV-Hras/p53R172H/R172H. Salivary tumors from these mice were characterized with regard to age of tumor onset, tumor growth rates, cell cycle distribution, apoptotic levels, tumor histopathology, as well as response to doxorubicin treatment. Microarray analysis was also performed to profile gene expression. The MMTV-Hras/p53-/- and MMTV-Hras/p53R172H/R172H mice displayed similar properties with regard to age of tumor onset, tumor growth rates, tumor histopathology, and response to doxorubicin, while both groups were clearly distinct from the MMTV-Hras/p53+/+ mice by these measurements. In addition, the gene expression profiles of the MMTV-Hras/p53-/- and MMTV-Hras/p53R172H/R172H tumors were tightly clustered, and clearly distinct from the profiles of the MMTV-Hras/p53+/+ tumors. Only a small group of genes showing differential expression between the MMTV-Hras/p53-/- and MMTV-Hras/p53R172H/R172H tumors, that did not appear to be regulated by wild-type p53, were identified. Taken together, these results indicate that in this MMTV-Hras-driven salivary tumor model, the major effect of the p53 R172H mutant is due to the loss of wild-type p53 function, with little or no gain-of-function effect on tumorigenesis, which may be explained by the tissue- and tumor type-specific properties of this gain-of-function mutant of p53. PMID:25695772

  6. Targeted deletion of p53 in the proximal tubule prevents ischemic renal injury.

    PubMed

    Ying, Yuan; Kim, Jinu; Westphal, Sherry N; Long, Kelly E; Padanilam, Babu J

    2014-12-01

    The contribution of p53 to kidney dysfunction, inflammation, and tubular cell death, hallmark features of ischemic renal injury (IRI), remains undefined. Here, we studied the role of proximal tubule cell (PTC)-specific p53 activation on the short- and long-term consequences of renal ischemia/reperfusion injury in mice. After IRI, mice with PTC-specific deletion of p53 (p53 knockout [KO]) had diminished whole-kidney expression levels of p53 and its target genes, improved renal function, which was shown by decreased plasma levels of creatinine and BUN, and attenuated renal histologic damage, oxidative stress, and infiltration of neutrophils and macrophages compared with wild-type mice. Notably, necrotic cell death was attenuated in p53 KO ischemic kidneys as well as oxidant-injured p53-deficient primary PTCs and pifithrin-α-treated PTC lines. Reduced oxidative stress and diminished expression of PARP1 and Bax in p53 KO ischemic kidneys may account for the decreased necrosis. Apoptosis and expression of proapoptotic p53 targets, including Bid and Siva, were also significantly reduced, and cell cycle arrest at the G2/M phase was attenuated in p53 KO ischemic kidneys. Furthermore, IRI-induced activation of TGF-β and the long-term development of inflammation and interstitial fibrosis were significantly reduced in p53 KO mice. In conclusion, specific deletion of p53 in the PTC protects kidneys from functional and histologic deterioration after IRI by decreasing necrosis, apoptosis, and inflammation and modulates the long-term sequelae of IRI by preventing interstitial fibrogenesis. PMID:24854277

  7. CD4+ T cell responses to self- and mutated p53 determinants during tumorigenesis in mice.

    PubMed

    Fedoseyeva, E V; Boisgérault, F; Anosova, N G; Wollish, W S; Arlotta, P; Jensen, P E; Ono, S J; Benichou, G

    2000-06-01

    We analyzed CD4+ T helper responses to wild-type (wt) and mutated (mut) p53 protein in normal and tumor-bearing mice. In normal mice, we observed that although some self-p53 determinants induced negative selection of p53-reactive CD4+ T cells, other p53 determinants (cryptic) were immunogenic. Next, BALB/c mice were inoculated with J774 syngeneic tumor cell line expressing mut p53. BALB/c tumor-bearing mice mounted potent CD4+ T cell responses to two formerly cryptic peptides on self-p53. This response was characterized by massive production of IL-5, a Th2-type lymphokine. Interestingly, we found that T cell response was induced by different p53 peptides depending upon the stage of cancer. Mut p53 gene was shown to contain a single mutation resulting in the substitution of a tyrosine by a histidine at position 231 of the protein. Two peptides corresponding to wt and mutated sequences of this region were synthesized. Both peptides bound to the MHC class II-presenting molecule (Ed) with similar affinities. However, only mut p53.225-239 induced T cell responses in normal BALB/c mice, a result strongly suggesting that high-affinity wt p53.225-239 autoreactive T cells had been eliminated in these mice. Surprisingly, CD4+ T cell responses to both mut and wt p53.225-239 peptides were recorded in J774 tumor-bearing mice, a phenomenon attributed to the recruitment of low-avidity p53.225-239 self-reactive T cells. PMID:10820239

  8. Peroxisomes in wild-type and rosy mutant Drosophila melanogaster.

    PubMed Central

    Beard, M E; Holtzman, E

    1987-01-01

    This study shows that peroxisomes are abundant in the Malpighian tubule and gut of wild-type Oregon R Drosophila melanogaster and that the peroxisomal population of the rosy-506 eye-color mutant differs from that of the wild type. Catalase activity in wild-type flies is demonstrable in bodies of appearance and centrifugal behavior comparable to the peroxisomes of vertebrate tissues. Xanthine oxidase (xanthine:oxygen oxidoreductase, EC 1.1.3.22) activity of the Malpighian tubule of wild-type flies is demonstrable cytochemically in bodies like those containing catalase. The rosy-506 mutant flies, with a deletion in the structural gene for xanthine dehydrogenase (xanthine:NAD+ oxidoreductase, EC 1.1.1.204), lack cytochemically demonstrable peroxisomal xanthine oxidase activity. In addition, peroxisomes in the rosy-506 mutants show less intense cytochemical staining for catalase than those in wild-type flies, and biochemical assays indicate that catalase in the rosy mutant is much more accessible to substrate in the absence of detergent than in the wild type. Thus, the rosy-506 mutation appears to affect peroxisomes and may mimic aspects of the defects of peroxisomes in some human metabolic disorders. Images PMID:3118368

  9. Zinc supplementation augments in vivo antitumor effect of chemotherapy by restoring p53 function.

    PubMed

    Margalit, Ofer; Simon, Amos J; Yakubov, Eduard; Puca, Rosa; Yosepovich, Ady; Avivi, Camila; Jacob-Hirsch, Jasmine; Gelernter, Ilana; Harmelin, Alon; Barshack, Iris; Rechavi, Gideon; D'Orazi, Gabriella; Givol, David; Amariglio, Ninette

    2012-08-15

    Activated p53 is necessary for tumor suppression. Homeodomain-interacting protein kinase-2 (HIPK2) is a positive regulator of functional p53. HIPK2 modulates wild-type p53 activity toward proapoptotic transcription and tumor suppression by the phosphorylation of serine 46. Knock-down of HIPK2 interferes with tumor suppression and sensitivity to chemotherapy. Combined administration of adriamycin and zinc restores activity of misfolded p53 and enables the induction of its proapoptotic and tumor suppressor functions in vitro and in vivo. We therefore looked for a cancer model where HIPK2 expression is low. MMTV-neu transgenic mice overexpressing HER2/neu, develop mammary tumors at puberty with a long latency, showing very low expression of HIPK2. Here we show that whereas these tumors are resistant to adriamycin treatment, a combination of adriamycin and zinc suppresses tumor growth in vivo in these mice, an effect evidenced by the histological features of the mammary tumors. The combined treatment of adriamycin and zinc also restores wild-type p53 conformation and induces proapoptotic transcription activity. These findings may open up new possibilities for the treatment of human cancers via the combination of zinc with chemotherapeutic agents, for a selected group of patients expressing low levels of HIPK2, with an intact p53. In addition, HIPK2 may serve as a new biomarker for tumor aggressiveness. PMID:21932419

  10. In vivo activation of the p53 tumor suppressor pathway by an engineered cyclotide

    PubMed Central

    Neamati, Nouri; Shekhtman, Alexander; Camarero, Julio A.

    2013-01-01

    The overexpression of Hdm2 and HdmX is a common mechanism used by many tumor cells to inactive the p53 tumor suppressor pathway promoting cell survival. Targeting Hdm2 and HdmX has emerged as a validated therapeutic strategy for treating cancers with wild-type p53. Small linear peptides mimicking the N-terminal fragment of p53 have been shown to be potent Hdm2/HdmX antagonists. The potential therapeutic use of these peptides, however, is limited by their poor stability and bioavailability. Here, we report the engineering of the cyclotide MCoTI-I to efficiently antagonize intracellular p53 degradation. The resulting cyclotide MCo-PMI was able to bind with low nanomolar affinity to both Hdm2 and HdmX, showed high stability in human serum and was cytotoxic to wild-type p53 cancer cell lines by activating the p53 tumor suppressor pathway both in vitro and in vivo. These features make the cyclotide MCoTI-I an optimal scaffold for targeting intracellular protein-protein interactions. PMID:23848581

  11. MIF Maintains the Tumorigenic Capacity of Brain Tumor-Initiating Cells by Directly Inhibiting p53.

    PubMed

    Fukaya, Raita; Ohta, Shigeki; Yaguchi, Tomonori; Matsuzaki, Yumi; Sugihara, Eiji; Okano, Hideyuki; Saya, Hideyuki; Kawakami, Yutaka; Kawase, Takeshi; Yoshida, Kazunari; Toda, Masahiro

    2016-05-01

    Tumor-initiating cells thought to drive brain cancer are embedded in a complex heterogeneous histology. In this study, we isolated primary cells from 21 human brain tumor specimens to establish cell lines with high tumorigenic potential and to identify the molecules enabling this capability. The morphology, sphere-forming ability upon expansion, and differentiation potential of all cell lines were indistinguishable in vitro However, testing for tumorigenicity revealed two distinct cell types, brain tumor-initiating cells (BTIC) and non-BTIC. We found that macrophage migration inhibitory factor (MIF) was highly expressed in BTIC compared with non-BTIC. MIF bound directly to both wild-type and mutant p53 but regulated p53-dependent cell growth by different mechanisms, depending on glioma cell line and p53 status. MIF physically interacted with wild-type p53 in the nucleus and inhibited its transcription-dependent functions. In contrast, MIF bound to mutant p53 in the cytoplasm and abrogated transcription-independent induction of apoptosis. Furthermore, MIF knockdown inhibited BTIC-induced tumor formation in a mouse xenograft model, leading to increased overall survival. Collectively, our findings suggest that MIF regulates BTIC function through direct, intracellular inhibition of p53, shedding light on the molecular mechanisms underlying the tumorigenicity of certain malignant brain cells. Cancer Res; 76(9); 2813-23. ©2016 AACR. PMID:26980763

  12. A new genotoxicity assay based on p53 target gene induction.

    PubMed

    Zerdoumi, Y; Kasper, E; Soubigou, F; Adriouch, S; Bougeard, G; Frebourg, T; Flaman, J-M

    2015-08-01

    The p53 tumor suppressor protein has emerged as a universal sensor of genotoxic stress that regulates the transcription of numerous genes required for appropriate cellular response to DNA damage. Therefore, transcriptional induction of p53 target genes can be considered as a global and early indicator of genotoxic stress. By performing expression microarrays and RNA-Seq analysis on wild-type and mutant TP53 human lymphocytes respectively derived from controls and Li-Fraumeni patients and exposed to different classes of genotoxic agents, we first determined a common p53-dependent transcriptional signature of DNA damage. We then derived a simple and fast assay based on the exposure of wild-type TP53 lymphocytes to physical or chemical agents and on the quantitative measurement of selected p53 target gene transcriptional induction. The specificity of the p53 genotoxicity assay can easily be demonstrated by performing the same experiment in control lymphocytes with heterozygous TP53 mutations, which compromise responses to DNA damage. This assay allowed us to show that most of the drugs commonly used in cancer treatment, except the microtubule poisons, are highly genotoxic. The p53 genotoxicity assay should facilitate the measurement of the genotoxic effects of chemical and physical agents and the identification of drugs that are not genotoxic and do not expose patients to the risk of secondary malignancies, especially those with a constitutional defect in response to DNA damage, such as patients with Li-Fraumeni syndrome. PMID:26232255

  13. Expanding the prion concept to cancer biology: dominant-negative effect of aggregates of mutant p53 tumour suppressor

    PubMed Central

    Silva, Jerson L.; Rangel, Luciana P.; Costa, Danielly C. F.; Cordeiro, Yraima; De Moura Gallo, Claudia V.

    2013-01-01

    p53 is a key protein that participates in cell-cycle control, and its malfunction can lead to cancer. This tumour suppressor protein has three main domains; the N-terminal transactivation domain, the CTD (C-terminal domain) and the core domain (p53C) that constitutes the sequence-specific DBD (DNA-binding region). Most p53 mutations related to cancer development are found in the DBD. Aggregation of p53 into amyloid oligomers and fibrils has been shown. Moreover, amyloid aggregates of both the mutant and WT (wild-type) forms of p53 were detected in tumour tissues. We propose that if p53 aggregation occurred, it would be a crucial aspect of cancer development, as p53 would lose its WT functions in an aggregated state. Mutant p53 can also exert a dominant-negative regulatory effect on WT p53. Herein, we discuss the dominant-negative effect in light of p53 aggregation and the fact that amyloid-like mutant p53 can convert WT p53 into more aggregated species, leading into gain of function in addition to the loss of tumour suppressor function. In summary, the results obtained in the last decade indicate that cancer may have characteristics in common with amyloidogenic and prion diseases. PMID:24003888

  14. Development of a mechanistically-based genetically engineered PC12 cell system to detect p53-mediated cytotoxicity.

    PubMed

    van Vliet, Erwin; Eskes, Chantra; Stingele, Silvia; Gartlon, Joanne; Price, Anna; Farina, Massimo; Ponti, Jessica; Hartung, Thomas; Sabbioni, Enrico; Coecke, Sandra

    2007-06-01

    The human wild type p53 gene, key for apoptosis, was introduced into the pheochromocytoma (PC12) cell line, to create a mechanistically-based in vitro test model for the detection of p53-mediated toxicity. Expression of the wt p53 gene was regulated by a system, which allowed or blocked expression p53 by absence or presence of tetracycline in the culture media. Western blot analyses confirmed an inducible and tetracycline-dependent expression of the wt p53 protein. Functionality of the p53 protein was verified by camptothecin treatment, known to induce p53-dependent apoptosis. Results showed that p53-expressing cells were significantly more sensitive to camptothecin induced cytotoxicity compared to non-expressing cells, and presented a significantly higher incidence of apoptosis. A screening study on 31 metal compounds, showed that the classified human carcinogens (NaAsO2, CdSO4 .8H2O, Na2CrO4 .4H2O, MnCl2, (NH4)2PtCl6) significantly increased cytotoxicity in p53-expressing cells compared to non-expressing cells, suggesting that their cytotoxicity was p53-mediated. Finally, acute and subchronic treatment with methyl mercury showed no significant differences in cytotoxicity and the percentage of apoptosis or necrosis between p53-expressing and non-expressing differentiated cells, suggesting that methyl mercury cytotoxicity was p53-independent. PMID:17258428

  15. Functional analysis of the p53 pathway in neuroblastoma cells using the small-molecule MDM2 antagonist nutlin-3.

    PubMed

    Van Maerken, Tom; Rihani, Ali; Dreidax, Daniel; De Clercq, Sarah; Yigit, Nurten; Marine, Jean-Christophe; Westermann, Frank; De Paepe, Anne; Vandesompele, Jo; Speleman, Frank

    2011-06-01

    Suppression of p53 activity is essential for proliferation and survival of tumor cells. A direct p53-activating compound, nutlin-3, was used in this study, together with p53 mutation analysis, to characterize p53 pathway defects in a set of 34 human neuroblastoma cell lines. We identified 9 cell lines (26%) with a p53 loss-of-function mutation, including 6 missense mutations, 1 nonsense mutation, 1 in-frame deletion, and 1 homozygous deletion of the 3' end of the p53 gene. Sensitivity to nutlin-3 was highly predictive of absence of p53 mutation. Signaling pathways downstream of p53 were functionally intact in 23 of 25 cell lines with wild-type p53. Knockdown and overexpression experiments revealed a potentiating effect of p14(ARF) expression on the response of neuroblastoma cells to nutlin-3. Our findings shed light on the spectrum of p53 pathway lesions in neuroblastoma cells, indicate that defects in effector molecules downstream of p53 are remarkably rare in neuroblastoma, and identify p14(ARF) as a determinant of the outcome of the response to MDM2 inhibition. These insights may prove useful for the clinical translation of evolving strategies aimed at p53 reactivation and for the development of new therapeutic approaches. PMID:21460101

  16. Cadmium Induces p53-Dependent Apoptosis in Human Prostate Epithelial Cells

    PubMed Central

    Aimola, Pierpaolo; Carmignani, Marco; Volpe, Anna Rita; Di Benedetto, Altomare; Claudio, Luigi; Waalkes, Michael P.; van Bokhoven, Adrie; Tokar, Erik J.; Claudio, Pier Paolo

    2012-01-01

    Cadmium, a widespread toxic pollutant of occupational and environmental concern, is a known human carcinogen. The prostate is a potential target for cadmium carcinogenesis, although the underlying mechanisms are still unclear. Furthermore, cadmium may induce cell death by apoptosis in various cell types, and it has been hypothesized that a key factor in cadmium-induced malignant transformation is acquisition of apoptotic resistance. We investigated the in vitro effects produced by cadmium exposure in normal or tumor cells derived from human prostate epithelium, including RWPE-1 and its cadmium-transformed derivative CTPE, the primary adenocarcinoma 22Rv1 and CWR-R1 cells and LNCaP, PC-3 and DU145 metastatic cancer cell lines. Cells were treated for 24 hours with different concentrations of CdCl2 and apoptosis, cell cycle distribution and expression of tumor suppressor proteins were analyzed. Subsequently, cellular response to cadmium was evaluated after siRNA-mediated p53 silencing in wild type p53-expressing RWPE-1 and LNCaP cells, and after adenoviral p53 overexpression in p53-deficient DU145 and PC-3 cell lines. The cell lines exhibited different sensitivity to cadmium, and 24-hour exposure to different CdCl2 concentrations induced dose- and cell type-dependent apoptotic response and inhibition of cell proliferation that correlated with accumulation of functional p53 and overexpression of p21 in wild type p53-expressing cell lines. On the other hand, p53 silencing was able to suppress cadmium-induced apoptosis. Our results demonstrate that cadmium can induce p53-dependent apoptosis in human prostate epithelial cells and suggest p53 mutation as a possible contributing factor for the acquisition of apoptotic resistance in cadmium prostatic carcinogenesis. PMID:22448262

  17. Sodium orthovanadate inhibits p53-mediated apoptosis.

    PubMed

    Morita, Akinori; Yamamoto, Shinichi; Wang, Bing; Tanaka, Kaoru; Suzuki, Norio; Aoki, Shin; Ito, Azusa; Nanao, Tomohisa; Ohya, Soichiro; Yoshino, Minako; Zhu, Jin; Enomoto, Atsushi; Matsumoto, Yoshihisa; Funatsu, Osamu; Hosoi, Yoshio; Ikekita, Masahiko

    2010-01-01

    Sodium orthovanadate (vanadate) inhibits the DNA-binding activity of p53, but its precise effects on p53 function have not been examined. Here, we show that vanadate exerts a potent antiapoptotic activity through both transcription-dependent and transcription-independent mechanisms relative to other p53 inhibitors, including pifithrin (PFT) alpha. We compared the effects of vanadate to PFTalpha and PFTmicro, an inhibitor of transcription-independent apoptosis by p53. Vanadate suppressed p53-associated apoptotic events at the mitochondria, including the loss of mitochondrial membrane potential, the conformational change of Bax and Bak, the mitochondrial translocation of p53, and the interaction of p53 with Bcl-2. Similarly, vanadate suppressed the apoptosis-inducing activity of a mitochondrially targeted temperature-sensitive p53 in stable transfectants of SaOS-2 cells. In radioprotection assays, which rely on p53, vanadate completely protected mice from a sublethal dose of 8 Gy and partially from a lethal dose of 12 Gy. Together, our findings indicated that vanadate effectively suppresses p53-mediated apoptosis by both transcription-dependent and transcription-independent pathways, and suggested that both pathways must be inhibited to completely block p53-mediated apoptosis. PMID:20048077

  18. [Suppressive effect of protein kinase C inhibitors on tumor cell function via phosphorylation of p53 protein in mice].

    PubMed

    Nakamura, K; Shinozuka, K; Kunitomo, M

    2000-12-01

    We examined the role of protein kinase C (PKC) in the phosphorylation of a p53 protein. Exposure to a protein kinase inhibitor, 1-(5-isoquinolinesulfonyl)-2-methylpiperazine dihydrochloride (H7), increased the phosphorylation of the wild type p53 protein, whereas exposure to a tumor promoter phorbol ester, 12-O-tetradecanoyl-phorbol-13-acetate (TPA), decreased it in vivo after incubation with mouse epidermal JB6 cells for 3 h. Exposure to a cAMP dependent protein kinase (PKA) activator, forskolin, did not decrease the phosphorylation of p53 protein. In the transient transfection/luciferase reporter transactivation assay, H7 slightly increased the mouse double minute (MDM) 2 reporter transactivation activity of the p53 protein after treatment for 24 h, whereas TPA completely blocked it. Exposure to H7 and a specific PKC inhibitor, bisindolylmaleimide (bis), dose-dependently reduced the lung-colonizing potential of highly metastatic B16-F10 mouse melanoma cells in syngeneic mice. These results suggest that the phosphorylation of the wild type p53 protein is inversely related to PKC activation, and also suggest that the phosphorylation of the p53 protein is involved in the function of its transcription factor. The PKC inhibitor may exhibit a potent anti-metastatic effect through the phosphorylation of wild type p53 protein and the activation of its function. PMID:11193387

  19. Enhanced sensitivity to irinotecan by Cdk1 inhibition in the p53-deficient HT29 human colon cancer cell line.

    PubMed

    Abal, Miguel; Bras-Goncalves, Rui; Judde, Jean-Gabriel; Fsihi, Hafida; De Cremoux, Patricia; Louvard, Daniel; Magdelenat, Henri; Robine, Sylvie; Poupon, Marie-France

    2004-03-01

    Mutations in the tumor-suppressor gene p53 have been associated with advanced colorectal cancer (CRC). Irinotecan (CPT-11), a DNA topoisomerase 1 inhibitor, has been recently incorporated to the adjuvant therapy. Since the DNA-damage checkpoint depends on p53 activation, the status of p53 might critically influence the response to CPT-11. We analysed the sensitivity to CPT-11 in the human colon cancer cell line HT29 (mut p53) and its wild-type (wt)-p53 stably transfected subclone HT29-A4. Cell-cycle analysis in synchronised cells demonstrated the activation of transfected wt-p53 and a p21(WAF1/CIP1)-dependent cell-cycle blockage in the S phase. Activated wt-p53 increased apoptosis and enhanced sensitivity to CPT-11. In p53-deficient cells, cDNA-macroarray analysis and western blotting showed an accumulation of the cyclin-dependent kinase (cdk)1/cyclin B complex. Subsequent p53-independent activation of the cdk-inhibitor (cdk-I) p21(WAF1/CIP1) prevented cell-cycle progression. Cdk1 induction was exploited in vivo to improve the sensitivity to CPT-11 by additional treatment with the cdk-I CYC-202. We demonstrate a gain of sensitivity to CPT-11 in a p53-mutated colon cancer model either by restoring wild-type p53 function or by sequential treatment with cdk-Is. Considering that mutations in p53 are among the most common genetic alterations in CRC, a therapeutic approach specifically targeting p53-deficient tumors could greatly improve the treatment outcomes. PMID:15001986

  20. Molecular mechanisms of nutlin-induced apoptosis in multiple myeloma: evidence for p53-transcription-dependent and -independent pathways.

    PubMed

    Saha, Manujendra N; Jiang, Hua; Chang, Hong

    2010-09-15

    Multiple myeloma (MM) is an incurable plasma cell malignancy in which p53 is rarely mutated. Thus, activation of the p53 pathway by a small molecule inhibitor of the p53-MDM2 interaction, nutlin, in MM cells retaining wild type p53 is an attractive therapeutic strategy. Recently we reported that nutlin plus velcade (a proteasome inhibitor) displayed a synergistic response in MM. However, the mechanism of the p53-mediated apoptosis in MM has not been fully understood. Our data show that nutlin-induced apoptosis correlated with reduction in cell viability, upregulation of p53, p21 and MDM2 protein levels with a simultaneous increase in pro-apoptotic targets PUMA, Bax and Bak and downregulation of anti-apoptotic targets Bcl2 and survivin and activation of caspase in MM cells harboring wild type p53. Nutlin-induced apoptosis was inhibited when activation of caspase was blocked by the caspase inhibitor. Nutlin caused mitochondrial translocation of p53 where it binds with Bcl2, leading to cytochrome C release. Moreover, blocking the transcriptional arm of p53 by the p53-specific transcriptional inhibitor, pifithrin-α, not only inhibited nutlin-induced upregulation of p53-transcriptional targets but also augmented apoptosis in MM cells, suggesting an association of transcription-independent pathway of apoptosis. However, inhibitor of mitochondrial translocation of p53, PFT-μ, did not prevent nutlin-induced apoptosis, suggesting that the p53 transcription-dependent pathway was also operational in nutlin-induced apoptosis in MM. Our study provides the evidence that nutlin-induced apoptosis in MM cells is mediated by transcription-dependent and -independent pathways and supports further clinical evaluation of nutlin as a novel therapeutic agent in MM. PMID:20595817

  1. p53 causes butein-mediated apoptosis of chronic myeloid leukemia cells

    PubMed Central

    WOO, SANG-MI; CHOI, YOUN KYNUG; KIM, AH JEONG; CHO, SUNG-GOOK; KO, SEONG-GYU

    2016-01-01

    Progression of chronic myeloid leukemia, marked by the oncogenic Bcr-Abl mutation, is tightly associated with an alteration of the p53 pathway. It is known that butein extracted from various plants represses cancer growth. Although the anticancer effects of butein are widely accepted, the mechanisms by which butein induces apoptosis of chronic myeloid leukemia cells remains to be elucidated. The present study demonstrated that butein-induced apoptosis was mediated by p53. KBM5 chronic myeloid leukemia (CML) cells expressing wild-type p53 were more sensitive to butein compared with p53-null K562 CML cells in terms of apoptotic cell death. In addition, butein arrested KBM5 cells at S-phase and altered the expression levels of certain cyclins and the p53-downstream targets, MDM2 and p21. In addition, while butein reduced the protein expression of MDM2 in the KBM5 and K562 cells, it resulted in proteasome-independent MDM2 degradation in p53-expressing KBM5 cells, however, not in p53-null K562 cells. Therefore, the present study suggested that p53 causes the butein-mediated apoptosis of leukemic cells. PMID:26676515

  2. p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells

    SciTech Connect

    Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin; Maier, Thorsten J.; Wobst, Ivonne; Geisslinger, Gerd

    2008-01-25

    S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53{sup wt}) or being p(HCT-116 p53{sup -/-}), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53{sup -/-} xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53{sup wt} cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53{sup wt} cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75{sup NTR}, p53 and Bax.

  3. Gain-of-function p53 mutants co-opt chromatin pathways to drive cancer growth.

    PubMed

    Zhu, Jiajun; Sammons, Morgan A; Donahue, Greg; Dou, Zhixun; Vedadi, Masoud; Getlik, Matthäus; Barsyte-Lovejoy, Dalia; Al-awar, Rima; Katona, Bryson W; Shilatifard, Ali; Huang, Jing; Hua, Xianxin; Arrowsmith, Cheryl H; Berger, Shelley L

    2015-09-10

    TP53 (which encodes p53 protein) is the most frequently mutated gene among all human cancers. Prevalent p53 missense mutations abrogate its tumour suppressive function and lead to a 'gain-of-function' (GOF) that promotes cancer. Here we show that p53 GOF mutants bind to and upregulate chromatin regulatory genes, including the methyltransferases MLL1 (also known as KMT2A), MLL2 (also known as KMT2D), and acetyltransferase MOZ (also known as KAT6A or MYST3), resulting in genome-wide increases of histone methylation and acetylation. Analysis of The Cancer Genome Atlas shows specific upregulation of MLL1, MLL2, and MOZ in p53 GOF patient-derived tumours, but not in wild-type p53 or p53 null tumours. Cancer cell proliferation is markedly lowered by genetic knockdown of MLL1 or by pharmacological inhibition of the MLL1 methyltransferase complex. Our study reveals a novel chromatin mechanism underlying the progression of tumours with GOF p53, and suggests new possibilities for designing combinatorial chromatin-based therapies for treating individual cancers driven by prevalent GOF p53 mutations. PMID:26331536

  4. p53 Transactivation and the Impact of Mutations, Cofactors and Small Molecules Using a Simplified Yeast-Based Screening System

    PubMed Central

    Bisio, Alessandra; Lion, Mattia; Jordan, Jennifer; Fronza, Gilberto; Menichini, Paola; Resnick, Michael A.; Inga, Alberto

    2011-01-01

    Background The p53 tumor suppressor, which is altered in most cancers, is a sequence-specific transcription factor that is able to modulate the expression of many target genes and influence a variety of cellular pathways. Inactivation of the p53 pathway in cancer frequently occurs through the expression of mutant p53 protein. In tumors that retain wild type p53, the pathway can be altered by upstream modulators, particularly the p53 negative regulators MDM2 and MDM4. Methodology/Principal Findings Given the many factors that might influence p53 function, including expression levels, mutations, cofactor proteins and small molecules, we expanded our previously described yeast-based system to provide the opportunity for efficient investigation of their individual and combined impacts in a miniaturized format. The system integrates i) variable expression of p53 proteins under the finely tunable GAL1,10 promoter, ii) single copy, chromosomally located p53-responsive and control luminescence reporters, iii) enhanced chemical uptake using modified ABC-transporters, iv) small-volume formats for treatment and dual-luciferase assays, and v) opportunities to co-express p53 with other cofactor proteins. This robust system can distinguish different levels of expression of WT and mutant p53 as well as interactions with MDM2 or 53BP1. Conclusions/Significance We found that the small molecules Nutlin and RITA could both relieve the MDM2-dependent inhibition of WT p53 transactivation function, while only RITA could impact p53/53BP1 functional interactions. PRIMA-1 was ineffective in modifying the transactivation capacity of WT p53 and missense p53 mutations. This dual-luciferase assay can, therefore, provide a high-throughput assessment tool for investigating a matrix of factors that can influence the p53 network, including the effectiveness of newly developed small molecules, on WT and tumor-associated p53 mutants as well as interacting proteins. PMID:21674059

  5. DNA-mediated oxidation of p53.

    PubMed

    Schaefer, Kathryn N; Barton, Jacqueline K

    2014-06-01

    Transcription factor p53 is the most commonly altered gene in human cancer. As a redox-active protein in direct contact with DNA, p53 can directly sense oxidative stress through DNA-mediated charge transport. Electron hole transport occurs over long distances through the π-stacked bases and leads to the oxidative dissociation of p53. The extent of protein dissociation depends upon the redox potential of the DNA in direct contact with each p53 monomer. The DNA sequence dependence of p53 oxidative dissociation was examined by electrophoretic mobility shift assays using oligonucleotides containing both synthetic and human p53 consensus sequences with an appended photooxidant, anthraquinone. Greater p53 dissociation is observed from sequences containing low-redox potential purine regions, particularly guanine triplets. Using denaturing polyacrylamide gel electrophoresis of irradiated anthraquinone-modified DNA, the DNA damage sites corresponding to sites of preferred electron hole localization were determined. The resulting DNA damage preferentially localizes to guanine doublets and triplets. Oxidative DNA damage is inhibited in the presence of p53, but only at sites in direct contact with p53. From these data, predictions about the sensitivity of human p53-binding sites to oxidative stress as well as possible biological implications have been made. On the basis of our data, the guanine pattern within the purine region of each p53-binding site determines the response of p53 to DNA oxidation, yielding for some sequences the oxidative dissociation of p53 from a distance and thereby providing another potential role for DNA charge transport chemistry within the cell. PMID:24853816

  6. Frameshift and nonsense p53 mutations in squamous-cell carcinoma of head and neck - non-reactivity with 3 anti-p53 monoclonal-antibodies.

    PubMed

    Chen, Y; Xu, L; Massey, L; Zlotolow, I; Huvos, A; Garinchesa, P; Old, L

    1994-03-01

    p53 mutations in human tumors are often associated with overexpression of p53, and immunohistochemical detection of p53 has frequently been chosen as a simpler method than genetic analysis to access p53 mutations. In this study, we analyzed the p53 gene by single-strand conformational polymorphism (SSCP) and DNA sequencing, and correlated findings to Ab staining results. In a series of 58 squamous cell carcinoma, 15 showed mutations in exons 5, 6, 7, 8 and 9 by SSCP. Of these 15 cases, 11 were positive by antibody staining, and DNA sequencing showed missense mutations but no frameshift or nonsense mutations. In contrast, the antibody-negative cases had frameshift or nonsense mutations, but no missense mutations. SSCP analysis of these 4 cases showed mutations in exon 6 (2 cases), exon 7 (1), and exon 8 (1), respectively. In case 1, sequencing data revealed a single-base addition in exon 6, leading to a truncated gene product of 207 amino acids (aa), in contrast to 393 aa in wild-type p53. Similar frameshift mutations were shown in case 2 and case 3. Case 4, instead of a frameshift mutation, carried a nonsense mutation, and a truncated peptide of 235 aa. All these mutations thus shared the feature of producing truncated p53 products nonreactive with antibodies. We conclude that frameshift mutations as well as nonsense mutations can lead to altered p53 undetectable by available monoclonal antibodies. Our finding indicates that the absence of Ab reactivity does not rule out genetic alterations of the p53 gene in human tumors. PMID:21566966

  7. Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

    DOE PAGESBeta

    Botcheva, Krassimira; McCorkle, Sean R.

    2014-11-21

    The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less

  8. Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

    PubMed Central

    Botcheva, Krassimira; McCorkle, Sean R.

    2014-01-01

    The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We report distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). Our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways. PMID:25415302

  9. p53 Enables metabolic fitness and self-renewal of nephron progenitor cells.

    PubMed

    Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida

    2015-04-01

    Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre(+);p53(fl/fl)) induces progressive depletion of Cited1(+)/Six2(+) self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre(+);p53(fl/fl) cap has 30% fewer Six2(GFP(+)) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre(+);p53(fl/fl) cells in the S and G2/M phases compared with Six2Cre(+);p53(+/+) cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP(+)) CM cells revealed that the top downregulated genes in Six2Cre(+);p53(fl/fl) CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼ 50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. PMID:25804735

  10. Oncogenic Intra-p53 Family Member Interactions in Human Cancers

    PubMed Central

    Ferraiuolo, Maria; Di Agostino, Silvia; Blandino, Giovanni; Strano, Sabrina

    2016-01-01

    The p53 gene family members p53, p73, and p63 display several isoforms derived from the presence of internal promoters and alternative splicing events. They are structural homologs but hold peculiar functional properties. p53, p73, and p63 are tumor suppressor genes that promote differentiation, senescence, and apoptosis. p53, unlike p73 and p63, is frequently mutated in cancer often displaying oncogenic “gain of function” activities correlated with the induction of proliferation, invasion, chemoresistance, and genomic instability in cancer cells. These oncogenic functions are promoted either by the aberrant transcriptional cooperation of mutant p53 (mutp53) with transcription cofactors (e.g., NF-Y, E2F1, Vitamin D Receptor, Ets-1, NF-kB and YAP) or by the interaction with the p53 family members, p73 and p63, determining their functional inactivation. The instauration of these aberrant transcriptional networks leads to increased cell growth, low activation of DNA damage response pathways (DNA damage response and DNA double-strand breaks response), enhanced invasion, and high chemoresistance to different conventional chemotherapeutic treatments. Several studies have clearly shown that different cancers harboring mutant p53 proteins exhibit a poor prognosis when compared to those carrying wild-type p53 (wt-p53) protein. The interference of mutantp53/p73 and/or mutantp53/p63 interactions, thereby restoring p53, p73, and p63 tumor suppression functions, could be among the potential therapeutic strategies for the treatment of mutant p53 human cancers. PMID:27066457

  11. Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

    SciTech Connect

    Botcheva, Krassimira; McCorkle, Sean R.

    2014-11-21

    The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We report distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.

  12. p53 enables metabolic fitness and self-renewal of nephron progenitor cells

    PubMed Central

    Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida

    2015-01-01

    Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre+;p53fl/fl) induces progressive depletion of Cited1+/Six2+ self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre+;p53fl/fl cap has 30% fewer Six2(GFP+) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre+;p53fl/fl cells in the S and G2/M phases compared with Six2Cre+;p53+/+ cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP+) CM cells revealed that the top downregulated genes in Six2Cre+;p53fl/fl CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. PMID:25804735

  13. The tumor suppressor p53 inhibits Net, an effector of Ras/extracellular signal-regulated kinase signaling.

    PubMed

    Nakade, Koji; Zheng, Hong; Ganguli, Gitali; Buchwalter, Gilles; Gross, Christian; Wasylyk, Bohdan

    2004-02-01

    The tumor suppressor function of p53 is linked to its ability to repress gene expression, but the mechanisms of specific gene repression are poorly understood. We report that wild-type p53 inhibits an effector of the Ras oncogene/mitogen-activated protein (MAP) kinase pathway, the transcription factor Net. Tumor-associated mutant p53s are less efficient inhibitors. p53 inhibits by preventing phosphorylation of Net by MAP kinases. Loss of p53 in vivo leads to increased Net phosphorylation in response to wound healing and UV irradiation of skin. Our results show that p53 can repress specific gene expression by inhibiting Net, a factor implicated in cell cycle entry. PMID:14729959

  14. [Quality control of recombinant oncolytic adenovirus/p53].

    PubMed

    Gao, Kai; Bi, Hua; Ding, You-Xue; Li, Yong-Hong; Han, Chun-Mei; Guo, Ying; Rao, Chun-Ming

    2011-12-01

    To establish a detection method of oncolytic adenovirus/p53 and standard of quality control, human telomerase reverse transcriptase (hTERT) promoter, CMV fusion promoter containing hypoxia reaction element (HRE) and p53 gene were identified by vector DNA restriction enzyme digestion and PCR analysis. The result conformed that all modified regions were in consistent with theoretical ones. Particle number was 2.0 x 10(11) mL(-1) determined by UV (A260). Infectious titer was 5.0 x 10(10) IU mL(-1) analyzed by TCID50. In vitro p53 gene expression in human lung cancer cell H1299 was determined by ELISA, and A450 ratio of nucleoprotein in virus infection group to control group was 5.2. Antitumor potency was evaluated by cytotoxicity assay using human lung cancer cell A549, and the MOI(IC50) of this gene therapy preparation was 1.0. The tumor cells targeted replication ability of recombinant virus was determined by TCID50 titer ratio of filial generation virus between human lung cancer cell A549 and human diploid epidermal fibrolast BJ cells after infected by virus with same MOI. TCID50 titer ratio of tumor cell infection group to normal cell infection control group was 398. The IE-HPLC purity of virus was 99.5%. There was less than 1 copy of wild type adenovirus within 1 x 10(7) VP recombinant virus. Other quality control items were complied with corresponding requirements in the guidance for human somatic cell therapy and gene therapy and Chinese pharmacopeia volume III. The detection method of oncolytic adenovirus/p53 was successfully established for quality control standard. The study also provided reference for quality control of other oncolytic viral vector products. PMID:22375422

  15. p53 mutation heterogeneity in cancer

    SciTech Connect

    Soussi, T. . E-mail: thierry.soussi@free.fr; Lozano, G.

    2005-06-10

    The p53 gene is inactivated in about 50% of human cancers and the p53 protein is an essential component of the cell response induced by genotoxic stresses such as those generated by radiotherapy or chemotherapy. It is therefore highly likely that these alterations are an important component in tumor resistance to therapy. The particular characteristics of these alterations, 80% of which are missense mutations leading to functionally heterogeneous proteins, make p53 a unique gene in the class of tumor suppressor genes. A considerable number of mutant p53 proteins probably have an oncogenic activity per se and therefore actively participate in cell transformation. The fact that the apoptotic and antiproliferative functions of p53 can be dissociated in certain mutants also suggests another level of complexity in the relationships between p53 inactivation and neoplasia.

  16. Mutant p53: one name, many proteins

    PubMed Central

    Freed-Pastor, William A.; Prives, Carol

    2012-01-01

    There is now strong evidence that mutation not only abrogates p53 tumor-suppressive functions, but in some instances can also endow mutant proteins with novel activities. Such neomorphic p53 proteins are capable of dramatically altering tumor cell behavior, primarily through their interactions with other cellular proteins and regulation of cancer cell transcriptional programs. Different missense mutations in p53 may confer unique activities and thereby offer insight into the mutagenic events that drive tumor progression. Here we review mechanisms by which mutant p53 exerts its cellular effects, with a particular focus on the burgeoning mutant p53 transcriptome, and discuss the biological and clinical consequences of mutant p53 gain of function. PMID:22713868

  17. Mutant p53 confers chemoresistance in non-small cell lung cancer by upregulating Nrf2

    PubMed Central

    Wang, Yao-Chen; He, Tsung-Ying; Lee, Ming-Ching; Yeh, Sauh-Der; Chen, Chih-Yi; Lee, Huei

    2015-01-01

    Nrf2 is a key transcription factor for genes coding for antioxidants, detoxification enzymes, and multiple drug resistance and it also confers resistance to anticancer drugs. Here, we hypothesized that mutant p53 could upregulate Nrf2 expression at the transcriptional level, thereby conferring cisplatin resistance in non-small cell lung cancer (NSCLC). Luciferase reporter assays and real-time PCR analysis indicated that the Nrf2 promoter activity and its mRNA levels were markedly suppressed by wild-type p53, but not by mutant p53. Chromatin immunoprecipitation (ChIP) further confirmed that wild-type p53 binds at the p53 putative binding site to block Sp1 binding to the Nrf2 promoter and consequently to suppress the Nrf2 promoter activity. The MTT assay indicated that an increase in Nrf2 expression by mutant p53 is responsible for cisplatin resistance. Among the Nrf2 downstream genes, Bcl-2 and Bcl-xL contribute more strongly to Nrf2-mediated cisplatin resistance when compared with heme oxygenase 1 (HO-1). Cox regression analysis showed that patients with high-Nrf2, high-Bcl-2, high-Bcl-xL mRNA tumors were more commonly occurred unfavorable response to cisplatin-based chemotherapy than their counterparts. The prognostic significance of Nrf2 mRNA levels on OS and RFS was also observed in patients who have received cisplatin-based chemotherapy, particularly in p53-mutant patients. Collectively, mutant p53 may confer cisplatin resistance via upregulation of Nrf2 expression, and Nrf2 mRNA level may predict chemotherapeutic response and outcomes in NSCLC. PMID:26497680

  18. Selective induction of apoptosis through the FADD/caspase-8 pathway by a p53 c-terminal peptide in human pre-malignant and malignant cells.

    PubMed

    Li, Yin; Mao, Yuehua; Rosal, Ramon V; Dinnen, Richard D; Williams, Ann C; Brandt-Rauf, Paul W; Fine, Robert L

    2005-05-20

    A p53 C-terminal peptide (aa 361-382, p53p), fused at its C-terminus to the minimal carrier peptide of antennapedia (17 aa, Ant; p53p-Ant), induced rapid apoptosis in human cancer cells, via activation of the Fas pathway. We examined p53p-Ant mechanism of action, toxicity in various human normal, non-malignant, pre-malignant and malignant cancer cells and investigated its biophysical characteristics. p53p-Ant selectively induced cell death in only pre-malignant or malignant cells in a p53-dependent manner and was not toxic to normal and non-malignant cells. p53p-Ant was more toxic to the mutant p53 than wild-type p53 phenotype in H1299 lung cancer cells stably expressing human temperature-sensitive p53 mutant 143Ala. Surface plasmon resonance (BIACORE) analysis demonstrated that this peptide had higher binding affinity to mutant p53 as compared to wild-type p53. p53p-Ant induced-cell death had the classical morphological characteristics of apoptosis and had no features of necrosis. The mechanism of cell death by p53p-Ant was through the FADD/caspase-8-dependent pathway without the involvement of the TRAIL pathway, Bcl-2 family and cell cycle changes. Blocking Fas with antibody did not alter the peptide's effect, suggesting that Fas itself did not interact with the peptide. Transfection with a dominant-negative FADD with a deleted N-terminus inhibited p53p-Ant-induced apoptosis. Its mechanism of action is related to the FADD-induced pathway without restoration of other p53 functions. p53p-Ant is a novel anticancer agent with unique selectivity for human cancer cells and could be useful as a prototype for the development of new anti-cancer agents. PMID:15645452

  19. FAK and p53 protein interactions.

    PubMed

    Golubovskaya, Vita M; Cance, William G

    2011-09-01

    Focal Adhesion Kinase plays a major role in cell adhesion, motility, survival, proliferation, metastasis, angiogenesis and lymphangiogenesis. In 2004, we have cloned the promoter sequence of FAK and found that p53 inhibits its activity (BBA, v. 1678, 2004). In 2005, we were the first group to show that FAK and p53 proteins directly interact in the cells (JBC, v. 280, 2005). We have shown that FAK and p53 proteins interact in the cytoplasm and in the nucleus by immunoprecipitation, pull-down and confocal microscopy assays. We have shown that FAK inhibited activity of p53 with the transcriptional targets: p21, Bax and Mdm-2 through protein-protein interactions. We identified the 7 amino-acid site in p53 that is involved in interaction with FAK protein. The present review will discuss the interaction of FAK and p53 proteins and discuss the mechanism of FAK-p53 loop regulation: inhibition of FAK promoter activity by p53 protein and also inhibition of p53 transcriptional activity by FAK protein. PMID:21355845

  20. Targeting of Mutant p53 and the Cellular Redox Balance by APR-246 as a Strategy for Efficient Cancer Therapy

    PubMed Central

    Bykov, Vladimir J. N.; Zhang, Qiang; Zhang, Meiqiongzi; Ceder, Sophia; Abrahmsen, Lars; Wiman, Klas G.

    2016-01-01

    TP53 is the most frequently mutated gene in cancer. The p53 protein activates transcription of genes that promote cell cycle arrest or apoptosis, or regulate cell metabolism, and other processes. Missense mutations in TP53 abolish specific DNA binding of p53 and allow evasion of apoptosis and accelerated tumor progression. Mutant p53 often accumulates at high levels in tumor cells. Pharmacological reactivation of mutant p53 has emerged as a promising strategy for improved cancer therapy. Small molecules that restore wild type activity of mutant p53 have been identified using various approaches. One of these molecules, APR-246, is a prodrug that is converted to the Michael acceptor methylene quinuclidinone (MQ) that binds covalently to cysteines in p53, leading to refolding and restoration of wild type p53 function. MQ also targets the cellular redox balance by inhibiting thioredoxin reductase (TrxR1) and depleting glutathione. This dual mechanism of action may account for the striking synergy between APR-246 and platinum compounds. APR-246 is the only mutant p53-targeting compound in clinical development. A phase I/IIa clinical trial in hematological malignancies and prostate cancer showed good safety profile and clinical effects in some patients. APR-246 is currently tested in a phase Ib/II trial in patients with high-grade serous ovarian cancer. PMID:26870698

  1. p53 Acts as a Co-Repressor to Regulate Keratin 14 Expression during Epidermal Cell Differentiation

    PubMed Central

    Chao, Chung-Faye; Lu, Mei-Hua; Lin, Hwang-Chi; Chiou, Shih-Hwa; Tao, Pao-Luh; Chen, Jang-Yi

    2012-01-01

    During epidermal cell differentiation, keratin 14 (K14) expression is down-regulated, p53 expression varies, and the expression of the p53 target genes, p21 and 14-3-3σ, increases. These trends suggest that the relative transcriptional activity of p53 is increased during epidermal cell differentiation. To determine the relationship between K14 and p53, we constructed K14 promoters of various sizes and found that wild-type p53 could repress the promoter activity of all of the K14 promoter constructs in H1299 cells. K14-p160 contains an SP1 binding site mutation that prevents p53 from repressing K14 expression. Using a DNA affinity precipitation assay, we confirmed that p53 forms a complex with SP1 at the SP1 binding site between nucleotides -48 and -43 on the K14 promoter. Thus, our data indicate that p53 acts as a co-repressor to down-regulate K14 expression by binding to SP1. Next, we used a 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced epidermal cell differentiation model to examine the inhibition of K14 expression caused by increased p53 activity. Human ovarian teratocarcinoma C9 cells were treated with TPA to induce differentiation. Over-expression of the dominant negative p53 mutant ΔTAp53, which inhibits p53 activity, prevented the TPA-induced K14 down-regulation in C9 cells. Furthermore, treatment of normal primary human foreskin keratinocytes (PHFK) with the p53 inhibitor pifithrin-α (PFT-α) showed that the inhibition of p53 activity relieves K14 repression during epidermal cell differentiation. Finally, we found that TPA induces the phosphorylation of p53 at residue 378, which enhances the affinity of p53 to bind to Sp1 and repress K14 expression. PMID:22911849

  2. Biological and genetic properties of the p53 null preneoplastic mammary epithelium

    NASA Technical Reports Server (NTRS)

    Medina, Daniel; Kittrell, Frances S.; Shepard, Anne; Stephens, L. Clifton; Jiang, Cheng; Lu, Junxuan; Allred, D. Craig; McCarthy, Maureen; Ullrich, Robert L.

    2002-01-01

    The absence of the tumor suppressor gene p53 confers an increased tumorigenic risk for mammary epithelial cells. In this report, we describe the biological and genetic properties of the p53 null preneoplastic mouse mammary epithelium in a p53 wild-type environment. Mammary epithelium from p53 null mice was transplanted serially into the cleared mammary fat pads of p53 wild-type BALB/c female to develop stable outgrowth lines. The outgrowth lines were transplanted for 10 generations. The outgrowths were ductal in morphology and progressed through ductal hyperplasia and ductal carcinoma in situ before invasive cancer. The preneoplastic outgrowth lines were immortal and exhibited activated telomerase activity. They are estrogen and progesterone receptor-positive, and aneuploid, and had various levels of tumorigenic potential. The biological and genetic properties of these lines are distinct from those found in most hyperplastic alveolar outgrowth lines, the form of mammary preneoplasia occurring in most traditional models of murine mammary tumorigenesis. These results indicate that the preneoplastic cell populations found in this genetically engineered model are similar in biological properties to a subset of precurser lesions found in human breast cancer and provide a unique model to identify secondary events critical for tumorigenicity and invasiveness.

  3. MDM2 Inhibits Axin-Induced p53 Activation Independently of its E3 Ligase Activity.

    PubMed

    He, Ying; Lian, Guili; Lin, Shuyong; Ye, Zhiyun; Li, Qinxi

    2013-01-01

    MDM2 plays a crucial role in negatively regulating the functions of tumor suppressor p53. Here we show that MDM2 can inhibit Axin-stimulated p53-dependent apoptosis by suppressing p53 phosphorylation at Ser 46 and apoptosis-related p53 transactivational activity. Interestingly, the ubiquitin E3 ligase activity of MDM2 is not required for this inhibitory effect. Mechanically, either wildtype MDM2 or its E3-dead mutant, disrupts the Axin-based HIPK2/p53 complex formation by blocking the binding of p53 and HIPK2 to Axin. MDM2Δp53, a deletion mutant that lacks p53 binding domain fails to exert the inhibitory effect, demonstrating that the interaction of MDM2 and p53, but not its E3 ligase activity toward p53 plays key role in suppressing Axin-stimulated p53 activation. Our results thus have revealed a novel aspect of the mechanism by which MDM2 regulates p53 activities. PMID:23826318

  4. Critical roles of DMP1 in HER2/neu-Arf-p53 signaling and breast cancer development

    PubMed Central

    Taneja, Pankaj; Maglic, Dejan; Kai, Fumitake; Sugiyama, Takayuki; Kendig, Robert D.; Frazier, Donna P.; Willingham, Mark C.; Inoue, Kazushi

    2010-01-01

    HER2 overexpression stimulates cell growth in p53-mutated cells while it inhibits cell proliferation in those with wild-type p53, but the molecular mechanism is unknown. The Dmp1 promoter was activated by HER2/neu through the PI3K-Akt-NF-κB pathway, which in turn stimulated Arf transcription. Binding of p65 and p52 subunits of NF-κB was demonstrated to the Dmp1 promoter and that of Dmp1 to the Arf promoter upon HER2/neu overexpression. Both Dmp1 and p53 were induced in pre-malignant lesions from MMTV-neu mice and mammary tumorigenesis was significantly accelerated in both Dmp1+/− and Dmp1−/− mice. Selective deletion of Dmp1 and/or overexpression of Tbx2/Pokemon was found in >50 % of wild-type HER2/neu carcinomas while the involvement of Arf, Mdm2, or p53 was rare. Tumors from Dmp1+/−, Dmp1−/−, and wild-type neu mice with hemizygous Dmp1 deletion showed significant downregulation of Arf and p21Cip1/WAF1, showing p53 inactivity and more aggressive phenotypes than tumors without Dmp1 deletion. Notably, endogenous hDMP1 mRNA decreased when HER2 was depleted in human breast cancer cells. Our study demonstrates the pivotal roles of Dmp1 in HER2/neu-p53 signaling and breast carcinogenesis. PMID:21062982

  5. Mitochondrial death functions of p53

    PubMed Central

    Marchenko, N D; Moll, U M

    2014-01-01

    The p53 tumor suppressor network plays a fundamental surveillance role in both homeostatic and adaptive cell biology. p53 is one of the most important barriers against malignant derailment of normal cells, orchestrating growth arrest, senescence, or cell death by linking many different pathways in response to genotoxic and non-genotoxic insults. p53 is the key broadband sensor for numerous cellular stresses such as DNA damage, hypoxia, oxidative stress, oncogenic signaling, and nucleolar stress. The crucial tumor suppressive and tissue homeostasis activity of p53 is its ability to activate cell death via multiple different pathways. A well-characterized biochemical function of p53 in the regulation of apoptosis is its role as a potent transcriptional regulator. p53 activates a panel of proapoptotic genes from the mitochondrial apoptotic and death receptor programs while repressing antiapoptotic Bcl2 family genes. In addition, over the last 10 y a growing body of evidence has also defined direct extranuclear non-transcriptional p53 activities within mitochondria-mediated cell death pathways that are based on p53 protein accumulation in cytosolic and mitochondrial compartments and protein-protein interactions. To date, transcription-independent p53-mediated cell death regulation has been described for apoptosis, necrosis, and autophagy. Because mitochondrial dysregulation is central to the development of a number of pathologic processes such as cancer and neurodegenerative and age-related diseases, understanding the direct roles of p53 protein in mitochondria has high translational impact and could facilitate the development of novel drug targets to combat these diseases. In this review we will mainly focus on mechanisms of p53-mediated transcription-independent cell death pathways at mitochondria. PMID:27308326

  6. The p53 Pathway: Origins, Inactivation in Cancer, and Emerging Therapeutic Approaches.

    PubMed

    Joerger, Andreas C; Fersht, Alan R

    2016-06-01

    Inactivation of the transcription factor p53, through either direct mutation or aberrations in one of its many regulatory pathways, is a hallmark of virtually every tumor. In recent years, screening for p53 activators and a better understanding of the molecular mechanisms of oncogenic perturbations of p53 function have opened up a host of novel avenues for therapeutic intervention in cancer: from the structure-guided design of chemical chaperones to restore the function of conformationally unstable p53 cancer mutants, to the development of potent antagonists of the negative regulators MDM2 and MDMX and other modulators of the p53 pathway for the treatment of cancers with wild-type p53. Some of these compounds have now moved from proof-of-concept studies into clinical trials, with prospects for further, personalized anticancer medicines. We trace the structural evolution of the p53 pathway, from germ-line surveillance in simple multicellular organisms to its pluripotential role in humans. PMID:27145840

  7. The Contrived Mutant p53 Oncogene – Beyond Loss of Functions

    PubMed Central

    Sabapathy, Kanaga

    2015-01-01

    Mutations in p53 are almost synonymous with cancer – be it susceptibility to the disease or response to treatment – and therefore, are a critical determinant of overall survival. As most of these mutations occur in the DNA-binding domain of p53, many of the clinical correlations with mutant p53 have been initially relegated to the loss of its transcription-dependent activities as a tumor suppressor. However, significant efforts over the last two decades have led to the vast knowledge on the potential functions of the mutated p53 protein, which have been attributed to the physical presence of the mutant protein rather than the loss of its wild-type (WT) functions. Beyond the inhibitory effects of mutant p53 on the remaining WT protein that leads to the dominant-negative effect in the heterozygous state, mutant p53’s presence has also been significantly attributed to novel gain-of-functions that lead to addiction of cancer cells to its presence for survival, as well as for their ability to invade and metastasize, elevating it to a contrived oncogene that drives the cancer cells forward. This review will summarize the functional consequences of the presence of mutant p53 protein on cellular and organismal physiology. PMID:26697411

  8. Mutant p53 regulates ovarian cancer transformed phenotypes through autocrine matrix deposition

    PubMed Central

    Iwanicki, Marcin P.; Chen, Hsing-Yu; Iavarone, Claudia; Zervantonakis, Ioannis K.; Muranen, Taru; Novak, Marián; Ince, Tan A.; Drapkin, Ronny; Brugge, Joan S.

    2016-01-01

    High-grade serous ovarian carcinoma (HGS-OvCa) harbors p53 mutations and can originate from the epithelial cell compartment of the fallopian tube fimbriae. From this site, neoplastic cells detach, survive in the peritoneal cavity, and form cellular clusters that intercalate into the mesothelium to form ovarian and peritoneal masses. To examine the contribution of mutant p53 to phenotypic alterations associated with HGS-OvCA, we developed live-cell microscopy assays that recapitulate these early events in cultured fallopian tube nonciliated epithelial (FNE) cells. Expression of stabilizing mutant variants of p53, but not depletion of endogenous wild-type p53, in FNE cells promoted survival and cell-cell aggregation under conditions of cell detachment, leading to the formation of cell clusters with mesothelium-intercalation capacity. Mutant p53R175H-induced phenotypes were dependent on fibronectin production, α5β1 fibronectin receptor engagement, and TWIST1 expression. These results indicate that FNE cells expressing stabilizing p53 mutants acquire anchorage independence and subsequent mesothelial intercalation capacity through a mechanism involving mesenchymal transition and matrix production. These findings provide important new insights into activities of mutant p53 in the cells of origin of HGS-OvCa. PMID:27482544

  9. Skin human papillomavirus type 38 alters p53 functions by accumulation of deltaNp73.

    PubMed

    Accardi, Rosita; Dong, Wen; Smet, Anouk; Cui, Rutao; Hautefeuille, Agnes; Gabet, Anne-Sophie; Sylla, Bakary S; Gissmann, Lutz; Hainaut, Pierre; Tommasino, Massimo

    2006-03-01

    The E6 and E7 of the cutaneous human papillomavirus (HPV) type 38 immortalize primary human keratinocytes, an event normally associated with the inactivation of pathways controlled by the tumour suppressor p53. Here, we show for the first time that HPV38 alters p53 functions. Expression of HPV38 E6 and E7 in human keratinocytes or in the skin of transgenic mice induces stabilization of wild-type p53. This selectively activates the transcription of deltaNp73, an isoform of the p53-related protein p73, which in turn inhibits the capacity of p53 to induce the transcription of genes involved in growth suppression and apoptosis. DeltaNp73 downregulation by an antisense oligonucleotide leads to transcriptional re-activation of p53-regulated genes and apoptosis. Our findings illustrate a novel mechanism of the alteration of p53 function that is mediated by a cutaneous HPV type and support the role of HPV38 and deltaNp73 in human carcinogenesis. PMID:16397624

  10. Skin human papillomavirus type 38 alters p53 functions by accumulation of ΔNp73

    PubMed Central

    Accardi, Rosita; Dong, Wen; Smet, Anouk; Cui, Rutao; Hautefeuille, Agnes; Gabet, Anne-Sophie; Sylla, Bakary S; Gissmann, Lutz; Hainaut, Pierre; Tommasino, Massimo

    2006-01-01

    The E6 and E7 of the cutaneous human papillomavirus (HPV) type 38 immortalize primary human keratinocytes, an event normally associated with the inactivation of pathways controlled by the tumour suppressor p53. Here, we show for the first time that HPV38 alters p53 functions. Expression of HPV38 E6 and E7 in human keratinocytes or in the skin of transgenic mice induces stabilization of wild-type p53. This selectively activates the transcription of ΔNp73, an isoform of the p53-related protein p73, which in turn inhibits the capacity of p53 to induce the transcription of genes involved in growth suppression and apoptosis. ΔNp73 downregulation by an antisense oligonucleotide leads to transcriptional re-activation of p53-regulated genes and apoptosis. Our findings illustrate a novel mechanism of the alteration of p53 function that is mediated by a cutaneous HPV type and support the role of HPV38 and ΔNp73 in human carcinogenesis. PMID:16397624

  11. p53 regulates the proliferation, differentiation and spontaneous transformation of mesenchymal stem cells

    SciTech Connect

    Armesilla-Diaz, Alejandro; Elvira, Gema; Silva, Augusto

    2009-12-10

    Mesenchymal stem cells (MSC) have been extensively studied and gained wide popularity due to their therapeutic potential. Spontaneous transformation of MSC, from both human and murine origin, has been reported in many studies. MSC transformation depends on the culture conditions, the origin of the cells and the time on culture; however, the precise biological characteristics involved in this process have not been fully defined yet. In this study, we investigated the role of p53 in the biology and transformation of murine bone marrow (BM)-derived MSC. We demonstrate that the MSC derived from p53KO mice showed an augmented proliferation rate, a shorter doubling time and also morphologic and phenotypic changes, as compared to MSC derived from wild-type animals. Furthermore, the MSC devoid of p53 had an increased number of cells able to generate colonies. In addition, not only proliferation but also MSC differentiation is controlled by p53 since its absence modifies the speed of the process. Moreover, genomic instability, changes in the expression of c-myc and anchorage independent growth were also observed in p53KO MSC. In addition, the absence of p53 implicates the spontaneous transformation of MSC in long-term cultures. Our results reveal that p53 plays a central role in the biology of MSC.

  12. Changing the p53 master regulatory network: ELEMENTary, my dear Mr Watson.

    PubMed

    Menendez, D; Inga, A; Jordan, J J; Resnick, M A

    2007-04-01

    The p53 master regulatory network provides for the stress-responsive direct control of a vast number of genes in humans that can be grouped into several biological categories including cell-cycle control, apoptosis and DNA repair. Similar to other sequence-specific master regulators, there is a matrix of key components, which provide for variation within the p53 master regulatory network that include p53 itself, target response element sequences (REs) that provide for p53 regulation of target genes, chromatin, accessory proteins and transcription machinery. Changes in any of these can impact the expression of individual genes, groups of genes and the eventual biological responses. The many REs represent the core of the master regulatory network. Since defects or altered expression of p53 are associated with over 50% of all cancers and greater than 90% of p53 mutations are in the sequence-specific DNA-binding domain, it is important to understand the relationship between wild-type or mutant p53 proteins and the target response elements. In the words of the legendary detective Sherlock Holmes, it is 'Elementary, my dear Mr. Watson'. PMID:17401428

  13. Inhibition of DNA topoisomerase II alpha gene expression by the p53 tumor suppressor.

    PubMed Central

    Wang, Q; Zambetti, G P; Suttle, D P

    1997-01-01

    DNA topoisomerase II (topo II) is an essential nuclear enzyme involved in major cellular functions such as DNA replication, transcription, recombination, and mitosis. While an elevated level of topo II alpha is associated with cell proliferation, wild-type (wt) p53 inhibits the expression of various growth-stimulatory genes. To determine if p53 downregulates topo II alpha gene expression, a murine cell line, (10)1val, that expresses a temperature-sensitive p53 was utilized. The (10)1val cells had significantly lower levels of topo II alpha mRNA and protein following incubation for 24 h at 32 degrees C (p53 with wt conformation) than at 39 degrees C (p53 with mutant conformation). The effect of p53 on the human topo II alpha gene promoter was determined by using luciferase reporter plasmids containing varying lengths of the topo II alpha promoter transiently cotransfected into p53-deficient (10)1 cells together with wt or mutant p53 expression plasmids. Transcription from the full-length (bp -557 to +90) topo II alpha promoter was decreased 15-fold by wt p53 in a concentration-dependent manner, whereas mutant p53 exerted much weaker inhibition. Consecutive deletion of the five inverted CCAAT elements (ICEs) from the topo II alpha promoter reduced both the basal promoter activity and wt p53-induced suppression. Transcription of the minimal promoter (-32 to +90), which contains no ICE, was slightly stimulated by wt or mutant p53 expression. When point mutations were introduced into the most proximal ICE (-68), the inhibitory effect of wt p53 was alleviated and stimulation of topo II alpha expression resulted. Our study suggests that wt p53 functions as a transcriptional repressor of topo II alpha gene expression, possibly through a functional interaction with specific ICEs. Inactivation of wt p53 may reduce normal regulatory suppression of topo II alpha and contribute to abortive cell cycle checkpoints, accelerated cell proliferation, and alterations in genomic

  14. Ribosomal Protein Mutations Result in Constitutive p53 Protein Degradation through Impairment of the AKT Pathway.

    PubMed

    Antunes, Ana T; Goos, Yvonne J; Pereboom, Tamara C; Hermkens, Dorien; Wlodarski, Marcin W; Da Costa, Lydie; MacInnes, Alyson W

    2015-07-01

    Mutations in ribosomal protein (RP) genes can result in the loss of erythrocyte progenitor cells and cause severe anemia. This is seen in patients with Diamond-Blackfan anemia (DBA), a pure red cell aplasia and bone marrow failure syndrome that is almost exclusively linked to RP gene haploinsufficiency. While the mechanisms underlying the cytopenia phenotype of patients with these mutations are not completely understood, it is believed that stabilization of the p53 tumor suppressor protein may induce apoptosis in the progenitor cells. In stark contrast, tumor cells from zebrafish with RP gene haploinsufficiency are unable to stabilize p53 even when exposed to acute DNA damage despite transcribing wild type p53 normally. In this work we demonstrate that p53 has a limited role in eliciting the anemia phenotype of zebrafish models of DBA. In fact, we find that RP-deficient embryos exhibit the same normal p53 transcription, absence of p53 protein, and impaired p53 response to DNA damage as RP haploinsufficient tumor cells. Recently we reported that RP mutations suppress activity of the AKT pathway, and we show here that this suppression results in proteasomal degradation of p53. By re-activating the AKT pathway or by inhibiting GSK-3, a downstream modifier that normally represses AKT signaling, we are able to restore the stabilization of p53. Our work indicates that the anemia phenotype of zebrafish models of DBA is dependent on factors other than p53, and may hold clinical significance for both DBA and the increasing number of cancers revealing spontaneous mutations in RP genes. PMID:26132763

  15. High frequency of p53/MDM2/p14ARF pathway abnormalities in relapsed neuroblastoma

    PubMed Central

    Carr-Wilkinson, Jane; O' Toole, Kieran; Wood, Katrina M.; Challen, Christine C.; Baker, Angela G.; Board, Julian R.; Evans, Laura; Cole, Michael; Cheung, Nai-Kong V.; Boos, Joachim; Köhler, Gabriele; Leuschner, Ivo; Pearson, Andrew D.J.; Lunec, John; Tweddle, Deborah A.

    2010-01-01

    Purpose: Most neuroblastomas initially respond to therapy but many relapse with chemoresistant disease. p53 mutations are rare in diagnostic neuroblastomas, but we have previously reported inactivation of the p53/MDM2/p14ARF pathway in 9/17 (53%) neuroblastoma cell lines established at relapse. Hypothesis: Inactivation of the p53/MDM2/p14ARF pathway develops during treatment and contributes to neuroblastoma relapse. Methods: Eighty-four neuroblastomas were studied from 41 patients with relapsed neuroblastoma including 38 paired neuroblastomas at different stages of therapy. p53 mutations were detected by automated sequencing, p14ARF methylation and deletion by methylation-specific PCR and duplex PCR respectively, and MDM2 amplification by fluorescent in-situ hybridisation. Results: Abnormalities in the p53 pathway were identified in 20/41(49%) cases. Downstream defects due to inactivating missense p53 mutations were identified in 6/41 (15%) cases, 5 following chemotherapy and/or at relapse and 1 at diagnosis, post chemotherapy and relapse. The presence of a p53 mutation was independently prognostic for overall survival (hazard ratio 3.4, 95% confidence interval 1.2, 9.9; p = 0.02). Upstream defects were present in 35% cases: MDM2 amplification in 3 cases, all at diagnosis & relapse and p14ARF inactivation in 12/41 (29%) cases: 3 had p14ARF methylation, 2 after chemotherapy, and 9 had homozygous deletions, 8 at diagnosis and relapse. Conclusions: These results show that a high proportion of neuroblastomas which relapse have an abnormality in the p53 pathway. The majority have upstream defects suggesting that agents which reactivate wild-type p53 would be beneficial, in contrast to those with downstream defects where p53 independent therapies are indicated. PMID:20145180

  16. Ribosomal Protein Mutations Result in Constitutive p53 Protein Degradation through Impairment of the AKT Pathway

    PubMed Central

    Hermkens, Dorien; Wlodarski, Marcin W.; Da Costa, Lydie; MacInnes, Alyson W.

    2015-01-01

    Mutations in ribosomal protein (RP) genes can result in the loss of erythrocyte progenitor cells and cause severe anemia. This is seen in patients with Diamond-Blackfan anemia (DBA), a pure red cell aplasia and bone marrow failure syndrome that is almost exclusively linked to RP gene haploinsufficiency. While the mechanisms underlying the cytopenia phenotype of patients with these mutations are not completely understood, it is believed that stabilization of the p53 tumor suppressor protein may induce apoptosis in the progenitor cells. In stark contrast, tumor cells from zebrafish with RP gene haploinsufficiency are unable to stabilize p53 even when exposed to acute DNA damage despite transcribing wild type p53 normally. In this work we demonstrate that p53 has a limited role in eliciting the anemia phenotype of zebrafish models of DBA. In fact, we find that RP-deficient embryos exhibit the same normal p53 transcription, absence of p53 protein, and impaired p53 response to DNA damage as RP haploinsufficient tumor cells. Recently we reported that RP mutations suppress activity of the AKT pathway, and we show here that this suppression results in proteasomal degradation of p53. By re-activating the AKT pathway or by inhibiting GSK-3, a downstream modifier that normally represses AKT signaling, we are able to restore the stabilization of p53. Our work indicates that the anemia phenotype of zebrafish models of DBA is dependent on factors other than p53, and may hold clinical significance for both DBA and the increasing number of cancers revealing spontaneous mutations in RP genes. PMID:26132763

  17. Microbial Regulation of p53 Tumor Suppressor.

    PubMed

    Zaika, Alexander I; Wei, Jinxiong; Noto, Jennifer M; Peek, Richard M

    2015-09-01

    p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40). Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections. PMID:26379246

  18. Microbial Regulation of p53 Tumor Suppressor

    PubMed Central

    Zaika, Alexander I.; Wei, Jinxiong; Noto, Jennifer M.; Peek, Richard M.

    2015-01-01

    p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40). Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host–bacteria interactions and tumorigenesis associated with bacterial infections. PMID:26379246

  19. FOLATE AND VITAMIN B6 INTAKE AND RISK OF COLON CANCER IN RELATION TO P53 MUTATIONAL STATUS

    PubMed Central

    Schernhammer, Eva S.; Ogino, Shuji; Fuchs, Charles S.

    2009-01-01

    BACKGROUND AND AIMS Considerable evidence suggests a low-folate diet increases colorectal cancer risk, although a recent randomized trial indicates that folate supplementation may not reduce the risk of adenoma recurrence. In laboratory models, folate deficiency appears to induce p53 mutation. METHODS We immunohistochemically assayed p53 expression in paraffin-fixed colon cancer specimens in a large prospective cohort of women with 22 years of follow-up, to examine the relationship of folate intake and intake of other one-carbon nutrients to risks by tumor p53-mutational status. RESULTS A total of 399 incident colon cancers accessible for p53 expression were available. The effect of folate differed significantly according to p53 mutational status (Pheterogeneity = 0.01). Compared with women reporting less than 200 μg of folate per day, the multivariate relative risks (RRs) for p53 overexpressing (mutated) cancers were 0.54 (95% CI, 0.36-0.81) for women who consumed 200-299 μg per day, 0.42 (95% CI, 0.24-0.76) for those who consumed 300-399 μg per day, and 0.54 (95% CI, 0.35-0.83) for ≥ 400 μg per day. In contrast, total folate intake had no influence on wild-type tumors (RR, 1.05; 95% CI, 0.73-1.51, comparing ≥ 400 to < 200 μg per day). Similarly, high vitamin B6 intake conferred a protective effect on p53-mutated cancers (top versus bottom quintile, RR, 0.57; 95% CI, 0.35-0.94; Pheterogeneity = 0.01) but had no effect on p53 wild-type tumors. CONCLUSIONS We found that low folate and vitamin B6 intake was associated with an increased risk of p53 mutated colon cancers but not wild-type tumors. PMID:18619459

  20. Amifostine alleviates radiation-induced lethal small bowel damage via promotion of 14-3-3σ-mediated nuclear p53 accumulation.

    PubMed

    Huang, Eng-Yen; Wang, Feng-Sheng; Chen, Yu-Min; Chen, Yi-Fan; Wang, Chung-Chi; Lin, I-Hui; Huang, Yu-Jie; Yang, Kuender D

    2014-10-30

    Amifostine (AM) is a radioprotector that scavenges free radicals and is used in patients undergoing radiotherapy. p53 has long been implicated in cell cycle arrest for cellular repair after radiation exposure. We therefore investigated the protective p53-dependent mechanism of AM on small bowel damage after lethal whole-abdominal irradiation (WAI). AM increased both the survival rate of rats and crypt survival following lethal 18 Gy WAI. The p53 inhibitor PFT-α compromised AM-mediated effects when administered prior to AM administration. AM significantly increased clonogenic survival in IEC-6 cells expressing wild type p53 but not in p53 knockdown cells. AM significantly increased p53 nuclear accumulation and p53 tetramer expression before irradiation through the inhibition of p53 degradation. AM inhibited p53 interactions with MDM2 but enhanced p53 interactions with 14-3-3σ. Knockdown of 14-3-3σ also compromised the effect of AM on clonogenic survival and p53 nuclear accumulation in IEC-6 cells. For the first time, our data reveal that AM alleviates lethal small bowel damage through the induction of 14-3-3σ and subsequent accumulation of p53. Enhancement of the p53/14-3-3σ interaction results in p53 tetramerization in the nucleus that rescues lethal small bowel damage. PMID:25230151

  1. Mutant p53 cooperates with ETS and selectively up-regulates human MDR1 not MRP1.

    PubMed

    Sampath, J; Sun, D; Kidd, V J; Grenet, J; Gandhi, A; Shapiro, L H; Wang, Q; Zambetti, G P; Schuetz, J D

    2001-10-19

    The most frequently expressed drug resistance genes, MDR1 and MRP1, occur in human tumors with mutant p53. However, it was unknown if mutant p53 transcriptionally regulated both MDR1 and MRP1. We demonstrated that mutant p53 did not activate either the MRP1 promoter or the endogenous gene. In contrast, mutant p53 strongly up-regulated the MDR1 promoter and expression of the endogenous MDR1 gene. Notably, cells that expressed either a transcriptionally inactive mutant p53 or the empty vector showed no endogenous MDR1 up-regulation. Transcriptional activation of the MDR1 promoter by mutant p53 required an Ets binding site, and mutant p53 and Ets-1 synergistically activated MDR1 transcription. Biochemical analysis revealed that Ets-1 interacted exclusively with mutant p53s in vivo but not with wild-type p53. These findings are the first to demonstrate the induction of endogenous MDR1 by mutant p53 and provide insight into the mechanism. PMID:11483599

  2. MDM2 small-molecule antagonist RG7112 activates p53 signaling and regresses human tumors in preclinical cancer models.

    PubMed

    Tovar, Christian; Graves, Bradford; Packman, Kathryn; Filipovic, Zoran; Higgins, Brian; Xia, Mingxuan; Tardell, Christine; Garrido, Rosario; Lee, Edmund; Kolinsky, Kenneth; To, Kwong-Him; Linn, Michael; Podlaski, Frank; Wovkulich, Peter; Vu, Binh; Vassilev, Lyubomir T

    2013-04-15

    MDM2 negatively regulates p53 stability and many human tumors overproduce MDM2 as a mechanism to restrict p53 function. Thus, inhibitors of p53-MDM2 binding that can reactivate p53 in cancer cells may offer an effective approach for cancer therapy. RG7112 is a potent and selective member of the nutlin family of MDM2 antagonists currently in phase I clinical studies. RG7112 binds MDM2 with high affinity (K(D) ~ 11 nmol/L), blocking its interactions with p53 in vitro. A crystal structure of the RG7112-MDM2 complex revealed that the small molecule binds in the p53 pocket of MDM2, mimicking the interactions of critical p53 amino acid residues. Treatment of cancer cells expressing wild-type p53 with RG7112 activated the p53 pathway, leading to cell-cycle arrest and apoptosis. RG7112 showed potent antitumor activity against a panel of solid tumor cell lines. However, its apoptotic activity varied widely with the best response observed in osteosarcoma cells with MDM2 gene amplification. Interestingly, inhibition of caspase activity did not change the kinetics of p53-induced cell death. Oral administration of RG7112 to human xenograft-bearing mice at nontoxic concentrations caused dose-dependent changes in proliferation/apoptosis biomarkers as well as tumor inhibition and regression. Notably, RG7112 was highly synergistic with androgen deprivation in LNCaP xenograft tumors. Our findings offer a preclinical proof-of-concept that RG7112 is effective in treatment of solid tumors expressing wild-type p53. PMID:23400593

  3. Loss of Atrx sensitizes cells to DNA damaging agents through p53-mediated death pathways.

    PubMed

    Conte, Damiano; Huh, Michael; Goodall, Emma; Delorme, Marilyne; Parks, Robin J; Picketts, David J

    2012-01-01

    Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx(f/f) mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS) activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU). Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres) were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors. PMID:23284920

  4. Transcriptional Cross Talk between NF-κB and p53

    PubMed Central

    Webster, Gill A.; Perkins, Neil D.

    1999-01-01

    Many cellular stimuli result in the induction of both the tumor suppressor p53 and NF-κB. In contrast to activation of p53, which is associated with the induction of apoptosis, stimulation of NF-κB has been shown to promote resistance to programmed cell death. These observations suggest that a regulatory mechanism must exist to integrate these opposing outcomes and coordinate this critical cellular decision-making event. Here we show that both p53 and NF-κB inhibit each other’s ability to stimulate gene expression and that this process is controlled by the relative levels of each transcription factor. Expression of either wild-type p53 or the RelA(p65) NF-κB subunit suppresses stimulation of transcription by the other factor from a reporter plasmid in vivo. Moreover, endogenous, tumor necrosis factor alpha-activated NF-κB will inhibit endogenous wild-type p53 transactivation. Following exposure to UV light, however, the converse is observed, with p53 downregulating NF-κB-mediated transcriptional activation. Both p53 and RelA(p65) interact with the transcriptional coactivator proteins p300 and CREB-binding protein (CBP), and we demonstrate that these results are consistent with competition for a limiting pool of p300/CBP complexes in vivo. These observations have many implications for regulation of the transcriptional decision-making mechanisms that govern cellular processes such as apoptosis. Furthermore, they suggest a previously unrealized mechanism through which dysregulated NF-κB can contribute to tumorigenesis and disease. PMID:10207072

  5. The heme-p53 interaction: Linking iron metabolism to p53 signaling and tumorigenesis.

    PubMed

    Shen, Jia; Sheng, Xiangpeng; Chang, ZeNan; Wu, Qian; Xie, Dong; Wang, Fudi; Hu, Ronggui

    2016-01-01

    Recently, we reported that heme binds to tumor suppressor p53 protein (TP53, best known as p53) and promotes its nuclear export and cytosolic degradation, whereas iron chelation stabilizes p53 protein and suppresses tumors in a p53-dependent manner. This not only provides mechanistic insights into tumorigenesis associated with iron excess, but also helps guide the administration of chemotherapy based on iron deprivation in the clinic. PMID:27308524

  6. The heme–p53 interaction: Linking iron metabolism to p53 signaling and tumorigenesis

    PubMed Central

    Shen, Jia; Sheng, Xiangpeng; Chang, ZeNan; Wu, Qian; Xie, Dong; Wang, Fudi; Hu, Ronggui

    2016-01-01

    Recently, we reported that heme binds to tumor suppressor p53 protein (TP53, best known as p53) and promotes its nuclear export and cytosolic degradation, whereas iron chelation stabilizes p53 protein and suppresses tumors in a p53-dependent manner. This not only provides mechanistic insights into tumorigenesis associated with iron excess, but also helps guide the administration of chemotherapy based on iron deprivation in the clinic. PMID:27308524

  7. High incidence of lung, bone, and lymphoid tumors in transgenic mice overexpressing mutant alleles of the p53 oncogene.

    PubMed Central

    Lavigueur, A; Maltby, V; Mock, D; Rossant, J; Pawson, T; Bernstein, A

    1989-01-01

    We have investigated the role of the p53 gene in oncogenesis in vivo by generating transgenic mice carrying murine p53 genomic fragments isolated from a mouse Friend erythroleukemia cell line or BALB/c mouse liver DNA. Elevated levels of p53 mRNA were detected in several tissues of two transgenic lines tested. Increased levels of p53 protein were also detected in most of the tissues analyzed by Western blotting (immunoblotting). Because both transgenes encoded p53 proteins that were antigenically distinct from wild-type p53, it was possible to demonstrate that overexpression of the p53 protein was mostly, if not entirely, due to the expression of the transgenes. Neoplasms developed in 20% of the transgenic mice, with a high incidence of lung adenocarcinomas, osteosarcomas, and lymphomas. Tissues such as ovaries that expressed the transgene at high levels were not at higher risk of malignant transformation than tissues expressing p53 protein at much lower levels. The long latent period and low penetrance suggest that overexpression of p53 alone is not sufficient to induce malignancies and that additional events are required. These observations provide direct evidence that mutant alleles of the p53 oncogene have oncogenic potential in vivo and that different cell types show intrinsic differences in susceptibility to malignant transformation by p53. Since recent data suggest that p53 may be a recessive oncogene, it is possible that the elevated tumor incidence results from functional inactivation of endogenous p53 by overexpression of the mutant transgene. The high incidence of lung and bone tumors suggests that p53 transgenic mice may provide a useful model to investigate the molecular events that underlie these malignancies in humans. Images PMID:2476668

  8. Modulation of p53-mediated transcriptional repression and apoptosis by the adenovirus E1B 19K protein.

    PubMed Central

    Sabbatini, P; Chiou, S K; Rao, L; White, E

    1995-01-01

    BRK cell lines that stably express adenovirus E1A and a murine temperature-sensitive p53 undergo apoptosis when p53 assumes the wild-type conformation. Expression of the E1B 19,000-molecular-weight (19K) protein rescues cells from this p53-mediated apoptosis and diverts cells to a growth-arrested state. As p53 likely functions as a tumor suppressor by regulating transcription, the ability of the E1B 19K protein to regulate p53-mediated transactivation and transcriptional repression was investigated. In promoter-reporter assays the E1B 19K did not block p53-mediated transactivation but did alleviate p53-mediated transcriptional repression. E1B 19K expression permitted efficient transcriptional activation of the p21/WAF-1/cip-1 mRNA by p53, consistent with maintenance of the growth arrest function of p53. The E1B 19K protein is thereby unique among DNA virus-transforming proteins that target p53 for inactivation in that it selectively modulates the transcriptional properties of p53. The E1B 19K protein also rescued cells from apoptosis induced by inhibitors of transcription and protein synthesis. This suggests that cell death may result from the inhibition of expression of survival factors which function to maintain cell viability. p53 may induce apoptosis through generalized transcriptional repression. In turn, the E1B 19K protein may prevent p53-mediated apoptosis by alleviating p53-mediated transcriptional repression. PMID:7823921

  9. Downregulation of GLS2 in glioblastoma cells is related to DNA hypermethylation but not to the p53 status.

    PubMed

    Szeliga, Monika; Bogacińska-Karaś, Małgorzata; Kuźmicz, Katarzyna; Rola, Radosław; Albrecht, Jan

    2016-09-01

    Human phosphate-activated glutaminase (GA) is encoded by two genes: GLS and GLS2. Glioblastomas (GB) usually lack GLS2 transcripts, and their reintroduction inhibits GB growth. The GLS2 gene in peripheral tumors may be i) methylation- controlled and ii) a target of tumor suppressor p53 often mutated in gliomas. Here we assessed the relation of GLS2 downregulation in GB to its methylation and TP53 status. DNA demethylation with 5-aza-2'-deoxycytidine restored GLS2 mRNA and protein content in human GB cell lines with both mutated (T98G) and wild-type (U87MG) p53 and reduced the methylation of CpG1 (promoter region island), and CpG2 (first intron island) in both cell lines. In cell lines and clinical GB samples alike, methylated CpG islands were detected both in the GLS2 promoter (as reported earlier) and in the first intron of this gene. CpG methylation of either island was absent in GLS2-expressing non-tumoros brain tissues. Screening for mutation in the exons 5-8 of TP53 revealed a point mutation in only one out of seven GB examined. In conclusion, aberrant methylation of CpG islands, appear to contribute to silencing of GLS2 in GB by a mechanism bypassing TP53 mutations. © 2015 Wiley Periodicals, Inc. PMID:26258493

  10. The Expression Levels of XLF and Mutant P53 Are Inversely Correlated in Head and Neck Cancer Cells

    PubMed Central

    Feng, Sizhe; Rabii, Ramin; Liang, Guobiao; Song, Chenxi; Chen, Wei; Guo, Mian; Wei, Xuezhong; Messadi, Diana; Hu, Shen

    2016-01-01

    XRCC4-like factor (XLF), also known as Cernunnos, is a protein encoded by the human NHEJ1 gene and an important repair factor for DNA double-strand breaks. In this study, we have found that XLF is over-expressed in HPV(+) versus HPV(-) head and neck squamous cell carcinoma (HNSCC) and significantly down-regulated in the HNSCC cell lines expressing high level of mutant p53 protein versus those cell lines harboring wild-type TP53 gene with low p53 protein expression. We have also demonstrated that Werner syndrome protein (WRN), a member of the NHEJ repair pathway, binds to both mutant p53 protein and NHEJ1 gene promoter, and siRNA knockdown of WRN leads to the inhibition of XLF expression in the HNSCC cells. Collectively, these findings suggest that WRN and p53 are involved in the regulation of XLF expression and the activity of WRN might be affected by mutant p53 protein in the HNSCC cells with aberrant TP53 gene mutations, due to the interaction of mutant p53 with WRN. As a result, the expression of XLF in these cancer cells is significantly suppressed. Our study also suggests that XLF is over-expressed in HPV(+) HNSCC with low expression of wild type p53, and might serve as a potential biomarker for HPV(+) HNSCC. Further studies are warranted to investigate the mechanisms underlying the interactive role of WRN and XLF in NHEJ repair pathway. PMID:27471552

  11. The Expression Levels of XLF and Mutant P53 Are Inversely Correlated in Head and Neck Cancer Cells.

    PubMed

    Feng, Sizhe; Rabii, Ramin; Liang, Guobiao; Song, Chenxi; Chen, Wei; Guo, Mian; Wei, Xuezhong; Messadi, Diana; Hu, Shen

    2016-01-01

    XRCC4-like factor (XLF), also known as Cernunnos, is a protein encoded by the human NHEJ1 gene and an important repair factor for DNA double-strand breaks. In this study, we have found that XLF is over-expressed in HPV(+) versus HPV(-) head and neck squamous cell carcinoma (HNSCC) and significantly down-regulated in the HNSCC cell lines expressing high level of mutant p53 protein versus those cell lines harboring wild-type TP53 gene with low p53 protein expression. We have also demonstrated that Werner syndrome protein (WRN), a member of the NHEJ repair pathway, binds to both mutant p53 protein and NHEJ1 gene promoter, and siRNA knockdown of WRN leads to the inhibition of XLF expression in the HNSCC cells. Collectively, these findings suggest that WRN and p53 are involved in the regulation of XLF expression and the activity of WRN might be affected by mutant p53 protein in the HNSCC cells with aberrant TP53 gene mutations, due to the interaction of mutant p53 with WRN. As a result, the expression of XLF in these cancer cells is significantly suppressed. Our study also suggests that XLF is over-expressed in HPV(+) HNSCC with low expression of wild type p53, and might serve as a potential biomarker for HPV(+) HNSCC. Further studies are warranted to investigate the mechanisms underlying the interactive role of WRN and XLF in NHEJ repair pathway. PMID:27471552

  12. Replication of ONYX-015, a Potential Anticancer Adenovirus, Is Independent of p53 Status in Tumor Cells

    PubMed Central

    Rothmann, Thomas; Hengstermann, Arnd; Whitaker, Noel J.; Scheffner, Martin; zur Hausen, Harald

    1998-01-01

    The 55-kDa E1B protein of adenovirus, which binds to and inactivates the tumor suppressor protein p53, is not expressed in the adenoviral mutant termed ONYX-015 (i.e., dl1520). It was reported that the mutant virus due to a deletion in E1B is able to replicate only in cells deficient for wild-type p53. Accordingly, dl1520 is currently being evaluated as a potential tool in the therapy of p53 deficient cancers. In contrast, we report here that dl1520 replicates independently of the p53 status in various tumor cell lines (U87, RKO, A549, H1299, and U373). In addition, the inhibition of p53-mediated transcriptional activation in wild-type p53 containing U2OS cells, by overexpression of a transdominant negative p53 mutant, did not render the cells permissive for dl1520 replication. Finally, we show that, depending on the multiplicity of infection, the deleted virus is able to replicate in and to kill primary human cells. Thus, the molecular basis for the growth differences of dl1520 within different cell types remains to be determined. PMID:9811680

  13. Unequal prognostic potentials of p53 gain-of-function mutations in human cancers associate with drug-metabolizing activity.

    PubMed

    Xu, J; Wang, J; Hu, Y; Qian, J; Xu, B; Chen, H; Zou, W; Fang, J-Y

    2014-01-01

    Mutation of p53 is the most common genetic change in human cancer, causing complex effects including not only loss of wild-type function but also gain of novel oncogenic functions (GOF). It is increasingly likely that p53-hotspot mutations may confer different types and magnitudes of GOF, but the evidences are mainly supported by cellular and transgenic animal models. Here we combine large-scale cancer genomic data to characterize the prognostic significance of different p53 mutations in human cancers. Unexpectedly, only mutations on the Arg248 and Arg282 positions displayed significant association with shorter patient survival, but such association was not evident for other hotspot GOF mutations. Gene set enrichment analysis on these mutations revealed higher activity of drug-metabolizing enzymes, including the CYP3A4 cytochrome P450. Ectopic expression of p53 mutant R282W in H1299 and SaOS2 cells significantly upregulated CYP3A4 mRNA and protein levels, and cancer cell lines bearing mortality-associated p53 mutations display higher CYP3A4 expression and resistance to several CYP3A4-metabolized chemotherapeutic drugs. Our results suggest that p53 mutations have unequal GOF activities in human cancers, and future evaluation of p53 as a cancer biomarker should consider which mutation is present in the tumor, rather than having comparison between wild-type and mutant genotypes. PMID:24603336

  14. Expression of p53β and Δ133p53 isoforms in different gastric tissues

    PubMed Central

    Ji, Wansheng; Zhang, Na; Zhang, Hongmei; Ma, Jingrong; Zhong, Hua; Jiao, Jianxin; Gao, Zhixing

    2015-01-01

    This study aims to detect the mRNA of p53β and Δ133p53 isoforms in three gastric carcinoma cell lines and tissues of superficial gastritis, atrophic gastritis, gastric carcinoma, or paracancerous area. Nested reverse transcription PCR was used to detect the mRNA of p53β and Δ133p53 isoforms in tissues of superficial gastritis, chronic atrophic gastritis, gastric cancer cell lines (SGC-7901, MKN45, KATO III), gastric adenocarcinoma, and paracancerous lesion. The amplified products were shown by agarose gel electrophoresis. The expression difference among various tissues was analyzed by x2 tests. The positive rates of ∆133p53 mRNA were 73.3% (11/15) in gastric adenocarcinoma and 20% (3/15) in paracancerous tissue, whereas the positive rates of p53β mRNA were 20% (3/15) in gastric adenocarcinoma and 66.7% (10/15) in paracancerous tissue. The difference between adenocarcinoma and paracancerous tissues was significant (P<0.05). The positive rates of ∆133p53 mRNA were 25% (5/20), 50% (15/30), and 75% (15/20), respectively, in superficial gastritis, atrophic gastritis, and gastric adenocarcinoma; the positive rates of p53β mRNA were 65% (13/20), 33.3% (10/30), and 25% (5/20), respectively, in superficial gastritis, atrophic gastritis, and gastric adenocarcinoma. The difference between adenocarcinoma and superficial gastritis samples was significant (P<0.05). Both p53β and ∆133p53 mRNAs were positive in MKN45; only p53β mRNA was detected in SGC7901; neither p53β nor ∆133p53 mRNA was detected in KATO III. ∆133p53 and p53β, which are possible indicators for the diagnosis and biological therapy of gastric carcinoma, were expressed differentially in different gastric tissues. PMID:26617756

  15. A distinct p53 target gene set predicts for response to the selective p53–HDM2 inhibitor NVP-CGM097

    PubMed Central

    Jeay, Sébastien; Gaulis, Swann; Ferretti, Stéphane; Bitter, Hans; Ito, Moriko; Valat, Thérèse; Murakami, Masato; Ruetz, Stephan; Guthy, Daniel A; Rynn, Caroline; Jensen, Michael R; Wiesmann, Marion; Kallen, Joerg; Furet, Pascal; Gessier, François; Holzer, Philipp; Masuya, Keiichi; Würthner, Jens; Halilovic, Ensar; Hofmann, Francesco; Sellers, William R; Graus Porta, Diana

    2015-01-01

    Biomarkers for patient selection are essential for the successful and rapid development of emerging targeted anti-cancer therapeutics. In this study, we report the discovery of a novel patient selection strategy for the p53–HDM2 inhibitor NVP-CGM097, currently under evaluation in clinical trials. By intersecting high-throughput cell line sensitivity data with genomic data, we have identified a gene expression signature consisting of 13 up-regulated genes that predicts for sensitivity to NVP-CGM097 in both cell lines and in patient-derived tumor xenograft models. Interestingly, these 13 genes are known p53 downstream target genes, suggesting that the identified gene signature reflects the presence of at least a partially activated p53 pathway in NVP-CGM097-sensitive tumors. Together, our findings provide evidence for the use of this newly identified predictive gene signature to refine the selection of patients with wild-type p53 tumors and increase the likelihood of response to treatment with p53–HDM2 inhibitors, such as NVP-CGM097. DOI: http://dx.doi.org/10.7554/eLife.06498.001 PMID:25965177

  16. p53 and Mitochondrial Function in Neurons

    PubMed Central

    Wang, David B.; Kinoshita, Chizuru; Kinoshita, Yoshito; Morrison, Richard S.

    2014-01-01

    The p53 tumor suppressor plays a central role in dictating cell survival and death as a cellular sensor for a myriad of stresses including DNA damage, oxidative and nutritional stress, ischemia and disruption of nucleolar function. Activation of p53-dependent apoptosis leads to mitochondrial apoptotic changes via the intrinsic and extrinsic pathways triggering cell death execution most notably by release of cytochrome c and activation of the caspase cascade. Although it was previously believed that p53 induces apoptotic mitochondrial changes exclusively through transcription-dependent mechanisms, recent studies suggest that p53 also regulates apoptosis via a transcription-independent action at the mitochondria. Recent evidence further suggests that p53 can regulate necrotic cell death and autophagic activity including mitophagy. An increasing number of cytosolic and mitochondrial proteins involved in mitochondrial metabolism and respiration are regulated by p53, which influences mitochondrial ROS production as well. Cellular redox homeostasis is also directly regulated by p53 through modified expression of pro- and anti-oxidant proteins. Proper regulation of mitochondrial size and shape through fission and fusion assures optimal mitochondrial bioenergetic function while enabling adequate mitochondrial transport to accommodate local energy demands unique to neuronal architecture. Abnormal regulation of mitochondrial dynamics has been increasingly implicated in neurodegeneration, where elevated levels of p53 may have a direct contribution as the expression of some fission/fusion proteins are directly regulated by p53. Thus, p53 may have a much wider influence on mitochondrial integrity and function than one would expect from its well-established ability to transcriptionally induce mitochondrial apoptosis. However, much of the evidence demonstrating that p53 can influence mitochondria through nuclear, cytosolic or intra-mitochondrial sites of action has yet to be

  17. Rational Tuning of the Electrocatalytic Nanobiointerface for a "Turn-Off" Biofuel-Cell-Based Self-Powered Biosensor for p53 Protein.

    PubMed

    Han, Yajing; Chabu, Johnny Muya; Hu, Shengqiang; Deng, Liu; Liu, You-Nian; Guo, Shaojun

    2015-09-01

    Herein, a novel tunable electrocatalytic nanobiointerface for the construction of a high-sensitivity and high-selectivity biofuel-cell (BFC)-based self-powered biosensor for the detection of transcription factor protein p53 is reported, in which bilirubin oxidase (BOD)/DNA supramolecular modified graphene/platinum nanoparticles hybrid nanosheet (GPNHN) works as a new enhanced material of biocathode to control the attachment of target, and thus tune the electron-transfer process of oxygen reduction for transducing signaling magnification. It is found that in the presence of p53, the strong interaction between the wild-type p53 and its consensus DNA sequence on the electrode surface can block the electron transfer from the BOD to the electrode, thus providing a good opportunity for reducing the electrocatalytic activity of oxygen reduction in the biocathode. This in combination with the glucose oxidation at the carbon nanotube/Meldola's blue/glucose dehydrogenase bioanode can result in a current/or power decrease of BFC in the presence of wild-type p53. The specially designed BFC-based self-powered p53 sensor shows a wide linear range from 1 pM to 1 μM with a detection limit of 1 pM for analyzing wild-type p53. Most importantly, our BFC-based self-powered sensors can detect the concentrations of wild-type p53 in normal and cancer cell lysates without any extensive sample pretreatment/separation or specialized instruments. The present BFC-based self-powered sensor can provide a simple, economical, sensitive, and rapid way for analyzing p53 protein in normal and cancer cells at clinical level, which shows great potential for creating the treatment modalities that capitalize on the concentration variation of the wild-type p53. PMID:26211519

  18. Chk1/2 inhibition overcomes the cisplatin resistance of head and neck cancer cells secondary to the loss of functional p53

    PubMed Central

    Gadhikar, Mayur A.; Sciuto, Maria Rita; Alves, Marcus Vinicius Ortega; Pickering, Curtis R.; Osman, Abdullah A.; Neskey, David M.; Zhao, Mei; Fitzgerald, Alison L.; Myers, Jeffrey N.; Frederick, Mitchell J

    2014-01-01

    Despite the use of multimodality therapy employing cisplatin to treat patients with advanced stage head and neck squamous cell carcinoma (HNSCC), there is an unacceptably high rate of treatment failure. TP53 is the most commonly mutated gene in HNSCC, and the impact of p53 mutation on response to cisplatin treatment is poorly understood. Here we show unambiguously that wild type TP53 (wtp53) is associated with sensitivity of HNSCC cells to cisplatin treatment while mutation or loss of TP53 is associated with cisplatin resistance. We also demonstrate that senescence is the major cellular response to cisplatin in wtp53 HNSCC cells and that cisplatin resistance in p53 null or mutant TP53 cells is due to their lack of senescence. Given the dependence on Chk1/2 kinases to mediate the DNA damage response in p53 deficient cells, there is potential to exploit this to therapeutic advantage through targeted inhibition of the Chk1/2 kinases. Treatment of p53 deficient HNSCC cells with the Chk inhibitor AZD7762 sensitizes them to cisplatin through induction of mitotic cell death. This is the first report demonstrating the ability of a Chk kinase inhibitor to sensitize TP53-deficient HNSCC to cisplatin in a synthetic lethal manner, which has significance given the frequency of TP53 mutations in this disease and because cisplatin has become part of standard therapy for aggressive HNSCC tumors. These pre-clinical data provide evidence that a personalized approach to the treatment of HNSCC based on Chk inhibition in p53 mutant tumors may be feasible. PMID:23839309

  19. Chk1/2 inhibition overcomes the cisplatin resistance of head and neck cancer cells secondary to the loss of functional p53.

    PubMed

    Gadhikar, Mayur A; Sciuto, Maria Rita; Alves, Marcus Vinicius Ortega; Pickering, Curtis R; Osman, Abdullah A; Neskey, David M; Zhao, Mei; Fitzgerald, Alison L; Myers, Jeffrey N; Frederick, Mitchell J

    2013-09-01

    Despite the use of multimodality therapy using cisplatin to treat patients with advanced stage squamous cell carcinoma of the head and neck (HNSCC), there is an unacceptably high rate of treatment failure. TP53 is the most commonly mutated gene in HNSCC, and the impact of p53 mutation on response to cisplatin treatment is poorly understood. Here, we show unambiguously that wild-type TP53 (wtp53) is associated with sensitivity of HNSCC cells to cisplatin treatment, whereas mutation or loss of TP53 is associated with cisplatin resistance. We also show that senescence is the major cellular response to cisplatin in wtp53 HNSCC cells and that cisplatin resistance in p53-null or -mutant TP53 cells is due to their lack of senescence. Given the dependence on checkpoint kinase (Chk)1/2 kinases to mediate the DNA damage response in p53-deficient cells, there is potential to exploit this to therapeutic advantage through targeted inhibition of the Chk1/2 kinases. Treatment of p53-deficient HNSCC cells with the Chk inhibitor AZD7762 sensitizes them to cisplatin through induction of mitotic cell death. This is the first report showing the ability of a Chk kinase inhibitor to sensitize TP53-deficient HNSCC to cisplatin in a synthetic lethal manner, which has significance given the frequency of TP53 mutations in this disease and because cisplatin has become part of standard therapy for aggressive HNSCC tumors. These preclinical data provide evidence that a personalized approach to the treatment of HNSCC based on Chk inhibition in p53-mutant tumors may be feasible. PMID:23839309

  20. Radiosensitization of Non-Small Cell Lung Cancer Cells by Inhibition of TGF-β1 Signaling With SB431542 Is Dependent on p53 Status.

    PubMed

    Zhao, Yifan; Wang, Longxiao; Huang, Qianyi; Jiang, Youqin; Wang, Jingdong; Zhang, Liyuan; Tian, Ye; Yang, Hongying

    2016-01-01

    Although medically inoperable patients with stage I non-small cell lung cancer cells (NSCLC) are often treated with stereotactic body radiation therapy, its efficacy can be compromised due to poor radiosensitivity of cancer cells. Inhibition of transforming growth factor-β1 (TGF-β1) using LY364947 and LY2109761 has been demonstrated to radiosensitize cancer cells such as breast cancer, glioblastoma, and lung cancer. Our previous results have demonstrated that another potent and selective inhibitor of TGF-β1 receptor kinases, SB431542, could radiosensitize H460 cells both in vitro and in vivo. In the present study, we investigated whether SB431542 could radiosensitize other NSCLC cell lines, trying to explore the potential implication of this TGF-β1 inhibitor in radiotherapy for NSCLC patients. The results showed that A549 cells were significantly radiosensitized by SB431542, whereas no radiosensitizing effect was observed in H1299 cells. Interestingly, both H460 and A549 cells have wild-type p53, while H1299 cells have deficient p53. To study whether the radiosensitizing effect of SB431542 was associated with p53 status of cancer cells, the p53 of H460 cells was silenced using shRNA transfection. Then it was found that the radiosensitizing effect of SB431542 on H460 cells was not observed in H460 cells with silenced p53. Moreover, X-irradiation caused rapid Smad2 activation in H460 and A549 cells but not in H1299 and H460 cells with silenced p53. The Smad2 activation postirradiation could be abolished by SB431542. This may explain the lack of radiosensitizing effect of SB431542 in H1299 and H460 cells with silenced p53. Thus, we concluded that the radiosensitizing effect of inhibition of TGF-β1 signaling in NSCLC cells by SB431542 was p53 dependent, suggesting that using TGF-β1 inhibitor in radiotherapy may be more complicated than previously thought and may need further investigation. PMID:27178816

  1. p53-independent functions of the p19ARF tumor suppressor

    PubMed Central

    Weber, Jason D.; Jeffers, John R.; Rehg, Jerold E.; Randle, David H.; Lozano, Guillermina; Roussel, Martine F.; Sherr, Charles J.; Zambetti, Gerard P.

    2000-01-01

    The p19ARF tumor suppressor antagonizes Mdm2 to induce p53-dependent cell cycle arrest. Individual TKO (triple knock out) mice nullizygous for ARF, p53, and Mdm2 develop multiple tumors at a frequency greater than those observed in animals lacking both p53 and Mdm2 or p53 alone, demonstrating that p19ARF can act independently of the Mdm2-p53 axis in tumor surveillance. Reintroduction of ARF into TKO mouse embryo fibroblasts (MEFs), but not into those lacking both p53 and ARF, arrested the cell division cycle in the G1 phase. Inhibition of the retinoblastoma protein had no effect on the ability of ARF to arrest TKO MEFs. Thus, in the absence of Mdm2, p19ARF interacts with other targets to inhibit cell proliferation. PMID:10995391

  2. Simian virus 40 T antigen can regulate p53-mediated transcription independent of binding p53.

    PubMed Central

    Rushton, J J; Jiang, D; Srinivasan, A; Pipas, J M; Robbins, P D

    1997-01-01

    A simian virus 40 (SV40) T-antigen mutant containing only the N-terminal 136 amino acids, able to bind to Rb and p300 but not p53, partially inhibited p53-mediated transcription without affecting the ability of p53 to bind DNA. These results suggest that SV40 T antigen can regulate p53-mediated transcription either directly through protein-protein association or indirectly through interaction with factors which may function to confer p53-mediated transcription. PMID:9188637

  3. Role of Peroxiredoxin I in Rectal Cancer and Related to p53 Status

    SciTech Connect

    Chen, Miao-Fen; Lee, Kuan-Der; Yeh, Chung-Hung; Chen, Wen-Cheng; Huang, Wen-Shih; Chin, Chih-Chien; Lin, Paul- Yang; Wang, Jeng-Yi

    2010-11-01

    Background: Neoadjuvant chemoradiotherapy is widely accepted for the treatment of localized rectal cancer. Although peroxiredoxin I (PrxI) and p53 have been implicated in carcinogenesis and cancer treatment, the role of PrxI and its interaction with p53 in the prognosis and treatment response of rectal cancer remain relatively unstudied. Methods and Materials: In the present study, we examined the levels of PrxI and p53 in rectal cancer patients using membrane arrays and compared them with normal population samples. To demonstrate the biologic changes after manipulation of PrxI expression, we established stable transfectants of HCT-116 (wild-type p53) and HT-29 (mutant p53) cells with a PrxI silencing vector. The predictive capacities of PrxI and p53 were also assessed by relating the immunohistochemical staining of a retrospective series of rectal cancer cases to the clinical outcome. Results: The membrane array and immunochemical staining data showed that PrxI, but not p53, was significantly associated with the tumor burden. Our immunochemistry findings further indicated that PrxI positivity was linked to a poor response to neoadjuvant therapy and worse survival. In cellular and animal experiments, the inhibition of PrxI significantly decreased tumor growth and sensitized the tumor to irradiation, as indicated by a lower capacity to scavenge reactive oxygen species and more extensive DNA damage. The p53 status might have contributed to the difference between HCT-116 and HT-29 after knockdown of PrxI. Conclusion: According to our data, the level of PrxI combined with the p53 status is relevant to the prognosis and the treatment response. We suggested that PrxI might be a new biomarker for rectal cancer.

  4. p53 Mutation suppresses adult neurogenesis in medaka fish (Oryzias latipes)

    SciTech Connect

    Isoe, Yasuko; Okuyama, Teruhiro; Taniguchi, Yoshihito; Kubo, Takeo; Takeuchi, Hideaki

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer Progenitor migration is accompanied by an increase in their numbers in the adult brain. Black-Right-Pointing-Pointer p53 Mutation suppressed an increase in the number of the migrated progenitors. Black-Right-Pointing-Pointer The decreased progenitor number is not due to enhanced cell death. Black-Right-Pointing-Pointer p53 Mutation did not affect proliferation of stem cells. -- Abstract: Tumor suppressor p53 negatively regulates self-renewal of neural stem cells in the adult murine brain. Here, we report that the p53 null mutation in medaka fish (Oryzias latipes) suppressed neurogenesis in the telencephalon, independent of cell death. By using 5-bromo-29-deoxyuridine (BrdU) immunohistochemistry, we identified 18 proliferation zones in the brains of young medaka fish; in situ hybridization showed that p53 was expressed selectively in at least 12 proliferation zones. We also compared the number of BrdU-positive cells present in the whole telencephalon of wild-type (WT) and p53 mutant fish. Immediately after BrdU exposure, the number of BrdU-positive cells did not differ significantly between them. One week after BrdU-exposure, the BrdU-positive cells migrated from the proliferation zone, which was accompanied by an increased number in the WT brain. In contrast, no significant increase was observed in the p53 mutant brain. Terminal deoxynucleotidyl transferase (dUTP) nick end-labeling revealed that there was no significant difference in the number of apoptotic cells in the telencephalon of p53 mutant and WT medaka, suggesting that the decreased number of BrdU-positive cells in the mutant may be due to the suppression of proliferation rather than the enhancement of neural cell death. These results suggest that p53 positively regulates neurogenesis via cell proliferation.

  5. Structural proteins of Kaposi's sarcoma-associated herpesvirus antagonize p53-mediated apoptosis.

    PubMed

    Chudasama, P; Konrad, A; Jochmann, R; Lausen, B; Holz, P; Naschberger, E; Neipel, F; Britzen-Laurent, N; Stürzl, M

    2015-01-29

    The tumor suppressor p53 is a central regulatory molecule of apoptosis and is commonly mutated in tumors. Kaposi's sarcoma-associated herpesvirus (KSHV)-related malignancies express wild-type p53. Accordingly, KSHV encodes proteins that counteract the cell death-inducing effects of p53. Here, the effects of all KSHV genes on the p53 signaling pathway were systematically analyzed using the reversely transfected cell microarray technology. With this approach we detected eight KSHV-encoded genes with potent p53 inhibiting activity in addition to the previously described inhibitory effects of KSHV genes ORF50, K10 and K10.5. Interestingly, the three most potent newly identified inhibitors were KSHV structural proteins, namely ORF22 (glycoprotein H), ORF25 (major capsid protein) and ORF64 (tegument protein). Validation of these results with a classical transfection approach showed that these proteins inhibited p53 signaling in a dose-dependent manner and that this effect could be reversed by small interfering RNA-mediated knockdown of the respective viral gene. All three genes inhibited p53-mediated apoptosis in response to Nutlin-3 treatment in non-infected and KSHV-infected cells. Addressing putative mechanisms, we could show that these proteins could also inhibit the transactivation of the promoters of apoptotic mediators of p53 such as BAX and PIG3. Altogether, we demonstrate for the first time that structural proteins of KSHV can counteract p53-induced apoptosis. These proteins are expressed in the late lytic phase of the viral life cycle and are incorporated into the KSHV virion. Accordingly, these genes may inhibit cell death in the productive and in the early entrance phase of KSHV infection. PMID:24469037

  6. Hepatitis B virus X protein inhibits p53 sequence-specific DNA binding, transcriptional activity, and association with transcription factor ERCC3.

    PubMed Central

    Wang, X W; Forrester, K; Yeh, H; Feitelson, M A; Gu, J R; Harris, C C

    1994-01-01

    Chronic active hepatitis caused by infection with hepatitis B virus, a DNA virus, is a major risk factor for human hepatocellular carcinoma. Since the oncogenicity of several DNA viruses is dependent on the interaction of their viral oncoproteins with cellular tumor-suppressor gene products, we investigated the interaction between hepatitis B virus X protein (HBX) and human wild-type p53 protein. HBX complexes with the wild-type p53 protein and inhibits its sequence-specific DNA binding in vitro. HBX expression also inhibits p53-mediated transcriptional activation in vivo and the in vitro association of p53 and ERCC3, a general transcription factor involved in nucleotide excision repair. Therefore, HBX may affect a wide range of p53 functions and contribute to the molecular pathogenesis of human hepatocellular carcinoma. Images PMID:8134379

  7. Transcriptional regulation of the human glycoprotein hormone common alpha subunit gene by cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and p53.

    PubMed Central

    Zhang, Xian; Grand, Roger J A; McCabe, Christopher J; Franklyn, Jayne A; Gallimore, Phillip H; Turnell, Andrew S

    2002-01-01

    We have investigated the functional interactions between adenovirus early region 1A (AdE1A) protein, the co-activators cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and SUG1, and the transcriptional repressor retinoblastoma (Rb) in mediating T3-dependent repression. Utilizing the human glycoprotein hormone common alpha-subunit (alpha-subunit) promoter and AdE1A mutants with selective binding capacity to these molecules we have determined an essential role for CBP/p300. In normal circumstances, wild-type 12 S AdE1A inhibited alpha-subunit activity. In contrast, adenovirus mutants that retain both the SUG1- and Rb-binding sites, but lack the CBP/p300-binding site, were unable to repress promoter activity. We have also identified a role for the tumour-suppressor gene product p53 in regulation of the alpha-subunit promoter. Akin to 12 S AdE1A, exogenous p53 expression repressed alpha-subunit activity. This function resided in the ability of p53 to interact with CBP/p300; an N-terminal mutant incapable of interacting with CBP/p300 did not inhibit alpha-subunit activity. Stabilization of endogenous p53 by UV irradiation also correlated positively with reduced alpha-subunit activity. Intriguingly, T3 stimulated endogenous p53 transcriptional activity, implicating p53 in T3-dependent signalling pathways. These data indicate that CBP/p300 and p53 are key regulators of alpha-subunit activity. PMID:12164786

  8. Irradiation-injured brain tissues can self-renew in the absence of the pivotal tumor suppressor p53 in the medaka (Oryzias latipes) embryo

    PubMed Central

    Yasuda, Takako; Kimori, Yoshitaka; Nagata, Kento; Igarashi, Kento; Watanabe-Asaka, Tomomi; Oda, Shoji; Mitani, Hiroshi

    2016-01-01

    The tumor suppressor protein, p53, plays pivotal roles in regulating apoptosis and proliferation in the embryonic and adult central nervous system (CNS) following neuronal injuries such as those induced by ionizing radiation. There is increasing evidence that p53 negatively regulates the self-renewal of neural stem cells in the adult murine brain; however, it is still unknown whether p53 is essential for self-renewal in the injured developing CNS. Previously, we demonstrated that the numbers of apoptotic cells in medaka (Oryzias latipes) embryos decreased in the absence of p53 at 12–24 h after irradiation with 10-Gy gamma rays. Here, we used histology to examine the later morphological development of the irradiated medaka brain. In p53-deficient larvae, the embryonic brain possessed similar vacuoles in the brain and retina, although the vacuoles were much smaller and fewer than those found in wild-type embryos. At the time of hatching (6 days after irradiation), no brain abnormality was observed. In contrast, severe disorganized neuronal arrangements were still present in the brain of irradiated wild-type embryos. Our present results demonstrated that self-renewal of the brain tissue completed faster in the absence of p53 than wild type at the time of hatching because p53 reduces the acute severe neural apoptosis induced by irradiation, suggesting that p53 is not essential for tissue self-renewal in developing brain. PMID:26410759

  9. Crocetin exploits p53-induced death domain (PIDD) and FAS-associated death domain (FADD) proteins to induce apoptosis in colorectal cancer.

    PubMed

    Ray, Pallab; Guha, Deblina; Chakraborty, Juni; Banerjee, Shuvomoy; Adhikary, Arghya; Chakraborty, Samik; Das, Tanya; Sa, Gaurisankar

    2016-01-01

    Tumor suppressor p53 preserves the genomic integrity by restricting anomaly at the gene level. The hotspots for mutation in half of all colon cancers reside in p53. Hence, in a p53-mutated cellular milieu targeting cancer cells may be achievable by targeting the paralogue(s) of p53. Here we have shown the effectiveness of crocetin, a dietary component, in inducing apoptosis of colon cancer cells with varying p53 status. In wild-type p53-expressing cancer cells, p53 in one hand transactivates BAX and in parallel up-regulates p53-induced death domain protein (PIDD) that in turn cleaves and activates BID through caspase-2. Both BAX and t-BID converge at mitochondria to alter the transmembrane potential thereby leading to caspase-9 and caspase-3-mediated apoptosis. In contrast, in functional p53-impaired cells, this phytochemical exploits p53-paralogue p73, which up-regulates FAS to cleave BID through FAS-FADD-caspase-8-pathway. These findings not only underline the phenomenon of functional switch-over from p53 to p73 in p53-impaired condition, but also validate p73 as a promising and potential target for cancer therapy in absence of functional p53. PMID:27622714

  10. Expression of p53 in endometrial polyps with special reference to the p53 signature.

    PubMed

    Sho, Tomoko; Hachisuga, Toru; Kawagoe, Toshinori; Urabe, Rie; Kurita, Tomoko; Kagami, Seiji; Shimajiri, Shohei; Fujino, Yoshihisa

    2016-07-01

    We herein examined the significance of the p53 expression in endometrial polyps (EMPs). A total of 133 EMPs, including 62 premenopausal and 71 postmenopausal women with EMP, were immunohistochemically studied for the expression of estrogen receptor (ER)-alpha, Ki-67 and p53. Apoptotic cells were identified using a TUNEL assay. A DNA sequence analysis of TP53 exons 5 to 9 was performed. Among the premenopausal EMPs, a multivariate analysis showed the labeling index (LI) for Ki-67 to correlate significantly with that for p53 (P<0.001), but not that for apoptosis. On the contrary, among the postmenopausal EMPs, the LI for Ki-67 correlated significantly with that for apoptosis (P<0.001). The p53 signature (p53S) was defined by endometrial epithelial cells, which are morphologically benign in appearance but display 12 or more consecutive epithelial cell nuclei with strong p53 immunostaining. The p53S was found in nine (12.7%) postmenopausal EMPs (mean age: 70.2 years). The median Ki-67 index for the p53S was 7%, with no significant difference from that of the glands of the postmenopausal EMPs without the p53S (P=0.058). The median apoptotic index for the p53S was 0%, which was significantly lower than that of the postmenopausal EMPs without the p53S (P=0.002). Two of four p53Ss showed TP53 mutations according to the DNA sequence analysis. The presence of the p53S is not rare in postmenopausal EMPs with an advanced age. Among postmenopausal EMPs, the LI of Ki-67 significantly correlates with that of apoptosis. However, such a positive correlation between the LI of Ki-67 and apoptosis is not observed in p53S. PMID:26727623

  11. Mutant p53 and mTOR/PKM2 regulation in cancer cells.

    PubMed

    Dando, Ilaria; Cordani, Marco; Donadelli, Massimo

    2016-09-01

    Mutations of TP53 gene are the most common feature in aggressive malignant cells. In addition to the loss of the tumor suppressive role of wild-type p53, hotspot mutant p53 isoforms display oncogenic proprieties notoriously referred as gain of functions (GOFs) which result in chemoresistance to therapies, genomic instability, aberrant deregulation of cell cycle progression, invasiveness and enhanced metastatic potential, and finally, in patient poor survival rate. The identification of novel functional oncogenic pathways regulated by mutant p53 represent and intriguing topic for emerging therapies against a broad spectrum of cancer types bearing mutant TP53 gene. Mammalian target of rapamycin (mTOR), as well as pyruvate kinase isoform M2 (PKM2) are master regulators of cancer growth, metabolism, and cell proliferation. Herein, we report that GOF mutant R175H and R273H p53 proteins trigger PKM2 phosphorylation on Tyr 105 through the involvement of mTOR signaling. Our data, together with the newly discovered connection between mutant p53 and mTOR stimulation, raise important implications for the potential therapeutic use of synthetic drugs inhibiting mTOR/PKM2 axis in cancer cells bearing mutant TP53 gene. We further hypothesize that mTOR/PKM2 pathway stimulation serves to sustain the oncogenic activity of mutant p53 through both the enhancement of chemoresistance and of aerobic glycolysis of cancer cells. © 2016 IUBMB Life, 68(9):722-726, 2016. PMID:27385486

  12. Insulin-like Growth Factor 1 Signaling Axis Meets p53 Genome Protection Pathways

    PubMed Central

    Werner, Haim; Sarfstein, Rive; LeRoith, Derek; Bruchim, Ilan

    2016-01-01

    Clinical, epidemiological, and experimental evidence indicate that the insulin-like growth factors (IGFs) are important mediators in the biochemical chain of events that lead from a phenotypically normal to a neoplastic cell. The IGF1 receptor (IGF1R), which mediates the biological actions of IGF1 and IGF2, exhibits potent pro-survival and antiapoptotic activities. The IGF1R is highly expressed in most types of cancer and is regarded as a promising therapeutic target in oncology. p53 is a transcription factor with tumor suppressor activity that is usually activated in response to DNA damage and other forms of cellular stress. On the basis of its protective activities, p53 is commonly regarded as the guardian of the genome. We provide evidence that the IGF signaling axis and p53 genome protection pathways are tightly interconnected. Wild-type, but not mutant, p53 suppresses IGF1R gene transcription, leading to abrogation of the IGF signaling network, with ensuing cell cycle arrest. Gain-of-function, or loss-of-function, mutations of p53 in tumor cells may disrupt its inhibitory activity, thus generating oncogenic molecules capable of transactivating the IGF1R gene. The interplay between the IGF1 and p53 pathways is also of major relevance in terms of metabolic regulation, including glucose transport and glycolysis. A better understanding of the complex physical and functional interactions between these important signaling pathways will have major basic and translational relevance. PMID:27446805

  13. Free Radicals Generated by Ionizing Radiation Signal Nuclear Translocation of p53

    NASA Technical Reports Server (NTRS)

    Martinez, J. D.; Pennington, M. E.; Craven, M. T.; Warters, R. L.

    1997-01-01

    The p53 tumor suppressor is a transcription factor that regulates several pathways, which function collectively to maintain the integrity of the genome. Nuclear localization is critical for wild-type function. However, the signals that regulate subcellular localization of p53 have not been identified. Here, we examine the effect of ionizing radiation on the subcellular localization of p53 in two cell lines in which p63 is normally sequestered in the cytoplasm and found that ionizing radiation caused a biphasic translocation response. p53 entered the nucleus 1-2 hours postirradiation (early response), subsequently emerged from the nucleus, and then again entered the nucleus 12-24 hours after the cells had been irradiated (delayed response). These changes in subcellular localization could be completely blocked by the free radical scavenger, WR1065. By comparison, two DNA-damaging agents that do not generate free radicals, mitomycin C and doxorubicin, caused translocation only after 12-24 h of exposure to the drugs, and this effect could not be inhibited by WR1065. Hence, although all three DNA-damaging agents induced relocalization of p53 to the nucleus, only the translocation caused by radiation was sensitive to free radical scavenging. We suggest that the free radicals generated by ionizing radiation can signal p53 translocation to the nucleus.

  14. The p53-mediated cytotoxicity of photodynamic therapy of cancer: Recent advances

    SciTech Connect

    Zawacka-Pankau, Joanna Krachulec, Justyna Grulkowski, Ireneusz Bielawski, Krzysztof P. Selivanova, Galina

    2008-11-01

    Photodynamic therapy (PDT) is a promising modality for the treatment of both pre-malignant and malignant lesions. The mechanism of action converges mainly on the generation of reactive oxygen species which damage cancer cells directly as well as indirectly acting on tumor vasculature. The exact mechanism of PDT action is not fully understood, which is a formidable barrier to its successful clinical application. Elucidation of the mechanisms of cancer cell elimination by PDT might help in establishing highly specific, non-genotoxic anti-cancer treatment of tomorrow. One of the candidate PDT targets is the well-known tumor suppressor p53 protein recognized as the guardian of the genome. Together with its family members, p73 and p63 proteins, p53 is involved in apoptosis induction upon stress stimuli. The wild-type and mutant p53-targeting chemotherapeutics are currently extensively investigated as a promising strategy for highly specific anti-cancer therapy. In photodynamic therapy porphyrinogenic sensitizers are the most widely used compounds due to their potent biophysical and biochemical properties. Recent data suggest that the p53 tumor suppressor protein might play a significant role in porphyrin-PDT-mediated cell death by direct interaction with the drug which leads to its accumulation and induction of p53-dependent cell death both in the dark and upon irradiation. In this review we describe the available evidence on the role of p53 in PDT.

  15. Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage

    PubMed Central

    Clewell, Rebecca A.; Sun, Bin; Adeleye, Yeyejide; Carmichael, Paul; Efremenko, Alina; McMullen, Patrick D.; Pendse, Salil; Trask, O. J.; White, Andy; Andersen, Melvin E.

    2014-01-01

    As part of a larger effort to provide proof-of-concept in vitro-only risk assessments, we have developed a suite of high-throughput assays for key readouts in the p53 DNA damage response toxicity pathway: double-strand break DNA damage (p-H2AX), permanent chromosomal damage (micronuclei), p53 activation, p53 transcriptional activity, and cell fate (cell cycle arrest, apoptosis, micronuclei). Dose-response studies were performed with these protein and cell fate assays, together with whole genome transcriptomics, for three prototype chemicals: etoposide, quercetin, and methyl methanesulfonate. Data were collected in a human cell line expressing wild-type p53 (HT1080) and results were confirmed in a second p53 competent cell line (HCT 116). At chemical concentrations causing similar increases in p53 protein expression, p53-mediated protein expression and cellular processes showed substantial chemical-specific differences. These chemical-specific differences in the p53 transcriptional response appear to be determined by augmentation of the p53 response by co-regulators. More importantly, dose-response data for each of the chemicals indicate that the p53 transcriptional response does not prevent micronuclei induction at low concentrations. In fact, the no observed effect levels and benchmark doses for micronuclei induction were less than or equal to those for p53-mediated gene transcription regardless of the test chemical, indicating that p53's post-translational responses may be more important than transcriptional activation in the response to low dose DNA damage. This effort demonstrates the process of defining key assays required for a pathway-based, in vitro-only risk assessment, using the p53-mediated DNA damage response pathway as a prototype. PMID:25078064

  16. Activation of p53-Dependent Growth Suppression in Human Cells by Mutations in PTEN or PIK3CA▿

    PubMed Central

    Kim, Jung-Sik; Lee, Carolyn; Bonifant, Challice L.; Ressom, Habtom; Waldman, Todd

    2007-01-01

    In an effort to identify genes whose expression is regulated by activated phosphatidylinositol 3-kinase (PI3K) signaling, we performed microarray analysis and subsequent quantitative reverse transcription-PCR on an isogenic set of PTEN gene-targeted human cancer cells. Numerous p53 effectors were upregulated following PTEN deletion, including p21, GDF15, PIG3, NOXA, and PLK2. Stable depletion of p53 led to reversion of the gene expression program. Western blots revealed that p53 was stabilized in HCT116 PTEN−/− cells via an Akt1-dependent and p14ARF-independent mechanism. Stable depletion of PTEN in untransformed human fibroblasts and epithelial cells also led to upregulation of p53 and senescence-like growth arrest. Simultaneous depletion of p53 rescued this phenotype, enabling PTEN-depleted cells to continue proliferating. Next, we tested whether oncogenic PIK3CA, like inactivated PTEN, could activate p53. Retroviral expression of oncogenic human PIK3CA in MCF10A cells led to activation of p53 and upregulation of p53-regulated genes. Stable depletion of p53 reversed these PIK3CA-induced expression changes and synergized with oncogenic PIK3CA in inducing anchorage-independent growth. Finally, targeted deletion of an endogenous allele of oncogenic, but not wild-type, PIK3CA in a human cancer cell line led to a reduction in p53 levels and a decrease in the expression of p53-regulated genes. These studies demonstrate that activation of PI3K signaling by mutations in PTEN or PIK3CA can lead to activation of p53-mediated growth suppression in human cells, indicating that p53 can function as a brake on phosphatidylinositol (3,4,5)-triphosphate-induced mitogenesis during human cancer pathogenesis. PMID:17060456

  17. p53, Stem Cells, and Reprogramming

    PubMed Central

    Spike, Benjamin T.; Wahl, Geoffrey M.

    2011-01-01

    p53 is well recognized as a potent tumor suppressor. In its classic role, p53 responds to genotoxic insults by inducing cell cycle exit or programmed cell death to limit the propagation of cells with corrupted genomes. p53 is also implicated in a variety of other cellular processes in which its involvement is less well understood including self-renewal, differentiation, and reprogramming. These activities represent an emerging area of intense interest for cancer biologists, as they provide potential mechanistic links between p53 loss and the stem cell–like cellular plasticity that has been suggested to contribute to tumor cell heterogeneity and to drive tumor progression. Despite accumulating evidence linking p53 loss to stem-like phenotypes in cancer, it is not yet understood how p53 contributes to acquisition of “stemness” at the molecular level. Whether and how stem-like cells confer survival advantages to propagate the tumor also remain to be resolved. Furthermore, although it seems reasonable that the combination of p53 deficiency and the stem-like state could contribute to the genesis of cancers that are refractory to treatment, direct linkages and mechanistic underpinnings remain under investigation. Here, we discuss recent findings supporting the connection between p53 loss and the emergence of tumor cells bearing functional and molecular similarities to stem cells. We address several potential molecular and cellular mechanisms that may contribute to this link, and we discuss implications of these findings for the way we think about cancer progression. PMID:21779509

  18. EGFR, p53, IDH-1 and MDM2 immunohistochemical analysis in glioblastoma: therapeutic and prognostic correlation.

    PubMed

    Montgomery, Richard Murdoch; Queiroz, Luciano de Souza; Rogerio, Fabio

    2015-07-01

    We studied 36 glioblastoma cases at HC-UNICAMP from 2008 to 2012 and classified the immunohistochemical distribution of the wild-type epidermal growth factor receptor (EGFR), mutated forms of p53 protein and isocitrate dehydrogenase-1 (IDH-1) and murine double protein 2 (MDM2). Immunostaining findings were correlated with clinical data and response to treatment (surgery, chemotherapy and radiotherapy). About 97% of the tumors were primary, most of them localized in the frontal lobe. Mean time free of clinical or symptomatic disease and free time of radiological disease were 7.56 and 7.14 months, respectively. We observed a significant positive correlation between expressions of p53 and MDM2, EGFR and MDM2. Clinical, radiological and overall survivals also showed a significant positive correlation. p53 staining and clinical survival showed a significant negative correlation. The current series provides clinical and histopathological data that contribute to knowledge on glioblastoma in Brazilians. PMID:26200049

  19. P53 status influences regulation of HSPs and ribosomal proteins by PDTC and radiation

    SciTech Connect

    Thompson, John S. |||. E-mail: jsthom1@uky.edu; Asmis, Reto; Glass, Judith; Liu Hua; Wilson, Colin; Nelson, Brandy; Brown, Stephen A.; Stromberg, Arnold J. |||

    2006-05-05

    Pyrrolidine dithiocarbamate (PDTC) is a thiol-containing compound that can act under varying conditions as an anti-oxidant or pro-oxidant. Utilizing microarrays, we determined the effect of PDTC +/- ionizing radiation (IR) on the expression of heat shock protein (HSP) genes in isolated B6/129 wild-type (WT) and p53-/- spleen cells. Extremely significant microarrays demonstrated that PDTC, but not IR, markedly up-regulated the expression of the majority of detectable HSP genes in WT and many to a significantly greater degree in p53-/- deficient cells. Determination of the glutathione/glutathione disulfide ratio indicated that PDTC was acting as a pro-oxidant under these conditions. From these data we conclude that the clinical use of 'antioxidants' with radiotherapy or chemotherapy must be very carefully based on knowledge of the p53 status of their intended normal and tumor target cells.

  20. Inhibiting bladder tumor growth with a cell penetrating R11 peptide derived from the p53 C-terminus.

    PubMed

    Zhang, Tingting; Wu, Kaijie; Ding, Chen; Sun, Kangwei; Guan, Zhenfeng; Wang, Xinyang; Hsieh, Jer-Tsong; He, Dalin; Fan, Jinhai

    2015-11-10

    Urothelial carcinoma of the bladder (UCB) is the most common malignancy of the urinary tract, nearly half of which contains a mutation in TP53 gene. Hence, therapeutic approach by restoring functional p53 protein in cancer cells will be beneficial. Recent studies have demonstrated the inhibition of cancer cell growth by p53 reactivation using a peptide derived from the p53 C-terminus (p53C). However, the outcome of reactivating p53 in controlling bladder cancer development is limited by its efficiency and specificity of peptide delivery, especially in metastatic animal models. Herein, we report that the cell penetrating peptide (polyarginine, R11)-conjugated p53C can exhibit a preferential uptake and growth inhibit of UCB cells expressing either mutant or wild-type TP53 by the activation of p53-dependent pathway. R11-p53C peptide treatment of preclinical orthotopic and metastatic bladder cancer models significantly decreased the tumor burden and increased the lifespan without a significant cytotoxicity. Based on these results, we believe that R11-p53C peptide has therapeutic potential for primary and metastatic bladder cancer, and R11-mediated transduction may be a useful strategy for the therapeutic delivery of large tumor suppressor molecules to tumor cells in vitro and in vivo. PMID:26462022

  1. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression

    PubMed Central

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F.; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-01-01

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker–induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress. PMID:27407148

  2. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    PubMed

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress. PMID:27407148

  3. β-Catenin C-terminal signals suppress p53 and are essential for artery formation.

    PubMed

    Riascos-Bernal, Dario F; Chinnasamy, Prameladevi; Cao, Longyue Lily; Dunaway, Charlene M; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E S

    2016-01-01

    Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

  4. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  5. β-Catenin C-terminal signals suppress p53 and are essential for artery formation

    PubMed Central

    Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

    2016-01-01

    Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

  6. Drug resistance to inhibitors of the human double minute-2 E3 ligase is mediated by point mutations of p53, but can be overcome with the p53 targeting agent RITA.

    PubMed

    Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z

    2012-10-01

    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation. PMID:22933706

  7. p53 protects against genome instability following centriole duplication failure

    PubMed Central

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  8. p53-directed translational control can shape and expand the universe of p53 target genes

    PubMed Central

    Zaccara, S; Tebaldi, T; Pederiva, C; Ciribilli, Y; Bisio, A; Inga, A

    2014-01-01

    The increasing number of genome-wide transcriptome analyses focusing on p53-induced cellular responses in many cellular contexts keeps adding to the already numerous p53-regulated transcriptional networks. To investigate post-transcriptional controls as an additional dimension of p53-directed gene expression responses, we performed a translatome analysis through polysomal profiling on MCF7 cells upon 16 hours of doxorubicin or nutlin-3a treatment. The comparison between the transcriptome and the translatome revealed a considerable level of uncoupling, characterized by genes whose transcription variations did not correlate with translation variations. Interestingly, uncoupled genes were associated with apoptosis, DNA and RNA metabolism and cell cycle functions, suggesting that post-transcriptional control can modulate classical p53-regulated responses. Furthermore, even for well-established p53 targets that were differentially expressed both at the transcriptional and translational levels, quantitative differences between the transcriptome, subpolysomal and polysomal RNAs were evident. As we searched mechanisms underlying gene expression uncoupling, we identified the p53-dependent modulation of six RNA-binding proteins, where hnRNPD (AUF1) and CPEB4 are direct p53 transcriptional targets, whereas SRSF1, DDX17, YBX1 and TARDBP are indirect targets (genes modulated preferentially in the subpolysomal or polysomal mRNA level) modulated at the translational level in a p53-dependent manner. In particular, YBX1 translation appeared to be reduced by p53 via two different mechanisms, one related to mTOR inhibition and the other to miR-34a expression. Overall, we established p53 as a master regulator of translational control and identified new p53-regulated genes affecting translation that can contribute to p53-dependent cellular responses. PMID:24926617

  9. p53-directed translational control can shape and expand the universe of p53 target genes.

    PubMed

    Zaccara, S; Tebaldi, T; Pederiva, C; Ciribilli, Y; Bisio, A; Inga, A

    2014-10-01

    The increasing number of genome-wide transcriptome analyses focusing on p53-induced cellular responses in many cellular contexts keeps adding to the already numerous p53-regulated transcriptional networks. To investigate post-transcriptional controls as an additional dimension of p53-directed gene expression responses, we performed a translatome analysis through polysomal profiling on MCF7 cells upon 16 hours of doxorubicin or nutlin-3a treatment. The comparison between the transcriptome and the translatome revealed a considerable level of uncoupling, characterized by genes whose transcription variations did not correlate with translation variations. Interestingly, uncoupled genes were associated with apoptosis, DNA and RNA metabolism and cell cycle functions, suggesting that post-transcriptional control can modulate classical p53-regulated responses. Furthermore, even for well-established p53 targets that were differentially expressed both at the transcriptional and translational levels, quantitative differences between the transcriptome, subpolysomal and polysomal RNAs were evident. As we searched mechanisms underlying gene expression uncoupling, we identified the p53-dependent modulation of six RNA-binding proteins, where hnRNPD (AUF1) and CPEB4 are direct p53 transcriptional targets, whereas SRSF1, DDX17, YBX1 and TARDBP are indirect targets (genes modulated preferentially in the subpolysomal or polysomal mRNA level) modulated at the translational level in a p53-dependent manner. In particular, YBX1 translation appeared to be reduced by p53 via two different mechanisms, one related to mTOR inhibition and the other to miR-34a expression. Overall, we established p53 as a master regulator of translational control and identified new p53-regulated genes affecting translation that can contribute to p53-dependent cellular responses. PMID:24926617

  10. The role of p53 in ribosomopathies.

    PubMed

    Fumagalli, Stefano; Thomas, George

    2011-04-01

    Impaired ribosome biogenesis is the underlying cause of the pathological conditions collectively known as ribosomopathies. Several hypotheses have been advanced to explain the mechanisms by which deficiencies in ribosome biogenesis interfere with developmental processes leading eventually to the emergence of these diseases. In recent years it has become clear that perturbation of this process triggers a cell-cycle checkpoint that, through activation of the tumor-suppressor p53, leads to cell-cycle arrest and apoptosis. Indeed, evidence is accumulating from studies in animal models that the unscheduled activation of p53 is responsible for perturbations in tissue homeostasis that cause the development of ribosomopathies such as Treacher-Collins syndrome (TCS) and 5q(-) syndrome. These findings imply that inhibition of p53, or better, of mechanisms that specifically lead to p53 activation in response to inhibition of ribosome biogenesis, could be targeted in the treatment of ribosomopathies where activation of p53 is shown to play a pathogenic role. PMID:21435506

  11. “Super p53” Mice Display Retinal Astroglial Changes

    PubMed Central

    Salazar, Juan J.; Gallego-Pinazo, Roberto; de Hoz, Rosa; Pinazo-Durán, Maria D.; Rojas, Blanca; Ramírez, Ana I.; Serrano, Manuel; Ramírez, José M.

    2013-01-01

    Tumour-suppressor genes, such as the p53 gene, produce proteins that inhibit cell division under adverse conditions, as in the case of DNA damage, radiation, hypoxia, or oxidative stress (OS). The p53 gene can arrest proliferation and trigger death by apoptosis subsequent to several factors. In astrocytes, p53 promotes cell-cycle arrest and is involved in oxidative stress-mediated astrocyte cell death. Increasingly, astrocytic p53 is proving fundamental in orchestrating neurodegenerative disease pathogenesis. In terms of ocular disease, p53 may play a role in hypoxia due to ischaemia and may be involved in the retinal response to oxidative stress (OS). We studied the influence of the p53 gene in the structural and quantitative characteristics of astrocytes in the retina. Adult mice of the C57BL/6 strain (12 months old) were distributed into two groups: 1) mice with two extra copies of p53 (“super p53”; n = 6) and 2) wild-type p53 age-matched control, as the control group (WT; n = 6). Retinas from each group were immunohistochemically processed to locate the glial fibrillary acidic protein (GFAP). GFAP+ astrocytes were manually counted and the mean area occupied for one astrocyte was quantified. Retinal-astrocyte distribution followed established patterns; however, morphological changes were seen through the retinas in relation to p53 availability. The mean GFAP+ area occupied by one astrocyte in “super p53” eyes was significantly higher (p<0.05; Student’s t-test) than in the WT. In addition, astroglial density was significantly higher in the “super p53” retinas than in the WT ones, both in the whole-retina (p<0,01 Student’s t-test) and in the intermediate and peripheral concentric areas of the retina (p<0.05 Student’s t-test). This fact might improve the resistance of the retinal cells against OS and its downstream signalling pathways. PMID:23762373

  12. In vitro and in vivo cytotoxic effects of PRIMA-1 on hepatocellular carcinoma cells expressing mutant p53ser249.

    PubMed

    Shi, Hong; Lambert, Jeremy M R; Hautefeuille, Agnes; Bykov, Vladimir J N; Wiman, Klas G; Hainaut, Pierre; Caron de Fromentel, Claude

    2008-07-01

    Hepatocellular carcinoma (HCC) is highly lethal due to limited curative options. In high-incidence regions, such as parts of Africa and Southeastern Asia, >50% of cases carry an AGG to AGT mutation at codon 249 of the TP53 gene, considered as a 'signature' of mutagenesis by aflatoxins. The protein product, p53ser249, may represent a therapeutic target for HCC. The small molecule p53 reactivation and induction of massive apoptosis (PRIMA)-1 has been shown to induce apoptosis in tumour cells by reactivating the transactivation capacity of some p53 mutants. In this study, we have investigated the cytotoxic effects of PRIMA-1 on HCC cells expressing p53ser249. In p53-null Hep3B cells, over-expression of p53ser249 or p53gln248 by stable transfection increased the cytotoxicity of PRIMA-1 at 50 muM. Furthermore, PRIMA-1 treatment delayed the growth of p53ser249-expressing Hep3B cells xenografted in severe combined immunodeficiency mice. However, PRIMA-1 did not restore wild-type DNA binding and transactivation activities to p53ser249 or to p53gln248 in Hep3B cells. Moreover, in PLC/PRF/5, a HCC cell line constitutively expressing p53ser249, small interfering RNA (siRNA) silencing of the mutant increased the cytotoxic effect of PRIMA-1. These apparently contradictory effects can be reconciled by proposing that p53ser249 exerts a gain-of-function effect, which favours the survival of HCC cells. Thus, both inhibition of this effect by PRIMA-1 and removal of the mutant by siRNA can lead to the decrease of survival capacity of HCC cells. PMID:18048389

  13. PUMA Binding Induces Partial Unfolding within BCL-xL to Disrupt p53 Binding and Promote Apoptosis

    PubMed Central

    Follis, Ariele Viacava; Chipuk, Jerry E.; Fisher, John C.; Yun, Mi-Kyung; Grace, Christy R.; Nourse, Amanda; Baran, Katherine; Ou, Li; Min, Lie; White, Stephen W.; Green, Douglas R.; Kriwacki, Richard W.

    2012-01-01

    Following DNA damage, nuclear p53 induces the expression of PUMA, a BH3-only protein that binds and inhibits the anti-apoptotic BCL-2 repertoire, including BCL-xL. PUMA, unique amongst BH3-only proteins, disrupts the interaction between cytosolic p53 and BCL-xL, allowing p53 to promote apoptosis via direct activation of the BCL-2 effector molecules, BAX and BAK. Structural investigations using nuclear magnetic resonance spectroscopy and X-ray crystallography revealed that PUMA binding induced partial unfolding of two α-helices within BCL-xL. Wild-type PUMA or a PUMA mutant incapable of causing binding-induced unfolding of BCL-xL equivalently inhibited the anti-apoptotic BCL-2 repertoire to sensitize for death receptor (DR)-activated apoptosis, but only wild-type PUMA promoted p53-dependent, DNA damage-induced apoptosis. Our data suggest that PUMA-induced partial unfolding of BCL-xL disrupts interactions between cytosolic p53 and BCL-xL, releasing the bound p53 to initiate apoptosis. We propose that regulated unfolding of BCL-xL provides a mechanism to promote PUMA-dependent signaling within the apoptotic pathways. PMID:23340338

  14. TRIM32 is a novel negative regulator of p53.

    PubMed

    Liu, Juan; Zhu, Yu; Hu, Wenwei; Feng, Zhaohui

    2015-01-01

    To ensure proper function, the tumor suppressor p53 is tightly regulated through different post-translational modifications, particularly ubiquitination. Recently, TRIM32 was identified as a p53-regulated gene and an E3 ubiquitin ligase of p53. Thus, TRIM32 and p53 form a novel auto-regulatory negative feedback loop for p53 regulation in cells. PMID:27308422

  15. TRIM32 is a novel negative regulator of p53

    PubMed Central

    Liu, Juan; Zhu, Yu; Hu, Wenwei; Feng, Zhaohui

    2015-01-01

    To ensure proper function, the tumor suppressor p53 is tightly regulated through different post-translational modifications, particularly ubiquitination. Recently, TRIM32 was identified as a p53-regulated gene and an E3 ubiquitin ligase of p53. Thus, TRIM32 and p53 form a novel auto-regulatory negative feedback loop for p53 regulation in cells. PMID:27308422

  16. Detection of genotoxic and non-genotoxic carcinogens in Xpc{sup −/−}p53{sup +/−} mice

    SciTech Connect

    Melis, Joost P.M.; Speksnijder, Ewoud N.; Kuiper, Raoul V.; Salvatori, Daniela C.F.; Schaap, Mirjam M.; Maas, Saskia; Robinson, Joke; Verhoef, Aart; Benthem, Jan van; Luijten, Mirjam; Steeg, Harry van

    2013-01-15

    An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed the Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Highlights: ► The Xpc*p53 mouse model is able to identify genotoxic and non-genotoxic carcinogens. ► Time, animals and cost can be significantly reduced compared to the 2-year bioassay. ► Xpc*p53 mice are more advantageous for carcinogen identification than Xpa*p53 mice. ► Xpc*p53 mice exhibit a wild type response upon exposure to genotoxicants.

  17. p53 and rapamycin are additive

    PubMed Central

    Campisi, Judith; Huang, Jing; Jones, Diane; Dodds, Sherry G.; Williams, Charnae; Hubbard, Gene; Livi, Carolina B.; Gao, Xiaoli; Weintraub, Susan; Curiel, Tyler; Sharp, Z. Dave; Hasty, Paul

    2015-01-01

    Mechanistic target of rapamycin (mTOR) is a kinase found in a complex (mTORC1) that enables macromolecular synthesis and cell growth and is implicated in cancer etiology. The rapamycin-FK506 binding protein 12 (FKBP12) complex allosterically inhibits mTORC1. In response to stress, p53 inhibits mTORC1 through a separate pathway involving cell signaling and amino acid sensing. Thus, these different mechanisms could be additive. Here we show that p53 improved the ability of rapamycin to: 1) extend mouse life span, 2) suppress ionizing radiation (IR)-induced senescence-associated secretory phenotype (SASP) and 3) increase the levels of amino acids and citric acid in mouse embryonic stem (ES) cells. This additive effect could have implications for cancer treatment since rapamycin and p53 are anti-oncogenic. PMID:26158292

  18. p53 Suppresses Tetraploid Development in Mice

    PubMed Central

    Horii, Takuro; Yamamoto, Masamichi; Morita, Sumiyo; Kimura, Mika; Nagao, Yasumitsu; Hatada, Izuho

    2015-01-01

    Mammalian tetraploid embryos die in early development because of defects in the epiblast. Experiments with diploid/tetraploid chimeric mice, obtained via the aggregation of embryonic stem cells, clarified that while tetraploid cells are excluded from epiblast derivatives, diploid embryos with tetraploid extraembryonic tissues can develop to term. Today, this method, known as tetraploid complementation, is usually used for rescuing extraembryonic defects or for obtaining completely embryonic stem (ES) cell-derived pups. However, it is still unknown why defects occur in the epiblast during mammalian development. Here, we demonstrated that downregulation of p53, a tumour suppressor protein, rescued tetraploid development in the mammalian epiblast. Tetraploidy in differentiating epiblast cells triggered p53-dependent cell-cycle arrest and apoptosis, suggesting the activation of a tetraploidy checkpoint during early development. Finally, we found that p53 downregulation rescued tetraploid embryos later in gestation. PMID:25752699

  19. CTLA-4 blockade enhances the therapeutic effect of an attenuated poxvirus vaccine targeting p53 in an established murine tumor model.

    PubMed

    Espenschied, Jonathan; Lamont, Jeffrey; Longmate, Jeff; Pendas, Solange; Wang, Zhongde; Diamond, Don J; Ellenhorn, Joshua D I

    2003-03-15

    p53 is overexpressed by half of all cancers, and is an attractive target for a vaccine approach to immunotherapy. p53 overexpression is frequently the result of point mutations, which leaves the majority of the protein in its wild-type form. Therefore, the majority of p53 sequence is wild type, making it a self-protein for which tolerance plays a role in limiting immune responses. To overcome tolerance to p53, we have expressed wild-type murine p53 in the nonpathogenic attenuated poxvirus, modified vaccinia virus Ankara (recombinant modified vaccinia virus Ankara expressing wild-type murine p53 (rMVAp53)). Mice immunized with rMVAp53 vaccine developed vigorous p53-specific CTL responses. rMVAp53 vaccine was evaluated for its ability to inhibit the outgrowth of the syngeneic murine sarcoma Meth A, which overexpresses mutant p53. Mice were inoculated with a lethal dose (5 x 10(5) cells injected s.c.) of Meth A tumor cells and vaccinated by i.p. injection 3 days later with 5 x 10(7) PFU of rMVAp53. The majority of mice remained tumor free and resistant to rechallenge with Meth A tumor cells. We wished to determine whether rMVAp53 immunization could effect the rejection of an established, palpable Meth A tumor. In subsequent experiments, mice were injected with 10(6) Meth A tumor cells, and treated 6 days later with anti-CTLA-4 Ab (9H10) and rMVAp53. The majority of treated mice had complete tumor regression along with lasting tumor immunity. In vivo Ab depletion confirmed that the antitumor effect was primarily CD8 and to a lesser extent CD4 dependent. These experiments demonstrate the potential of a novel cell-free vaccine targeting p53 in malignancy. PMID:12626601

  20. Distinct novel quinazolinone exhibits selective inhibition in MGC-803 cancer cells by dictating mutant p53 function.

    PubMed

    Zhang, Guo-Hai; Xue, Wen-Bin; An, Yun-Feng; Yuan, Jing-Mei; Qin, Jiang-Ke; Pan, Cheng-Xue; Su, Gui-Fa

    2015-05-01

    The mutant p53 proteins and their corresponding cellular response can be manipulated by novel quinazolinone derivatives 4-8 (a-i) in p53 mutant cancer cells. Of the two most potent compounds, 4a exhibited promising broad-spectrum anti-cancer effects, whereas 6c showed selective and exclusive inhibition activity in p53 mutant cancer cell lines but low toxicity to wild-type p53 cancer cell A375 and normal lung fibroblast WI-38 cells. Furthermore, 6c exhibited a more sophisticated mechanism for cell-destructive response by causing S/G2 phase arrest effect and cell size reduction. Compared with the cellular response of 6b and genetic background of cell lines studied, p53 mutation was found to be the key factor and main target for 6c evoked cell-destructive response. Molecular mechanism studies indicated that p53 phosphorylation and acetylation dual-targeting inhibitor 6c exerted anti-cancer activities with a special mechanism in evoking cell apoptosis by arresting mutant p53 function to trigger the deregulation of Cdk2 caused Bim-mediated apoptosis. To the best of our knowledge, 6c is the first quinazolinone derivative to dictate mutant p53 function for apoptotic cell death. PMID:25828929

  1. Negative regulation of beta4 integrin transcription by homeodomain-interacting protein kinase 2 and p53 impairs tumor progression.

    PubMed

    Bon, Giulia; Di Carlo, Selene E; Folgiero, Valentina; Avetrani, Paolo; Lazzari, Chiara; D'Orazi, Gabriella; Brizzi, Maria Felice; Sacchi, Ada; Soddu, Silvia; Blandino, Giovanni; Mottolese, Marcella; Falcioni, Rita

    2009-07-15

    Increased expression of alpha(6)beta(4) integrin in several epithelial cancers promotes tumor progression; however, the mechanism underlying its transcriptional regulation remains unclear. Here, we show that depletion of homeodomain-interacting protein kinase 2 (HIPK2) activates beta(4) transcription that results in a strong increase of beta(4)-dependent mitogen-activated protein kinase and Akt phosphorylation, anchorage-independent growth, and invasion. In contrast, stabilization of HIPK2 represses beta(4) expression in wild-type p53 (wtp53)-expressing cells but not in p53-null cells or cells expressing mutant p53, indicating that HIPK2 requires a wtp53 to inhibit beta(4) transcription. Consistent with our in vitro findings, a strong correlation between beta(4) overexpression and HIPK2 inactivation by cytoplasmic relocalization was observed in wtp53-expressing human breast carcinomas. Under loss of function of HIPK2 or p53, the p53 family members TAp63 and TAp73 strongly activate beta(4) transcription. These data, by revealing that beta(4) expression is transcriptionally repressed in tumors by HIPK2 and p53 to impair beta(4)-dependent tumor progression, suggest that loss of p53 function favors the formation of coactivator complex with the TA members of the p53 family to allow beta(4) transcription. PMID:19567674

  2. Targeting the MDM2/MDM4 interaction interface as a promising approach for p53 reactivation therapy.

    PubMed

    Pellegrino, Marsha; Mancini, Francesca; Lucà, Rossella; Coletti, Alice; Giacchè, Nicola; Manni, Isabella; Arisi, Ivan; Florenzano, Fulvio; Teveroni, Emanuela; Buttarelli, Marianna; Fici, Laura; Brandi, Rossella; Bruno, Tiziana; Fanciulli, Maurizio; D'Onofrio, Mara; Piaggio, Giulia; Pellicciari, Roberto; Pontecorvi, Alfredo; Marine, Jean Christophe; Macchiarulo, Antonio; Moretti, Fabiola

    2015-11-01

    Restoration of wild-type p53 tumor suppressor function has emerged as an attractive anticancer strategy. Therapeutics targeting the two p53-negative regulators, MDM2 and MDM4, have been developed, but most agents selectively target the ability of only one of these molecules to interact with p53, leaving the other free to operate. Therefore, we developed a method that targets the activity of MDM2 and MDM4 simultaneously based on recent studies indicating that formation of MDM2/MDM4 heterodimer complexes are required for efficient inactivation of p53 function. Using computational and mutagenesis analyses of the heterodimer binding interface, we identified a peptide that mimics the MDM4 C-terminus, competes with endogenous MDM4 for MDM2 binding, and activates p53 function. This peptide induces p53-dependent apoptosis in vitro and reduces tumor growth in vivo. Interestingly, interfering with the MDM2/MDM4 heterodimer specifically activates a p53-dependent oxidative stress response. Consistently, distinct subcellular pools of MDM2/MDM4 complexes were differentially sensitive to the peptide; nuclear MDM2/MDM4 complexes were particularly highly susceptible to the peptide-displacement activity. Taken together, these data identify the MDM2/MDM4 interaction interface as a valuable molecular target for therapeutic reactivation of p53 oncosuppressive function. PMID:26359458

  3. Δ113p53/Δ133p53 converts P53 from a repressor to a promoter of DNA double-stand break repair

    PubMed Central

    Gong, Lu; Chen, Jun

    2016-01-01

    ABSTRACT In response to DNA damage, p53 (TP53, best known as p53) is quickly activated leading to cell cycle arrest or apoptosis to ensure genomic integrity; however, this represses DNA double-strand break (DSB) repair. Our recent work revealed that Δ113p53/Δ133p53 protein is accumulated at a later stage upon DNA DSB stress to switch p53 signaling from repression to promotion of DNA DSB repair. PMID:27308550

  4. Ranking the Binding Energies of p53 Mutant Activators and Their ADMET Properties.

    PubMed

    Omar, Sara Ibrahim; Tuszynski, Jack

    2015-08-01

    The guardian of the genome, p53, is the most mutated protein found in all cancer cells. Restoration of wild-type activity to mutant p53 offers promise to eradicate cancer cells using novel pharmacological agents. Several molecules have already been found to activate mutant p53. While the exact mechanism of action of these compounds has not been fully understood, a transiently open pocket has been identified in some mutants. In our study, we docked twelve known activators to p53 into the open pocket to further understand their mechanism of action and rank the best binders. In addition, we predicted the absorption, distribution, metabolism, excretion and toxicity properties of these compounds to assess their pharmaceutical usefulness. Our studies showed that alkylating ligands do not all bind at the same position, probably due to their varying sizes. In addition, we found that non-alkylating ligands are capable of binding at the same pocket and directly interacting with Cys124. The comparison of the different ligands demonstrates that stictic acid has a great potential as a p53 activator in terms of less adverse effects although it has poorer pharmacokinetic properties. PMID:25407396

  5. Oncogenomic Approaches in Exploring Gain of Function of Mutant p53

    PubMed Central

    Donzelli, Sara; Biagioni, Francesca; Fausti, Francesca; Strano, Sabrina; Fontemaggi, Giulia; Blandino, Giovanni

    2008-01-01

    Cancer is caused by the spatial and temporal accumulation of alterations in the genome of a given cell. This leads to the deregulation of key signalling pathways that play a pivotal role in the control of cell proliferation and cell fate. The p53 tumor suppressor gene is the most frequent target in genetic alterations in human cancers. The primary selective advantage of such mutations is the elimination of cellular wild type p53 activity. In addition, many evidences in vitro and in vivo have demonstrated that at least certain mutant forms of p53 may possess a gain of function, whereby they contribute positively to cancer progression. The fine mapping and deciphering of specific cancer phenotypes is taking advantage of molecular-profiling studies based on genome-wide approaches. Currently, high-throughput methods such as array-based comparative genomic hybridization (CGH array), single nucleotide polymorphism array (SNP array), expression arrays and ChIP-on-chip arrays are available to study mutant p53-associated alterations in human cancers. Here we will mainly focus on the integration of the results raised through oncogenomic platforms that aim to shed light on the molecular mechanisms underlying mutant p53 gain of function activities and to provide useful information on the molecular stratification of tumor patients. PMID:19440517

  6. Transcriptional activation of cyclooxygenase-2 by tumor suppressor p53 requires nuclear factor-kappaB.

    PubMed

    Benoit, V; de Moraes, E; Dar, N A; Taranchon, E; Bours, V; Hautefeuille, A; Tanière, P; Chariot, A; Scoazec, J-Y; de Moura Gallo, C V; Merville, M-P; Hainaut, P

    2006-09-21

    Overexpression of cyclooxygenase-2 (Cox-2) is thought to exert antiapoptotic effects in cancer. Here we show that the tumor suppressor p53 upregulated Cox-2 in esophageal and colon cancer cell lines by inducing the binding of nuclear factor-kappaB (NF-kappaB) to its response element in the COX-2 promoter. Inhibition of NF-kappaB prevented p53 induction of Cox-2 expression. Cooperation between p53 and NF-kappaB was required for activation of COX-2 promoter in response to daunomycin, a DNA-damaging agent. Pharmacological inhibition of Cox-2 enhanced apoptosis in response to daunomycin, in particular in cells containing active p53. In esophageal cancer, there was a correlation between Cox-2 expression and wild-type TP53 in Barrett's esophagus (BE) and in adenocarcinoma, but not in squamous cell carcinoma (P<0.01). These results suggest that p53 and NF-kappaB cooperate in upregulating Cox-2 expression, promoting cell survival in inflammatory precursor lesions such as BE. PMID:16682957

  7. FHL2 mediates p53-induced transcriptional activation through a direct association with HIPK2

    SciTech Connect

    Lee, Sang-Wang . E-mail: umsj@sejong.ac.kr

    2006-01-27

    To understand the molecular mechanism underlying HIPK2 regulation of the transcriptional activation by p53, we sought to identify the protein that interacts with HIPK2. From our yeast two-hybrid screen, we found that four and a half LIM domains 2 (FHL2) could bind to the C-terminal half of HIPK2. Further assays in yeast mapped the minimal interaction domain to amino acids 812-907 in HIPK2. The interaction was confirmed using a GST pull-down assay in vitro, and an immunoprecipitation (IP) assay and fluorescence microscopy in vivo. FHL2 alone spread throughout both the cytoplasm and nucleus but was redistributed to dot-like structures in the nucleus when HIPK2 was coexpressed in HEK293 cells. When tethered to the Gal4-responsive promoter through the Gal4 DBD fusion, FHL2 showed autonomous transcriptional activity that was enhanced by wild-type HIPK2, but not by the kinase-defective mutant. In addition, FHL2 increased the p53-dependent transcriptional activation and had an additive effect on the activation when coexpressed with HIPK2, which was again not observed with the kinase-defective mutant of HIPK2. Finally, we found a ternary complex of p53, HIPK2, and FHL2 using IP, and their recruitment to the p53-responsive p21Waf1 promoter in chromatin IP assays. Overall, our findings indicate that FHL2 can also regulate p53 via a direct association with HIPK2.

  8. Recognition Dynamics of p53 and MDM2: Implications for Peptide Design.

    PubMed

    ElSawy, Karim M; Lane, David P; Verma, Chandra S; Caves, Leo S D

    2016-01-21

    Peptides that inhibit MDM2 and attenuate MDM2-p53 interactions, thus activating p53, are currently being pursued as anticancer drug leads for tumors harboring wild type p53. The thermodynamic determinants of peptide-MDM2 interactions have been extensively studied. However, a detailed understanding of the dynamics that underlie these interactions is largely missing. In this study, we explore the kinetics of the binding of a set of peptides using Brownian dynamics simulations. We systematically investigate the effect of peptide C-terminal substitutions (Ser, Ala, Asn, Pro) of a Q16ETFSDLWKLLP27 p53-based peptide and a M1PRFMDYWEGLN12 12/1 phage-derived peptide on their interaction dynamics with MDM2. The substitutions modulate peptide residence times around the MDM2 protein. In particular, the highest affinity peptide, Q16ETFSDLWKLLS27, has the longest residence time (t ∼ 25 μs) around MDM2, suggesting its potentially important contribution to binding affinity. The binding of the p53-based peptides appears to be kinetically driven while that of the phage-derived series appears to be thermodynamically driven. The phage-derived peptides were found to adopt distinctly different modes of interaction with the MDM2 protein compared to their p53-based counterparts. The p53-based peptides approach the N-terminal region of the MDM2 protein with the peptide C-terminal end oriented toward the protein, while the M1PRFMDYWEGLN12-based peptides adopt the reverse orientation. To probe the determinants of this switch in orientation, a designed mutant of the phage-derived peptide, R3E (M1PEFMDYWEGLN12), was simulated and found to adopt the orientation adopted by the p53-based peptides and also to result in almost a 5-fold increase in the peptide residence time (∼120 μs) relative to the p53-based peptides. On this basis, we suggest that the R3E mutant phage-derived peptide has a higher affinity for MDM2 than the p53-based peptides and would therefore, competitively inhibit MDM2

  9. Apoptosis and morphological alterations after UVA irradiation in red blood cells of p53 deficient Japanese medaka (Oryzias latipes).

    PubMed

    Sayed, Alla El-Din Hamid; Watanabe-Asaka, Tomomi; Oda, Shoji; Mitani, Hiroshi

    2016-08-01

    Morphological alterations in red blood cells were described as hematological bioindicators of UVA exposure to investigate the sensitivity to UVA in wild type Japanese medaka (Oryzias latipes) and a p53 deficient mutant. The fewer abnormal red blood cells were observed in the p53 mutant fish under the control conditions. After exposure to different doses of UVA radiation (15min, 30min and 60min/day for 3days), cellular and nuclear alterations in red blood cells were analyzed in the UVA exposed fish compared with non-exposed controls and those alterations included acanthocytes, cell membrane lysis, swollen cells, teardrop-like cell, hemolyzed cells and sickle cells. Those alterations were increased after the UVA exposure both in wild type and the p53 deficient fish. Moreover, apoptosis analyzed by acridine orange assay showed increased number of apoptosis in red blood cells at the higher UVA exposure dose. No micronuclei but nuclear abnormalities as eccentric nucleus, nuclear budding, deformed nucleus, and bilobed nucleus were observed in each group. These results suggested that UVA exposure induced both p53 dependent and independent apoptosis and morphological alterations in red blood cells but less sensitive to UVA than Wild type in medaka fish. PMID:27203565

  10. p53 loss promotes acute myeloid leukemia by enabling aberrant self-renewal

    PubMed Central

    Zhao, Zhen; Zuber, Johannes; Diaz-Flores, Ernesto; Lintault, Laura; Kogan, Scott C.; Shannon, Kevin; Lowe, Scott W.

    2010-01-01

    The p53 tumor suppressor limits proliferation in response to cellular stress through several mechanisms. Here, we test whether the recently described ability of p53 to limit stem cell self-renewal suppresses tumorigenesis in acute myeloid leukemia (AML), an aggressive cancer in which p53 mutations are associated with drug resistance and adverse outcome. Our approach combined mosaic mouse models, Cre-lox technology, and in vivo RNAi to disable p53 and simultaneously activate endogenous KrasG12D—a common AML lesion that promotes proliferation but not self-renewal. We show that p53 inactivation strongly cooperates with oncogenic KrasG12D to induce aggressive AML, while both lesions on their own induce T-cell malignancies with long latency. This synergy is based on a pivotal role of p53 in limiting aberrant self-renewal of myeloid progenitor cells, such that loss of p53 counters the deleterious effects of oncogenic Kras on these cells and enables them to self-renew indefinitely. Consequently, myeloid progenitor cells expressing oncogenic Kras and lacking p53 become leukemia-initiating cells, resembling cancer stem cells capable of maintaining AML in vivo. Our results establish an efficient new strategy for interrogating oncogene cooperation, and provide strong evidence that the ability of p53 to limit aberrant self-renewal contributes to its tumor suppressor activity. PMID:20595231

  11. Functional p53 is required for rapid restoration of daunorubicin-induced lesions of the spleen

    PubMed Central

    2013-01-01

    Background The tumour suppressor and transcription factor p53 is a major determinant of the therapeutic response to anthracyclines. In healthy tissue, p53 is also considered pivotal for side effects of anthracycline treatment such as lesions in haematopoietic tissues like the spleen. We used a Trp53null mouse to explore the significance of p53 in anthracycline (daunorubicin) induced lesions in the spleen. Methods Mice with wild type or deleted Trp53 were treated with the daunorubicin (DNR) for three consecutive days. Spleens were collected at various time points after treatment, and examined for signs of chemotherapy-related lesions by microscopic analysis of haematoxylin-eosin or tunel-stained paraffin sections. Expression of death-inducing proteins was analysed by immunoblotting. Changes between Trp53 wild type and null mice were compared by t-tests. Results Signs of cell death (pyknotic nuclei and tunel-positive cells) in the white pulp of the spleen occurred earlier following DNR exposure in wt-mice compared to Trp53-null mice. While the spleen of wt-mice recovered to normal morphology, the spleen of the Trp53-null animals still had lesions with large necrotic areas and disorganised histologic appearance eight days after treatment. Immunoblotting showed that only Trp53-wt mice had significant increase in p21 after DNR treatment. However, both wt and null mice had elevated p63 levels following DNR exposure. Conclusions p53 protects against severe and enduring cellular damage of the spleen parenchyma after DNR treatment, and initial DNR-induced apoptosis is not predictive of tissue lesions in the spleen. Our data indicate that p53 induction following DNR treatment serves to protect rather than to destroy normal tissue. PMID:23841896

  12. Autoantibody recognition mechanisms of p53 epitopes

    NASA Astrophysics Data System (ADS)

    Phillips, J. C.

    2016-06-01

    There is an urgent need for economical blood based, noninvasive molecular biomarkers to assist in the detection and diagnosis of cancers in a cost-effective manner at an early stage, when curative interventions are still possible. Serum autoantibodies are attractive biomarkers for early cancer detection, but their development has been hindered by the punctuated genetic nature of the ten million known cancer mutations. A landmark study of 50,000 patients (Pedersen et al., 2013) showed that a few p53 15-mer epitopes are much more sensitive colon cancer biomarkers than p53, which in turn is a more sensitive cancer biomarker than any other protein. The function of p53 as a nearly universal "tumor suppressor" is well established, because of its strong immunogenicity in terms of not only antibody recruitment, but also stimulation of autoantibodies. Here we examine dimensionally compressed bioinformatic fractal scaling analysis for identifying the few sensitive epitopes from the p53 amino acid sequence, and show how it could be used for early cancer detection (ECD). We trim 15-mers to 7-mers, and identify specific 7-mers from other species that could be more sensitive to aggressive human cancers, such as liver cancer. Our results could provide a roadmap for ECD.

  13. Immunohistoselective sequencing (IHSS) of p53 tumor suppressor gene in human oesophageal precancerous lesions.

    PubMed

    Shi, S T; Feng, B; Yang, G Y; Wang, L D; Yang, C S

    1996-10-01

    Accumulation of p53 protein occurs in human oesophageal precancerous lesions and even in near-normal oesophageal epithelium. In some instances, p53 gene mutations have been detected. In many of the cases of p53 protein accumulation in early lesions, however, p53 mutations were not detected due to either the lack of mutation or the low abundance of cells with a mutation. In order to enrich p53 immunostain-positive cells for single strand conformation polymorphism (SSCP) analysis and DNA sequencing, an immunohisto-selective sequencing (IHSS) method was developed. Anti-p53 antibody-peroxidase stained oesophageal tissue sections were subjected to ultraviolet (UV) irradiation to damage the DNA in p53 immunostain-negative cells. The immunostain protected p53 immunostain-positive cells from the UV light and thus preserved the DNA in those cells for PCR amplification. Comparison of the SSCP results from sections with and without UV treatment showed that the IHSS method selectively enriched p53 immunostain-positive cells. With this method, we could analyse mutations in samples with as few as 30 p53 immunostain-positive cells per tissue section. Analysis was carried out on tissues with precancerous lesions from six surgically-resected oesophageal specimens and 13 oesophageal biopsies from symptom-free subjects. The results of mutation analysis for some of the samples were confirmed by microdissection to enrich the p53-positive cells. The mutations in tissues with precancerous lesions were compared with those in the corresponding squamous cell carcinomas. The IHSS method is shown to be a simple and effective way to analyse mutations in p53 immunostain-positive cells. IHSS may also be a general method for molecular analysis of biological specimens after immunohistochemical staining. PMID:8895479

  14. Drug Resistance to Inhibitors of the Human Double Minute-2 E3 Ligase is Mediated by Point Mutations of p53, but can be Overcome with the p53 Targeting Agent RITA

    PubMed Central

    Jones, Richard J.; Bjorklund, Chad C.; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J.; Orlowski, Robert Z.

    2012-01-01

    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover, and has been validated pre-clinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, while Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA. HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor non-genotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G2/M arrest, up-regulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared to RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation. PMID:22933706

  15. ERβ decreases the invasiveness of triple-negative breast cancer cells by regulating mutant p53 oncogenic function

    PubMed Central

    Bado, Igor; Nikolos, Fotis; Rajapaksa, Gayani; Gustafsson, Jan-Åke; Thomas, Christoforos

    2016-01-01

    Most (80%) of the triple-negative breast cancers (TNBCs) express mutant p53 proteins that acquire oncogenic activities including promoting metastasis. We previously showed that wild-type ERβ (ERβ1) impedes epithelial to mesenchymal transition (EMT) and decreases the invasiveness of TNBC cells. In the present study we searched for signaling pathways that ERβ1 uses to inhibit EMT and invasion in TNBC cells. We show that ERβ1 binds to and opposes the transcriptional activity of mutant p53 at the promoters of genes that regulate metastasis. p63 that transcriptionally cooperates with mutant p53 also binds to ERβ1. Downregulation of p63 represses the epithelial phenotype of ERβ1-expressing cells and alters the expression of mutant p53 target genes. These results describe a novel mechanism through which ERβ1 can disturb oncogenic signals to inhibit aggressiveness in TNBCs. PMID:26871946

  16. Discovery of new low-molecular-weight p53-Mdmx disruptors and their anti-cancer activities.

    PubMed

    Uesato, Shinichi; Matsuura, Yoshihiro; Matsue, Saki; Sumiyoshi, Takaaki; Hirata, Yoshiyuki; Takemoto, Suzuho; Kawaratani, Yasuyuki; Yamai, Yusuke; Ishida, Kyoji; Sasaki, Tsutomu; Enari, Masato

    2016-04-15

    Although several p53-Mdm2-binding disruptors have been identified to date, few studies have been published on p53-Mdmx-interaction inhibitors. In the present study, we demonstrated that o-aminothiophenol derivatives with molecular weights of 200-300 selectively inhibited the p53-Mdmx interaction. S-2-Isobutyramidophenyl 2-methylpropanethioate (K-178) (1c) activated p53, up-regulated the expression of its downstream genes such as p21 and Mdm2, and preferentially inhibited the growth of cancer cells with wild-type p53 over those with mutant p53. Furthermore, we found that the S-isobutyryl-deprotected forms 1b and 3b of 1c and S-2-benzamidophenyl 2-methylpropanethioate (K-181) (3c) preferentially inhibited the p53-Mdmx interaction over the p53-Mdm2 interaction, respectively, by using a Flag-p53 and glutathione S-transferase (GST)-fused protein complex (Mdm2, Mdmx, DAPK1, or PPID). In addition, the interaction of p53 with Mdmx was lost by replacing a sulfur atom with an oxygen atom in 1b and 1c. These results suggest that sulfides such as 1b, 3b, 4b, and 5b interfere with the binding of p53-Mdmx, resulting in the dissociation of the two proteins. Furthermore, the results of oral administration experiments using xenografts in nude mice indicated that 1c reduced the volume of tumor masses to 49.0% and 36.6% that of the control at 100mg/kg and 150mg/kg, respectively, in 40days. PMID:27010502

  17. Absence of a p53 allele delays nitrogen mustard-induced early apoptosis and inflammation of murine skin

    PubMed Central

    Inturi, Swetha; Tewari-Singh, Neera; Jain, Anil K.; Roy, Srirupa; White, Carl W.; Agarwal, Rajesh

    2013-01-01

    Bifunctional alkylating agent sulfur mustard (SM) and its analog nitrogen mustard (NM) cause DNA damage leading to cell death, and potentially activating inflammation. Transcription factor p53 plays a critical role in DNA damage by regulating cell cycle progression and apoptosis. Earlier studies by our laboratory demonstrated phosphorylation of p53 at Ser15 and an increase in total p53 in epidermal cells both in vitro and in vivo following NM exposure. To elucidate the role of p53 in NM-induced skin toxicity, we employed SKH-1 hairless mice harboring wild type (WT) or heterozygous p53 (p53+/−). Exposure to NM (3.2 mg) caused a more profound increase in epidermal thickness and apoptotic cell death in WT relative to p53+/− mice at 24 h. However, by 72 h after exposure, there was a comparable increase in NM-induced epidermal cell death in both WT and p53+/− mice. Myeloperoxidase activity data showed that neutrophil infiltration was strongly enhanced in NM-exposed WT mice at 24 h persisting through 72 h of exposure. Conversely, robust NM-induced neutrophil infiltration (comparable to WT mice) was seen only at 72 h after exposure in p53+/− mice. Similarly, NM-exposure strongly induced macrophage and mast cell infiltration in WT, but not p53+/− mice. Together, these data indicate that early apoptosis and inflammation induced by NM in mouse skin are p53-dependent. Thus, targeting this pathway could be a novel strategy for developing countermeasures against vesicants-induced skin injury. PMID:23845566

  18. Novel p53 target genes secreted by the liver are involved in non-cell-autonomous regulation.

    PubMed

    Charni, M; Molchadsky, A; Goldstein, I; Solomon, H; Tal, P; Goldfinger, N; Yang, P; Porat, Z; Lozano, G; Rotter, V

    2016-03-01

    The tumor-suppressor p53 is a transcription factor that prevents cancer development and is involved in regulation of various physiological processes. This is mediated both by induction of cell cycle arrest and apoptosis and by controlling the expression of a plethora of target genes, including secreted proteins. It has been demonstrated that p53 may exert its effect in non-cell-autonomous manner by modulating the expression of genes that encode for secreted factors. In this study, we utilized our microarray data to identify and characterize novel p53 target genes expressed in human liver cells and associated with steroid hormones processing and transfer. We identified the steroid hormones binding factors, sex hormone-binding globulin (SHBG), corticosteroid-binding globulin (CBG) and cytochrome P450 family 21 subfamily A polypeptide 2, as novel p53 target genes. Their expression and secretion was increased following p53 activation in various hepatic cells. We observed that p53 wild-type mice exhibited higher levels of CBG compared with their p53 null counterparts. We demonstrated that the induction of the steroid hormones binding factors can be mediated by binding to specific p53 responsive elements within their promoters. In addition, utilizing conditioned medium experiments we have shown that p53-dependent induction of SHBG secretion from liver cells enhances apoptosis of breast cancer cells. Moreover, depletion of SHBG abolished the induction of breast cancer cells death. The newly identified p53 target genes suggest a novel non-cell-autonomous tumor-suppressive regulation mediated by p53 that is central for maintaining organism homeostasis. PMID:26358154

  19. Nutlin-3a: A Potential Therapeutic Opportunity for TP53 Wild-Type Ovarian Carcinomas

    PubMed Central

    Tsang, Yvonne T. M.; Mullany, Lisa K.; Zu, Zhifei; Richards, JoAnne S.; Gershenson, David M.; Wong, Kwong-Kwok

    2015-01-01

    Epithelial ovarian cancer is a diverse molecular and clinical disease, yet standard treatment is the same for all subtypes. TP53 mutations represent a node of divergence in epithelial ovarian cancer histologic subtypes and may represent a therapeutic opportunity in subtypes expressing wild type, including most low-grade ovarian serous carcinomas, ovarian clear cell carcinomas and ovarian endometrioid carcinomas, which represent approximately 25% of all epithelial ovarian cancer. We therefore sought to investigate Nutlin-3a—a therapeutic which inhibits MDM2, activates wild-type p53, and induces apoptosis—as a therapeutic compound for TP53 wild-type ovarian carcinomas. Fifteen epithelial ovarian cancer cell lines of varying histologic subtypes were treated with Nutlin-3a with determination of IC50 values. Western Blot (WB) and quantitative real-time polymerase chain reaction (qRT-PCR) analyses quantified MDM2, p53, and p21 expression after Nutlin-3a treatment. DNA from 15 cell lines was then sequenced for TP53 mutations in exons 2-11 including intron-exon boundaries. Responses to Nutlin-3a were dependent upon TP53 mutation status. By qRT-PCR and WB, levels of MDM2 and p21 were upregulated in wild-type TP53 sensitive cell lines, and p21 induction was reduced or absent in mutant cell lines. Annexin V assays demonstrated apoptosis in sensitive cell lines treated with Nutlin-3a. Thus, Nutlin-3a could be a potential therapeutic agent for ovarian carcinomas expressing wild-type TP53 and warrants further investigation. PMID:26248031

  20. Nutlin-3a: A Potential Therapeutic Opportunity for TP53 Wild-Type Ovarian Carcinomas.

    PubMed

    Crane, Erin K; Kwan, Suet-Yan; Izaguirre, Daisy I; Tsang, Yvonne T M; Mullany, Lisa K; Zu, Zhifei; Richards, JoAnne S; Gershenson, David M; Wong, Kwong-Kwok

    2015-01-01

    Epithelial ovarian cancer is a diverse molecular and clinical disease, yet standard treatment is the same for all subtypes. TP53 mutations represent a node of divergence in epithelial ovarian cancer histologic subtypes and may represent a therapeutic opportunity in subtypes expressing wild type, including most low-grade ovarian serous carcinomas, ovarian clear cell carcinomas and ovarian endometrioid carcinomas, which represent approximately 25% of all epithelial ovarian cancer. We therefore sought to investigate Nutlin-3a--a therapeutic which inhibits MDM2, activates wild-type p53, and induces apoptosis--as a therapeutic compound for TP53 wild-type ovarian carcinomas. Fifteen epithelial ovarian cancer cell lines of varying histologic subtypes were treated with Nutlin-3a with determination of IC50 values. Western Blot (WB) and quantitative real-time polymerase chain reaction (qRT-PCR) analyses quantified MDM2, p53, and p21 expression after Nutlin-3a treatment. DNA from 15 cell lines was then sequenced for TP53 mutations in exons 2-11 including intron-exon boundaries. Responses to Nutlin-3a were dependent upon TP53 mutation status. By qRT-PCR and WB, levels of MDM2 and p21 were upregulated in wild-type TP53 sensitive cell lines, and p21 induction was reduced or absent in mutant cell lines. Annexin V assays demonstrated apoptosis in sensitive cell lines treated with Nutlin-3a. Thus, Nutlin-3a could be a potential therapeutic agent for ovarian carcinomas expressing wild-type TP53 and warrants further investigation. PMID:26248031

  1. The p53 inhibitor MDM2 facilitates Sonic Hedgehog-mediated tumorigenesis and influences cerebellar foliation.

    PubMed

    Malek, Reem; Matta, Jennifer; Taylor, Natalie; Perry, Mary Ellen; Mendrysa, Susan M

    2011-01-01

    Disruption of cerebellar granular neuronal precursor (GNP) maturation can result in defects in motor coordination and learning, or in medulloblastoma, the most common childhood brain tumor. The Sonic Hedgehog (Shh) pathway is important for GNP proliferation; however, the factors regulating the extent and timing of GNP proliferation, as well as GNP differentiation and migration are poorly understood. The p53 tumor suppressor has been shown to negatively regulate the activity of the Shh effector, Gli1, in neural stem cells; however, the contribution of p53 to the regulation of Shh signaling in GNPs during cerebellar development has not been determined. Here, we exploited a hypomorphic allele of Mdm2 (Mdm2(puro)), which encodes a critical negative regulator of p53, to alter the level of wild-type MDM2 and p53 in vivo. We report that mice with reduced levels of MDM2 and increased levels of p53 have small cerebella with shortened folia, reminiscent of deficient Shh signaling. Indeed, Shh signaling in Mdm2-deficient GNPs is attenuated, concomitant with decreased expression of the Shh transducers, Gli1 and Gli2. We also find that Shh stimulation of GNPs promotes MDM2 accumulation and enhances phosphorylation at serine 166, a modification known to increase MDM2-p53 binding. Significantly, loss of MDM2 in Ptch1(+/-) mice, a model for Shh-mediated human medulloblastoma, impedes cerebellar tumorigenesis. Together, these results place MDM2 at a major nexus between the p53 and Shh signaling pathways in GNPs, with key roles in cerebellar development, GNP survival, cerebellar foliation, and MB tumorigenesis. PMID:21437245

  2. Survivin safeguards chromosome numbers and protects from aneuploidy independently from p53

    PubMed Central

    2014-01-01

    Background Survivin, a member of the inhibitor of apoptosis (IAP) gene family, has a dual role in mitosis and in apoptosis. It is abundantly expressed in every human tumor, compared with normal tissues. During mitosis Survivin assembles with the chromosomal passenger complex and regulates chromosomal segregation. Here, we aim to explore whether interference with the mitotic function of Survivin is linked to p53-mediated G1 cell cycle arrest and affects chromosomal stability. Methods In this study, we used HCT116, SBC-2, and U87-MG and generated corresponding isogenic p53-deficient cells. Retroviral vectors were used to stably knockdown Survivin. The resulting phenotype, in particular the mechanisms of cell cycle arrest and of initiation of aneuploidy, were investigated by Western Blot analysis, confocal laser scan microscopy, proliferation assays, spectral karyotyping and RNAi. Results In all cell lines Survivin-RNAi did not induce instant apoptosis but caused polyplodization irrespective of p53 status. Strikingly, polyploidization after knockdown of Survivin resulted in merotelic kinetochore spindle assemblies, γH2AX-foci, and DNA damage response (DDR), which was accompanied by a transient p53-mediated G1-arrest. That p53 wild type cells specifically arrest due to DNA damage was shown by simultaneous inhibition of ATM and DNA-PK, which abolished induction of p21waf/cip. Cytogenetic analysis revealed chromosomal aberrations indicative for DNA double strand break repair by the mechanism of non-homologous end joining (NHEJ), only in Survivin-depleted cells. Conclusion Our findings suggest that Survivin plays an essential role in proper amphitelic kinetochore-spindle assembly and that constraining Survivin’s mitotic function results in polyploidy and aneuploidy which cannot be controlled by p53. Therefore, Survivin critically safeguards chromosomal stability independently from p53. PMID:24886358

  3. Tumor suppressor p53 inhibits transcriptional activation of invasion gene thromboxane synthase mediated by the proto-oncogenic factor ets-1.

    PubMed

    Kim, Ella; Günther, Willy; Yoshizato, Kimio; Meissner, Hildegard; Zapf, Srenja; Nüsing, Rolf M; Yamamoto, Hirotaka; Van Meir, Erwin G; Deppert, Wolfgang; Giese, Alf

    2003-10-30

    Cancer formation and progression is a complex process determined by several mechanisms that promote cell growth, invasiveness, neo-angiogenesis, and render neoplastic cells resistant to apoptosis. The tumor suppressor p53 and the proto-oncogenic factor ets-1 are important regulators of such mechanisms. While it is well established that p53 and ets-1 influence various aspects of cell behavior by regulating the transcription of specific genes, little is known about the functional relationship between these transcription factors. We found that the gene encoding thromboxane synthase (TXSA), which we recently identified as a factor promoting invasion and resistance to apoptosis in gliomas, is a novel target gene for both p53 and ets-1. We demonstrate that p53 and ets-1 coregulate TXSA in an antagonistic and inter-related manner, with ets-1 being a potent transcriptional activator and p53 inhibiting ets-1-dependent transcription. Negative interference with ets-1 transcription requires functional p53 and is lost in mutant p53 proteins. We show that ets-1 and p53 associate physically in vitro and in vivo and that their interaction, rather than a direct binding of p53 to the TXSA promoter, is required for transcriptional repression of TXSA by wild-type p53. An important implication of our findings is that the loss of p53-mediated negative control over ets-1-dependent transcription may lead to the acquisition of an invasive phenotype in tumor cells. PMID:14586398

  4. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

    PubMed

    2003-01-01

    Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

  5. FUSE Binding Protein 1 Facilitates Persistent Hepatitis C Virus Replication in Hepatoma Cells by Regulating Tumor Suppressor p53

    PubMed Central

    Dixit, Updesh; Pandey, Ashutosh K.; Liu, Zhihe; Kumar, Sushil; Neiditch, Matthew B.; Klein, Kenneth M.

    2015-01-01

    ABSTRACT Hepatitis C virus (HCV) is a leading cause of chronic hepatitis C (CHC), liver cirrhosis, and hepatocellular carcinoma (HCC). Immunohistochemistry of archived HCC tumors showed abundant FBP1 expression in HCC tumors with the CHC background. Oncomine data analysis of normal versus HCC tumors with the CHC background indicated a 4-fold increase in FBP1 expression with a concomitant 2.5-fold decrease in the expression of p53. We found that FBP1 promotes HCV replication by inhibiting p53 and regulating BCCIP and TCTP, which are positive and negative regulators of p53, respectively. The severe inhibition of HCV replication in FBP1-knockdown Huh7.5 cells was restored to a normal level by downregulation of either p53 or BCCIP. Although p53 in Huh7.5 cells is transcriptionally inactive as a result of Y220C mutation, we found that the activation and DNA binding ability of Y220C p53 were strongly suppressed by FBP1 but significantly activated upon knockdown of FBP1. Transient expression of FBP1 in FBP1 knockdown cells fully restored the control phenotype in which the DNA binding ability of p53 was strongly suppressed. Using electrophoretic mobility shift assay (EMSA) and isothermal titration calorimetry (ITC), we found no significant difference in in vitro target DNA binding affinity of recombinant wild-type p53 and its Y220C mutant p53. However, in the presence of recombinant FBP1, the DNA binding ability of p53 is strongly inhibited. We confirmed that FBP1 downregulates BCCIP, p21, and p53 and upregulates TCTP under radiation-induced stress. Since FBP1 is overexpressed in most HCC tumors with an HCV background, it may have a role in promoting persistent virus infection and tumorigenesis. IMPORTANCE It is our novel finding that FUSE binding protein 1 (FBP1) strongly inhibits the function of tumor suppressor p53 and is an essential host cell factor required for HCV replication. Oncomine data analysis of a large number of samples has revealed that overexpression of

  6. Novel luminescent silica nanoparticles (LSN): p53 gene delivery system in breast cancer in vitro and in vivo.

    PubMed

    Rejeeth, Chandrababu; Salem, Ahmed

    2016-03-01

    Objectives  Mutations in the p53 tumor suppressor gene are one among the most common genetic abnormalities to be described in breast cancer. However, there are a few recant reports on non-viral vector-mediated p53 gene delivery in breast cancer. Methods  A new formulation of luminescent silica nanoparticles (LSNs) for gene delivery was produced by the two-step method with slight modification. Key findings  The pp53 plasmid constructs (p53-EGFP)/LSNs complexes were transfected into human breast cancer cell (MCF-7) and transfection efficiency was determined by FACS analysis. The gene expression was determined by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis respectively. Further the growth inhibition through induced apoptosis with pp53-EGFP/LSNs complex were assessed by trypan blue exclusion assay and annexin V staining, respectively. Interestingly the in vivo biodistribution of plasmid DNA study revealed the occurrence was investigated by PCR and RT-PCR. The transfection efficiency of LSNs showed the highest transfection efficiency among the LSN formulation was higher than that of commercially available Lipofectin®. The LSNs-mediated transfection of the p53 gene resulted in efficient high level of wild-type p53 mRNA and protein expression levels in MCF-7 cells. Selected tissues were analyzed for any potential toxicity by histological analysis the efficient reestablishment of wild-type p53 function in breast cancer cells restored the p53 dependent apoptotic pathway. Conclusions  Taken together, our results reveal that cationic LSN-mediated p53 gene delivery may have potential application as a non-viral vector-mediated breast cancer gene therapy due to its effective induction of apoptosis and tumor growth inhibition. PMID:27085860

  7. SAR405838: An optimized inhibitor of MDM2-p53 interaction that induces complete and durable tumor regression

    PubMed Central

    Wang, Shaomeng; Sun, Wei; Zhao, Yujun; McEachern, Donna; Meaux, Isabelle; Barrière, Cédric; Stuckey, Jeanne; Meagher, Jennifer; Bai, Longchuan; Liu, Liu; Hoffman-Luca, Cassandra Gianna; Lu, Jianfeng; Shangary, Sanjeev; Yu, Shanghai; Bernard, Denzil; Aguilar, Angelo; Dos-Santos, Odette; Besret, Laurent; Guerif, Stéphane; Pannier, Pascal; Gorge-Bernat, Dimitri; Debussche, Laurent

    2014-01-01

    Blocking the MDM2-p53 protein-protein interaction has long been considered to offer a broad cancer therapeutic strategy, despite the potential risks of selecting tumors harboring p53 mutations that escape MDM2 control. In this study, we report a novel small molecule inhibitor of the MDM2-p53 interaction, SAR405838 (MI-77301) that has been advanced into Phase I clinical trials. SAR405838 binds to MDM2 with Ki = 0.88 nM and has high specificity over other proteins. A co-crystal structure of the SAR405838:MDM2 complex shows that in addition to mimicking three key p53 amino acid residues, the inhibitor captures additional interactions not observed in the p53-MDM2 complex and induces refolding of the short, unstructured MDM2 N-terminal region to achieve its high affinity. SAR405838 effectively activates wild-type p53 in vitro and in xenograft tumor tissue of leukemia and solid tumors, leading to p53-dependent cell cycle arrest and/or apoptosis. At well-tolerated dose schedules, SAR405838 achieves either durable tumor regression or complete tumor growth inhibition in mouse xenograft models of SJSA-1 osteosarcoma, RS4;11 acute leukemia, LNCaP prostate cancer and HCT-116 colon cancer. Remarkably, a single oral dose of SAR405838 is sufficient to achieve complete tumor regression in the SJSA-1 model. Mechanistically, robust transcriptional up-regulation of PUMA induced by SAR405838 results in strong apoptosis in tumor tissue, leading to complete tumor regression. Our findings provide a preclinical basis upon which to evaluate SAR405838 as a therapeutic agent in patients whose tumors retain wild-type p53. PMID:25145672

  8. Cyclopentenyl cytosine induces senescence in breast cancer cells through the nucleolar stress response and activation of p53.

    PubMed

    Huang, Min; Whang, Patrick; Lewicki, Patrick; Mitchell, Beverly S

    2011-07-01

    The induction of senescence has emerged as a potentially important contributor to the effects of chemotherapeutic agents against tumors. We have demonstrated that depletion of CTP induced by cyclopentenyl cytosine (CPEC; NSC 375575), a specific inhibitor of the enzyme CTP synthetase, induces irreversible growth arrest and senescence characterized by altered morphology and expression of senescence-associated β-galactosidase activity in MCF-7 breast cancer cells expressing wild-type p53. In contrast, differentiation in the absence of senescence resulted from CPEC treatment in MDA-MB-231 breast cancer cells that express a mutated p53. Both senescence of MCF-7 cells and differentiation of MDA-MB-231 cells were prevented by repletion of CTP through the cytidine salvage pathway. Senescence in MCF-7 cells was associated with a G(2)- and S-phase arrest, whereas differentiation in MDA-MB-231 cells was associated with arrest in G(1) phase at 5 days. Mechanistic studies revealed that CTP depletion induced a rapid translocation of nucleolar proteins, including nucleostemin and nucleolin into the nucleoplasm. This nucleolar stress response resulted in a sustained elevation of p53 and the p53 target genes, p21 and Mdm2, in cells with wild-type p53. Furthermore, short interfering RNA-induced knockdown of p53 in MCF-7 cells treated with CPEC prevented cellular senescence and increased apoptotic cell death. We conclude that CTP depletion and the resulting nucleolar stress response results in a senescence-like growth arrest through activation of p53, whereas cells with mutated p53 undergo differentiation or apoptotic cell death. PMID:21464199

  9. Cyclopentenyl Cytosine Induces Senescence in Breast Cancer Cells through the Nucleolar Stress Response and Activation of p53S⃞

    PubMed Central

    Huang, Min; Whang, Patrick; Lewicki, Patrick

    2011-01-01

    The induction of senescence has emerged as a potentially important contributor to the effects of chemotherapeutic agents against tumors. We have demonstrated that depletion of CTP induced by cyclopentenyl cytosine (CPEC; NSC 375575), a specific inhibitor of the enzyme CTP synthetase, induces irreversible growth arrest and senescence characterized by altered morphology and expression of senescence-associated β-galactosidase activity in MCF-7 breast cancer cells expressing wild-type p53. In contrast, differentiation in the absence of senescence resulted from CPEC treatment in MDA-MB-231 breast cancer cells that express a mutated p53. Both senescence of MCF-7 cells and differentiation of MDA-MB-231 cells were prevented by repletion of CTP through the cytidine salvage pathway. Senescence in MCF-7 cells was associated with a G2- and S-phase arrest, whereas differentiation in MDA-MB-231 cells was associated with arrest in G1 phase at 5 days. Mechanistic studies revealed that CTP depletion induced a rapid translocation of nucleolar proteins, including nucleostemin and nucleolin into the nucleoplasm. This nucleolar stress response resulted in a sustained elevation of p53 and the p53 target genes, p21 and Mdm2, in cells with wild-type p53. Furthermore, short interfering RNA-induced knockdown of p53 in MCF-7 cells treated with CPEC prevented cellular senescence and increased apoptotic cell death. We conclude that CTP depletion and the resulting nucleolar stress response results in a senescence-like growth arrest through activation of p53, whereas cells with mutated p53 undergo differentiation or apoptotic cell death. PMID:21464199

  10. Neoangiogenesis and p53 protein in lung cancer: their prognostic role and their relation with vascular endothelial growth factor (VEGF) expression.

    PubMed Central

    Fontanini, G.; Vignati, S.; Lucchi, M.; Mussi, A.; Calcinai, A.; Boldrini, L.; Chiné, S.; Silvestri, V.; Angeletti, C. A.; Basolo, F.; Bevilacqua, G.

    1997-01-01

    Following up-regulation of an angiogenesis inhibitor by the wild-type p53 protein proven recently, we have analysed on the one hand the prognostic impact of microvessel count (MC) and p53 protein overexpression in non-small-cell lung carcinoma (NSCLC) progression and, on the other hand, the inter-relation between the microvascular pattern and the p53 protein expression. Moreover, we assessed the expression of vascular endothelial growth factor (VEGF), one of the pivotal mediators of tumour angiogenesis, in order to investigate its relation to p53 protein expression and MC. Tumours from 73 patients resected for NSCLC between March 1991 and April 1992 (median follow-up 47 months, range 32-51 months) were analysed using an immunohistochemical method. In univariate analysis, MC and p53 accumulation were shown to affect metastatic nodal involvement, recurrence and death significantly. Multiple logistic regression analysis showed an important prognostic influence of MC and nodal status on overall (P = 0.0009; P = 0.01) and disease-free survival (P = 0.0001; P = 0.03). Interestingly, a strong statistical association was observed between p53 nuclear accumulation and MC (P = 0.0003). The same inter-relationship was found in non-squamous histotype (P = 0.002). When we analysed the concomitant influence of MC and p53 expression on overall survival, we were able to confirm a real predominant role of MC in comparison with p53. With regard to VEGF expression, p53-negative and lowly vascularized tumours showed a mean VEGF expression significantly lower than p53-positive and highly vascularized cancers (P = 0.02). These results underline the prognostic impact of MC and p53 protein accumulation in NSCLC and their reciprocal inter-relationship, supporting the hypothesis of a wild-type p53 regulation on the angiogenetic process through a VEGF up-regulation. Images Figure 1 Figure 3 Figure 8 PMID:9155049

  11. PDL1 Regulation by p53 via miR-34

    PubMed Central

    Cortez, Maria Angelica; Ivan, Cristina; Valdecanas, David; Wang, Xiaohong; Peltier, Heidi J.; Ye, Yuping; Araujo, Luiz; Carbone, David P.; Shilo, Konstantin; Giri, Dipak K; Kelnar, Kevin; Martin, Desiree; Komaki, Ritsuko; Gomez, Daniel R.; Krishnan, Sunil; Calin, George A.; Bader, Andreas G.

    2016-01-01

    Background: Although clinical studies have shown promise for targeting PD1/PDL1 signaling in non–small cell lung cancer (NSCLC), the regulation of PDL1 expression is poorly understood. Here, we show that PDL1 is regulated by p53 via miR-34. Methods: p53 wild-type and p53-deficient cell lines (p53–/– and p53+/+ HCT116, p53-inducible H1299, and p53-knockdown H460) were used to determine if p53 regulates PDL1 via miR-34. PDL1 and miR-34a expression were analyzed in samples from patients with NSCLC and mutated p53 vs wild-type p53 tumors from The Cancer Genome Atlas for Lung Adenocarcinoma (TCGA LUAD). We confirmed that PDL1 is a direct target of miR-34 with western blotting and luciferase assays and used a p53R172HΔg/+K-rasLA1/+ syngeneic mouse model (n = 12) to deliver miR-34a–loaded liposomes (MRX34) plus radiotherapy (XRT) and assessed PDL1 expression and tumor-infiltrating lymphocytes (TILs). A two-sided t test was applied to compare the mean between different treatments. Results: We found that p53 regulates PDL1 via miR-34, which directly binds to the PDL1 3’ untranslated region in models of NSCLC (fold-change luciferase activity to control group, mean for miR-34a = 0.50, SD = 0.2, P < .001; mean for miR-34b = 0.52, SD = 0.2, P = .006; and mean for miR-34c = 0.59, SD = 0.14, and P = .006). Therapeutic delivery of MRX34, currently the subject of a phase I clinical trial, promoted TILs (mean of CD8 expression percentage of control group = 22.5%, SD = 1.9%; mean of CD8 expression percentage of MRX34 = 30.1%, SD = 3.7%, P = .016, n = 4) and reduced CD8+PD1+ cells in vivo (mean of CD8/PD1 expression percentage of control group = 40.2%, SD = 6.2%; mean of CD8/PD1 expression percentage of MRX34 = 20.3%, SD = 5.1%, P = .001, n = 4). Further, MRX34 plus XRT increased CD8+ cell numbers more than either therapy alone (mean of CD8 expression percentage of MRX34 plus XRT to control group = 44.2%, SD = 8.7%, P = .004, n = 4). Finally, miR-34a delivery reduced the

  12. A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53.

    PubMed

    Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena; Spiotto, Michael T

    2016-01-01

    p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

  13. A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53

    PubMed Central

    Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena

    2016-01-01

    p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

  14. Induction of PPM1D following DNA-damaging treatments through a conserved p53 response element coincides with a shift in the use of transcription initiation sites

    SciTech Connect

    Rossi, M.; Anderson, C.; Demidov, O. N.; Appella, E.; Mazur, S. J.

    2008-12-01

    PPM1D (Wip1), a type PP2C phosphatase, is expressed at low levels in most normal tissues but is overexpressed in several types of cancers. In cells containing wild-type p53, the levels of PPM1D mRNA and protein increase following exposure to genotoxic stress, but the mechanism of regulation by p53 was unknown. PPM1D also has been identified as a CREB-regulated gene due to the presence of a cyclic AMP response element (CRE) in the promoter. Transient transfection and chromatin immunoprecipitation experiments in HCT116 cells were used to characterize a conserved p53 response element located in the 5' untranslated region (UTR) of the PPM1D gene that is required for the p53-dependent induction of transcription from the human PPM1D promoter. CREB binding to the CRE contributes to the regulation of basal expression of PPM1D and directs transcription initiation at upstream sites. Following exposure to ultraviolet (UV) or ionizing radiation, the abundance of transcripts with short 5' UTRs increased in cells containing wild-type p53, indicating increased utilization of downstream transcription initiation sites. In cells containing wild-type p53, exposure to UV resulted in increased PPM1D protein levels even when PPM1D mRNA levels remained constant, indicating post-transcriptional regulation of PPM1D protein levels.

  15. Critical roles of DMP1 in human epidermal growth factor receptor 2/neu-Arf-p53 signaling and breast cancer development.

    PubMed

    Taneja, Pankaj; Maglic, Dejan; Kai, Fumitake; Sugiyama, Takayuki; Kendig, Robert D; Frazier, Donna P; Willingham, Mark C; Inoue, Kazushi

    2010-11-15

    Human epidermal growth factor receptor 2 (HER2) overexpression stimulates cell growth in p53-mutated cells while it inhibits cell proliferation in those with wild-type p53, but the molecular mechanism is unknown. The Dmp1 promoter was activated by HER2/neu through the phosphatidylinositol-3'-kinase-Akt-NF-κB pathway, which in turn stimulated Arf transcription. Binding of p65 and p52 subunits of NF-κB was shown to the Dmp1 promoter and that of Dmp1 to the Arf promoter on HER2/neu overexpression. Both Dmp1 and p53 were induced in premalignant lesions from mouse mammary tumor virus-neu mice, and mammary tumorigenesis was significantly accelerated in both Dmp1+/- and Dmp1-/- mice. Selective deletion of Dmp1 and/or overexpression of Tbx2/Pokemon was found in >50% of wild-type HER2/neu carcinomas, although the involvement of Arf, Mdm2, or p53 was rare. Tumors from Dmp1+/-, Dmp1-/-, and wild-type neu mice with hemizygous Dmp1 deletion showed significant downregulation of Arf and p21Cip1/WAF1, showing p53 inactivity and more aggressive phenotypes than tumors without Dmp1 deletion. Notably, endogenous hDMP1 mRNA decreased when HER2 was depleted in human breast cancer cells. Our study shows the pivotal roles of Dmp1 in HER2/neu-p53 signaling and breast carcinogenesis. PMID:21062982

  16. Mammary gland-specific ablation of focal adhesion kinase reduces the incidence of p53-mediated mammary tumour formation

    PubMed Central

    van Miltenburg, M H A M; van Nimwegen, M J; Tijdens, I; Lalai, R; Kuiper, R; Klarenbeek, S; Schouten, P C; de Vries, A; Jonkers, J; van de Water, B

    2014-01-01

    Background: Elevated expression of focal adhesion kinase (FAK) occurs in numerous human cancers including colon-, cervix- and breast cancer. Although several studies have implicated FAK in mammary tumour formation induced by ectopic oncogene expression, evidence supporting a role for FAK in spontaneous mammary tumour development caused by loss of tumour suppressor genes such as p53 is lacking. Alterations in the tumour suppressor gene p53 have been implicated in over 50% of human breast cancers. Given that elevated FAK expression highly correlates with p53 mutation status in human breast cancer, we set out to investigate the importance of FAK in p53-mediated spontaneous mammary tumour development. Methods: To directly assess the role of FAK, we generated mice with conditional inactivation of FAK and p53. We generated female p53lox/lox/FAK+/+/WapCre, p53lox/lox/FAKflox/+/WapCre and p53lox/lox/FAKflox/−/WapCre mice, and mice with WapCre-mediated conditional expression of p53R270H, the mouse equivalent of human p53R273H hot spot mutation, together with conditional deletion of FAK, P53R270H/+/FAKlox/+/WapCre and p53R270H/+/FAKflox/−/WapCre mice. All mice were subjected to one pregnancy to induce WapCre-mediated deletion of p53 or expression of p53 R270H, and Fak genes flanked by two loxP sites, and subsequently followed the development of mammary tumours. Results: Using this approach, we show that FAK is important for p53-induced mammary tumour development. In addition, mice with the mammary gland-specific conditional expression of p53 point mutation R270H, the mouse equivalent to human R273H, in combination with conditional deletion of Fak showed reduced incidence of p53R270H-induced mammary tumours. In both models these effects of FAK were related to reduced proliferation in preneoplastic lesions in the mammary gland ductal structures. Conclusions: Mammary gland-specific ablation of FAK hampers p53-regulated spontaneous mammary tumour formation. Focal adhesion

  17. Computational identification of a transiently open L1/S3 pocket for reactivation of mutant p53

    PubMed Central

    Wassman, Christopher D.; Baronio, Roberta; Demir, Özlem; Wallentine, Brad D.; Chen, Chiung-Kuang; Hall, Linda V.; Salehi, Faezeh; Lin, Da-Wei; Chung, Benjamin P.; Wesley Hatfield, G.; Richard Chamberlin, A.; Luecke, Hartmut; Lathrop, Richard H.; Kaiser, Peter; Amaro, Rommie E.

    2013-01-01

    The tumour suppressor p53 is the most frequently mutated gene in human cancer. Reactivation of mutant p53 by small molecules is an exciting potential cancer therapy. Although several compounds restore wild-type function to mutant p53, their binding sites and mechanisms of action are elusive. Here computational methods identify a transiently open binding pocket between loop L1 and sheet S3 of the p53 core domain. Mutation of residue Cys124, located at the centre of the pocket, abolishes p53 reactivation of mutant R175H by PRIMA-1, a known reactivation compound. Ensemble-based virtual screening against this newly revealed pocket selects stictic acid as a potential p53 reactivation compound. In human osteosarcoma cells, stictic acid exhibits dose-dependent reactivation of p21 expression for mutant R175H more strongly than does PRIMA-1. These results indicate the L1/S3 pocket as a target for pharmaceutical reactivation of p53 mutants. PMID:23360998

  18. Functional and physical interaction between p53 and BZLF1: implications for Epstein-Barr virus latency.

    PubMed Central

    Zhang, Q; Gutsch, D; Kenney, S

    1994-01-01

    The p53 tumor suppressor protein, which is commonly mutated in human cancers, has been shown to interact directly with virally encoded from papillomavirus, adenovirus, and simian virus 40. The disruption of p53 function may be required for efficient replication of certain viruses and may also play a role in the development of virally induced malignancies. Infection with Epstein-Barr virus (EBV) has been associated with the development of B-cell lymphomas and nasopharyngeal carcinoma. Here we show that the EBV immediate-early protein, BZLF1 (Z), which is responsible for initiating the switch from latent to lytic infection, can interact directly in vitro and in vivo with the tumor suppressor protein, p53. This interaction requires the coiled-coil dimerization domain of the Z protein and the carboxy-terminal portion of p53. Overexpression of wild-type p53 inhibits the ability of Z to disrupt viral latency. Likewise, Z inhibits p53-dependent transactivation in lymphoid cells. The direct interaction between Z and p53 may play a role in regulating the switch from latent to lytic viral infection. Images PMID:8114724

  19. The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.

    PubMed

    Puszynski, Krzysztof; Gandolfi, Alberto; d'Onofrio, Alberto

    2014-12-01

    In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug. PMID:25504419

  20. New insights into the anticancer activity of carnosol: p53 reactivation in the U87MG human glioblastoma cell line.

    PubMed

    Giacomelli, Chiara; Natali, Letizia; Trincavelli, Maria Letizia; Daniele, Simona; Bertoli, Alessandra; Flamini, Guido; Braca, Alessandra; Martini, Claudia

    2016-05-01

    Glioblastoma multiforme (GBM) is an aggressive brain tumour with high resistance to radio- and chemotherapy. As such, increasing attention has focused on developing new therapeutic strategies to improve treatment responses. Recently, attention has been shifted to natural compounds that are able to halt tumour development. Among them, carnosol (CAR), a phenolic diterpene present in rosemary, has become a promising molecule that is able to prevent certain types of solid cancer. However, no data are available on the effects of CAR in GBM. Here, CAR activity decreased the proliferation of different human glioblastoma cell lines, particularly cells that express wild type p53. The p53 pathway is involved in the control of apoptosis and is often impaired in GBM. Notably, CAR, through the dissociation of p53 from its endogenous inhibitor MDM2, was able to increase the intracellular p53 levels in GBM cells. Accordingly, functional reactivation of p53 was demonstrated by the stimulation of p53 target genes' transcription, the induction of apoptosis and cell cycle blockade. Most importantly, CAR produced synergistic effects with temozolomide (TMZ) and reduced the restoration of the tumour cells' proliferation after drug removal. Thus, for the first time, these data highlighted the potential use of the diterpene in the sensitization of GBM cells to chemotherapy through a direct re-activation of p53 pathway. Furthermore, progress has been made in delineating the biochemical mechanisms underlying the pro-apoptotic effects of this molecule. PMID:26939786

  1. Inhibition of p53-dependent transcription by BOX-I phospho-peptide mimetics that bind to p300

    PubMed Central

    Dornan, David; Hupp, Ted R.

    2001-01-01

    The N-terminal BOX-I domain of p53 containing a docking site for the negative regulator MDM2 and the positive effector p300, harbours two recently identified phosphorylation sites at Thr18 or Ser20 whose affect on p300 is undefined. Biochemical assays demonstrate that although MDM2 binding is inhibited by these phosphorylations, p300 binding is strikingly stabilized by Thr18 or Ser20 phosphorylation. Introducing EGFP-BOX-I domain peptides with an aspartate substitution at Thr18 or Ser20 induced a significant inhibition of endogenous p53-dependent transcription in cycling cells, in irradiated cells, as well as in cells transiently co-transfected with p300 and p53. In contrast an EGFP-wild-type BOX-I domain peptide stimulated p53 activity via inhibition of MDM2 protein binding. These results suggest that phosphorylation of p53 at Thr18 or Ser20 can activate p53 by stabilizing the p300–p53 complex and also identify a class of small molecular weight ligands capable of selective discrimination between MDM2- and p300-dependent activities. PMID:11258706

  2. Inhibition of p53-dependent transcription by BOX-I phospho-peptide mimetics that bind to p300.

    PubMed

    Dornan, D; Hupp, T R

    2001-02-01

    The N-terminal BOX-I domain of p53 containing a docking site for the negative regulator MDM2 and the positive effector p300, harbours two recently identified phosphorylation sites at Thr18 or Ser20O whose affect on p300 is undefined. Biochemical assays demonstrate that although MDM2 binding is inhibited by these phosphorylations, p300 binding is strikingly stabilized by Thr18 or Ser20 phosphorylation. Introducing EGFP-BOX-I domain peptides with an aspartate substitution at Thr18 or Ser20 induced a significant inhibition of endogenous p53-dependent transcription in cycling cells, in irradiated cells, as well as in cells transiently co-transfected with p300 and p53. In contrast an EGFP-wild-type BOX-I domain peptide stimulated p53 activity via inhibition of MDM2 protein binding. These results suggest that phosphorylation of p53 at Thr18 or Ser20 can activate p53 by stabilizing the p300-p53 complex and also identify a class of small molecular weight ligands capable of selective discrimination between MDM2- and p300-dependent activities. PMID:11258706

  3. p53 and ATF4 mediate distinct and additive pathways to skeletal muscle atrophy during limb immobilization

    PubMed Central

    Fox, Daniel K.; Ebert, Scott M.; Bongers, Kale S.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.; Kunkel, Steven D.

    2014-01-01

    Immobilization causes skeletal muscle atrophy via complex signaling pathways that are not well understood. To better understand these pathways, we investigated the roles of p53 and ATF4, two transcription factors that mediate adaptations to a variety of cellular stresses. Using mouse models, we demonstrate that 3 days of muscle immobilization induces muscle atrophy and increases expression of p53 and ATF4. Furthermore, muscle fibers lacking p53 or ATF4 are partially resistant to immobilization-induced muscle atrophy, and forced expression of p53 or ATF4 induces muscle fiber atrophy in the absence of immobilization. Importantly, however, p53 and ATF4 do not require each other to promote atrophy, and coexpression of p53 and ATF4 induces more atrophy than either transcription factor alone. Moreover, muscle fibers lacking both p53 and ATF4 are more resistant to immobilization-induced atrophy than fibers lacking only p53 or ATF4. Interestingly, the independent and additive nature of the p53 and ATF4 pathways allows for combinatorial control of at least one downstream effector, p21. Using genome-wide mRNA expression arrays, we identified p21 mRNA as a skeletal muscle transcript that is highly induced in immobilized muscle via the combined actions of p53 and ATF4. Additionally, in mouse muscle, p21 induces atrophy in a manner that does not require immobilization, p53 or ATF4, and p21 is required for atrophy induced by immobilization, p53, and ATF4. Collectively, these results identify p53 and ATF4 as essential and complementary mediators of immobilization-induced muscle atrophy and discover p21 as a critical downstream effector of the p53 and ATF4 pathways. PMID:24895282

  4. Mutant p53 promotes ovarian cancer cell adhesion to mesothelial cells via integrin β4 and Akt signals

    PubMed Central

    Lee, Jong-Gyu; Ahn, Ji-Hye; Jin Kim, Tae; Ho Lee, Jae; Choi, Jung-Hye

    2015-01-01

    Missense mutations in the TP53 gene resulting in the accumulation of mutant proteins are extremely common in advanced ovarian cancer, which is characterised by peritoneal metastasis. Attachment of cancer cells to the peritoneal mesothelium is regarded as an initial, key step for the metastatic spread of ovarian cancer. In the present study, we investigated the possible role of a p53 mutant in the mesothelial adhesion of ovarian cancer cells. We found that OVCAR-3 cells with the R248 TP53 mutation (p53R248) were more adhesive to mesothelial Met5A cells than were A2780 cells expressing wild-type p53. In addition, ectopic expression of p53R248 in p53-null SKOV-3 cells significantly increased adhesion to Met5A cells. Knockdown of mutant p53 significantly compromised p53R248-induced cell adhesion to Met5A cells. Microarray analysis revealed that several adhesion-related genes, including integrin β4, were markedly up-regulated, and certain signalling pathways, including PI3K/Akt, were activated in p53R248 transfectants of SKOV-3 cells. Inhibition of integrin β4 and Akt signalling using blocking antibody and the inhibitor LY294002, respectively, significantly attenuated p53R248-mediated ovarian cancer-mesothelial adhesion. These data suggest that the p53R248 mutant endows ovarian cancer cells with increased adhesiveness and that integrin β4 and Akt signalling are associated with the mutation-enhanced ovarian cancer-mesothelial cell adhesion. PMID:26223322

  5. PRIMA-1, a mutant p53 reactivator, induces apoptosis and enhances chemotherapeutic cytotoxicity in pancreatic cancer cell lines.

    PubMed

    Izetti, Patricia; Hautefeuille, Agnes; Abujamra, Ana Lucia; de Farias, Caroline Brunetto; Giacomazzi, Juliana; Alemar, Bárbara; Lenz, Guido; Roesler, Rafael; Schwartsmann, Gilberto; Osvaldt, Alessandro Bersch; Hainaut, Pierre; Ashton-Prolla, Patricia

    2014-10-01

    TP53 mutation is a common event in many cancers, including pancreatic adenocarcinoma, where it occurs in 50-70 % of cases. In an effort to reactivate mutant p53 protein, several new drugs are being developed, including PRIMA-1 and PRIMA-1(Met)/APR-246 (p53 reactivation and induction of massive apoptosis). PRIMA-1 has been shown to induce apoptosis in tumor cells by reactivating p53 mutants, but its effect in pancreatic cancer remains unclear. Here we investigated the effects of PRIMA-1 on cell viability, cell cycle and expression of p53-regulated proteins in PANC-1 and BxPC-3 (mutant TP53), and CAPAN-2 (wild-type TP53) pancreatic cell lines. Treatment with PRIMA-1 selectively induced apoptosis and cell cycle arrest in p53 mutant cells compared to CAPAN-2 cells. The growth suppressive effect of PRIMA-1 was markedly reduced in p53 mutant cell lines transfected with p53 siRNA, supporting the role of mutant p53 in PRIMA-1 induced cell death. Moreover, treatment with the thiol group donor N-acetylcysteine completely blocked PRIMA-1-induced apoptosis and reinforced the hypothesis that thiol modifications are important for PRIMA-1 biological activity. In combination treatments, PRIMA-1 enhanced the anti-tumor activity of several chemotherapic drugs against pancreatic cancer cells and also exhibited a pronounced synergistic effect in association with the Mdm2 inhibitor Nutlin-3. Taken together, our data indicate that PRIMA-1 induces apoptosis in p53 mutant pancreatic cancer cells by promoting the re-activation of p53 and inducing proapoptotic signaling pathways, providing in vitro evidence for a potential therapeutic approach in pancreatic cancer. PMID:24838627

  6. Maintenance of imaginal disc plasticity and regenerative potential in Drosophila by p53.

    PubMed

    Wells, Brent S; Johnston, Laura A

    2012-01-15

    Following irradiation (IR), the DNA damage response (DDR) activates p53, which triggers death of cells in which repair cannot be completed. Lost tissue is then replaced and re-patterned through regeneration. We have examined the role of p53 in co-regulation of the DDR and tissue regeneration following IR damage in Drosophila. We find that after IR, p53 is required for imaginal disc cells to repair DNA, and in its absence the damage marker, γ-H2AX is persistently expressed. p53 is also required for the compensatory proliferation and re-patterning of the damaged discs, and our results indicate that cell death is not required to trigger these processes. We identify an IR-induced delay in developmental patterning in wing discs that accompanies an animal-wide delay of the juvenile-adult transition, and demonstrate that both of these delays require p53. In p53 mutants, the lack of developmental delays and of damage resolution leads to anueploidy and tissue defects, and ultimately to morphological abnormalities and adult inviability. We propose that p53 maintains plasticity of imaginal discs by co-regulating the maintenance of genome integrity and disc regeneration, and coordinating these processes with the physiology of the animal. These findings place p53 in a role as master coordinator of DNA and tissue repair following IR. PMID:22036477

  7. p53 checkpoint ablation exacerbates the phenotype of Hinfp dependent histone H4 deficiency.

    PubMed

    Ghule, Prachi N; Xie, Rong-Lin; Colby, Jennifer L; Jones, Stephen N; Lian, Jane B; Wijnen, Andre J van; Stein, Janet L; Stein, Gary S

    2015-08-01

    Histone Nuclear Factor P (HINFP) is essential for expression of histone H4 genes. Ablation of Hinfp and consequential depletion of histones alter nucleosome spacing and cause stalled replication and DNA damage that ultimately result in genomic instability. Faithful replication and packaging of newly replicated DNA are required for normal cell cycle control and proliferation. The tumor suppressor protein p53, the guardian of the genome, controls multiple cell cycle checkpoints and its loss leads to cellular transformation. Here we addressed whether the absence of p53 impacts the outcomes/consequences of Hinfp-mediated histone H4 deficiency. We examined mouse embryonic fibroblasts lacking both Hinfp and p53. Our data revealed that the reduced histone H4 expression caused by depletion of Hinfp persists when p53 is also inactivated. Loss of p53 enhanced the abnormalities in nuclear shape and size (i.e. multi-lobed irregularly shaped nuclei) caused by Hinfp depletion and also altered the sub-nuclear organization of Histone Locus Bodies (HLBs). In addition to the polyploid phenotype resulting from deletion of either p53 or Hinfp, inactivation of both p53 and Hinfp increased mitotic defects and generated chromosomal fragility and susceptibility to DNA damage. Thus, our study conclusively establishes that simultaneous loss of both Hinfp and the p53 checkpoint is detrimental to normal cell growth and may predispose to cellular transformation. PMID:26030398

  8. Ferroptosis: A missing puzzle piece in the p53 blueprint?

    PubMed Central

    Wang, Shang-Jui; Ou, Yang; Jiang, Le; Gu, Wei

    2016-01-01

    ABSTRACT Recent evidence indicates that canonical functions of p53 (i.e., apoptosis and growth arrest) are dispensable for p53-mediated tumor suppression. We have uncovered a novel function of p53 that contributes to tumor suppression through regulation of cystine metabolism, reactive oxygen species responses, and ferroptosis. The p53-mediated ferroptotic response via SLC7A11 denotes an extra layer of defense against tumorigenesis in conjunction with other p53 functions. PMID:27314071

  9. Ferroptosis: A missing puzzle piece in the p53 blueprint?

    PubMed

    Wang, Shang-Jui; Ou, Yang; Jiang, Le; Gu, Wei

    2016-05-01

    Recent evidence indicates that canonical functions of p53 (i.e., apoptosis and growth arrest) are dispensable for p53-mediated tumor suppression. We have uncovered a novel function of p53 that contributes to tumor suppression through regulation of cystine metabolism, reactive oxygen species responses, and ferroptosis. The p53-mediated ferroptotic response via SLC7A11 denotes an extra layer of defense against tumorigenesis in conjunction with other p53 functions. PMID:27314071

  10. The combination of 5-fluorouracil plus p53 pathway restoration is associated with depletion of p53-deficient or mutant p53-expressing putative colon cancer stem cells.

    PubMed

    Huang, Catherine; Zhang, Xiang M; Tavaluc, Raluca T; Hart, Lori S; Dicker, David T; Wang, Wenge; El-Deiry, Wafik S

    2009-11-01

    The cancer stem cell hypothesis suggests that rare populations of tumor-initiating cells may be resistant to therapy, lead to tumor relapse and contribute to poor prognosis for cancer patients. We previously demonstrated the feasibility of p53 pathway restoration in p53-deficient tumor cell populations using small molecules including ellipticine or its derivatives. We now establish a single cell p53-regulated green fluorescent protein (EGFP)-reporter system in human DLD1 colon tumor cells expressing mutant p53 protein. We use these p53-EGFP reporter DLD1 cells to investigate the status of p53 transcriptional activity in putative colon cancer stem cell populations following exposure to p53 pathway-restoring drugs and/or classical chemotherapy. We demonstrate induction of p53-specific EGFP reporter fluorescence following overexpression of p53 family member p73 by an Adenovirus vector. We further show that p53-reporter activity is induced in DLD1 putative cancer stem cell side-populations analyzed by their Hoechst dye efflux properties following treatment with the p53 pathway restoring drug ellipticine. Combination of ellipticine with the cytotoxic agent 5-fluorouracil resulted in increased cytotoxicity as compared to either agent alone and this was associated with depletion of putative cancer stem cell populations as compared with 5-FU alone treatment. Our results support the feasibility of therapeutic targeting of mutant p53 in putative cancer stem cells as well as the potential to enhance cytotoxic chemotherapy. PMID:19923910

  11. Mortalin–p53 interaction in cancer cells is stress dependent and constitutes a selective target for cancer therapy

    PubMed Central

    Lu, W-J; Lee, N P; Kaul, S C; Lan, F; Poon, R T P; Wadhwa, R; Luk, J M

    2011-01-01

    Stress protein mortalin is a multifunctional protein and is highly expressed in cancers. It has been shown to interact with tumor suppressor protein-p53 (both wild and mutant types) and inactivates its transcriptional activation and apoptotic functions in cancer cells. In the present study, we found that, unlike most of the cancer cells, HepG2 hepatoma lacked mortalin–p53 interaction. We demonstrate that the mortalin–p53 interaction exists in cancer cells that are either physiologically stressed (frequently associated with p53 mutations) or treated with stress-inducing chemicals. Targeting mortalin–p53 interaction with either mortalin small hairpin RNA or a chemical or peptide inhibitor could induce p53-mediated tumor cell-specific apoptosis in hepatocellular carcinoma; p53-null hepatoma or normal hepatocytes remain unaffected. PMID:21233847

  12. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate.

    PubMed

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M

    2016-02-25

    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in differ